Virus compositions with enhanced specificity in the brain

Engineered rAAV capsids using M-CREATE enhance specificity and transduction efficiency in the central nervous system, addressing non-specific tropisms and off-target effects in brain cell types and organs like the liver.

JP2025106514APending Publication Date: 2025-07-15CALIFORNIA INST OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2025065562
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-04-11
Filing Date
2025-04-11
Publication Date
2025-07-15

AI Technical Summary

Technical Problem

Existing recombinant adeno-associated virus (rAAV) serotypes face limitations in specifically targeting distinct brain cell types upon systemic delivery, leading to non-specific tropisms and off-target effects, particularly when crossing the blood-brain barrier, necessitating higher viral dosages for therapeutic efficacy.

Method used

The development of recombinant AAV capsids engineered through the multiplexed Cre-recombinase-based AAV target evolution (M-CREATE) method, introducing mutations into the capsid protein sequence, enhances specificity and transduction efficiency in the central nervous system while reducing off-target effects in organs like the liver.

Benefits of technology

The engineered rAAV capsids demonstrate improved transduction efficiency and specificity for target brain cell types, reducing off-target effects and potentially lowering required viral dosages for therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025106514000040
    Figure 2025106514000040
  • Figure 2025106514000041
    Figure 2025106514000041
  • Figure 2025106514000042
    Figure 2025106514000042
Patent Text Reader

Abstract

To provide virus compositions with enhanced specificity in the brain.SOLUTION: There are provided compositions and kits comprising recombinant adeno-associated viruses (rAAVs) with tropisms showing increased specificity and enhanced efficiency of viral transduction in targeted cell-types, for example, the brain and the liver. Therapeutic and biomedical research applications of the rAAVs are also described, including without limitation, methods of discovering rAAVs using a multiplexed Cre recombination-based AAV targeted evolution (M-CREATE) method, and methods of treating various diseases and conditions by rAAV-mediated transgene therapy.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Related Applications This application claims the benefit and priority of U.S. Provisional Patent Application No. 62 / 832,836, filed on April 11, 2019, the content of which is hereby incorporated by reference in its entirety. Description of Research Funded by the Federal Government

[0002] This invention was made with government support under grants NS087949, MH117069, and OD025535 awarded by the National Institutes of Health. The government has certain rights in this invention.

Background Art

[0003] Recombinant adeno-associated virus (rAAV) has been widely used as a vector for gene delivery in basic science research and therapeutic applications due to its ability to transduce both dividing and non-dividing cells, its long-term persistence as episomal DNA in infected cells, and its low immunogenicity. Because of these characteristics, rAAV is attractive for applications in basic science as well as in the clinic, such as gene therapy. However, there is a need to significantly improve the performance of existing serotypes to specifically target distinct brain cell types upon systemic delivery to a subject. This need is particularly acute when AAV has to cross the blood-brain barrier (BBB) to reach the central nervous system (CNS).

[0004] Systemic delivery of existing AAV serotypes is limited to transduction of certain cell types and organs, indicating non-specific overlapping tropisms in other cell types and organs. This presents several troublesome issues in the context of gene therapy applications, including, but not limited to, off-target effects resulting from transduction of unaffected organs and cell types (notably, the liver), and the need for higher viral dosages to achieve sufficient therapeutic levels in the target tissue or organ.

Summary of the Invention

Means for Solving the Problem

[0005] Iterative positive and negative selection rounds are used to generate variants with increased specificity and transduction efficiency when measured in the CNS, and in some cases, decreased specificity and transduction efficiency in off-target environments such as the liver, and to confer specificity on the capsid structure. The rAAV disclosed herein achieves broad transduction into target environments (e.g., target cell types or tissues) in a subject upon systemic delivery (e.g., intravenous injection).

[0006] Also provided is a method of engineering the rAAV of the present disclosure using the multiplexed Cre recombinase-based AAV target evolution (M-CREATE) method. The M-CREATE method results in enhanced transduction efficiency and / or specificity by (1) introducing mutations into the capsid protein sequence, (2) unbiased in vivo selection and recovery of only variants that migrate into a defined cell population, (3) crossing the cell membrane, (4) migrating into the nucleus, and (5) unpacking and expressing their gene dosage. Variant capsids exhibiting the most desirable tropism (e.g., enhanced efficiency and specificity for a particular in vivo environment) are recovered and identified by deep sequencing. Strategies for unbiased selection and analysis include determining the enrichment score of a variant (by normalizing the target tissue library to the starting virus library) and determining unbiased propagation (where each variant is equally represented) between selection rounds through synthetic library construction. Also disclosed is a detailed characterization of the library obtained from sequencing data that provides useful insights into the selection of variants for a target.

[0007] An AAV capsid library generated using M-CREATE is disclosed herein. A first library, a 7-mer peptide insertion in AAV9 (7-mer-i library), was constructed for parallel in vivo selection across different brain cell types - endothelial cells, neurons, and astrocytes - and a large pool of AAV9 variants with enhanced ability to target, as well as cross, the blood-brain barrier (BBB) and widely transduce the central nervous system (CNS) was obtained. A second library, a 3-mer peptide substitution in AAV-PHP.B (3-mer-s library), was re-investigated by incorporating deep sequencing to recover the capsids. A pool of AAV-PHP.B variants containing variants that transduce CNS neurons with greater specificity was discovered. The rAAV of the present disclosure can efficiently target variants that can widely transduce endothelial cells of the blood-brain barrier, variants that can widely transduce different cell types in the central nervous system, and variants that can exhibit greater specificity towards transduction into neurons.

[0008] Aspects disclosed herein provide an AAV capsid comprising an AAV capsid protein, which, when systemically delivered to a subject, is characterized by at least one of an increase in specificity and an improvement in transduction efficiency as measured in the central nervous system (CNS) of the subject, compared to the native AAV capsid protein provided in SEQ ID NO: 1. The AAV capsid protein comprises: (a) (i) a first amino acid sequence that is at least 98% identical to amino acids 217 to 736 of SEQ ID NO: 1; and (ii) a second amino acid sequence that is at least 57.1% identical to the amino acid sequence provided in Tables 2-3 or Figure 33 inserted at positions 588_589 within SEQ ID NO: 1. In some embodiments, the second amino acid sequence is at least 71.4% identical to the amino acid sequence provided in Tables 2-3 or Figure 33. In some embodiments, the second amino acid sequence is at least 86.7% identical to the amino acid sequence provided in Tables 2-3 or Figure 33. In some embodiments, the second amino acid sequence is selected from the group consisting of TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, SIERPFK, RYQGDSV, and TTLKPFS. In some embodiments, the AAV capsid protein is present in the VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into the AAV capsid. In some embodiments, the CNS comprises cell types selected from the group consisting of neurons, oligodendrocytes, astrocytes, and cerebrovascular cells. In some embodiments, the CNS comprises tissues selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord. In some embodiments, the AAV capsid protein further comprises the amino acid substitution A587D. In some embodiments, the AAV capsid protein further comprises the amino acid substitution Q588G. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising A589N. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising Q590P.In some embodiments, the second amino acid sequence at positions 588_589 of the amino acid sequence of SEQ ID NO: 1 is not TLAVPFK, not KFPVALT, not SVSKPFL, not FTLTTPK, not MNATKNV, not NGGTSSS, not TRTNPEA, and not YTLSQGW. In some embodiments, the AAV capsid is isolated and purified. In some embodiments, the AAV capsid is formulated as a pharmaceutical preparation for intravenous administration for treating a liver disease or condition, and this pharmaceutical preparation further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0009] Aspects disclosed herein provide an AAV capsid comprising an AAV capsid protein that includes a 7 - amino acid insert (X1 - X2 - X3 - X4 - X5 - X6 - X7) between amino acid 588 and amino acid 589 in the amino acid sequence of the AAV capsid protein provided in SEQ ID NO:1, wherein X1 is an amino acid selected from the group consisting of E, D, G, R, S, and T. In some embodiments, X2 is an amino acid selected from the group consisting of A, G, I, L, M, N, Q, T, and Y. In some embodiments, X3 is an amino acid selected from the group consisting of E, K, L, T, and Q. In some embodiments, X4 is an amino acid selected from the group consisting of G, I, K, L, R, T, and V. In some embodiments, X5 is an amino acid selected from the group consisting of A, D, G, P, L, Q, and V. In some embodiments, X6 is an amino acid selected from the group consisting of F, K, N, P, Q, S, and V. In some embodiments, X7 is an amino acid selected from the group consisting of I, K, L, P, and V. In some embodiments, the 7 - amino acid insert is selected from the group consisting of TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, SIERPFK, RYQGDSV, and TTLKPFS. In some embodiments, the AAV capsid protein is present in VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into an AAV capsid. In some embodiments, the AAV capsid protein, when measured in the central nervous system (CNS) of a subject when systemically delivered to the subject, is characterized by at least one of an increase in specificity and an improvement in transduction efficiency compared to the native AAV capsid protein provided in SEQ ID NO:1. In some embodiments, the CNS includes cell types selected from the group consisting of neurons, glial cells, oligodendrocytes, ependymal cells, astrocytes, Schwann cells, satellite cells, and enteric glial cells. In some embodiments, the CNS includes tissues selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord.In some embodiments, the AAV capsid protein further comprises an amino acid substitution that includes A587D. In some embodiments, the AAV capsid protein further comprises an amino acid substitution that includes Q588G. In some embodiments, the AAV capsid protein further comprises an amino acid substitution that includes A589N. In some embodiments, the AAV capsid protein further comprises an amino acid substitution that includes Q590P. In some embodiments, the 7-amino acid insert is not TLAVPFK, KFPVALT, SVSKPFL, FTLTTPK, MNATKNV, NGGTSSS, TRTNPEA, or YTLSQGW. In some embodiments, the AAV capsid is isolated and purified. In some embodiments, the AAV capsid is formulated as a pharmaceutical preparation for intravenous administration for treating a liver disease or condition, and the pharmaceutical preparation further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0010] Aspects provided herein include an AAV capsid comprising an AAV capsid protein that, when systemically delivered to a subject and measured in the subject's liver, is characterized by at least one of an increase in specificity and an improvement in transduction efficiency compared to the native AAV capsid protein provided by SEQ ID NO: 1, the AAV capsid protein comprising: (a) (i) a first amino acid sequence that is at least 98% identical to amino acids 217 to 736 of SEQ ID NO: 1; and (ii) a second amino acid sequence that is at least 57.1% identical to the amino acid sequence provided in Table 4 or FIG. 35 at positions 588_589 within SEQ ID NO: 1. In some embodiments, the second amino acid sequence is at least 71.4% identical to the amino acid sequence provided in Table 4 or FIG. 35. In some embodiments, the second amino acid sequence is at least 86.7% identical to the amino acid sequence provided in Table 4 or FIG. 35. In some embodiments, the second amino acid sequence is selected from the group consisting of KAYSVQV, PSGSARS, and RTANALG. In some embodiments, the AAV capsid protein is present in the VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into the AAV capsid. In some embodiments, the AAV capsid is isolated and purified. In some embodiments, the AAV capsid is formulated as a pharmaceutical preparation for intravenous administration for treating a liver disease or condition, the pharmaceutical preparation further comprising a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0011] Aspects disclosed herein provide an AAV capsid protein comprising: (i) a first amino acid sequence that is at least 98% identical to amino acids 217 to 736 of SEQ ID NO: 1; and (ii) a second amino acid sequence that is at least 57.1% identical to the amino acid sequence provided in Tables 2-3 or Figure 33 inserted at positions 588_589 within SEQ ID NO: 1, wherein when systemically delivered to a subject and measured in the central nervous system (CNS) of the subject, it is characterized by at least one of an increase in specificity and an improvement in transduction efficiency compared to the native AAV capsid protein provided in SEQ ID NO: 1. In some embodiments, the second amino acid sequence is at least 71.4% identical to the amino acid sequence provided in Tables 2-3 or Figure 33. In some embodiments, the second amino acid sequence is at least 86.7% identical to the amino acid sequence provided in Tables 2-3 or Figure 33. In some embodiments, the second amino acid sequence is selected from the group consisting of TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, SIERPFK, RYQGDSV, and TTLKPFS. In some embodiments, the AAV capsid protein is present in VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into an AAV capsid. In some embodiments, the CNS comprises cell types selected from the group consisting of neurons, oligodendrocytes, astrocytes, and cerebrovascular cells. In some embodiments, the CNS comprises tissues selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord. In some embodiments, the AAV capsid protein further comprises the amino acid substitution A587D. In some embodiments, the AAV capsid protein further comprises the amino acid substitution Q588G. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising A589N. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising Q590P.In some embodiments, the second amino acid sequence at positions 588_589 of the amino acid in SEQ ID NO: 1 is not TLAVPFK, not KFPVALT, not SVSKPFL, not FTLTTPK, not MNATKNV, not NGGTSSS, not TRTNPEA, and not YTLSQGW. In some embodiments, the AAV capsid protein is isolated and purified. In some embodiments, the AAV capsid protein is formulated as a pharmaceutical preparation for intravenous administration for treating liver diseases or conditions, and this pharmaceutical preparation further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0012] Aspects disclosed herein provide an AAV capsid protein comprising a 7 - amino acid insert (X1 - X2 - X3 - X4 - X5 - X6 - X7) between amino acid 588 and amino acid 589 in the amino acid sequence of the AAV capsid protein provided by SEQ ID NO:1, wherein X1 is an amino acid selected from the group consisting of E, D, G, R, S, and T. In some embodiments, X2 is an amino acid selected from the group consisting of A, G, I, L, M, N, Q, T, and Y. In some embodiments, X3 is an amino acid selected from the group consisting of E, K, L, T, and Q. In some embodiments, X4 is an amino acid selected from the group consisting of G, I, K, L, R, T, and V. In some embodiments, X5 is an amino acid selected from the group consisting of A, D, G, P, L, Q, and V. In some embodiments, X6 is an amino acid selected from the group consisting of F, K, N, P, Q, S, and V. In some embodiments, X7 is an amino acid selected from the group consisting of I, K, L, P, and V. In some embodiments, the 7 - amino acid insert is selected from the group consisting of TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, SIERPFK, RYQGDSV, and TTLKPFS. In some embodiments, the AAV capsid protein is present in VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into an AAV capsid. In some embodiments, the AAV capsid protein, when measured in the central nervous system (CNS) of a subject upon systemic delivery to the subject, is characterized by at least one of an increase in specificity and an improvement in transduction efficiency as compared to the native AAV capsid protein provided by SEQ ID NO:1. In some embodiments, the CNS comprises cell types selected from the group consisting of neurons, glial cells, oligodendrocytes, ependymal cells, astrocytes, Schwann cells, satellite cells, and enteric glial cells. In some embodiments, the CNS comprises tissues selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising A587D.In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising Q588G. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising A589N. In some embodiments, the AAV capsid protein further comprises an amino acid substitution comprising Q590P. In some embodiments, the 7-amino acid insert is not TLAVPFK, nor KFPVALT, nor SVSKPFL, nor FTLTTPK, nor MNATKNV, nor NGGTSSS, nor TRTNPEA, nor YTLSQGW. In some embodiments, the AAV capsid protein is isolated and purified. In some embodiments, the AAV capsid protein is formulated as a pharmaceutical preparation for intravenous administration for treating a liver disease or condition, and the pharmaceutical preparation further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0013] Aspects provided herein include: (i) a first amino acid sequence that is at least 98% identical to amino acids 217 to 736 of SEQ ID NO: 1; and (ii) a second amino acid sequence that is at least 57.1% identical to the amino acid sequence provided in Table 4 or FIG. 35 at positions 588_589 within SEQ ID NO: 1. When measured in the liver of a subject upon systemic delivery to the subject, the AAV capsid protein is characterized by at least one of an increase in specificity and an improvement in transduction efficiency as compared to the native AAV capsid protein provided in SEQ ID NO: 1. In some embodiments, the second amino acid sequence is at least 71.4% identical to the amino acid sequence provided in Table 4 or FIG. 35. In some embodiments, the second amino acid sequence is at least 86.7% identical to the amino acid sequence provided in Table 4 or FIG. 35. In some embodiments, the second amino acid sequence is selected from the group consisting of KAYSVQV, PSGSARS, and RTANALG. In some embodiments, the AAV capsid protein is present in VP1, VP2, and VP3 of the AAV capsid. In some embodiments, the AAV capsid is chimeric. In some embodiments, 60 copies of the AAV capsid protein are assembled into an AAV capsid. In some embodiments, the AAV capsid protein is isolated and purified. In some embodiments, the AAV capsid protein is formulated as a pharmaceutical preparation for intravenous administration for treating a liver disease or condition, and the pharmaceutical preparation further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical preparation further comprises a therapeutic agent.

[0014] Aspects disclosed herein include plasmid vectors comprising nucleic acid sequences encoding the AAV capsids and AAV capsid proteins described herein. In some cases, the plasmid vector is bacterial. In some cases, the plasmid vector is derived from Escherichia coli. In some cases, the nucleic acid sequence comprises, in the 5' to 3' direction, (1) a 5' inverted terminal repeat (ITR) sequence, (2) a replication (Rep) gene, (3) a capsid (Cap) gene, and (4) a 3' ITR, wherein the Cap gene encodes an AAV capsid protein described herein. In some cases, the plasmid vector encodes a pseudotyped AAV capsid protein. In some cases, the Cap gene is derived from a deoxyribonucleic acid (DNA) provided by any one of SEQ ID NOs: 6-10. In some cases, the nucleic acid sequence comprising the Cap gene is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the DNA sequences provided in U.S. Patent Application No. 16 / 582,635, which is incorporated herein by reference. In some cases, the 5' ITR and the 3' ITR are derived from the AAV2 serotype. In some cases, the 5' ITR and the 3' ITR are derived from the AAV5 serotype. In some cases, the 5' ITR and the 3' ITR are derived from the AAV9 serotype.

[0015] Aspects disclosed herein provide a method of treating a disease or condition in a subject, the method comprising administering a therapeutically effective amount of a pharmaceutical formulation comprising an AAV capsid protein or AAV capsid of the present disclosure. In some embodiments, the disease or condition is a disease or condition of the subject's central nervous system (CNS) or liver. In some embodiments, the liver disease or condition is selected from the group consisting of Alagille syndrome, alcohol-related liver disease, alpha-1 antitrypsin deficiency, autoimmune hepatitis, benign liver tumor, biliary atresia, cirrhosis, Crigler-Najjar syndrome, galactosemia, Gilbert syndrome, hemochromatosis, hepatic encephalopathy, hepatitis A, hepatitis B, hepatitis C, hepatorenal syndrome, intrahepatic cholestasis of pregnancy (ICP), lysosomal acid lipase deficiency (LAL-D), liver cysts, liver cancer, neonatal jaundice, non-alcoholic fatty liver disease, primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), Reye syndrome, type I glycogenosis, and Wilson disease. In some embodiments, the CNS disease or condition is septum pellucidum defect, acid lipase disease, acid maltase deficiency, acquired aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Adie pupil, Adie syndrome, adrenoleukodystrophy, agenesis of the corpus callosum, agnosia, Aicardi syndrome, Aicardi-Goutières syndrome disorder, AIDS-neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angelman syndrome, angiomatosis, anoxia, antiphospholipid antibody syndrome, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger syndrome, ataxia, ataxia telangiectasia, ataxia and cerebellar or spinocerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic neuropathy, back pain, Barth syndrome, Batten disease, Becker type muscular dystrophy, Behçet's disease, Bell palsy, benign essential blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhardt-Roth syndrome, Binswanger disease, blepharospasm, Bloch-Sulzberger syndrome, birth brachial plexus injury, brachial plexus injury, Bradberry-Eggleston syndrome, brain and spinal cord tumors, brain aneurysm, brain injury, Brown-Séquard syndrome, bulbospinal muscular atrophy,Autosomal dominant cerebral arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, causalgia, cabernoma, cavernous hemangioma, cavernous malformation, central cord syndrome, central spinal cord syndrome, central pain syndrome, central pontine myelinolysis, cranial injury, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral beriberi, cerebral cavernous malformation, cerebral gigantism, hypoxic encephalopathy, cerebral palsy, cerebro-oculo-facio-skeletal syndrome (COFS), Charcot-Marie-Tooth disease, Charcot-Marie-Tooth syndrome, classical rhizomelic chondrodysplasia punctata (RCDP), Chiari malformation, cholesterol ester storage disease, chorea, acanthocytic chorea, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, cocaine syndrome type II, Coffin-Lowry syndrome, corpora quadrigemina, coma, complex regional pain syndrome, congenital facial diplegia, congenital myasthenia, congenital myopathy, congenital cavernous malformation, corticobasal degeneration, cranial arteritis, craniosynostosis, Creutzfeldt-Jakob disease, cumulative traumatic disorder, Cushing syndrome, cytomegalovirus infection, dancing eyes-dancing feet syndrome, Dandy-Walker syndrome, Dawson disease, deafness, dystonia syndrome, Dejerine-Klumpke paralysis, dementia, multi-infarct dementia, semantic dementia, subcortical dementia, Lewy body dementia, dentatorubral atrophy, dermatomyositis, developmental apraxia, Devic syndrome, diabetic neuropathy, disseminated sclerosis, Dravet syndrome, Duchenne muscular dystrophy, autonomic neuropathy, dysgraphia, dyslexia, dysphagia, dyspraxia, myoclonic cerebellar ataxia, progressive cerebellar ataxia, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalitis lethargica, cerebral hernia, encephalopathy, encephalopathy (familial neonatal), cerebrotrigeminal angiomatosis, epilepsy, epileptic hemiplegia, Erb paralysis, Erb-Duchenne and Dejerine-Klumpke paralysis, essential tremor, extrapontine myelinolysis, Fabry disease, Fahr syndrome, absence, familial dysautonomia, familial angioma, familial idiopathic basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Farber disease, febrile convulsion, fibromuscular dysplasia,Fisher syndrome, hypotonic child syndrome, drop foot, Friedrich ataxia, frontotemporal dementia, Gaucher disease, generalized gangliosidosis, Gerstmann syndrome, Gerstmann-Straussler-Scheinker disease, giant axonal neuropathy, giant cell arteritis, giant cell inclusion disease, glioblastoma, globoid cell leukodystrophy, glossopharyngeal neuralgia, glycogenosis, Guillain-Barre syndrome, Hallervorden-Spatz disease, head injury, headache, persistent unilateral headache, hemifacial spasm, Hemiplegia Alterans, hereditary neuropathy, hereditary spastic paraplegia, polyneuropathy type hereditary ataxia, herpes zoster, Ramsay Hunt syndrome, Hirayama syndrome, Holmes-Adie syndrome, holoprosencephaly, HTLV-1 associated myelopathy, Hughes syndrome, Huntington disease, hydranencephaly, hydrocephalus, normal pressure hydrocephalus, syringomyelia, hyperadrenocorticism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, pediatric hypotonia, infantile neuroaxonal dystrophy, infantile phytanic acid storage disease, infantile Refsum disease, infantile spasms, inflammatory myopathy, foramen magnum encephalocoele, intestinal lipodystrophy, intracranial cyst, intracranial hypertension, Isaac syndrome, Joubert syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsbourne syndrome, Kleine-Levin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüver-Bucy syndrome, Korsakoff amnestic syndrome, Krabbe disease, Kugelberg-Welander disease, Kuru disease, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral medullary syndrome, learning disability, Leigh disease, Lennox-Gastaut syndrome, Lesch-Nyhan syndrome, leukodystrophy, Levin-Critchley syndrome, Lewy body dementia, lipid storage disease, lipoid proteinosis, lissencephaly, locked-in syndrome, Lou Gehrig disease, lupus-neurological sequelae, Lyme disease-neurological complications, Machado-Joseph disease, encephalopathy, megalencephaly, Melkersson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes disease, abnormal sensory femoral neuralgia, metachromatic leukodystrophy, microcephaly, migraine, Miller Fisher syndrome, mild stroke, mitochondrial myopathy, Möbius syndrome, unilateral muscular atrophy, motor neuron diseaseMoyamoya disease, mucolipidosis, mucopolysaccharidoses, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, congenital myasthenia, myasthenia gravis, diffuse myeloablative sclerosis, myoclonic encephalopathy of infantile period, myoclonus, myopathy, congenital myopathy, thyrotoxic myopathy, myotonia, myotonia congenital, narcolepsy, neuroacanthocytosis, neurodegeneration with intracerebral iron deposition, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, cytomegalovirus (HIV)-associated neurodegeneration, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, cytomegalovirus (HIV)-associated neurodegeneration, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, cytomegalovirus (HIV)-associated neurodegeneration, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, cytomegalovirus (CYP ... Neurological outcome of Gallovirus infection, Neurological manifestations of Pompe disease, Neurological sequelae of lupus, Neuromyelitis optica, Neuromyotonia, Neuronal ceroid lipofuscinosis, Neuronal migration disorder, Hereditary neuropathies, Neurosarcoidosis, Neurosyphilis, Neurotoxicity, Cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, Occipital neuralgia, Ohtahara syndrome, Olivopontocerebellar atrophy, Opsoclonus-myoclonus, Orthostatic hypotension, Overuse syndrome, Chronic pain, Pantothenate kinase-related neurodegeneration, Paraneoplastic syndromes, Dysesthesias, Parkinson's disease, Paroxysmal choreoathetosis , paroxysmal hemicrania, Parry-Romberg, Pelizaeus-Merzbacher disease, Pena-Shocker syndrome type II, radicular cyst, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorder, phytanic acid storage disease, Pick's disease, compressed nerve, piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, porencephaly, post-polio syndrome, post-herpetic neuralgia, post-infectious encephalomyelitis, postural hypotension, postural orthostatic tachycardia syndrome, postural orthostatic tachycardia syndrome, primary dentate atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive facial hemimelia, progressive gait disorder Ataxia, progressive multifocal leukoencephalopathy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, prosopagnosia, pseudo-Torch syndrome, pseudo-toxoplasmosis syndrome, pseudotumor cerebri, psychogenic movement syndrome, Ramsay Hunt syndrome type I, Ramsay Hunt syndrome type II, Rasmussen encephalitis, reflex sympathetic dystrophy syndrome, Refsum disease, infantile Refsum disease, repetitive movement disorder, repetitive strain injury, restless legs syndrome, retrovirus-associated myelopathy, Rett syndrome, Reye syndrome, rheumatic encephalitis, Riley-Day syndrome, sacral root cyst, St. Vitus chorea, salivary gland disease,Sandhoff disease, Schilder's disease, split-brain syndrome, Zitelberger's disease, paroxysmal disorders, semantic dementia, septo-optic dysplasia, severe myoclonic epilepsy in infancy (SMEI), shaken baby syndrome, herpes zoster, Shy-Drager syndrome, Sjögren's syndrome, sleep apnea, sleeping sickness, Sotos syndrome, spasm, diploscoliosis, spinal cord infarction, spinal cord injury, spinal cord tumor, spinal muscular atrophy, spinocerebellar atrophy, spinocerebellar degeneration, Steele-Richardson-Olszewski syndrome, stiff-person syndrome, striatonigral degeneration, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subcortical arteriosclerotic encephalopathy, short-lasting unilateral neuralgiform (SUNCT) headache, dysphagia, Sydenham chorea, absence, syphilitic myelosclerosis, syringomyelia, syringohydromyelia, systemic lupus erythematosus, spinal gangrene, tardive dyskinesia, Tarui cyst, Tay-Sachs disease, temporal arteritis, tethered cord syndrome, Tommasen myotonia, thoracic outlet syndrome, thyrotoxic myopathy, painful tic, Todd paralysis, Tourette syndrome, transient ischemic attack, transmissible hereditary spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraparesis, Troyer syndrome, tuberous sclerosis, vascular erectile tumor, vasculitic syndromes of the central and peripheral nervous systems, von Economo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Werdnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, infantile spasms, Whipple's disease, Williams syndrome, Wilson's disease, Wolman disease, and X-linked bulbospinal muscular atrophy, and is selected from the group consisting of. In some embodiments, the pharmaceutical formulation comprises a therapeutic nucleic acid encoding a therapeutic gene expression product. In some cases, the therapeutic gene expression product is sarcoglycan alpha (SGCA), glutamic acid decarboxylase 65 (GAD65), glutamic acid decarboxylase 67 (GAD67), CLN2, nerve growth factor (NGF), survival motor neuron 1, telomeric (SMN1), factor X (FIX), retinoid isomerohydrolase (RPE65), sarcoplasmic / endoplasmic reticulum Ca2+-ATPase (SERCA2a), beta-glucocerebrosidase (GCase), frataxin (FXN), huntingtin (HTN), methyl-CpG-binding protein 2 (MECP2), peroxisome biogenesis factor (PEX),Effective for modulating the activity or expression of a target gene or gene expression product selected from the group consisting of progranulin (GRN), antitubulin agents, copper-zinc superoxide dismutase (SOD1), glucosylceramidase beta (GBA), NPC intracellular cholesterol transporter 1 (NPC1), and NLRP3 inflammasome. . In some cases, the therapeutic gene expression product comprises a gene editing component. In some cases, the gene editing component is selected from the group consisting of small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), artificial site-specific RNA endonuclease (ASRE), zinc finger endonuclease (ZFN), CRISPR / Cas, and transcription activator-like effector nuclease (TALEN).

[0016] Aspects disclosed herein are methods of producing recombinant AAV particles from the AAV capsids of the present disclosure, comprising: (a) introducing into a cell a nucleic acid comprising: (i) a first nucleic acid sequence encoding a therapeutic gene expression product; (ii) a second nucleic acid sequence encoding a recombinant viral genome comprising a capsid (Cap) gene modified to express the AAV capsid of the present disclosure; and (iii) a third nucleic acid sequence encoding an AAV helper virus genome; and (b) assembling recombinant AAV particles comprising the AAV capsid encapsulating the first nucleic acid.

[0017] Aspects disclosed herein include the steps of: (a) introducing into a cell a nucleic acid comprising: (i) a first nucleic acid sequence encoding a therapeutic gene expression product flanked by 5' and 3' inverted terminal repeat (ITR) sequences; (ii) a second nucleic acid sequence encoding a viral genome comprising a 5' ITR sequence, a replication (Rep) gene, a capsid (Cap) gene, and a 3' ITR, wherein the Cap gene encodes an AAV capsid protein as described herein; and (iii) a third nucleic acid sequence encoding a first helper virus protein selected from the group consisting of E4orf6, E2a, and VA RNA, and optionally encoding a second helper virus protein comprising E1a or E1b55k; (b) expressing in the cell an AAV capsid protein as described herein; (c) assembling AAV particles comprising the AAV capsid protein disclosed herein; and (d) packaging the first nucleic acid sequence into the AAV particles. In some cases, the cell is a mammalian cell. In some cases, the cell is an immortalized cell. In some cases, the immortalized cell is an embryonic stem cell. In some cases, the embryonic stem cell is a human embryonic stem cell. In some cases, the human embryonic stem cell is a human fetal kidney 293 (HEK-293) cell. In some cases, the Cap gene is derived from a deoxyribonucleic acid (DNA) provided by any one of SEQ ID NOs: 6-10. In some cases, the nucleic acid sequence comprising the Cap gene is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the DNA sequences provided in U.S. Patent Application No. 16 / 582,635, which is incorporated herein by reference. In some cases, the 5' ITR and the 3' ITR are derived from the AAV2 serotype. In some cases, the 5' ITR and the 3' ITR are derived from the AAV5 serotype. In some cases, the 5' ITR and the 3' ITR are derived from the AAV9 serotype. In some cases, the first nucleic acid sequence and the second nucleic acid sequence are in a trans relationship. In some cases, the first nucleic acid sequence and the second nucleic acid sequence are in a cis relationship. In some cases, the first nucleic acid sequence, the second nucleic acid sequence, and the third nucleic acid sequence are in a trans relationship.

[0018] Aspects disclosed herein are methods of producing recombinant AAV particles, comprising: (a) (i) preparing a recombinant AAV genome comprising an AAV capsid gene and (ii) a recognition sequence for Cre recombinase that promotes a recombinase-dependent change that is detectable and that comprises two Cre recognition sites; (iii) transfecting the recombinant AAV genome into a population of cells that express Cre recombinase, whereby the Cre recombinase induces a recombination event to effect a recombinase-dependent change in the recombinant AAV genome, the recombinase-dependent change comprising an inversion of a sequence adjacent to the Cre recognition site; (iv) detecting an increase in the rate of recombinase-dependent change in target cells in the population of cells; (v) detecting a decrease in the rate of recombinase-dependent change in non-target cells in the population of cells; and (vi) identifying a recombinant AAV genome produced by the recombinase-dependent change, the identified rAAV genome comprising an inversion, the identified recombinant AAV genome having an increased specificity for target cells and a decreased specificity for non-target cells, which encodes AAV capsid particles. In some embodiments, the non-target cells are hepatocytes. In some embodiments, the target cells are cells selected from the group consisting of neurons, glial cells, oligodendrocytes, ependymal cells, astrocytes, Schwann cells, satellite cells, and enteric glial cells.

[0019] Aspects disclosed herein provide a kit comprising: (a) a first vector comprising a recombinant vector of the present disclosure; (b) a second vector encoding helper virus proteins; and (c) a third vector comprising a therapeutic nucleic acid encoding a therapeutic gene expression product.

[0020] Aspects disclosed herein provide a kit comprising: (a) a first vector comprising a first nucleic acid sequence encoding a viral genome, wherein the viral genome comprises, in the 5' to 3' direction, (i) a 5' inverted terminal repeat (ITR) sequence, (ii) a replication (Rep) gene, (iii) a capsid (Cap) gene encoding an AAV capsid protein described herein, and (iv) a 3' ITR; and (b) optionally, a second vector comprising a second nucleic acid sequence encoding a helper viral protein comprising at least one of E4orf6, E2a, VA RNA, E1a, and E1b55k. In some cases, the kit further comprises cells. In some cases, the cells are mammalian cells. In some cases, the cells are immortalized cells. In some cases, the immortalized cells are embryonic stem cells. In some cases, the embryonic stem cells are human embryonic stem cells. In some cases, the human embryonic stem cells are human fetal kidney 293 (HEK-293) cells. In some cases, the kit further comprises an AAV vector comprising a heterologous nucleic acid encoding a therapeutic gene expression product. In some cases, the AAV vector is episomal. Incorporation by reference

[0021] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0022] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained by reference to the following detailed description that illustrates exemplary embodiments in which the principles of the invention are utilized and the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0023]

Figure 1

[0024]

Figure 2

[0025]

Figure 3

[0026]

Figure 4

[0027]

Figure 5

[0028]

Figure 6

[0029]

Figure 7

[0030]

Figure 8

[0031]

Figure 9

[0032]

Figure 10

[0033]

Figure 11

[0034]

Figure 12

[0035]

Figure 13

[0036]

Figure 14

[0037]

Figure 15

[0038]

Figure 16

[0039]

Figure 17

[0040]

Figure 18

[0041]

Figure 19

[0042]

Figure 20-1

Figure 20-2

[0043]

Figure 21

Figure 22

Figure 23

[0044]

Figure 24

[0045]

Figure 25

[0046]

Figure 26

[0047]

Figure 27

[0048]

Figure 28

[0049]

Figure 29-1

Figure 29-2

[0050]

Figure 30

[0051]

Figure 31

[0052]

Figure 32

[0053]

Figure 33-1

Figure 33-2

Figure 33-3

Figure 33-4

Figure 33-5

Figure 33-6

Figure 33-7

Figure 33-8

Figure 33-9

Figure 33-10

Figure 33-11

Figure 33-12

Figure 33-13

Figure 33-14

Figure 33-15

Figure 33-16

Figure 33-17

Figure 33-18

Figure 33-19

Figure 33-20

Figure 33-21

Figure 33-22

Figure 33-23

Figure 33-24

Figure 33-25

Figure 33-26

Figure 33-27

Figure 33-28

Figure 33-29

Figure 33-30

Figure 33-31

Figure 33-32

Figure 33-33

Figure 33-34

Figure 33-35

Figure 33-36

Figure 33-37

Figure 33-38

Figure 33-39

Figure 33-40

Figure 33-41

Figure 33-42

Figure 33-43

Figure 33-44

Figure 33-45

Figure 33-46

Figure 33-47

Figure 33-48

Figure 33-49

Figure 33-50

Figure 33-51

Figure 33-52

Figure 33-53

Figure 33-54

Figure 33-55

Figure 33-56

Figure 33-57

Figure 33-58

Figure 33-59

Figure 33-60

Figure 33-61

Figure 33-62

Figure 33-63

Figure 33-64

Figure 33-65

Figure 33-66

Figure 33-67

Figure 33-68

Figure 33-69

Figure 33-70

Figure 33-71

Figure 33-72

Figure 33-73

Figure 33-74

Figure 33-75

Figure 33-76

Figure 33-77

Figure 33-78

Figure 33-79

Figure 33-80

Figure 33-81

Figure 33-82

Figure 33-83

Figure 33-84

Figure 33-85

Figure 33-86

Figure 33-87

Figure 33-88

Figure 33-89

Figure 33-90

Figure 33-91

Figure 33-92

Figure 33-93

Figure 33-94

Figure 33-95

Figure 33-96

Figure 33-97

Figure 33-98

Figure 33-99

Figure 33-100

Figure 33-101

Figure 33-102

Figure 33-103

Figure 33-104

Figure 33-105

Figure 33-106

Figure 33-107

Figure 33-108

Figure 33-109

Figure 33-110

Figure 33-111

Figure 33-112

Figure 33-113

Figure 33-114

Figure 33-115

Figure 33-116

Figure 33-117

Figure 33-118

Figure 33-119

Figure 33-120

Figure 33-121

Figure 33-122

Figure 33-123

Figure 33-124

Figure 33-125

Figure 33-126

Figure 33-127

Figure 33-128

Figure 33-129

Figure 33-130

Figure 33-131

Figure 33-132

Figure 33-133

Figure 33-134

Figure 33-135

Figure 33-136

Figure 33-137

Figure 33-138

Figure 33-139

Figure 33-140

Figure 33-141

Figure 33-142

Figure 33-143

Figure 33-144

[0054]

Figure 34-1

Figure 34-2

[0055]

Figure 35-1

Figure 35-2

Figure 35-3

Figure 35-4

[0056]

Figure 36

[0057]

Figure 37

[0058]

Figure 38

[0059]

Figure 39

[0060]

Figure 40

[0061]

Figure 41

[0062]

Figure 42

[0063]

Figure 43

[0064]

Figure 44

[0065]

Figure 45

[0066]

Figure 46

[0067]

Figure 47

[0068]

Figure 48-1

Figure 48-2

[0069]

Figure 49

[0070]

Figure 50

[0071]

Figure 51

[0072]

Figure 52

[0073]

Figure 53-1

Figure 53-2

[0074]

Figure 54

[0075]

Figure 55

[0076]

Figure 56

[0077]

Figure 57

[0078]

Figure 58

[0079]

Figure 59

[0080]

Figure 60

[0081]

Figure 61

[0082]

Figure 62

[0083]

Figure 63

[0084]

Figure 64

[0085]

Figure 65

[0086]

Figure 66

Figure 67

[0087]

Figure 68

[0088]

Figure 69

[0089]

Figure 70

[0090]

Figure 71

[0091]

Figure 72

[0092]

Figure 73

[0093]

Figure 74-1

Figure 74-2

Figure 74-3

Figure 74-4

[0094]

Figure 75-1

Figure 75-2

Figure 75-3

Figure 75-4

Figure 75-5

Figure 75-6

Figure 75-7

Figure 75-8

Best Mode for Carrying Out the Invention

[0095] Preferred examples of the present disclosure have been shown and described herein, but it will be apparent to those skilled in the art that such examples are provided only as examples. Without departing from the present disclosure, a very large number of variations, modifications and substitutions will now occur to those skilled in the art. It should be understood that various alternatives to the examples of the present disclosure described herein can be utilized in practicing the present disclosure. It is intended that the scope of the present disclosure be defined by the following claims, and that methods and structures within the scope of these claims and their equivalents be covered by these claims.

[0096] Provided herein is a modified adeno-associated (AAV) viral capsid composition useful for incorporating a transgene into a target cell or environment (e.g., cell type or tissue) in a subject when the transgene is administered systemically (e.g., intravenously, intranasally) to the subject. The modified AAV capsid proteins of the present disclosure include at least one insertion or substitution of an amino acid in the corresponding parental AAV capsid protein, and these insertions and substitutions result in a desired directionality such as an increase or decrease in specificity compared to the reference AAV capsid protein, or an improvement or decrease in transgene transduction efficiency compared to the reference AAV capsid protein.

[0097] Disclosed herein are AAV capsids that have been engineered to have a desired tropism, such that the specificity of viral transduction into a target in vivo environment, such as tissue or cells, is increased. In some embodiments, the AAV capsids of the present disclosure are engineered to specifically target the central nervous system (CNS) of a subject. In some embodiments, the AAV capsids of the present disclosure are engineered to specifically target the liver of a subject. The AAV capsids can encapsidate a viral vector having a heterologous nucleic acid, such as a heterologous nucleic acid encoding a therapeutic gene expression product. High specific transduction of the heterologous nucleic acid into the target in vivo environment (e.g., brain, liver) can be achieved upon systemic delivery of the AAV capsids of the present disclosure encapsidating the heterologous nucleic acid to a subject. The AAV capsids disclosed herein are advantageous for many applications, such as the diagnosis and / or treatment of monogenetic disorders of the brain (e.g., GLUT1 deficiency syndrome, mucopolysaccharidosis type IIIC), and give rise to applications in adoptive cell therapy and biomedical research. and are useful in many applications such as the diagnosis and / or treatment of monogenetic disorders of the brain (e.g., GLUT1 deficiency syndrome, mucopolysaccharidosis type IIIC), and give rise to applications in adoptive cell therapy and biomedical research.

[0098] The AAV capsids contain AAV capsid proteins (e.g., VP1, VP2, and VP3), and each of these proteins has at least one amino acid insertion or substitution in the amino acids within the 588 loop (AAV9 VP1 numbering) of the parental AAV capsid protein structure. The 588 loop contains the heparan sulfate binding site of AAV2 and is suitable for peptide display. The known receptors for AAV9 are only N-linked terminal galactose and the AAV receptor (AAVR), although much suggests that others exist. Modification of the AAV9 588 loop has been shown herein to result in increased specificity and improved transgene transduction into the target in vivo environment compared to reference AAV in rodent models. In some cases, the parental AAV capsid protein has AAV serotype 9 (also known as AAV9).

[0099] The most common method of AAV vector-mediated gene delivery is by direct injection into the target in vivo environment, which is disadvantageous for many reasons including the risk of injury or death, pain, and higher costs compared to less invasive methods. For example, intracranial injection can cause brain hemorrhage. Prior AAV vector delivery by intravenous administration avoids the need for direct injection but has the drawback of reduced specificity for the target in vivo environment (e.g., tissue or cells), resulting in off-target transduction events and the need for a higher viral load to reach sufficient therapeutic levels in the target in vivo environment. This is particularly pronounced when AAV has to cross the blood-brain barrier (BBB).

[0100] Disclosed is a method comprising the step of systemically administering an AAV capsid of the present disclosure that encapsulates a viral vector containing a transgene (e.g., a therapeutic nucleic acid) with increased specificity compared to a reference AAV capsid protein. The AAV capsids of the present disclosure are capable of crossing the BBB in a subject and transducing the transgene into specific target cell types (e.g., neurons, endothelial cells). Thus, the AAV capsid proteins of the present disclosure are suitable for gene therapy for treating human diseases, particularly diseases that affect the target in vivo environment.

[0101] Also provided herein are transgenes contained in recombinant AAV (rAAV) vectors and transgenes encapsulated within the capsids by the AAV capsid proteins of the present disclosure. The transgenes disclosed herein are delivered to a subject for various purposes, e.g., to treat a disease or condition in the subject. The transgene can be a gene editing component that modulates the activity or expression of a target gene or gene expression product. Alternatively, the transgene is a therapeutic gene expression product that is effective in modulating its own activity or expression, or a gene that encodes another target gene or gene expression product.

[0102] Methods for identifying 7-mer or 3-mer peptide insertions, including multiplexed Cre-recombinase based AAV target evolution (M-CREATE), are provided herein. The M-CREATE method of the present disclosure aids in the calculation of true enrichment scores for each variant by (1) correcting for bias in virus production prior to selection using deep sequencing, (2) reducing the propagation of bias in successive selection rounds by creating a post-synthesis pool library that displays equal variants, (3) reducing false positives by including two codon duplications for each selected variant within the pool, and (4) supporting both positive and negative selection criteria by comparing deep sequencing of the recovered capsid library across multiple targets (cell types or organs). These features enable the confident selection, based on information, of variants worthy of in vivo validation and characterization.

[0103] A method for producing an AAV capsid comprising an AAV capsid protein and a viral vector encoding a therapeutic nucleic acid is disclosed herein. The AAV capsid protein is produced by introducing into a cell (e.g., an immortalized stem cell) a first vector encoding a transgene (e.g., containing a therapeutic nucleic acid) required for assembly of the AAV capsid structure and packaging of the transgene into the AAV capsid, a second vector encoding an AAV genome having the AAV capsid protein, and a third vector encoding a helper virus protein. The assembled AAV capsid can be isolated and purified from the cells using suitable methods known in the art.

[0104] Recombinant AAV vectors comprising nucleic acid sequences encoding the AAV capsid proteins of the present disclosure are also provided herein. For example, the viral vectors of the present disclosure comprise a nucleic acid sequence comprising AAV viral Cap (capsid) encoding VP1, VP2, and VP3, and at least one of VP1, VP2, and VP3 is modified to produce the AAV capsid protein of the present disclosure. The provided recombinant AAV vectors may be derived from an AAV serotype (e.g., AAV9). I. Compositions

[0105] Recombinant adeno-associated virus (rAAV)-mediated gene delivery utilizes the AAV viral transduction mechanism for nuclear expression of episomal heterologous nucleic acids (e.g., transgenes, therapeutic nucleic acids). When delivered to the host in vivo environment, rAAV (1) binds or attaches to cell surface receptors on target cells, (2) undergoes endocytosis, (3) is transported to the nucleus, (4) uncoats the virus to release the heterologous nucleic acid encapsulated within the capsid, (5) converts the heterologous nucleic acid from single-stranded to double-stranded DNA as a template for transcription in the nucleus, and (6) transcribes (``transduces'') the episomal heterologous nucleic acid in the nucleus of the host cell. rAAV engineered to have increased specificity (binding to cell surface receptors on target cells) and improved transduction efficiency (transcription of episomal heterologous nucleic acids within host cells) is desirable for applications in gene therapy.

[0106] rAAV comprises an AAV capsid that can be engineered to encapsulate a heterologous nucleic acid (e.g., a therapeutic nucleic acid, a gene editing mechanism). The AAV capsid is composed of three AAV capsid protein monomers, VP1, VP2, and VP3. Sixty copies of these three VP proteins interact in a ratio of 1:1:10 to form the viral capsid (Figure 2). VP1 encompasses the entire VP2 protein in addition to an approximately 137 amino acid N-terminal region (VP1u), and VP2 encompasses the entire VP3 in addition to an approximately 65 amino acid N-terminal region (VP1 / 2 common region). The three capsid proteins share a conserved amino acid sequence of VP3, which in some cases is the region starting at amino acid position 138 (e.g., AA139-736).

[0107] The AAV VP3 structure contains a highly conserved region common to all serotypes, a core eight-stranded β-barrel motif (βB-βI), and a small α-helix (αA). The loop regions inserted between the β-strands consist of a characteristic HI loop between β-strands H and I, a DE loop between β-strands D and E, and nine variable regions (VRs) that form the top of the loop. These VRs, such as the AA588 loop, are found on the capsid surface and may be related to specific functional roles in the AAV life cycle, including receptor binding, transduction, and antigen specificity.

[0108] Disclosed herein are AAV capsids comprising an AAV capsid protein with a substitution in the 588 loop that provides a desired tropism, characterized by higher specificity for transduction in certain cell types, including higher specificity for brain cell types (e.g., brain endothelial cells, neurons, astrocytes) and liver cell types. Specifically, the AAV capsid proteins disclosed herein enable rAAV-mediated transduction of heterologous nucleic acids (e.g., transgenes) into the brain or liver of a subject. The AAV capsids, or AAV capsid proteins, of the present disclosure can be formulated as a pharmaceutical composition. In addition, the AAV capsids, or AAV capsid proteins, can be isolated and purified for use in various applications. A. Adeno-Associated Virus (AAV) Capsid Protein

[0109] Recombinant AAV (rAAV) capsids comprising AAV capsid proteins engineered using modified capsid proteins (e.g., VP1, VP2, VP3) are disclosed herein. In some embodiments, the rAAV capsid proteins of the disclosure are generated using methods disclosed herein (e.g., M-CREATE). In some embodiments, the AAV capsid proteins are used in methods of delivering a therapeutic nucleic acid (e.g., a transgene) to a subject. In some cases, the rAAV capsid proteins have desirable AAV tropism that makes them particularly suitable for certain therapeutic applications, such as treating diseases or disorders in a subject, such as those disclosed herein.

[0110] rAAV capsid proteins, such as those provided in Tables 2-3 and Figure 33, are engineered for optimization of entry into and via the blood-brain barrier (BBB) of a subject upon systemic administration of rAAV to the subject. Previous AAV-mediated delivery methods of therapeutic transgenes to the brain required intracranial injection. Intracranial injection is an invasive procedure that subjects the subject to discomfort and, in some cases, pain. For example, intracranial injection can cause bleeding in the brain. In addition, intracranial delivery does not spread well and is highly non-uniform. The rAAV capsid proteins provided in Tables 2-4 and Figure 33 are engineered to have tropism that eliminates the need for intracranial injection and, moreover, to achieve broad and efficient transduction of the transgene encapsulated within the capsid. Specifically, tropism includes at least one of increased specificity and improved efficiency (e.g., efficiency of viral transduction) in the central nervous system (CNS) of the subject as compared to a reference AAV.

[0111] The engineered AAV capsid proteins described herein, in some cases, have an insertion of an amino acid that is heterologous to the parental AAV capsid protein at an amino acid position within the 588 loop. In some embodiments, the amino acid is not endogenous to the parental AAV capsid protein at the amino acid insertion position. The amino acid may be an amino acid that naturally occurs at the same or equivalent amino acid position as an insertion or substitution in a different AAV capsid protein.

[0112] Aspects provided herein include a 7 - amino acid polymer (7 - mer) inserted into AA588_589 and may further include amino acid insertions at amino acid positions adjacent to the 7 - mer sequence (e.g., AA587 - 588 and / or AA589 - 590) for producing an 11 - amino acid polymer (11 - mer) in the 588 loop of the parental AAV capsid protein. The 7 - mers described herein, wherein each of the 7 amino acids is encoded by the deoxyribonucleic acid (DNA) sequence N - N - K, were advantageously generated using polymerase chain reaction (PCR) with degenerate primers. "N" is any of the 4 DNA nucleotides and "K" is guanine (G) or thymine (T). This method of generating a random 7 - mer amino acid sequence allows for 1.28 billion possible combinations at the protein level. Since the 7 - mers developed are random, some of the amino acids in the 7 - mer may naturally occur at that amino acid position of the AAC capsid protein, while others may be different.

[0113] Recombinant adeno-associated viruses (rAAVs) were generated that each encapsidate a reporter gene within the capsid and have a unique 7-mer or 11-mer in a 588 loop, enabling the selective amplification and recovery of sequences that effectively transduce the reporter gene into the target in vivo environment of transgenic animals when systemically administered to multiple transgenic animals. 7-mers and 11-mers that show positive enrichment in the target in vivo environment (e.g., central nervous system, liver) are provided herein. “Enrichment” is the prevalence of a given 7-mer or 11-mer in the tissue of the in vivo environment compared to its prevalence in the viral library administered to the transgenic animal. An enrichment score higher than 0 indicates positive enrichment. An enrichment score less than 0 indicates negative enrichment. A subset of rAAVs with a desired enrichment profile was individually tested in vivo to determine accurate systemic expression (e.g., specificity and transduction efficiency). rAAVs from this subset that exhibit the desired tropism, including increased specificity of viral transduction and in some cases improved transduction efficiency, are considered to be uniquely suitable for targeted rAAV-mediated transgene delivery useful for a wide variety of purposes (e.g., therapy, diagnosis, scientific discovery).

[0114] The rAAV particles having the 7-mer or 11-mer described herein have an improved transduction efficiency into a target in vivo environment (e.g., tissue or cell type). In some cases, the improvement in transduction efficiency includes an improvement by 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold, 48-fold, 49-fold, 50-fold, 75-fold or 100-fold or more as compared to a reference AAV. In some cases, the improvement in transduction efficiency is at least 30-fold. In some cases, the improvement in transduction efficiency is at least 40-fold. In some cases, the improvement in transduction efficiency is at least 50-fold. In some cases, the improvement in transduction efficiency is at least 60-fold. In some cases, the improvement in transduction efficiency is at least 80-fold. In some cases, the improvement in transduction efficiency is at least 90-fold. In some cases, the improvement in transduction efficiency is at least 100-fold.

[0115] The rAAV particles having the 7-mer or 11-mer described herein have an increased specificity into a target in vivo environment (e.g., tissue or cell type) as compared to a reference AAV. Detecting whether the rAAV has a greater or lesser specificity for the target in vivo environment than the reference AAV involves measuring the level of a gene expression product (e.g., RNA or protein) expressed from a heterologous nucleic acid encapsulated within the capsid by the rAAV in a tissue sample obtained from the target in vivo environment in a subject; and comparing the measured level to a control level (e.g., a level for a gene expression product expressed from a heterologous nucleic acid encapsulated within the capsid by a reference AAV (e.g., AAV9)). Methods suitable for measuring the expression of the gene expression product include luciferase reporter assays and quantitative polymerase chain reaction (qPCR). ​

[0116] The increased specificity correlates with an increased enrichment in the target in vivo environment, which in some cases is represented by the enrichment scores provided in Figures 33-35 herein. As a non-limiting example, AAV-PHP.V2 (TTLKPFL) shown herein to be positively enriched in the brain (enrichment score of about 2.51) also exhibited an increase in reporter gene expression (about 60% of cortical cerebrovascular cells and about 60% of cortical astrocytes transduced with the reporter gene) in the brain (e.g., as measured by a fluorescence reporter assay) compared to reference AAV9 (nearly 0%). Without being bound by a particular theory, the inventors of the present disclosure expect this correlation to be seen for all rAAVs disclosed herein, and further expect that the enrichment score, whether negative or positive, may correlate with a higher specificity for the in vivo environment as indicated by the measured level of the gene expression product in the in vivo environment, the higher the significance.

[0117] The transduction efficiency as disclosed herein can be measured by at least one of (1) the number of cells expressing the heterologous nucleic acid encapsulated within the capsid by the modified AAV capsid protein disclosed herein in the target in vivo or ex vivo in vivo environment, and (2) the amount of expression of the heterologous nucleic acid in a single cell. When an increase in the presence or level of rAAV-mediated transduction into the target in vivo environment is observed compared to the reference AAV, specificity for the target in vivo environment can be inferred. When the absence or a decrease in the level of rAAV-mediated transduction into the ex vivo in vivo environment is observed compared to the reference AAV, a lack or reduction of specificity for the ex vivo in vivo environment can be inferred.

[0118] The reference AAV can have a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or variants thereof. For example, the reference AAV can have a serotype selected from the group consisting of AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0119] The rAAV capsid proteins of the present disclosure include an amino acid insertion within the amino acid sequence of the AAV capsid protein. The AAV capsid from which the engineered AAV capsid protein of the present disclosure is produced is referred to as the "parent" AAV capsid. In some cases, the parent AAV has a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. The complete genome of AAV-1 is provided by GenBank accession number NC_002077, and the complete genome of AAV-2 is provided by GenBank accession numbers NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983), AAV -3's complete genome is provided by GenBank accession number NC_1829, the complete genome of AAV-4 is provided by GenBank accession number NC_001829, the AAV-5 genome is provided by GenBank accession number AF085716, the complete genome of AAV-6 is provided by GenBank accession number NC_001862, at least parts of the AAV-7 and AAV-8 genomes are provided by GenBank accession numbers AX753246 and AX753249 respectively, the AAV-9 genome is, Gao et al., J. Virol., 78: 6381-6388 (2004), the AAV-10 ge nome is provided by Mol.Ther., 13(1): 67-76 (2006), the AAV-11 genome is , provided in Virology, 330(2): 375-383 (2004), part of the AAV-12 genome is provided by Genbank accession number DQ813647, and the part of the AAV-13 genome is provided by Genbank accession number EU285562.

[0120] In some cases, the parental AAV is derived from an AAV having a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. The "derived" AAV capsid protein in another may be a variant AAV capsid protein. The variant may, for example, contain heterologous amino acids within the amino acid sequence of the AAV capsid protein. The heterologous amino acids may not be naturally present in the AAV capsid protein. The heterologous amino acids may also be naturally present in different AAV capsid proteins. In some cases, the parental AAV capsid is described in U.S. Patent Application Nos. 62 / 736,904, 16 / 582,635, 62 / 832,812, and 62 / 832,826, and the content of each of these reference patent documents is incorporated herein. For example, the parental AAV capsid may have a modified 455 loop of the AAV capsid protein (e.g., substitution of 7-mer at AA452-458, AAV9 VP1 numbering).

[0121] In some cases, the parental AAV is AAV9. In some cases, the amino acid sequence of the AAV9 capsid protein includes SEQ ID NO: 1. The amino acid sequence of the AAV9 VP1 capsid protein (>tr|Q6JC40|Q6JC40_9VIRU capsid protein VP1 OS=adeno-associated virus 9 OX=235455 GN=cap PE=1 SV=1) is SEQ ID NO: 1

Chemical formula

[0122] Insertion of an amino acid (or amino acid sequence) at the amino acid position between amino acid 588 and amino acid 589 of the amino acid sequence of the AAV capsid protein is disclosed herein. As used herein, “AA588_589” indicates that the insertion of the amino acid (or amino acid sequence) is immediately after the amino acid (AA) at position 588 (VP1 numbering) and immediately before the AA at position 589 within the amino acid sequence of the parental AAV VP capsid protein. Amino acids 587-591 contain a motif including “AQAQA” as shown in SEQ ID NO: 1. Exemplary AAV capsid protein sequences are provided in Table 1. For example, QAVRTSL is inserted at AA588_589 in the AAV9 capsid amino acid sequence and is provided in SEQ ID NO: 3. In another example, TLAVPFK is inserted at AA588_589 in the AAV9 capsid amino acid sequence and is provided in SEQ ID NO: 2. It is contemplated that the 7-mer insertions disclosed herein (FIGS. 33-35, Tables 2-4) can be inserted at AA588_589 in the amino acid sequence of the parental AAV9 capsid protein, its variants, or at the equivalent amino acid position in parental AAVs of different serotypes (e.g., AAV1, AAV2, AAV3, etc.).

[0123] The 11-mer described herein may, in some cases, include a 7-mer insertion at AA588_589 and one or more amino acid substitutions at amino acid positions AA587-590. In some cases, amino acids 587-590 are substituted with amino acids that are not endogenous to the parental AAV capsid protein at those positions. In some cases, AA587 is substituted with D (e.g., A587D). In some cases, AA587 is substituted with A (e.g., Q587A). In some cases, AA587 is substituted with S (e.g., Q587S). In some cases, AA587 is substituted with G (e.g., Q587G). In some cases, AA588 is substituted with G (e.g., Q588G). In some cases, AA589 is substituted with N (e.g., A589N). In some cases, AA590 is substituted with P (e.g., A590P). In a non-limiting example, SEQ ID NO: 4 (PHP-AAV.eB) includes the insertion of TLAVPFK at AA588_AA589 and the substitutions A587D and Q588G. In another non-limiting example, SEQ ID NO: 5 (PHP-AAV.N) includes the insertion of TTLKPFS at AA588_AA589 and the substitutions A587D, Q588G, A589N and Q590P. In addition to any substitution with an amino acid at positions 587-590, any 7-mer insert disclosed herein is envisioned to include an 11-mer.

[0124] Table 1. Exemplary AAV Capsid Protein Sequences

Table 1-1

Table 1-2

Table 1-3

[0125] The rAAV capsid proteins described herein can be isolated and purified. AAV can be isolated and purified by standard methods in the art, for example, by column chromatography or cesium chloride gradient. Methods for purifying AAV from helper virus are known in the art and can include, for example, the methods disclosed in Clark et al., Hum.Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol.Med., 69: 427-443 (2002); U.S. Patent No. 6,566,118 and WO98 / 09657.

[0126] The rAAV capsid protein can be conjugated to a nanoparticle, a second molecule, or a viral capsid protein. In some cases, the nanoparticle or viral capsid protein will encapsidate the therapeutic nucleic acid described herein within the capsid. In some instances, the second molecule is a therapeutic agent, such as a small molecule, antibody, antigen-binding fragment, peptide or protein, such as those described herein. In some instances, the second molecule is a detectable moiety. For example, a modified AAV capsid protein conjugated to a detectable moiety can be used for applications in biomedical research in vitro, ex vivo or in vivo, and this detectable moiety is used to visualize the modified capsid protein. A modified AAV capsid protein conjugated to a detectable moiety can also be used for diagnostic purposes.

[0127] AAV capsid proteins targeting the central nervous system

[0128] An AAV capsid protein having at least one amino acid substitution or insertion at the above amino acid positions of the parental AAV capsid protein, wherein the substitution or insertion results in an increase in specificity for the central nervous system (CNS) or peripheral nervous system (PNS) in a subject even when systemically delivered, is disclosed herein. One of the many advantages of the AAV capsid proteins described herein is their ability to target the CNS and cross the blood-brain barrier (BBB).

[0129] The in vivo environment can be a cell. The cell can be a cell type selected from the group consisting of central nervous system (CNS) cells and peripheral nervous system (PNS) cells. Non-limiting examples of CNS cells include neurons and glial cells. Glial cells can be selected from the group consisting of oligodendrocytes, ependymal cells, and astrocytes. Non-limiting examples of PNS cells include neurons or glial cells. Glial cells can be selected from the group consisting of Schwann cells, satellite cells, and enteric glial cells.

[0130] The in vivo environment can be a tissue. The tissue can be the brain or spinal cord. The tissue can also be an organ, for example, a region of the cerebrum, cerebellum, brainstem, cortex, striatum, thalamus, lateral ventricle, putamen, hypothalamus, medulla, pons, hippocampus, tonsil, motor cortex, or a combination thereof.

[0131] An AAV capsid protein having at least one amino acid insertion or substitution in the parental AAV capsid protein is disclosed herein. The insertion or substitution can be an insertion or substitution of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acids or more. In some cases, the amino acids are contiguous. In some cases, the amino acids are not contiguous.

[0132] In some cases, the insertion is at least 1 amino acid insertion provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 2 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 3 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 4 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 5 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 6 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6. In some cases, the insertion is at least 7 amino acid insertions provided by any one of the sequences provided in any one of Tables 2-3 or Figure 6.

[0133] An AAV capsid protein having at least one insertion of amino acid X1, wherein X1 is selected from the group consisting of A, E, D, G, R, S, and T, is disclosed herein. In some cases, the insertion further comprises 2 amino acids, and X2 is selected from the group consisting of A, G, I, L, M, N, Q, R, T, and Y. In some cases, the insertion further comprises 3 amino acids, and X3 is selected from the group consisting of E, K, L, T, and Q. In some cases, the insertion further comprises at least 4 amino acids, X1 is selected from the group consisting of A, E, D, G, R, S, and T, X2 is selected from the group consisting of A, G, I, L, M, N, Q, R, T, and Y, X3 is selected from the group consisting of E, K, L, T, and Q, and X4 is selected from the group consisting of G, I, K, L, M, R, T, and V. In some cases, the insertion further comprises 5 amino acids, and X5 is selected from the group consisting of A, D, G, P, L, Q, and V. In some cases, the insertion further comprises 6 amino acids, and X6 is selected from the group consisting of F, K, L, N, P, Q, S, and V. In some cases, the insertion further comprises at least 7 amino acids, and X7 is selected from the group consisting of I, K, L, P, S, and V.

[0134] In some embodiments, X1, X2, X3, X4, X5, X6, and X7 are consecutive (X1-X2-X3-X4-X5-X6-X7). In some embodiments, any two of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, any three of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, any four of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, any five of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, any six of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, any seven of X1, X2, X3, X4, X5, X6, and X7 are consecutive. In some embodiments, X1, X2, X3, X4, X5, X6, and X7 are not consecutive. In some embodiments, the insertion is not TLAVPFK.

[0135] The 7-mers disclosed herein, in some cases, share a common motif. The 7-mer (X1-X2-X3-X4-X5-X6-X7) is advantageously, in some cases, having T at the X1 position, L at the X2 position, P at the X5 position, F at the X6 position, and K or L at the X7 position. In some embodiments, the 7-mer comprises T-L-X3-X4-P-F-K, wherein X3 and X4 in the formula are any amino acids. In some embodiments, the 7-mer comprises T-L-X3-X4-P-F-L, wherein X3 and X4 in the formula are any amino acids. In some cases, X3 is not A. In some cases, X3 is A, S, Q, or E, or L. In some cases, X4 is not V. In some cases, X4 is R, K, V, or Q.

[0136] In some cases, the 7-mer is X1-L-A-V-P-F-K (where X1 is any amino acid other than T, S, or N); X1-X2-A-V-P-F-K (where X1 is any amino acid other than T, S, or N and X2 is any amino acid other than L or V); or X1-X2-X3-V-P-F-K (where X1 is any amino acid other than T, S, or N, X2 is any amino acid other than L or V, and X3 is any amino acid other than A, S, Q, P, or T); or X1-X2-X3-X4-P-F-K (where X1 is any amino acid other than T, S, or N, X2 is any amino acid other than L or V, X3 is any amino acid other than A, S, Q, P, or T, and X4 is any amino acid other than V, T, Q, N, L, or M). In some cases, the 7-mer is T-L-A-X4-P-F-K, where X is any amino acid other than V. In some cases, the 7-mer is T-L-A-X4-P-F-K, where X is any amino acid other than T, Q, N, L, or M.

[0137] In some cases, the 7-mer (X1-X2-X3-X4-X5-X6-X7) contains TALKPFL. In some cases, the 7-mer contains TTLKPFL. In some cases, the 7-mer contains TLQIPFK. In some cases, the 7-mer contains TMQKPFI. In some cases, the 7-mer contains SIERPFK. In some cases, the 7-mer contains RYQGDSV.

[0138] In some cases, the AAV capsid protein comprises an insertion of at least or about 3, 4, 5, 6, or 7 amino acids of the amino acid sequence T-X2-L-K-P-F-L at positions 588_589 of the parental AAV9 capsid protein (SEQ ID NO: 1), wherein X2 is A or T. In some cases, the AAV capsid protein has an increased specificity of viral transduction into cerebrovascular cells (GLUT1+) compared to a reference AAV (e.g., AAV9). In some cases, the AAV capsid protein has an increased specificity of viral transduction into astrocytes compared to a reference AAV (e.g., AAV9).

[0139] In some cases, the AAV capsid protein comprises an insertion of at least or about 3, 4, 5, 6, or 7 amino acids of the amino acid sequence T-X2-Q-X4-P-F-X7 at positions 588_589 of the parental AAV9 capsid protein (SEQ ID NO: 1), wherein X2 is L or M, X4 is I, K, or L, and X7 is K or I. In some cases, the AAV capsid protein has an increased specificity of viral transduction into neurons and astrocytes compared to a reference AAV (e.g., AAV9). In some cases, the amino acid sequence is TLQIPFK. In some cases, the amino acid sequence is TMQKPFI. In some cases, the amino acid sequence is TLQLPFK.

[0140] In some cases, the AAV capsid protein comprises an insertion of at least or about 3, 4, 5, 6, or 7 amino acids of the amino acid sequence S-I-E-R-P-F-K at positions 588_589 of the parental AAV9 capsid protein (SEQ ID NO: 1). In some cases, the AAV capsid protein has an increased specificity of viral transduction into neurons and astrocytes compared to a reference AAV (e.g., AAV9).

[0141] In some cases, the AAV capsid protein comprises at least or about 3, 4, 5, 6, or 7 amino acid insertions of the amino acid sequence R - Y - Q - G - D - S - V at amino acid positions 588_589 of the parental AAV9 capsid protein (SEQ ID NO: 1). In some cases, the AAV capsid protein has an increased specificity of viral transduction into astrocytes compared to a reference AAV (e.g., AAV9).

[0142] Table 2: List of 7 - mer targeting peptides that can target the CNS with higher efficiency and specificity

Table 2 - 1

Table 2 - 2

Table 2 - 3

Table 2 - 4

Table 2 - 5

Table 2 - 6

Table 2 - 7

Table 2 - 8

Table 2 - 9

Table 2 - 10

Table 2 - 11

Table 2 - 12

[0143] Table 3: 11-mer targeting peptides capable of targeting the CNS [Table 3]

[0144] AAV capsid proteins targeting the liver

[0145] An AAV capsid protein having at least one amino acid substitution or insertion at the above amino acid position of the parental AAV capsid protein, wherein the substitution or insertion results in an increase in specificity for the liver, is disclosed herein. In some cases, the insertion comprises at least 1 amino acid provided by any one of the sequences provided in Table 4 and / or Figure 35. In some cases, the insertion comprises at least 2 amino acids provided by any one of the sequences provided in Table 4 and / or Figure 35. In some cases, the insertion comprises at least 3 amino acids provided by any one of the sequences provided in Table 4 and / or Figure 35. In some cases, the insertion comprises at least 4 amino acids provided by any one of the sequences provided in Table 4 and / or Figure 35. In some cases, the insertion comprises at least 5 amino acids provided by Table 4 and / or Figure 35. In some cases, the insertion comprises at least 6 amino acids provided by Table 4 and / or Figure 35. In some cases, the insertion comprises at least 7 amino acids provided by Table 4 and / or Figure 35. In some cases, the amino acids are contiguous. In some cases, the amino acids are not contiguous. In some cases, the insertion is at amino acid positions 588_589 of the parental AAV capsid protein. In some cases, the parental capsid protein is the AAV9 capsid protein provided by SEQ ID NO: 1.

[0146] Table 4. List of 7-mer targeting peptides targeting the liver [Table 4-1]

Table 4-2

Table 4-3

[0147] The AAV capsids and AAV capsid proteins disclosed herein are, in some embodiments, isolated. In some cases, the AAV capsids and AAV capsid proteins disclosed herein are isolated and purified. Additionally, the AAV capsids and AAV capsid proteins disclosed herein, whether isolated and purified or not, can be formulated into pharmaceutical formulations, which in some cases further include a pharmaceutically acceptable carrier. B. Heterologous Nucleic Acids

[0148] Therapeutic nucleic acids useful for treating or preventing a disease or condition disclosed herein, or a symptom of a disease or condition, are disclosed herein. In some embodiments, the therapeutic nucleic acid encodes a therapeutic gene expression product. Non-limiting examples of gene expression products include proteins, polypeptides, peptides, enzymes, antibodies, antigen-binding fragments, nucleic acids (RNA, DNA, antisense oligonucleotides, siRNA, etc.), and gene editing components for use in treating, preventing, and / or ameliorating a disease or disorder, or a symptom of a disease or disorder. In some cases, the therapeutic nucleic acid is delivered to a subject's living body, cell, tissue, or organ by rAAV such as those disclosed herein.

[0149] rAAVs each containing a viral vector (e.g., a single-stranded DNA molecule (ssDNA)) are disclosed herein. In some cases, the viral vector contains two inverted terminal repeat (ITR) sequences, each approximately 145 bases in length, adjacent to the transgene. In some embodiments, the transgene contains a therapeutic nucleic acid and, in some cases, a promoter that is in cis relation to the therapeutic nucleic acid within an open reading frame (ORF). The promoter can initiate transcription of the therapeutic nucleic acid in the nucleus of the target cell. The ITR sequences can be from any AAV serotype. Non-limiting examples of AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. In some cases, the ITR is the ITR from AAV2. In some cases, the ITR is the ITR from AAV9.

[0150] Transgenes that can contain any number of nucleotides are disclosed herein. In some cases, the transgene can contain less than about 100 nucleotides. In some cases, the transgene can contain at least about 100 nucleotides. In some cases, the transgene can contain at least about 200 nucleotides. In some cases, the transgene can contain at least about 300 nucleotides. In some cases, the transgene can contain at least about 400 nucleotides. In some cases, the transgene can contain at least about 500 nucleotides. In some cases, the transgene can contain at least about 1000 nucleotides. In some cases, the transgene can contain at least about 5000 nucleotides. In some cases, the transgene can contain at least about 10,000 nucleotides. In some cases, the transgene can contain at least about 20,000 nucleotides. In some cases, the transgene can contain at least about 30,000 nucleotides. In some cases, the transgene can contain at least about 40,000 nucleotides. In some cases, the transgene can contain at least about 50,000 nucleotides. In some cases, the transgene can contain between about 500 and about 5000 nucleotides. In some cases, the transgene can contain between about 5000 and about 10,000 nucleotides. In any of the cases disclosed herein, the transgene can include DNA, RNA, or a hybrid of DNA and RNA. In some cases, the transgene can be single-stranded. In some cases, the transgene can be double-stranded.

[0151] Transgenes useful for modulating the expression or activity of a target gene or its gene expression product are disclosed herein. In some cases, the transgene is encapsidated within the capsid by the rAAV capsid protein of the rAAV particles described herein. In some cases, the rAAV particles are delivered to a subject to treat a disease or condition disclosed herein in the subject. In some cases, the delivery is systemic (e.g., intravenous, intranasal) delivery.

[0152] The transgenes disclosed herein are useful for expressing endogenous genes at levels similar to those of healthy or normal individuals. This is particularly useful for treating diseases or conditions associated with underexpression or lack of expression of gene expression products. In some embodiments, the transgenes disclosed herein are useful for overexpressing endogenous genes such that the expression level of the endogenous gene is higher than the expression level of a healthy or normal individual. Additionally, transgenes can be used to express foreign genes (e.g., active substances such as antibodies, peptides, nucleic acids, or gene editing components). In some embodiments, the therapeutic gene expression product can alter, enhance, increase, or induce the activity of one or more endogenous biological processes in a cell. In some embodiments, the transgenes disclosed herein are useful for reducing the expression of endogenous genes, such as dominant negative genes. In some embodiments, the therapeutic gene expression product can alter, inhibit, reduce, prevent, abolish, or impair the activity of one or more endogenous biological processes in a cell. In some aspects, an increase in gene expression refers to an increase of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. In one aspect, the protein product of the target gene can be increased by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. In some aspects, a decrease in gene expression refers to an increase of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. In one aspect, the protein product of the target gene can be decreased by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%.

[0153] When an endogenous sequence (an endogenous transgene or a part of a transgene) is expressed together with a transgene, the endogenous sequence may be a full-length sequence (wild-type or mutant) or a partial sequence. The endogenous sequence can be functional. Non-limiting examples of the functions of these full-length or partial sequences include extending the serum half-life of a polypeptide expressed by a transgene (e.g., a therapeutic gene) and / or acting as a carrier.

[0154] A transgene can be inserted into an endogenous gene such that all of the endogenous gene is expressed, such that a part of the endogenous gene is expressed, or such that no endogenous gene is expressed. For example, a part of an endogenous sequence (the N-terminal side and / or C-terminal side of the transgene) can be expressed, for example, as a fusion with the transgene, or no endogenous sequence can be expressed, for example, as a fusion with the transgene, by inserting the transgene described herein into the endogenous locus. In other cases, a transgene (e.g., with or without an additional coding sequence of an endogenous gene) is integrated into any endogenous locus, e.g., a safe harbor locus. For example, a frataxin (FXN) transgene can be inserted into the endogenous FXN gene. A transgene can be inserted into any gene, e.g., a gene described herein.

[0155] At least one advantage of the present disclosure is that virtually any therapeutic nucleic acid can be used to express any therapeutic gene expression product. In some cases, the therapeutic gene expression product is a therapeutic protein or peptide (e.g., an antibody, antigen-binding fragment, peptide, or protein). In one embodiment, the protein encoded by the therapeutic nucleic acid is between 50 and 5000 amino acids in length. In some embodiments, the encoded protein is between 50 and 2000 amino acids in length. In some embodiments, the encoded protein is between 50 and 1000 amino acids in length. In some embodiments, the encoded protein is between 50 and 1500 amino acids in length. In some embodiments, the encoded protein is between 50 and 800 amino acids in length. In some embodiments, the encoded protein is between 50 and 600 amino acids in length. In some embodiments, the encoded protein is between 50 and 400 amino acids in length. In some embodiments, the encoded protein is between 50 and 200 amino acids in length. In some embodiments, the encoded protein is between 50 and 100 amino acids in length. In some embodiments, the encoded peptide is between 4 and 50 amino acids in length. In some embodiments, the encoded protein is a tetrapeptide, pentapeptide, hexapeptide, heptapeptide, octapeptide, nonapeptide, or decapeptide. In some embodiments, the encoded protein comprises a peptide of 2 to 30 amino acids, such as 5 to 30, 10 to 30, 2 to 25, 5 to 25, 10 to 25, or 10 to 20 amino acids. In some embodiments, the encoded protein comprises a peptide of at least 11, 12, 13, 14, 15, 17, 20, 25, or 30 amino acids, or a peptide of 50 amino acids or less, such as 35, 30, 25, 20, 17, 15, 14, 13, 12, 11, or 10 amino acids or less.

[0156] Non-limiting examples of therapeutic proteins or peptides include adrenergic agonists, anti-apoptotic factors, apoptosis inhibitors, cytokine receptors, cytokines, cytotoxins, erythropoietin, glutamic acid decarboxylase, glycoproteins, growth factors, growth factor receptors, hormones, hormone receptors, interferons, interleukins, interleukin receptors, kinases, kinase inhibitors, nerve growth factors, netrins, bioactive peptides, bioactive peptide receptors, neurogenic factors, neurogenic factor receptors, neuropilins, neurotrophic factors, neurotrophins, neurotrophin receptors, N-methyl-D-aspartic acid antagonists, plexins, proteases, protease inhibitors, protein decarboxylases, protein kinases, protein kinase inhibitors, proteolytic proteins, proteolytic protein inhibitors, semaphorins ), semaphorin receptors, serotonin transporter proteins, serotonin uptake inhibitors, serotonin receptors, serpins, serpin receptors, and tumor suppressors. In certain embodiments, the therapeutic protein or peptide is selected from the group consisting of brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), macrophage colony-stimulating factor (CSF), epidermal growth factor (EGF), fibroblast growth factor (FGF), gonadotropin, interferon-gamma (IFN), insulin-like growth factor 1 (IFG-1), nerve growth factor (NGF), platelet-derived growth factor (PDGF), pigment epithelium-derived factor (PEDF), transforming growth factor (TGF), transforming growth factor-beta (TGF-B), tumor necrosis factor (TNF), vascular endothelial growth factor (VEGF), prolactin, somatotropin, X-linked apoptosis inhibitor protein 1 (XIAP1), interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10, viral IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, and IL-18.

[0157] The therapeutic gene expression product may include gene editing components. Non-limiting examples of gene editing components include those required for CRISPR / Cas, artificial site-specific RNA endonuclease (ASRE), zinc finger endonuclease (ZFN), and transcription activator-like effector nuclease (TALEN). In a non-limiting example, a subject suffering from Huntington's disease is identified. In that case, a first amount of rAAV encapsulating a viral vector encoding a ZFN engineered to suppress the transcription of the huntingtin (HTT) gene within a capsid is systemically administered to the subject. In some cases, the administration route is the intravenous route. The rAAV will include a modified AAV capsid protein comprising an amino acid sequence provided in any one of Tables 2-3 or Figure 33 to enable proper targeting of the ZFN to the nervous system and retargeting of off-target organs such as the liver. Optionally, a second or third dose of rAAV is administered to the subject until a therapeutically effective amount of the ZFN is expressed in the subject's nervous system. In another non-limiting example, a subject suffering from cystic fibrosis is identified. In that case, a first amount of rAAV encapsulating a viral vector encoding a ZFN engineered to suppress the transcription of the cystic fibrosis transmembrane conductance regulator (CFTR) gene within a capsid is systemically administered to the subject. In some cases, the administration route is the intranasal route (e.g., intranasal spray). The rAAV will include a modified AAV capsid protein comprising an amino acid sequence provided in Figure 33 or Tables 2-3 to enable proper targeting of the ZFN to the lungs. Optionally, a second or third dose of rAAV is administered to the subject until a therapeutically effective amount of the ZFN is expressed in the subject's lungs.

[0158] Therapeutic nucleic acids can include sequences encoding non-protein-coding genes, such as antisense RNAs, RNAi, shRNAs, and microRNAs (miRNAs), miRNA sponges or decoys, and delivery of recombinases for conditional gene deletion, conditional (recombinase-dependent) expression, including those required for the gene editing components described herein. Non-protein-coding genes may also encode tRNAs, rRNAs, tmRNAs, piRNAs, double-stranded RNAs, snRNAs, snoRNAs, and / or long non-coding RNAs (lncRNAs). In some cases, non-protein-coding genes can modulate the expression or activity of target genes or gene expression products. For example, the RNAs described herein can be used to inhibit gene expression in target cells, such as cells of the central nervous system (CNS) or peripheral organs (e.g., the lung). In some cases, inhibition of gene expression refers to at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100% inhibition. In some cases, the protein product of the target gene can be inhibited by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%. The gene may be a wild-type gene or a gene having at least one mutation. The target protein may be a wild-type protein or a protein having at least one mutation.

[0159] Therapeutic nucleic acids can modulate the expression or activity of genes involved in brain diseases or disorders, or gene expression products expressed from such genes. For example, in some cases, the therapeutic nucleic acid is a gene described herein or a modified version of such gene. In another example, the therapeutic nucleic acid comprises an effector gene expression product, such as a gene editing component specific for targeting a gene therein. Non-limiting examples of genes include sarcoglycan alpha (SGCA), glutamate decarboxylase 65 (GAD65), glutamate decarboxylase 67 (GAD67), CLN2 gene, nerve growth factor (NGF), glial cell line-derived neurotrophic factor (GDNF), neurturin, survival motor neuron 1, telomeric form (SMN1), beta-glucosylceramidase (GCase), frataxin (FXN), huntingtin (HTN), methyl-CpG binding protein 2 (MECP2), peroxisome biogenesis factor (PEX), progranulin (GRN), anti-tubulin agent, copper-zinc superoxide dismutase (SOD1), glucosylceramidase beta (GBA), NPC intracellular cholesterol transporter 1 (NPC1), and NPS3. In some embodiments, the peroxisome biogenesis factor (PEX) is selected from the group consisting of PEX1, PEX2, PEX3, PEX4, PEX5, PEX6, PEX7, PEX10, PEX11β, PEX12, PEX13, PEX14, PEX16, PEX19, and PEX26. In some cases, the gene or gene expression product is inhibited. In some cases, the gene or gene expression product is enhanced.

[0160] Therapeutic nucleic acids modulate the expression or activity of genes involved in diseases or disorders of specific organs (e.g., lung, heart, liver, muscle, eye) or gene expression products expressed from such genes. Non-limiting examples of genes include Cystic Fibrosis Transmembrane Conductance Regulator (CFTR), Factor X (FIX), RPE65, Retinoid Isomerohydrolase (RPE65), Sarcoglycan alpha (SGCA), and Sarco / Endoplasmic Reticulum Ca2+-ATPase (SERCA2a). In some embodiments, the therapeutic gene expression products are of human, murine, avian, porcine, bovine, ovine, feline, canine, equine, caprine, ovine, lupine, or primate origin. In some cases, the gene or gene expression product is inhibited. In some cases, the gene or gene expression product is enhanced. C. AAV vector

[0161] Adeno-associated virus (AAV) vectors containing genetic information are disclosed herein. The AAV vectors described herein are useful for the assembly of rAAV and the viral packaging of heterologous nucleic acids. In addition, AAV vectors can encode transgenes containing heterologous nucleic acids. In some cases, the AAV vector is from an AAV serotype selected from the group consisting of AV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. In some cases, the AAV vector is selected from modified AAV serotypes selected from the group consisting of AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0162] An AAV vector can contain a transgene that, in some cases, encodes a heterologous gene expression product (e.g., a therapeutic gene expression product, a recombinant capsid protein, etc.). The transgene is in cis relation with two inverted terminal repeats (ITRs) adjacent to the transgene. The transgene may contain a therapeutic nucleic acid encoding a therapeutic gene expression product. Due to the limited packaging capacity of rAAV (about 2.5 kB), in some cases, a longer transgene may be split between two AAV vectors, a first AAV vector having a 3' splice donor and a second AAV vector having a 5' splice acceptor. Concatenomers are formed upon co-infection of cells and these are spliced together to express the full-length transgene.

[0163] Generally, a transgene is inserted such that its expression is driven by the endogenous promoter at the integration site, i.e., the promoter that drives the expression of the endogenous gene into which the transgene is inserted. In some cases, the transgene includes a promoter and / or enhancer, e.g., a constitutive promoter or an inducible or tissue / cell-specific promoter. By way of non-limiting example, the promoter can be a CMV promoter, a CMV-β-actin-intron-β-globin hybrid promoter (CAG), a CBA promoter, an FRDA or FXN promoter, a UBC promoter, a GUSB promoter, an NSE promoter, a synapsin promoter, a MeCP2 promoter, a GFAP promoter, an H1 promoter, a U6 promoter, an NFL promoter, an NFH promoter, an SCN8A promoter, or a PGK promoter. By way of non-limiting example, the promoter can be a tissue-specific expression element including, but not limited to, human elongation factor 1α-subunit (EF1α), immediate early cytomegalovirus (CMV), chicken β-actin (CBA) and its derivative CAG, β-glucuronidase (GUSB), and ubiquitin C (UBC). The transgene may include a tissue-specific expression element for neurons, e.g., but not limited to, neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), synapsin (Syn), methyl-CpG-binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), NFL, NFH, np32, PPE, Enk, and EAAT2 promoter. The transgene may include a tissue-specific expression element for astrocytes, e.g., but not limited to, glial fibrillary acidic protein (GFAP) and EAAT2 promoter. The transgene may include a tissue-specific expression element for oligodendrocytes, e.g., but not limited to, myelin basic protein (MBP) promoter.

[0164] In some embodiments, the promoter is less than 1 kb. The promoter can have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, or longer than 800. The promoter can have a length between 200 - 300, 200 - 400, 200 - 500, 200 - 600, 200 - 700, 200 - 800, 300 - 400, 300 - 500, 300 - 600, 300 - 700, 300 - 800, 400 - 500, 400 - 600, 400 - 700, 400 - 800, 500 - 600, 500 - 700, 500 - 800, 600 - 700, 600 - 800 or 700 - 800. The promoter can provide expression of a therapeutic gene expression product over a period of time in a target tissue, such as, but not limited to, the central nervous system and peripheral organs (e.g., lungs).Expression of the therapeutic gene expression product may occur over a period of 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years or a period longer than 65 years. Expression of the payload may occur over a period of 1 to 5 hours, 1 to 12 hours, 1 to 2 days, 1 to 5 days, 1 to 2 weeks, 1 to 3 weeks, 1 to 4 weeks, 1 to 2 months, 1 to 4 months, 1 to 6 months, 2 to 6 months, 3 to 6 months, 3 to 9 months, 4 to 8 months, 6 to 12 months, 1 to 2 years, 1 to 5 years, 2 to 5 years, 3 to 6 years, 3 to 8 years, 4 to 8 years, or 5 to 10 years, or 10 to 15 years, or 15 to 20 years, or 20 to 25 years, or 25 to 30 years, or 30 to 35 years, or 35 to 40 years, or 40 to 45 years, or 45 to 50 years, or 50 to 55 years, or 55 to 60 years, or 60 to 65 years.

[0165] An AAV vector can contain the genome of a helper virus. Helper virus proteins are required for the assembly of recombinant AAV (rAAV) and the packaging of a transgene containing a heterologous nucleic acid into rAAV. Helper virus genes are adenovirus genes E4, E2a, and VA that assist AAV replication when expressed in a cell. In some embodiments, the AAV vector contains E2. In some embodiments, the AAV vector contains E4. In some embodiments, the AAV vector contains VA. In some cases, the AAV vector contains one or any combination of helper virus proteins.

[0166] An AAV vector can contain a viral genome that includes a nucleic acid encoding a recombinant AAV (rAAV) capsid protein as described herein. The viral genome can include a replication (Rep) gene encoding a Rep protein and a capsid (Cap) gene encoding an AAP protein within a first open reading frame (ORF1) or encoding a Cap protein within a second open reading frame (ORF2). The Rep protein is selected from the group consisting of Rep78, Rep68, Rep52, and Rep40. In some cases, the Cap gene is modified to encode a modified AAV capsid protein as described herein. The wild-type Cap gene encodes three proteins, VP1, VP2, and VP3. In some cases, VP1 is modified. In some cases, VP2 is modified. In some cases, VP3 is modified. In some cases, all three of VP1-VP3 are modified. The AAV vector can contain a nucleic acid encoding wild-type Rep78, Rep68, Rep52, Rep40, and an AAP protein.

[0167] An AAV vector comprising any one of SEQ ID NOs: 10-434, 860-863, 868-949, 1068-5661, 14841-14880, and 14961-15053, which is a DNA sequence encoding a modified portion of the AAV capsid protein of the present disclosure, is disclosed herein. In some cases, the AAV vector comprises a nucleic acid sequence provided by any one of SEQ ID NOs: 10-434 and 868-949, which encodes a 7-mer modified AAV capsid protein portion. The AAV vectors of the present disclosure can comprise a VP1 Cap gene comprising any one of SEQ ID NOs: 6-9 provided in Table 5. The AAV vector can comprise 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of any one of SEQ ID NOs: 6-9.

[0168] In some cases, the AAV9 VP1 gene provided by SEQ ID NO: 6, provided in Table 5, is modified to comprise any one of SEQ ID NOs: 10-434, 860-863, 868-949, 1068-5661, 14841-14880, and 14961-15053. In some cases, AAV-PHP.eB VP1 (SEQ ID NO: 9), also provided in Table 5, is modified to comprise any one of SEQ ID NOs: 10-434, 860-863, 868-949, 1068-5661, 14841-14880, and 14961-15053. The AAV vectors described herein can be used to produce variant AAV capsids by the methods described herein.

[0169] Table 5. VP1 Capsid Protein Nucleic Acid Sequences

Table 5-1

Table 5-2

Table 5-3

Table 5-4

Table 5-5

Table 5-6

[0170] Methods for identifying recombinant adeno-associated virus (rAAV), such as those disclosed herein, are disclosed herein. AAV peptides specific for a target in vivo environment are identified using multiplexed Cre-recombinase-based AAV target evolution (M-CREATE). Figure 1 provides a workflow using M-CREATE. M-CREATE uses an rAAV capsid genome that couples a full-length AAV Cap gene controlled by regulatory elements from the AAV Rep gene to a Cre-invertible switch (rAAV-Cap-in-cis-lox or rAAV-ΔCap-in-cis-lox2 as described in Example 2 below). The rAAV-ΔCap-in-cis-lox2 backbone has bidirectional polyA flanked by two Lox sites (lox71 and lox66). The ΔCap backbone is non-functional because a portion of the capsid gene is missing. When a library fragment with mutations induced at specific sites is inserted into the capsid, it becomes a fully functional vector. In cells expressing Cre recombinase, Cre-Lox recombination promotes inversion of the polyA in addition to inversion of the Lox sites to Lox72 and LoxP. (See Figures 1 and 36). The randomized 7-mers and 11-mers disclosed herein are generated using PCR and then inserted into rAAV-ΔCap-in-cis-lox to generate a virus library with randomized insertions or substitutions (e.g., at AA588_589) within the capsid protein sequence. (Figure 1). In the first in vivo selection round, the virus library is injected (e.g., intravenously) into the bloodstream of a transgenic animal expressing Cre recombinase. Tissue is obtained from the transgenic animal after injection into the in vivo environment (e.g., brain / liver). Selective amplification of the reporter gene expression product is used to detect the inverted reporter expression cassette. rAAV in the tissue is isolated, the viral genome around the insertion site is sequenced, and aligned with the AAV9 template DNA fragment. The recovered 7-mers and 11-mers are enriched for the target in vivo environment and cloned into another rAAV-ΔCap-in-cis-lox2 backbone.Then another in vivo selection round is performed. The 7-mers and 11-mers enriched in the target in vivo environment and negatively enriched in the off-target in vivo environment are sequenced using a suitable method, such as next-generation sequencing. Figures 33-35 provide the DNA sequences identified using the methods provided herein.

[0171] The method includes the step of preparing an rAAV genome comprising an AAV capsid gene and a recognition sequence for Cre recombinase. In some cases, the rAAV genome has two recognition sequences for Cre recombinase adjacent to a reporter expression cassette. The recognition sequences for Cre recombinase (e.g., LoxP) are oriented such that inversion of the reporter cassette is promoted in the presence of Cre recombinase in the cell. The method includes the step of transfecting the rAAV genome into a population of cells that express Cre recombinase. Cre recombinase induces an inversion (e.g., "flipping" of a reporter gene into the genome of a transgenic animal). In some cases, the inversion rate (e.g., the expression level of the reporter gene in the target cells) can be measured using any suitable method, such as quantitative polymerase chain reaction, or immunohistochemical examination. The expression level of the reporter gene is compared to a reference value, which in some cases is the inversion rate by a reference AAV (e.g., AAV9). The methods disclosed herein provide a method for detecting an increase in the inversion rate as compared to the inversion rate of a reference AAV in a target in vivo environment. In some cases, a decrease in the inversion rate is detected in off-target cells as compared to the inversion rate of the reference AAV. The rAAV genomes recovered using the methods described herein encode AAV capsid particles (e.g., capsid proteins, capsids) having an increased specificity for target cells and a decreased specificity for off-target cells.

[0172] Methods for producing rAAV disclosed herein are disclosed herein. In some cases, all elements required for AAV production in target cells (e.g., HEK293 cells) are transiently transfected into the target cells using suitable methods known in the art. For example, the rAAV of the present disclosure can be produced by co-transfecting three plasmid vectors: a first vector having an ITR-containing plasmid carrying a transgene (e.g., a therapeutic nucleic acid), a second vector carrying the AAV Rep and Cap genes, and (3) a third vector providing helper genes isolated from adenovirus. The methods described herein generate high-titer AAV vectors that are free of adenovirus. The Cap genes disclosed herein include any one of SEQ ID NOs: 10-434, 860-863, 868-949, 1068-5661, 14841-14880, and 14961-15053, which are DNA sequences encoding the modified AAV capsid protein moieties of the present disclosure. In some cases, the rAAV of the present disclosure is generated using the method described in Challis, R. C. et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat. Protoc.14, 379 (2019), which is hereby incorporated by reference in its entirety. Briefly, triple transfection of HEK293T cells (ATCC) using polyethyleneimine (PEI) is performed, and after 120 hours, the virus is recovered from both the cell lysate and the medium and purified using iodixanol.

[0173] (a) introducing into a cell a nucleic acid comprising: (1) a first nucleic acid sequence encoding a therapeutic gene expression product; (2) a second nucleic acid sequence encoding a viral genome component comprising (i) a replication (Rep) gene encoding a Rep protein and (ii) a modified capsid (Cap) gene encoding a modified AAV capsid protein as described herein; and (3) a third nucleic acid sequence encoding the genome of an AAV helper virus; and (b) encapsulating the first nucleic acid within a capsid to assemble a recombinant AAV (rAAV) capsid having an increased specificity for a target in vivo environment in a subject and a decreased specificity for a non-target in vivo environment as compared to the tropism of the corresponding parental AAV capsid protein. In some instances, the method further comprises packing a first nucleic acid sequence encoding a therapeutic gene expression product so that it is encapsidated by a modified AAV capsid protein. In some embodiments, the rAAV particles are isolated, concentrated, and purified using suitable viral purification methods such as those described herein.

[0174] In a non-limiting example, rAAV is generated by triple transfection of progenitor cells (e.g., HEK293T) using a standard transfection protocol (e.g., PEI). Viral particles are harvested from the medium after a period of time (e.g., 72 hours after transfection) and from the cells and medium at a later time point (e.g., 120 hours after transfection). Viruses present in the medium are concentrated by precipitation with 8% poly(ethylene glycol) and 500 mM sodium chloride, and the precipitated virus is added to a lysate prepared from the harvested cells. The virus is purified using a step gradient of iodixanol (Optiprep, Sigma) (15%, 25%, 40%, and 60%). The virus is concentrated and formulated in PBS. The virus titer is determined by measuring the number of DNaseI-resistant vector genome copies (VG) using qPCR and a linearized genomic plasmid as a control.

[0175] The Rep protein can be selected from the group consisting of Rep78, Rep68, Rep52, and Rep40. The genome of the AAV helper virus contains an AAV helper gene selected from the group consisting of E2, E4, and VA. The second nucleic acid and the first nucleic acid can be in a trans relationship. The second nucleic acid and the first nucleic acid can be in a cis relationship.

[0176] The cell can be selected from the group consisting of human, primate, murine, feline, canine, porcine, ovine, bovine, equine, caprine, and lupine host cells. In some cases, the cell is a progenitor cell or a precursor cell, such as a stem cell. In some cases, the stem cell is a mesenchymal cell, an embryonic stem cell, an induced pluripotent stem cell (iPSC), a fibroblast, or other tissue-specific stem cell. The cell can also be an immortalized cell. In some cases, the immortalized cell is a HEK293 cell. In some cases, the cell is a differentiated cell. Based on the present disclosure provided, it is expected that an AAV capsid can be developed that more efficiently transduces the target cell population by using the system in combination with any transgenic line that expresses recombinase in the target cell type of interest. B. rAAV-Mediated Delivery Method of Heterologous Nucleic Acid

[0177] Disclosed herein is a method of delivering a heterologous nucleic acid (e.g., a therapeutic nucleic acid or a transgene disclosed herein) to a subject in need thereof. The transgene can be encapsidated within the capsid by a recombinant AAV (rAAV) capsid protein or rAAV particles such as those described herein.

[0178] The method, e.g., for scientific research purposes or for generating adoptive cell therapy, can be ex vivo. The subject can be a human primary or mature cell, or a cell line. The subject can be a cell from a monkey, hamster, or mouse. In any case, the delivery can include contacting the composition with the cell or cell line.

[0179] A method, e.g., a method of treating a disease or condition in a subject in need thereof, can be in vivo. In some cases, the subject can be a mammal, e.g., a human or non-human primate, and in such cases, delivery of the composition can include administering the composition to the subject. In some embodiments, delivery of the heterologous nucleic acid includes administering the composition to the subject using any one of the administration routes described herein.

[0180] In some embodiments, a method of increasing transduction of a heterologous nucleic acid into a target in vivo environment includes delivering an rAAV particle described herein that has been engineered to have improved transduction efficiency into the target in vivo environment (e.g., tissue or cell type). In some cases, the improvement in transduction efficiency includes an improvement of 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold, 48-fold, 49-fold, 50-fold, 75-fold or 100-fold or more as compared to a reference AAV. In some cases, the improvement in transduction efficiency is at least 30-fold. In some cases, the improvement in transduction efficiency is at least 40-fold. In some cases, the improvement in transduction efficiency is at least 50-fold. In some cases, the improvement in transduction efficiency is at least 60-fold. In some cases, the improvement in transduction efficiency is at least 80-fold. In some cases, the improvement in transduction efficiency is at least 90-fold. In some cases, the improvement in transduction efficiency is at least 100-fold.

[0181] A method of delivering a heterologous nucleic acid to a target in vivo environment, the method comprising delivering an rAAV particle described herein that has been engineered to have an increased specificity compared to a reference AAV into a target in vivo environment (e.g., a tissue or cell type). The method, in some cases, further comprises detecting whether the rAAV has a greater specificity for the target in vivo environment than the reference AAV, which comprises measuring the level of a gene expression product (e.g., RNA or protein) expressed from the heterologous nucleic acid encapsulated within the capsid by the rAAV in a tissue sample obtained from the target in vivo environment in a subject; and comparing the measured level to a control level (e.g., the level for a gene expression product expressed from a heterologous nucleic acid encapsulated within the capsid by a reference AAV (e.g., AAV9)). Suitable methods for measuring the expression of the gene expression product include luciferase reporter assays and quantitative polymerase chain reaction (qPCR).

[0182] In some cases, the reference AAV has a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or variants thereof. For example, the reference AAV can have a serotype selected from the group consisting of AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0183] Delivery to the CNS

[0184] A method of delivering a heterologous nucleic acid to a target in vivo environment, the method comprising delivering a composition to a target in vivo environment selected from the group consisting of the central nervous system (CNS) in a subject, the composition comprising rAAV particles having an rAAV capsid protein, the rAAV capsid protein encapsidating within the capsid a viral vector encoding a heterologous nucleic acid (e.g., a therapeutic nucleic acid), is provided herein. In some embodiments, the rAAV particles encapsidating the heterologous nucleic acid comprise an engineered rAAV capsid protein and have an increased specificity and in some cases an improved transduction efficiency as compared to a reference AAV when measured in the CNS or PNS of the subject, even when systemically administered to the subject.

[0185] The method comprises delivering rAAV particles comprising an rAAV capsid protein that have an increased specificity and / or an improved transduction efficiency as compared to a reference AAV (e.g., AAV9) when measured in the CNS of the subject. In some embodiments, the delivery is systemic delivery. Alternatively, the delivery is direct (e.g., to the affected part of the CNS).

[0186] The rAAV capsid protein may contain substitutions of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acids presented in the amino acid sequences provided in any one of Tables 2-3 in the amino acid sequence of the parental AAV. In some cases, X1 is selected from the group consisting of A, E, D, G, R, S, and T. In some cases, the insertion further includes 2 amino acids, and X2 is selected from the group consisting of A, G, I, L, M, N, Q, R, T, and Y. In some cases, the insertion further includes 3 amino acids, and X3 is selected from the group consisting of E, K, L, T, and Q. In some cases, the insertion further includes at least 4 amino acids, X1 is selected from the group consisting of A, E, D, G, R, S, and T, X2 is selected from the group consisting of A, G, I, L, M, N, Q, R, T, and Y, X3 is selected from the group consisting of E, K, L, T, and Q, and X4 is selected from the group consisting of G, I, K, L, M, R, T, and V. In some cases, the insertion further includes 5 amino acids, and X5 is selected from the group consisting of A, D, G, P, L, Q, and V. In some cases, the insertion further includes at least 6 amino acids, and X6 is selected from the group consisting of F, K, L, N, P, Q, S, and V. In some cases, the insertion further includes at least 7 amino acids, and X7 is selected from the group consisting of I, K, L, P, S, and V.

[0187] A method comprising delivering rAAV particles encapsulating a heterologous nucleic acid to a target CNS, wherein the rAAV particles comprise (i) an increase in the specificity of the heterologous nucleic acid for the CNS and / or an improvement in transduction efficiency, and the rAAV particles comprise an insertion of at least or about 3, 4, 5, 6, or 7 amino acids of the amino acid sequence TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, or RYQGDSV, or any amino acid sequence provided in Tables 2-3 or Figure 33, at amino acid positions 588_589 of the parental AAV capsid protein, and having an rAAV capsid protein, is disclosed herein. In some embodiments, the delivery is systemic delivery. In some embodiments, the delivery is direct delivery (e.g., injected into an in vivo environment). In some embodiments, the parental AAV capsid protein is an AAV9 capsid protein (e.g., for that provided by SEQ ID NO: 1). In some embodiments, the delivery is more specific than delivery of the heterologous nucleic acid by a reference AAV, such as AAV9. In some embodiments, the delivery is systemic (e.g., intravenous) delivery. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0188] Delivery to the liver

[0189] In some cases, a method of delivering a heterologous nucleic acid comprises delivering a composition to a target in vivo environment in a subject, the composition comprising rAAV particles having an rAAV capsid protein, the rAAV capsid protein encapsulating a viral vector encoding a heterologous nucleic acid (e.g., a therapeutic nucleic acid) within the capsid. In some cases, the target in vivo environment is the liver. In some embodiments, the rAAV particles encapsulating the heterologous nucleic acid comprise a engineered rAAV capsid protein and have an increase in specificity and in some cases an improvement in transduction efficiency when systemically administered to the subject as measured in the target in vivo environment of the subject.

[0190] In some embodiments, the method comprises delivering rAAV particles comprising an rAAV capsid protein, the rAAV particles having an increased specificity for a heterologous nucleic acid and / or an improved transduction efficiency in a target liver as compared to a reference AAV (e.g., AAV9). In some embodiments, the rAAV optimized for targeting to the liver has an amino acid sequence comprising the amino acid sequences provided in SEQ ID NOs: 950-1031 and 15054-15146 (Figure 35).

[0191] An rAAV capsid protein suitable for delivery of a heterologous nucleic acid to the liver can comprise the insertion of at least one amino acid into a parental AAV capsid protein. In some cases, the insertion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acids presented in the amino acid sequences provided in Table 4 or Figure 35.

[0192] A method comprising delivering an rAAV particle encapsulating a heterologous nucleic acid to a target in vivo environment selected from the group consisting of a liver of a subject, the rAAV particle comprising an increase in specificity for the heterologous nucleic acid and / or an improvement in transduction efficiency for the target in vivo environment, the rAAV particle comprising an insertion of at least or about 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acids of the amino acid sequences provided in Table 4 or Figure 35, having an rAAV capsid protein, is disclosed herein. In some embodiments, the delivery is more specific than delivery of the heterologous nucleic acid by a reference AAV, e.g., AAV9. In some embodiments, the method further comprises reducing or decreasing delivery of the heterologous nucleic acid into a non-target in vivo environment, such as the liver, as compared to the reference AAV. In some embodiments, the delivery is characterized by an improvement in the transduction efficiency (e.g., of the heterologous nucleic acid) into the target in vivo environment as compared to the transduction efficiency of the reference AAV into the target in vivo environment. In some embodiments, the delivery is systemic (e.g., intravenous) delivery. In some embodiments, the subject is a mammal. In some cases, the mammal is a human. C. Treatment Methods

[0193] A method of treating a disease or condition in a subject or a symptom of a disease or condition, the method comprising administering to the subject a therapeutically effective amount of one or more compositions (e.g., rAAV particles, AAV vectors, pharmaceutical compositions) disclosed herein, is disclosed herein. In some embodiments, the composition is an rAAV capsid protein as described herein. In some embodiments, the composition is an isolated and purified rAAV capsid protein as described herein. In some embodiments, the rAAV particle encapsulates an AAV vector containing a transgene (e.g., a therapeutic nucleic acid) within the capsid. In some embodiments, the composition is an rAAV capsid protein as described herein conjugated to a therapeutic agent disclosed herein. In some embodiments, the composition is a pharmaceutical composition comprising rAAV particles and a pharmaceutically acceptable carrier. In some embodiments, the one or more compositions are administered to the subject alone (e.g., as a monotherapy). In some embodiments, the one or more compositions are administered in combination with an additional agent. In some embodiments, the composition is a first-line therapy for a disease or condition. In some embodiments, the composition is a second-line, third-line or fourth-line therapy for a disease or condition.

[0194] A method of treating a disease or condition in a subject or a symptom of a disease or condition, the method comprising: (a) diagnosing the subject as having a disease or condition that impairs a target in vivo environment; and (b) treating the disease or condition by administering to the subject a therapeutically effective amount of a composition (e.g., rAAV particles, AAV vectors, pharmaceutical compositions) disclosed herein, wherein the composition has been engineered to have increased specificity for the target in vivo environment, is provided herein.

[0195] A method of treating a disease or condition that affects a target in vivo environment in a subject or a symptom of a disease or condition, the method comprising: (a) administering to the subject a composition (e.g., rAAV particles, AAV vectors, pharmaceutical compositions); and (b) expressing a therapeutic nucleic acid in the target in vivo environment in the subject with increased specificity and / or improved transduction efficiency as compared to a reference AAV, is disclosed herein. In some cases, the reference AAV is AAV9, or a variant thereof.

[0196] A method of treating a disease or condition affecting the central nervous system (CNS) comprises administering rAAV particles to the CNS of a subject, wherein the rAAV particles comprise an rAAV capsid protein having an insertion of at least or about 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acids of the amino acid sequence TALKPFL, TTLKPFL, TLQIPFK, TMQKPFI, RYQGDSV, or any amino acid sequence provided in Tables 2-3 or FIG. 33 at amino acid positions 588_589 of the parental AAV capsid protein. In some cases, the insert is not TLAVPFK, KFPVALT, SVSKPFL, FTLTTPK, MNATKNV, NGGTSSS, TRTNPEA, or YTLSQGW. In some embodiments, the parental AAV capsid protein is an AAV9 capsid protein (e.g., as provided in SEQ ID NO: 1). In some instances, the parental AAV capsid protein comprises an amino acid sequence that is at least 95%, 96%, 96.1, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100.0% identical to SEQ ID NO: 1. In some embodiments, the delivery is more specific than delivery of a heterologous nucleic acid by a reference AAV, such as AAV9. In some embodiments, the delivery is systemic (e.g., intravenous) delivery. In some embodiments, the subject is a human or non-human primate.

[0197] A method of treating a disease or condition affecting a target in vivo environment comprising the liver comprises administering rAAV particles to the target in vivo environment of a subject, wherein the rAAV particles comprise an rAAV capsid protein comprising at least or about 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions of the amino acid sequences provided by any one of SEQ ID NOs: 950-1031 and 15054-15146 (Figure 35). In some embodiments, the method comprises delivering rAAV particles comprising an rAAV capsid protein having an increased specificity for the liver of the subject as compared to a reference AAV (e.g., AAV9). In some embodiments, the rAAV optimized for targeting the liver has an amino acid sequence comprising the amino acid sequences KAYSVQV, PSGSARS, and RTANALG at amino acid positions 588_589 of the parental AAV capsid protein. In some embodiments, the parental AAV capsid protein is the AAV9 capsid protein (e.g., as provided by SEQ ID NO: 1). In some cases, the parental AAV capsid protein comprises an amino acid sequence that is at least 95%, 96%, 96.1, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100.0% identical to SEQ ID NO: 1. In some embodiments, the delivery is more specific than delivery of a heterologous nucleic acid by a reference AAV, e.g., AAV9. In some embodiments, the delivery is systemic (e.g., intravenous, or intranasal). In some embodiments, the subject is a human or non-human primate.

[0198] A method of modulating a target gene expression product, the method comprising administering to a subject in need thereof a composition disclosed herein (e.g., an rAAV particle, an AAV vector, a pharmaceutical composition). For example, the methods provided herein include administering to a subject an rAAV having an rAAV capsid protein that encapsidates within a capsid a viral vector comprising a heterologous nucleic acid that modulates the expression or activity of a target gene expression product. In some embodiments, the disease or condition is characterized by an increase or enhancement in the expression or activity of a gene or its gene expression product as compared to a normal individual. In some cases, administration of a therapeutically effective amount of the composition restores the expression or activity of the gene or its gene expression product to a level that is typical in a normal individual. The term "normal individual" refers to an individual who is not afflicted with a disease or condition characterized by variation in the expression or activity of a gene or its gene expression product.

[0199] Non-limiting examples of genes involved in central nervous system (CNS) diseases or disorders include sarcoglycan alpha (SGCA), glutamate decarboxylase 65 (GAD65), glutamate decarboxylase 67 (GAD67), the CLN2 gene, nerve growth factor (NGF), glial cell-derived neurotrophic factor (GDNF), neurturin, survival motor neuron 1, telomeric (SMN1), beta-glucosylceramidase (GCase), frataxin (FXN), huntingtin (HTN), methyl-CpG-binding protein 2 (MECP2), peroxisome biogenesis factor (PEX), progranulin (GRN), antitubulin agents, copper-zinc superoxide dismutase (SOD1), glucosylceramidase beta (GBA), NPC intracellular cholesterol transporter 1 (NPC1), and NPS3. In some embodiments, the peroxisome biogenesis factor (PEX) is selected from the group consisting of PEX1, PEX2, PEX3, PEX4, PEX5, PEX6, PEX7, PEX10, PEX11β, PEX12, PEX13, PEX14, PEX16, PEX19, and PEX26. Non-limiting examples of genes involved in diseases or disorders of a particular organ (e.g., lung, heart, liver, muscle, eye) include cystic fibrosis transmembrane conductance regulator (CFTR), factor X (FIX), RPE65, retinoid isomerohydrolase (RPE65), sarcoglycan alpha (SGCA), and sarcoplasmic / endoplasmic reticulum Ca2+-ATPase (SERCA2a). In some cases, the expression of a gene, or the expression or activity of a gene expression product, is inhibited by administration of a composition to a subject. In some cases, the expression of a gene, or the expression or activity of a gene expression product, is enhanced by administration of a composition to a subject.

[0200] In some cases, the composition is administered at a dosage level sufficient to deliver from about 0.0001 mg / kg to about 100 mg / kg, about 0.001 mg / kg to about 0.05 mg / kg, about 0.005 mg / kg to about 0.05 mg / kg, about 0.001 mg / kg to about 0.005 mg / kg, about 0.05 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg of the subject's body weight per day, one or more times a day, to obtain the desired therapeutic effect.

[0201] In some cases, the viral genome (vg) concentration of the administered composition is between 1.0×10 11 vg per kilogram (kg) and 1.0×10 16 vg / kg. In some cases, the concentration of infectious particles is at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , or 10 17 . In some cases, the concentration of infectious particles is 2×10 7 , 2×10 8 , 2×10 9 , 2×10 10 , 2×10 11 , 2×10 12 , 2×10 13 , 2×10 14 , 2×10 15 , 2×10 16 , or 2×10 17 . In some cases, the concentration of infectious particles is 3×10 7 , 3×10 8 , 3×10 9 , 3×10 10 , 3×10 11 , 3×10 12 , 3×1013 , 3×10 14 , 3×10 15 , 3×10 16 , or 3×10 17 is. In some cases, the concentration of infectious particles is 4×10 7 , 4×10 8 , 4×10 9 , 4×10 10 , 4×10 11 , 4×10 12 , 4×10 13 , 4×10 14 , 4×10 15 , 4×10 16 , or 4×10 17 is. In some cases, the concentration of infectious particles is 5×10 7 , 5×10 8 , 5×10 9 , 5×10 10 , 5×10 11 , 5×10 12 , 5×10 13 , 5×10 14 , 5×10 15 , 5×10 16 , or 5×10 17 is. In some cases, the concentration of infectious particles is 6×10 7 , 6×10 8 , 6×10 9 , 6×10 10 , 6×10 11 , 6×10 12 , 6×10 13 , 6×10 14 , 6×10 15 , 6×10 16 , or 6×10 17 is. In some cases, the concentration of infectious particles is 7×10 7 , 7×10 8 , 7×10 9 , 7×10 10 , 7×10 11 , 7×10 12 , 7×10 13 , 7×10 14 , 7×10 15 , 7×10 16 , or 7×10 17 is. In some cases, the concentration of infectious particles is 8×107 , 8×10 8 , 8×10 9 , 8×10 10 , 8×10 11 , 8×10 12 , 8×10 13 , 8×10 14 , 8×10 15 , 8×10 16 , or 8×10 17 is. In some cases, the concentration of infectious particles is 9×10 7 , 9×10 8 , 9×10 9 , 9×10 10 , 9×10 11 , 9×10 12 , 9×10 13 , 9×10 14 , 9×10 15 , 9×10 16 , or 9×10 17 is.

[0202] In some embodiments, the administration of the step is performed once. Alternatively, the administration of the step is repeated at least twice. The administration of the step can be performed once a day. In some cases, the administration of the step includes intravenous administration. In some cases, the administration includes transpulmonary administration. In some cases, the administration includes intranasal administration (e.g., spray). In some cases, the administration of the step includes injecting the composition into the target in vivo environment. In some cases, the administration of the step does not include injecting the composition into the target in vivo environment.

[0203] Subject

[0204] Disclosed herein are methods for delivering to a subject at least one of AAV particles and viral vectors, for example, to treat or prevent a disease or condition of the subject. The subject is, in some cases, a mammal. Non-limiting examples of mammals include mice, rats, guinea pigs, rabbits, chimpanzees, or livestock. In some instances, the mammal is a non-human primate. In some instances, the subject is a human. The subject of the present disclosure may not be diagnosed with a disease or condition. Alternatively, the subject may be a patient diagnosed with or suspected of having a disease or disorder.

[0205] disease or condition

[0206] Disclosed herein are methods of treating a disease or condition in a subject by administering a composition comprising rAAV, such as that disclosed herein. At least one advantage of the rAAV disclosed herein is that virtually any disease or condition that would benefit from gene therapy, including, but not limited to, spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), Parkinson's disease, Pompe disease, Huntington's disease, Alzheimer's disease, Batten disease, lysosomal storage disorders, glioblastoma multiforme, Rett syndrome, Leber congenital amaurosis, late-infantile neuronal ceroid lipofuscinosis (LINCL), chronic pain, stroke, spinal cord injury, traumatic brain injury, and lysosomal storage disorders, can be treated using rAAV.

[0207] The disease or condition may, in some embodiments, be characterized by a reduction or decrease in the expression or activity of a gene or its gene expression product as compared to a normal individual. In some embodiments, it is characterized by an increase or enhancement in the expression or activity of a gene or its gene expression product as compared to a normal individual.

[0208] In some cases, the disease or condition is localized to a specific in vivo environment of the subject, such as the brain or liver. The compositions of the present disclosure are particularly useful for treating the diseases or conditions described herein, as they deliver therapeutic nucleic acids engineered to specifically target the in vivo environment and modulate the activity or expression of target gene expression products involved in the etiology or pathogenesis of the disease or condition.

[0209] In some cases, the disease or condition includes a disease or condition of the central nervous system (CNS). Non-limiting examples of CNS diseases include septum pellucidum defect, acid lipase disease, acid maltase deficiency, acquired epileptic aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Adie pupil, Adie syndrome, adrenoleukodystrophy, agenesis of the corpus callosum, agnosia, Aicardi syndrome, Aicardi-Goutières syndrome disorder, AIDS-neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angelman syndrome, angiomatosis, anoxia, antiphospholipid antibody syndrome, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger syndrome, ataxia, ataxia telangiectasia, ataxia and cerebellar or spinocerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic neuropathy, back pain, Barth syndrome, Batten disease, Becker type muscular dystrophy, Behçet's disease, Bell palsy, benign essential blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhardt-Roth syndrome, Binswanger disease, blepharospasm, Bloch-Sulzberger syndrome, birth brachial plexus injury, brachial plexus injury, Bradberry-Eggleston syndrome, brain and spinal cord tumors, cerebral aneurysm, brain injury, Brown-Séquard syndrome, bulbospinal muscular atrophy, cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, causalgia, cavernoma, cavernous hemangioma, cavernous vascular malformation, central cervical cord syndrome, central cord syndrome, central pain syndrome, central pontine myelinolysis, craniofacial disorder, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral beriberi, cerebral cavernous vascular malformation, cerebral gigantism, hypoxic encephalopathy, cerebral palsy, cerebro-oculo-facio-skeletal syndrome (COFS), Charcot-Marie-Tooth disease, Charcot-Marie-Tooth syndrome, classical rhizomelic chondrodysplasia punctata (RCDP), Chiari malformation, cholesterol ester storage disease, chorea, acanthocytic chorea, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, cocaine syndrome type II, Coffin-Lowry syndrome, corpora quadrigemina, coma, complex regional pain syndrome, congenital facial diplegia, congenital myasthenia gravis,Congenital myopathy, congenital cavernous angioma, corticobasal degeneration, cranial arteritis, craniosynostosis, Creutzfeldt encephalitis, Creutzfeldt-Jakob disease, cumulative traumatic injury, Cushing syndrome, cytomegalovirus inclusion disease, cytomegalovirus infection, dancing eyes-dancing feet syndrome, Dandy-Walker syndrome, Dawson disease, deafness, Dromolaxia syndrome, Dejerine-Klumpke paralysis, dementia, multi-infarct dementia, semantic dementia, subcortical dementia, Lewy body dementia, dentatorubral-pallidoluysian atrophy, dentatorubral atrophy, dermatomyositis, developmental apraxia, Devic syndrome, diabetic neuropathy, disseminated sclerosis, Drave syndrome, Duchenne muscular dystrophy, autonomic neuropathy, dysgraphia, dyslexia, dysphagia, integrative movement disorder, myoclonic cerebellar ataxia, progressive cerebellar ataxia, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalitis lethargica, brain hernia, encephalopathy, encephalopathy (familial neonatal), encephalotrigeminal angiomatosis, epilepsy, epileptic hemiplegia, Erb paralysis, Erb-Duchenne and Dejerine-Klumpke paralysis, essential tremor, extra-pontine myelinolysis, Fabry disease, Fahr syndrome, absence, familial dysautonomia, familial angioma, familial idiopathic basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Farber disease, febrile convulsion, fibromuscular dysplasia, Fisher syndrome, hypotonic child syndrome, foot drop, Friedreich ataxia, frontotemporal dementia, Gaucher disease, generalized gangliosidosis, Gerstmann syndrome, Gerstmann-Straussler-Scheinker disease, giant axonal neuropathy, giant cell arteritis, cytomegalovirus inclusion body disease, glioblastoma, globoid cell leukodystrophy, glossopharyngeal neuralgia, glycogenosis, Guillain-Barré syndrome, Hallervorden-Spatz disease, head injury, headache, persistent unilateral headache, hemifacial spasm, alternating hemiplegia, hereditary neuropathy, hereditary spastic paraplegia, polyneuropathy type hereditary ataxia, herpes zoster, Ramsay Hunt syndrome, Hirayama syndrome, Holmes-Adie syndrome, holoprosencephaly, HTLV-1 associated myelopathy, Hughes syndrome, Huntington disease, hydranencephaly, hydrocephalus, normal pressure hydrocephalus, syringomyelia, hyperadrenocorticism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile hypotonia, infantile neuroaxonal dystrophy, infantile phytanic acid storage disease, infantile Refsum disease,Infantile spasms, inflammatory myopathy, foramen occipitalis, intestinal lipodystrophy, intracranial cyst, intracranial hypertension, Isaacs syndrome, Joubert syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsbourne syndrome, Klein-Levin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüver-Bucy syndrome, Korsakoff amnesia syndrome, Krabbe disease, Kugelberg-Welander disease, kuru, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral myeloproliferative syndrome, learning disabilities, Leigh syndrome disease, Lennox-Gastaut syndrome, Lesch-Nyhan syndrome, leukodystrophies, Levin-Critchley syndrome, dementia with Lewy bodies, lipid storage diseases, lipoid proteinosis, lissencephaly, locked-in syndrome, Lou Gehrig's disease, lupus - neurological sequelae, Lyme disease - neurological complications, Machado-Joseph disease, megaencephaly, megalencephaly, Melkersson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes disease, dyssensory femoral neuralgia, metachromatic leukodystrophy, microcephaly, migraine, Miller-Fisher syndrome, mild stroke, mitochondrial myopathy, Mebiovascular disease, Streptococcus aureus syndrome, unilateral muscular atrophy, motor neuron disease, moyamoya disease, mucolipidosis, mucopolysaccharidosis, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, congenital myasthenia, myasthenia gravis, diffuse myeloablative sclerosis, myoclonic encephalopathy of infancy, myoclonus, myopathy, congenital myopathy, thyrotoxic myopathy, myotonia, congenital myotonia, narcolepsy, neuroacanthocytosis, neurodegeneration with cerebral iron deposition, neurofibromatosis, neuroleptic malignant syndrome, AIDS Neurological complications, Neurological complications of Lyme disease, Neurological outcome of cytomegalovirus infection, Neurological manifestations of Pompe disease, Neurological sequelae of lupus, Neuromyelitis optica, Neuromyotonia, Neuronal ceroid lipofuscinosis, Neuronal migration disorder, Hereditary neuropathies, Neurosarcoidosis, Neurosyphilis, Neurotoxicity, Cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, Occipital neuralgia, Ohtahara syndrome, Olivopontocerebellar atrophy, Opsoclonus-myoclonus, Orthostatic hypotension, Overuse syndrome, Chronic pain, Pantothenate kinase-associated neurodegeneration, Paraneoplastic syndromes,Abnormal perception, Parkinson's disease, paroxysmal choreoathetosis, paroxysmal hemicrania, Parry-Romberg, Pelizaeus-Merzbacher disease, Pena-Shokker syndrome type II, nerve root cyst, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorder, phytanic acid storage disease, Pick's disease, compressed nerve, piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, porencephaly, post-polio syndrome, postherpetic neuralgia, postinfectious encephalomyelitis, orthostatic hypotension, orthostatic tachycardia syndrome, orthostatic tachycardia syndrome, primary dentate nucleus atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive facial hemiatrophy, progressive gait ataxia, progressive multifocal leukoencephalopathy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, prosopagnosia, pseudotumor cerebri, psychogenic movement, Ramsay Hunt syndrome type I, Ramsay Hunt syndrome type II, Rasmussen encephalitis, reflex sympathetic dystrophy syndrome, Refsum disease, infantile Refsum disease, repetitive movement disorder, repetitive strain injury, restless legs syndrome, retrovirus-associated myelopathy, Rett syndrome, Riley-Day syndrome, rheumatoid encephalitis, sacral nerve root cyst, St. Vitus' dance, salivary gland disease, Sandhoff disease, Schilder's disease, split-brain syndrome, Zitelberger's disease, paroxysmal disorder, semantic dementia, septo-optic dysplasia, severe myoclonic epilepsy in infancy (SMEI), shaken baby syndrome, herpes zoster, Shy-Drager syndrome, Sjogren's syndrome, sleep apnea, sleeping sickness, Sotos syndrome, spasm, diastematomyelia, spinal cord infarction, spinal cord injury, spinal cord tumor, spinal muscular atrophy, spinocerebellar atrophy, spinocerebellar degeneration, Steele-Richardson-Olszewski syndrome, stiff-person syndrome, striatonigral degeneration, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subcortical arteriosclerotic encephalopathy, short-lasting unilateral neuralgiform (SUNCT) headache, dysphagia, Sydenham's chorea, absence seizure, tabes dorsalis, syringomyelia, syringohydromyelia, systemic lupus erythematosus, spinal cord abscess, tardive dyskinesia, Tarlov cyst, Tay-Sachs disease, temporal arteritis, tethered cord syndrome, Tommasen myotonia, thoracic outlet syndrome, thyrotoxic myopathy, painful tic, Todd paralysis, Tourette syndrome, transient ischemic attack, transmissible spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgiaTropical spastic paraparesis, Troyer syndrome, tuberous sclerosis, angiofibroma, central and peripheral nervous system vasculitis syndromes, von Economo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Werdnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, infantile spasms, Whipple disease, Williams syndrome, Wilson disease, Wolman disease, and X-linked spinal muscular atrophy are included.

[0210] In some cases, the disease or condition includes or is associated with a liver disease or disorder. Non-limiting examples include bile acid synthesis disorders (e.g., Wilson disease, progressive familial intrahepatic cholestasis type 3), carbohydrate metabolism disorders (e.g., hereditary fructose intolerance, glycogenosis type IV), amino acid metabolism disorders (e.g., tyrosinemia type I), urea cycle disorders (e.g., argininosuccinate lyase deficiency, citrin deficiency (CTLN2, NICCD)), lipid metabolism disorders (e.g., cholesteryl ester storage disease), and others including, but not limited to, alpha-1 antitrypsin deficiency, cystic fibrosis, hereditary hemochromatosis, Alström syndrome, and congenital hepatic fibrosis.

[0211] In some cases, the disease or condition is a liver disease or condition. Non-limiting examples of liver diseases or disorders include Alagille syndrome, alcohol-related liver disease, alpha-1 antitrypsin deficiency, autoimmune hepatitis, benign liver tumors, biliary obstruction, cirrhosis, Crigler-Najjar syndrome, galactosemia, Gilbert syndrome, hemochromatosis, hepatic encephalopathy, hepatitis A, hepatitis B, hepatitis C, hepatorenal syndrome, intrahepatic cholestasis of pregnancy (ICP), lysosomal acid lipase deficiency (LAL-D), liver cysts, liver cancer, neonatal jaundice, non-alcoholic fatty liver disease, primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), Reye syndrome, glycogenosis type I, and Wilson disease.

[0212] A method of treating a disease or condition associated with abnormal expression or activity of a target gene or its gene expression product, the method comprising modulating the expression or activity of the target gene or gene expression product in a subject by administering an rAAV encapsulating a heterologous nucleic acid of the present disclosure is provided herein. In some cases, the administration is systemic administration. In some cases, the expression or activity of the target gene or gene expression product is decreased compared to that in a normal (non-diseased) individual, and the administration of rAAV to the subject is sufficient to increase the expression or activity of the target gene or gene expression product to that of a normal individual. In some cases, the expression or activity of the gene or gene expression product is increased compared to that in a normal individual, and the administration of rAAV to the subject is sufficient to decrease the expression or activity of the target gene or gene expression product. In a non-limiting example, in some cases, an rAAV disclosed herein encapsulating a therapeutic nucleic acid that is a silencing RNA (siRNA) or other RNAi having a loss-of-function effect on PSEN1 mRNA is administered to a subject diagnosed with Alzheimer's disease caused by a gain of function of presenilin 1 and / or presenilin 2 (encoded by the genes PSEN1 and PSEN2, respectively).

[0213] Also provided is a method of treating or preventing a disease or condition disclosed herein in a subject, the method comprising administering to the subject a therapeutically effective amount of an AAV vector comprising a nucleic acid sequence encoding a therapeutic gene expression product described herein. The AAV vector can be encapsidated into a modified capsid protein or AAV viral particle described herein. In some cases, the therapeutic gene expression product is effective in modulating the activity or expression of a target gene or gene expression product.

[0214] Formulations, Dosages, and Routes of Administration

[0215] Generally, the methods disclosed herein include administering a therapeutic rAAV composition by systemic administration. In some cases, the method includes administering the therapeutic rAAV composition by oral administration. In some cases, the method includes administering the therapeutic rAAV composition by intraperitoneal injection. In some cases, the method includes administering the therapeutic rAAV composition in the form of a rectal suppository. In some cases, the method includes administering the therapeutic rAAV composition by intravenous (“i.v.”) administration. The therapeutic rAAV compositions disclosed herein can also be administered by other routes, such as subcutaneous injection, intramuscular injection, intradermal injection, transdermal injection, transdermal administration, intranasal administration, intralymphatic injection, rectal administration, intragastric administration, intraocular administration, intracerebroventricular administration, into the subarachnoid space, or by any other suitable parenteral administration. In some cases, the method includes administering the therapeutic rAAV composition by topical administration, such as by rubbing or otherwise contacting the rAAV composition to a target area (e.g., the tympanic membrane, the bladder) of the subject. In some embodiments, a local delivery route closer to the site of injury or inflammation is preferred over a systemic route. The route, dosage, timing, and duration of administration of the therapeutic agent can be adjusted. In some embodiments, administration of the therapeutic agent is before or after the onset of either or both acute and chronic symptoms of the disease or condition.

[0216] The effective dose and dosage of the pharmaceutical composition for preventing or treating a disease or condition disclosed herein are defined by the beneficial response observed with respect to the disease or condition, or the symptoms of the disease or condition. Beneficial responses include prevention, alleviation, suppression or cure of the disease or condition, or the symptoms of the disease or condition. In some embodiments, a beneficial response can be measured by detecting a measurable improvement in the presence, level or activity of a biomarker, the risk profile of the transcriptome, or the gut microbiota in the subject. As used herein, "improvement" refers to a shift in the presence, level or activity thereof to a certain presence, level or activity observed in a normal individual (e.g., an individual not suffering from a disease or condition). If the therapeutic rAAV composition is not effective in treatment or does not result in a sufficient reduction of the disease or condition, or the symptoms of the disease or condition, the dosage and / or the route of administration can be changed, or additional agents can be administered to the subject together with the therapeutic rAAV composition. In some embodiments, when the regimen of the therapeutic rAAV composition is initiated, the patient is also withdrawn from a second treatment regimen (e.g., a stepwise reduction in dosage).

[0217] In some embodiments, the pharmaceutical composition according to the present disclosure can be administered at a dosage level sufficient to deliver about 0.0001 mg / kg to about 100 mg / kg, about 0.001 mg / kg to about 0.05 mg / kg, about 0.005 mg / kg to about 0.05 mg / kg, about 0.001 mg / kg to about 0.005 mg / kg, about 0.05 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg per day of the subject's body weight, once or multiple times a day, to obtain the desired therapeutic, diagnostic or prophylactic effect. It will be understood that the above dosage concentrations can be converted by those skilled in the art to vg per kg, i.e., viral genome, or to the total viral genome administered.

[0218] In some cases, the dosage of the pharmaceutical composition is at least or about 10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、10 13 、10 14 、10 15 、10 16 、or 10 17 and may include the concentration of infectious particles. In some cases, the concentration of infectious particles is 2×10 7 、2×10 8 、2×10 9 、2×10 10 、2×10 11 、2×10 12 、2×10 13 、2×10 14 、2×10 15 、2×10 16 、or 2×10 17 . In some cases, the concentration of infectious particles is 3×10 7 、3×10 8 、3×10 9 、3×10 10 、3×10 11 、3×10 12 、3×10 13 、3×10 14 、3×10 15 、3×10 16 、or 3×10 17 . In some cases, the concentration of infectious particles is 4×10 7 、4×10 8 、4×10 9 、4×10 10 、4×10 11 、4×10 12 、4×10 13 、4×10 14 、4×10 15 、4×10 16 、or 4×10 17 . In some cases, the concentration of infectious particles is 5×10 7 、5×10 8 、5×10 9 、5×10 10 、5×1011 , 5×10 12 , 5×10 13 , 5×10 14 , 5×10 15 , 5×10 16 , or 5×10 17 is. In some cases, the concentration of infectious particles is 6×10 7 , 6×10 8 , 6×10 9 , 6×10 10 , 6×10 11 , 6×10 12 , 6×10 13 , 6×10 14 , 6×10 15 , 6×10 16 , or 6×10 17 is. In some cases, the concentration of infectious particles is 7×10 7 , 7×10 8 , 7×10 9 , 7×10 10 , 7×10 11 , 7×10 12 , 7×10 13 , 7×10 14 , 7×10 15 , 7×10 16 , or 7×10 17 is. In some cases, the concentration of infectious particles is 8×10 7 , 8×10 8 , 8×10 9 , 8×10 10 , 8×10 11 , 8×10 12 , 8×10 13 , 8×10 14 , 8×10 15 , 8×10 16 , or 8×10 17 is. In some cases, the concentration of infectious particles is 9×10 7 , 9×10 8 , 9×10 9 , 9×10 10 , 9×10 11 , 9×10 12 , 9×10 13 , 9×10 14 , 9×10 15 , 9×10 16 , or 9×1017 It is.

[0219] In some embodiments, formulations of pharmaceutically acceptable excipients and carrier solutions suitable for delivery of the rAAV compositions described herein, as well as suitable dosing and treatment regimens for using the specific compositions described herein in various treatment regimens, are disclosed herein. In some embodiments, the amount of therapeutic gene expression product in each of the compositions useful for treatment can be prepared such that a suitable dosage will result in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf-life of the product, and other pharmacological considerations will be taken into account by those skilled in the art in preparing such pharmaceutical formulations, and thus, various dosages and treatment regimens may be desirable. In some cases, the rAAV composition is a pharmaceutically acceptable formulated pharmaceutical composition for any of intravitreal delivery, intravitreal delivery, parenteral delivery, subcutaneous delivery, intravenous delivery, intracerebroventricular delivery, intramuscular delivery, intrathecal delivery, oral delivery, intraperitoneal delivery, delivery by oral or nasal inhalation, or delivery by direct injection into one or more cells, tissues or organs by direct injection, as disclosed herein.

[0220] In some embodiments, pharmaceutical forms of AAV-based viral compositions suitable for use as an injectable include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycols, etc.), suitable mixtures thereof, and / or vegetable oils. Appropriate fluidity can be maintained, for example, by the use of coating agents such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents such as sugars and sodium chloride. Sustained absorption of the injectable composition can be brought about by the use in the composition of agents that delay absorption, such as aluminum monostearate and gelatin.

[0221] In some cases, for the administration of an aqueous injection solution, for example, the solution can be suitably buffered as necessary and the liquid diluent can be made isotonic first with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Depending on the condition of the subject to be treated, inevitable variations in the dosage will occur. In any case, the person responsible for the administration will determine the dosage suitable for the individual subject. Further, for administration to humans, the preparation must meet the requirements as sterility, pyrogenicity, and general safety and purity criteria as requirements by the standards of the FDA Office of Biologics.

[0222] A sterile injectable solution comprising the rAAV composition disclosed herein, wherein the rAAV composition disclosed herein is admixed in a necessary amount with a suitable solvent containing, optionally, some of the other ingredients listed above, and then sterilized by filtration, is disclosed herein. Generally, a dispersion is prepared by admixing various sterilized active ingredients with a sterile vehicle containing a base dispersion medium and other necessary ingredients from those listed above. In the case of a sterile powder for the preparation of a sterile injectable solution, a preferred method of preparation is by vacuum drying and lyophilization, which results in a powder of the active ingredient with any additional desired ingredients added, from its previously sterile-filtered solution. An injectable solution may be advantageous for systemic administration, for example, by intravenous administration.

[0223] Neutral or salt forms of the formulations are also provided herein. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein), and acid addition salts formed with inorganic acids such as hydrochloric acid or phosphoric acid, or with organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups can also be derived from inorganic bases such as sodium, potassium, ammonium, calcium or ferric hydroxide, and can also be derived from organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc. When formulated, the solution will be administered in an amount effective for treatment in a manner compatible with the dosage formulation. The formulations are readily administered in various dosage forms such as injectable solutions, drug-release capsules, etc.

[0224] Transpulmonary administration can be advantageously achieved by buccal administration. In some embodiments, the formulation may comprise dry particles containing the active ingredient. In such embodiments, the dry particles may have a diameter in the range of about 0.5 nm to about 7 nm or about 1 nm to about 6 nm. In some embodiments, the formulation may be in the form of a dry powder for administration using a device comprising a dry powder reservoir that can direct the flow of a propellant to disperse the dry powder. In some embodiments, a self-propelled solvent / powder metering supply container may be used. In such embodiments, the active ingredient may be dissolved and / or suspended in a low-boiling propellant within a sealed container. Such powders may comprise particles at least 98% by weight of the particles having a diameter greater than 0.5 nm and at least 95% by number of the particles having a diameter less than 7 nm. Alternatively, at least 95% by weight of the particles have a diameter greater than 1 nm and at least 90% by number of the particles have a diameter less than 6 nm. The dry powder composition may contain a solid fine powder diluent such as sugar and is conveniently provided in a unit dosage form. The low-boiling propellant generally includes a liquid propellant having a boiling point of less than 65°F at atmospheric pressure. Generally, the propellant may constitute 50% to 99.9% (w / w) of the composition, and the active ingredient may constitute 0.1% to 20% (w / w) of the composition. The propellant may further contain additional components, such as liquid non-ionic and / or solid anionic surfactants and / or solid diluents (which may have the same order of particle size as the particles containing the active ingredient).

[0225] A pharmaceutical composition formulated for pulmonary delivery can provide the active ingredient in the form of droplets of a solution and / or a suspension. Such a formulation can be prepared, packaged and / or sold as an aqueous and / or diluted alcoholic solution and / or suspension, optionally sterile, containing the active ingredient, and can be conveniently administered using any spraying and / or atomizing device. Such a formulation may further contain one or more additional components including, but not limited to, flavoring agents such as sodium saccharin, volatile oils, buffering agents, surfactants, and / or preservatives such as methyl hydroxybenzoate. The droplets provided by this route of administration can have an average diameter in the range of about 0.1 nm to about 200 nm. The formulations described herein that are useful for pulmonary delivery may also be useful for nasal delivery. In some embodiments, a formulation for nasal administration comprises a coarse powder containing the active ingredient, the coarse powder having an average particle size of about 0.2 μm to 500 μm. Such a formulation is administered in the manner in which a snuff is taken, i.e., by rapid inhalation via the nose from a powder container held near the nose.

[0226] Formulations suitable for nasal administration may, for example, contain as little as about 0.1% (w / w) to as much as about 100% (w / w) of the active ingredient, and may also contain one or more of the additional ingredients described herein. The pharmaceutical composition can be prepared, packaged, and / or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets and / or troches made using conventional methods, and may, for example, contain 0.1% to 20% (w / w) of the active ingredient, the balance being an orally soluble and / or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternatively, formulations suitable for buccal administration may contain powders and / or aerosolized and / or nebulized solutions and / or suspensions containing the active ingredient. Such powdered, aerosolized, and / or nebulized formulations may, when dispersed, have an average particle size and / or droplet size in the range of about 0.1 nm to about 200 nm, and may further contain one or more of any additional ingredients described herein.

[0227] Suitable dosages and dosing regimens to be administered to a subject are determined by factors including, but not limited to, the particular therapeutic rAAV composition, the medical condition and its severity, and the identity of the subject in need of treatment (e.g., weight, gender, age), and can be determined according to the particular circumstances surrounding the case, including, for example, the specific agent to be administered, the route of administration, the condition to be treated, and the subject or host to be treated.

[0228] The amount of the AAV composition and the number of administrations of such composition will be within the purview of those of ordinary skill in the art who will benefit from the present teachings. However, it is likely that administration of a therapeutically effective amount of the disclosed composition can be effected by a single administration, such as a single injection, of a sufficient number of infectious particles to provide a therapeutic benefit to the patient to be so treated. This is made possible, at least in part, by the fact that certain target cells (e.g., neurons) do not divide and thus do not require multiple or chronic administrations.

[0229] Alternatively, in some situations, it may be desirable to provide multiple or continuous administrations of an AAV vector composition over a relatively short period of time, or over a relatively long period of time, depending on the judgment of the physician overseeing the administration of such a composition. For example, the number of infectious particles administered to a mammal may be on the order of about 10 7 10 8 10 9 10 10 10 11 10 12 10 13 particles / ml or even more, and this may be administered as a single dose, or divided into two or more administrations, as needed to effect the treatment of the particular disease or disorder to be treated. In fact, in certain embodiments, it may be desirable to administer two or more different AAV vector compositions, alone or in combination with one or more other therapeutic agents, to achieve the desired effect of a particular treatment regimen. In various embodiments, the daily dosage and unit dosage will vary depending on several variable factors including, but not limited to, the activity of the therapeutic rAAV composition being used, the disease or condition being treated, the method of administration, the requirements of the individual subject, the severity of the disease or condition to be treated, and the judgment of the practitioner.

[0230] In some embodiments, administration of the therapeutic rAAV composition is once per hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, once per day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, once per month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, once per year, 2 years, 3 years, 4 years, or once every 5 years or 10 years. The effective dosage range can be adjusted based on the response of the subject to the treatment. Some administration routes will require a higher concentration of the therapeutically effective amount than other routes.

[0231] Unexpectedly, considering the advantages of the present disclosure, in certain embodiments where the patient's condition does not improve, at the discretion of the physician, the administration of the therapeutic rAAV composition is chronic, i.e., over a long period including throughout the patient's life, to improve or otherwise control or limit the symptoms of the patient's disease or condition. In certain embodiments where the patient's condition improves, the dose of the therapeutic rAAV composition being administered may be temporarily reduced or temporarily discontinued for a certain period (i.e., "drug holiday"). In certain embodiments, the length of the drug holiday is between 2 days and 1 year, which includes, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or a period longer than 28 days. The dose reduction during the drug holiday is, by way of example only, a 10% to 100% reduction, which includes, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and 100% reduction. In certain embodiments, the dose of the drug being administered may be temporarily reduced or temporarily discontinued for a certain period (i.e., "drug diversion"). In certain embodiments, the length of the drug diversion is between 2 days and 1 year, which includes, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or a period longer than 28 days. The dose reduction during the drug diversion is, by way of example only, a 10% to 100% reduction, which includes, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and 100% reduction. After a suitable period, the normal dosing schedule is resumed as needed.

[0232] In some embodiments, when improvement in the patient's condition occurs, a maintenance dose is administered as needed. Thereafter, in certain embodiments, the dosage or the frequency of administration or both are reduced to a level at which improvement of the disease, disorder or condition is maintained, depending on the symptoms. However, in certain embodiments, the patient requires long-term intermittent treatment based on recurrence of any of the symptoms.

[0233] The toxicity and therapeutic efficacy of such treatment regimens are determined by standard pharmaceutical procedures including, but not limited to, determination of LD50 and ED50 in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. In certain embodiments, data obtained from cell culture assays and animal studies are used in formulating a therapeutically effective daily dosage range and / or a therapeutically effective unit dosage for use in mammals, including humans. In some embodiments, the dosage of the therapeutic rAAV compositions described herein is within the range of circulating concentrations that include the ED50 with minimal toxicity. In certain embodiments, the daily dosage range and / or unit dosage vary within this range depending on the dosage form utilized and the route of administration employed.

[0234] Additional therapeutic agents

[0235] Therapeutic nucleic acids can be used alone or in combination with additional therapeutic agents (collectively, "therapeutic agents"). In some cases, the "additional therapeutic agents" as used herein are administered alone. Therapeutic agents may be administered together or sequentially in combination therapies. Combination therapies may be administered on the same day, or may be administered one or more days, weeks, months or years apart. In some cases, the therapeutic nucleic acids provided herein are administered when it is determined that a first-choice treatment has not been effective in a subject.

[0236] The additional therapeutic agent can include small molecules. The additional therapeutic agent can include an antibody or an antigen-binding fragment thereof. The additional therapeutic agent can include cell-based therapies. Exemplary cell-based therapies include, but are not limited to, immune effector cell therapy, chimeric antigen receptor T cell (CAR-T) therapy, natural killer cell therapy, and chimeric antigen receptor natural killer (NK) cell therapy. Any of NK cells, or CAR-NK cells, or a combination of NK cells and CAR-NK cells can be used in combination with the methods disclosed herein. In some embodiments, NK cells and CAR-NK cells are derived from human induced pluripotent stem cells (iPSCs), umbilical cord blood, or cell lines. NK cells and CAR-NK cells can include cytokine receptors and suicide genes. The cell-based therapy can include stem cell therapy. The stem cell therapy can be embryonic stem cells or somatic stem cells. The stem cells can be isolated from a donor (allogeneic) or from the subject (autologous). The stem cells can be expanded adipose-derived stem cells (eASCs), hematopoietic stem cells (HSCs), mesenchymal stem (stromal) cells (MSCs), or induced pluripotent stem cells (iPSCs) derived from the subject's cells. III. Kit

[0237] Kits comprising the compositions disclosed herein are disclosed herein. Also disclosed herein are kits for the treatment or prevention of diseases or conditions of the central nervous system (CNS) or target organs or environments (e.g., the liver). In some instances, the disease or condition is cancer, a pathogen infection, a lung disease or condition, a neurological disease, a muscle disease, or an immune disorder, such as those described herein. In one embodiment, the kit can comprise a therapeutically or prophylactically effective amount of a composition of rAAV particles encapsidating within the capsid a recombinant AAV vector encoding a therapeutic nucleic acid (e.g., a therapeutic nucleic acid) and a recombinant AAV (rAAV) capsid protein of the present disclosure. In another embodiment, the kit can comprise, in a unit dosage form expressing a therapeutic nucleic acid, a therapeutically or prophylactically effective amount of a composition comprising cells modified by an rAAV as described herein ("modified cells"). In some embodiments, the kit comprises a sterile container capable of holding the therapeutic composition, such container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a pouch, a blister pack, or other suitable container forms known in the art. Such container can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding pharmaceuticals.

[0238] In some cases, the rAAV is provided together with instructions for use for administering the rAAV to a subject suffering from or at risk of developing a disease or condition (e.g., a disease of the CNS, PNS, liver, etc.). The instructions for use can generally include information about the use of the composition for the treatment or prevention of the disease or condition.

[0239] In some cases, the kit can comprise allogeneic cells. In some cases, the kit can comprise cells that can comprise genomic modifications. In some cases, the kit can comprise "off-the-shelf" cells. In some cases, the kit can comprise cells that can be expanded for clinical use. In some cases, the kit can contain research content.

[0240] In some cases, the instructions for use include at least one of the following: a description of the therapeutic rAAV composition; a dosing schedule and administration for the treatment or prevention of the diseases or conditions disclosed herein; precautions for use; warnings; indications; contraindications; overdose information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions for use may be printed directly on the container (if present), or may be present as a label affixed to the container, or may be present as a separate sheet, pamphlet, card or holder supplied within or with the container. In some cases, the instructions for use provide procedures for administering rAAV alone to a subject. In some cases, the instructions for use provide procedures for administering rAAV to a subject at least about 1 hour (hr), 2 hr, 3 hr, 4 hr, 5 hr, 6 hr, 7 hr, 8 hr, 9 hr, 10 hr, 11 hr, 12 hr, 13 hr, 14 hr, 15 hr, 16 hr, 17 hr, 18 hr, 19 hr, 20 hr, 21 hr, 22 hr, 23 hr, 24 hr, 25 hr, 26 hr, 27 hr, 28 hr, 29 hr, 30 hr before or after administration of an additional therapeutic agent disclosed herein, or within 2 days, 3 days, 4 days, 5 days, 6 days or 7 days before or after its administration. In some instances, the instructions for use specify that rAAV is formulated for intravenous administration. IV. Definitions

[0241] The terminology used herein is for the purpose of describing particular cases only and is not intended to be limiting. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise. Further, the terms "including", "includes", "having", "has", "with", or variants thereof, as used in either the description of the embodiments for carrying out the invention and / or the claims, are intended to be as inclusive as the term "comprising".

[0242] The terms "about" or "approximately" mean within an acceptable error range of a particular value as determined by one of ordinary skill in the art, and this acceptable error range will in part depend on the method by which the value is measured or determined, e.g., limitations of the measuring system. For example, "about" may mean within one standard deviation of a given value according to convention, or it may mean a standard deviation greater than one. When a particular value is recited in the present application and the claims, unless otherwise stated, the term "about" is to be taken to mean an acceptable error range of the particular value.

[0243] As used herein, "consisting essentially of" when used to define compositions and methods is intended to mean excluding any elements other than those that are essential to the combination for the stated purpose. Thus, a composition consisting essentially of the elements as defined herein will not exclude other materials or steps that do not substantially affect the basic novel features of the disclosure recited in the claims, such as compositions for treating skin disorders such as acne, eczema, psoriasis, and rosacea.

[0244] The terms "homologous", "homology", or "percent homology" are used herein to generally mean an amino acid sequence or nucleic acid sequence having the same or a similar sequence as a reference sequence. The percent homology of a sequence can be determined using the most recent version of BLAST as of the filing date of the present application.

[0245] The terms "increased" or "increase" are used herein to generally mean a statistically significant amount of increase. In some embodiments, the terms "increased" or "increase" mean an increase of at least 10% compared to a reference level, e.g., at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% increase compared to a reference level, standard or control, or an increase up to and including 100%, or any increase between 10 - 100%. Other examples of "increase" include an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or greater compared to a reference level.

[0246] The terms "decreased" or "decrease" are used herein to generally mean a statistically significant amount of decrease. In some embodiments, "decreased" or "decrease" means a decrease of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% decrease compared to a reference level, or a decrease up to and including 100% (e.g., a level that has disappeared or is undetectable compared to a reference level), or any decrease between 10 - 100%. With respect to a marker or symptom, these terms mean a statistically significant decrease in such levels. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and preferably falls to a level recognized as within the normal range for an individual not suffering from a given disease.

[0247] The term "subject" is any organism. In some cases, the organism is a mammal. Non-limiting examples of mammals include any member of the class Mammalia: humans, non-human primates such as chimpanzees, as well as other apes and monkey species; domestic animals such as cows, horses, sheep, goats, pigs; companion animals such as rabbits, dogs and cats; laboratory animals including rodents such as rats, mice and guinea pigs. In one aspect, the mammal is a human. The term "animal" as used herein includes humans and non-human animals. In one embodiment, the "non-human animal" is a mammal, such as a rodent, such as a rat or a mouse. In some cases, the subject is a patient, and as used herein, a patient can refer to a subject diagnosed with a particular disease or disorder.

[0248] The term "gene" as used herein refers to a segment of nucleic acid (also referred to as a "coding sequence" or "coding region") that encodes an individual protein or RNA, optionally together with associated regulatory regions that may be located upstream or downstream of the coding sequence, such as a promoter, operator, terminator, and the like.

[0249] The term "adeno-associated virus" or "AAV" as used herein refers to adeno-associated viruses or their derivatives. Non-limiting examples of AAVs include AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), AAV type 10 (AAV10), AAV type 11 (AAV11), AAV type 12 (AAV12), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. In some cases, AAV is described as "primate AAV", and primate AAV refers to AAV that infects primates. Similarly, AAV can infect animals of the subfamily Bovinae (e.g., "bovine AAV", etc.). In some cases, AAV is wild-type AAV or naturally occurring AAV. In some cases, AAV is recombinant AAV.

[0250] The term "AAV capsid," as used herein, refers to the capsid protein or peptide of adeno-associated virus. In some cases, the AAV capsid protein is engineered to encapsidate genetic information (e.g., a transgene, a therapeutic nucleic acid, a viral genome) within the capsid. In some cases, the AAV capsids of the present disclosure are AAV capsids that are modified compared to the corresponding parental AAV capsid protein.

[0251] The term "tropism," as used herein, refers to a quality or characteristic of an AAV capsid that can include an improvement or decrease in the specificity and / or efficiency of expression of the encapsidated genetic information in an in vivo environment as compared to a second in vivo environment. The in vivo environment is, in some cases, a cell type. The in vivo environment is, in some cases, an organ, or an organ system.

[0252] The term "AAV vector," as used herein, refers to a nucleic acid polymer that encodes genetic information related to a virus. An AAV vector can be a recombinant AAV vector (rAAV), and rAAV refers to an AAV vector generated using recombinant genetic techniques. In some cases, an rAAV vector includes at least one heterologous polynucleotide (e.g., a polynucleotide other than the wild-type or naturally occurring AAV genome, such as a transgene).

[0253] The term "AAV particle," as used herein, refers to an AAV virus, virion, AAV capsid protein, or a component thereof. In some cases, the AAV particle is modified compared to a parental AAV particle.

[0254] The term "gene product" or "gene expression product" refers to the expression product of a polynucleotide sequence, such as, for example, a polypeptide, peptide, protein, or interfering RNA (e.g., siRNA, miRNA, shRNA) and messenger RNA (mRNA), including RNA.

[0255] The term "operably linked" or "operatively linked" refers to an arrangement of two or more elements (e.g., genetic elements such as a promoter, enhancer, termination signal sequence, polyadenylation sequence, etc.) that are in proximity to each other and, in some cases, adjacent to each other, which enables a functional relationship between these two or more elements. In one non-limiting example, a promoter that is operably linked to a coding region enables the initiation of transcription of the coding sequence.

[0256] The term "heterologous", as used herein, refers to a genetic element (e.g., a coding region) or gene expression product (e.g., RNA, protein) that is derived from an entity that is genetically distinct from the remainder of the entity to which it is being compared.

[0257] The term "endogenous", as used herein, refers to a genetic element (e.g., a coding region) or gene expression product (e.g., RNA, protein) that is naturally present or associated with an organism or a particular cell within that organism.

[0258] As used herein, a "detectable moiety" is a moiety that can be covalently or non-covalently attached to a compound or biomolecule and that can be detected, for example, using techniques known in the art. In embodiments, the detectable moiety is covalently attached. The detectable moiety can be provided for imaging the attached compound or biomolecule. The detectable moiety can indicate contact between two compounds. Exemplary detectable moieties are fluorophores, antibodies, reactive dyes, radiolabeled moieties, magnetic contrast agents, and quantum dots. Exemplary fluorophores include fluorescein, rhodamine, GFP, coumarin, FITC, Alexa fluor, Cy3, Cy5, BODIPY, and cyanine dyes. Exemplary radionuclides include fluorine-18, gallium-68, and copper-64. Exemplary magnetic contrast agents include gadolinium, iron oxide and iron platinum, and manganese.

[0259] As used herein, the terms "treat", "treating" and "treatment" refer to reducing or suppressing a disorder, disease or condition, or one or more symptoms associated with a disorder, disease or condition, or reducing or eradicating the cause of the disorder, disease or condition itself. Desirable effects of treatment can include, but are not limited to, preventing the occurrence or recurrence of a disease, reducing symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the medical condition, and remission, or improvement of prognosis.

[0260] The term "therapeutically effective amount" refers to an amount of a compound or treatment that is sufficient to prevent the occurrence of one or more of the symptoms of a disorder, disease or condition thereof or to reduce said one or more to some extent when administered, or an amount of a compound that is sufficient to elicit a biological or medical response in a cell, tissue, system, animal or human that is being sought by a researcher, veterinarian, physician or clinician.

[0261] The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable excipient", "physiologically acceptable carrier" or "physiologically acceptable excipient" refer to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. A component can be "pharmaceutically acceptable" in the sense of being compatible with the other components of a pharmaceutical formulation. It is also suitable for use in contact with human and animal tissues or organs, and can be one that is without excessive toxicity, irritation, allergic response, immunogenicity or other problems or complications, and is commensurate with a reasonable risk-benefit ratio. See Remington: The Science and Practice of Pharmacy, 21st Edition; Lippincott Williams & Wilkins: Philadelphia, PA, 2005; Handbook of Pharmaceutical Excipients, 5th Edition; Rowe et al., Eds., The Pharmaceutical Press and the American Pharmaceutical Association: 2005; and Handbook of Pharmaceutical Additives, 3rd Edition; Ash and Ash Eds., Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, Gibson Ed., CRC Press LLC: Boca Raton, FL, 2004.

[0262] The term "pharmaceutical composition" refers to a mixture of a compound disclosed herein with other chemical components, such as a diluent or carrier. A pharmaceutical composition can facilitate the administration of a compound to a living being. A number of techniques for administering a compound exist in the art and such techniques include, but are not limited to, oral, injection, aerosol, parenteral and topical administration.

[0263] Non-limiting examples of a "sample" include any material from which nucleic acids and / or proteins can be obtained. By way of non-limiting example, these include whole blood, peripheral blood, plasma, serum, saliva, mucus, urine, semen, lymph fluid, fecal extracts, oral swabs, cells or other body fluids or tissues, including but not limited to tissues obtained by surgical biopsy or surgical resection. In various embodiments, the sample includes tissue from the large intestine and / or small intestine. In various embodiments, the large intestine sample includes the cecum, colon (ascending colon, transverse colon, descending colon, and sigmoid colon), rectum and / or anal canal. In some embodiments, the small intestine sample includes the duodenum, jejunum, and / or ileum. Alternatively, the sample can be obtained from a primary cell line derived from a patient, or can be an archived patient sample in the form of a stored sample, or can be a fresh frozen sample.

[0264] The term "in vivo" is used to describe an event that occurs within the body of a subject.

[0265] The term "ex vivo" is used to describe an event that occurs outside the body of a subject. An ex vivo assay is not performed on the subject. More precisely, it is performed on a sample that has been separated from the subject. An example of an ex vivo assay performed using a sample is an "in vitro" assay.

[0266] The term "in vitro" is used to describe an event that is performed within a container for holding laboratory reagents, such that the material is contained so as to be isolated from the biological source from which it was taken. An in vitro assay can include cell-based assays in which live or dead cells are used. An in vitro assay can also include cell-free assays in which intact cells are not used.

[0267] The section headings used herein are for organization purposes only and should not be construed as limiting the subject matter described.

Examples

[0268] V. Examples (Example 1) Method for producing rAAV

[0269] Produce recombinant AAV (rAAV). Using a standard transfection protocol (e.g., using PEI), triple transfect three plasmid vectors into immortalized HEK293. The first vector contains a transgene cassette flanked by inverted terminal repeat (ITR) sequences from the parental AAV virus. The transgene cassette has a promoter sequence that drives the transcription of the heterologous nucleic acid in the nucleus of the target cell. The second vector contains a nucleic acid encoding the AAV Rep gene and a modified Cap gene, e.g., AAV2 / 9 REP-AAP-ΔCap. The modified Cap gene includes any one of the DNA sequences provided in FIGS. 33-35, which is a DNA sequence encoding the modified AAV capsid protein of the present disclosure. The third vector contains a nucleic acid encoding the helper virus proteins required for virus assembly and packaging of the heterologous nucleic acid into the modified capsid structure.

[0270] Collect virus particles from the medium 72 hours after transfection and from the cells and medium 120 hours after transfection. Concentrate the virus present in the medium by precipitation with 8% poly(ethylene glycol) and 500 mM sodium chloride, and add the precipitated virus to the lysate prepared from the collected cells. Purify the virus using a step gradient of iodixanol (Optiprep, Sigma) (15%, 25%, 40% and 60%). Concentrate the virus and formulate it in PBS. Determine the virus titer by measuring the number of DNaseI-resistant vector genome copies (VG) using qPCR and a linearized genomic plasmid as a control.

[0271] (Example 2) Method for identifying variant AAV capsid proteins

[0272] Plasmid

[0273] Library generation. The rAAV-ΔCap-in-cis-Lox2 plasmid (Figure 36) is a variant of the rAAV-ΔCap-in-cis-Lox plasmid. For the generation of 7-mer-i library fragments, the pCRII-9Cap-XE plasmid was used as a template. The AAV2 / 9 REP-AAP-ΔCap plasmid (Figure 36) was modified from the AAV2 / 9 REP-AAP plasmid.

[0274] The rAAV-ΔCap-in-cis-Lox2 plasmid consists of three major elements adjacent to the AAV2 ITR. (i) The UBC ubiquitous promoter, which drives the expression of the fluorescent protein mNeongreen, followed by the expression of a synthetic polyadenylation sequence. The mCherry expression cassette of the old version of the plasmid was replaced with the mNeonGreen cassette. (ii) A portion of the AAV2 rep gene (residues 1680 - 1974 of GenBank AF085716.1) having a splicing sequence and the AAV5 p41 promoter, followed by the AAV9 cap gene. The previous version of this plasmid, rAAV-ΔCap-in-cis-Lox, had a short 12 bp sequence between the restriction sites XbaI and AgeI at AA450 and 592 of the AAV9 Cap gene. In the newer version of the plasmid, this was replaced with a 723 bp sequence of the in-frame mRuby2 gene (which acts as filler DNA). (iii) The SV40 polyadenylation sequence adjacent to the lox71 and lox66 sites. This small change was introduced into the previous version of the plasmid to facilitate cloning and visualize mammalian cell transfection. The Lox sites of these rAAV plasmids show a moderate level of Cre-independent inversion. This was minimized by reducing the number of amplification cycles during PCR-based capsid recovery to a point where no rAAV capsids could be recovered from control DNA extracted from wild-type mice injected with the library (i.e., lacking Cre expression). The pCRII-9Cap-XE plasmid contains the AAV9 capsid gene sequence from AA450 - 592 and is adjacent to the XbaI and AgeI restriction sites.

[0275] The AAV2 / 9 REP-AAP-ΔCap plasmid has five stop codons that were present in front of AAV2 / 9 REP-AAP in addition to the deletion of AA450-592 of the AAV9 capsid sequence. These modifications did not affect vector production. By eliminating the overlapping fragments between REP-AAP and the rAAV-ΔCap-in-cis-Lox2 plasmid, recombination between plasmids that could potentially generate the AAV9 wild-type capsid during co-transfection of vector production was minimized.

[0276] Capsid Characterization

[0277] AAV capsid. Using the pUCmini-iCAP-PHP.B backbone, an AAV capsid variant with a 7-mer insertion or 11-mer substitution between positions 587-597 of the AAV-PHP.B capsid was generated (Addgene ID: 103002).

[0278] ssAAV genome. To characterize the AAV capsid variant, a single-stranded (ss) rAAV genome was used. Genomes such as pAAV:CAG-mNeonGreen27 (equivalent plasmid, pAAV:CAG-eYFP35; Addgene ID: 104055), pAAV:CAG-NLS-EGFP26 (an equivalent version with one NLS is at Addgene ID 104061), pAAV:CAG-DIO-EYFP35 (Addgene ID: 104052), pAAV:GfABC1D-2xNLS-mTurquoise235 (Addgene ID: 104053), and pAAV-Ple261-iCre30 (Addgene ID 49113) were used.

[0279] The pAAV:CAG-mNeonGreen2 genome consists of a ubiquitous CMV-β-actin-intron-β-globin (CAG) hybrid promoter that drives the expression of the fluorescent protein mNeonGreen (equivalent plasmid, pAAV:CAG-eYFP3; Addgene ID: 104055). pAAV:CAG-NLS-EGFP1 consists of NLS sequences at the N and C termini of EGFP and is driven by the CAG promoter. An equivalent version with one NLS is available from Addgene (ID 104061). pAAV:CAG-DIO-EYFP3 (Addgene ID: 104052) consists of the EYFP gene constructed in the opposite orientation to the CAG promoter, which is flanked on both sides by a pair of Cre-Lox sites (Lox P and Lox 2272).

[0280] In cells expressing Cre, the Cre-lox pair inverses EYFP to allow transcription and translation, and then excises the lox sites to prevent re-inversion. Elsewhere, pAAV:GfABC1D-2xNLS-mTurquoise23, also called pAAV:GFAP-2xNLS-mTurquoise2 (Addgene ID: 104053), consists of NLS sequences at the N and C termini of mTurquoise2 and is driven by the astrocyte-specific promoter GfABC1D4. pAAV:Ple261-iCre5 (Addgene ID 49113) contains an endothelial cell-specific promoter that drives the expression of iCre.

[0281] pAAV:CAG-XFP (mNeongreen) was packaged to characterize AAV variants. However, when quantifying cell types: neurons, astrocytes, and oligodendrocytes, expression was restricted to the nucleus using CAG-NLS-EGFP for easier quantification using microscopic images. GFAP-NLS-mTurq2 is used to quantify astrocytes. CAG-DIO-EYFP is used in Cre driver lines due to the presence of lox sites within this plasmid.

[0282] The scAAV:CB6-EGFP genome, a self-complementary genome from Dr. Guangping Gao, has a hybrid ubiquitous CB6 promoter (975 bp) containing a CMV enhancer (cytomegalovirus immediate early enhancer), a chicken β-actin promoter, and a hybrid intron, and has a promoter that drives the expression of EGFP. This genome has a rabbit globin polyA (127 bp) after the EGFP gene. The scAAV:CAG-EGFP (Addgene ID: 83279) vector drives the expression of EGFP using a ubiquitous CMV-β-actin-intron-β-globin (CAG) hybrid promoter.

[0283] Round-1 AAV Capsid Library Generation

[0284] Mutagenesis strategy. Using an NNK saturation mutagenesis strategy with degenerate primers containing mixed bases (from Integrated DNA Technologies, Inc.), 7-mer randomized insertions were designed. N can be an A, C, G, or T base, and K can be a G or T. Using this strategy, all 20 combinations of each AA at each position of a 7-mer peptide using 33 codons were obtained, resulting in a library size of 1,280,000,000 at the AA combination level. The mutagenesis strategy for the 3-mer-s PHP.B library is described in Chan, K. Y. et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat. Neurosci. 20, 1172-1179 (2017).

[0285] Library cloning. A 480 bp AAV capsid fragment (450 - 592 AA) with a 7-mer random insertion between AA588 and 589 was generated by conventional PCR using degenerate mixed-base primers. The library fragment was amplified from the pCRII-9Cap-XE template with Q5 Hot Start High-Fidelity 2X Master Mix (NEB; M0494S), forward primer XF: 5’-ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC-3’, and reverse primer 7xMNN-588i: 5’-GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMNNMNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG-3’. To avoid PCR-introduced bias due to point mutations, recombination, and template switching, PCR amplification was limited to 15 - 20 cycles and the reaction scale was increased to obtain the required yield. The resulting PCR product was electrophoresed on a 1% agarose gel and extracted with the Zymoclean Gel DNA Recovery kit (Zymo Research; D4007). It is essential to avoid AAV contamination during this step by taking precautions such as using a clean gel electrophoresis box and freshly prepared 1×TAE buffer.

[0286] The rAAV-ΔCap-in-cis-Lox2 plasmid (6960 bp) was linearized with restriction enzymes AgeI and XbaI, and then the NEB-recommended protocol was followed for double digestion. The digested plasmid was electrophoresed on a 0.8% - 1% agarose gel to extract the linearized backbone (6237 bp) with the Zymoclean Gel DNA Recovery kit.

[0287] The amplified library fragment was assembled into the linearized vector using NEBuilder HiFi DNA Assembly Master Mix (NEB; E2621S) and a 1:2 molar ratio of vector to insert for 60 minutes at 50°C.

[0288] Library purification. Subsequently, the assembled library was subjected to Plasmid Safe (PS) DNase (Epicentre; E3105K) treatment to purify the assembled product from the mixture by degrading unassembled DNA fragments. For the R1 library, approximately 3 U of PS DNase per 1 μg of input DNA was used for a 30-minute reaction at 37°C. Alternatively, exonuclease V (RecBCD) was used following the NEB recommended protocol (NEB; M0345S). Equivalent results were obtained by both procedures. The resulting mixture was further purified using a DNA Clean and Concentrator kit (Zymo Research; D4013).

[0289] Library yield. After PS treatment, a yield of approximately 15 - 20 ng per 100 ng of input DNA per 20 μL reaction was obtained with an assembly efficiency of 15 - 20%. To construct the 7-mer-i DNA library, approximately 5 - 6 μg of input DNA was used to obtain approximately 800 ng of the assembled library.

[0290] Quality control. To verify the successful assembly of the library, 1 ng of the assembled final library was introduced into E. coli SURE 2 Supercompetent Cells (Integrated Sciences; 200152) to cause transformation. After incubation overnight at 37 °C, colonies on LB / agar plates containing carbenicillin antibiotic were identified. The DNA library around the insertion site was sequenced (Laragen; Sanger sequencing). A non-biased library shows multiple nucleotide peaks with equal diversity (25% each of A, T, G, C) across all base positions in diverse regions. To confirm that the ITRs were intact, SmaI digestion was performed according to the NEB recommended protocol (NEB; R0141S). To verify transfection success and evaluate the vector production yield per 150 mm dish, 10 ng of the 7-mer-i library was used to transfect HEK293 producer cells. Uniform expression of the mNeonGreen protein was observed across HEK cells, and an average yield of 0.1 - 1×10 11 vg was obtained per 150 mm dish. The average yield per dish was used to scale up the vector production for in vivo selection (see Figure 45).

[0291] Round-2 AAV Capsid DNA Library

[0292] PCR Pool Design. To maintain proportional pooling, the fraction of each sample / library to be pooled was mathematically determined based on the diversity of the individual libraries. This process involves the estimation of diversity without noise and the consideration of the amplification of this diversity across samples by determining the area under the curve for the intervals of high-confidence variants falling within a higher RC range. The area under the curve (AUC) was estimated by plotting all the recovered variants within the library (X-axis) against their read counts (RC or copy number from deep sequencing data, Y-axis) using the composite Simpson's rule (see Figure 40). To determine a clear interval for the AUC, the data was sorted based on the decreasing order of RC. Visually, this distribution has two phases, with a more constant slope of variants in the higher RC range, followed by a sharp drop in the slope of the curve (RC of approximately 1 / 50 to 1 / 1000). By observation, this steeper side of the curve has significant sequencing errors / PCR mutations, and thus, this error-dominated slope is otherwise called noise from __ and excluded from the AUC estimation. When comparing the composite Simpson's rule with another function such as the composite trapezoidal rule, the difference was extremely small.

[0293] This area was then used to determine the fraction of individual libraries to be pooled into the PCR pool libraries using the formula: [Area under the curve / Total number of pooled libraries].

[0294] The pooled samples were used as templates for further amplification in 12 cycles of 98 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s with Q5 polymerase using the primers 588-R2lib-F: 5’-CACTCATCGACCAATACTTGTACTATCTCTCT-3’ and 588-R2lib-R: 5’-GTATTCCTTGGTTTTGAACCCAACCG-3’. Similar to R1 library generation, the PCR products were assembled into the rAAV-ΔCap-in-cis-Lox2 plasmid and the virus was produced.

[0295] The R1 library used to construct R2 was Cre-Lox inverted rAAV DNA from half of the mouse brain (about 0.3 g) from all Cre lines and a portion of the spinal cord (0.1 - 0.2 g). The amount of tissue processed here was sufficient for complete capsid library recovery. Separately pooled and amplified libraries (per PCR pool or synthetic pool) were assembled using Gibson assembly and follow-up PS or exonuclease V treatment (as described for R1 library generation). The success of library generation was verified by transformation, Sanger sequencing, and ITR SmaI digestion.

[0296] For vector production, approximately 10 ng of purified and assembled library was used to transfect each of 150 mm dishes of 293T cells, and a yield of approximately 6 × 10 11 vg was obtained (i.e., assuming that these sequences had already been produced sufficiently to overcome R1 selection, the R2 yield was 6-fold that of R1).

[0297] Synthetic pool design. As described in the PCR pool strategy, high-confidence variants were selected using RCs above the slope of error-dominated noise from the plot of library distribution (see Figure 40). This yielded approximately 9000 sequences from all brain and spinal cord samples of all Cre lines. The same primer design as described in the explanation of R1 library generation was used. Primer XF: 5’-ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC-3’ and 11-mer-588i: 5’-GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCXXXXXXMNNMNNMNNMNNMNNMNNMNNXXXXXXACTCTGGTGGTTTGTG-3’ (replace “XXXXXXMNNMNNMNNMNNMNNMNNMNNXXXXXX” in this formula with the specific nucleotide sequence of a 7-mer tissue retrieval variant (7×MNN) with modifications of two adjacent codons flanking the 7-mer insertion site (6×X), which are residues 587-588 “AQ” and residues 589-590 “AQ” on the AAV9 capsid). To select sequences for synthesis, the R1 brain and spinal cord libraries were chosen and the same RC threshold as described in the PCR pool strategy was used. This yielded approximately 9000 sequences from all brain and spinal cord samples of all Cre lines. The spike-in library, having 11-mer mutant variants, used the same primer design with “XXXXXXMNNMNNMNNMNNMNNMNNMNNXXXXXX” replaced with the specific nucleotide sequence of the 11-mer variant. Replicates of each sequence within this library were designed using different codons optimized for mammals. These primers were designed using a Python-based script for custom ordering (the code will be made available on Github). Twist Biosciences synthesized the custom-designed oligo pool at equimolar ratios. Using this oligo pool, the pCRII-XE Cap9 template was amplified over 13 cycles of 98 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s.To obtain more large-scale library preparation yields, the product of the first PCR was used as a template for a second PCR using primers XF and 588-R2lib-R (described above) and amplified over 13 cycles. As described in the explanation of R1 library generation, the PCR products were assembled into an rAAV backbone for virus production, processed, and purified. Approximately 10 ng of HEK293 cells per 150 mm dish were, about 6×10. 11 produced a viral library of vg.

[0298] AAV viral library production and purification

[0299] To prevent capsid mosaic formation of the 7-mer-i library in HEK293 producer cells, only 10 ng of the assembled library per 150 mm dish was transfected together with the other reagents necessary for AAV vector production. In addition to the 10 ng library transfection per 150 mm dish for 293T producer cells, three plasmids: AAV2 / 9 REP-AAP-ΔCap, pUC18 and pHelper (genes encoding adenovirus proteins for AAV replication) were transfected in a 1:1:2 ratio. Plasmid pUC18 acts as a filler DNA to compensate for a small amount of library DNA to maintain the N:P ratio required for optimal transfection using polyethyleneimine (PEI (Polysciences; 24765-1) transfection). Cells and culture medium were harvested 60 hours after transfection to recover virus particles. Harvesting and purification of rAAV were performed according to the protocol. The low amount of library DNA per plate and the early cell harvesting time point are essential to reduce the possibility of mosaic capsid assembly during vector production (similar considerations seen in previous reports).

[0300] For the 7-mer-i library, the scale of production was 60 dishes (about 1.8×10 7cells / dish), and about 10% of the library transfected, resulting in about 1×10 8 complete transformants. For the NNK 7mer library with about 1×10 8 complete transformants, the number of unique variants is 9.99×10 7 is.

[0301] For rAAV DNA extraction from the purified rAAV virus library, approximately 10% of the purified virus library was used to extract the viral genome by proteinase K treatment. To degrade any contaminating DNA from the purified library, it was treated with DNase I enzyme (5 μl of 10 U / μl) (Sigma-Aldrich; 4716728001) in 100 μl of DNase I buffer and incubated at 37 °C for 1 hour. The enzyme was inactivated by adding 5 μl of 0.5 M EDTA at 70 °C for 10 minutes. After DNase I treatment, the capsid protein shell was digested by adding 120 μl of proteinase solution containing 5 μl of 20 μg / μl proteinase K and incubated overnight at 50 °C. The mixture was boiled at 95 °C to inactivate proteinase K. The extracted rAAV library DNA was then concentrated and purified using phenol-chloroform and ethanol. Equal volume of phenol:chloroform:isoamyl alcohol 25:24:1, pH 8.0 (approx. 250 μl; ThermoFisher Scientific; 15593031) was added and vortexed for 30 seconds. After incubating the mixture at room temperature (RT) for 5 minutes, it was centrifuged at 15,000 rpm for 10 minutes at 4 °C. The upper aqueous phase was separated, mixed with an equal volume of chloroform, and vortexed for 30 seconds. After a 5-minute incubation at RT, it was centrifuged at 15,000 rpm for 10 minutes at 4 °C. The upper aqueous phase was separated, 1 / 10 volume of 3 M sodium acetate (pH 5.2) with 2 μl of Co-Precipitant Pink (Bioline; BIO-37075), and 2.5 volumes of ice-cold 100% ethanol were added and then vortexed for 30 seconds. After incubating the mixture at -20 °C for at least 1 hour, it was centrifuged at 15,000 rpm for 15 minutes at 4 °C. The pellet was air-dried and resuspended in TE buffer. The DNA concentration was determined using the Qubit ssDNA assay.

[0302] animal

[0303] All animal procedures performed in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the California Institute of Technology. The C57BL / 6J (000664), Tek-Cre (8863), SNAP25-Cre (23525), GFAP-Cre (012886), Syn1-Cre (3966), and Ai14 (007908) mouse strains used in this study were purchased from the Jackson Laboratory (JAX). in For in vivo library selection, adult male and female mice, 6–8 weeks old, were injected intravenously with the virus library. Both sexes were used for capsid selection to recover capsid variants with minimal gender bias. IV injection of rAAV was performed into the retro-orbital sinus of adult mice. To test the transduction phenotype of rAAV, 6–8-week-old C57BL / 6J or Tek-Cre or Ai14 adult male mice were randomly assigned. The experimenters were blinded to all experiments performed in this study.

[0304] in vivo selection

[0305] 7-mer-i virus library selection was performed on Cre transgenic adult mice of different strains: Tek-Cre, SNAP25-Cre, and GFAP-Cre for R1 selection and Syn1-Cre in addition to these 3 strains for R2 selection. Adult male and female mice were administered a viral vector dose of 2×10 11 vg / mouse for R1 selection and a dose of 1×10 12 vg / mouse for R2 selection via intravenous injection. The doses were determined based on the different viral yields between selection rounds (Figure 45). Both sexes were used to recover capsid variants with minimal gender bias. Two weeks after injection, the mice were euthanized, and all organs including the brain were recovered, snap-frozen using dry ice, and stored at -80 °C.

[0306] rAAV Genome Extraction from Tissues

[0307] Optimization. For rAAV genome extraction from tissues, both the TRIzol method (Life Technologies; 15596) and the QIAprep Spin Miniprep Kit (Qiagen, Inc; 27104) were used according to the manufacturer's recommended protocols, and it was found that the TRIzol method was more efficient. The total rAAV genome recovery from 0.1 g of mouse liver was quantified by quantitative PCR using primers mNeonGreen-F: 5’-CGACACATGAGTTACACATCTTTGGCTC-3’ and mNeonGreen-R: 5’-GGAGGTCACCCTTGGTGGACTTC-3’ that bind to the mNeonGreen gene of the ssAAV-ΔCap-in-cis-Lox2 genome. As an internal control, the mitochondrial DNA amount (a measure of less genomic recovery) was quantified using primers Mito-F: 5’-CCCAGCTACTACCATCATTCAAGT-3’ and Mito-R: 5’-GATGGTTTGGGAGATTGGTTGATGT-3’. The percentage of viral DNA per 1 ng of total extracted DNA was approximately 1.5-fold higher with the QIAprep kit than with the TRIzol method, but the overall recovery rate was lower with the QIAprep kit.

[0308] The extracted viral genomes were digested with restriction enzymes such as SmaI (found within the ITR) to improve the rAAV genome recovery rate by PCR. This was analyzed by quantitative PCR using the Cre+ primers CapF-56: 5’-ATTGGCACCAGATACCTG ACTCGTAA-3’, Cre+R-58: 5’-CAAGTAAAACCTCTACAAATGTGGTAAAATCG-3’, and the Cre- primers CapF-56 (see above) and Cre-R-57: 5’-GTCCAAACTCATCAATGTATCTTATCATGTCTG-3’.

[0309] rAAV genome extraction by the TRIzol method. Half of the frozen cerebral hemisphere (approximately 0.3 g) was homogenized using a 2-ml glass homogenizer (Sigma Aldrich; D8938) or an electric plastic inner tube (Fisher Scientific; 12-141-361, 12-141-363) (for smaller tissues) and processed as described in previous studies. The extracted DNA was then treated with 3 - 6 μl of 10 μg / μl RNase Cocktail Enzyme Mix (ThermoFisher Scientific; AM2286) to remove RNA and digested with SmaI restriction enzyme. The treated mixture was then purified using the Zymo DNA Clean and Concentrator kit (D4033). It was observed from the analysis of deep sequencing data that the amount of tissue processed for rAAV genome recovery was sufficient.

[0310] rAAV genome recovery by Cre-dependent PCR. The rAAV genome with Lox sites inverted by Cre recombination was selectively recovered and amplified using PCR with primers that produce PCR products only when the Lox sites are inverted (see Figure 37). Primers 71F: 5’-CTTCCAGTTCAGCTACGAGTTTGAGAAC-3’ and CDF / R: 5’-CAAGTAAAACCTCTACAAATGTGGTAAAATCG-3’ were used, and the genome recombined with Cre was amplified using Q5 DNA polymerase over 25 cycles of 98 °C for 10 seconds, 58 °C for 30 seconds, and 72 °C for 1 minute.

[0311] Recovery of all rAAV genomes by PCR (Cre-independent). To recover all rAAV genomes from the tissue, primers XF (5’-ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC-3’) and 588-R2lib-R (5’-GTATTCCTTGGTTTTGAACCCAACCG-3’) were used, and the genome was amplified using Q5 DNA polymerase over 25 cycles of 98 °C for 10 seconds, 60 °C for 30 seconds, and 72 °C for 30 minutes.

[0312] Sample preparation for NGS

[0313] To analyze selections using deep sequencing, DNA libraries, viral libraries, and tissue libraries after in vivo selection were processed to add flow cell adapters around diverse 7-mer insertion regions (see Figure 37).

[0314] Preparation of rAAV DNA and viral DNA libraries. The rAAV DNA library generated by Gibson assembly and DNA extracted from the viral library were amplified with Q5 DNA polymerase using primers 588i-lib-PCR1-6bpUID-F: 5'-CACGACGCTCTTCCGATCTAANNNNNNAGTCCTATGGACAAGTGGCCACA-3' and 588i-lib-PCR1-R: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTTGGTTTTGAACCCAACCG-3', which are located approximately 50 bases from the randomized 7-mer insertion on the capsid and contain the read 1 and read 2 flow cell sequences at the 5' end.

[0315] The primer 588i-lib-PCR1-6bpUID-F: 5’CACGACGCTCTTCCGATCTAANNNNNNAGTCCTATGGACAAGTGGCCACA-3’, which is used to minimally amplify DNA and viral libraries for NGS, has a 6-nucleotide long UID (unique identifier) “NNNNNN” located after the 19 nucleotides “5’-CACGACGCTCTTCCGATCT” of the read-1 sequence used for NGS, and a linker “AA”. The sequence “AGTCCTATGGACAAGTGGCCACA” after the UID is the region that anneals to the AAV9 capsid. The UID is an optimal feature for NGS data analysis to identify potential PCR amplification errors. However, in this study, this feature was not utilized for NGS data analysis in order to maintain consistency with the primers (primer 71F: 5’-CTTCCAGTTCAGCTACGAGTTTGAGAAC-3’ and CDF / R: 5’-CAAGTAAAACCTCTACAAATGTGGTAAAATCG-3’) used for rAAV genome recovery from tissues lacking this UID feature. The UID or any kind of overhang was thought to affect PCR-based recovery from tissues. Perhaps, primer thermal stability plays an important role in the very small amount of rAAV genome extracted from tissues.

[0316] Using 5 - 10 ng of template DNA in a 50 μl reaction, DNA was minimally amplified over 4 cycles of 98 °C for 10 seconds, 60 °C for 30 seconds, and 72 °C for 10 seconds. The mixture was then purified with a PCR purification kit. The eluted DNA was then used as a template in a second PCR, and unique identifiers (single or double) were added by the recommended primers (NEB; E7335S, E7500S, E7600S) in a 12-cycle reaction using the same temperature cycles as described above. The samples were then sent for deep sequencing after additional processing and verification.

[0317] The PCR products after index addition were electrophoresed on a freshly prepared 2% low melting point agarose gel (ThermoFisher Scientific, 16520050) for better separation and recovery of DNA bands of approximately 120 bp on the gel. Before sending the samples for NGS, the nucleotide diversity at the randomized 7-mer positions was confirmed by Sanger sequencing. If necessary, PCR was performed as needed to send sufficient samples for Sanger sequencing using 15 - 20 cycles of 98 °C for 10 seconds, 60 °C for 30 seconds, and 72 °C for 10 seconds with primers NGS-QC-F: 5’-AATGATACGGCGACCACCGAG-3’ and NGS-QC-R: 5’-CAAGCAGAAGACGGCATACGA-3’. Once verified, the library was sent for deep sequencing using the Illumina HiSeq 2500 System (Millard and Muriel Jacobs Genetics and Genomics Laboratory, Caltech; Integrative Genomics Core, City of Hope).

[0318] Preparation of the rAAV tissue DNA library. The PCR-amplified rAAV DNA library from tissue (see section: in vivo selection (i)(c)) was further amplified using a 1:100 dilution of this DNA with primers 1527: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACAAGTGGCCACAAACCACCAG-3’ and 1532: 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTTGGTTTTGAACCCAACCG-3’ (which are located approximately 50 bases from the randomized 7-mer insert on the capsid and contain the lead 1 and lead 2 sequences at the 5’ end). The DNA was subjected to 10 cycles of 98 °C for 10 seconds, 59 °C for 30 seconds, and 72 °C for 10 seconds with Q5 Hot Start High-Fidelity 2X Master Amplified with Mix or NEBNext Ultra II Q5 Master Mix (NEB; M0544). The mixture was purified using a PCR purification kit. The eluted DNA was then used as a template in a second PCR and unique identifiers (single or dual) were added using the recommended primers (NEB; E7335S, E7500S, E7600S) in a 10-cycle reaction with the same temperature cycles as described above (for DNA and viral library preparation). The extracted DNA was verified by Sanger sequencing and sent for deep sequencing as described in the previous section.

[0319] In vivo characterization of AAV vectors

[0320] Cloning of AAV capsid variants. Using overlapping forward and reverse primers with an 11-mer substitution spanning the MscI site (at position 581AA) to the AgeI site (at position 600AA) on the pUCmini plasmid (for the 7-mer-i variant, the adjacent amino acids AA587 - 588 "AQ" and AA589 - 590 "AQ" from the AAV9 capsid were codon-modified), the AAV capsid variants were cloned into the pUCmini-iCAP-PHP.B backbone (Addgene ID: 103002). A custom python script (the code will be made available on github) was used to design primers for all capsid variants, and since they cover the full fragment insertion, these primers were self-annealed and amplified using PCR to generate dsDNA fragments without using template DNA. They were amplified with Q5 Hot Start High-Fidelity 2X Master Mix for 20 cycles of 10 seconds at 98°C, 30 seconds at 60°C, and 10 seconds at 72°C. This fragment was then assembled by Gibson assembly method into the MscI / AgeI digested pUCmini-iCAP-PHP.B backbone. There is a second MscI site on the backbone, which was blocked by methylation. The assembled plasmid was then introduced into NEB Stable Competent E.coli (New England Biolabs, Inc; C3040H) to cause transformation, and colonies were selected on carbenicillin / ampicillin-LB agar plates.

[0321] List of primers used to clone AAV-PHP variants: Variants from the 7-mer-i and 3-mer-s libraries were cloned in the same way as the 11-mer substitution.

[0322] Table 6. Primers for AAV-PHP variants

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

[0323] AAV vector production. Using an optimized protocol, AAV vectors were produced from 5 - 10 150 mm plates, thereby obtaining an amount sufficient for administration to adult mice.

[0324] AAV vector administration. AAV vectors were intravenously administered by retro-orbital injection to adult male mice (6 - 8 weeks old) at a dose of 1 - 10×10 11 vg. The AAV dose was determined according to the experimental necessity. CAG-NLS-GFP related experiments for quantification were performed at a moderate dose of 1×10 11 vg, on the premise that this dose was the one previously determined for AAV-PHP.eB characterization. Otherwise, non-NLS genome related experiments were performed at 3×10 11 vg, except in the case of Cre-driver lines (GFAP-Cre or Tek-Cre), or genomes containing a lower-intensity promoter (GFAP-NLS-mTurq), where the dose was 1×10 12 vg. This high dose was chosen to understand the maximum potential of the new vector in these systems.

[0325] All experiments using vectors carrying the CAG, a strong ubiquitous promoter, were incubated for 3 weeks. Incubation for 4 weeks is for Cre driver lines or incubations involving expression from cell type-specific promoters, where longer waiting times are generally recommended. Incubation for 2 weeks is for cases where the vector carries a self-complementary genome with a strong ubiquitous promoter.

[0326] Tissue processing. After 3 weeks of expression (unless otherwise specified), mice were anesthetized with Euthasol (pentobarbital sodium and phenytoin sodium solution, Virbac AH), and perfused transcardially with 30 - 50 mL of 0.1 M phosphate-buffered saline (PBS) (pH 7.4), followed by 30 - 50 mL of 4% paraformaldehyde (PFA) in 0.1 M PBS. After this procedure, all organs were harvested and post-fixed overnight at 4°C in 4% PFA. The tissues were then washed and stored at 4°C in 0.1 M PBS and 0.05% sodium azide. All solutions used in this procedure were freshly prepared. For the brain and liver, 100-μm thick sections were cut with a Leica VT1200 vibratome.

[0327] For vascular labeling, mice were anesthetized and perfused transcardially with 20 mL of ice-cold PBS, followed by 10 mL of ice-cold PBS containing Texas Red-labeled Lycopersicon Esculentum (tomato) lectin (1:100, Vector laboratories, TL-1176), and then placed in 30 mL of ice-cold 4% PFA for fixation.

[0328] Immunohistochemical examination. First, tissue sections - typically 100 μm thick - were incubated in a blocking buffer (10% normal donkey serum, 0.1% Triton X-100 and 0.01% sodium azide in 0.1M PBS, pH 7.4) containing primary antibodies at an appropriate dilution for 24 hours at room temperature using a rocking device. The primary antibodies used in this study were rabbit S100 (1:400, Abcam, ab868), rabbit Olig2 (1:400; Abcam, ab109186), rabbit NeuN (1:400, Abcam, ab177487), and rabbit GLUT-1 (1:400; Millipore Sigma, 07-1401). After primary antibody incubation, the tissue was washed 1 - 3 times with a washing buffer (0.1% Triton X-100 in 0.1M PBS buffer, pH 7.4) for a total of 5 - 6 hours. Subsequently, the tissue was incubated in a blocking buffer containing secondary antibodies at an appropriate dilution for 12 - 24 hours at room temperature and then washed 3 times in 0.1M PBS, pH 7.4 for a total of 5 - 6 hours. The secondary antibody used in this study was Alexa Fluor 647 AffiniPure donkey anti-rabbit IgG (H+L) (Jackson ImmunoResearch Lab, 711-605-152). When nuclear staining was performed, 4’,6-diamidino-2’-phenylindole dihydrochloride (DAPI, Sigma Aldrich, 10236276001) was used at a 1:1000 dilution in 0.1M PBS, pH 7.4 and incubated with the tissue for 15 minutes, followed by a single wash in 0.1M PBS, pH 7.4 for 10 minutes. The DAPI and / or antibody-stained tissue sections were mounted with ProLong Diamond Antifade Mountant (ThermoFisher Scientific, P36970).

[0329] RNA labeling based on hybridization chain reaction (HCR) in tissues. Fluorescent in situ hybridization chain reaction (FITC-HCR) was used to label excitatory neurons with VGLUT1 and inhibitory neurons with GAD1, and the third-generation HCR protocol was adapted to characterize the AAV capsid variant AAV-PHP.N in brain tissue. To characterize the AAV capsid variant AAV-PHP.N in brain tissue, an HCR method for labeling excitatory and inhibitory neurons was explored. Fluorescent in situ hybridization chain reaction (FITC-HCR) was used to label excitatory neurons with VGLUT1 and inhibitory neurons with GAD1. The third-generation HCR was adapted to design 13 probe sets per target using custom software (https: / / github.com / GradinaruLab / HCRprobe). After 3 weeks of expression, as previously described (Section D. Tissue processing), transcardial perfusion and fixation of the mice were performed. To minimize RNase enzyme exposure in the fixed tissue after overnight fixation in 4% PFA, the tissue was washed with 0.1M The RNase was stored at 4°C in PBS without RNase and 0.05% sodium azide. From this point forward, the harvested brains were handled with care to avoid exposure to RNase using reagents such as RNAlater stabilization solution / PBS without RNase / RNaseZap (ThermoFisher Scientific, AM7021, AM9624, AM9780). Once the harvested brains were sliced sagittally into 100-μm-thick sections, FITC-HCR was performed to detect both genes. The tissue sections were permeabilized at RT for 1 hour using 0.1% Triton X-100 in 0.1 M PBS without RNase and prehybridized at 37°C for >30 minutes in hybridization solution (10% dextran sulfate and 10% ethylene carbonate in 2×SSC buffer (saline-sodium citrate)). The designed probes were diluted in the hybridization solution to obtain a final concentration of 2 nM. Subsequently, the tissue sections were subjected to hybridization with the probes at 37°C overnight. After this, the sections were washed twice with prewarmed wash buffer (10% ethylene carbonate in 2×SSC) at 37°C for 30 minutes and then twice with 2×SSC at RT for 30 minutes. Amplification using hairpin pairs (Molecular Technologies, CA) was performed in amplification buffer (10× dextran sulfate in 2×SSC). The hairpins were quenched at 95°C for 90 seconds and then at RT for 30 minutes and diluted with amplification buffer (60 nM). Subsequently, the tissue was incubated overnight at RT in this amplification buffer containing the hairpins with gentle stirring. Once amplification was performed, the samples were washed briefly with 2×SSC and mounted with Prolong Diamond for imaging.

[0330] Imaging and image processing. All images in this study were obtained using a Zeiss LSM Images were acquired using either an 880 confocal microscope with an objective lens Fluar 5×0.25 M27, Plan-Apochromat 10×0.45 M27 (working distance 2.0 mm), and Plan-Apochromat 25×0.8 Imm Corr DIC M27 multi-immersion, or a Keyence BZ-X700 microscope. The acquired images were processed with Zen Black 2.3 SP1 (Zeiss), BZ-X Analyzer (Keyence), Illustrator CC 2018 (Adobe), Photoshop (registered trademark) CC 2018 (Adobe), and Imaris (Bitplane). To prevent any imaging artifacts resulting from the overlap of multiple fluorescence spectra, the fluorescence excitation and emission spectra were individually retained after acquisition of the recommended linear separation for each color. A far-red fluorescent dye was selected for any additional marker staining, and any spectral overlap between detector channels was prevented by retaining the imaging parameters separately from in vivo fluorescence expression. Tissues were regularly monitored for autofluorescence or imaging artifacts prior to acquisition, and the imaging parameters were adjusted as necessary. To avoid any imaging artifacts, the imaging parameters were cross-checked using tissues without in vivo transduction. To minimize bias during comparison, the regions used for the images were made to match exactly between experimental groups.

[0331] Tissue clearing and imaging of thick tissues. To demonstrate the ability of PHP.V1 to transduce the vascular system across thick tissues such as the mouse cerebral hemisphere or half of the femur, tissues from Tek-Cre mice were evaluated after 4 weeks of expression.

[0332] The cerebral hemispheres were stained with the primary antibody anti-GFP (Aves Labs, GFP-1020) and the secondary antibody goat anti-chicken IgY, Alexa Fluor 633 (ThermoFisher Scientific, A-21103) using the iDISCO protocol 38It was purified by [method name]. For imaging, a commercially available light sheet microscope (Lavision BioTec) and a specially ordered objective lens (4×) were used. The obtained image files were reorganized by a custom MATLAB® script to enable stitching with TeraStitcher. For 3D visualization, Imaris (Bitplane) was used.

[0333] To image the mouse femur, the bone was sectioned into 300-μm-thick slices for antibody penetration and stained with the primary antibody anti-GFP and the secondary antibody Alexa Fluor 488 donkey anti-chicken IgY (Jackson ImmunoResearch Lab, 703-545-155), and then purified by the TDE (2-2'-thiodiethanol) purification method 41 It was purified by [method name]. Images were acquired with a confocal microscope (Zeiss LSM 880) and visualized with Imaris software.

[0334] Tissue processing and imaging for quantification of rAAV transduction in vivo. For quantification of rAAV transduction, 6- to 8-week-old male mice were injected intravenously with the virus and the virus was allowed to express for 3 weeks (unless otherwise specified). Mice were randomly assigned to groups and the experimenter was blinded. Mice were perfused and organs were fixed in PFA. The brain and liver were cut into 100-μm-thick sections and immunostained with different cell type-specific antibodies as described above. Images were acquired with a 25× objective lens using a Zeiss LSM 880 confocal microscope or a Keyence BZ-X700 microscope, and images for direct comparison between groups were acquired and processed with the same microscope and settings.

[0335] For quantification of transduction of PHP.B family variants into tissues, Zeiss Images were acquired using a 25× objective lens with 1× digital zoom on an LSM 880 confocal microscope. For each of one variant, n = 3 mice were used to acquire images across four brain regions - cortex, striatum, ventral midbrain, and thalamus - and the tissues were stained with three cell type markers (NeuN, Olig2, and S100). For each mouse, two images were acquired for each cell type marker for one brain region, and the mean values were plotted.

[0336] For PHP.N transduction analysis, images were acquired on a Keyence BZ-X700 microscope using a 20× objective lens. Using n = 3 mice, images were acquired for three cell type markers (NeuN, Olig2, and S100) across four brain regions - cortex, striatum, ventral midbrain, and thalamus - to cover the entire brain region. This included 6 - 8 images for each mouse for each cell type marker to cover the cortex, thalamus, and striatum, and 2 images to cover the ventral midbrain. For each mouse, the mean values from the images were plotted across each region.

[0337] PHP.V GLUT1 + For transduction analysis, images were acquired using a 25× objective lens with 1× digital zoom on a Zeiss LSM 880 confocal microscope. GLUT1 + Each distinct blood vessel within the image with staining and XFP expression was determined to be positive for transduction. Quantification of expression from the CAG-mNeonGreen vector was performed across the cortex (n = 3 per group). Each data point was derived from the mean of 3 - 2 images per mouse. For the Tek-Cre and Ai14 mouse experiments, different brain regions were quantified with n = 2 per group. For the cortex, cerebellum, corpus striatum, and ventral midbrain, the mean values from 3 - 4 images for one region per mouse were plotted.

[0338] In vitro characterization of the AAV vector

[0339] Human brain microvascular endothelial cells (HBMECs) (ScienCell Research Laboratories, Cat. 1000) were cultured according to the instructions provided by the supplier. HBMECs from frozen stock vials were cultured in fibronectin-coated T-75 flasks using endothelial cell medium (Cat. 1001) at a seeding density of 7000 - 9000 cells / cm 2 2. Cells were subcultured at the recommended seeding density in fibronectin-coated 48-well plates (growth area 0.95 cm 2 2) and incubated at 37 °C for approximately 24 - 48 hours until the cells were completely adhered at approximately 70 - 80% confluence. The viral vector packaging pAAV-CAG-mNeongreen was added to the cell culture at a dose of either 1 × 10 8 or 1 × 10 10 vg per well (3 wells per dose per vector). The medium was replaced after 24 hours, and the cultures were evaluated for fluorescence expression 3 days after infection. The cell culture was maintained by replacing the culture medium every other day according to the supplier's recommendation.

[0340] Data analysis

[0341] Quantification of rAAV vector transduction in mouse tissues. Manual counting was performed for cell types in which expression and / or antibody staining covered the entire cell morphology using the Adobe Photoshop (registered trademark) CC 2018 Count Tool. The Keyence Hybrid Cell Count software (BZ-H3C) was used, which was able to easily detect clearly different cells from the entire dataset. To maintain consistency in counting across different markers and groups, quantification across all groups in all regions of the brain was assigned to one person.

[0342] Manual counting was performed for GLUT-1 stained blood vessels and the expression of ssAAV:CAG-mNeonGreen and ssAAV:CAG-DIO-EYFP, and the efficiency was calculated as the percentage of XFP+ blood vessels relative to GLUT-1 staining. Manual counting was also performed to quantify nuclear or cell body stained cells, including NeuN-, Olig2-, and S100-stained cells. The efficiency was calculated as the percentage of XFP+ cells relative to cell marker+ cells.

[0343] Keyence Hybrid Cell Count software (BZ-H3C) was used to quantify the expression of nuclear-localized AAV genomes in hepatocytes of the liver co-localized with the DNA stain DAPI and was also used in studies targeting the ssAAV:GFAP-2xNLS-mTurquoise2 genome with the S100 cell marker.

[0344] The mean fluorescence intensity across microscopic images was quantified using ImageJ software. The images were processed and the mean fluorescence intensity was measured using background removal and thresholding operations.

[0345] Alignment and processing of NGS data. Raw fastq files from NGS runs were processed with an ordering script (code will be made available on Github) that aligns the data to AAV9 template DNA fragments containing diverse regions 7×NNK (for R1) or 11×NNN (for R2; synthesized as 11×NNN). The pipeline for processing these datasets included filtering of the datasets to remove low-quality reads by using deep sequencing quality scores for each sequence. Variant sequences were then recovered from the sequencing reads by searching the adjacent template sequences and extracting the nucleotides of the diverse regions (exact string matching algorithm). The quality of the aligned data was further investigated to remove any incorrect sequences (e.g., those having stop codons). The raw data was plotted (as shown in Supplementary Fig. 1e) to study the quality of recovery across all libraries. Based on the RC distribution, the inventors adapted a binarization method to remove the most likely incorrect mutants that could have arisen as a result of PCR or NGS-based errors. If there was a PCR mutation or NGS error on the recovered parental sequence, this parent had to be present at least one round earlier than the incorrect sequence, and thus there should be a difference in RC, which is the premise.

[0346] For the R1 tissue library, a sharp drop was observed in the slope of the distribution curve after a long tail of low-count sequences, and it was found that there were more sequences in the higher count range in the parental variant form. The threshold for RC was set manually to remove such incorrect mutants. Custom Python-based scripts were then used to process the binarized data differently based on the experimental requirements as described elsewhere.

[0347] For the R2 tissue libraries from the PCR pool and the synthesis pool, considering the smaller library size compared to R1, the data was binarized in two steps. Only the input DNA and the tissue recovery sequences present in the viral library were considered (after removing lower count variants from the input library following the same principle as the R1 tissue library). This step partially removed the long tail of low count reads. As a second step, the binarization described for the R1 tissue library was applied.

[0348] Although it seems plausible that true variants could be lost during binarization, this method minimized false positives because low count mutants in the tissue and viral libraries often seemed to have very high enrichment scores (when normalizing RC against the input library). In other words, a selective investigation of positively and negatively enriched variants with higher confidence in their NGS RC became possible through binarization.

[0349] As an alternative to the manual binarization method, an error correction method called "folding" was constructed to further validate the results from the filtered dataset. This method starts with the lowest count variant (variant with count 1) and searches for possible parent variants, where the parent variants are shifted by one nucleotide each but have at least twice the count (fold change = (2 ΔCT )(where CT is the PCR cycle threshold)). Then, this error correction method transfers the counts of these potentially erroneous sequences to their original sequences and recursively repeats until all sequences have been considered. Applying this error correction to the binarized data captured an additional approximately 0.002 - 0.03% of the sequences (compared to >19% captured by binarization), confirming that the binarization strategy was generally successful.

[0350] NGS data analysis. Subsequently, the aligned data was further processed by a custom data processing pipeline using scripts written in Python (available from Github). The enrichment score of variants across different libraries (total = N) was calculated from the read count (RC) according to the following formula: Enrichment score = log10[(variant 1 RC in tissue library 1 / total of variant N RC in library 1) / (variant 1 RC in virus library / total of variant N RC in virus library)]

[0351] To consistently represent library recovery between R1-selected and R2-selected variants, the enrichment score of variants in R1 selection was estimated. The z-score of variants within a particular library was calculated using this formula: z-score = (read count_i - mean) / standard deviation. Where read count_i is the raw copy number of variant i, mean is the average of the read counts of all variants across a particular library, and standard deviation is the standard deviation of the read counts of all variants across a particular library.

[0352] Since DNA and viral libraries did not undergo complete sample extraction, unlike tissue libraries, the inventors assigned putative RC to variants that were not present in the input library but were present in the output library. For example, the R1 viral library is the input library to the R1 tissue library. Assuming that these variants are found in relatively low abundance compared to variants recovered from deep sequencing, the putative RC is defined as the number that is less than the lowest RC in the library. In the viral library, since the lowest RC was 1.0, the inventors assigned a putative RC of 0.9 to all missing variants. The inventors used this method to calculate the enrichment score of the R1 tissue library normalized to the R1 viral library (Figure 1d). This was done to consistently represent the library over two selection rounds. However, the individual enrichment scores among the R1 variants did not provide significant added value to the variants selected in the R2 selection, as described in the criteria for separating signal from noise in R1 using RC.

[0353] Heatmap generation. The relative AA distributions of diverse regions are plotted as heatmaps. The plots were generated using the Python Plotly plotting library. Heatmap values were generated from a custom script written in Python using functions from the custom “pepars” Python package. Each heatmap uses both the expected (input) and output distributions of the amino acid sequences. The output distribution must be a list of sequences and their counts, and the input distribution can be either a list of sequences and their counts or the expected amino acid frequencies from a template such as NNK. For both input and output, the total count of amino acids at each position is tailed according to the count of each sequence, then divided by the total count of counts, thereby obtaining the frequency of each amino acid at each position. Next, the log2 fold change between the output and input is calculated. For amino acids where the count of either the input or output is 0, the calculation is not performed. To distinguish statistically significant amino acid biases from each other, statistical tests were performed using the statsmodels Python library. When there were two amino acid counts, a two-sided, two-proportion z-test was performed, and a one-proportion z-test was performed to compare the output amino acid count to the expected input frequency from the template. Next, all p-values were corrected for multiple comparisons using the Bonferroni correction. Then, only the summary of the differences in biases less than the significance threshold of 1×10 -4 is shown on the heatmap, and all other (non-significant) squares are left blank.

[0354] Clustering analysis. Using a custom script written in MATLAB® (version R2017b; MathWorks), the inverse Hamming distance representing the number of shared AAs between two peptides was determined. Then, Cytoscape (version 3.7.1 53) Software was used to cluster variants. AA frequency plots showing highlighted clusters were created using Weblogo (version 2.8.2). Reverse Hamming distances (representing the number of shared AAs between two peptides) were determined for all unique capsid variants with counts greater than 10 and enrichment greater than 2.5-fold after R2 selection. This process iteratively compares each variant within a group to every other variant. Capsid variants were then clustered by their reverse Hamming distances using Cytoscape. The minimum reverse Hamming distance for visualization was chosen manually based on sequence similarity.

[0355] For amino acid frequency plots, the number at the bottom represents the position of diverse motifs starting from 1. The size of the amino acids within the stack reflects the proportion of unique clones in which the AA appears at that specific position within the motif. The color code is based on AA properties. The positively charged residues K, R, and H are blue. The negatively charged residues D and E are red. The amide-containing polar residues Q and N are magenta. The polar residues T and S are green. The highly hydrophobic residues A, L, V, I, P, F, M, and W are black.

[0356] (Example 3) Multiplexed CREATE enables detailed characterization of the capsid library during round-1 selection

[0357] To identify variants that enrich in specific cell types or organs, parallel selections were performed across multiple targets and the enrichment or depletion of each capsid variant across these targets was mapped.

[0358] During DNA and viral library generation, biases can accumulate that over-represent certain capsid variants, obscuring their true enrichment during in vivo selection. These biases can be due to PCR amplification biases within the DNA library or can result from sequence biases across various steps: capsid assembly, efficiency of virus production over genome packaging, and stability during purification. This was investigated using the 7-mer-i library, a randomized 7-mer library inserted between positions 588 and 589 of AAV9 in the rAAV-ΔCap9-in-cis-Lox2 plasmid (Figure 36) (Figures 1 and 2). Sequencing to a depth of 10 - 20× million (M) reads of the library after DNA assembly and virus purification was sufficient to capture biases between variants during virus production (Figure 3; despite ~1% variant overlap between these libraries; Figures 38 and 39), demonstrating that even at permissive sites such as 588 - 589, biological constraints are imposed on the sampled sequence space. The DNA library had a uniform distribution of 9.6M unique variants among ~10M total reads (read count (RC) mean = 1.0, S.D. = 0.074), indicating minimal bias. In contrast, the viral library had 3.6M unique variants (RC mean = 4.59, S.D. = 11.15) within a depth of ~20M, indicating enrichment of a subset of variants during virus production.

[0359] For in vivo selection, the 7-mer-i viral library was administered to adult transgenic mice expressing Cre in different brain cell types at 2×10 11Doses of vg were injected intravenously into astrocytes of GFAP-Cre mice, neurons of SNAP25-Cre mice, and endothelial cells of Tek-Cre mice (n = 2 mice per Cre transgenic line; see methods). Two weeks after intravenous (IV) injection, brain and liver tissues were harvested. The liver tissue described below served as a control organ because AAV9 transduces this tissue with high efficiency. The rAAV genome was extracted from the tissues, and the capsids transduced into Cre-expressing cells were selectively amplified (Figs. 40-44). Deep sequencing revealed that approximately 8×10 4 unique nucleotide variants recovered from brain tissue and <50 variants in the spinal cord (approximately 48% of which were identified within the viral library) were observed across transgenic lines, and each variant was represented by an enrichment score reflecting the change in relative abundance between the brain library and the starting viral library (Fig. 4).

Table 7-1

[0360] Two features of this dataset are notable. First, the variants recovered within brain tissue were unevenly represented among the fractions of the transduced capsid library observed by sequencing after virus production, demonstrating how production biases the asymmetric selection results. Second, the distribution of capsid read counts (RC) revealed that more than half of the unique variants recovered after selection appear with significantly low read counts. These variants could be either unintended mutants from experimental manipulations or AAV9-like variants with low basal levels of CNS transduction (Fig. 40).

[0361] (Example 4) The novel round-2 library design improves selection results

[0362] Concerned that bias in the sequences during virus production and recovery would propagate over selection rounds regardless of post-enrichment scoring, an unbiased library was designed using an oligo pool (Twist Bioscience) based on the round-1 (R1) output (synthetic pool library). This library was compared to a library PCR directly amplified from the recovered R1 DNA (PCR pool library) (Figure 5, Table 7).

[0363] Table 7: Comparison between two methods for R2 selection. This table summarizes the advantages and disadvantages of the selection design parameters for the synthetic pool and PCR pool R2 selection methods.

Table 7-2

[0364] The synthetic pool library design included (1) an equimolar amount of approximately 8950 capsid variants present with high read counts in at least one of the R1 selections from the brain and spinal cord (Figure 40), (2) an alternative codon replication of these approximately 8950 variants (optimized for mammalian codons) to reduce false positives, and (3) a control "spike-in" library (Figures 74 and 75), resulting in a total library size of 18,000 nucleotide variants.

[0365] As expected, both round-2 (R2) virus libraries had high titers (approximately 6×10 per 10 ng of R2 DNA library per 150 mm dish) 11vg; (Figure 45) was generated, and approximately 99% of the variants from R2 DNA were observed after virus production (Figure 6). However, there were significant differences in the distribution of DNA and virus libraries from both designs. The PCR pool library promoted the bias of R1 selection (Figures 7, 46, and 47), and its abundance reflected not only the previous enrichment across tissues in R1 but also the bias from virus production and sample mixing. In contrast, the synthetic pool DNA library was more evenly distributed, and thus, the amplification of bias over the selection rounds was minimized.

[0366] For in vivo selection, a dose of 1×10 12 vg was administered to each adult transgenic mouse, including three of the previously used strains (Cre transgenic strains - GFAP, SNAP25, Tek - n = 2 mice each) as well as the Syn - Cre strain (for neurons). Two weeks after IV injection, the rAAV genome was extracted from brain samples, selectively amplified, and deep - sequenced (similar to the case of R1). The synthetic pool library produced a larger number of positively enriched capsid variants (e.g., approximately 1700 variants versus approximately 700 variants per tissue library at the amino acid (AA) level in GFAP - Cre) than the PCR pool brain library (Figures 8 and 48). In the synthetic pool, approximately 90% of the variants from the spike - in library were positively enriched as expected (Figure 48, middle panel; Figure 74).

[0367] The degree of correlation of enrichment scores of variants recovered from both the PCR pool library and the synthetic pool library varies among each Cre transgenic line, which demonstrates the presence of noise in the experiment (Figure 49). The codon duplication feature of the synthetic pool addresses this dilemma by identifying the level of enrichment required in each selection and making it higher than the noise (Figures 9, 50, and 51). This is a significant advantage over PCR pool design, which allows researchers to interpret enrichment scores in a given selection with confidence.

[0368] The enrichment level at which the correlation breaks down appears to vary by Cre line. A disadvantage of the PCR pool is that there is no way to determine whether it or the synthetic pool is the larger “true” enrichment score, or even whether there is cause for concern about a particular enrichment value. The correlation between positively enriched variants between these two methods was found to improve with the magnitude of positive enrichment. For each experiment, there is an enrichment level below which the scores become non-reproducible or noisy. Figure 50 essentially demonstrates that there is no PCR or synthetic pool with a lower enrichment score that has more “truth”. This is because the synthetic pool methodology using its codon duplication has a built-in control for determining an enrichment level below which the enrichment value has no further predictive power. The term “noise” is used herein to refer to the region of enrichment in a particular experiment below which the values lose their reproducibility and predictive power. By being able to experimentally determine an enrichment signal above the noise, researchers can focus on an internally reproducible level of enrichment and analyze the data, thereby avoiding selecting false positive variants or drawing unfounded conclusions.

[0369] Therefore, if one is only interested in the most highly enriched variants for a particular tissue, PCR pool design with enrichment normalization for the viral library may not differ significantly from synthetic pool designs (e.g., Tek-Cre or SNAP-Cre) that use an additional round of selection for a subset of in vivo selection. However, without additional validation, it is difficult to predict whether a given in vivo system will function like Tek-Cre. This becomes very important in multiplexed selection studies where target-specific variants may not be able to achieve the highest enrichment in one particular in vivo selection.

[0370] (Example 5) Analysis of the AAV capsid library after round-2 selection

[0371] The AA distribution of the DNA library closely matches the oligopool design, but viral production selected for a motif with Asn (N) at position 2, β-branched AAs (I, T, V) at position 4, and positively charged AAs (K, R) at position 5 (Figure 10, 52). The fitness for BBB crossing resulted in very different patterns. Compared to the R2 viral library, highly enriched variants, e.g., proline (P) at position 5 and phenylalanine (F) at position 6, share a preference trend.

[0372] Therefore, the distribution of variants positively enriched from the brain across all peripheral organs was determined (Figure 11, left). Approximately 60 variants highly enriched in the brain are relatively depleted across all other organs (Figure 11, center). Motivated by the expected behavior of spike-in control variants (AAV9, PHP.B, PHP.eB), 11 novel variants were selected for further validation (Figure 11, right), which included several that would have been missed if the selection was based on PCR pools or CREATE (Table 8).

[0373] Table 8: Ranking of AAV-PHP capsids among methods. Among all capsids recovered from R2 Tek-Cre selection by synthetic pool enrichment score (representing M-CREATE), PCR pool enrichment score (representing approximately M-CREATE), or PCR pool read count (representing CREATE) rank of selected variants. Starting from 1 for the highest rank, "not recovered" represents the absence of the variant in the R2 sequencing data.

Table 8-1

Table 8-2

[0374] These variants were chosen because of their enrichment and if they entered the sequence space. Positively enriched variants were found to cluster into distinct families based on sequence similarity. Consistent with the heatmap discussed above, most of the enriched variants share a common motif: T at position 1, L at position 2, P at position 5, F at position 6, and K or L at position 7, forming distinct families by selection (Figure 12, 53). This AA pattern closely resembles that of the previously identified variant AAV-PHP.B-TLAVPFK. Considering the sequence similarity among members, the inventors predicted that they could similarly cross the BBB and target the central nervous system.

[0375] The fact that it can be constructed completely independently and recover the AAV-PHP.B array family from the selected library twice confirms that the array space coverage of this viral library was broad enough to recover a family of variants sharing a common motif. Different from CREATE which identified only one variant, AAV-PHP.B, M-CREATE yielded a diverse family of PHP.B-like that suggests important chemical features of this motif. The sequence diversity within this family suggests that the isolation of AAV-PHP.B was not just luck in previous studies (considering the theoretical starting library size of about 1,300,000,000) and that this is the major family for this particular experiment.

[0376] (Example 6) Capsid recovery from round-2 selection yields a pool of AAV9 variants with enhanced BBB entry and CNS transduction

[0377] Considering the dominance of the PHP.B family in this particular selection, the most enriched member, TALKPFL, was tested (Figures 12 and 13). Hereafter, this member is referred to as AAV-PHP.V1. Somewhat surprisingly considering its sequence similarity to AAV.PHP.B, the tropism of AAV-PHP.V1 is biased towards transduction of cerebrovascular cells (Figures 14, 54). When delivered intravenously, AAV-PHP.V1 carrying a fluorescent reporter under the control of the ubiquitous CAG promoter transduces approximately 60% of the cortical cerebrovascular system compared to approximately 20% with AAV-PHP.eB and little to no transduction with AAV9 (Figures 14 and 16). In addition to the vasculature, AAV-PHP.V1 also transduced approximately 60% of cortical S100 + astrocytes (Figure 17). However, AAV-PHP.V1 is not as efficient as previously reported AAV-PHP.eB for astrocyte transduction (when packaged with the astrocyte-specific GfABC1D promoter, Figure 55). +

[0378] For applications that require endothelial cell-restricted transduction by intravenous delivery, the AAV-PHP.V1 vector can be used in three different systems: (1) in endothelial cell type-specific Tek-Cre mice using a Cre-dependent expression vector (FIGS. 15 (left) and 18), (2) in fluorescent reporter mice where Cre is delivered by an endothelial cell type-specific MiniPromoter (Ple261) (FIGS. 15 (right) and FIGS. 19 to the left column of FIG. 58), and (3) in wild-type mice by packaging a self-complementary genome (scAAV) containing a ubiquitous promoter (right column of FIG. 58). The mechanism of endothelial cell-specific transduction by AAV-PHP.V1 using the scAAV genome is unknown, but a shift in vector tropism has been reported for another capsid when packaging the scAAV genome.

[0379] Considering the dramatic difference in tropism between AAV-PHP.V1 and AAV-PHP.B / eB, the inventors tested several additional variants within the PHP.B-like family. AAV-PHP.V2-TTLKPFL, which is a variant that differed from AAV-PHP.V1 by only one AA, had a similar tropism (FIGS. 59-61). AAV-PHP.V2 was found to be present in high abundance across all brain libraries in the R1 selection and highly enriched in R2 (FIGS. 4, 11 (right panel), 12, 13, and 40). Given its sequence similarity, a tropism similar to that of AAV-PHP.V1 was expected. This was verified in vivo in C57BL / 6J adult mice (ssAAV-PHP.V2:CAG-mNeongreen genome; 3×10 11 vg dose per adult mouse; n = 3; FIG. 59), in Tek-Cre mice (ssAAV-PHP.V2:CAG-DIO-EYFP genome; 1×10 12 vg dose per adult mouse; n = 2; FIG. 60), and in GFAP-Cre mice (ssAAV-PHP.V2:CAG-DIO-EYFP; 1×10 12 vg dose per adult mouse; n = 2; FIG. 61).

[0380] Three other variants, AAV-PHP.B4-TLQIPFK, AAV-PHP.B7-SIERPFK, and AAV-PHP.B8-TMQKPFI (Figs. 12, 13, 20, and 21), which have arrays of nearly equal deviations from both AAV.PHP.V1 and AAV.PHP.B, have PHP.B-like tropism with a bias in transduction to neurons and astrocytes (Figs. 21 and 62-64). Similar variants in the spike-in library, AAV-PHP.B5-TLQLPFK and AAV-PHP.B6-TLQQPFK, also shared this tropism (Figs. 13, 20, 21, and 62).

[0381] To evaluate the performance of the spike-in library, two highly enriched variants at similar positions within the array space: AAV-PHP.B6-TLQLPFK and AAV-PHP.B7-TLQQPFK (Fig. 48 (central panel), and 53) were selected, which were previously identified in the 3-mer-s PHP.B library but had not been verified in vivo until now. In C57BL / 6J adult mice, at a moderate dose of 1×10 11 vg, these variants also exhibited PHP.B-like tropism (Figs. 20-21 and 62).

[0382] Next, a series of variants selected to confirm the predictive power of M-CREATE outside this family were investigated: (1) AAV-PHP.C1-RYQGDSV (Figs. 12, 13, 20, and 21), a highly enriched variant with a completely unrelated sequence that transduced astrocytes with similar efficiency and neurons with low efficiency compared to other tested variants from the B-family (Fig. 21). (2) AAV-PHP.X1-ARQMDLS and AAV-PHP.X2-TNKVGNI (right side of Fig. 46), two variants that were found at high abundance in the R2 synthetic pool virus library and were negatively enriched in the brain (consistently with both codon duplications), and are variants with poor transduction into the CNS (Fig. 63). (3) AAV-PHP.X3-QNVTKGV and AAV-PHP.X4-LNAIKNI (Fig. 65), two variants that were found at higher abundance in the brain library from the PCR pool R2 and were also unable to exhibit performance superior to AAV9 in the brain.

[0383] Collectively, the characterization of these AAV variants demonstrates several key points. First, within diverse sequence families, there is room for both functional redundancy and the emergence of new directions. Second, highly enriched sequences outside the major families may also possess enhanced functions. Third, supported by codon duplication matches in synthetic pools, the enrichment of variants across tissues can be useful for prediction. Fourth, the synthetic pool R2 library contains a subset of the sequences present in the PCR pool R2 and thus may lack some enhanced variants, while false positives are enriched in populations that do not include the PCR pool.

[0384] The ability to confidently predict in vivo transduction from a pool of 18,000 variants across mice is a significant advancement in the selection process and demonstrates the power of M-CREATE for the evolution of individual vectors.

[0385] (Example 7) Reexamination of capsid selection to generate AAV.PHP.eB reveals variants that specifically transduce neurons

[0386] NGS was used to reexamine the CREATE methodology prior to generating AAV-PHP.eB 27 The 3-mer-s(s-substituted) PHP.B library generated by the method was reexamined (Figure 24). The brain library was deep-sequenced using Cre-dependent PCR and the R2 liver library from wild-type mice (all capsid sequences were processed by PCR regardless of Cre-mediated inversion), and 150 - 200 positively enriched capsids were identified in brain tissue (Figures 25, 66, and 67). Briefly, a reexamined 3-mer-s PHP.B library (a total of approximately 40,000 variants) that diversified in three consecutive AA segments at positions 587 - 597 of the AAV-PHP.B capsid (corresponding to 587 - 590 AA on AAV9) (Figure 24). Selection was performed in three Cre-transgenic lines: Vglut2-IRES-Cre for glutamatergic neurons, Vgat-IRES-Cre for GABAergic neurons, and GFAP-Cre for astrocytes.

[0387] Variants positively enriched in the brain and negatively enriched in the liver showed a significant bias towards certain AAs: G, D, E at position 1; G, S ...

Claims

**Claim 1** i. A first amino acid sequence that is at least 98% identical to amino acids 217 to 736 of SEQ ID NO: 1, wherein amino acids 217 to 586 and amino acids 591 to 736 of the first amino acid sequence are identical to amino acids 217 to 586 and amino acids 591 to 736 of SEQ ID NO: 1, and the amino acid residues at positions 587 to 588 and positions 589 to 590 relative to SEQ ID NO: 1 are both AQ, and the first amino acid sequence, ii. A second amino acid sequence selected from the group consisting of SEQ ID NOs: 435 to 859, 864, 866 inserted at positions 588_589 within SEQ ID NO: 1, An AAV capsid protein comprising: when measured in the central nervous system (CNS) of a subject when systemically delivered to the subject, characterized by at least one of an increase in specificity and an improvement in transduction efficiency compared to the native AAV capsid protein provided by SEQ ID NO: 1, and the second amino acid sequence at positions 588_589 within SEQ ID NO: 1 is not TLAVPFK, nor KFPVALT, nor SVSKPF, nor FTFTTPK, nor MNATKNV, nor NGGTSSS, nor TRTNPEA, nor YTFSQG, an AAV capsid protein An AAV comprising. **Claim 2** The AAV according to claim 1, wherein the second amino acid sequence is selected from the group consisting of TALKPF, TTALKPF, TLQIPFK, TMQKPF, SIERPFK, and RYQGDSV. **Claim 3** The AAV according to claim 1, wherein the AAV capsid protein is present in VP1, VP2, and VP3 capsid protein monomers that form the AAV capsid. **Claim 4** The AAV according to claim 3, wherein the AAV capsid is chimeric. **Claim 5** The AAV according to claim 3, wherein 60 copies of the AAV capsid protein are assembled into an AAV capsid. **Claim 6** The AAV comprising the AAV capsid protein according to claim 1, wherein the CNS comprises cell types selected from the group consisting of neurons, oligodendrocytes, astrocytes, and cerebrovascular cells. **Claim 7** The AAV according to claim 1, wherein the CNS comprises tissues selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord. **Claim 8** The AAV according to claim 1, which is isolated and purified. **Claim 9** An AAV according to claim 1, formulated as a pharmaceutical preparation for intravenous administration for treating said CNS disease or condition, said pharmaceutical preparation further comprising a pharmaceutically acceptable carrier.

10. An AAV according to claim 9, wherein said pharmaceutical preparation further comprises a therapeutic agent.

11. An AAV comprising an AAV capsid protein comprising a 7 - amino acid insert (X1 - X2 - X3 - X4 - X5 - X6 - X7) between amino acid 588 and amino acid 589 in the amino acid sequence of the AAV capsid protein provided by SEQ ID NO: 1, wherein the amino acid residues at positions 587 - 588 and positions 589 - 590 relative to SEQ ID NO: 1 are both AQ, X1 is an amino acid selected from the group consisting of E, D, G, R, S, and T; X2 is an amino acid selected from the group consisting of A, G, I, L, M, N, Q, T, and Y; X3 is an amino acid selected from the group consisting of E, K, L, T, and Q; X4 is an amino acid selected from the group consisting of G, I, K, L, R, T, and V; X5 is an amino acid selected from the group consisting of A, D, G, P, L, Q, and V; X6 is an amino acid selected from the group consisting of F, K, N, P, Q, S, and V; X7 is an amino acid selected from the group consisting of I, K, L, P, and V; said 7 - amino acid insert is not TLAVPFK, nor KFPVALT, nor SVSK PFF, nor FTTTPK, nor MNATKNV, nor NGGTS SS, nor TRTNPEA, nor YTFSQG W, and said 7 - amino acid insert has a brain average enrichment score (log10 scale) of 0.5 or more, said AAV capsid protein, when measured in the central nervous system (CNS) of a subject when systemically delivered to the subject, is characterized by at least one of an increase in specificity and an improvement in transduction efficiency compared to the native AAV capsid protein provided by SEQ ID NO:

1.

12. An AAV according to claim 11, wherein said 7 - amino acid insert is selected from the group consisting of TALKPF L, TTLKPF L, TLQIPF K, TMQKPF I, SIERP F K, and RYQGD SV.

13. An AAV according to claim 11, wherein said AAV capsid protein is present in the VP1, VP2, and VP3 capsid protein monomers that form the AAV capsid.

14. The AAV according to claim 13, wherein the AAV capsid is chimeric.

15. The AAV according to claim 13, wherein 60 copies of the AAV capsid protein are assembled into an AAV capsid.

16. The AAV comprising the AAV capsid protein according to claim 11, wherein the CNS comprises a cell type selected from the group consisting of neurons, glial cells, oligodendrocytes, ependymal cells, astrocytes, Schwann cells, satellite cells, and enteric glial cells.

17. The AAV according to claim 11, wherein the CNS comprises a tissue selected from the group consisting of the brain, thalamus, cortex, striatum, ventral midbrain, and spinal cord.

18. The AAV according to claim 11, wherein the AAV capsid protein further comprises an amino acid substitution comprising A589N or Q590P.

19. The AAV according to claim 11, which is isolated and purified.

20. The AAV according to claim 11, formulated as a pharmaceutical preparation for intravenous administration for treating the CNS disease or condition, and the pharmaceutical preparation further comprises a pharmaceutically acceptable carrier.

21. The AAV according to claim 20, wherein the pharmaceutical preparation further comprises a therapeutic agent.

22. A recombinant vector comprising a nucleic acid encoding the AAV capsid protein according to any one of claims 1 to 21.

23. a) a first vector comprising the recombinant vector according to claim 22; b) a second vector encoding a helper virus protein; c) a third vector comprising a therapeutic nucleic acid encoding a therapeutic gene expression product comprising a kit.

24. A pharmaceutical preparation for treating a disease or condition in a subject, the pharmaceutical preparation comprising the AAV capsid protein according to any one of claims 1 to 21.

25. The pharmaceutical preparation according to claim 24, wherein the disease or condition is a disease or condition of the central nervous system of the subject.

26. An in vitro method for producing recombinant AAV particles from the AAV according to any one of claims 1 to 21, comprising: a) introducing into a cell: i. a first nucleic acid sequence encoding a therapeutic gene expression product; ii. a second nucleic acid sequence encoding a recombinant viral genome comprising a capsid (Cap) gene modified to express the AAV according to any one of claims 1 to 21; iii. a third nucleic acid sequence encoding an AAV helper virus genome introducing a nucleic acid comprising; and b) assembling the recombinant AAV particles comprising an AAV capsid encapsulating the first nucleic acid sequence within the capsid A method comprising.

Citation Information

Patent Citations

  • Targeting peptides for inducing adeno-associated virus (AAV)

    JP2019506141A

  • Selective recovery

    US20180230186A1