Mediators of gene silencing

Abstract

To provide novel molecules and methods of inhibiting gene expression.SOLUTION: The present invention relates to a method of inhibiting expression of a gene in a biological system. The method of the present invention comprises introducing a tRNA-derived polynucleotide into the biological system. The tRNA-derived polynucleotide of the present invention comprises a sequence that is complementary to an intronic region of the gene whose expression is to be inhibited.SELECTED DRAWING: Figure 1a

Description

Technical Field

[0001] The present invention relates to a method for inhibiting gene expression in a biological system. The present invention further relates to tRNA-derived polynucleotides and their use as medicaments.

Background Art

[0002] Mammalian cells utilize small RNAs (sRNAs) of endogenous origin for controlling gene expression in a pathway known as RNA interference (RNAi). These sRNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs) in the cytoplasm that can control the expression of many protein-coding genes post-transcriptionally.

[0003] The RNAi pathway exists in many eukaryotes and is initiated by Dicer, an enzyme that cleaves long double-stranded RNA (dsRNA) into shorter double-stranded fragments approximately 21 nucleotides in length. These short double-stranded fragments are known as siRNAs. Each siRNA unwinds to form two single-stranded RNAs, and one of these (the guide strand) is incorporated into the RNA-induced silencing complex (RISC). The guide strand then base pairs with complementary messenger RNA (mRNA), and cleavage is induced by Argonaute 2 (Ago2), the catalytic component of RISC, resulting in post-transcriptional gene silencing.

[0004] miRNAs are non-coding RNAs that are involved in the control of gene expression, particularly during development. RNAi includes not only the gene silencing effect of miRNAs but also the effect caused by dsRNA discussed above. miRNAs, once processed by Drosha, can bind and be cleaved by Dicer to produce miRNAs that can be incorporated into RISC. However, unlike siRNA-loaded RISC, miRNA-loaded RISC potentially scans mRNAs for complementary sequences, binds to the 3'untranslated regions of these mRNAs, thereby preventing translation.

[0005] Advances in the understanding surrounding the basic RNAi mechanism have been exploited in many fields including research, such as investigation of gene function, and various therapeutic applications for the treatment of diseases. Diseases associated with the activity of one or more genes must be well-suited for RNAi-based therapies since small RNAs directed against these genes can be designed and used as therapeutic agents. These can include, for example, cancer, autoimmune diseases, and neurodegenerative diseases such as Alzheimer's disease. Age-related macular degeneration is being treated using clinical applications of RNAi, and further therapies are being developed in a range of therapeutic areas including the treatment of various viral infections such as HIV. It would be advantageous to develop methods of inhibiting gene expression that can be used in the treatment of diseases.

[0006] Transfer RNA (tRNA) is an RNA molecule approximately 75 - 90 nucleotides in length that serves as an adapter molecule to carry amino acids to the codons of mRNA. tRNA typically assumes the shape of a cloverleaf structure containing an acceptor stem that binds to the anticodon arm, which is complementary to the amino acid and the mRNA codon. In addition to their role as adapter molecules, tRNAs have recently been identified as the origin of a new class of regulatory RNA fragments with uncharacterized roles.

Prior Art Documents

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0008] An object of the present invention is to provide a new molecule and method for inhibiting gene expression.

Means for Solving the Problems

[0009] The present invention relates to RNA interference, particularly a new method for mediating gene silencing. RNAi is a biological process in which an RNA molecule inhibits gene expression or translation by neutralizing a targeted mRNA molecule. Accordingly, a method for inhibiting gene expression is also provided. We also provide novel species of isolated tRNA polynucleotides that mediate gene silencing and their use in methods for treating diseases.

[0010] In part, the present invention is based on investigations by the inventors showing that after transfection of cells with tRNA-derived polynucleotides, particularly short fragments of tRNA that mediate gene silencing, it is possible to reduce the mRNA level and subsequently the protein level of specific genes. These short fragments of tRNA are referred to as tsRNA (tRNA-derived sRNA). TsRNA is different from tRNA halves and tRNA fragments, both of which are cleavage products of the cloverleaf structure of tRNA. However, as described herein, tsRNA is alternatively folded tRNA, i.e., generated by Dicer-dependent cleavage of a stem-loop / hairpin structure. Unlike siRNA, tsRNA is generated in the nucleus by Dicer cleavage of hairpin-like RNA. TsRNA targets genes in the nucleus. Accordingly, the present invention is not related to tRNA halves and tRNA fragments generated by cleavage of the cloverleaf structure of tRNA.

[0011] The inventor has shown that Dicer, an endoribonuclease that is an important player in classical RNAi, associates with actively transcribed tRNA genes, binds to tRNAs folded into non-classical secondary structures, and processes them into tsRNAs. Furthermore, these Dicer-dependent tsRNAs functionally and specifically target the introns of many protein-coding genes and result in the degradation of their nascent RNAs in an Argonaute 2 (Ago2)-dependent manner. This distinguishes its mechanism from other RNA mechanisms mediated by known siRNAs. Furthermore, tsRNAs act in the nucleus, while other known siRNAs act in the cytoplasm. Targeting of the introns of genes or long non-coding RNAs results in the immediate degradation of the RNA as soon as it is produced in the nucleus. The inventor has shown that tsRNAs are not generated from mature tRNAs but from a distinct population of tRNAs that fold into an alternative secondary structure, a structure that can be described as a stem-loop / hairpin structure. These alternatively folded tRNAs are recognized by Dicer and processed into tsRNAs in the nucleus. Thus, we propose a novel mechanism for the Dicer-dependent control of gene expression mediated by tsRNAs through nascent RNA degradation, distinct from well-known post-transcriptional or post-translational gene silencing.

[0012] Importantly, the inventor has shown that tsRNA target genes are highly associated with various diseases such as cancer, supporting the biological importance of this pathway. Thus, the tsRNAs described herein can be used in the treatment of diseases.

[0013] The inventor of the present invention has found that the expression of genes or long non-coding RNAs can be inhibited by introducing a tRNA-derived polynucleotide, such as tsRNA, into a biological system, such as a cell, and that a tRNA-derived polynucleotide containing a sequence that is partially or completely complementary to the intron region of the gene can be provided. The inhibition of gene expression achieved by the inventor using this method has been shown to be very effective.

[0014] While not wishing to be bound by theory, the inventors understand that tsRNA co-transcriptionally controls gene expression in the nucleus, not by requiring transcriptional repression and heterochromatin formation, but rather by targeting introns of protein-coding genes for degradation of nascent RNA.

BRIEF DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] Here, embodiments of the present invention will be further described. In the following sections, different embodiments are described. Each aspect so defined may be combined with any other one or more aspects, unless clearly indicated to the contrary. In particular, any feature shown as preferred or advantageous may be combined with any other one or more features shown as preferred or advantageous.

[0016] In general, the nomenclature and techniques used in connection with cell and tissue culture, pathology, oncology, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, as well as hybridization, described herein are well known and commonly used in the art. The methods and techniques of the present disclosure are generally carried out in accordance with conventional methods well known in the art and, unless otherwise indicated, as described in various general and more detailed references cited and discussed throughout this specification. See, for example, Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (2012).

[0017] Polynucleotide In a first aspect of the present invention, there is provided an isolated tRNA-derived polynucleotide comprising a sequence complementary to an intron region of a target gene or long non-coding RNA, in particular, the tRNA-derived polynucleotide is a tRNA fragment (tsRNA) having 14 to 35 nucleotides.

[0018] The term "isolated" means that the tRNA-derived polynucleotide is isolated from its natural environment and does not exist naturally. This indicates the involvement of human hands. When referring to nucleic acid molecules, this term means that the nucleic acid molecule or polypeptide does not substantially contain at least one other component that they are naturally associated with and are found in nature.

[0019] As understood by those skilled in the art, the term "polynucleotide" refers to a linear polymer containing covalently linked nucleotide monomers. Polynucleotides include, for example, DNA and RNA. In embodiments of the present invention, the polynucleotide is derived from tRNA.

[0020] Transfer RNA (tRNA) is an RNA molecule approximately 75 to 90 nucleotides in length, which serves as an adapter molecule for carrying amino acids to the codons of mRNA. In the present application, the term "derived from tRNA" is used to indicate that the polynucleotide may contain all or part of the sequence of a naturally occurring tRNA, or a modified sequence of all or part of the sequence of a naturally occurring tRNA (e.g., all or part of the sequence of a tRNA having one or more insertions, deletions, or modifications). The tRNA-derived polynucleotide may be a chemically synthesized RNA or an analog of a naturally occurring RNA. The analog may differ from RNA by the addition, deletion, substitution, or change of one or more nucleotides.

[0021] The term "tRNA-derived polynucleotide" can include, for example, an artificial polynucleotide based on the sequence of a naturally occurring tRNA, or an artificial polynucleotide developed using a bioinformatics algorithm based on a characteristic of a naturally occurring tRNA, such as the sequence of a naturally occurring tRNA.

[0022] In some embodiments of the present invention, the tRNA-derived polynucleotide can include all or part of the sequence of a naturally occurring tRNA, or a modified sequence of all or part of the sequence of a naturally occurring tRNA (e.g., including one or more insertions, deletions, or modifications of the naturally occurring sequence). Preferably, when the sequence includes a modification of the naturally occurring sequence of the tRNA, the modification is a conservative modification. One of ordinary skill in the art will understand that by utilizing conserved modifications, the properties of the modified nucleotide are maintained or substantially maintained. The modified sequence may not be naturally occurring, but rather may include one or more artificial nucleotides, such as locked nucleic acids (LNAs).

[0023] In an embodiment, the tRNA-derived polynucleotide includes a sequence that is at least 50, 60, 70, 80, 90, or 95% complementary to a naturally occurring tRNA sequence. In an embodiment, the tRNA-derived polynucleotide includes a sequence that is at least 98 or 99% complementary to a naturally occurring tRNA sequence.

[0024] The inventors have surprisingly found that the use of tRNA-derived sequences, particularly sequences having a high sequence similarity to naturally occurring tRNAs, results in an effective inhibition of gene expression and the expression of long non-coding RNAs.

[0025] In embodiments of the present invention, the polynucleotide includes tRNA. In such embodiments, the tRNA preferably includes a stem-loop / hairpin structure. The inventors have shown that in addition to forming the classical cloverleaf structure, tRNA can also form alternative secondary structures, particularly stem-loop structures. The inventors have shown that this stem-loop structure can be bound by the endoribonuclease Dicer for subsequent processing and cleavage to generate tsRNA in the nucleus. Thus, the tsRNA described herein is produced by Dicer-dependent cleavage of tRNA having a stem-loop / hairpin structure.

[0026] Thus, in preferred embodiments, the polynucleotide includes a tRNA-derived polynucleotide fragment (tsRNA) having 14 to 35 nucleotides. tRNA-derived sRNA is referred to as tsRNA. The inventors have shown that processing of tRNA by the endoribonuclease Dicer, an important player in classical RNAi, results in the formation of tsRNA. Without wishing to be bound by theory, the inventors understand that Dicer associates with actively transcribed tRNA genes and binds to tRNA folded into non-classical secondary structures (such as structures that can be described as stem-loops or short hairpin structures), which are then processed into tsRNA.

[0027] The inventors have shown that tsRNA is very effective in binding to intron regions of the gene or long non-coding RNA, where they have complementarity and thereby inhibit the expression of the gene or long non-coding RNA.

[0028] For example, tsRNA molecules contain 14 to 25, 18 to 23, 20 to 22, or 25 to 28 nucleotides. In one embodiment, the polynucleotide contains 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides. tsRNA can be double-stranded or single-stranded. Double-stranded tsRNA may have blunt ends. In another embodiment, tsRNA is double-stranded and tsRNA contains overhangs. tsRNA may be mammalian, plant, or bacterial tsRNA. For example, tsRNA may be human or rodent tsRNA. In one embodiment, tsRNA is UA-rich at the 5' or 3' end.

[0029] In one embodiment, tsRNA is chemically modified. The modifications can be introduced to promote stability, minimize innate immunity, and enable delivery to target tissues.

[0030] For example, at least one 2'-hydroxyl group of the nucleotides of ds or ss tsRNA can be replaced by a chemical group, preferably a 2'-amino group or a 2'-methyl group. At least one nucleotide in at least one strand may also preferably be a locked nucleotide having a chemically modified sugar ring by a 2'-O,4'-C methylene bridge. Advantageously, some nucleotides are locked nucleotides. Phosphorothioate modifications can also be included. Other modifications are insertions of DNA or RNA analogs such as inverted dT or abasic sites. Or conjugates such as peptide nucleic acid conjugates.

[0031] For example, single-stranded tsRNA can be degraded by nucleases. However, this can be eliminated by either adding chemical modifications or by modifying the tsRNA ends by locking (LNA) of the sugar linkages.

[0032] In one embodiment, the tRNA-derived polynucleotide is conjugated to another moiety, such as N-acetylgalactosamine (GalNAc), which aids in delivery to the nucleus.

[0033] The inventors have shown that tsRNAs with specific sequences can target two or more genes. This can be beneficial when targeting two or more genes in one pathway is required. In other instances, it may be desirable to generate a more specific tsRNA such that only one gene is targeted. This can be achieved by adding several nucleotides (i.e., more than 5 residues) from the target gene sequence on both sides of the tsRNA.

[0034] The isolated tRNA-derived polynucleotide, e.g., tsRNA, contains a sequence complementary to an intron region of a target gene or long non-coding RNA. The tRNA-derived polynucleotide inactivates the target gene or long non-coding RNA by degradation of nascent RNA. Furthermore, the tsRNA-derived polynucleotide is not derived from mature tRNA. It is derived from aberrantly folded tRNA species that form stem-loop / hairpin structures and are cleaved by a Dicer-dependent mechanism. The tsRNAs described herein can target nascent RNA in the nucleus. The tsRNAs target the intron regions of specific genes and downregulate their expression by cleaving nascent RNA in an Ago2-dependent manner.

[0035] Those skilled in the art will readily understand that an intron is a non-coding RNA splice region that does not code for a segment of DNA or RNA, or a protein, and typically interrupts the protein-coding region (exon) of a gene. In the present invention, the polynucleotide is complementary to the intron region of the gene whose expression is inhibited. Those skilled in the art will understand that it is not necessary for the entire polynucleotide to be complementary to the intron region of the gene. However, the polynucleotide must be sufficiently complementary for the polynucleotide to bind and / or hybridize to the intron region of the gene.

[0036] As used herein, "complementary" is used to mean substantially complementary. In other words, complementarity need not be 100%. "Complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence, either by traditional Watson-Crick or other non-traditional types. The percentage of complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5 out of 10, 6 out of 10, 7 out of 10, 8 out of 10, 9 out of 10, 10 out of 10 are 50%, 60%, 70%, 80%, over 90%, and 100% complementary). "Fully complementary" means that all adjacent residues of a nucleic acid sequence hydrogen bond with the same number of adjacent residues in a second nucleic acid sequence. "Substantially complementary", as used herein, refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. As used herein, "stringent conditions" for hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence hybridizes predominantly to the target sequence and not substantially to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on a number of factors. Generally, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.

[0037] Accordingly, in some embodiments, a polynucleotide comprises a sequence that is at least 50%, 60%, 70%, 80%, 90% or 95% complementary to a sequence in an intron region of a gene. Preferably, the polynucleotide may comprise a sequence that is at least 95%, 96%, 97%, 98% or 99% complementary to a sequence in an intron region of a gene.

[0038] In a preferred embodiment of the present invention, the polynucleotide binds and / or hybridizes to an intron region of the mRNA of the gene whose expression is inhibited. In an embodiment, the polynucleotide binds to an intron region of the nascent mRNA of the gene whose expression is inhibited. The inventors have surprisingly found that by using a tRNA-derived polynucleotide that is complementary to the intron region of the mRNA of the gene whose expression is inhibited and can thus bind thereto, a very efficient inhibition of the expression of said gene can be achieved. Without wishing to be bound by theory, the inventors propose that this is achieved by degradation of nascent RNA. Accordingly, the present invention also relates to the methods presented below.

[0039] Preferably, the target gene is associated with a pathological condition. The present inventors surprisingly found that most of the genes targeted by tsRNAs are disease-related genes, particularly genes that are associated with a disease phenotype when overexpressed. In one embodiment, the target gene is associated with cancer. In one embodiment, the target gene is associated with a disease shown in FIGS. 10, 11, or 12. In one embodiment, the target gene is selected from the genes of FIGS. 10, 11, or 12. In one embodiment, the target gene is selected from the following human genes or long non-coding RNAs: epidermal growth factor receptor (EGFR, see, e.g., UniProtKB: P00533), MET (MET proto-oncogene, receptor tyrosine kinase, see, e.g., UniProtKB: P08581), BCL2 (BCL2 apoptosis regulator, see, e.g., UniProtKB: P10415), LINC0665 (long intergenic non-coding RNA 00665, Lieu et al., Mol Ther Nucleic Acids. Jun. 7, 2019;16:155-161) or LINC00660. Exemplary tsRNA sequences targeting these genes are shown in the examples and are within the scope of the present invention. The pathological condition may be selected from cancer, autoimmune diseases, neurodegenerative diseases such as Alzheimer's disease or Parkinson's disease, metabolic diseases, respiratory diseases, and cardiovascular diseases. In one embodiment, the pathological condition is selected from one of the conditions shown in FIGS. 10, 11, or 12.

[0040] In one embodiment, the tsRNA has a sequence comprising SEQ ID NO: 4, 5, or 6.

[0041] In another aspect, we provide an isolated tRNA-derived polynucleotide, for example, a vector comprising the tsRNA fragment described above. Also provided is a host cell comprising a tRNA-derived polynucleotide, for example, the tsRNA fragment or vector described above. The host cell may be a mammalian cell, a viral cell, a bacterial cell, a plant cell or a yeast cell. The vector may be a plasmid or a viral vector. Methods such as injection of naked tsRNA, physical delivery such as electroporation, gene gun, sonoporation, magnetofection, hydrodynamic delivery, and chemical methods for enhancing delivery such as inorganic nanoparticles and cell-penetrating peptides can be used for delivery.

[0042] Method The present invention provides a method for inhibiting or downregulating the expression of a gene in a biological system. Inhibition or downregulation of expression is achieved by introducing a tRNA-derived polynucleotide, for example, tsRNA, that is complementary to the intron region of the gene into the biological system.

[0043] Accordingly, a method for inhibiting or downregulating the expression of a target gene or non-coding RNA in a biological system, comprising: introducing a tRNA-derived polynucleotide, for example, tsRNA, into the biological system is provided, wherein the polynucleotide comprises a sequence that is complementary to the intron region of the target gene or non-coding RNA.

[0044] The tRNA-derived polynucleotide is as described above, for example, the tsRNA described above. In one embodiment, the tRNA-derived polynucleotide is contained in the vector described above.

[0045] As will be understood by those skilled in the art, the phrase "inhibiting gene expression" does not necessarily require that the gene expression be globally silenced. In embodiments, the method can result in substantially complete inhibition of the expression of a gene or non-coding RNA (i.e., 100% or nearly 100% inhibition of gene expression). However, in alternative embodiments, the methods of the invention can result in partial, e.g., slight or moderate, reduction of the expression of a target gene or non-coding RNA.

[0046] For example, the method can result in gene or non-coding RNA expression that is inhibited / downregulated by at least 10%, 20%, 30%, 40% or 50% compared to normal or wild-type expression. As will be understood by those skilled in the art, the amount of inhibition required depends on the gene being targeted. For example, the methods of the invention can result in gene expression that is inhibited / downregulated by at least 60%, 70%, 80%, 90%, 95%, 98% or 99% compared to normal or wild-type expression.

[0047] The method results in inhibition of gene or non-coding RNA expression in a biological system. However, those skilled in the art will understand that the method can result in simultaneous inhibition of the expression of multiple genes. In such embodiments, inhibition of the expression of the multiple genes is achieved by introducing a tRNA-derived polynucleotide that is complementary to the intron region of the multiple genes.

[0048] The method of the invention can be used to inhibit the expression of any target gene, which is any gene of interest or any target non-coding RNA that provides a tRNA-derived polynucleotide described herein, e.g., tsRNA, that is complementary to the intron region of the gene / gene that can be designed therefor and that is available for introduction into a biological system.

[0049] The method of the present invention may be used for research purposes, for example, to determine the function of a specific gene or the effect of reducing the expression of that gene. In such embodiments, the gene may be the gene for which further information is sought. The gene may be, in certain embodiments, a gene associated with a specific disease. For example, in embodiments of the present invention where the method is used for research purposes, the gene may be intentionally associated with a disease, and the method may be used to determine the effect of inhibition of that gene in in vitro, in vivo, ex vivo or in silico systems.

[0050] For example, as described above, the gene may be a gene associated with a disease such as cancer, autoimmune disease, neurodegenerative diseases such as Alzheimer's disease, viral or bacterial infectious diseases, etc.

[0051] Biological system The method described above results in inhibition / downregulation of the expression of a gene or long non-coding RNA in a biological system. The method includes the step of introducing a tRNA or tRNA-derived polynucleotide, such as tsRNA, into the biological system.

[0052] As will be understood by those skilled in the art, the biological system of the present invention can be any biological system that contains the gene whose expression is to be inhibited. For example, the biological system may include one cell or a plurality of cells, such as one or more eukaryotic cells. The sample may include cells, tissues, blood, urine, saliva, exosomes, CSF or other samples derived from a human or animal, such as a mammalian subject. In another example, the sample may include cells or tissues derived from a plant. In certain embodiments, the biological system may be a human or animal subject, such as a subject in need of inhibition of gene expression. In embodiments, the biological system may include a synthetic biological system that is, for example, constructed from component parts in vitro or constructed in silico.

[0053] The method of the present invention may be performed in vitro. For example, in such embodiments, the biological system may include cells, tissues, blood samples or other samples derived from human, plant or animal subjects. In such embodiments, inhibition of gene expression may be necessary for research purposes, for example, to determine the function of the gene or to determine whether inhibition of the gene results in a specific outcome.

[0054] Alternatively, the method of the present invention may be performed in vivo. For example, in such embodiments, the biological system may be a human, plant or animal subject. In such embodiments, inhibition of gene expression may result in an altered phenotype in the human or animal subject. For example, inhibition of gene expression may result in treatment of the disease if the gene is associated with a disease.

[0055] In yet further embodiments, the method of the present invention may be performed ex vivo.

[0056] The method described above of the present invention includes the step of introducing a tRNA-derived polynucleotide, for example, tsRNA, into a biological system. Those skilled in the art will understand that there are numerous methods for introducing a tRNA-derived polynucleotide into a biological system. Such exemplary methods may include, for example, the use of non-viral vectors such as exosomes, nanoparticles or liposomes (e.g., Lipofectamine), or viral vectors such as retroviral vectors, adenoviral vectors or herpes simplex virus vectors.

[0057] Other non-limiting delivery methods may include physical delivery such as injection of naked tsRNA, electroporation, gene gun, sonoporation, magnetofection, hydrodynamic delivery, and chemical methods for enhancing delivery such as inorganic nanoparticles and cell-penetrating peptides. Other delivery methods known in the art for siRNA may also be used.

[0058] In embodiments of the invention where the tRNA-derived polynucleotide comprises tRNA, the method may further comprise introducing into the biological system an enzyme that cleaves the tRNA to produce tsRNA. In embodiments, the enzyme comprises Dicer.

[0059] The inventors have shown that Dicer, an important player in classical RNAi, associates with active, transcribed tRNA genes, binds to tRNAs that fold into non-classical secondary structures (stem-loop structures), and processes them into tsRNAs. The inventors effectively used such tsRNAs to target and inhibit gene expression.

[0060] One of ordinary skill in the art will understand that Dicer is naturally present in some biological systems used in the present invention. However, in certain systems, such as synthetic biological systems, Dicer may not be present, and introduction of Dicer into the biological system may be advantageous.

[0061] In embodiments, the method of the invention may comprise introducing the tRNA-derived polynucleotide into the nucleus of a cell in a biological system. As will be appreciated by one of ordinary skill in the art, there are various methods by which a polynucleotide can be introduced into the nucleus of a cell, as is known in the art. These include, for example, pronuclear injection and other microinjection methods, or targeting of the polynucleotide to the nucleus using a sequence that targets the nucleus and is operably linked to the polynucleotide.

[0062] In embodiments of the invention, the method may further comprise introducing into the biological system an enzyme that transports the tRNA-derived polynucleotide to the nucleus. In embodiments, the enzyme comprises Argonaute 2 (Ago2).

[0063] The inventors have surprisingly shown that Ago2 associates with tsRNA and that tsRNA can shuttle to and from the nucleus to inhibit gene expression by binding to the intron region of nascent mRNA.

[0064] One of ordinary skill in the art will understand that in some biological systems used in the present invention, Ago2 exists naturally. However, in certain systems, such as synthetic biological systems, Ago2 may not exist, and the introduction of Ago2 into the biological system may be advantageous.

[0065] One of ordinary skill in the art will understand that there are numerous methods by which enzymes such as Ago2 or Dicer can be introduced into a biological system. Such methods can include, for example, the use of non-viral vectors such as exosomes, nanoparticles, or liposomes, or viral vectors such as retroviral vectors, adenoviral vectors, or herpes simplex virus vectors. Alternatively, an expression vector that expresses the enzyme under certain conditions within the biological system may be used to introduce such an enzyme. The use of such expression vectors will be well understood by those of ordinary skill in the art.

[0066] We provide a method for degrading nascent RNA in a biological system, comprising the step of introducing a tRNA-derived polynucleotide into the biological system, wherein the polynucleotide comprises a sequence complementary to an intron region of the nascent RNA and the method also includes the step of isolating tsRNA.

[0067] The method may further include the step of isolating tsRNA.

[0068] We also provide a method for identifying a tsRNA fragment that mediates RNA interference of a target gene, a) preparing a sample; b) isolating a tsRNA fragment having approximately 14 to 35 nucleotides from the sample; c) characterizing the tsRNA fragment to determine sequence identity or similarity with the target gene; and d) identifying a tsRNA fragment that comprises a sequence complementary to an intron region of the target gene and the method also includes the step of isolating tsRNA.

[0069] The sample may be tissue, cells, blood, serum, exosomes or another sample.

[0070] We also provide a method for producing tsRNA that mediates RNA interference, the method comprising the step of identifying a tsRNA fragment by the above method. This may include the step of synthesizing tsRNA based on the sequence of the identified tRNA fragment.

[0071] We also provide a method for producing tsRNA from a tRNA having a stem-loop / hairpin structure, the method comprising the step of cleaving the stem-loop / hairpin structure in a Dicer-dependent manner.

[0072] Another aspect relates to a tsRNA fragment that mediates RNA interference and is obtained by or obtainable by the method described above.

[0073] We provide a method for mediating RNA interference, comprising the step of introducing into a biological system a tRNA-derived polynucleotide as described herein, such as tsRNA.

[0074] We also provide a method for mediating target-specific RNA interference in a cell, the method comprising the step of contacting the cell with a tRNA-derived polynucleotide as described herein, such as tsRNA.

[0075] In all of the above methods, the tRNA-derived polynucleotide is as described herein and is the tsRNA described herein.

[0076] We further provide a method for designing a tRNA-derived polynucleotide, such as tsRNA, that is complementary to an intron region of a target gene and can inhibit the gene expression of the target gene, the method comprising as shown in FIG. 4a.

[0077] ​We provide a method for designing a tRNA-derived polynucleotide, such as tsRNA, that is complementary to an intron region of a target gene and can inhibit the gene expression of the target gene, comprising: - generating a knockout of Dicer and ago2; - identifying genes that are upregulated when Dicer and ago2 are knocked out; - generating a database of candidate targets; - identifying the intron regions of the candidate targets; - generating in silico a panel of complementary tsRNA sequences; and - validating the target to confirm whether the generated tsRNA binds to the predicted intron region. We further provide a method comprising the above steps.

[0078] Use of tRNA-derived polynucleotides as biomarkers In another aspect, the tRNA-derived polynucleotides described herein, such as tsRNA, can be used as biomarkers for detecting the presence of a disease.

[0079] In another aspect, we provide a method for detecting a disease, comprising: a) detecting the presence of a tsRNA having 14 to 35 nucleotides and being complementary to an intron region of a target gene or a long non-coding RNA in a sample; b) quantifying the amount of tsRNA present in the sample; c) comparing the amount of tsRNA present in the sample with a reference value; and d) evaluating the presence or absence of the disease. We provide a method comprising the above steps.

[0080] In one embodiment, the reference is the amount of tsRNA in healthy or diseased cells, serum, or exosomes. In one embodiment, the disorder is selected from cancer, autoimmune diseases, neurodegenerative diseases, metabolic diseases, respiratory diseases, and cardiovascular diseases. In one embodiment, the isolated tsRNA is quantified by methods known in the art, such as RT-PCR. In one embodiment, the sample is a blood sample. In one embodiment, the method is performed in vitro.

[0081] Medical Use and Method The present invention also provides the tRNA-derived polynucleotide described above, for example, tsRNA, comprising a sequence complementary to an intron region of a gene or long non-coding RNA, for use as a medicament, or the pharmaceutical composition described herein.

[0082] The present invention also provides the tRNA-derived polynucleotide described above, for example, tsRNA, comprising a sequence complementary to an intron region of a gene or long non-coding RNA, for use in the treatment of a disease that can be at least partially improved by inhibiting gene expression, or the pharmaceutical composition described herein.

[0083] Suitably, the use comprises administering to a subject having the disease a therapeutically effective amount of the tRNA-derived polynucleotide.

[0084] The present invention also provides a method of treating a disease in a subject, the method comprising administering to the subject a therapeutically effective amount of the tRNA-derived polynucleotide described above, for example, tsRNA, or the pharmaceutical composition described above, wherein the disease can be at least partially improved by inhibiting gene expression and the tRNA-derived polynucleotide comprises a sequence complementary to an intron region of a gene or long non-coding RNA.

[0085] The characteristics of the tRNA-derived polynucleotide described above, for example, tsRNA, are related to the first aspect of the present invention. In one embodiment, the tRNA-derived polynucleotide is the tsRNA described above.

[0086] As will be appreciated by those skilled in the art, there are many diseases associated with gene expression. For example, the expression or overexpression of a particular gene can result in a disease phenotype. Examples include the overexpression of α-synuclein associated with the development of Parkinson's disease, and the overexpression of p53 associated with various forms of cancer. Other diseases are listed in FIGS. 10, 11, and 12. As will be appreciated by those skilled in the art, when a disease results from the expression or overexpression of a gene, such a disease can be treated by inhibiting the expression of the gene. Thus, for example, it may be possible to treat Parkinson's disease by reducing the expression of α-synuclein.

[0087] As will be appreciated by those skilled in the art, the terms "treating", "treat", and "treatment" include both prophylactic and curative treatment of a condition, disease, or disorder. These terms also include delaying, interrupting, controlling, or stopping the progression of a condition, disease, or disorder, and preventing, curing, delaying, interrupting, controlling, or stopping the symptoms of a condition, disease, or disorder.

[0088] The inventors have shown that the expression of a gene can be inhibited by utilizing a tRNA-derived polynucleotide that is complementary to the intron region of the gene. By targeting specific disease-related genes (those of diseases resulting from the expression or overexpression of the gene), it is possible to treat the disease.

[0089] Diseases treated by tRNA-derived polynucleotides, such as tsRNAs, are diseases that can be at least partially ameliorated by inhibiting the expression of a gene to which the tRNA-derived polynucleotide is complementary to an intron portion. In certain embodiments, the disease may be selected from, for example, cancer, autoimmune diseases, neurodegenerative diseases such as Alzheimer's disease or Parkinson's disease, metabolic diseases, respiratory diseases, and cardiovascular diseases. Other diseases are listed in FIGS. 10, 11, and 12.

[0090] As will be understood by those skilled in the art, the phrase "inhibiting the expression of a gene" does not necessarily require that the expression of the gene be globally suppressed. In embodiments, the tRNA-derived polynucleotide can completely inhibit the expression of a gene (i.e., 100% inhibition of gene expression). However, in alternative embodiments, the tRNA-derived polynucleotide can result in a slight or moderate reduction in gene expression.

[0091] Preferably, the tRNA-derived polynucleotide results in the expression of a gene that is inhibited by at least 50% compared to normal or wild-type expression. Preferably, the tRNA-derived polynucleotide results in the expression of a gene that is inhibited by at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% compared to normal or wild-type expression. Preferably, the tRNA-derived polynucleotide, such as tsRNA, results in complete inhibition of gene expression (i.e., the expression of the gene is inhibited to 100%).

[0092] In a method of treating a disease, the method includes administering a tRNA-derived polynucleotide, such as tsRNA, to a subject. The subject can be any subject in need of treatment for a disease that can be treated by inhibiting the expression of a gene. In embodiments, the subject is a human or animal subject.

[0093] A therapeutically effective amount of a tRNA-derived polynucleotide, e.g., tsRNA, may be administered orally, topically, by inhalation, or parenterally, e.g., by an inhaler. As will be understood by those skilled in the art, a tRNA-derived polynucleotide, e.g., tsRNA, may be formulated for a particular route of administration, e.g., in a pharmaceutical composition. Suitable formulations for oral administration include, for example, tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs. Suitable formulations for topical use include, for example, creams, ointments, gels, or aqueous or oily solutions or suspensions. Suitable formulations for inhalation include, for example, as fine powders, or liquid aerosols. Suitable formulations for administration by an inhaler include, for example, fine powders. Suitable formulations for parenteral administration include, for example, sterile aqueous or oily solutions for intravenous, subcutaneous, intramuscular or intramuscular dosing, or suppositories for rectal dosing.

[0094] As will be understood by those skilled in the art, the therapeutically effective amount of a tRNA-derived polynucleotide, e.g., tsRNA, will necessarily vary depending on the subject being treated, the route of administration, the nature and severity of the disease being treated.

[0095] We also provide combination therapies comprising the tRNA-derived polynucleotides described above or the pharmaceutical compositions described above, and the administration of an anti-cancer therapy. The anti-cancer therapy may be radiotherapy, chemotherapy, RNAi therapy, gene therapy, or treatment with a biological or small molecule drug. The tRNA-derived polynucleotide or pharmaceutical composition and the anti-cancer therapy may be provided simultaneously, in the same or different medicaments. Alternatively, the therapies may be provided as different medicaments administered sequentially. In one embodiment, the other therapy is radiotherapy, and the combination therapy may provide at least an additive effect. Accordingly, we also provide a method for enhancing the therapeutic efficacy of radiotherapy by simultaneous administration of a tRNA-derived polynucleotide described herein.

[0096] Pharmaceutical composition The present invention also provides a pharmaceutical composition comprising a tRNA-derived polynucleotide described herein, for example, tsRNA, and a pharmaceutically acceptable diluent or carrier.

[0097] There is also provided a pharmaceutical composition comprising a tRNA-derived polynucleotide described herein, for example, tsRNA, and a pharmaceutically acceptable diluent or carrier for use as a medicament.

[0098] There is also provided a pharmaceutical composition comprising a tRNA-derived polynucleotide, for example, tsRNA, and a pharmaceutically acceptable diluent or carrier for use in the treatment of a disease that can be at least partially ameliorated by inhibiting the expression of a target gene or long non-coding RNA, the tRNA-derived polynucleotide comprising a sequence complementary to an intron region of the gene.

[0099] The characteristics of the tRNA-derived polynucleotide, for example, tsRNA, are described above.

[0100] As will be understood by those skilled in the art, the terms "treating", "treat" and "treatment" include both prophylactic and curative treatment of a condition, disease or disorder. These terms also include delaying, interrupting, controlling or stopping the progression of a condition, disease or disorder, and preventing, curing, delaying, interrupting, controlling or stopping the symptoms of a condition, disease or disorder.

[0101] The pharmaceutical composition of the present invention may be administered orally, topically, by inhalation, or parenterally, e.g., by an inhaler. As will be understood by those skilled in the art, the pharmaceutical composition may be formulated for a particular route of administration. For example, suitable formulations for oral administration include tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs. Suitable formulations for topical use include, for example, creams, ointments, gels, or aqueous or oily solutions or suspensions. Suitable formulations for inhalation include, for example, fine powders or liquid aerosols. Suitable formulations for administration by an inhaler include, for example, fine powders. Suitable formulations for parenteral administration include, for example, sterile aqueous or oily solutions for intravenous, subcutaneous, intramuscular or intramuscular injection, or suppositories for rectal administration.

[0102] The pharmaceutical composition of the present invention may be obtained by conventional procedures using conventional pharmaceutical excipients. For example, a pharmaceutical composition intended for oral administration may contain, for example, one or more coloring agents, sweetening agents, flavoring agents and / or preservatives.

[0103] As will be understood by those skilled in the art, the amount of the active ingredient (i.e., the tRNA-derived polynucleotide) will necessarily vary depending on the host to be treated and the route of administration. The amount of the active ingredient will necessarily vary depending on the nature and severity of the disease to be treated, the age and sex of the patient or animal, and the route of administration.

[0104] The pharmaceutical composition may be formulated, in particular for the delivery of RNA molecules, with a non-viral vector such as exosomes, nanoparticles or liposomes, or a viral vector such as a retroviral vector, an adenoviral vector or a herpes simplex virus vector, or may be lipid-conjugated. Other possible delivery methods are listed elsewhere in this specification.

[0105] Use The present invention also provides the use of a tRNA-derived polynucleotide described herein, such as a tsRNA, for inhibiting the expression of a gene or long non-coding RNA in a biological system, wherein the polynucleotide comprises a sequence complementary to an intron region of the gene.

[0106] In some embodiments, the use is an in vitro use, i.e., a non-medical use. In other embodiments, the use is an ex vivo use, such as use in a pretreatment for cell therapy.

[0107] Kit The present invention also provides a kit comprising a tRNA-derived polynucleotide described herein, such as a tsRNA.

[0108] Method for designing a molecule We provide a computer-implemented method for generating a candidate tRNA-derived polynucleotide, such as a tsRNA, that is complementary to an intron region of a target gene described herein and capable of inhibiting the gene expression of the target gene, comprising: a) determining the unique characteristics of the tRNA from which the polynucleotide is derived; b) determining the unique characteristics of the binding site within the intron region of the target gene to which the tRNA-derived polynucleotide binds; c) generating a dataset comprising known tRNA-derived polynucleotides and binding sites; d) using the dataset to define a training dataset and identify a structure, nucleotide content, position within the intron, primary, secondary or tertiary structure, or any pattern in the gene target; e) screening a genomic sequence using the training dataset to identify candidate binding sites within the intron region of the target gene; and f) generating a candidate tRNA-derived polynucleotide comprising a sequence complementary to the intron region of the target gene also provided.

[0109] In one embodiment, the unique features include the sequence, secondary structure and / or position within the genome.

[0110] We also provide a computer system for identifying one or more unique tRNA-derived polynucleotide sequences in a eukaryotic genome, I. a memory unit configured to receive and / or store genomic sequence information; and II. one or more processors programmed to perform the method described above, alone or in combination including a computer system.

[0111] The features of the use of the present invention will be described in more detail in the following examples in relation to the above-described aspects of the present invention.

[0112] The examples described and illustrated should be considered illustrative and not limiting of the properties, and that only the preferred embodiments are shown and described, and that it is desired to protect all changes and modifications within the scope of the invention as defined in the claims.

[0113] The use of terms such as "preferable", "preferably", "preferred" or "more preferred" in the description suggests that the features so described may be desirable, but nevertheless, they may not be necessary, and embodiments lacking such features may be contemplated as within the scope of the invention as defined in the appended claims. In relation to the claims, when terms such as "a", "an" or "at least one" are used to preface a feature, it is intended that the claims are not intended to be limited to only one such feature, unless specifically stated to the contrary in the claims.

[0114] Here, the present invention will be further described with reference to the following non-limiting figures shown below.

Brief Description of the Drawings

[0115]

Fig. 1a

Fig. 1b

Fig. 1c

Fig. 1d

Fig. 1e

Fig. 2a

Fig. 2b

Fig. 2c

Fig. 3a

Fig. 3b

Fig. 4a

Fig. 4b

Fig. 4c

Fig. 4d

Fig. 4e

Fig. 4f

Fig. 5a

Fig. 5b

Fig. 5c

Fig. 6a

Fig. 6b

Fig. 6c

Fig. 7a

Fig. 7b

Fig. 8

Fig. 9a

Fig. 9b

Fig. 9c

Fig. 9d

Fig. 9e

Fig. 9f

Fig. 9g

Fig. 10a

Fig. 10b

Fig. 10c

Fig. 11

Fig. 12

Fig. 13a

Fig. 13b

Fig. 14

Fig. 15

Fig. 16

Fig. 17a

Fig. 17b

Fig. 17c

Fig. 17d

Fig. 18

Fig. 19

Fig. 20

Fig. 21

Fig. 22

Fig. 23a

Fig. 23b

Fig. 24

Fig. 25

Fig. 26

Fig. 27a

Fig. 27b

Fig. 28a

Fig. 28b

Fig. 29a

Fig. 29b

Fig. 29c

Fig. 30a

Fig. 30b

Fig. 31a

Fig. 32a

Fig. 32b

Fig. 33a

Fig. 34a

Fig. 34b

Fig. 35a

Fig. 36a

Fig. 36b

Fig. 36c

Fig. 36d

[0116] As discussed above, aspects of the invention enable the expression of a gene to be efficiently inhibited by use of a tRNA-derived polynucleotide that is complementary to an intron region of the gene. The inventors conducted important considerations to develop the aspects of the invention described below.

Example

[0117] The present invention is further described with reference to the following non-limiting examples.

[0118] (Example 1) Materials and Methods Cell Lines and Treatments The cell lines used in the research conducted by the present inventors were human embryonic kidney 293 (HEK293 cells), HEK293 clone 1.3 cells having an integrated doxycycline-inducible expression cassette containing a TAP-tagged Dicer together with shRNA against Dicer mRNA (shDicer), and HEK293-based cell lines having integrated doxycycline-inducible expression cassettes containing shDicer and shRNA against AGO2 mRNA (shAgo2), respectively. All cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Thermo Fisher Scientific) having 10% fetal bovine serum, 1% L-glutamine (Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific) at 37 °C with 5% CO2. Dicer and Ago2 knockdown were achieved by incubating the inducible cell lines with doxycycline (3 μg / ml) in DMEM at 37 °C for 72 hours (changing to fresh medium with doxycycline every 24 hours). The TAP tag in HEK293T clone 1.3 cells was induced with doxycycline (3 μg / ml) for 5 days. Transfection of shRNA (10 μg twice at 6 hours) and tsRNA (50 μM at 48 hours) against the plasmid containing Drosha mRNA (shDrosha) was performed using Lipofectamine 2000 reagent (Invitrogen). Cells were incubated with α-amanitin (2 μg / ml, Sigma) for 24 hours to inhibit transcription.

[0119] Northern blot 2 - 3 μg of RNA in 2× native loading dye (0.05% xylene cyanol, 0.05% bromophenol blue, 20% glycerol) was separated on a 14% bis - polyacrylamide gel in 1× TBE and subsequently transferred onto a nitrocellulose membrane (Protran, GE Healthcare). The membrane was UV cross - linked and pre - hybridized in oligohybridization buffer at 42 °C for 1 hour. The tRNA - specific oligonucleotide probe was radio - labeled with 32 P - ATP at 37 °C for 30 minutes using polynucleotide kinase (PNK). The radio - labeled probe was purified on a G - 25 Sephadex column (GE Healthcare), hybridized to the membrane overnight at 42 °C, subsequently washed with Northern wash buffer (0.05% SDS, 0.1× SCC), and subjected to autoradiography.

[0120] Western blot Whole cell, cytoplasmic, nuclear or chromatin extracts were directly treated with 4× Laemmli buffer (0.2 M Tris - HCl, 8% (w / v) SDS, 40% glycerol, 20% (v / v) β - mercaptoethanol, 0.005% bromophenol blue), incubated at 95 °C for 5 minutes, and sonicated. The samples were separated on a mini - PROTEAN® TGX™ gel (Bio - Rad Laboratories) and subsequently transferred onto a nitrocellulose membrane (Protran, GE Healthcare) and probed with antibodies.

[0121] Preparation of sRNA - seq and mRNA - seq samples For sRNA-seq, total RNA was isolated from cells treated with scrambled shRNA (as a control) and shDicer cells for 7 days using the miRVana miRNA Isolation Kit (Thermo Fisher Scientific). The amount of purified RNA was confirmed with the RNA 6000 Pico Kit (Agilent) on an Agilent 2100 Bioanalyzer. Sequencing libraries were prepared using the NEBNext® Multiplex Small RNA Library Prep Set (New England BioLabs) and sequenced on the HiSeq2000 (Illumina). For mRNA-seq, RNA was purified using the miRNEasy Kit (Qiagen), treated with DNase (Thermo Fisher Scientific) at 37°C for 30 min, followed by acidic phenol-chloroform extraction. The integrity of the samples was verified on a 1.25% formaldehyde gel. RNA samples were depleted of ribosomes, and sequencing libraries were prepared with the TruSeq Stranded Total RNA Sample Preparation Kit (Illumina), followed by paired-end sequencing on the HiSeq2000 (Illumina).

[0122] Reverse transcription-quantitative PCR RNA was isolated from whole cells, cytoplasmic, nuclear or chromatin extracts using TRIzol (Invitrogen) according to the manufacturer's instructions and treated with DNase I (1 U, Roche) for 30 minutes at 37°C. 200 - 500 ng (exon-based) and 5 μg of RNA (intron-based) were used to prepare cDNA templates using SuperScript™ reverse transcriptase (Thermo Fisher Scientific) together with specific reverse primers. Real-time PCR was performed using SensiMix™ SYBR No-Rox Mastermix (Bioline Reagents) together with a pair of specific primers on a Rotor-Gene RG3000 machine (Corbett Research). Relative fold changes were computer calculated using the comparative Ct method (1).

[0123] Intracellular fraction Cytoplasmic and nuclear fractions were obtained according to a published protocol (2).

[0124] Sequencing of chromatin-associated RNA The chromatin fraction was extracted using approximately 6.72×10 6 cells according to a published protocol (3), treated with 40 μg of proteinase K and 1 μl of Turbo DNase (2 U / μl) (Thermo Fisher Scientific) in 1% SDS, followed by TRIzol (Invitrogen) extraction. The incompletely lysed chromatin pellet was lysed by heating the sample at 55°C for 10 minutes on a heat block in a safe-lock tube (Eppendorf).

[0125] Chromatin immunoprecipitation Approximately 7×10 6Cells were incubated with 1% formaldehyde in DMEM for 8 minutes, followed by quenching with 0.125 M glycine in DMEM at 37°C for 10 minutes. Cells were washed with ice-cold PBS and lysed in 500 μl of lysis buffer (0.5% NP-40, 85 mM KCl, 5 mM PIPES, 1× protease inhibitor cocktail (Roche)). Chromatin was pelleted at 800 g for 10 minutes and lysed in nuclear lysis buffer (50 mM Tris-HCl, 1% SDS, 10 mM EDTA, 1× protease inhibitor cocktail (Roche)) and sonicated at high power setting for 25 minutes at 4°C. The fragmented chromatin lysate was pre-cleared with Protein G magnetic beads (40 μl per sample, Invitrogen) for 1 hour and divided equally into input, IP, and beads-only samples and diluted in dilution buffer (16.7 mM Tris-HCl, 0.01% SDS, 1.1% Triton X-100, 500 mM EDTA, 167 mM NaCl, 1× protease inhibitor cocktail (Roche)). Immunoprecipitation with antibody was performed overnight and the samples were incubated with Protein G magnetic beads (40 μl) for 1 hour. The beads were washed with wash buffer A (20 mM Tris-HCl, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 150 mM NaCl), B (20 mM Tris-HCl, 2 mM EDTA, 0.1% SDS, 1% Triton X-100, 500 mM NaCl), C (10 mM Tris-HCl, 1 mM EDTA, 1% NP-40, 1% sodium deoxycholate, 0.25 M LiCl), and D (10 mM Tris-HCl, 1 mM EDTA). The protein-DNA complex was eluted with elution buffer (1% SDS, 0.1 M NaHCO3) for 30 minutes at room temperature and treated with RNase A (1 μl) and proteinase K (2 μl) overnight at 65°C. DNA was extracted with phenol-chloroform (1:1) mixture and subsequently analyzed using qPCR.

[0126] Statistical analysis of experimental data qPCR data was analyzed using raw Ct values. When comparing two conditions, the data was subjected to the Shapiro-Wilk test and F-test to evaluate normality and equal variance. If they followed a normal distribution and had the same variance, an unpaired t-test (one-sided) was performed to test for significant differences (p-value < 0.05 was considered significant). If the data did not follow a normal distribution, an unpaired Mann-Whitney test (one-sided) was used instead. For the comparison of two or more conditions, one-way ANOVA was performed, followed by Tukey's multiple comparison test.

[0127] Bioinformatics analysis ChIP-seq The ChIP-seq of Dicer previously published by the present inventors was analyzed (4) (GSM1366345). The raw data was adapter-trimmed using cutadapt 1.8.3 (5) for various contaminating sequences identified by fastqc (6). In this way, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 1), TCGTATGCCGTCTTCTG (SEQ ID NO: 2), and CTGTAGGCACCATCAAT (SEQ ID NO: 3) were trimmed at the 3' and 5' ends.

[0128] RNAPIII ChIP-seq data was downloaded from GEO (GSM509047) (7), and similarly, RNAPII ChIP-seq data (GSM935534) and input (GSM935533) (ChIP-seq from Stanford / Yale / USC / Harvard, ENCODE transcription factor binding sites) were downloaded. All ChIP-Seq data was mapped to hg38 using bowtie2 (9) with default values. Reads with samflag 4 (unmapped) were discarded, and duplicate reads were removed using samtools 0.1.19 (10). Bedgraph was generated using bedTools genomeCoverageBed (11), (library size) / 10 8Generated by normalization. The presence of RNAPIII and Dicer was determined by peak calling with MACS version 2.1.1(12) and the command line argument callpeak -g hs --broad - cutoff 0.05 - broad.

[0129] tRNA hg38 coordinates were downloaded from UCSC(13). Coverage values for each tRNA and the region around 200nt were computed using a custom - written perl script. Then, each tRNA was extended to 100nt and the coverage values were adjusted. Heatmaps were generated using a custom MATLAB® (MATLAB and Statistics Toolbox Release 2016a The MathWorks, Inc., Natick, Massachusetts, USA) script using a 25nt rolling average.

[0130] sRNA - seq and PAR - CLIP Bowtie indexes were constructed using bowtie - build(14) for tRNA gene sequences extended 7nt on each side. MicroRNA and snoRNA sequences were downloaded from UCSC(13) and indexes were constructed in the same way. sRNA - seq data for Dicer knockdown and scrambled shRNA controls(3rep), and PAR - CLIP data for AGO 1, 2, 3, and 4(15) and Dicer(16) were adapter - trimmed using cutadapt 1.8.3 with a minimum length of 10 24 and sequences consisting of partial adapters were removed using a custom - written perl script. The remaining sequences were mapped to tRNA±7nt / mi - and snoRNA using bowtie - S - v3 --all --best - strata(14). Only sequences with lengths of 19nt - 22nt were considered for further analysis. Reads were equalized against their genomic sequences.

[0131] For sRNA analysis, reads were supported by at least one AGO and one Dicer PAR-CLIP hit in any rep. Hits in the tRNA / miRNA / snoRNA regions were normalized against the total number of reads mappable to the genome. These were determined by mapping reads using bowtie(14)-m 1-k 1 to hg38, and aggregating "reads by at least one reported alignment" and "reads by alignments suppressed due to -m" from the output report. For PAR-CLIP, reads occurring 25 times in all AGO sets and 323, 41, or 19 times in any of the sets of Dicer rep1, rep2, or rep3, respectively, were further considered (the cutoffs were due to different library sizes and distributions of read occurrences). These were considered to be tsRNAs.

[0132] ChrRNA-seq cDNA and ncRNA sequence data were downloaded from Ensembl version 89(17), and kallisto (v0.43.1) indexes were constructed. Read counts for RNA-seq data were generated using kallisto(18) with the following options: --rf-stranded -b 100 -t 5.

[0133] Differential gene expression Differentially expressed genes were determined using DESeq2(19). For mRNA-seq genes with adjusted FDR, P < 0.001 was considered significant differential expression. For chrRNA-seq, genes with adjusted P < 0.005 for sh Dicer and shAgo2 were considered significant differential expression. Due to a small number of changing genes, a less stringent criterion of adjusted P < 0.05 was used in the sh Drosha samples.

[0134] Target prediction The tsRNA targets were predicted by running miRanda 3.3a(20) with parameter -sc 150 -en -30 -quiet against genes significantly upregulated as determined by mRNA - Seq. The same analysis was repeated for genes significantly upregulated in chrRNA - seq in sh - Dicer and shAgo2.

[0135] tsRNA distribution sRNA mappings to tRNAs were grouped by whether they overlapped each other by up to 10 nt. Each group was then considered as one sRNA with the most extreme mapping. Each tRNA was extended up to 100 nt. The absolute frequency was computer - calculated as the number of (grouped) sRNA hits at each tRNA position.

[0136] Disease - related heatmap The inventors downloaded from DisGeNET(21) the table of all gene - disease associations and the selected annotations of cui, disease, and disease class. DisGeNET uses NCBI annotations as references. We extracted the gene symbols and all synonyms for NCBI genes. The inventors also extracted gene symbols for Ensembl 89 using BioMart(22). The gene population was obtained as the overlap of NCBI gene symbols and Ensembl 89 gene symbols, and only target genes having diseases and symbols in this population were further considered. Then, a contingency table was constructed and the significance of the observed results was evaluated using a one - sided Fisher's exact test. The heatmap was plotted in R(23) using the pheatmap package(24) by constructing a binary matrix for target - gene - disease / disease class associations. This matrix was sorted first by the column total (genes) and then by the row total (diseases).

[0137] Prediction of tRNA secondary structure To predict possible tRNA structures, we used the mFold (25) web server with sub-optimality %: 20 and otherwise default parameters.

[0138] Discussion The advent of deep sequencing techniques has helped identify tsRNAs in mammalian cells, dispelling the suspicion that sRNAs of tRNA origin are random fragmentation products. However, there is room for discussion regarding which enzymes generate tsRNAs, and the extent of their biological roles remains unclear. Since Dicer has been implicated in the production of some tsRNAs, the inventor sought to examine whether the nuclear function of Dicer has any association with this class of sRNAs.

[0139] The inventors first used chromatin immunoprecipitation sequencing (ChIP-seq) data for Dicer and RNA polymerase III (RNAPIII) to show that Dicer preferentially binds to transcribed tRNA genes. RNA polymerase II (RNAPII) and input were used as negative controls (Figures 1a, b, 2a). To test whether Dicer has any effect on tRNA, the inventors performed Northern blot analysis and showed that in Dicer knockdown, a distinct population of tRNAs was stabilized in native polyacrylamide gel electrophoresis (PAGE), but not in denaturing PAGE (Figure 1c), suggesting that this population of tRNAs has the same primary sequence as classical tRNAs but folds into an alternative secondary structure. The inventors also used mFold (25) to predict the alternative secondary structures of tRNAs and showed that they can actually fold into short hairpin structures similar to miRNA precursors (Figure 2b). To confirm a direct association between Dicer and alternatively folded tRNAs, the inventors immunoprecipitated tandem affinity purification (TAP)-tagged Dicer and detected the enrichment of alternatively folded tRNAs in native PAGE (Figure 1d). It was proposed that Dicer binds to various RNA substrates without any further processing. To test whether Dicer processes alternatively folded tRNAs into functional sRNAs, the inventors sequenced and compared sRNAs isolated from wild-type and inducible Dicer knockdown cells (Figure 2c). First, the inventors detected tsRNAs in wild-type cells and confirmed their presence. Second, their levels decreased in Dicer knockdown, along with the miRNA that the inventors used as a positive control. The levels of small nucleolar RNAs (snoRNAs) used as negative controls did not decrease in Dicer knockdown (Figures 1e, 3a). A large proportion of these tsRNAs, which are derived from the first half of tRNAs (Figure 3b), distinguish them from tRNA fragments. These data suggest that Dicer is involved in the biogenesis of tsRNAs derived from alternatively folded tRNA structures.Therefore, this type of tsRNA is different from the Dicer-independent tsRNA derived from the previously reported mature tRNA.

[0140] Next, the inventor extracted sequences from data of photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) digesters and Ago1, 2, 3, and 4, and mapped them to tRNA genes (±7 nt). Next, the inventor sequenced mRNAs from wild-type and dicer knockdown cells and determined genes upregulated in dicer knockdown by DESeq2. Finally, they generated a list of genes predicted to be targeted by dicer- and Ago-related tsRNAs using miRanda (20) (Figure 4a). Six randomly selected target genes were tested by reverse transcription-quantitative PCR (qRT-PCR) in wild-type, Drosha, dicer, and Ago2 knockdown cells (Figure 5a, b) using primers targeting the 3′ untranslated region (UTR). If genes are regulated by miRNAs, the absence of Drosha should result in their upregulation because Drosha is important for miRNA biogenesis. Four protein-coding genes (GK, GUCY1A2, RBP7, and SPINT1) and a non-coding transcript (RP4-639F20.1) were upregulated only in dicer and Ago2 knockdowns, indicating that they are not regulated via the miRNA-dependent pathway (Figure 4b). NOV was significantly upregulated in Drosha, dicer, and Ago2 knockdowns. Since these data suggest miRNA-independent control for most of the tested genes, we next analyzed whether target genes in intracellular compartments were upregulated and performed intracellular fractionation followed by qRT-PCR. Surprisingly, four of the tested target genes were upregulated in both the cytoplasmic and nuclear compartments (Figure 5c). It could be argued that potential contamination from the cytoplasmic fraction could have led to this observation. Therefore, the inventor used qRT-PCR probes in the introns of target genes and showed that six of the tested genes were upregulated in dicer and Ago2 knockdowns but did not affect the level of the non-target control gene ETNK1 (Figure 4c).These results mean that the genes tested are controlled at the transcriptional level (rather than post-transcriptionally) because intron splicing occurs co-transcriptionally. Transcriptional gene silencing (TGS) is mediated by histone modification and heterochromatin formation, resulting in transcriptional arrest and the absence of RNAPII in chromatin. To test whether tsRNAs can target genes for TGS, the inventors performed ChIP of total and active (phosphorylated at serine positions 2 (S2P) and 5 (S5P) of the C-terminal domain) RNAPII with three selected target genes (searches in the promoter, exon and 3'UTR), and found that the levels of RNAPII did not increase in dicer knockdown (Figure 4d, Figure 6a). Furthermore, the level of histone 3 dimethylated at lysine 9 (H3K9me2), a heterochromatin mark, was detected only at background levels in the target genes and did not change in dicer knockdown, although the total protein levels of RNAPII, H3 and H3K9me2 were not affected (Figure 6b, c). These results suggest that tsRNA-mediated gene silencing does not require changes in transcription or chromatin state, but rather leads to the degradation of nascent RNA.

[0141] To identify the genes globally controlled by this distinct gene silencing mechanism, the inventor performed chromatin-associated RNA sequencing (chrRNA-seq) to detect the levels of nascent transcripts in wild-type, Drosha, Dicer, and Ago2 knockdown cells (Figure 7a). More than 2,000 genes were identified that were upregulated in both Dicer and Ago2 knockdowns but not in Drosha knockdown (Figure 9a, b). A detailed examination of one of the target genes, SPINT1, confirmed only low levels of nascent RNA in wild-type and Drosha knockdown cells. However, the active histone marks H3 acetylated at lysine 27 (H3K27Ac) and H3 trimethylated at lysine 4 (H3K4me3) were present at the promoter of SPINT1, while the repressive mark H3 trimethylated at lysine 9 (H3K9me3) was not detected (Figure 8; GEO accession number GSE66530). The inventor then performed miRanda analysis on the target genes upregulated in chrRNA-seq (Figure 7b) and showed that they were specifically targeted in their introns by tsRNAs (Figure 9c). Of the 531 tRNAs that produce tsRNAs, 496 have targets in at least one intron region of protein-coding genes (Figure 9d). To verify the molecular mechanism of tsRNAs targeting introns, the inventor synthesized a tsRNA sequence predicted to target the second intron of SPINT1, transfected it into wild-type and Dicer knockdown cells, and used qRT-PCR to evaluate the levels of SPINT1 and GK mRNAs. The inventor found that the upregulation of SPINT1 in Dicer knockdown was significantly reduced after transfection with its targeting tsRNA, while the upregulation of GK used as a negative control was not affected (Figure 9e). This experiment demonstrates that tsRNAs can target the intron regions of specific genes and downregulate their expression.The target gene is upregulated in Dicer and Ago2 knockdowns, and since Ago2 functions normally downstream of Dicer, the inventor hypothesizes that Ago2 is guided to chromatin by tsRNA to target nascent RNA for degradation. The inventor observed that the level of Ago2 in chromatin decreased upon 24-hour inhibition of RNAPII by α-amanitin (Figure 9e), suggesting that the association between Ago2 and chromatin is transcription-dependent. In short, the inventor proposes a novel gene silencing mechanism that uses Dicer-dependent tsRNA to drive Ago2-dependent degradation of nascent RNA (Figure 9g). This mechanism is distinct from miRNA-mediated post-transcriptional gene silencing because it occurs in the nucleus and is Drosha-independent. It is also different from transcriptional gene silencing because it does not involve transcriptional inhibition and heterochromatin formation. The advantage of this gene silencing mechanism is that it does not require changing the chromatin context, which could potentially affect the expression of genes near the target gene.

[0142] Finally, the inventor examined what the genes regulated by tsRNA have in common. Considering that they are suppressed in wild-type cells, we asked whether the degradation of their nascent RNA has a biological context. Using DisGeNET, a platform that documents human disease-related genes, the inventor surprisingly found that genes targeted by Dicer-dependent tsRNA for silencing are significantly associated with diseases when compared to non-target genes (one-sided Fisher's exact probability test, P < 2.2 × 10-16) (Figure 10a). The inventor identified an association with at least one disease for 1225 target genes (out of 1565 in total) (Figures 11 and 12). In Figure 10b, the inventor shows that the top 100 genes are involved in the most diseases (here, the top 50), as previously known. Furthermore, the inventor classified the top 100 diseases associated with the target genes and revealed that many target genes are involved in tumorigenesis, nervous system diseases, autoimmune diseases, etc. (Figure 10c).

[0143] The inventors of the present invention propose a distinct mechanism of gene silencing. Different from miRNA-mediated PTGS, Dicer-dependent tsRNAs target genes co-transcriptionally in the nucleus. However, different from TGS promoted by transcriptional repression and heterochromatin formation, these tsRNAs target introns of protein-coding genes for immediate degradation of nascent RNAs. This novel molecular mechanism that controls 1125 disease-related genes has great transformative potential in the current era of expanding RNA therapies.

[0144] (Example 2) Cell lines expressing EGFR tsRNAs were generated as shown in Fig. 4a. EGFR, the epidermal growth factor receptor encoding the gene, is a member of the type I family of growth factor receptors that encodes a transmembrane glycoprotein located at chromosome 7p12 and having a tyrosine kinase activity of 170 kDa. High-level expression of EGFR at the sites of many cancer types often correlates with more malignant or advanced diseases and poor prognosis.

[0145] Cells were transfected with tsRNAs for 24 hours and collected for RNA isolation. Relative RNA levels were quantified by reverse transcription-quantitative PCR (qRT-PCR). Primers targeting exons were used to quantify steady-state mRNA levels, while primers targeting introns were used to quantify nascent (newly produced) RNA levels. As shown in Fig. 13A, the steady-state level of EGFR mRNA was reduced in the transfection of tsRNA EGFR. As shown in Fig. 13B, the nascent level of EGFR mRNA was reduced in the transfection of tsRNA EGFR.

[0146] (Example 3) Cell lines expressing MET tsRNA was generated as shown in Figure 4a. cMET is also overexpressed in breast cancer cells and human breast tumors, and its expression correlates with that of EGFR. The cMET growth factor receptor is characterized as a receptor tyrosine kinase. cMET, in part, controls the tyrosine phosphorylation and growth of EGFR. Cells were transfected with tsRNA for 24 hours and collected for RNA isolation. Relative RNA levels were quantified by reverse transcription-quantitative PCR (qRT-PCR). Primers targeting exons were used to quantify steady-state mRNA levels while primers targeting introns were used to quantify nascent (newly produced) RNA levels. As shown in Figure 13A, the steady-state level of MET mRNA was reduced in the transfection of tsRNA MET. As shown in Figure 13B, the nascent level of MET mRNA was reduced in the transfection of tsRNA MET.

[0147] (Example 4) EGFR+MET using BT549 that expresses both As shown in Fig. 14, BT549 cells were transfected with tsRNA EGFR / MET and imaged on day 3 using an optical microscope. More cells appeared to be dead in the population of cells transfected with tsRNA EGFR / MET. tsRNA is single-stranded and has the following sequence (5' to 3'): UCCCUGGUGGUCUAGUGGUUAG (SEQ ID NO: 4). BT549 cells were transfected with increasing concentrations of tsRNA EGFR / MET (10, 20, 40 and 80 μl - 100, 200, 400 and 800 pmol) and imaged on day 6. As shown in Fig. 15, the number of dead cells increased with the increase in the amount of tsRNA EGFR / MET (light microscopy), and in Fig. 16, it can be seen that the number of live cells decreased with the increase in the amount of tsRNA EGFR / MET (crystal violet staining). BT549 cells were transfected for 24 hours with either tsRNA EGFR / MET (100 pmol) or siRNA targeting EGFR (100 pmol). Total RNA and protein were extracted from the cells for qRT-PCR (Figs. 17A and 17B) and western blotted respectively (Figs. 17C and 17D).

[0148] (Example 5) BCL2 tsRNA was generated as shown in Figure 4a. It is single-stranded and has the following sequence (5' to 3'): UAAGCCAGGGAUUGUGGGUUCG (SEQ ID NO: 5). The Bcl-2 protein family plays an important role in the regulation of apoptosis, including necrosis and autophagy. Overexpression of the anti-apoptotic gene of the Bcl-2 family, namely Bcl-2, is the cause of resistance to breast cancer chemotherapy. MCF7 is a breast cancer cell line that expresses BCL2. The tsRNA BCL2 used here specifically targets BCL2, and tsRNA SPINT1 was used as a control. Cells were transfected with tsRNA for 24 hours and collected for RNA isolation. Relative RNA levels were quantified by reverse transcription-quantitative PCR (qRT-PCR). Primers targeting exons were used to quantify the steady-state mRNA levels. Transfection of tsRNA BCL2 into cells resulted in downregulation of the steady-state mRNA level of BCL2 (Figure 18).

[0149] MCF7 cells were transfected with increasing amounts of tsRNA BCL2 for 24 hours. Total protein was extracted for Western blot, and the signal of beta-tubulin was used as a loading control. The signal of cleaved caspase-9 was used as a proxy for cells undergoing apoptosis. As shown in Figure 19, BCL-2 levels decreased with an increase in the amount of transfected tsRNA BCL2. Cleaved caspase-9, following the reverse pattern, increased with an increase in the amount of tsRNA BCL2, indicating that more cells underwent apoptosis. MCF7 cells were transfected with tsRNA BCL2 and imaged on day 3 by light microscopy. More dead cells were present in the population of cells transfected with tsRNA BCL2. This is shown in Figure 20.

[0150] A549, MCF7, and BT549 cells were transfected with tsRNA BCL2 and subjected to crystal violet staining on the 8th day. As shown in Figure 21, fewer viable cells were present in the population of cells transfected with tsRNA BCL2.

[0151] (Example 6) LINC00665 tsRNA was generated as shown in Figure 4a. It is single-stranded and has the following sequence (5' to 3'): GGGGGUGUAGCUCAGUGGUA (SEQ ID NO: 6). Long non-coding RNAs (lncRNAs) are frequently dysregulated in multiple malignancies, demonstrating their potential oncogenic or tumor-suppressive roles in tumorigenesis. LINC00665 is significantly upregulated in lung cancer tissues and may serve as an independent predictor for poor prognosis. Functional assays have shown that LINC00665 enhanced the proliferation of lung cancer cells and metastasis in vitro and in vivo. LINC00665 controls the pathways in the cell cycle that promote cancer development and progression by 10 identified core genes: CDK1, BUB1B, BUB1, PLK1, CCNB2, CCNB1, CDC20, ESPL1, MAD2L1, and CCNA2. A549 is an invasive lung cancer cell line that expresses LINC00665. The tsRNA LINC00665 used here targets LINC00665, and tsRNA SPINT1 was used as a control.

[0152] BT549 cells were transfected with tsRNA LINC00665 for 24 hours. RNA was extracted for qRT-PCR. Primers targeting exons were used to quantify the steady-state RNA levels. As shown in Figure 22, the LINC0665 levels were reduced by the transfection of tsRNA LINC0665 in BT549 cells.

[0153] A549 cells were transfected with tsRNA LINC00665 for 24 hours. RNA was extracted for qRT-PCR. Primers targeting exons were used to quantify steady-state RNA levels, while primers targeting introns were used to quantify nascent RNA levels. As shown in Figures 23A and 23B, both steady-state and nascent LINC0665 levels were reduced by transfection with tsRNA LINC0665 in A549 cells. As shown in Figure 24, A549 cells were transfected with tsRNA LINC00665 and imaged on day 3 by light microscopy. More dead cells were present in the population of cells transfected with tsRNA LINC00665.

[0154] A549, MCR7 and BT549 cells were transfected with tsRNA LINC00665 and subjected to crystal violet staining on day 6. As shown in Figure 25, fewer viable cells were present in the population of cells transfected with tsRNA LINC00665. A549 cells were transfected with tsRNA LINC00665 for 24 hours. Total proteins were extracted at 30 and 90 minutes after irradiation and subjected to western blot. The signal of gamma-H2AX, used as a surrogate for DNA damage, was quantified using a blot imager and normalized to the level of beta-tubulin. As expected, irradiated cells showed a higher gamma-H2AX signal at 30 minutes after irradiation, however, at the 90-minute time point, cells transfected with ts20 (i.e., the tsRNA targeting LINC00665) did not repair DNA damage as expected, suggesting that tsRNA LINC00665 affects genes involved in the DNA damage response (shown in Figure 26).

[0155] A549, MCF7, and BT549 were transfected with tsRNA LINC00665, irradiated with 10 Gy 24 hours later, and finally subjected to crystal violet staining on day 6. As shown in Figures 27A and 27B, transfection of tsRNA LINC00665 into MCF7 and BT549 cells caused cell death; more cell death occurred when the cells were subjected to gamma irradiation. However, this effect was amplified when the transfection of tsRNA LINC00665 was combined with gamma irradiation.

[0156] Finally, A549, MCF7, and BT549 were transfected with tsRNA BCL2, irradiated with 10 Gy 24 hours later, and finally subjected to crystal violet staining on day 6. As shown in Figures 28A and 28B, transfection of tsRNA BCL2 into MCF7 and BT549 cells caused cell death; more cell death occurred when the cells were subjected to gamma irradiation. However, this effect was amplified when the transfection of tsRNA LINC00665 was combined with gamma irradiation.

[0157] To verify the secondary structure prediction of this hairpin-like tRNA, we used in vitro transcription of tRNA Arg-CCG-2-1 and the well-studied hairpin miRNA pre-let7a. As expected, transcription of pre-let7a yielded a single band. tRNA Arg-CCG-2-1 surprisingly yielded two bands: a minor one corresponding to the cloverleaf structure and a major one that migrated near the position of the pre-let7a control after native PAGE, suggesting that the structure is hairpin-like (Figure 29a). It is important to note that the absence of enzymes that modify RNA in vitro can significantly cause alternative folding of tRNA, and in vitro-modified tRNA can preferentially fold into the cloverleaf structure, so a larger amount of hairpin-like tRNA was detected in our experiment.

[0158] To test whether Dicer processes this hairpin-like tRNA into small RNAs, we transcribed tRNA Arg-CCG-2-1 , pre-let7a, and snoRD38A in vitro and incubated them with purified Dicer-TAP. We showed that the levels of the pre-let7a substrate decreased over time in the presence of Dicer-TAP. Interestingly, the levels of the hairpin-like tRNA Arg-CCG-2-1 substrate decreased in the presence of Dicer, suggesting that Dicer can process the hairpin-like tRNA into small RNAs, while the levels of the snoRNA snoRD38A used as a negative control did not change (Figure 29b). However, we did not detect sRNAs on gels stained with SYBR Gold, which may be due to the sensitivity of the tissue. Subsequent Northern analysis showed that the decrease in tRNA levels led to the production of sRNAs (Figure 29c).

[0159] We then performed miRanda (Enright et al., 2003) analysis on the chrRNA-seq data, showing that tsRNAs target introns of protein-coding genes and non-coding RNAs. Interestingly, there is a preference in the targeting of early introns (Figure 31a). Next, we examined the transcriptional status of the target genes in wt HEK293 cells. We aligned RNAP II ChIP-seq data (GSE126751), mammalian nascent elongating transcription (mNET-seq) data (Mayer et al., 2015), and chRNA-seq data (GSE126751). A detailed examination of snapshots of the selected target genes RP4-639F20.1, SPINT1, and GK revealed the presence of not only RNAP II (ChIP-seq), but also RNAP II-protected nascent transcript signals (mNET-seq), as well as very low levels of nascent RNA in wt cells. The nascent RNA levels of the target genes increased in Dicer and Ago2 knockdowns, but not in Drosha knockdowns (Figures 30a, 32a, and 32b). We also show combined snapshots for the highly transcribed non-target gene GAPDH. We observed no significant change in the nascent RNA levels of GAPDH in wt, Drosha, Dicer, and Ago2 knockdowns (Figure 30b).

[0160] We emphasize that when tsRNAs target nascent RNAs, they should be detectable in the nucleus. To test whether tsRNAs are localized to the nucleus, we fluorescently labeled synthetic tsRNAs and siRNAs targeting the EGFR gene in vitro. After transient transfection, we detected tsRNAs in both the nucleus and cytoplasm, whereas the siRNAs were localized only to the cytoplasm (Figure 33a). Next, we performed fractionation followed by Northern blotting to detect two endogenous tsRNAs. Again, we obtained signals from both fractions: the nucleus and the cytoplasm (Figure 34a). To test whether Ago2 binds directly to tsRNAs, we performed immunoprecipitation of Ago2 followed by Northern blotting to detect one of the tsRNAs. Indeed, we detected the tsRNA signal in the Ago2 pull-down but not in the control IgG pull-down (Figure 34b).

[0161] To evaluate the cleavage activity of Ago2 in this gene-silencing pathway, we incubated FLAG-tagged AGO2 with synthetic tsRNAs together with a substrate having a sequence predicted to be targeted by the tsRNAs. As shown by Northern blotting, the full-length substrate was destabilized upon incubation with Ago2 and its targeting tsRNAs, whereas the same full-length substrate remained intact in the absence of Ago2 (Figure 35a).

[0162] These data demonstrate that tsRNAs target intronic regions of specific genes and downregulate their expression by cleaving nascent RNAs in an Ago2-dependent manner.

[0163] To confirm further intron targeting, we synthesized a tsRNA predicted to specifically target the second intron of SPINT1. We transfected the synthetic tsRNA into wt cells and observed a decrease in the nascent levels of SPINT1 pre-mRNA. However, transfection of the synthetic tsRNA did not reduce the expression of the mature transcript (Figure 36a). This may be because the levels of the mature transcript are very low under wt conditions and detection of further silencing of such low levels may be difficult. We then transfected the same synthetic tsRNA into both wt and Dicer knockdown cells and evaluated the levels of nascent and mature SPINT1 using qRT-PCR. We found that the upregulation of SPINT1 in Dicer knockdown was significantly reduced after transfection of the tsRNA targeting its intron (Figure 36b). In addition, we tested whether it is important for the synthetic tsRNA to be transfected in single-stranded or double-stranded form. We found that both forms can bring about target gene silencing and, in most cases, the effect is dose-dependent (Figures 36c and 36d).

[0164] It will be understood that numerous modifications may be made to the above-described method without departing from the scope of the invention as defined in the appended claims.

[0165] [References] TIFF2025106263000002.tif219150TIFF2025106263000003.tif104150

Claims

**Claim 1** A pharmaceutical composition for use in the treatment of cancer, comprising an isolated tRNA-derived polynucleotide comprising a sequence that is at least 70, 80, 90 or 95% complementary to an intron region of a target gene associated with cancer or a long non-coding RNA associated with cancer, wherein the tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment (tsRNA) having 14 to 35 nucleotides, and the tRNA comprises a stem-loop / hairpin structure. **Claim 2** The pharmaceutical composition according to claim 1, wherein the isolated tRNA-derived polynucleotide comprises a sequence that is at least 90% complementary to an intron region of a target gene or a long non-coding RNA. **Claim 3** The pharmaceutical composition according to claim 1 or 2, wherein the isolated tRNA-derived polynucleotide targets an intron region of the target gene associated with the cancer or the long non-coding RNA associated with the cancer, and downregulates the expression of the target gene associated with the cancer or the long non-coding RNA associated with the cancer by cleaving nascent RNA in an Ago2-dependent manner. **Claim 4** The pharmaceutical composition according to claim 1 or 2, wherein the tsRNA is double-stranded or single-stranded. **Claim 5** The pharmaceutical composition according to claim 4, wherein the double-stranded tsRNA has blunt ends. **Claim 6** The pharmaceutical composition according to claim 5, wherein the double-stranded tsRNA comprises overhangs. **Claim 7** The pharmaceutical composition according to any one of claims 1 to 6, wherein the tRNA-derived polynucleotide is chemically modified. **Claim 8** The pharmaceutical composition according to claim 1, wherein the polynucleotide is tRNA. **Claim 9** The pharmaceutical composition according to any one of claims 1 to 8, wherein the polynucleotide binds to an intron region of the mRNA of the target gene, thereby inhibiting gene expression. **Claim 10** The pharmaceutical composition according to any one of claims 1 to 9, wherein the tRNA and the tsRNA are located in the nucleus. **Claim 11** The pharmaceutical composition according to any one of claims 1 to 10, which is used in combination with other anti-cancer therapies. **Claim 12** The pharmaceutical composition according to claim 11, wherein the other anti-cancer therapy is selected from radiotherapy or chemotherapy. **Claim 13** An in vitro or ex vivo method for inhibiting the expression of a target gene associated with cancer or a long non-coding RNA associated with cancer in a biological system, comprising: introducing into the biological system a tRNA-derived polynucleotide comprising a sequence that is at least 70, 80, 90 or 95% complementary to an intron region of a target gene associated with cancer or a long non-coding RNA associated with cancer, wherein the tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment (tsRNA) having 14 to 35 nucleotides, and the tRNA contains a stem-loop / hairpin. A method comprising the above.

14. The method according to claim 13, wherein the biological system is selected from eukaryotic cells, such as mammalian cells or plant cells.

15. The method according to claim 13 or 14, further comprising introducing into the biological system an enzyme that cleaves tRNA to produce tsRNA.

16. The method according to claim 15, wherein the enzyme is Dicer.

17. The method according to any one of claims 13 to 16, further comprising introducing the tRNA-derived polynucleotide into the nucleus of the cell.

18. The method according to any one of claims 13 to 17, further comprising introducing into the biological system an enzyme that transports the tRNA-derived polynucleotide into the nucleus.

19. The method according to claim 18, wherein the enzyme comprises Argonaute 2 (Ago2).

20. An in vitro or ex vivo method for mediating target-specific RNA interference, comprising: introducing into the biological system a tRNA-derived polynucleotide comprising a sequence that is at least 70, 80, 90 or 95% complementary to an intron region of a target gene associated with cancer or a long non-coding RNA associated with cancer, wherein the tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment (tsRNA) having 14 to 35 nucleotides, and the tRNA contains a stem-loop / hairpin structure. A method comprising the above.

Images