Methods of characterizing and utilizing agent-condensate interactions

Abstract

To provide methods of characterizing and utilizing agent-condensate interactions.SOLUTION: Described herein are methods of characterizing agent incorporation into condensates, methods of reducing transcription of oncogenes associated with condensates, and methods of using peptides to inhibit nuclear receptor and cofactor binding in condensates. Herein it is shown that transcriptional condensates are implicated in driving oncogenesis and provide a framework for new entry points in cancer therapeutics.SELECTED DRAWING: Figure 22

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 848,539, filed May 15, 2019, and U.S. Provisional Application No. 62 / 927,073, filed October 28, 2019, the contents of which are incorporated herein by reference in their entireties.

[0002] Federal Government Support This invention was made with federal support under grants GM123511, CA213333, and CA155258 awarded by the National Institutes of Health, and PHY1743900 awarded by the National Science Foundation. The U.S. Government has certain rights in this invention. [Background technology]

[0003] Transcription factors and cofactors that occupy super-enhancers form liquid-like condensates that compartmentalize and concentrate the transcription machinery at key cellular identity genes. Tumor cells acquire long super-enhancers of driver oncogenes, thereby contributing to the transcriptional dysregulation that characterizes cancer. Summary of the Invention

[0004] It is shown herein that transcriptional condensates are implicated in driving carcinogenesis, providing a framework for novel intervention points in cancer therapy. The discovery that multiple key proteins in the transcriptional machinery reside within these structures may make previously undruggable targets (due to their disordered nature) attractive drug targets. Unexpectedly, it is shown herein that some drugs (e.g., small molecules) enter transcriptional condensates independently of the presence of a drug target. The methods disclosed herein, which measure the extent to which a drug can enter condensates and its specificity for different types of condensates (e.g., transcriptional condensates, heterochromatin or repressive condensates, splicing speckle condensates, nucleoli, chromatin condensates, Polycomb condensates, DNA damage repair condensates), provide valuable information regarding drug exposure and off-target effects. The methods disclosed herein can determine how much of a drug partitions into condensates and how much partitions outside of condensates to help determine the efficacy of a candidate in a cell or organism. Also provided is a method for controlling the incorporation of drugs into condensates by adjusting the number of aromatic side chains on the drug or condensate components. Additionally, determining how drugs function in condensates may enable the adoption of known drugs in new applications.

[0005] Some aspects of the present invention relate to methods for characterizing a drug, the method comprising contacting the drug with a composition comprising a condensate having at least one component and measuring the incorporation of the drug into the condensate. In some embodiments, the incorporation of the drug into the condensate is detected without the use of a detectable tag on the drug. In some embodiments, the incorporation of the drug into the condensate is detected using Raman spectroscopy, spectrophotometry and quantitative phase contrast microscopy, or a spin-down assay. In some embodiments, the drug comprises a detectable tag. In some embodiments, the component or the condensate comprises a detectable tag. In some embodiments, the detectable tag is a fluorescent tag.

[0006] In some embodiments, the method includes contacting an agent having a detectable tag with a composition comprising the condensate, measuring the incorporation of the agent having the detectable tag into the condensate, contacting the composition comprising the condensate and the agent having the detectable tag with a control agent that does not have a detectable tag, and again measuring the incorporation of the agent having the detectable tag into the condensate.

[0007] In some embodiments, the method comprises contacting the agent with a plurality of condensates having one or more different components. In some embodiments, the method comprises contacting the agent with a plurality of compositions, each having a condensate having at least one different component. In some embodiments, the method comprises contacting a plurality of agents with a plurality of compositions, each having a condensate containing the same component.

[0008] In some embodiments, the at least one component is a transcription condensate component, a heterochromatin condensate component, a component of a condensate physically associated with mRNA initiation, a component of a condensate physically associated with mRNA elongation, a component of a chromatin condensate, a component of a Polycomb condensate, or a component of a DNA damage repair condensate. In some embodiments, the at least one component is a Mediator, a component of a Mediator, MED1, BRD4, POLII (i.e., POL2), SRSF2, FIB1, NPM1, HP1α, a histone, a histone tail, a component of Polycomb Repressive Complex 1 (PRC1) (e.g., CBX2), or 53BP1. In some embodiments, the at least one component is a component or functional portion of a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate. In some embodiments, the component comprises an intrinsically disordered region (IDR).

[0009] In some embodiments, the component comprises a different detectable tag compared to the agent. In some embodiments, the uptake of the agent is measured relative to a control. In some embodiments, the uptake of multiple agents is measured and compared to each other.

[0010] In some embodiments, the agent is capable of binding to a target. In some embodiments, the condensate does not include a target. In some embodiments, the target is present primarily outside the condensate. In some embodiments, the target is present primarily within the condensate. In some embodiments, the target is a therapeutic target. In some embodiments, the target is an enzyme, receptor, ligand, oncogene, oncogene product, or transcription factor. In some embodiments, the target is genomic DNA. In some embodiments, the composition comprises a target.

[0011] In some embodiments, the relative amount of agent that is or is not incorporated into the condensate is measured. In some embodiments, the condensate is physically associated with DNA.

[0012] In some embodiments, the condensates are present within a cell. In some embodiments, the cell is a diseased cell. In some embodiments, the condensates are present in vitro. In some embodiments, the agent is a small molecule, polypeptide, or nucleic acid. In some embodiments, the agent is a known chemotherapeutic agent. In some embodiments, the agent is a candidate chemotherapeutic agent. In some embodiments, the agent is or comprises cisplatin or a derivative thereof. In some embodiments, the agent is or comprises JQ1 (2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (S)-tert-butyl)) or a derivative thereof. In some embodiments, the agent is or comprises tamoxifen or a derivative thereof.

[0013] Some aspects of the present invention are directed to methods of characterizing a first agent, the method comprising contacting the first agent with a composition comprising a condensate having at least one component, the condensate containing at least a second agent, and measuring the ability of the first agent to cause displacement of the second agent from the condensate. In some embodiments, the second agent comprises a detectable tag. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, a condensate component is a target for the second agent.

[0014] Some aspects of the invention are directed to compositions comprising a condensate and an agent having a therapeutic target, wherein the condensate does not comprise the therapeutic target. In some embodiments, the therapeutic target is genomic DNA.

[0015] As shown in the examples below, dyes that do not preferentially partition into condensates can be modified to preferentially partition into condensates by coupling with a drug or moiety. Some aspects of the present invention are directed to methods of modulating partitioning of a first drug into condensates, comprising coupling the first drug to a second drug, thereby modulating partitioning of the first drug into the condensate. In some embodiments, the condensate is selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, or nucleoli. In some embodiments, partitioning of the first drug into condensates is increased. In some embodiments, partitioning of the first drug into condensates is decreased. In some embodiments, the therapeutic efficacy of the coupled first drug is increased compared to the uncoupled first drug. In some embodiments, the side effects of the coupled first drug are reduced compared to the uncoupled first drug.

[0016] Also, as shown in the Examples below, increasing the aromatic side chain content of a drug increases the drug's partitioning into MED1 in vitro condensates (i.e., droplets). Some aspects of the present invention are directed to methods of modulating the drug's partitioning into condensates by modifying the drug to increase or decrease the number of aromatic side chains. In some embodiments, the partitioning of the modified drug into condensates is increased compared to the unmodified drug. In some embodiments, the partitioning of the modified drug is decreased compared to the unmodified drug.

[0017] Some aspects of the present disclosure are directed to methods of screening for candidate drugs with modulated partitioning into condensates, the method comprising modifying a drug having a condensate partition coefficient and measuring the condensate partition coefficient of the modified drug; where the modified drug has a different partition coefficient than the original drug, the modified drug is identified as a candidate drug with modulated partitioning into condensates. In some embodiments, the condensate partition coefficient of the modified drug is measured in an in vitro condensate. In some embodiments, the condensate partition coefficient of the modified drug is measured in an intracellular condensate. In some embodiments, a candidate drug is identified as an improved candidate drug if the candidate drug has increased partitioning into condensates that have a therapeutic target for the candidate drug. In some embodiments, a candidate drug is identified as an improved candidate drug if the candidate drug has decreased partitioning into condensates that do not have a therapeutic target for the candidate drug. In some embodiments, the candidate drug with modulated condensate partitioning is a chemotherapeutic drug. In some embodiments, the modification comprises an increase or decrease in the number of aromatic side chains of the drug.

[0018] Some aspects of the invention are directed to methods of reducing transcription of an oncogene, comprising contacting the transcription condensate with an agent that modulates the composition of the transcription condensate associated with the oncogene, dissolves the transcription condensate, or dissociates the transcription condensate.

[0019] In some embodiments, the agent dissolves the transcription condensate, separates the transcription condensate from genomic DNA containing the cancer gene, or eliminates one or more components of the transcription condensate. In some embodiments, the agent is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of the transcription condensate. In some embodiments, the agent preferentially concentrates within the transcription condensate. In some embodiments, the condensate is present intracellularly. In some embodiments, the cell is a cancer cell.

[0020] In some embodiments, the agent is administered to a subject with cancer, hi some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.

[0021] Some aspects of the present invention relate to methods of treating a subject in need of treatment for a cancer characterized by transcription of an oncogene, comprising administering to the subject an agent that modulates the composition of a transcription condensate associated with the oncogene, or dissolves or dissociates the transcription condensate. In some embodiments, the agent is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of the transcription condensate. In some embodiments, the agent preferentially concentrates within the transcription condensate. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.

[0022] In some embodiments, the subject is a human. In some embodiments, the agent is administered orally, subcutaneously, topically, or intravenously. In some embodiments, the agent is a small molecule, a polypeptide, or a nucleic acid.

[0023] Some aspects of the present disclosure are directed to methods for inhibiting transcription associated with a transcription condensate, comprising inhibiting binding of a nuclear receptor associated with the transcription condensate to a cofactor having an LXXLL domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain.

[0024] In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or a retinoic acid receptor alpha. In some embodiments, the cofactor is MED1. In some embodiments, transcription of an oncogene is inhibited. In some embodiments, the transcription condensate is present in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the peptide is administered to a subject. In some embodiments, the subject has cancer.

[0025] Some aspects of the present invention are directed to methods for inhibiting transcription associated with a transcription condensate, comprising inhibiting binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain.

[0026] In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or a retinoic acid receptor alpha. In some embodiments, the cofactor is MED1. In some embodiments, transcription of an oncogene is inhibited. In some embodiments, the transcription condensate is present in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the peptide is administered to a subject. In some embodiments, the subject has cancer.

[0027] Some aspects of the present invention are directed to compositions comprising cells having first condensates comprising a first detectable label and second condensates comprising a different second detectable label, wherein the first and second condensates are different types of condensates selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates. In some embodiments, the composition further comprises an agent in contact with the cells. In some embodiments, the agent is a known therapeutic agent. In some embodiments, the agent is a candidate therapeutic agent. In some embodiments, the second detectable label is detectably distinguishable from the first detectable label.

[0028] Some aspects of the present invention are directed to compositions comprising a first in vitro condensate, a second in vitro condensate, and an agent contacted with the first and second in vitro condensates. In some embodiments, at least one of the first in vitro condensate, the second in vitro condensate, and the agent comprises a detectable label. In some embodiments, the composition further comprises a third in vitro condensate and optionally a fourth in vitro condensate, each contacted with an agent. In some embodiments, at least one of the in vitro condensates comprises a transcription condensate, a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate component or functional fragment thereof. Some embodiments are directed to articles comprising a first in vitro condensate contacted with an agent, a second in vitro condensate contacted with the same agent, and a multiwell plate separating the first and second in vitro condensates into separate wells. In some embodiments, the article further comprises at least a third in vitro condensate contacted with the agent. In some embodiments, the article further comprises at least a fourth in vitro condensate contacted with the agent. The first, second, third, and fourth in vitro condensates can each comprise components or functional fragments of different condensates (e.g., super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates). The first, second, third, and fourth in vitro condensates can each comprise different detectable labels.

[0029] Some aspects of the present invention are directed to methods for assessing whether differential expression of one or more condensate components by cells resistant to a drug causes or contributes to the resistance, the methods comprising providing drug-resistant cells, contacting the drug-resistant cells with the drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control.

[0030] Some aspects of the present invention are directed to methods for assessing whether differential expression of one or more condensate components by cells resistant to a drug causes or contributes to the resistance, the methods comprising providing condensates isolated from drug-resistant cells, contacting the condensates with the drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control.

[0031] Some aspects of the present invention are directed to methods for assessing whether differential expression of one or more condensate components by cells resistant to a drug causes or contributes to the resistance, the methods comprising providing in vitro condensates (e.g., droplets) containing differential amounts of condensate components or fragments thereof that are differentially expressed in drug-resistant cells, contacting the condensate with the drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control.

[0032] Some aspects of the present invention are directed to methods for assessing whether differential expression of one or more condensate components by cells resistant to a drug causes or contributes to the resistance, the methods comprising providing an in vitro condensate (e.g., droplet) comprising a mutant condensate component or fragment thereof corresponding to the mutant condensate component in the drug-resistant cell, contacting the condensate with the drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control.

[0033] Some aspects of the present invention are directed to methods for characterizing drug-resistant condensates, comprising contacting the condensates with one or more second agents and assessing at least one of the localization, concentration, or therapeutic activity of the agents and / or the morphology, stability, or dissolution of the condensates. In some embodiments, the second agents are contacted with cells containing the drug-resistant condensates. In some embodiments, the condensates are isolated from the cells. In some embodiments, the condensates are in vitro condensates (e.g., droplets). In some embodiments, the condensates comprise mutant condensate components or fragments thereof associated with resistance to the drugs.

[0034] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0035] [Figure 1] Schematic showing how alterations in the transcriptional machinery are a hallmark of cancer. Adapted from Bradner, Hnisz and Young, Cell 2017. [Figure 2] ChIP-seq data identify super-enhancers, large clusters of enhancers that regulate genes with prominent roles in cell identity and are occupied by a very high density of intrinsically disordered domain-rich proteins and high levels of eRNA. Adapted from Hnisz et al., Cell (2013). [Figure 3] Tumor cells acquire extraordinarily long super-enhancers at driver oncogenes that can be nucleated by small DNA changes and are particularly sensitive to transcriptional drugs. Figure adapted from Mansour et al. Science (2014) and Loven et al. Cell (2013). [Figure 4]We show that transcription factors and Mediator coactivators contribute to the formation of condensates at super-enhancers (see Sabari, Dall'Agnese et al., Science 2018; Cho, Spille et al., Science 2018; and Boija, Klein et al., Cell 2018). [Figure 5] We show that biomolecular condensates can be generated by phase separation. Adapted from Brangwynne CP. JCB 2013. [Figure 6] We demonstrate that transcriptional condensates are involved in oncogene expression and represent potential therapeutic targets. TxEx: transcriptase; TF: transcription factor; CoA: coactivator; SE-driven oncogene: super-enhancer-driven oncogene. [Figure 7A] Figure 1 shows that transcription condensates containing driver transcription factors (TFs) and the MED1 subunit of Mediator occur at the MYC oncogene in human tumor tissues. H&E staining of breast cancer carcinoma and ER+ breast cancer is shown. [Figure 7B] Figure 1 shows that transcriptional condensates containing the driver transcription factor (TF) and the MED1 subunit of Mediator occur at the MYC oncogene in human tumor tissues. Immunofluorescence microscopy of ER+ breast cancer tissues using antibodies against MED1 (MED1 IF) or estrogen receptor (ER IF), followed by Myc RNA FISH, is shown. The upper right panel (enlarged merged image) shows that MED1 and Myc transcripts colocalize within the condensates. The lower right panel shows that estrogen receptor and Myc transcripts colocalize within the condensates. [Figure 7C]Figure 1 shows that transcriptional condensates containing the driver transcription factor (TF) and the MED1 subunit of Mediator occur at the MYC oncogene in human tumor tissues. Immunofluorescence microscopy of ER+ breast cancer tissues using antibodies against MED1 (MED1 IF) or estrogen receptor (ER IF), followed by Myc DNA FISH, is shown. The upper right panel (enlarged merged image) shows that MED1 and Myc genes colocalize within the condensates. The lower right panel shows that estrogen receptor and Myc genes colocalize within the condensates. [Figure 8] We show that Mediator condensates are present on MYC in a variety of cancer cell types. [Figure 9] We show that DNA-bound ER promotes MED1 condensation formation. In in vitro droplet assays, MED1 and ER formed droplets in the presence of DNA containing ER-binding sites, but not in the presence of control DNA or in the absence of DNA. All experiments were performed in the presence of estrogen. [Figure 10A] We show that ligand-dependent condensate formation links phase separation to oncogene expression. We show that MED1 colocalizes with Myc DNA within condensates in the presence of estrogen, but not in the absence of estrogen or in the presence of estrogen and tamoxifen. [Figure 10B] We show that ligand-dependent condensate formation links phase separation to oncogene expression, and that MYC expression is increased in the presence of estrogen and decreased to constitutive levels in the presence of estrogen and tamoxifen. [Figure 10C] Ligand-dependent condensate formation links phase separation to oncogene expression. ER is incorporated into condensates in the presence of estrogen, but not in the presence of estrogen and tamoxifen. ER droplets are shown in the top row, MED1 droplets in the middle row, and a merged image of ER and MED1 droplets in the bottom row. [Figure 10D]We show that ligand-dependent condensate formation links phase separation to oncogene expression. We show that the ER enrichment ratio in MED1 condensates is significantly increased in the presence of estrogen. [Figure 11] We demonstrate that transcription condensates are multicomponent structures. Using IF and Myc FISH, we demonstrated the colocalization of BRD4, p300, CDK7, CDK6, proteosomes, and topoisomerase with Myc transcripts in the condensates. p300 and CDK7 were detected in ovarian cancer cells. All other components were detected in the breast cancer cell line MCF7. [Figure 12] We show that transcriptional condensates are multicomponent structures. [Figure 13] We demonstrate a tool for analyzing the effects of small molecules on transcriptional condensates. HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, POL2-GFP, or HP1a-GFP (mock) all form condensates in the nucleus. [Figure 14A] Figure 1 shows that JQ1 dissolves genomic transcription condensates. Figure 2 shows that JQ1 reduces the number of or eliminates MED1, BRD4, and POL2 condensates. [Figure 14B] JQ1 dissolves genomic transcription condensates. Results of a fluorescence recovery after photobleaching (FRAP) assay using fluorescently labeled BRD4 are shown. The presence of JQ1 significantly increased the rate at which BRD4 replaced condensates illuminated by light, resulting in a significantly faster recovery (10 seconds vs. 120 seconds) due to replacement of photobleached BRD4 with fluorescent BRD4. [Figure 14C] We show that JQ1 dissolves genomic transcription condensates. We show higher levels of BRD4 at conventional enhancers (TEs) compared to super-enhancers (SEs). [Figure 14D]We show that JQ1 dissolves genomic transcription condensates. (Left panel) We show that gene expression driven by super-enhancers is more sensitive to JQ1 inhibition than at canonical enhancers. (Right panel) We show that JQ1 reduces genomic occupancy by BRD4 to a greater extent at super-enhancers than at canonical enhancers. [Figure 15] We show that antimetabolites have no effect on transcriptional condensation. Specifically, neither 5 μM 5-FU nor 5 μM 5-Aza had any detectable effect on MED1, BRD4, or POL2 condensation. [Figure 16] 1 shows the effect of various inhibitors on MED1, BRD4, and POL2 condensates in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 17] 1 shows the effect of various intercalators on MED1, BRD4, and POL2 condensates in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 18] 1 shows the effect of various CDK inhibitors on condensates containing MED1, BRD4, and POL2 in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 19] This study provides a model for the effects of drugs on transcriptional condensates. Bortezomib, mitoxantrone, daunorubicin, THZ1, and dinaciclib cause global dissolution of condensates. See Figures 16-18. Prolonged exposure to JQ1 (e.g., 24 hours) caused genome release and condensate hardening, similar to exposure to A485 and palbociclib. See Figures 14, 16, and 18. Short-term exposure to JQ1 (e.g., 5 minutes) caused elimination (i.e., selective elimination) of some condensate components, similar to exposure to U0216. See Figures 14 and 16. [Figure 20]Figures 20A-B show that small molecules approach condensates in vitro. Figure 20A (left panel) shows that estrogen receptor (ER) (green) and MED1 (red) colocalize in in vitro droplets in the presence of estrogen, but that estrogen receptors are not incorporated into condensates in the presence of estrogen and tamoxifen. The top panel of the right column in Figure 20A shows that cells with ER-bound LAC sequences have condensates containing ER (green) and MED1 (red) that are reduced in the presence of tamoxifen. The bottom panel of the right column shows the relative fluorescence intensity of ER and MED1 in the presence and absence of tamoxifen. The top panel of Figure 20B shows the structures of fluorescently labeled tamoxifen (FLTX1) and Cy5 dye (which have similar molecular weights). The bottom panel of Figure 20B shows that FLTX1 is incorporated into condensates containing MED1, but a Cy5 dye of similar size is not. [Figure 21] The figures show that tamoxifen "excludes" fluorescent tamoxifen from MED1 droplets. The top row shows that MED1 droplets are unaffected by the addition of FLTX1, or FLTX1 and tamoxifen. The bottom row shows that FLTX1 is incorporated into MED1 droplets but is diluted by the addition of a 10-fold excess of tamoxifen, confirming that FLTX1 and tamoxifen have similar condensate uptake properties. [Figure 22] Fluorescent tamoxifen is specifically enriched within MED1 condensates. The bottom left panel shows that FLTX1 is incorporated into MED1 droplets. MED1 is a component of transcriptional condensates. The bottom right panel shows that FLTX1 is not incorporated into heterochromatin protein 1 (HP1a) droplets. HP1a is a component of heterochromatin condensates. Importantly, FLTX1 was incorporated into MED1 droplets in the absence of its target, the estrogen receptor. [Figure 23]This shows that drugs that dissolve aggregates are enriched in MED1 aggregates. Mitoxantrone, curcumin, and daunorubicin each have fluorescent activity and cause aggregate dissolution. The bottom panel of Figure 23 shows that these drugs are readily incorporated into MED1 droplets. [Figure 24] Shown is an ER / MED1 droplet contacted by a fluorescent peptide (left side). Upon exposure to estrogen, the estrogen receptor undergoes a conformational change that allows it to interact with the LXXLL domain of MED1 (right side). [Figure 25] Figure 1 shows that upon addition of the LXXLL peptide (QNPILTSLLQITG; SEQ ID NO: 1) to ER / MED1 droplets, the peptide is taken up into the MED1 droplets, resulting in a decrease in ER partitioning into the MED1 droplets. [Figure 26] Peptide uptake into MED1 / ER droplets in the presence of estrogen. Polyproline (polyP) and RNA polymerase II CTD repeat YSPTSPS peptide (CTD) had no effect on ER / MED1 droplet formation, whereas polyglutamic acid (polyE) (acidic) and polylysine (polyK) peptides (basic) abolished MED1 / ER droplet formation. [Figure 27] 1 shows the uptake of the cell membrane permeable LXXLL peptide bearing an HIV-TAT tag into U2OS cells, demonstrating that the peptide can be visualized in live cells. [Figure 28A] Figure 1 shows nuclear condensates in human tissue and in vitro. Figure 2 shows a model illustrating the possible behavior of small molecules in nuclear condensates. [Figure 28B] Figure 28B shows intranuclear condensates in human tissues and in vitro. Immunofluorescence of various intranuclear condensate scaffolding proteins in nuclei stained with Hoechst and imaged at 100x with a fluorescent confocal microscope in tissue biopsies from benign and malignant human breast tissue (Figure 28C). [Figure 28C]Figure 28C shows intranuclear condensates in human tissues and in vitro. Immunofluorescence of various intranuclear condensate scaffolding proteins in nuclei stained with Hoechst and imaged at 100x with a fluorescent confocal microscope in tissue biopsies from benign and malignant colon tissues. [Figure 28D] Figure 1 shows intranuclear condensates in human tissue and in vitro.Figure 2 shows a schematic diagram of an in vitro droplet formation assay for measuring small molecules partitioning into intranuclear condensates. [Figure 28E] Figure 1 shows nuclear condensates in human tissues and in vitro. Figure 2 shows an in vitro droplet assay demonstrating the behavior of fluorescein dye in the presence of six protein condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein and 5 μM fluorescein, imaged at 150x with a confocal fluorescence microscope. Quantitation of drug enrichment is shown on the right; error bars represent SEM. [Figure 29A] Figure 29 shows the partitioning behavior of small molecule drugs into intranuclear condensates in droplet assays. Six intranuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29A) were treated with 5 μM cisplatin-TMR and imaged at 150x magnification using a confocal fluorescence microscope. Quantitation of drug enrichment within the droplets is shown on the right side of each panel; error bars represent SEM. [Figure 29B] Figure 29B shows the partitioning behavior of small molecule drugs into intranuclear condensates in droplet assays. Six intranuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein were treated with 50 μM mitoxantrone and imaged at 150x magnification using a confocal fluorescence microscope. Quantitation of drug enrichment within the droplets is shown on the right side of each panel; error bars represent SEM. [Figure 29C]Figure 29C shows the partitioning behavior of small molecule drugs into intranuclear condensates in droplet assays. Six intranuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein were treated with 100 μM FLTX1 and imaged at 150x using a confocal fluorescence microscope. Quantitation of drug enrichment within the droplets is shown on the right side of each panel; error bars represent SEM. [Figure 29D] Figure 29D shows the partitioning behavior of small molecule drugs into intranuclear condensates in droplet assays. Six intranuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein were treated with 5 μM THZ1-TMR and imaged at 150x magnification using a confocal fluorescence microscope. Quantitation of drug enrichment within the droplets is shown on the right side of each panel; error bars represent SEM. [Figure 29E] Figure 29 shows the partitioning behavior of small molecule drugs into intranuclear condensates in droplet assays. Six intranuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29E) were treated with 1 μM JQ1-ROX and imaged at 150x magnification using a confocal fluorescence microscope. Quantitation of drug enrichment within the droplets is shown on the right side of each panel; error bars represent SEM. [Figure 30A] Figure 1 shows that small molecule concentration within condensates influences drug activity. Figure 1 shows an in vitro droplet assay of MED1 and HP1α condensates formed in 125 mM NaCl and 10% PEG containing 5 nM 450 bp DNA, 10 μM MED1, and 5 μM cisplatin-TR, and imaged at 150x with a confocal fluorescence microscope. [Figure 30B] Figure 1 shows that small molecule enrichment within condensates influences drug activity. Bioanalyzer tracings of DNA contained within MED1 or HP1α droplets exposed to the indicated concentrations of cisplatin. [Figure 30C]This shows that small molecule concentration within condensates influences drug activity. (Top) Schematic of the assay for determining the location of platinized DNA relative to various nuclear condensates. (Bottom) Co-immunofluorescence of platinized DNA and the indicated proteins in HCT116 cells treated with 50 μM cisplatin for 6 hours. Imaged at 100x with a confocal fluorescence microscope. Quantitation of overlap is shown on the right. [Figure 30D] Small molecule concentration within condensates impacts drug activity. (Top) Schematic of the live cell condensate dissolution assay. (Bottom) HCT116 cells with MED1, HP1α, or FIB1 endogenously tagged with mEGFP treated with 50 μM cisplatin for 12 hours. Quantification of MED1, HP1α, or FIB1 condensate scores is shown on the right. [Figure 30E] This shows that small molecule enrichment within condensates influences drug activity. MED1 ChIP-seq in HCT116 cells treated with vehicle or 50 μM cisplatin for 6 hours is shown. (Left) Average read density of MED1 at super-enhancers and regular enhancers (error bars indicate minimum and maximum) and (right) gene tracks of MED1 ChIP at the MYC super-enhancer and AQPEP regular enhancer are shown. [Figure 30F] This shows that small molecule enrichment within condensates influences drug activity. A metaplot of cisplatin-DNA-Seq in HeLa cells treated with cisplatin comparing super-enhancers and regular enhancers is shown. [Figure 31A] 1 shows tamoxifen action and resistance in MED1 condensates. 2 shows a schematic diagram showing tamoxifen resistance due to ER mutations and MED1 overexpression in breast cancer. [Figure 31B] (a) Tamoxifen effect and resistance in MED1 condensates. (b) In vitro droplet assay of the indicated forms of GFP-labeled ER in the presence of estrogen, + / - 100 μM tamoxifen. Droplets were formed in 125 mM NaCl and 10% PEG containing 10 μM of each protein and 100 μM estrogen. [Figure 31C] Tamoxifen effect and resistance in MED1 condensates. (Left) Immunofluorescence of MED1 in tamoxifen-sensitive (MCF7) and resistant (TAMR7) ER+ breast cancer cell lines imaged at 100x by confocal fluorescence microscopy. (Top right) Quantification of MED1 condensate size in breast cancer cells. (Bottom right) Relative amounts of MED1 by Western blot in the indicated breast cancer cell lines. Error bars represent SEM. [Figure 31D] Tamoxifen action and resistance in MED1 condensates are shown. In vitro droplet assay of ER in the presence of 100 μM estrogen, + / - 100 μM tamoxifen, and either 5 μM (low) or 20 μM (high) MED1 is shown. Droplets were formed with 5 μM ER in 125 mM NaCl and 10% PEG and imaged at 150x with a confocal fluorescence microscope. Error bars are SEM. [Figure 31E] (a) Tamoxifen effect and resistance in MED1 condensates. In vitro droplet assay with either 5 μM (low) or 20 μM (high) MED1 in 125 mM NaCl and 10% PEG containing 100 μM FLTX1. Error bars are SD. [Figure 31F] 1 shows tamoxifen action and resistance in MED1 condensates. A model for tamoxifen resistance due to altered drug affinity (due to ER mutations) or concentration (due to MED1 overexpression) is presented. [Figure 32A] Figure 1 shows nuclear condensates in cell lines and human tumor tissue. Mouse embryonic stem cells either expressing proteins endogenously tagged with mEGFP (MED1, BRD4, SRSF2), endogenously tagged with mCherry (HP1α), or transfected with constructs expressing GFP-tagged proteins (NPM1, FIB1), as imaged by confocal fluorescence microscopy. [Figure 32B]1 shows intranuclear condensates in cell lines and human tumor tissues. 2 shows clinical data from biopsied breast and colon cancer specimens. [Figure 32C] Figure 1 shows nuclear condensates in cell lines and human tumor tissues. H&E staining of ER-positive breast cancer and colon adenocarcinoma is shown. [Figure 33A] Figure 1 shows the volume and number of intranuclear condensates in normal and tumor tissues. Figure 2 shows the volume of intranuclear condensates in normal and malignant breast tissue (top) and in normal and malignant colon tissue (bottom). Values represent percent nuclear volume and standard deviation. There was no significant difference between individual intranuclear condensates in normal and malignant conditions. [Figure 33B] Figure 1 shows the volume and number of intranuclear condensates in normal and tumor tissue. Figure 2 shows a table showing the average volume of intranuclear condensates in normal and malignant tissue. [Figure 33C] Figure 1 shows the volume and number of intranuclear condensates in normal and tumor tissue. Figure 2 shows a table showing the average number of intranuclear condensates in normal and malignant tissue. [Figure 34A] Proteins that form nuclear condensates are shown. A schematic diagram of the constructs used to purify nuclear condensate proteins is shown. For MED1 and BRD4 proteins, only the IDRs (intrinsically disordered regions) were used, while for HP1α, SRSF2, NPM1, and FIB1 proteins, the full-length fragments were used. [Figure 34B] Proteins that form intranuclear condensates are shown. (Top) The number of hydrophobic amino acids, phenylalanine (F), tryptophan (W), and tyrosine (Y), in the IDR and full-length protein is shown. The MED1 IDR has the highest number of hydrophobic residues. (Bottom) Table of positively charged interactors (CIE+) and negatively charged interactors (CIE) in the IDR or full-length protein of intranuclear condensates. These results suggest that the MED1 protein may be involved in interactions governed by π systems. [Figure 35A]Figure 1 shows in vitro droplet formation of proteins that form condensates. Figure 2 shows confocal microscopy of in vitro droplet formation assays of the indicated GFP-labeled proteins in 125 mM NaCl and 10% PEG. The MED1 and BRD4 proteins are IDR portions only. [Figure 35B] In vitro droplets of proteins forming condensates are shown. Confocal microscopy images of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates at the indicated salt concentrations (125 mM, 350 mM, 650 mM, and 1000 mM NaCl) are shown. Experiments were performed with 10 μM protein in 10% PEG. [Figure 36] A schematic of the enrichment ratio calculation is shown. A droplet is defined in the protein channel, and the maximum intensity of the drug is measured in that region to obtain the drug interior (left panel). The background is measured in the drug channel in the region defined by the protein channel in an in vitro droplet reaction containing protein but no drug (middle panel). The drug diffusion intensity is measured in a droplet reaction without protein (right panel). [Figure 37A] Small molecules partitioning into intranuclear condensates are shown. Confocal microscopy of an in vitro droplet formation assay with the indicated small molecules alone (4.4 kDa dextran, fluorescein, and Hoechst) without any added protein in the reaction is shown. The small molecules alone all show a diffuse fluorescent signal, indicating that they do not form droplets by themselves. [Figure 37B] Showing small molecules partitioning into intranuclear condensates. Confocal microscopy images showing the behavior of Hoechst (FIG. 37B) on six types of intranuclear condensates formed in vitro in 125 mM NaCl and 10% PEG. [Figure 37C]Small molecules partitioning into intranuclear condensates are shown. Confocal microscopy images showing the behavior of 4.4 kDa dextran (Figure 37C) toward six intranuclear condensates formed in vitro in 125 mM NaCl and 10% PEG are shown. Quantitation is shown on the right, and error bars represent SEM. Both Hoechst and dextran diffuse freely through the condensates tested without being excluded or concentrated. A schematic of the assay is shown at the top. [Figure 37D] This figure shows small molecules partitioning within intranuclear condensates. Confocal microscopy images of fluorescently labeled 4.4 kDa, 10 kDa, 40 kDa, and 70 kDa dextrans in MED1 condensates are shown. Experiments were performed using 10 μM protein and 0.1 mg / ml TRITC-labeled dextrans in 125 mM salt and 16% Ficoll. While smaller dextrans (4.4 kDa and 10 kDa) can freely diffuse through the condensates, larger dextrans (40 kDa and 70 kDa) are partially excluded from MED1 condensates. This indicates that the effective pore size of the condensates studied is at least 10 kDa. [Figure 38A] This shows that the properties of small molecule drugs, rather than their fluorescent moieties, govern their partitioning into condensates. Confocal microscopy of in vitro droplet formation assays using only the indicated small molecule drugs (cisplatin, FLTX1, THZ1, mitoxantrone, and JQ1) without adding any protein to the reaction mixture is shown. The small molecule drugs alone all exhibited diffuse fluorescent signals, indicating that these molecules alone do not form droplets. [Figure 38B] This shows that the properties of small molecule drugs, rather than their fluorescent moieties, govern their partitioning into condensates. Figure 1 shows the enrichment of ROX and Texas Red in MED1 droplets formed in 125 mM NaCl and 10% PEG, as measured by confocal microscopy. Neither of the two dyes used to visualize drugs was enriched in MED1 condensates. [Figure 38C]This demonstrates that the properties of small molecule drugs, rather than their fluorescent moieties, govern their partitioning into condensates. A schematic diagram of an in vitro drug displacement experiment from droplets is shown. Labeled cisplatin is added to MED1 droplets to form cisplatin-TR-enriched MED1 droplets. Unlabeled transplatin or unlabeled cisplatin is added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplets is measured after displacement. While transplatin (the clinically ineffective trans isomer of cisplatin) cannot displace cisplatin-TR, high concentrations of unlabeled cisplatin can. [Figure 38D] This shows that the properties of small molecule drugs, rather than their fluorescent moieties, govern their partitioning into condensates. A schematic diagram of an in vitro drug displacement experiment from droplets is shown. A graph showing the enrichment of FLTX1 in MED1 droplets upon the addition of tamoxifen, as measured by confocal microscopy. Tamoxifen was able to displace FLTX1 from MED1 droplets. All error bars shown represent SEM. [Figure 39A] This shows that small molecule drugs can be concentrated 100-fold within MED1 condensates. Quantitative phase contrast microscopy of MED1 droplets formed in 125 mM NaCl and 10% PEG is shown. The color bar indicates the optical phase retardation (φ) in degrees. From the phase images, the average MED1 concentration in each condensate was calculated. [Figure 39B] This shows that small molecule drugs can be concentrated 100-fold in MED1 condensates. A graph shows MED1 concentration in in vitro droplets without drug addition, with the addition of 5 μM cisplatin, or with the addition of 50 μM mitoxantrone. Data points are population means (n = 272, 115, and 85 individual condensates for each condition). Error bars represent standard deviation. [Figure 39C]This shows that small molecule drugs can be concentrated 100-fold within MED1 condensates. Different concentrations of cisplatin or mitoxantrone were added to MED1 droplets, and the concentration of drug remaining in solution was measured by UV spectroscopy. Combining the spectroscopic measurements with estimates of the total volume of the MED1 condensate phase obtained from the measurements in Figure 39B, the partition ratio for cisplatin was estimated to be up to 600-fold, and for mitoxantrone, approximately 100-fold. [Figure 40A] Association of drug targets with transcriptional condensates is shown. Immunofluorescence of MED1, HP1α, CDK7, ER, and BRD4 is shown along with MYC RNA FISH. Consistent with the finding that MED1, a marker of transcriptional condensates, is present in MYC oncogene bright spots, CDK7, ER, and BRD4 are found in MYC bright spots. These results recapitulate those obtained by ChIP-Seq at this locus. In contrast, no signal for HP1α, a marker of heterochromatin condensates, is found at MYC. Analysis of average and random images is shown on the right. [Figure 40B] Association of drug targets with transcriptional condensates is shown. A schematic diagram (top) of an in vitro droplet assay demonstrating the mixing of nuclear condensate proteins (MED1 or HP1α) with various drug target proteins (CDK7, ER, or BRD4) is shown, along with their distribution within nuclear condensates measured by confocal microscopy. (Middle) In vitro droplet assay using MED1, ER, HP1α, and BRD4 at 10 μM and CDK7 at 200 nM. Droplets were formed in 125 mM NaCl, 10% PEG, and droplet formation buffer. All drug targets tested enriched within MED1 condensates. ER was found to enrich within MED1 and HP1α condensates, consistent with previous reports and the ability of ER to associate with coactivators and corepressors. (Bottom) Quantification of the enrichment of target proteins within the indicated condensates. Error bars represent SEM. [Figure 41]The partitioning behavior of various small molecule drugs across the mediator complex is shown. Confocal microscopy images of drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and 4.4 kDa dextran) in condensates across the mediator complex. The mediator was imaged in bright field, and the small molecules were imaged in the channel in which they fluoresce. The experiment was performed in 10% PEG and 125 mM NaCl. The partitioning behavior of various small molecule drugs across the mediator complex recapitulates that of drugs within MED1 condensates. Quantification of enrichment is shown on the right, and error bars represent SEM. [Figure 42] This figure shows the partitioning behavior of various small molecule drugs into MED1 condensates formed in Ficoll. Confocal microscopy images of the enrichment behavior of small molecule drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and JQ1) into MED1 condensates in the presence of 125 mM NaCl and 20% Ficoll. The partitioning behavior of small molecules is similar regardless of the crowder used to form the MED1 droplets. Quantification of enrichment is shown on the right, and error bars represent SEM. [Figure 43] Figures 43A-43B show that cisplatin molecules are highly mobile within MED1 droplets. Figure 43A shows confocal microscopy images demonstrating fluorescence recovery after photobleaching (FRAP) of TR-cisplatin and MED1 within condensates formed with 5 μM TR-cisplatin and 10 μM protein in the presence of 125 mM NaCl and 10% PEG. Figure 43B shows quantification of FRAP (error bars represent SEM). [Figure 44A] Figure 1. Depiction of a small molecule boron dipyrromethene (BODIPY) library showing that specific chemical moieties govern enrichment within MED1 condensates. [Figure 44B]This shows that specific chemical moieties direct the concentration into MED1 condensates. The fluorescence intensity of the probe library within MED1 droplets measured by confocal microscopy is shown. The experiment was performed in 125 mM NaCl and 10% PEG using 10 μM MED1 and 1 μM small molecule. The fluorescence of the BODIPY molecule alone is highlighted in red. [Figure 44C] We show that specific chemical moieties govern the concentration of MED1 into condensates. We show the fluorescence intensity of 18 randomly selected probes from the library in the absence of MED1 protein, demonstrating that they have comparable fluorescence intensities. [Figure 44D] Specific chemical moieties govern enrichment into MED1 condensates. The top five (left) and bottom five (right) R2 and R1 side chains ranked by fluorescence intensity are shown. [Figure 45A] These results demonstrate that aromatic residues in MED1 contribute to the partitioning of small molecules into MED1 condensates but are not necessarily required for condensate formation. Confocal microscopy images of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates formed with 5 μM small molecule probes in 125 mM NaCl and 10% PEG were shown. The probes were specifically enriched in MED1 condensates, indicating that the chemical features of the probes selectively interact with the chemical features of MED1 condensates. The top-ranked probes enriched in MED1 condensates showed a preference for BODIPY molecules modified with aromatic rings. This suggests that π-systems may contribute to the interaction between small molecules and MED1. [Figure 45B]We demonstrate that aromatic residues in MED1 contribute to the partitioning of small molecules into MED1 condensates but are not necessarily required for condensate formation. A schematic diagram of MED1 IDR mutant proteins is shown. π-systems govern the interactions of supramolecular assemblies, in which π-π or π-polar interactions play a prominent role. To investigate whether these interactions govern the partitioning of small molecules into MED1 condensates, and prompted by the finding that the MED1 IDR is enriched in aromatic and basic amino acid residues compared to the other proteins studied here, we generated MED1 IDR aromatic mutants (in which all 30 aromatic residues were changed to alanine) and MED1 IDR basic mutants (in which all 114 basic residues were changed to alanine). [Figure 45C] These results demonstrate that aromatic residues in MED1 contribute to the partitioning of small molecules into MED1 condensates but are not necessarily required for condensate formation. In Figure 45C, the ability of MED1 mutants to form droplets was examined by confocal microscopy using wild-type MED1, a MED1 basic mutant (in which all basic amino acids were substituted with alanine), and a MED1 aromatic mutant (in which all aromatic amino acids were substituted with alanine) in the presence of 125 mM NaCl and 10% PEG. The MED1 basic mutant exhibited impaired ability to form droplets in vitro, indicating that basic residues in MED1 are required for the homotypic interactions that govern droplet formation. The MED1 aromatic mutant formed droplets similar to those of the wild-type MED1 protein. [Figure 45D] We demonstrate that aromatic residues in MED1 contribute to the partitioning of small molecules into MED1 condensates but are not necessarily required for condensate formation. We demonstrate the role of MED1 aromatic residues in the uptake of aromatic small molecule probes. Confocal microscopy images and quantification of the top hit BODIPY probes, along with those of MED1 or MED1 aromatic mutants, demonstrate that the partitioning behavior of aromatic probes into MED1 aromatic mutant droplets is significantly reduced. Experiments were performed in 10% PEG and 125 mM NaCl using 10 μM protein and 5 μM small molecules. [Figure 45E]We demonstrate that aromatic residues in MED1 contribute to the partitioning of small molecules into MED1 condensates but are not necessarily required for condensate formation. Confocal microscopy images and quantification of MED1 or MED1 aromatic mutants plus cisplatin are shown, demonstrating that cisplatin partitioning behavior within MED1 aromatic mutant droplets is significantly reduced. Experiments were performed in 10% PEG and 125 mM NaCl using 10 μM protein and 5 μM cisplatin-TR. Collectively, these results suggest that π-systems contribute to the partitioning of small molecules into MED1 condensates. All error bars represent SEM. [Figure 46] This shows that DNA can be compartmentalized and concentrated within the intranuclear condensate. (Top) Schematic of the droplet assay showing protein, DNA, and cisplatin mixed under droplet-forming conditions and then spun down to separate the droplet phase from the dilute phase. The amount of DNA in the two phases is then measured using a bioanalyzer. DNA is enriched within the MED1 and HP1α droplet phase (left) compared to the MED1 and HP1α dilute phase (right). [Figure 47A] This shows that the concentration of small molecules within specific aggregates can affect target binding. HCT116 cells were treated with DMSO or 50 μM cisplatin for 6 hours, followed by immunofluorescence of cisplatin. The antibody recognized only platinized DNA in cisplatin-treated cells, supporting antibody specificity. [Figure 47B] This shows that the concentration of small molecules into specific condensates can affect target binding. (Left) Treatment of mEGFP-MED1-tagged HCT116 cells with JQ1 for 24 hours results in a decrease in MED1 condensates. (Right) Metaplot of MED1 ChIP-Seq in HCT116 cells treated with DMSO vs. JQ1. [Figure 47C]This shows that the concentration of small molecules within specific condensates can affect target binding. To determine whether the reduction of MED1 condensates leads to reduced DNA platinization at the MYC locus, cells were treated with JQ1 followed by cisplatin. MYC DNA FISH and MED1 immunofluorescence showed a loss of signal for platinized DNA after JQ1 treatment, indicating that the presence of MED1 condensates contributes to DNA platinization at this locus. [Figure 47D] This shows that concentration of small molecules within specific condensates can affect target binding. (Left) MED1 ChIP-Seq tracks at MYC in HCT116 cells treated with DMSO or JQ1, showing loss of MED1 loading after JQ1 treatment. (Right) Quantification of cisplatin IF signal at MYC DNA FISH foci in HCT116 cells treated with DMSO or JQ1. Error bars represent SEM. [Figure 48A] Figure 48A shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel genotyping showing MED1 tagged with mEGFP (Figure 48B) in HCT116 colon cancer cells. [Figure 48B] Figure 48B shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel genotyping showing HP1α tagged with mEGFP in HCT116 colon cancer cells (Figure 48C). [Figure 48C] Figure 48C shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel showing FIB1 tagged with mEGFP in HCT116 colon cancer cells (Figure 48D). [Figure 48D] Figure 48D shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel genotyping showing NPM1 tagged with mEGFP in HCT116 colon cancer cells (Figure 48E). [Figure 48E] Figure 1 shows genotyping of endogenously tagged cell lines. Agarose gel of FIB1 and NPM1 expression. [Figure 48F] Figure 48B shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel genotyping showing BRD4 tagged with mEGFP (Figure 48F) in HCT116 colon cancer cells. [Figure 48G] Figure 48G shows genotyping of endogenously tagged cell lines. Schematic image and agarose gel showing SRSF2 tagged with mEGFP in HCT116 colon cancer cells (Figure 48G). [Figure 49A] FRAP of MED1 tagged with mEGFP (FIG. 49A) in the HCT116 cell line (error bars represent SEM) (n=7), demonstrating that intracellular nuclear condensates are highly dynamic. [Figure 49B] FRAP of HP1α tagged with mEGFP (FIG. 49B) in the HCT116 cell line (error bars represent SEM) (n=7), demonstrating that intracellular nuclear condensates are highly dynamic. [Figure 50A] Figure 1 shows the dissolution of MED1 condensates in cells upon prolonged cisplatin treatment. HCT116 cells with MED1 endogenously tagged with GFP were treated with DMF or 50 μM cisplatin for 3, 6, or 12 hours. Quantitation is shown on the right. Error bars are SD. [Figure 50B] Figure 1 shows dissolution of MED1 condensates in cells upon prolonged cisplatin treatment. Figure 2 shows cell viability assay of HCT116 cells expressing GFP-MED1 treated with DMF or 50 μM cisplatin for 12 hours. [Figure 51] Figure 24 shows the effect of cisplatin on various nuclear condensates. Figure 24 shows HCT116 cells with either MED1, BRD4, HP1α, FIB1, NPM1, or SRSF2 endogenously tagged with GFP treated with 50 μM cisplatin for 12 hours. Consistent with cisplatin and BRD4 being selectively concentrated within MED1 condensates, cisplatin specifically disrupts MED1 and BRD4 condensates. [Figure 52]Figure 1 shows the decrease in genome occupancy by MED1 upon cisplatin treatment. The graph shows MED1 ChIP-seq after 6 hours of treatment with DMSO or 50 μM cisplatin. MED1 binding at the genome level is decreased after cisplatin treatment. [Figure 53A] 1 shows the characterization of MED1 condensates in MCF7 cells. 2 shows Western blots of MED1 in MCF7 cells and MCF cells infected with the MED1-mEGFP lentiviral vector. [Figure 53B] Characterization of MED1 condensates in MCF7 cells. FRAP of MED1-mEGFP in MCF7 cells expressing this fusion protein by a lentiviral vector. Quantitation is shown on the right, and the black bars represent the 95% confidence interval of the best-fit line. [Figure 53C] 1 shows the characterization of MED1 condensates in MCF7 cells. MCF7 cells expressing MED1-mEGFP were grown in estrogen-free conditions and then stimulated with 100 nM estrogen for 15 minutes and imaged for 4 minutes by confocal fluorescence microscopy. [Figure 53D] Figure 53C shows characterization of MED1 condensates in MCF7 cells. Quantification of the size and intensity of the confluent MED1 condensates shown in Figure 53C. [Figure 54A] Figure 1 shows estrogen- and tamoxifen-dependent MED1 condensate formation at the MYC oncogene. DNA FISH and immunofluorescence are shown in estrogen-deprived MCF7 cells treated with 100 nM estrogen or 100 nM estrogen and 5 μM tamoxifen for 24 hours. Analysis of average and random images is shown on the right. [Figure 54B] Figure 1 shows estrogen- and tamoxifen-dependent MED1 condensate formation at the MYC oncogene. RT-qPCR showing relative MYC RNA expression in estrogen-deprived MCF7 cells stimulated with estrogen or treated with estrogen and tamoxifen. Error bars represent SEM. [Figure 55]Figure 1 shows that FLTX1 concentrates within MED1 condensates within cells. (Left) Schematic of MED1 or HP1α tethered to LAC sequences in U2OS cells producing MED1 or HP1α condensates. (Center) Representative images of isolated U2OS cell nuclei with either MED1 or HP1α tethered to LAC sequences exposed to FLTX1. A magnified image of the Lac sequences is shown in the inset, and a merged image is shown on the right. (Right) Quantification of FLTX1 enrichment at LAC sequences tethered to either MED1 or HP1α. Error bars represent SEM. ESR1 is not expressed in this osteosarcoma cell line. [Figure 56] Figure 1 shows hormone therapy resistance mutations in ESR1 obtained from patients. A plot of ER mutation frequency obtained from a set of 220 patients from the cBioPortal database shows the location of ER point mutations with hotspots at 537 and 538. [Figure 57A] 1 shows the enrichment ratio of ER and ER mutants in MED1 droplets. Quantification of the enrichment ratio of ER or mutant ER in MED1 droplets in the presence of estrogen or estrogen and tamoxifen. [Figure 57B] Enrichment ratios of ER and ER mutants in MED1 droplets are shown. (Left) A representative image of mutant ER partitioning within a MED1 droplet is shown. Enrichment ratios are shown on the right. Both Figure 57A and Figure 57B experiments are performed in 125 mM NaCl, 10% PEG, 10 μM of each protein, 100 μM estrogen, with or without 100 μM of the indicated ligand. All error bars represent SD. [Figure 58A] Figure 1 shows MED1 overexpression in tamoxifen-resistant breast cancer cells.Figure 2 shows a schematic demonstrating drug concentration within condensates upon increasing condensate volume due to overexpression of a scaffold protein. [Figure 58B]Figure 58B shows MED1 overexpression in tamoxifen-resistant breast cancer cells. Assuming drug is limiting in the system, the concentration of drug within the MED1 droplets is expected to decrease upon increasing condensate volume (Figure 58B). Western blots of MED1 and actin in MCF7 cells (tamoxifen-sensitive) and TAMR7 cells (a tamoxifen-resistant derivative of MCF7) show higher MED1 levels in TAMR7 cells. Quantitation of the Western blots, averaged over three experiments, is shown below. [Figure 58C] Figure 1 shows MED1 overexpression in tamoxifen-resistant breast cancer cells.Figure 2 shows quantification of MED1 condensates in tamoxifen-sensitive and resistant cell lines, showing the volume of MED1 condensates and the number of condensates per nucleus. [Figure 59] A-B show the increase in MED1 condensate size with increasing MED1 concentration. Figure 59A shows droplet size in pixels for an in vitro droplet assay performed with 5 μM (low) or 20 μM (high) MED1-GFP in 125 mM NaCl and 10% PEG. Quantification is shown on the right, and error bars represent SD. Figure 59B shows a schematic phase diagram of MED1, demonstrating that as the total concentration of MED1 increases, the protein concentration within the droplet phase is maintained while the droplet size increases. [Figure 60]Figure 60 (left) shows a schematic of the Lac sequence assay. U2OS cells containing 50,000 copies of the Lac binding site were transfected with a construct expressing the DNA-binding domain (DBD) of Lac fused to the ligand-binding domain (LBD) of the estrogen receptor. When the transcriptional machinery is recruited to the site, Mediator condensations are detectable by immunofluorescence. (Center) U2OS-Lac cells were transfected with a construct overexpressing the ER LBD and the Lac DBD fused to GFP + / - MED1. Cells were grown in estrogen-depleted medium and treated with 10 nM estrogen + / - 10 nM tamoxifen, then fixed and subjected to MED1 IF. The upper panel shows the position of the ER-LBD at the Lac sequence, and the lower panel shows MED1 IF. The inserted image shows a magnification. (Right) Quantification of relative MED1 enrichment on Lac sequences. Error bars represent SD. [Figure 61A] Figure 61A shows an in silico model illustrating the partitioning of small molecules into condensates. To demonstrate the behavior of small molecule drugs binding to targets contained within condensates, a simple model was developed in which both the drug and target are contained within the condensates, with percent target binding as the readout. In this model, target partitioning is unaffected by drug binding. Figure 61A shows a table of values used to construct a model of drug binding within condensates, derived from known values for ER and tamoxifen. Concentration volume fraction values were derived from analysis of MED1 IF in human ER+ breast cancer biopsies. [Figure 61B] Figure 1 shows an in silico model illustrating the partitioning of small molecules into condensates. Figure 2 shows binding to targets as a function of drug concentration in the simulation. The dashed line represents a system in which the target and drug diffuse freely through the cell. The red and blue lines represent a system in which the target and drug are concentrated within the condensate. The blue line represents target binding within the condensate where the drug and target are concentrated, and the red line represents target binding in the dilute nucleocytoplasmic phase. Overall, these data indicate that at a given concentration, the drug binds to a higher percentage of target molecules inside the condensate compared to outside. [Figure 61C]

[0023] Figure 1 shows an in silico model illustrating the partitioning of small molecules into condensates. For a given concentration of drug, the fraction of bound target is shown at various partition coefficients of the drug. The dotted line represents target binding under diffusion conditions. Overall, this simulation shows that as the partition coefficient of the drug into the condensate increases, the percent of bound target at a given concentration increases. [Figure 61D] Figure 1 shows an in silico model showing the partitioning of small molecules into condensates. Figure 2 shows target binding by drugs in larger condensate settings. Figure 3 shows simulation of target binding as a function of drug concentration in normal condensate volume settings (2% of the nucleus volume) versus larger condensate volume settings (4% of the nucleus volume). Diffusion control is shown by the dashed line. Overall, these data indicate that drugs may bind their targets less effectively in larger condensates. DETAILED DESCRIPTION OF THE INVENTION

[0036] Detailed Description of the Invention Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference (RNAi), which are generally within the skill of one in the art. Non-limiting descriptions of some of these techniques can be found in the following publications: Ausubel, F., et al., (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, all John Wiley & Sons, NY (eds. current as of December 2008); Sambrook, Russell, and Sambrook, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001; Harlow, E. and Lane, D., Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988; Freshney, RI, "Culture of Animal Cells, A Manual of Basic Technique", 5th ed., John Wiley & Sons, Hoboken, NJ, 2005. Non-limiting information regarding therapeutic drugs and human diseases can be found in Goodman and Gilman's The Pharmacological Basis of Therapeutics, 11th ed., McGraw Hill, 2005, Katzung, B. (ed.) Basic and Clinical Pharmacology, McGraw-Hill / Appleton & Lange; 10th ed. (2006) or 11th ed. (July 2009).Non-limiting information regarding genes and genetic disorders can be found in McKusick, VA: Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins. University Press, 1998 (12th edition), or the more recent online database: Online Mendelian Inheritance in Man, OMIM™, McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD) (as of May 1, 2010), ncbi.nlm.nih.gov / omim / , and Online Mendelian Inheritance in Animals (OMIA), a database of genes, genetic disorders, and inherited traits for animal species (other than human and mouse), can be found at omia.angis.org.au / contact.shtml. All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) mentioned herein are incorporated by reference in their entirety. In the event of a conflict between this specification and any of the incorporated references, the specification (including any amendments thereof that may be based on the incorporated references) shall control. Unless otherwise specified, standard meanings of terms accepted in the art are used herein. Standard abbreviations for various terms are used herein.

[0037] The inventors surprisingly discovered that some drugs are incorporated into condensates that do not contain the drug's target (see Figure 22). This has important ramifications for drug efficacy. For example, a drug's efficacy may be lower if it is sequestered within condensates, preventing it from interacting with its target. Alternatively, a drug's efficacy may be lower if condensates block the drug's access to its target. This phenomenon may help explain why some candidate drugs exhibit high activity against therapeutic targets in vitro but do not exhibit the same activity in cells or organisms. This may also explain the surprising observation that inhibition of global gene regulators such as BRD4 or CDK7 can selectively affect cancer genes that have acquired long super-enhancers. Selective partitioning of inhibitors such as JQ1 and THZ1 into super-enhancer condensates would preferentially disrupt transcription at those loci. Furthermore, the inventors surprisingly discovered that condensates concentrate some clinically important small molecule cancer therapeutics in such a way that their pharmacodynamic properties are altered. Thus, condensates can concentrate small molecules, thereby directing their biological activity.

[0038] Accordingly, some aspects of the present invention relate to methods for characterizing a drug, the method comprising contacting the drug with a composition (e.g., a solution) containing a condensate having at least one component and measuring the uptake of the drug into the condensate. In some embodiments, the method further comprises determining whether the drug is a candidate therapeutic drug based on whether both the target and the drug are present at effective concentrations in appropriate cells, either within or outside the condensate. In some embodiments, the method further comprises characterizing multiple drugs (e.g., drug candidates) and selecting one or more lead drugs with a desired or optimal condensate distribution profile (e.g., enriching in the condensate of appropriate cells if the drug's target is present within the condensate, or enriching outside the condensate if the drug's target is present outside the condensate). As used herein, the term "drug" refers to any compound or substance, including, but not limited to, small molecules, nucleic acids, polypeptides, peptides, drugs, ions, etc. An "agent" can be any chemical entity, entity, or moiety, including, but not limited to, synthetic and naturally occurring proteinaceous and non-proteinaceous entities. In some embodiments, the agent is a nucleic acid, a nucleic acid analog, a protein, an antibody, a peptide, an aptamer, an oligomer of nucleic acid, amino acid, or carbohydrate, including, but not limited to, a protein, an oligonucleotide, a ribozyme, a DNA enzyme, a glycoprotein, an siRNA, a lipoprotein, an aptamer, and modifications and combinations thereof. In some embodiments, the agent is selected from the group consisting of a nucleic acid, a small molecule, a polypeptide, and a peptide. In certain embodiments, the agent is a small molecule having a chemical moiety. For example, the chemical moiety may include an unsubstituted or substituted alkyl, aromatic, or heterocyclyl moiety, including macrolides, leptomycin, and related natural products or their analogs. The compound may be known to have the desired activity and / or properties or may be selected from a library of diverse compounds. In some embodiments, the agent is small enough to diffuse into the condensate.In some embodiments, the agent is less than about 4.4 kDa. In some embodiments, the agent has a partition coefficient with a condensate described herein of at least 100, 150, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more. In some embodiments, the agent has a partition coefficient with a condensate described herein of less than about 10, 20, 50, 100, 150, 200, 300, 350, 400, 450, 500, 550, or 600.

[0039] In some embodiments, the agent is a small molecule. The term "small molecule" refers to an organic molecule having a mass of less than about 2 kilodaltons (kDa). In some embodiments, a small molecule is less than about 1.5 kDa or less than about 1 kDa. In some embodiments, a small molecule is less than about 800 daltons (Da), 600 Da, 500 Da, 400 Da, 300 Da, 200 Da, or 100 Da. Often, a small molecule has a mass of at least 50 Da. In some embodiments, a small molecule is a non-polymeric molecule. In some embodiments, a small molecule is not an amino acid. In some embodiments, a small molecule is not a nucleotide. In some embodiments, a small molecule is not a sugar. In some embodiments, small molecules contain multiple carbon-carbon bonds and may include one or more heteroatoms and / or one or more functional groups important for structural interactions (e.g., hydrogen bonding) with proteins, such as amine, carbonyl, hydroxyl, or carboxyl groups, and in some embodiments, at least two functional groups. Small molecules often include one or more carbon or heterocyclic structures and / or aromatic or polyaromatic structures, optionally substituted with one or more of the above functional groups. In some embodiments, small molecules include at least one, at least two, at least three, or more aromatic side chains.

[0040] In some embodiments, the agent is a protein or polypeptide. The term "polypeptide" refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule comprising one or more polypeptides. A peptide is a relatively short polypeptide, usually about 2 to 100 amino acids (aa) in length, e.g., 4 to 60 aa; 8 to 40 aa; 10 to 30 aa. The terms "protein," "polypeptide," and "peptide" may be used interchangeably. Generally, a polypeptide may contain only standard amino acids or may include one or more non-standard amino acids (which may be naturally occurring or unnatural amino acids) and / or, in various embodiments, amino acid analogs. A "standard amino acid" is any of the 20 L-amino acids commonly utilized in mammalian protein synthesis and encoded by the genetic code. A "non-standard amino acid" is an amino acid not commonly utilized in mammalian protein synthesis. Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and unnatural amino acids. One or more of the amino acids, e.g., within a polypeptide, can be modified, e.g., by addition, e.g., by covalent attachment of a moiety, e.g., an alkyl group, an alkanoyl group, a carbohydrate group, a phosphate group, a lipid, a polysaccharide, a halogen, a linker for conjugation, a protecting group, a small molecule (e.g., a fluorophore), etc. In some embodiments, the agent is a protein or polypeptide that includes at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, or more aromatic amino acids.

[0041] In some embodiments, the agent consists of or comprises DNA or RNA.

[0042] In some embodiments, the agent is a peptidomimetic. The terms "mimetic," "peptidomimetic," and "peptidomimetic" are used interchangeably herein and generally refer to a peptide, partial peptide, or non-peptide molecule that mimics the tertiary binding structure or activity of a selected native peptide or protein functional domain (e.g., a binding motif or active site). These peptidomimetics include recombinantly engineered or chemically modified peptides and non-peptide agents, such as small molecule drug mimetics.

[0043] The drug may be a known drug. The type of drug is not limited and may be any suitable drug. In some embodiments, the drug may be an anti-cancer drug. In some embodiments, the known drug is for treating a human disease or condition.

[0044] In some embodiments, the agent is a chemotherapeutic agent or derivative thereof, such as actinomycin D, aldesleukin, alitretinoin, all-trans retinoic acid / ATRA, altretamine, amsacrine, asparaginase, azacitidine, azathioprine, bacillus Calmette-Guerin / BCG, bendamustine hydrochloride, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carfilzomib, carmustine, chlorambucil, cisplatin / cisplatin ... Platinum, cladribine, cyclophosphamide / cytofosphan, cytabarine, dacarbazine, daunorubicin / daunomycin, denileukin diftitox, dexrazoxane, docetaxel, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil (5-FU), gemcitabine, goserelin, hydrocortisone, hydroxyurea, idarubicin, ifosfamide, interferon alpha, irinotecan (CPT-11) , lapatinib, lenalidomide, leuprolide, mechlorethamine / chlormethicone / mustine / HN2, mercaptopurine, methotrexate, methylprednisolone, mitomycin, mitotane, mitoxantrone, octreotide, oprelvekin, oxaliplatin, paclitaxel, pamidronate, pegaspargase, pegfilgrastim, PEG-interferon, pemetrexed, pentostatin, phenylalanine mustard, plicamycin / mithramycin In some embodiments, the agent is selected from the group consisting of cisplatin, prednisone, prednisolone, procarbazine, raloxifene, romiplostim, sargramostim, streptozocin, tamoxifen, temozolomide, temsirolimus, teniposide, thalidomide, thioguanine, thiophosphatamide / thiotepa, thiotepa, topotecan hydrochloride, toremifene, tretinoin, valrubicin, vinblastine, vincristine, vindesine, vinorelbine, vorinostat, zoledronic acid, and combinations thereof. In some embodiments, the agent is or comprises cisplatin or a derivative thereof.In some embodiments, the agent is or includes JQ1 (2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetic acid (S)-tert-butyl) or a derivative thereof. In some embodiments, the agent is or includes tamoxifen or a derivative thereof.

[0045] In some embodiments, the agent comprises a protein transduction domain (PTD). A PTD, or cell-penetrating peptide (CPP), is a peptide or peptoid capable of crossing the plasma membrane of many, but not all, mammalian cells. The PTD can enhance the uptake of a moiety bound to or present within the PTD. Often, such peptides are arginine-rich. For example, the PTD of the Tat protein of human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) has been extensively studied and is used to transport cargo into mammalian cells. See, e.g., Fonseca SB, et al., Adv Drug Deliv Rev., 61(11):953-64, 2009; Heitz F, et al., Br J Pharmacol., 157(2):195-206, 2009, and any references therein, which are incorporated herein by reference. In some embodiments, the cell-penetrating peptide is HIV-TAT.

[0046] In some embodiments, the agent can bind to the target. In some embodiments, the target is present in a composition containing the condensate. In some embodiments, the target is present primarily outside the condensate (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, or more). In some embodiments, the concentration of the target outside the condensate is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more, compared to the concentration of the target inside the condensate. In some embodiments, the target is present primarily within the condensate (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, or more). In some embodiments, the concentration of the target within the condensate is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more, greater than the concentration of the target outside the condensate.

[0047] In some embodiments, the agent is a candidate agent as described herein. In some embodiments, the agent is derived from an agent that has been modified to modulate incorporation into the condensate of interest. In some embodiments, the agent is derived by coupling or linking a first agent and a second agent as described herein.

[0048] As shown in the Examples below, it has been discovered that molecules with aromatic rings preferentially concentrate in MED1 condensates. Thus, in some embodiments, agents are modified to increase or decrease the number of aromatic rings. In some embodiments, agents are modified to increase the number of aromatic rings by at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, about 40, about 45, about 50, or more. In some embodiments, an agent (e.g., consisting of or comprising a small molecule) is modified to include at least one or at least two or more aromatic rings, as shown in the R1 and R2 groups provided in Figure 44A. In some embodiments, an agent (e.g., consisting of or comprising a small molecule) is modified to include at least one or at least two or more aromatic rings selected from components M66, K19, M101, M195, K18, M103, and M66 shown in Figure 44A. In some embodiments, an agent (e.g., consisting of or comprising a small molecule) is modified to include at least two or three structures as shown in each row under "Top 5 Probes" provided in Figure 44D.

[0049] In some embodiments, the agent consists of or comprises a peptide, polypeptide, or protein, where the number of aromatic rings has been increased by the substitution of one or more non-aromatic amino acid residues with aromatic amino acid residues (e.g., phenylalanine, tryptophan, tyrosine, and / or histidine). In some embodiments, the agent consists of or comprises a peptide, polypeptide, or protein, where the number of aromatic rings has been increased by the addition of one or more aromatic amino acids. In some embodiments, the aromatic amino acid residue is not histidine. In some embodiments, the aromatic amino acid residue is phenylalanine. In some embodiments, the aromatic amino acid residue is an unnatural or non-standard amino acid residue (e.g., L-dopa (1-3,4-dihydroxyphenylalanine)).

[0050] In some embodiments, the agent consists of or comprises a peptide, polypeptide, or protein in which the number of aromatic rings is reduced by substitution of one or more aromatic amino acids with non-aromatic amino acids (e.g., alanine), hi some embodiments, the number of aromatic rings is reduced by removal or modification of one or more aromatic amino acids.

[0051] In some embodiments, the number of aromatic rings is reduced by removing, modifying, and / or substituting two or more aromatic amino acids.

[0052] In some embodiments, the modified agent has increased affinity for condensates (e.g., transcription condensates, heterochromatin condensates, splicing speckle condensates, nucleoli, chromatin condensates, Polycomb condensates, DNA damage repair condensates, or condensates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has increased affinity for condensates containing a particular condensate component (e.g., Mediator, Mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has increased affinity for condensates containing a particular Mediator component or multiple Mediator components (e.g., MED1). In some embodiments, the condensate includes a condensate component (e.g., MED1) with one or more aromatic side chains. In some embodiments, the modified drug has an affinity for condensates that is at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or at least 100-fold greater than the corresponding unmodified drug.

[0053] In some embodiments, the modified agent has a decreased affinity for condensates (e.g., transcription condensates, heterochromatin condensates, splicing speckle condensates, nucleoli, chromatin condensates, Polycomb condensates, DNA damage repair condensates, or condensates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has a decreased affinity for condensates containing a particular condensate component (e.g., Mediator, Mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has a decreased affinity for condensates containing a particular Mediator component or multiple Mediator components (e.g., MED1). In some embodiments, the condensate includes a condensate component with one or more aromatic side chains. In some embodiments, the modified drug has an affinity for condensates that is at least 2 fold, at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 20 fold, at least 50 fold, or at least 100 fold less than the corresponding unmodified drug.

[0054] In some embodiments, the modified agent has affinity for the second agent. In some embodiments, the modified agent can increase the concentration or amount of the second agent in the condensate by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more, compared to the concentration or amount of the second agent in the condensate in the absence of the modified agent. In some embodiments, the modified agent can decrease the concentration or amount of the second agent in the condensate by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more, compared to the concentration or amount of the second agent in the condensate in the absence of the modified agent.

[0055] The target is not limited. In some embodiments, the target is an anti-cancer target. In some embodiments, the target is an enzyme (e.g., oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, kinase, cyclin-dependent kinase, MAPK, phosphatidylinositol kinase, sphingosine kinase, carbohydrate kinase, nucleoside phosphate kinase, nucleoside diphosphate kinase), receptor (e.g., nuclear receptor), oncogene, transcription factor, or signal transduction factor. In some embodiments, the target is genomic DNA. In some embodiments, the target is any component described herein.

[0056] As used herein, condensate refers to a phase-separated multi-molecular assembly. In some embodiments, condensate refers to an in vitro condensate (sometimes referred to herein as a "droplet"). In some embodiments, the in vitro condensate is artificially created in solution with one or more condensate components. In some embodiments, the in vitro condensate includes components that mimic condensates found within cells. In some embodiments, the in vitro condensate is isolated from cells.

[0057] Any suitable means for isolating condensates from cells or compositions is encompassed herein. In some embodiments, condensates are chemically precipitated or immunoprecipitated. In some embodiments, condensates are isolated by centrifugation (e.g., at about 5,000 x g, 10,000 x g, or 15,000 x g for about 5-15 minutes; at about 10,000 x g for about 10 minutes). Concentrates can also be isolated from cells by lysis of cell nuclei under suitable buffer conditions using a homogenizer (i.e., a Dance homogenizer), followed by centrifugation and / or filtration to separate the condensates.

[0058] In some embodiments, the condensate is present within a cell. The condensate may be a naturally occurring condensate. In other embodiments, the condensate may occur in a transgenic or otherwise engineered cell. In some embodiments, the condensate may include a detectable tag. In some embodiments, the detectable tag is present on a condensate component. In some embodiments, the detectable tag is incorporated within the condensate. The detectable tag (sometimes also referred to herein as a detectable label) is not limited and may be any detectable tag described herein. In some embodiments where multiple detectable tags are present, the detectable tags may be detectable in different ways.

[0059] In some embodiments, the condensate may be a transcription condensate, heterochromatin condensate, splicing speckle condensate, nucleolus, chromatin condensate, Polycomb condensate, DNA damage repair condensate, or condensate physically associated with mRNA initiation or elongation complexes. In some embodiments, the condensate may be an in vitro condensate having one or more components of a transcription condensate, heterochromatin condensate, splicing speckle condensate, nucleolus, chromatin condensate, Polycomb condensate, DNA damage repair condensate, or condensate physically associated with mRNA initiation or elongation complexes. In some embodiments, the condensate is physically associated with DNA (e.g., genomic DNA, genomic DNA in a cell). In some embodiments, the condensate, condensate component, agent, or method for assessing condensate properties is described in PCT / US2019 / 023694, filed March 22, 2019, which is incorporated herein by reference in its entirety. In some embodiments, the condensate (e.g., in vivo condensate, ex vivo condensate, in vitro condensate, or droplet) comprises a condensate component that is overexpressed in cancer cells that are resistant to an anticancer drug, and the overexpression is associated with resistance to the anticancer drug. In some embodiments, the amount of the condensate component in the condensate that is overexpressed in cancer cells that are resistant to an anticancer drug is greater than that present in a condensate of a cancer cell that does not overexpress the condensate component. In some embodiments, the volume of a condensate that includes a condensate component that is overexpressed in a cancer cell that is resistant to an anticancer drug is greater than the volume of a condensate found in a cancer cell that does not overexpress the condensate component.

[0060] In some embodiments, at least one component of the condensate is Mediator, a Mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α. In some embodiments, at least one component is a component of a nuclear condensate. In some embodiments, at least one component is a component of a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a splicing speckle condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, a DNA damage repair condensate, or a functional fragment of such a component. In some embodiments, at least one component is a component of a condensate present in the nucleus or a functional fragment thereof. In some embodiments, at least one component of the condensate comprises an intrinsically disordered region (IDR).

[0061] As used herein, a "transcription condensate" is a phase-separated multimolecular assembly that occurs at transcription sites and is a cooperative, high-density assembly of multiple components that may include transcription factors, cofactors (e.g., coactivators), chromatin regulators, DNA, non-coding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers (see Figures 4, 11, and 12). As used herein, a "super-enhancer condensate" is a transcription condensate that occurs at a super-enhancer. Super-enhancers are known in the art. See, e.g., U.S. Patent Application Publication No. 20140287932A1, incorporated herein by reference. As used herein, a "heterochromatin condensate" is a phase-separated multimolecular assembly that is physically associated with (e.g., occurs on) heterochromatin. Heterochromatin condensates have been shown to be associated with the repression of gene transcription. As used herein, condensates physically associated with mRNA initiation complexes or elongation complexes are phase-separated multimolecular assemblies occurring in the associated complexes. In some embodiments, condensates physically associated with elongation complexes include splicing factors. In some embodiments, condensates physically associated with elongation complexes are splicing speckles. As used herein, "splice speckles" (sometimes referred to as nuclear speckles or interchromatin granules) are condensates enriched in splicing factors. See, e.g., Y. Chen, A.S. Belmont, Genome organization around nuclear speckles. Curr. Opin. Genet. Dev. 55, 91-99 (2019), incorporated herein by reference. As used herein, "nucleolus" or "nucleoli" (plural) are condensates containing RNA and proteins occurring within the nucleus.See, e.g., M. Feric et al., Coexisting Liquid Phases Underlying Nucleolar Subcompartments. Cell. 165, 1686-1697 (2016), incorporated herein by reference. As used herein, "chromatin condensates" are phase-separated multimolecular assemblies that are physically associated with chromatin. See, e.g., Gibson et al., Organization of Chromatin by Intrinsic and Regulated Phase Separation, Cell (2019), incorporated herein by reference. As used herein, "Polycomb condensates" are phase-separated multimolecular assemblies that are physically associated with chromatin and can repress gene transcription. See Plys, et al., Phase separation of Polycomb-repressive complex 1 is governed by a charged disordered region of CBX2, Genes Dev. 2019 Jul 1;33(13-14):799-813, incorporated herein by reference. As used herein, "DNA damage repair condensates" are phase-separated multimolecular assemblies that physically associate with double-strand DNA breaks. See Pessina et al., Functional transcription promoters at DNA double-strand breaks mediate RNA-driven phase separation of damage-response factors, Nature Cell Biology volume 21, pages 1286-1299 (2019), incorporated herein by reference.

[0062] In some preferred embodiments of the methods disclosed herein, the condensate is a transcription condensate or an in vitro condensate comprising one or more components of a transcription condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a super-enhancer condensate or an in vitro condensate comprising one or more components of a super-enhancer condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a splicing speckle condensate or an in vitro condensate comprising one or more components of a splicing speckle condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a heterochromatin condensate or an in vitro condensate comprising one or more components of a heterochromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a heterochromatin condensate or an in vitro condensate comprising one or more components of a heterochromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a nucleolus or an in vitro condensate comprising one or more components of a nucleolus. In some preferred embodiments of the method disclosed herein, the condensate is a chromatin condensate or an in vitro condensate that comprises one or more components of a chromatin condensate.In some preferred embodiments of the method disclosed herein, the condensate is a Polycomb condensate or an in vitro condensate that comprises one or more components of a Polycomb condensate.In some preferred embodiments of the method disclosed herein, the condensate is a DNA damage repair condensate or an in vitro condensate that comprises one or more components of a DNA damage repair condensate.

[0063] As used herein, the phrase "condensate component" and the like refers to a peptide, protein, nucleic acid, signaling molecule, lipid, etc. that is part of a condensate (e.g., a transcription condensate, a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate) or has the ability to become part of a condensate. In some embodiments, the component is present within the condensate. In some embodiments, the component is required for condensate formation or stability. In some embodiments, the component is not required for condensate formation or stability. In some embodiments, the component is a protein or peptide and comprises one or more intrinsically disordered domains (e.g., an IDR of an activation domain of a transcription factor, an IDR that interacts with an IDR of an activation domain of a transcription factor, an IDR of a signal transduction factor, an IDR of a methylated DNA binding protein, an IDR of a gene silencing factor, an IDR of a polymerase, an IDR of a splicing factor, an IDR of a small nucleolar ribonucleoprotein, an IDR of nucleophosmin, an IDR of a histone, an IDR of CBX2, an IDR of 53BP1). In some embodiments, the component is a non-structural member of the condensate (e.g., not required for the integrity of the condensate). In some embodiments, the condensate comprises, consists of, or consists essentially of one, two, three, four, five, six, seven, eight, nine, ten, or more components. In some embodiments, the condensate (e.g., an in vitro condensate) does not comprise nucleic acids. In some embodiments, the condensate (e.g., in vitro condensate) does not include RNA. In some embodiments, the components are protein or nucleic acid fragments.

[0064] As shown in the Examples below, substitution of basic amino acids in MED1 with alanine impaired the ability of mutant MED1 to form droplets in solution (i.e., in vitro condensates). Thus, in some embodiments, the condensate component is a naturally occurring protein or polypeptide that has been modified to increase or decrease the number of basic amino acid residues, thereby modulating the condensate component's ability to form condensates (e.g., droplets). In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all basic amino acid residues have been replaced with non-basic amino acid residues (e.g., alanine or other neutral amino acids, such as asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more basic amino acid residues are replaced with non-basic amino acid residues, hi some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more basic amino acid residues are added to a condensate component.

[0065] In some embodiments, the ability of the modified condensate component to form a condensate (e.g., droplet) is reduced by at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6 fold, at least about 1.7 fold, at least about 1.8 fold, at least about 1.9 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 50 fold, or at least about 100 fold compared to the unmodified condensate component. In some embodiments, the ability of the modified condensate component to form a condensate (e.g., droplet) is increased by at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6 fold, at least about 1.7 fold, at least about 1.8 fold, at least about 1.9 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 50 fold, or at least about 100 fold compared to the unmodified condensate component.

[0066] As shown in the Examples below, substitution of aromatic amino acids in MED1 with alanine impaired the ability of agents containing aromatic substituents to be incorporated into droplets of engineered MED1. Thus, in some embodiments, the condensate component is a naturally occurring protein or polypeptide that has been modified to increase or decrease the number of aromatic amino acid residues, thereby modulating the ability of the condensate component to incorporate agents containing aromatic substituents. In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all of the aromatic amino acid residues are replaced with non-aromatic amino acid residues (e.g., alanine or other neutral amino acids, such as asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more aromatic amino acid residues are replaced with non-aromatic amino acid residues, hi some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more aromatic amino acid residues are added to the condensate component.

[0067] In some embodiments, the ability of a condensate comprising modified condensate components to uptake an agent comprising an aromatic substituent is reduced by at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6 fold, at least about 1.7 fold, at least about 1.8 fold, at least about 1.9 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, at least about 10 fold, at least about 20 fold, at least about 50 fold, or at least about 100 fold compared to a corresponding condensate comprising unmodified condensate components. In some embodiments, the ability of a condensate comprising modified condensate components to uptake an agent comprising an aromatic substituent is increased by at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to a corresponding condensate comprising unmodified condensate components.

[0068] In some specific embodiments, provided herein are methods for obtaining a drug with a desired partition coefficient, comprising: (a) providing a first drug having a partition coefficient and at least a second drug that is the same as the first drug except that one or more non-aromatic amino acids have been replaced with aromatic amino acids and / or one or more aromatic amino acids have been added; and (b) measuring the partition coefficient of the second drug, thereby obtaining a drug with the desired partition coefficient. In some specific embodiments, provided herein are methods for obtaining a drug with a desired partition coefficient, comprising: (a) providing a first drug having a partition coefficient and at least a second drug that is the same as the first drug except that one or more aromatic amino acids have been replaced with non-aromatic amino acids and / or one or more aromatic amino acids have been removed; and (b) measuring the partition coefficient of the second drug, thereby obtaining a drug with the desired partition coefficient.

[0069] Regions of intrinsic disorder, also referred to as intrinsically disordered regions (IDRs) or intrinsically disordered domains, can be found in many protein components of condensates. These terms are used interchangeably throughout this disclosure. IDRs lack stable secondary and tertiary structure. In some embodiments, IDRs can be identified by the methods disclosed in Ali, M., & Ivarsson, Y. (2018). High-throughput discovery of functional disordered regions. Molecular Systems Biology, 14(5), e8377. IDRs are known in the art, and any suitable method for identifying IDRs can be used.

[0070] In some embodiments, the component is a signal transduction factor, a methylated DNA binding protein, BRD4, a mediator, a mediator component, MED1, MED15, a transcription factor, an RNA polymerase, a DNA sequence (e.g., an enhancer DNA sequence, a methylated DNA sequence, a super-enhancer DNA sequence, the 3' end of a transcribed gene, a signal response element, a hormone response element, an oncogene, or a portion thereof), a gene silencing factor, a splicing factor, an elongation factor, an initiation factor, a histone (e.g., a modified histone), a cofactor, an RNA (e.g., an ncRNA), a mediator, an RNA polymerase (e.g., RNA polymerase II), a kinase (e.g., a cyclin-dependent kinase, CDK7, CDK8), a proteasome, or a topoisomerase. In some embodiments, the component is MED1, BRD4, POLII, SRSF2, FIB1, NPM1, a histone, CBX2, 53BP1, or HP1α, or a functional fragment thereof (e.g., a fragment containing an IDR). In some embodiments, the cofactor comprises an LXXLL motif. In some embodiments, the cofactor comprises an LXXLL motif and has increased binding valency for a TF (e.g., a nuclear receptor, a master transcription factor) when bound to a ligand (e.g., a cognate ligand, a naturally occurring ligand, a synthetic ligand). Cofactors with an LXXLL motif are known in the art. In some embodiments, the component is a fragment of a cofactor comprising an IDR and an LXXLL motif. In some embodiments, the component is a protein or a nucleic acid. The component is not limited and can be any condensation component identified in the art.

[0071] As used herein, a "Mediator component" includes or consists of a polypeptide whose amino acid sequence is identical to that of a naturally occurring Mediator complex polypeptide. A naturally occurring Mediator complex polypeptide can be, for example, any of the approximately 30 polypeptides found in Mediator complexes occurring in or isolated from cells (see, e.g., Conaway et al., 2005; Kornberg, 2005; Malik and Roeder, 2005). In some embodiments, a naturally occurring Mediator component is any of Med1 through Med31, or any naturally occurring Mediator polypeptide known in the art. For example, a naturally occurring Mediator complex polypeptide can be Med6, Med7, Med10, Med12, Med14, Med15, Med17, Med21, Med24, Med27, Med28, or Med30. In some embodiments, the mediator polypeptide is a subunit found in the Med11, Med17, Med20, Med22, Med8, Med18, Med19, Med6, Med30, Med21, Med4, Med7, Med31, Med10, Med1, Med27, Med26, Med14, Med15 complex. In some embodiments, the mediator polypeptide is a subunit found in the Med12 / Med13 / CDK8 / cyclin complex. Mediators are described in further detail in PCT International Patent Application No. WO2011 / 100374, the teachings of which are incorporated herein by reference in their entirety.

[0072] In some embodiments, the components of the condensate are TCF7L2, TCF7, TCF7L1, LEF1, β-catenin, SMAD2, SMAD3, SMAD4, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6, and NF-κB. In some embodiments, the signal transduction factor comprises one or more intrinsically disordered domains. In some embodiments, the condensate comprises a master transcription factor.

[0073] In some embodiments, the condensate component is a methylated DNA-binding protein that preferentially binds to methylated DNA. In some embodiments, the methylated DNA-binding protein is MECP2, MBD1, MBD2, MBD3, or MBD4. In some embodiments, the methylated DNA-binding protein is associated with gene silencing. In some embodiments, the component is a repressor associated with heterochromatin. In some embodiments, the methylated DNA-binding protein is HP1α, TBL1R (transducin β-like protein), HDAC3 (histone deacetylase 3), or SMRT (silencing mediator of retinoic acid and thyroid hormone receptors).

[0074] In some embodiments, the component of the condensate is an RNA polymerase associated with an mRNA initiation complex and an elongation complex. In some embodiments, the RNA polymerase is RNA polymerase II or the C-terminal region of RNA polymerase II. In some embodiments, the C-terminal region of RNA polymerase II comprises an intrinsically disordered region (IDR). In some embodiments, the IDR comprises a phosphorylation site. In some embodiments, the component is a splicing factor selected from SRSF2, SRRM1, or SRSF1.

[0075] In some embodiments, the component of the condensate is a transcription factor, ie, OCT4, p53, MYC, or GCN4, NANOG, MyoD, KLF4, a SOX family transcription factor, a GATA family transcription factor, or a nuclear receptor (e.g., a nuclear hormone receptor, an estrogen receptor, or a retinoic acid receptor alpha).

[0076] In some embodiments, the nuclear receptor (NR) is a member of nuclear receptor subfamily 0, a member of nuclear receptor subfamily 1, a member of nuclear receptor subfamily 2, a member of nuclear receptor subfamily 3, a member of nuclear receptor subfamily 4, a member of nuclear receptor subfamily 5, or a member of nuclear receptor subfamily 6. In some embodiments, the nuclear receptor is NR1D1 (nuclear receptor subfamily 1 group D member 1), NR1D2 (nuclear receptor subfamily 1 group D member 2), NR1H2 (nuclear receptor subfamily 1 group H member 2; also known as liver X receptor beta), NR1H3 (nuclear receptor subfamily 1 group H member 3; also known as liver X receptor alpha), NR1H4 (nuclear receptor subfamily 1 group H member 4), NR1I2 (nuclear receptor subfamily 1 group I member 2; also known as pregnane X receptor), NR1I3 (nuclear receptor subfamily 1 group I member 3; also known as constitutive androstane receptor), NR1I4 (nuclear receptor subfamily 1 group I member 4), NR1I5 (nuclear receptor subfamily 1 group I member 5; also known as ribosomal receptor), NR1I6 (nuclear receptor subfamily 1 group I member 6; also known as ribosomal receptor), NR1I7 (nuclear receptor subfamily 1 group I member 7; also known as ribosomal receptor), NR1I8 (nuclear receptor subfamily 1 group I member 8; also known as ribosomal receptor), NR1I9 (nuclear receptor subfamily 1 group I member 9; also known as ribosomal receptor), NR1I10 (nuclear receptor subfamily 1 group I member 10; also known as ribosomal receptor), NR1I11 (nuclear receptor subfamily 1 group I member 10; also known as ribosomal receptor), NR1I12 (nu 1 Group I member 4), NR2C1 (nuclear receptor subfamily 2 Group C member 1), NR2C2 (nuclear receptor subfamily 2 Group C member 2), NR2E1 (nuclear receptor subfamily 2 Group E member 1), NR2E3 (nuclear receptor subfamily 2 Group E member 3), NR2F1 (nuclear receptor subfamily 2 Group F member 1), NR2F2 (nuclear receptor subfamily 2 Group F member 2), NR2F6 (nuclear receptor subfamily 2 Group F member 6), NR3C1 (nuclear receptor subfamily 3 Group C member 1; also known as glucocorticoid receptor), NR3C2 (nuclear receptor subfamily 3 Group C member 2;Aliases: aldosterone receptor, mineralocorticoid receptor, NR4A1 (nuclear receptor subfamily 4 group A member 1), NR4A2 (nuclear receptor subfamily 4 group A member 2), NR4A3 (nuclear receptor subfamily 4 group A member 3), NR5A1 (nuclear receptor subfamily 5 group A member 1), NR5A2 (nuclear receptor subfamily 5 group A member 2), NR6A1 (nuclear receptor subfamily 6 group A member 1), NR0B1 (nuclear receptor subfamily 0 group B member 1), NR0B2 (nuclear receptor subfamily 0 group B member 2), RARA (retinoic acid receptor, alpha), RARB (retinoic acid receptor, beta), RARG (retinoic acid receptor, gamma), RXRA (retinoid X receptor, alpha; Aliases: nuclear receptor subfamily 2 group B member 1), RX These are RB (retinoid X receptor, beta; also known as nuclear receptor subfamily 2 group B member 2), RXRG (retinoid X receptor, gamma; also known as nuclear receptor subfamily 2 group B member 3), THRA (thyroid hormone receptor, alpha), THRB (thyroid hormone receptor, beta), AR (androgen receptor), ESR1 (estrogen receptor 1), ESR2 (estrogen receptor 2; also known as ERβ), ESRRA (estrogen-related receptor alpha), ESRRB (estrogen-related receptor beta), ESRRG (estrogen-related receptor gamma), PGR (progesterone receptor), PPARA (peroxisome proliferator-activated receptor alpha), PPARD (peroxisome proliferator-activated receptor delta), PPARG (peroxisome proliferator-activated receptor gamma), or VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor);

[0077] In some embodiments, the nuclear receptor is a naturally occurring truncated form of a nuclear receptor generated by proteolytic cleavage, such as a truncated RXRα or a truncated estrogen receptor. In some embodiments, the nuclear receptor is an HSP70 client. For example, the androgen receptor (AR) and the glucocorticoid receptor (GR) are HSP70 clients. Extensive information on NRs can be found in Germain, P., et al., Pharmacological Reviews, 58:685-704, 2006, which provides an overview of the names and structures of nuclear receptors, and in other articles in the same issue of Pharmacological Reviews for reviews of NR subfamilies. In some embodiments, the HSP90A client is a steroid hormone receptor (e.g., estrogen, progesterone, glucocorticoid, mineralocorticoid, or androgen receptor), PPARα, or PXR. In some embodiments, the nuclear receptor (NR) is a ligand-dependent NR. Ligand-dependent NRs are characterized in that the binding of a ligand to an NR regulates the activity of the NR. In some embodiments, the binding of a ligand to an NR in a ligand-dependent manner causes a conformational change in the NR, resulting in, for example, nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR. In some embodiments, the NR is a mutant that lacks one or more activities of a wild-type NR upon ligand binding (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR). In some embodiments, the NR is a mutant that has ligand-independent activities (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR) that are ligand-dependent in the wild-type NR. In some embodiments, the nuclear receptor activates transcription when bound to its cognate ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of its cognate ligand.

[0078] In some embodiments of the methods disclosed herein, the transcription factor is a human transcription factor identified in Lambert, et al., Cell. 2018 Feb 8;172(4):650-665. In some embodiments, the nuclear receptor activates transcription when bound to its cognate ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of its cognate ligand, or has a higher level of transcriptional activity (e.g., at least 1.5-fold, at least 2-fold, at least 3-fold, or more) in the absence of its cognate ligand compared to the wild-type nuclear receptor in the presence of a natural ligand (e.g., the cognate ligand). In some embodiments, the nuclear receptor is a mutant nuclear transcription factor that regulates transcription to a different extent compared to the wild-type nuclear receptor in the presence of its cognate ligand. In some embodiments, the transcription factor is an oncogenic fusion transcription factor. In some embodiments, the oncogenic fusion transcription factor is selected from an MLL rearrangement, an EWS-FLI, an ETS fusion, a BRD4-NUT, and a NUP98 fusion. The oncogenic transcription factor can be any oncogenic transcription factor identified in the art.

[0079] In some embodiments, the condensate components are components found in transcriptional condensates. In some embodiments, the transcriptional condensate components include transcription factors, cofactors, chromatin regulators, DNA, non-coding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers. In some embodiments, the transcription factor is, for example, OCT4, p53, MYC, GCN4, NANOG, MyoD, KLF4, SOX family transcription factors, GATA family transcription factors, nuclear receptors, or oncogenic fusion transcription factors.

[0080] In some embodiments, the component of the condensate is a component found in the nucleolus, hi some embodiments, the nucleolar component is an rRNA processing factor, POL1, FIB1, nucleophosmin, ribosomal DNA gene cluster, and / or POLR1E.

[0081] In some embodiments, incorporation of the drug into the condensate is detected without the use of a detectable tag. In some embodiments, the drug is naturally fluorescent. In some embodiments, the drug has a color that distinguishes the drug from the condensate and / or background or regions outside the condensate. In some embodiments, incorporation of the drug is detected by Raman spectroscopy (see, e.g., Smith et al., Analyst, 2016, 141, pp. 3590-3600). In some embodiments, incorporation of the drug is detected by nuclear magnetic resonance (NMR). In some embodiments, incorporation of the drug is detected by mass spectrometry. In some embodiments, incorporation of the drug is detected by spectrometry and quantitative phase-contrast microscopy. In some embodiments, incorporation of the drug is detected by coherence-controlled holographic microscopy. In some embodiments, incorporation of the drug is detected by a spin-down assay. It will also be understood that incorporation of the drug into the condensate can be detected by detecting the amount or proportion of drug that is not incorporated into the condensate.

[0082] In some embodiments, drug incorporation into condensates is detected by isolating the condensates from drugs not incorporated within the condensates and then measuring the drug remaining within the condensates. Any suitable method for isolating condensates may be used, including but not limited to: In some embodiments, condensates are isolated by removing the condensates from cells containing the condensates; In some embodiments, condensates are isolated by removing the condensates from an in vitro composition (e.g., a solution) containing the condensates; In some embodiments, the condensates are crosslinked to aid in the isolation of the condensates; In some embodiments, the isolated condensates are disrupted and the amount or ratio of drug is measured. Any suitable disruption method may be used, including physical and / or chemical means. In some embodiments, condensates may be disrupted by increasing or decreasing the salt concentration or crowding agent in the solution. In some embodiments, condensates may be disrupted by sonication, centrifugation, or temperature changes. In some embodiments, the drug from the disrupted condensates is measured by chromatography (e.g., HPLC).

[0083] In some embodiments, the uptake of the drug into the condensate is measured relative to a control. The control can be a compound known to be uptaken into the condensate under appropriate physiological conditions. The control can be a compound with similar physical or chemical properties as the drug and a known uptake profile into the condensate. In some embodiments, the enrichment ratio or partition coefficient of the drug (i.e., the relative concentration of the drug inside and outside the condensate) is determined. In some embodiments, the enrichment ratio is determined by measuring the fluorescence of a fluorescent tag on the drug both inside and outside the condensate. In some embodiments, the enrichment ratio is detected by methods described in the Examples section. Methods for determining enrichment ratios and partition coefficients are known in the art and are not limited. In some embodiments, the amount of drug partitioned into the condensate is determined. In some embodiments, the drug includes a detectable tag. In some embodiments, the uptake of the drug into the condensate is measured using the detectable tag. As used herein, the term "detectable tag" or "detectable label" includes, but is not limited to, detectable labels such as fluorophores, radioisotopes, chromogenic substrates, or enzymes; heterologous epitopes for which specific antibodies are commercially available, such as FLAG tags; heterologous amino acid sequences that are ligands for commercially available binding proteins, such as Strep tags and biotin; fluorescence quenchers that are typically used in conjunction with fluorescent tags on other polypeptides; and complementary bioluminescent or fluorescent polypeptide fragments. A detectable label or a tag that is a complementary bioluminescent or fluorescent polypeptide fragment can be measured directly (e.g., by measuring fluorescence or radioactivity, or by incubating with an appropriate substrate or enzyme to cause a spectrophotometrically detectable color change in the associated polypeptide compared to the unassociated polypeptide). A tag that is a heterologous epitope or ligand is typically detected using a second entity that binds to it, such as an antibody or binding protein, where the second entity is associated with a detectable label. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, the condensate component and the agent comprise a detectable tag.In some embodiments, the component comprises a detectable tag that is distinct from the agent.

[0084] The method for calculating the uptake of a drug into a condensate is not limited and can be any method known in the art. In some embodiments, the enrichment ratio of a drug is determined by the method shown in Figure 36. In some embodiments, the enrichment ratio of a drug (e.g., a drug with a detectable tag or a drug with a detectable property) in a particular condensate can be determined by providing the condensate in a solution containing the drug, detecting the intensity of the drug in the condensate by confocal microscopy, and calculating the drug uptake ratio. 内部 providing the condensate in a solution that does not contain the drug and detecting the intensity of the background in the condensate to obtain a background value; and providing the drug in a solution that does not contain the drug and detecting the intensity of the drug to obtain a drug value. 拡散 The enrichment ratio is determined by obtaining a value, where the enrichment ratio is 内部 -Background) / (Drug 拡散 ) In some embodiments, the drug partitioning can be determined experimentally by spectroscopy and quantitative phase contrast microscopy. In some embodiments, a sample composed of two coexisting phases is considered, termed the dilute and condensed phases, with a volume ratio Φ 希薄 and Φ 凝縮 = 1. Drugs are also c 合計 is present in the sample at an average concentration of c 合計 =c 希薄 Φ 希薄 +c 凝縮 Φ 凝縮 (1) It requires something.

[0085] In the formula, c 希薄 and c 凝縮 are the drug concentrations in the dilute and condensed phases, respectively. The partition coefficient of the drug into the condensed phase is P = c 凝縮 / c 希薄 With this definition and the requirement that the sum of the volume fractions of the phases be 1, Equation 1 becomes: c 合計 =c希薄 (1-Φ 凝縮 )+c 希薄 PΦ 凝縮 (2) can be written as:

[0086] This formula can be simplified and rearranged to

number

[0087] c 合計 / c 希薄 The ratio is estimated by fluorescence spectroscopy measurements as described below, while Φ 凝縮 is estimated by the lever principle (M. Rubinstein, RH Colby, Polymer Physics (Oxford University Press, 2003)) as follows: Let the concentration of the condensate protein (e.g., MED1) be denoted as s, and by mass conservation, s = s 合計 =s 希薄 Φ 希薄 +s 凝縮 Φ 凝縮 This equation can be rearranged again using the necessary condition that the volume fractions of the coexisting phases sum to 1, to obtain

number

[0088] In the formula, s 合計 and s 希薄 is measured, for example, by spectrophotometry using optical absorption at 280 nm, and s 凝縮 is measured by quantitative phase contrast microscopy using, for example, a coherence-controlled holographic microscope.

[0089] Using the Beer-Lambert law, Equation 5

number

[0090] where A is the measured absorbance (in absorbance units (AU)), I is the intensity of the incident light at a given wavelength, I is the transmitted intensity, L is the path length through the sample, and c is the concentration of the absorbing species. For each species and wavelength, ε is a constant known as the molar absorptivity or extinction coefficient. This constant is a fundamental molecular property in a given solvent at a specific temperature and pressure and has units of 1 / M*cm.

[0091] In some embodiments, the amount of drug dispensed can be measured using a spin-down assay. Specifically, a known concentration of drug is added to the condensate components to form droplets. The mixture is then centrifuged to pellet the droplets, the supernatant is collected, and the concentration of drug in the supernatant is measured. The amount of drug dispensed can then be determined by subtracting the concentration of drug in the supernatant from the known total concentration of drug added.

[0092] In some embodiments, quantitative phase measurements can be performed using a coherence-controlled holographic microscope, for example, as detailed in the Examples below. Software can be used to construct a corrected phase image from the resulting hologram. In some embodiments, each phase image is spatially partitioned based on intensity, and the window containing each partitioned object is

number

[0093] where φ(x, y) is the phase intensity at pixel location (x, y), λ is the illumination wavelength, Δn is the refractive index difference between the condensate and the surrounding dilute phase, and H(x, y|R) is the projected height within a radius R. The fitting parameters in Equation 6 are Δn and R. PEG is assumed not to partition into the condensate, and the average scaffold concentration in each filtered condensate is

number

[0094] where n0 is the refractive index of the buffer in the absence of scaffold and PEG, and n 希薄 is the refractive index of the dilute phase, both measured using a digital refractometer. The refractive index increment of the condensate protein, dn / ds, can be estimated from the amino acid composition.

[0095] In some embodiments, drug-target interactions in the presence of condensates can be modeled. Such modeling can be useful, for example, to determine the effective partition coefficient and / or concentration of a drug that is therapeutically effective for a target. In some embodiments, the modeling can be a simplified model as shown in the Examples herein. This simplified model was developed for drug-target interactions in the presence of condensates. The relevant species are the drug (D) (i.e., drug), the target (T), and the drug-target complex (DT). The bulk / dilute core phase (n) and the volume ratio f = V 凝縮物 / V 核 It is assumed that only two phases exist: (a) a condensate phase (c) and (b) a condensate phase (c). At equilibrium, the following partitioning conditions apply:

number

[0096] In the formula, p D , p T is the partition coefficient of the drug and target. [D] c represents the concentration of species D in the condensate phase (similarly for other components / phases). In this model, the drug and target are D The complex forms with a phase-independent dissociation constant of

number

[0097] To solve for the equilibrium concentrations of the various species present at total concentration [D]0, [T]0, the species equilibrium is written as:

number

[0098] These six concentrations are solved using two equations and four constraints (two from partition equilibrium and two from reaction equilibrium). In Figures 61A-61D, the fraction of target bound is defined as:

number

[0099] A similar expression is used for the proportion of target bound in the core (bulk or dilute) phase: when a control is plotted, the proportion plotted is that when only one phase is present (f=0).

[0100] The presence of a detectable tag on an agent may, in some cases, alter the incorporation activity of the agent into the condensate. However, if the labeled agent incorporated into the condensate can be washed out with excess unlabeled agent, the incorporation of the labeled agent into the condensate is not modulated by the label. Thus, in some embodiments, the methods disclosed herein include contacting an agent having a detectable tag with a composition containing the condensate, measuring the incorporation of the agent having the detectable tag into the condensate, contacting the composition (e.g., a solution) containing the condensate and the agent having the detectable tag with a control agent without a detectable tag (i.e., the same agent without a detectable tag), and again measuring the incorporation of the agent having the detectable tag into the condensate. In some embodiments, at least an equal concentration of the control agent is contacted. In some embodiments, an excess of control agent (e.g., at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more) is contacted. In some embodiments, the condensate incorporating the tagged agent is contacted with an increasing gradient of control agent, and loss of tagged agent is measured continuously or at discrete intervals. In some embodiments, the method may further include contacting the condensate (e.g., droplets) with the tagged agent and an isomer of the agent having a lower partition coefficient for the condensate. In some embodiments, the isomer of the agent does not detectably partition into the condensate. In some embodiments, contact of the tagged agent with the target in the condensate causes release of the target from the condensate. In some embodiments, contacting the condensate with the tagged drug and an isomer of the tagged drug that does not partition into the condensate to an appreciable extent does not reduce the amount of target released after binding to the tagged target compared to the tagged target in the absence of the isomer, hi some embodiments, the isomer is transplatin, an isomer of cisplatin, the tagged drug is tagged cisplatin, and the target is an estrogen receptor.

[0101] In some embodiments, a component of the condensate comprises a detectable tag. In some embodiments, both the agent and a component of the condensate comprise a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, DNA or RNA incorporated into or associated with the condensate comprises a detectable tag.

[0102] Some particular embodiments characterizing the agents disclosed herein are as follows:

[0103] Tracking / Competition Droplet Assay:

[0104] In some embodiments, provided herein are methods for determining whether a first agent modulates the incorporation of a second agent into a condensate, the method comprising: (a) measuring the incorporation of the second agent into the condensate in the presence of the first agent; and (b) comparing the incorporation of the second agent into the condensate in the presence of the first agent with a reference standard, thereby determining whether the first agent modulates the incorporation of the second agent into the condensate. In some embodiments, the reference standard is based on the incorporation of the second agent into the condensate in the absence of the first agent. The first and second agents can be, but are not limited to, any of the agents described herein. In some embodiments, at least the first or second agent is a small molecule as described herein.

[0105] In some embodiments, provided herein is a method for determining whether a first agent modulates the uptake of a second agent into a condensate, the method comprising: (a) measuring the uptake of the second agent into the condensate in the absence of the first agent; (b) measuring the uptake of the second agent into the condensate in the presence of the first agent; and (c) comparing the uptake of the second agent into the condensate in the absence of the first agent with the uptake of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the uptake of the second agent into the condensate.

[0106] In some embodiments, provided herein is a method for determining whether a first agent modulates the incorporation of a second agent into a condensate, the method comprising: (a) mixing a condensate and a second agent to form a reaction composition, wherein a condensate component comprises a first detectable tag and the second agent comprises a second detectable tag, and wherein signals of the first and second detectable tags are distinguishable; (b) measuring the incorporation of the second agent into the condensate in the absence of the first agent; (c) mixing the first agent with the reaction composition; (d) measuring the incorporation of the second agent into the condensate in the presence of the first agent; and (e) comparing the incorporation of the second agent into the condensate in the absence of the first agent with the incorporation of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the incorporation of the second agent into the condensate.

[0107] In some embodiments, a method for determining whether a first agent modulates incorporation of a second agent into a condensate comprises: (a) mixing a composition comprising a component of the condensate and a second agent to form a reaction composition and cause the formation of the condensate in the reaction composition, wherein the condensate component comprises a first detectable tag and the second agent comprises a second detectable tag, and the signals of the first and second detectable tags are distinguishable; (b) measuring the incorporation of the condensate in the absence of the first agent. Provided herein are methods comprising: (a) measuring the incorporation of a second agent into the condensate; (b) mixing the first agent with the reaction composition; (c) measuring the incorporation of the second agent into the condensate in the presence of the first agent; and (e) comparing the incorporation of the second agent into the condensate in the absence of the first agent with the incorporation of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the incorporation of the second agent into the condensate. In some embodiments, measuring the incorporation of an agent into the condensate comprises the use of techniques including Raman spectroscopy, spectrometry, fluorescence microscopy, including quantitative phase-contrast microscopy, quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the first agent and / or the second agent comprises a detectable tag, e.g., a fluorescent tag or label. In some embodiments, the condensate comprises a component comprising a detectable tag, e.g., a fluorescent tag or label. In some embodiments, the first agent is unlabeled and the second agent comprises a detectable tag, such as a fluorescent label. In some embodiments, the second agent comprises the first agent and a detectable tag, such as a fluorescent label. In some embodiments, measuring the incorporation of the agent into the condensate comprises quantifying the signal intensity of the agent in one or more condensate regions, where the one or more condensate regions are based on labeled components of the condensate, as described in the measurement techniques disclosed herein and / or shown in the figures accompanying this specification.

[0108] In some embodiments, provided herein are methods for determining whether an agent modulates the incorporation of a condensate component into a condensate, the methods comprising: (a) measuring the incorporation of the condensate component into the condensate in the presence of the agent; and (b) comparing the incorporation of the condensate component into the condensate in the presence of the agent to a reference standard, thereby determining whether the agent modulates the incorporation of the condensate component into the condensate. In some embodiments, the reference standard is based on the incorporation of the condensate component into the condensate in the absence of the agent. In some embodiments, the condensate comprises two or more condensate components, e.g., a first component and a second component.

[0010] In some embodiments, provided herein is a method for determining whether an agent modulates incorporation of a first condensate component into a condensate, the condensate comprising the first condensate component and a second condensate component in the absence of the agent, the method comprising: (a) measuring incorporation of the first condensate component into the condensate in the absence of the agent; (b) measuring incorporation of the first condensate component into the condensate in the presence of the agent; and (c) comparing incorporation of the first condensate component into the condensate in the presence of the agent with incorporation of the first condensate component into the condensate in the presence of the agent, thereby determining whether the agent modulates incorporation of the first condensate component into the condensate. In some embodiments, measuring incorporation of the agent and / or condensate component into the condensate comprises the use of techniques including Raman spectroscopy, spectrometry, fluorescence microscopy, including quantitative phase-contrast microscopy, quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the agent comprises a detectable tag, e.g., a fluorescent tag or label. In some embodiments, one or more of the condensate components comprises a detectable tag, e.g., a fluorescent tag or label.In some embodiments, a first condensate component comprises a first detectable tag and a second condensate component comprises a second detectable tag, wherein the first detectable tag and the second detectable tag are distinguishable (e.g., fluoresce at different wavelengths). In some embodiments, measuring the incorporation of a condensate component into the condensate comprises quantifying the signal intensity of the condensate component in one or more condensate ranges, wherein the one or more condensate ranges are based on labeled components of the condensate as described in the measurement techniques disclosed herein and / or shown in the figures.

[0109] Identifying agents with desired condensation coefficients

[0110] In some embodiments, provided herein are methods for identifying a drug having a desired condensate partition coefficient. In some embodiments, provided herein are methods for identifying a drug having a desired condensate partition coefficient, the methods comprising: (a) measuring the condensate partition coefficient of the drug; and (b) comparing the condensate partition coefficient of the drug with a standard, thereby identifying the drug having the desired condensate partition coefficient. The drug may be, but is not limited to, any drug described herein. In some embodiments, the drug is a small molecule as described herein.

[0111] In some embodiments, a method for identifying a drug having a desired condensate partition coefficient is used to screen a plurality of drugs and / or select a specific drug having a desired condensate partition coefficient. In some embodiments, the condensate partition coefficient of a first drug is measured in the absence of a second drug. For example, in some embodiments, a method for identifying one or more drugs having a desired condensate partition coefficient from a plurality of drugs is provided herein, the plurality of drugs including a first drug and a second drug, the method comprising: (a) measuring the condensate partition coefficient of the first drug; (b) measuring the condensate partition coefficient of the second drug; and (c) comparing the condensate partition coefficient of the first drug with the condensate partition coefficient of the second drug, thereby identifying one or more drugs from the plurality of drugs having a desired condensate partition coefficient. The first and second drugs can be, but are not limited to, any of the drugs described herein. In some embodiments, at least the first or second drug is a small molecule as described herein.

[0112] In some embodiments, the condensate partition coefficient of a first agent in the condensate is measured in the presence of a second agent (e.g., a competitive assay). For example, in some embodiments, provided herein are methods for identifying one or more agents having a desired condensate partition coefficient from a plurality of agents, the plurality of agents including a first agent and a second agent, the method comprising: (a) measuring the condensate partition coefficient of the first agent in the absence of the second agent; (b) measuring the condensate partition coefficient of the first agent in the presence of the second agent; and (c) comparing the condensate partition coefficient of the first agent in the absence of the second agent with the condensate partition coefficient of the first agent in the presence of the second agent, thereby identifying one or more agents from the plurality of agents having a desired condensate partition coefficient. In some embodiments, measuring the condensate partition coefficient of the agent within the condensate comprises using techniques including Raman spectroscopy, spectrometry, quantitative phase-contrast microscopy, fluorescence microscopy including quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the first agent and / or the second agent comprise a detectable tag, e.g., a fluorescent tag or label. In some embodiments, the condensate comprises a component comprising a detectable tag, e.g., a fluorescent tag or label. In some embodiments, measuring the condensate partition coefficient of the agent in the condensate comprises quantifying the signal intensity of the agent in one or more condensate ranges, where the one or more condensate ranges are based on labeled components of the condensate, as described in the measurement techniques and / or illustrated in the figures disclosed herein.

[0113] Isomers

[0114] In some embodiments, the first agent and the second agent are isomers of one another (e.g., cisplatin and transplatin), e.g., structural isomers, stereoisomers, enantiomers, diastereoisomers, cis / trans isomers, conformers, or rotamers, and the methods described herein can be used to identify one or more isomers having a desired condensate partition coefficient by screening multiple isomers.

[0115] For example, in some embodiments, provided herein is a method for identifying one or more isomers having a desired condensate partition coefficient, the method comprising: (a) measuring the condensate partition coefficient of a first isomeric drug; (b) measuring the condensate partition coefficient of a second isomeric drug; and (c) comparing the condensate partition coefficient of the first isomeric drug with the condensate partition coefficient of the second isomeric drug, thereby identifying one or more isomers having the desired condensate partition coefficient. In some embodiments, the first isomeric drug and the second isomeric drug are isomers of each other. In some embodiments, the first isomeric drug and the second isomeric drug are small molecules. The isomeric drug is not limited and can be any drug described herein.

[0116] In some embodiments, provided herein are methods for identifying one or more isomers having a desired condensate partition coefficient, the method comprising: (a) measuring the condensate partition coefficient of a first isomeric agent in the absence of a second isomeric agent; (b) measuring the condensate partition coefficient of the first isomeric agent in the presence of the second isomeric agent; and (c) comparing the condensate partition coefficient of the first isomeric agent in the absence of the second isomeric agent with the condensate partition coefficient of the first isomeric agent in the presence of the second isomeric agent, thereby identifying one or more isomers having a desired condensate partition coefficient.

[0117] In some embodiments, the disclosed methods for identifying one or more isomers having a desired condensate partition coefficient can include reference to a composition containing a mixture of different isomers, e.g., a racemic mixture of isomers. For example, in some embodiments, a method for identifying an isomer having a desired condensate partition coefficient is provided, the method comprising: (a) measuring the condensate partition coefficient of a first isomeric drug; and (b) comparing the condensate partition coefficient with that of a racemic mixture containing the first isomeric drug, thereby identifying the isomer having the desired condensate partition coefficient. In some embodiments, the racemic mixture is a known therapeutic drug (e.g., an anticancer drug). In some embodiments, a particular isomer of a drug will have a desirable condensate partition coefficient compared to other isomeric forms of the drug. Thus, in some aspects, provided herein are pure isomeric compositions having a desired condensate partition coefficient and methods for preparing the pure isomeric compositions, the methods comprising identifying an isomeric drug having a desired condensate partition coefficient according to the methods disclosed herein.

[0118] labeled nucleic acid

[0119] In some embodiments, provided herein are methods of contacting a condensate (e.g., a droplet) having a nucleic acid condensate component and / or containing nucleic acid with an agent capable of adding a moiety to the nucleic acid and detecting the addition of the moiety. In some embodiments, the amount of added moiety is compared to a control or reference level. In some embodiments, the agent is an agent modified by a method disclosed herein, and the control or reference level is the amount of moiety added by the unmodified agent. In some embodiments, the moiety is or includes a detectable tag used to detect the addition of the moiety. In some embodiments, the addition of the moiety modulates expression of a gene product associated with the nucleic acid, and expression of the gene product is used to detect the addition of the moiety. In some embodiments, the moiety is a platination moiety. In some embodiments, after contact with the agent, the addition of the moiety is measured by HPLC.

[0120] In some embodiments, methods are provided herein in which a condensate (e.g., a droplet) having a nucleic acid condensate component and / or containing nucleic acid is contacted with an agent capable of removing a moiety from the nucleic acid and detecting the removal of the moiety. In some embodiments, the amount of the removed moiety is compared to a control or reference level. In some embodiments, the agent is an agent modified by a method disclosed herein, and the control or reference level is the amount of the moiety removed by an unmodified agent. In some embodiments, the moiety is or includes a detectable tag used to detect the removal of the moiety or the moiety remaining in the nucleic acid. In some embodiments, the removal of the moiety modulates expression of a gene product associated with the nucleic acid, and expression of the gene product is used to detect the removal of the moiety. In some embodiments, the moiety is methylated. In some embodiments, after contact with the agent, the removal of the moiety is measured by HPLC.

[0121] Assays with tethered condensate components

[0122] In some embodiments, provided herein are methods for characterizing a drug, the method comprising providing a fusion construct comprising a condensate component or functional fragment thereof and a nucleic acid-binding domain in contact with a nucleic acid capable of binding to the nucleic acid-binding domain, and contacting the fusion construct with the drug, thereby characterizing the drug. In some embodiments, the fusion construct tethers a condensate comprising the condensate component or functional fragment to a nucleic acid, and the drug is contacted with the condensate. In some embodiments, the drug is contacted with the fusion construct and one or more condensate components capable of forming a condensate with the fusion construct.

[0123] In some embodiments, the fusion construct comprises MED1 or an IDR of MED1. In some embodiments, the fusion construct comprises HP1α or an IDR of HP1α. In some embodiments, the fusion construct comprises ESR1 or the activation domain of ESR1. In some embodiments, one or more condensate components that can form a condensate with the fusion construct comprise the same condensate components as the condensate components of the fusion construct. In some embodiments, the fusion construct comprises an IDR of MED1, and one or more condensate components comprise MED1. In some embodiments, the fusion construct comprises an IDR of HP1α, and one or more condensate components comprise HP1α. In some embodiments, the fusion construct comprises the activation domain of HP1αESR1, and one or more condensate components comprise MED1.

[0124] In some embodiments, the nucleic acid binding domain is LacI and the nucleic acid comprises a lac operator sequence (eg, a lac sequence).

[0125] In some embodiments, the fusion construct further comprises a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, a condensate component other than the condensate component or functional fragment of the fusion construct comprises a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, both the fusion construct and the condensate component other than the condensate component of the fusion construct or functional fragment thereof each comprise a detectable tag. In some embodiments, the fusion construct and the condensate component other than the condensate component of the fusion construct or functional fragment thereof each comprise a detectable tag, and the ability of the agent to modulate the amount of the condensate component associated with the fusion construct is measured by detecting co-localization of the respective detectable tags.

[0126] In some embodiments, the fusion construct further comprises a linker between the nucleic acid binding domain and the condensate component or functional fragment. The linker is not limited and can be any linker described herein. In some embodiments, the linker is GAPGSAGSAAGGSG (SEQ ID NO: 16).

[0127] Drug-resistant condensates

[0128] Some aspects of the present disclosure are directed to methods for assessing whether differential expression of one or more condensate components by cells that are resistant to a drug causes or contributes to the resistance.

[0129] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with a drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes a corresponding non-resistant cell. In some embodiments, the cell is a cancer cell. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cell is a breast cancer cell. The method for assessing the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the cell comprises a condensate having a detectable label. In some embodiments, the drug contacted with the cell comprises a detectable label. In some embodiments, both the intracellular condensate and the drug comprise detectable labels. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.

[0130] In some embodiments, the method includes providing a condensate isolated from drug-resistant cells, contacting the condensate with a drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes a corresponding condensate from a non-resistant cell. In some embodiments, the cell is a cancer cell. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cell is a breast cancer cell. The method for assessing the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the condensate comprises a detectable label. In some embodiments, the drug comprises a detectable label. In some embodiments, both the condensate and the drug comprise detectable labels. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.

[0131] In some embodiments, the method includes providing an in vitro condensate (e.g., droplets) containing differential amounts of condensate components or fragments thereof that are differentially expressed in drug-resistant cells, contacting the condensate with a drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes a corresponding condensate that does not contain differential amounts of the condensate components or fragments thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited to, and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The method for assessing the localization, concentration, and / or therapeutic activity of the drug is not limited to, and may include any method disclosed herein. In some embodiments, the condensate includes a detectable label. In some embodiments, the drug includes a detectable label. In some embodiments, both the condensate and the drug include detectable labels. The drug is not limited to, and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the condensate component is an IDR-containing mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof. In some embodiments, the differential amount of the condensate component is at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more than that found in the condensate of a non-resistant cell. In some embodiments, the differential amount of the condensate component is less than about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, or about 50-fold, or less than the amount of the condensate component found in the condensate of a non-resistant cell.

[0132] In some embodiments, the method includes providing an in vitro condensate (e.g., droplets) containing a mutant condensate component or a fragment thereof corresponding to the mutant condensate component in the drug-resistant cells, contacting the condensate with a drug, and assessing the localization, concentration, and / or therapeutic activity of the drug relative to a control. In some embodiments, the control includes a corresponding condensate containing a non-mutant form of the condensate component or a fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited to, and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The method for assessing the localization, concentration, and / or therapeutic activity of the drug is not limited to, and may include any method disclosed herein. In some embodiments, the condensate includes a detectable label. In some embodiments, the drug includes a detectable label. In some embodiments, both the condensate and the drug include detectable labels. The drug is not limited to, and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the mutant condensate component is Mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof, that comprises an IDR and has a mutation.

[0133] Some aspects of the present disclosure relate to characterizing drug-resistant aggregates, including contacting the aggregates with one or more second agents and assessing at least one of the localization, concentration, or therapeutic activity of the agents and / or the morphology, stability, or dissolution of the aggregates. In some embodiments, the method includes determining whether the second agent counteracts the effects of drug resistance (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of or removes the aggregates).

[0134] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with a second agent, and assessing at least one of the localization, concentration, or therapeutic activity of the second agent, and / or the morphology, stability, or dissolution of the condensate. In some embodiments, the cells are cancer cells. The cancer is not limited to, and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the cells contain condensates with a detectable label. In some embodiments, the agent contacted with the cells contains a detectable label. In some embodiments, both the intracellular condensate and the second agent contain detectable labels. The second agent is not limited to, and may be any agent disclosed herein. In some embodiments, the second agent is a small molecule. In some embodiments, the cells are contacted with both the second agent and the agent to which the cells are resistant. In some embodiments, the agent to which the cells are resistant contains a detectable label. In some embodiments, the size or dissolution of the condensate is assessed compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effects of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of or removes the aggregates).

[0135] In some embodiments, the method includes providing a condensate isolated from a drug-resistant cell, contacting the condensate with a second agent, and assessing at least one of the localization, concentration, or therapeutic activity of the second agent, and / or the morphology, stability, or dissolution of the condensate. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the condensate comprises a detectable label. In some embodiments, the second agent comprises a detectable label. In some embodiments, both the condensate and the second agent comprise detectable labels. The second agent is not limited and may be any agent disclosed herein. In some embodiments, the second agent is a small molecule. In some embodiments, the condensate is contacted with both the second agent and the agent to which the cell is resistant. In some embodiments, the agent to which the cell is resistant has a detectable label. In some embodiments, the size or dissolution of the condensate is assessed compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effects of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of or removes the aggregates).

[0136] In some embodiments, the method includes providing an in vitro condensate (e.g., droplets) containing differential amounts of condensate components or fragments thereof differentially expressed in drug-resistant cells, contacting the condensate with a second agent, and evaluating at least one of the localization, concentration, or therapeutic activity of the second agent, and / or the morphology, stability, or dissolution of the condensate. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited to, and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. In some embodiments, the condensate comprises a detectable label. In some embodiments, the second agent comprises a detectable label. In some embodiments, both the condensate and the second agent comprise detectable labels. The second agent is not limited to, and may be any agent disclosed herein. In some embodiments, the second agent is a small molecule. In some embodiments, the condensate is contacted with both the second agent and the agent to which the cells are resistant. In some embodiments, the agent to which the cells are resistant comprises a detectable label. In some embodiments, the condensate component is an IDR-containing mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof. In some embodiments, the differential amount of a condensate component is at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more than that found in condensates of non-resistant cells. In some embodiments, the differential amount of a condensate component is about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 50-fold, or less than the amount of a condensate component found in condensates of non-resistant cells. In some embodiments, the size or dissolution of the condensate is assessed compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effects of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of or removes the aggregates).

[0137] In some embodiments, the method includes providing an in vitro condensate (e.g., droplets) containing a mutant condensate component or a fragment thereof corresponding to the mutant condensate component in the drug-resistant cell, contacting the condensate with a second agent, and assessing at least one of the localization, concentration, or therapeutic activity of the second agent, and / or the morphology, stability, or dissolution of the condensate. In some embodiments, the control includes a corresponding condensate containing a non-mutant form of the condensate component or a fragment thereof. In some embodiments, the drug-resistant cell is a cancer cell. The cancer may be any cancer disclosed herein, without limitation. In some embodiments, the drug-resistant cell is a breast cancer cell. In some embodiments, the condensate includes a detectable label. In some embodiments, the second agent includes a detectable label. In some embodiments, both the condensate and the second agent include detectable labels. The second agent is not limited and may be any agent disclosed herein. In some embodiments, the second agent is a small molecule. In some embodiments, the condensate is contacted with both a second drug and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable label. In some embodiments, the mutant condensate component is Mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof, which comprises an IDR and has a mutation. In some embodiments, the size or dissolution of the condensate is assessed compared to a control. In some embodiments, it is assessed whether a second drug counteracts the effects of drug resistance to the drug (e.g., whether contact with the second drug reduces the size of the condensate or removes the condensate).

[0138] High-throughput screening

[0139] In some embodiments, high-throughput screening (HTS) is performed to characterize multiple agents and / or multiple different condensates (e.g., two or more of super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates; or two or more in vitro condensate types including super-enhancer condensate components, splicing speckle condensate components, heterochromatin condensate components, nucleolus components, chromatin condensates, Polycomb condensates, or DNA damage repair condensates). High-throughput screening can utilize cell-free or cell-based assays (e.g., cells containing condensates as described herein, in vitro condensates). High-throughput screening often involves testing a large number of compounds with high efficiency, e.g., in parallel. For example, tens of thousands or hundreds of thousands of compounds can be routinely screened in a short period of time, e.g., hours to days. Such screening is often performed in multiwell plates containing at least 96 wells or other containers in which multiple physically separated depressions or recesses are present in the substrate. High-throughput screening often involves the use of automation, for example, liquid handling, imaging, data acquisition, and processing. Certain general principles and techniques that can be applied in HTS embodiments of the invention are described in Macarron R & Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565:1-32, 2009 and / or An WF & Tolliday NJ., Introduction: cell-based assays for high-throughput screening. Methods Mol Biol. 486:1-12, 2009, and / or references therein.Useful methods are also disclosed in High Throughput Screening: Methods and Protocols (Methods in Molecular Biology) by William P. Janzen (2002) and High-Throughput Screening in Drug Discovery (Methods and Principles in Medicinal Chemistry) by Jorg Huser (2006).

[0140] In some embodiments of the methods disclosed herein, a plurality of agents (e.g., 10, 50, 100, 1000, 10,000, 100,000, or more) are each contacted with the condensate, and the incorporation of the agents into the condensate is measured or determined. In some embodiments, the condensates contacted with the plurality of agents contain the same components. In some embodiments, at least a portion of the condensates contain different components.

[0141] In some embodiments of the methods disclosed herein, the agent is contacted with multiple compositions (sequentially or more preferably in parallel), each of which has a condensate with at least one different component. In some embodiments, each of the multiple compositions is contained in a separate container (e.g., a separate well of a multi-well plate).

[0142] In some embodiments, multiple different agents are contacted with the condensate, each having the same components. In some embodiments, the uptake of the multiple different agents is compared. In some embodiments, the different agents each comprise an incremental change, thereby allowing for the identification of important properties of the agent that modulate uptake into the condensate.

[0143] In some embodiments of the methods disclosed herein, the agent is contacted with a composition (e.g., a solution) containing multiple condensates having different components. In some embodiments, the condensates having different components are identified by different detectable tags. In some embodiments, the condensates contain nucleic acids. In some embodiments, the nucleic acids are DNA or RNA. In some embodiments, the nucleic acids contain detectable tags (e.g., fluorescent tags).

[0144] In some embodiments, the agent is contacted with the condensate for between 1 minute and 48 hours. In some embodiments, the agent is contacted with the condensate for about 1 minute, about 5 minutes, about 10 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 3 hours, about 5 hours, about 8 hours, about 10 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or longer. In some embodiments, the incorporation of the agent into the condensate is assessed over multiple time points as described herein, or is monitored continuously (e.g., the first 5 minutes, the first 10 minutes, or the first hour after contact for up to 48 hours or longer). As will be apparent to one of skill in the art, the incorporation of the agent and its effect on the condensate can include both rapid and prolonged phases.

[0145] Some aspects of the present invention are directed to methods of modulating partitioning of a first agent into a condensate, the method comprising coupling the first agent to a second agent, thereby modulating partitioning of the first agent into the condensate. In some embodiments, the condensate is a transcription condensate. In some embodiments, the condensate is selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates. The method of coupling the agent to the second agent is not limited and can be any suitable method disclosed in the art. In some embodiments, the first and second agents are coupled by a covalent bond. In some embodiments, the first and second agents are coupled by a non-covalent or ionic bond. In some embodiments, the first and second agents are coupled by a linker. In some embodiments, the first and second agents are conjugated to each other. In some embodiments, the first agent has therapeutic activity.

[0146] As used herein, the term "linker" refers to a chemical group or molecule that covalently links a first and a second agent. In some embodiments, the linker is positioned between or sandwiched between two groups, molecules, or moieties and covalently linked to each other, thereby linking the two agents. In some embodiments, the linker is an amino acid or multiple amino acids. In some embodiments, the linker is an organic molecule, group, or chemical moiety. In some embodiments, the linker comprises or consists of a polypeptide. In some embodiments, the linker may comprise or consist of one or more glycine residues, and in some embodiments, one or more serine and / or threonine residues. In some embodiments, the linker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 amino acids. In some embodiments, the linker comprises an oligoglycine sequence. Any suitable linker known in the art can be used, and is not limited thereto. For example, in some embodiments, when the first and second agents are proteins, the linker can be a polypeptide (e.g., a polypeptide linking the C-terminus of one agent to the N-terminus of the other agent).

[0147] In some embodiments, the partitioning (e.g., partition coefficient) of a first agent within the condensate increases upon coupling with a second agent. In some embodiments, the partition coefficient increases by at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to the uncoupled agent. As used herein, a partition coefficient or enrichment ratio is the ratio of the concentrations of a compound (e.g., an agent) inside the condensate of interest and outside the condensate of interest (e.g., the surrounding solution). In some embodiments, the partition coefficient of the uncoupled agent is less than about 5, less than about 2, about 1, less than about 1, less than about 0.5, or less than about 0.1. In some embodiments, the partition coefficient of the coupled first agent is greater than about 1, greater than about 1.5, greater than about 2, greater than about 3, greater than about 4, greater than about 5, greater than about 10, greater than about 20, greater than about 50, or greater than about 100. In some embodiments, the partition coefficient of the coupled agent is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more compared to the uncoupled agent. In some embodiments, the condensate comprises the therapeutic target of the first agent.

[0148] In some embodiments, the partitioning (e.g., partition coefficient) of the first agent within the condensate is reduced. In some embodiments, the partition coefficient is reduced by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to the uncoupled agent. In some embodiments, the partition coefficient is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the uncoupled agent. In some embodiments, the partition coefficient of the uncoupled agent is about 10 or greater, about 5 or greater, about 2 or greater, about 1 or greater, or about 0.5 or greater. In some embodiments, the partition coefficient of the coupled first agent is less than about 10, less than about 5, less than about 2, less than about 1, less than about 0.5, less than about 0.1, or less than about 0.01. In some embodiments, the condensate does not include the therapeutic target of the first agent.

[0149] In some embodiments, the uncoupled second agent preferentially partitions into the condensate of interest. In some embodiments, the uncoupled second agent has a partition coefficient of greater than 1, greater than about 1.5, greater than about 2, greater than about 3, greater than about 4, greater than about 5, greater than about 10, greater than about 20, greater than about 50, or greater than about 100. In some embodiments, the second agent has a partition coefficient for the condensate of interest that is at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 50-fold, at least 100-fold, or at least 400-fold higher than the first agent. In some embodiments, the second agent has a partition coefficient for the condensate of interest that is at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 50-fold, at least 100-fold, or at least 400-fold lower than the first agent. In some embodiments, the second agent is a small molecule with a high partition coefficient for the condensate of interest, ie, a partition coefficient of greater than 10, greater than 20, greater than 30, greater than 50, or greater than 100 for the condensate of interest.

[0150] In some embodiments, the uncoupled second agent is preferentially displaced from the condensate of interest. In some embodiments, the uncoupled second agent has a partition coefficient of less than 0.9, 0.8, 0.5, 0.1, 0.05, or 0.01. In some embodiments, the second agent is a small molecule with a low partition coefficient for the condensate of interest. In some embodiments, the second agent is a small molecule with a partition coefficient of less than 0.5, less than 0.1, less than 0.05, or less than 0.01 for the condensate of interest. The second agent used to concentrate the first agent bound to the second agent in or displace it from the condensate of interest can be a small molecule that is non-toxic to the subject to which it is administered, and in some embodiments, does not itself have significant biological activity. The second agent (e.g., a small molecule) may include one or more functional groups suitable for reacting with a second functional group for binding the agent of interest to modify the partitioning behavior of the agent of interest with respect to one or more condensates.

[0151] In some embodiments, the therapeutic effectiveness of the coupled first agent is increased compared to the uncoupled first agent. In some embodiments, the therapeutically effective amount of the coupled first agent is reduced by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to the uncoupled first agent. In some embodiments, the therapeutically effective amount of the coupled first agent is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the uncoupled first agent.

[0152] In some embodiments, one or more side effects of the coupled first agent are reduced (e.g., reduced in severity or duration or eliminated) compared to the uncoupled first agent, hi some embodiments, the coupled first agent has increased therapeutic efficacy and reduced side effects compared to the uncoupled agent.

[0153] Some aspects of the present disclosure are directed to methods for screening for candidate drugs with modulated condensate partitioning, comprising modifying a drug with a condensate partition coefficient and measuring the condensate partition coefficient of the modified drug; if the modified drug has a different partition coefficient than the original drug, the modified drug is identified as a candidate drug with modulated condensate partitioning. The modification can be by well-known chemical manipulations and modifications of pharmaceuticals. In some embodiments, the modification increases or decreases the solubility of the drug. In some embodiments, the modification modulates the electrostatic properties of the drug. In some embodiments, the modification is the coupling of a moiety or a second drug that preferentially partitions into a desired condensate. In some embodiments, the modification is the coupling of a moiety or a second drug that does not preferentially partition into one or more types of condensates (e.g., super-enhancer condensates, nucleoli, etc.).

[0154] In some embodiments, the condensate partition coefficient of the modified agent is measured in in vitro condensates. In some embodiments, the condensate partition coefficient of the modified agent is measured in intracellular condensates.

[0155] In some embodiments, a candidate agent is identified as an improved candidate agent if the candidate agent has increased partitioning into condensates containing the therapeutic target for the candidate agent. In some embodiments, a candidate agent is identified as an improved candidate agent if partitioning is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to the unmodified agent. In some embodiments, a candidate agent is identified as an improved candidate agent if partitioning is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more compared to the unmodified agent.

[0156] In some embodiments, a candidate agent is identified as an improved candidate agent if it has reduced partitioning into condensates that do not have a therapeutic target for the candidate agent, hi some embodiments, a candidate agent is identified as an improved candidate agent if partitioning is reduced by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100-fold compared to the unmodified agent. In some embodiments, a candidate agent is identified as an improved candidate agent if distribution is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more compared to the unmodified agent.

[0157] In some embodiments, a candidate agent is identified as an improved candidate agent if the amount of the candidate agent in the condensate of interest (e.g., total number of molecules of the candidate agent, concentration of the candidate agent) is modulated compared to the unmodified agent. In some embodiments, the amount of the candidate agent in the condensate of interest increases. In some embodiments, this increase corresponds to an increase in the partition coefficient into the condensate of interest. However, this increase may also be due to an increase in the availability of the candidate agent for incorporation into the condensate. For example, the candidate agent may have reduced partitioning into condensates that are not of interest, thereby enabling incorporation of the candidate agent into the condensate of interest. In some embodiments, the amount of the candidate agent in the condensate of interest decreases.

[0158] In some embodiments, modulating the partitioning of a first agent within a condensate (e.g., by modifying the first agent, e.g., by coupling the first agent to a second agent, thereby creating a candidate agent) results in an increase in the concentration of the modified or coupled first agent within the condensate compared to the concentration of the unmodified / uncoupled first agent present within the condensate. In some embodiments, modifying or coupling the first agent increases the partition coefficient of the first agent within the condensate. In some embodiments, modifying or coupling the first agent reduces the partitioning of the first agent into a different condensate (e.g., a condensate not of interest) in which the first agent would otherwise be enriched. In some embodiments, modifying or coupling the first agent decreases the partition coefficient of the first agent within the condensate. In some embodiments, modifying or coupling the first agent increases the partitioning of the first agent into a different condensate (e.g., a condensate not of interest) in which the first agent would otherwise be enriched.

[0159] In some embodiments, the candidate agent with modulated condensate distribution is a chemotherapeutic agent.

[0160] Some aspects of the present invention are directed to compositions comprising cells having a first condensate comprising a first detectable label and a second condensate comprising a different second detectable label. In some embodiments, the first and second condensates are different condensate types selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates. In some embodiments, at least one of the condensates is a transcription condensate. In some embodiments, the composition further comprises an agent in contact with the cells. In some embodiments, the agent is a known therapeutic agent. In some embodiments, the agent is a candidate therapeutic agent.

[0161] Some aspects of the present invention are directed to a composition comprising a first in vitro condensate, a second in vitro condensate, and an agent in contact with the first and second in vitro condensates. In some embodiments, the first and second in vitro condensates are isolated from each other. In some embodiments, at least one of the first in vitro condensate, the second in vitro condensate, and the agent comprises a detectable label. In some embodiments, the composition further comprises a third in vitro condensate and optionally a fourth in vitro condensate, each in contact with the agent. In some embodiments, at least one of the in vitro condensates comprises a component of a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate. In some embodiments, disclosed herein are multi-well plates (e.g., 96-well plates) having a first in vitro condensate in contact with a drug and a second in vitro condensate in contact with the same drug, wherein the first and second in vitro condensates each comprise different components, and the first and second in vitro condensates are present in different wells of the multi-well plate.

[0162] Some embodiments are directed to an article comprising a first in vitro condensate contacted with a drug, a second in vitro condensate contacted with the same drug, and a multiwell plate separating the first and second in vitro condensates into separate wells. In some embodiments, the article further comprises at least a third in vitro condensate contacted with the drug. In some embodiments, the article further comprises at least a fourth in vitro condensate contacted with the drug. The first, second, third, and fourth in vitro condensates may each comprise components of a different condensate (e.g., super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleoli, chromatin condensates, Polycomb condensates, or DNA damage repair condensates). The first, second, third, and fourth in vitro condensates may each comprise a different detectable label.

[0163] In some embodiments, an agent disclosed herein is contacted with the condensate at a total concentration of about 1 nM to 500 μM. For example, the agent can be added to a solution containing the condensate to achieve a total concentration in the solution of about 1 nM to 500 μM. In some embodiments, the agent is contacted with the condensate at a total concentration of 10 nM to 100 nM, 10 nM to 1 μM, 1 μM to 10 μM, 10 μM to 100 μM, or 100 μM to 500 μM. In some embodiments, the agent is added to a composition (e.g., a solution) containing the condensate to achieve a total concentration of about 1 nM to 500 μM. In some embodiments, the agent is added to a composition containing the condensate to achieve a total concentration of 10 nM to 100 nM, 10 nM to 1 μM, 1 μM to 10 μM, 10 μM to 100 μM, or 100 μM to 500 μM.

[0164] In some embodiments, the condensate is present within a cell. The type of cell is not limited. In some embodiments, the cell is a mammalian cell, e.g., a human or mouse cell. In some embodiments, the cell is a somatic cell. In some embodiments, the cell is a pluripotent stem cell. In some embodiments, the cell is a germ cell, stem cell, or zygote. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a diseased cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is a leukocyte or fibroblast. In some embodiments, the cell is a cell isolated from an embryo.

[0165] In some embodiments, the cells are cells isolated from a patient with a disease, disorder, or condition. In some embodiments, the cells are derived from cells of a patient with a disease, disorder, or condition. In some embodiments, the cells are differentiated cells of induced pluripotent stem cells derived from cells of a patient with a disease, disorder, or condition. In some embodiments, the cells are induced pluripotent stem cells derived from cells of a patient with a disease, disorder, or condition. In some embodiments, the cells are genetically modified cells that express one or more condensate components with detectable labels. In some embodiments, the genetically modified cells express at least two different condensate components with different detectable labels and / or labels that are detectably distinguishable from one another. In some embodiments, the genetically modified cells express at least three different condensate components with different detectable labels and / or labels that are detectably distinguishable from one another. In some embodiments, the genetically modified cells express at least four different condensate components with different detectable labels and / or labels that are detectably distinguishable from one another. In some embodiments, each type of labeled condensate component is a component of a different condensate (e.g., a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate). In some embodiments, the genetically modified cells express labeled super-enhancer components and labeled nucleolar components. In some embodiments, the labels of the different condensate components are detectably distinguishable from one another.

[0166] The terms "disease," "disorder," or "condition" are used interchangeably and may refer to any alteration in the health and / or normal function of an organism, e.g., a physical or mental abnormality, that results in pain, discomfort, impairment, suffering, degeneration, or death in an affected individual. Diseases include any disease known to those of skill in the art. In some embodiments, a disease is chronic, e.g., it typically persists or has persisted for at least 3-6 months or longer, e.g., 1, 2, 3, 5, 10 years or longer, or indefinitely. A disease may have a characteristic set of symptoms and / or signs that commonly occur in individuals suffering from the disease. Diseases and their diagnosis and treatment methods are described in standard medical textbooks, such as Longo, D., et al. (eds.), Harrison's Principles of Internal Medicine, 18th Edition; McGraw-Hill Professional, 2011, and / or Goldman's Cecil Medicine, Saunders; 24th edition (August 5, 2011). In certain embodiments, the disease is a multigenic disorder (also called a complex disorder, multifactorial disorder, or polygenic disorder). Such diseases may be associated with the effects of multiple genes, possibly combined with environmental factors (e.g., exposure to certain physical or chemical or biological agents, e.g., viruses, lifestyle factors, e.g., diet, smoking, etc.). A multigenic disorder can be any disease in which multiple genes (e.g., particular alleles of such genes, particular polymorphisms in such genes) are known or suspected to contribute to the risk of developing the disease and / or to the manner in which the disease manifests (e.g., its severity, age of onset, rate of progression, etc.). In some embodiments, a multigenic disease is a disease that has a genetic component, as indicated by familial clustering (occurring more commonly in certain families than in the general population), but does not follow Mendelian laws of inheritance (e.g., the disease does not clearly follow dominant, recessive, X-linked, or Y-linked inheritance patterns).In some embodiments, multigenic diseases are those that are not typically controlled by a constraining variant of a single gene (as in Mendelian diseases). In some embodiments, multigenic diseases can be familial and sporadically occurring. Examples include, for example, Parkinson's disease, Alzheimer's disease, and various types of cancer. Examples of multigenic diseases include many common diseases, such as hypertension, diabetes (e.g., type 2 diabetes), cardiovascular disease, cancer, and stroke (ischemic, hemorrhagic). In some embodiments, the disease, e.g., multigenic disease, is a psychiatric disease, a neurological disease, a neurodevelopmental disease, a neurodegenerative disease, a cardiovascular disease, an autoimmune disease, a cancer, a metabolic disease, or a respiratory disease. In some embodiments, at least one gene is implicated in a familial multigenic disease.

[0167] In some embodiments, the disease is cancer, a term generally used interchangeably to refer to a disease characterized by one or more tumors, e.g., one or more malignant or potentially malignant tumors. As used herein, the term "tumor" encompasses abnormal growth, including abnormal cell proliferation. As known in the art, tumors are typically characterized by excessive cell proliferation that is not properly controlled (e.g., does not respond normally to physiological influences and signals that normally limit growth) and may exhibit one or more of the following characteristics: dysplasia (e.g., lack of normal cell differentiation, resulting in an increased number or proportion of immature cells); anaplasia (e.g., greater loss of differentiation, significant loss of structural organization, cellular pleomorphism, abnormalities such as large hyperchromatic nuclei, high nuclear-cytoplasmic ratios, atypical mitoses, etc.); invasion of adjacent tissues (e.g., breaching the basement membrane); and / or metastasis. Malignant tumors have a tendency to grow continuously and the ability to spread, e.g., to invade locally and / or metastasize locally and / or to distant sites, whereas benign tumors often remain localized to the site of origin and are often self-limiting in terms of growth. The term "tumor" includes malignant solid tumors, such as carcinomas (cancers arising from epithelial cells), sarcomas (cancers arising from cells of mesenchymal origin), and malignant tumors (e.g., certain hematologic malignancies) that may not present a detectable solid tumor mass.Cancers include, but are not limited to, breast cancer; biliary tract cancer; bladder cancer; brain cancer (e.g., glioblastoma, medulloblastoma); cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; hematological malignancies including acute lymphocytic leukemia and acute myeloid leukemia; T-cell acute lymphoblastic leukemia / lymphoma; hairy cell leukemia; chronic lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma; adult T-cell leukemia / lymphoma; intraepithelial neoplasia including Bowen's disease and Paget's disease; liver cancer; lung cancer; lymphomas including Hodgkin's disease and lymphocytic lymphoma; neuroblastoma; melanoma, These include oral cancer, including squamous cell carcinoma; ovarian cancer, including ovarian cancer arising from epithelial cells, stromal cells, germ cells, and mesenchymal cells; neuroblastoma; pancreatic cancer; prostate cancer; rectal cancer; sarcoma, including angiosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma, and osteosarcoma; kidney cancer, including renal cell carcinoma and Wilms' tumor; skin cancer, including basal cell carcinoma and squamous cell carcinoma; germ cell tumors, such as testicular cancer, including seminoma, non-seminoma (teratoma, choriocarcinoma), stromal tumor, and germ cell tumor; and thyroid cancer, including thyroid adenocarcinoma and medullary carcinoma. It will be understood that various different types of tumors can arise in a particular organ, and these may differ, for example, in terms of clinical and / or pathological features and / or molecular markers. Tumors arising in various different organs are classified, for example, according to the WHO Classification of Tumors series, 4. th ed or 3 rded (Pathology and Genetics of Tumors series), the International Agency for Research on Cancer (IARC), WHO Press, Geneva, Switzerland, all volumes of which are incorporated herein by reference. In some embodiments, the cancer is one in which mutation or overexpression of a particular gene is known or suspected to play a role in the onset, progression, recurrence, etc. of the cancer. In some embodiments, such genes are targets for genetic modification by the methods described herein. In some embodiments, the gene is an oncogene, proto-oncogene, or tumor suppressor gene. The term "oncogene" encompasses nucleic acids that, when expressed, can increase the likelihood of or contribute to the development or progression of cancer. Normal cellular sequences ("proto-oncogenes") can be activated to become oncogenes (sometimes termed "activated oncogenes") through mutation and / or aberrant expression. In various embodiments, the oncogene can include the complete coding sequence of the gene product, or a portion that retains at least part of the oncogenic potential of the complete sequence, or a sequence that encodes a fusion protein. Oncogenic mutations can result, for example, in altered (e.g., increased) protein activity, loss of proper regulation, or altered (e.g., increased) RA or protein levels. Abnormal expression can occur, for example, due to chromosomal rearrangements, epigenetic mechanisms, or amplification that result in juxtaposition with regulatory elements such as enhancers, resulting in increased amounts of proto-oncogene products or their production in inappropriate cell types. Proto-oncogenes often encode proteins that control or are involved in cell proliferation, differentiation, and / or apoptosis. These proteins include, for example, various transcription factors, chromatin remodelers, growth factors, growth factor receptors, signal transducers, and apoptosis regulators. A TSG can be any gene whose loss or reduction in function of its expression product can increase the likelihood of or contribute to the development or progression of cancer. Loss or reduction in function can occur, for example, due to mutations or epigenetic mechanisms.Many TSGs typically encode proteins that function to inhibit or negatively regulate cell proliferation and / or promote apoptosis. Exemplary oncogenes of interest for the methods disclosed herein include, for example, MYC, SRC, FOS, JUN, MYB, RAS, RAF, ABL, ALK, AKT, TRK, BCL2, WNT, HER2 / NEU, EGFR, MAPK, ERK, MDM2, CDK4, GLI1, GLI2, IGF2, TP53, and the like. Exemplary TSGs include, for example, RB, TP53, APC, NF1, BRCA1, BRCA2, PTEN, CDK inhibitor proteins (e.g., p16, p21), PTCH, WT1, and the like. It will be understood that the names of many of these oncogenes and TSGs encompass multiple family members, and many other TSGs are known. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is ER+ breast cancer. In some embodiments, the breast cancer is resistant to tamoxifen and comprises an ER mutation, hi some embodiments, the breast cancer is resistant to tamoxifen and overexpresses a condensate component.

[0168] In some embodiments, the disease is a cardiovascular disease, eg, atherosclerotic heart or vascular disease, congestive heart failure, myocardial infarction, cerebrovascular disease, peripheral arterial disease, or cardiomyopathy.

[0169] In some embodiments, the disease is a psychiatric, neurological, or neurodevelopmental disease, such as schizophrenia, depression, bipolar disorder, epilepsy, autism, or addiction. Neurodegenerative diseases include, for example, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and frontotemporal dementia.

[0170] In some embodiments, the disease is an autoimmune disease, such as acute disseminated encephalomyelitis, alopecia areata, antiphospholipid syndrome, autoimmune hepatitis, autoimmune myocarditis, autoimmune pancreatitis, autoimmune polyglandular syndrome, autoimmune uveitis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), type 1 diabetes (e.g., juvenile diabetes), multiple sclerosis, scleroderma, ankylosing spondylitis, sarcoidosis, pemphigus vulgaris, pemphigoid, psoriasis, myasthenia gravis, systemic lupus erythematosus, rheumatoid arthritis, juvenile onset arthritis, psoriatic arthritis, These include: inflammatory bowel disease, Behcet's syndrome, Reiter's disease, Berger's disease, dermatomyositis, polymyositis, antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatosis with polyangiitis (also known as Wegener's granulomatosis), microscopic polyangiitis, and Churg-Strauss syndrome), scleroderma, Sjögren's syndrome, antiglomerular basement membrane disease (including Goodpasture's syndrome), dilated cardiomyopathy, primary biliary cirrhosis, thyroiditis (e.g., Hashimoto's thyroiditis, Graves' disease), transverse myelitis, and Guillain-Barré syndrome.

[0171] In some embodiments, the disease is a respiratory disease, such as allergies, asthma, chronic obstructive pulmonary disease, pulmonary hypertension, pulmonary fibrosis, and sarcoidosis, which affect the respiratory system.

[0172] In some embodiments, the disease is a kidney disease, such as polycystic kidney disease, lupus, kidney disorders (nephrotic or nephritic), or glomerulonephritis (of any type).

[0173] In some embodiments, the condition is, for example, age-related vision loss or hearing loss.

[0174] In some embodiments, the disease is an infectious disease, for example, any disease caused by a virus, bacteria, fungus, or parasite.

[0175] In some embodiments, diseases exhibit hypermethylation (e.g., aberrant hypermethylation) or demethylation (e.g., aberrant demethylation) in genomic sequences. For example, fragile X syndrome exhibits hypermethylation of FMR-1. In some embodiments, the methods described herein can be used to treat or prevent diseases or disorders exhibiting aberrant methylation (e.g., hypermethylation or demethylation). In some embodiments, the agents disclosed herein preferentially integrate with condensates associated with aberrant methylation. For example, condensates (e.g., transcription condensates) can occur in regions associated with aberrant methylation sites or hypomethylated sites that cause aberrant gene transcription. In some embodiments, the agents described herein preferentially incorporate into such condensates and regulate (e.g., reduce) aberrant gene transcription. In some embodiments, the unmethylated or hypomethylated sites are associated with cancer genes. In other embodiments, condensates (e.g., splicing speckle condensates, heterochromatin condensates) can occur in regions associated with aberrant hypermethylation that causes aberrant gene transcription. In some embodiments, the agents described herein preferentially incorporate into such condensates and modulate aberrant gene transcription.

[0176] It will be understood that the classification of diseases herein is not intended to be limiting, and those skilled in the art will understand that various diseases may be properly classified into several different groups.

[0177] In some embodiments, the method further includes characterizing the incorporation (e.g., enrichment ratio) of multiple agents (e.g., potential drug candidates, potential drug candidates from families with different structural features) into condensates, e.g., for lead optimization, in vivo toxicity or efficacy testing, or Phase I clinical trials. In some embodiments, the method includes characterizing the drug candidates relative to the condensate or a group of condensates and selecting candidates that (1) are not undesirably sequestered in condensate(s) that are not sites where the target is expected to reside or be active, or (2) are enriched in, or at least not displaced from, condensate(s) that are sites where the target is expected to reside or be active. When optimizing lead compounds and selecting from a large number of different optimized candidates, this method can help avoid selecting candidates that have a stronger tendency than other candidates to be enriched in condensates that do not contain the target (or select candidates that have a stronger tendency than other candidates to be enriched in condensates that contain the target).

[0178] Some aspects of the present invention relate to methods for characterizing a first agent, the method comprising contacting the first agent with a composition comprising a condensate having at least one component, the condensate containing at least a second agent, and measuring the ability of the first agent to cause the removal of the second agent from the condensate. Such methods can be useful, for example, for identifying an agent (first agent) that releases a second agent from the condensate. Release of the agent from the condensate can enhance the therapeutic activity of the agent, for example, if the therapeutic target of the second agent is not present in the condensate. Furthermore, such methods can be useful for identifying a first agent that has a higher affinity for a target in the condensate than the second agent.

[0179] In some embodiments, measuring the ability of the first agent to cause the removal of the second agent from the condensate includes measuring the loss of the second agent from the condensate (e.g., by measuring a change in the amount, concentration, or ratio of the second agent inside or outside the condensate). The measurement can be performed by any method described herein (e.g., by the natural fluorescence or color of the second agent, Raman spectroscopy, NMR, mass spectrometry, chromatography, etc.). In some embodiments, the second agent has a detectable tag. In some embodiments, the second agent is measured by a detectable tag.

[0180] The first and second agents are not limited and can be any of the agents described herein. The condensate component is also not limited and can be any of the condensate components described herein. In some embodiments, the condensate component is a transcriptional condensate component. In some embodiments, the condensate component is present within a cell. The cell is not limited and can be any of the cells described herein. In some embodiments, the condensate is an in vitro condensate.

[0181] In some embodiments, the condensate component is a target for a second agent (e.g., the second agent specifically binds to the condensate component), and in some embodiments, the first agent displaces the second agent from its target (e.g., displaces the second agent from the condensate).

[0182] Some aspects of the present disclosure relate to compositions comprising a condensate and an agent having a therapeutic target, wherein the condensate does not contain, or preferentially does not contain, the therapeutic target. In some embodiments, the condensate comprises a detectable tag (e.g., the condensate comprises a component having a detectable tag). In some embodiments, the agent has a detectable tag. In some embodiments, the agent and the condensate have detectable tags (e.g., different detectable tags).

[0183] Disruption of cancer genes

[0184] The present inventors demonstrated for the first time herein the presence of condensates containing MED1 and ER at Myc RNA transcription sites in primary breast cancer cells. See, e.g., Figure 7. The presence of MED1 in Myc RNA transcription site condensates has also been confirmed in colon cancer, Burkitt's lymphoma, multiple myeloma, prostate cancer, and breast cancer cell lines. See, e.g., Figures 8-9. Other condensate components, including topoisomerases, proteosomes, CDK6, CDK7, p300, and BRD4, were also found in Myc RNA transcription site condensates. See, e.g., Figure 11. Using colon cancer cell lines and GFP-tagged MED1, BRD4, or POL2, we demonstrate that various inhibitors, intercalators, and cyclin-dependent kinase inhibitors dissolve Myc RNA transcription site condensates, cause genome release from condensates, or selectively remove components from condensates. See, e.g., Figures 14 and 16-19. Finally, it is shown herein that in the presence of tamoxifen, ER is not incorporated into the concentrates, and that the drug, which dissolves the concentrates, enriches in the concentrates before dissolving them. See Figures 20, 22, and 24.

[0185] Accordingly, some aspects of the invention relate to methods for reducing transcription of an oncogene, comprising modulating the composition of a transcription condensate associated with the oncogene, dissolving the transcription condensate, or dissociating the transcription condensate. In some embodiments, the transcription condensate is modulated by contacting the transcription condensate with an agent that dissolves the transcription condensate, dissociates the transcription condensate from genomic DNA containing the oncogene, or eliminates one or more components of the transcription condensate.

[0186] The agent is not limited and may be any agent described herein. In some embodiments, the agent is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of a transcription condensate. In some embodiments, the component is BRD4, p300, CDK7, CDK6, a proteosome, a topoisomerase, a transcription factor (e.g., a nuclear receptor, an estrogen receptor), a mediator, a mediator component, or an enhancer. In some embodiments, the agent binds to a component of a transcription condensate and dissolves the transcription condensate, severs the transcription condensate from genomic DNA containing the oncogene, or eliminates one or more components of the transcription condensate (e.g., eliminates the component bound by the agent or a component that is a binding partner of the component bound by the agent).

[0187] In some embodiments, the agent preferentially dissolves transcription condensates, separates transcription condensates from genomic DNA containing oncogenes, or, if the condensate contains one or more specific condensate components, eliminates one or more components of the transcription condensate. The components can be any of the components described herein, without limitation. In some embodiments, the components are BRD4, p300, CDK7, CDK6, proteosome, topoisomerase, transcription factor (e.g., nuclear receptor, estrogen receptor), mediator, mediator component, or enhancer.

[0188] In some embodiments, the condensate is an in vitro condensate as described herein. In some embodiments, the condensate may be present within a cell. The cell is not limited and may be any cell described herein. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is a colon cancer cell, a lymphoma cell, a multiple myeloma cell, a prostate cancer cell, or a breast cancer cell.

[0189] In some embodiments, the cells are present in a subject. In some embodiments, the subject is a mammal (e.g., a human, a non-human primate, a rodent, a dog, a cat, a cow). In some embodiments, the subject is a human with cancer. The cancer is not limited and can be any cancer described herein. In some embodiments, the cancer has dysregulated Myc gene expression. In some embodiments, the agent reduces transcription of the MYC oncogene in cancer cells of the subject by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more. In some embodiments, the cancer has dysregulation of an oncogene selected from SRC, FOS, JUN, MYB, RAS, ABL, HOXI1, HOXI1 1L2, TAL1 / SCL, LMO1, LMO2, EGFR, MYCN, MDM2, CDK4, GLI1, IGF2, activated EGFR, mutated genes such as FLT3-ITD, mutated forms of TP53, PAX3, PAX7, BCR / ABL, HER2 / NEU, FLT3R, FLT6-ITD, SRC, ABL, TAN1, PTC, B-RAF, PML-RAR-α, E2A-PRX1, and NPM-ALK, and fusions of members of the PAX and FKHR gene families. In some embodiments, the agent reduces transcription of the oncogene in cancer cells of the subject by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more.

[0190] In some embodiments, a drug is administered to a subject with cancer, thereby treating the cancer.As used herein, "treatment" encompasses any treatment of a disease or condition (e.g., cancer) in a mammal, particularly a human, and includes: (a) preventing the onset of symptoms of the disease or condition (e.g., cancer) in a subject who may be predisposed to the disease or condition but has not yet begun to experience symptoms; (b) suppressing the disease or condition (e.g., suppressing its onset); or (c) alleviating the disease or condition (e.g., causing regression of the disease or condition, improving one or more symptoms).The method of administration is not limited and can be any suitable method of administration.

[0191] The agent may be administered in a pharmaceutically acceptable solution, which may normally contain pharmaceutically acceptable concentrations of salts, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.

[0192] The agents may be formulated into solid, semi-solid, liquid, or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, inhalants, and injections, as well as preparations in the usual manner for oral administration, parenteral administration, or surgical procedures. The present invention also encompasses pharmaceutical compositions formulated for topical administration (e.g., by implantation).

[0193] Compositions suitable for oral administration may be presented as discrete units such as capsules, tablets, lozenges, each containing a predetermined amount of the active agent. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrups, elixirs, or emulsions.

[0194] In some embodiments, the agent may be administered directly to the tissue. Direct administration to the tissue may be achieved by direct injection. The agent may be administered once, or alternatively, they may be administered in multiple doses. When administered multiple times, the peptide may be administered by different routes. For example, the first (or first few) doses may be administered directly to the affected tissue, while subsequent doses may be systemic.

[0195] For oral administration, compositions can be easily formulated by mixing the agent with pharmaceutically acceptable carriers well known in the art. Such carriers allow the agent to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral ingestion by the subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipients. The resulting mixture can be optionally milled, and the granular mixture can be processed, if necessary, after adding suitable adjuvants, to obtain tablets or dragee cores. Suitable excipients are sugars, particularly fillers, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Optionally, the oral preparations may be formulated in saline or buffer solutions to neutralize internal acidic conditions, or may be administered without any carrier.

[0196] The dragee cores are provided with a suitable coating. For this purpose, concentrated sugar solutions can be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and / or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyes or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0197] Orally usable pharmaceutical preparations include push-fit capsules made of gelatin and soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules contain the active ingredient mixed with a filler, such as lactose, a binder, such as starch, and / or a lubricant, such as talc or magnesium stearate, and optionally, stabilizers. In soft capsules, the active compound may be dissolved or suspended in a suitable liquid, such as fatty oils, liquid paraffin, or liquid polyethylene glycol. Additionally, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been extensively described in the art. All formulations for oral administration should be in dosages suitable for such administration. For buccal administration, the composition may take the form of tablets or lozenges formulated in conventional manner.

[0198] When it is desirable to deliver the compounds systemically, they can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for injection can be provided in unit dosage form, for example, in ampoules or multi-dose containers with added preservatives. The compositions can take the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing, and / or dispersing agents.

[0199] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., those based on Ringer's dextrose), and the like. Preservatives and other additives, such as antibacterial agents, antioxidants, chelating agents, and inert gases, may also be present. If the subject does not respond adequately to the initial dose administered, higher doses (or more localized doses with a different, more effective delivery route) may be used, as tolerated by the patient. In some embodiments, multiple administrations per day are considered to achieve adequate systemic concentration of the compound.In some embodiments, the method further comprises administering to the subject an effective amount of at least one chemotherapeutic agent.The chemotherapeutic agent is not limited and can be any suitable chemotherapeutic agent known in the art.

[0200] Some aspects of the invention relate to methods of treating a subject in need of treatment for a cancer characterized by transcription of an oncogene, comprising administering to the subject an agent that modulates the composition of transcription condensates associated with the oncogene, or that dissolves or dissociates the transcription condensates.

[0201] The agent is not limited and can be any agent described herein. In some embodiments, the agent is a small molecule, polypeptide, or nucleic acid. In some embodiments, the agent is an agent that has been shown to be preferentially sequestered within transcription condensates associated with oncogenes or to have a component of transcription condensates associated with oncogenes. In some embodiments, the agent is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of a transcription condensate. The component is not limited and can be any transcription condensate component described herein (e.g., the mediator component, MED1). In some embodiments, the agent preferentially concentrates within a transcription condensate.

[0202] The cancer is not limited and can be any cancer described herein. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.

[0203] The subject is not limited and can be any subject described herein. In some embodiments, the subject is a human.

[0204] The agent may be present in a composition. The composition is not limited and may be any of the compositions described herein. The method of administering the agent is also not limited and may be any of the methods described herein. In some embodiments, the agent is administered orally, subcutaneously, topically, or intravenously.

[0205] Inhibition of nuclear receptor-mediated transcription

[0206] Some aspects of the present invention are directed to methods for inhibiting transcription associated with a transcription condensate, the methods comprising inhibiting binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain by contacting the condensate with a peptide that binds to the LXXLL-binding domain of the nuclear receptor.

[0207] The nuclear receptor is not limited as long as it can bind to a cofactor having an LXXLL domain, at least when bound to its ligand. In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or a retinoic acid receptor α. The cofactor is not limited as long as it has an LXXLL domain. Cofactors having an LXXLL motif are known in the art. In some embodiments, the cofactor is MED1.

[0208] In some embodiments, binding of the nuclear receptor to the cofactor is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9% or more compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription associated with the transcription condensate is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription of an oncogene is inhibited. The oncogene is not limited and can be any oncogene described herein. In some embodiments, the oncogene is Myc.

[0209] In some embodiments, the transcription condensate is an in vitro transcription condensate. In some embodiments, the transcription condensate is present within a cell. The cell is not limited to, and may be any cell described herein. In some embodiments, the cell is a cancer cell. The cancer is not limited to, and may be any cancer described herein. In some embodiments, the methods disclosed herein can be used to treat a disease or condition associated with abnormal activity or expression of a nuclear receptor. The disease or condition can be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.

[0210] The peptide is not limited as long as it binds to the LXXLL-binding domain. In some embodiments, the peptide comprises, consists of, or consists essentially of the peptide sequence QNPILTSLLQITG (SEQ ID NO: 1). In some embodiments, the peptide comprises, consists of, or consists essentially of acidic residues (e.g., polyglutamic acid) or basic residues (e.g., polylysine).

[0211] In some embodiments, the peptide comprises a protein transduction domain (PTD). The PTD is not limited and can be any PTD described herein. In some embodiments, the PTD is HIV-TAT.

[0212] In some embodiments, the peptide is administered to a subject to treat a disease or condition associated with abnormal activity or expression of a nuclear receptor. The disease or condition may be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The administration method is not limited and may be any of the administration methods for drugs as described herein. In some embodiments, the peptide is administered as a composition. The composition is not limited and may be any of the compositions described herein for administering drugs.

[0213] Some aspects of the present invention are directed to methods for inhibiting transcription associated with a transcription condensate, comprising inhibiting binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain, wherein binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain of the cofactor.

[0214] In some embodiments, binding of the nuclear receptor to the cofactor is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9% or more compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription associated with the transcription condensate is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription of an oncogene is inhibited. The oncogene is not limited and can be any oncogene described herein. In some embodiments, the oncogene is Myc.

[0215] In some embodiments, the transcription condensate is an in vitro transcription condensate. In some embodiments, the transcription condensate is present within a cell. The cell is not limited to, and may be any cell described herein. In some embodiments, the cell is a cancer cell. The cancer is not limited to, and may be any cancer described herein. In some embodiments, the methods disclosed herein can be used to treat a disease or condition associated with abnormal activity or expression of a nuclear receptor. The disease or condition can be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.

[0216] The peptide is not limited as long as it binds to the LXXLL domain. In some embodiments, the peptide comprises a protein transduction domain (PTD). The PTD is not limited and can be any PTD described herein. In some embodiments, the PTD is HIV-TAT.

[0217] In some embodiments, the peptide is administered to a subject to treat a disease or condition associated with abnormal activity or expression of a nuclear receptor. The disease or condition may be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The administration method is not limited and may be any of the administration methods for drugs as described herein. In some embodiments, the peptide is administered as a composition. The composition is not limited and may be any of the compositions described herein for administering drugs.

[0218] Inhibition of transcription associated with overexpression of condensate components

[0219] As shown in the Examples below, tamoxifen-resistant ER+ breast cancer cell lines that overexpress MED1 contain MED1-containing condensates with a larger volume than MED1-containing condensates in breast cancer cells that do not overexpress MED1. The Examples further show that when tamoxifen is contacted with MED1 in vitro condensates (e.g., droplets) that have a four-fold increase in MED1 levels, the condensates have a much lower concentration of tamoxifen.

[0220] Accordingly, some aspects of the present invention are directed to methods of suppressing the growth or proliferation of cancer cells that overexpress a condensate component (e.g., MED1) and exhibit resistance to an anti-cancer drug (e.g., tamoxifen). In some embodiments, the method involves inhibiting the expression or condensate-forming activity of a condensate component. In some embodiments, the method involves contacting a condensate with a modified condensate component that increases partitioning of the anti-cancer drug into the condensate. For example, in some embodiments, the condensate component can be modified to increase the content of aromatic side chains, thereby increasing the affinity of the condensate containing the modified component for drugs with aromatic side chains. In some embodiments, a condensate having an increased level of condensate component can be contacted with an anti-cancer drug and a drug that has affinity for the condensate, thereby increasing the concentration of the anti-cancer drug in the condensate. In some embodiments, the anti-cancer drug can be modified to increase its partitioning into the condensate. For example, in some embodiments, an anti-cancer drug (e.g., tamoxifen) can be modified to increase the number of aromatic side chains, thereby increasing its partitioning into condensates containing condensate components with aromatic side chains.

[0221] Another aspect of the invention involves determining whether cancers that overexpress a gene and exhibit resistance to an anticancer drug contain condensates that are greater than corresponding condensates in cancers that do not overexpress the gene. In some embodiments, the overexpressed gene is associated with resistance to the anticancer drug. In some embodiments, the concentration of the anticancer drug in the increased condensates from the resistant cancer is compared to the concentration of the anticancer drug in non-resistant cancers that do not overexpress the gene.

[0222] Some embodiments further include providing an in vitro condensate (e.g., droplet) containing an expanded condensate or an overexpressed gene product from the resistant cancer. In some embodiments, the expanded condensate or in vitro condensate is contacted with one or more modified anticancer drugs, and the concentration of the modified anticancer drugs in the contacted condensate is determined. In some embodiments, a library of modified anticancer drugs is contacted with the condensate, and the concentration of the modified anticancer drugs is determined to screen for modified anticancer drugs that are effective against the resistant cancer.

[0223] *** The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of and examples for the present disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the present disclosure, as will be understood by those skilled in the relevant art. For example, while method steps or functions are shown in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the present disclosure provided herein may be applied to other procedures or methods as appropriate. The various embodiments described herein may be combined to provide further embodiments. Aspects of the present disclosure may be modified, as appropriate, to employ the compositions, functions, and concepts of the above references and applications to provide still other embodiments of the present disclosure. These and other changes may be made to the present disclosure in light of the Detailed Description.

[0224] Particular elements of any of the foregoing embodiments may be combined with or substituted for elements of other embodiments. Furthermore, although advantages associated with particular embodiments of the present disclosure are described in the context of those embodiments, other embodiments may also exhibit such advantages, and not necessarily all embodiments need exhibit such advantages to fall within the scope of the present disclosure.

[0225] All patents and other publications identified are expressly incorporated herein by reference to describe and disclose, for example, methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or prior publication or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the accuracy of the dates or contents of these documents.

[0226] Those skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages described, as well as those inherent therein. The details of the description and examples herein represent particular embodiments and are exemplary and are not intended to limit the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention. It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.

[0227] As used herein, the articles "a" and "an" should be understood to include plural references in the specification and claims unless clearly stipulated to the contrary. A claim or description including "or" between one or more members of a group is deemed to apply when one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless stipulated to the contrary or otherwise clear from the context. The invention includes embodiments in which exactly one member of a group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all, of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, unless expressly stated otherwise or unless it is apparent to one of ordinary skill in the art that a contradiction or inconsistency would arise, it should be understood that the invention provides all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive language, etc. from one or more of the enumerated claims as introduced in another claim (or any other related claim) dependent on the same base claim. It is intended that all embodiments described herein may be applied to all different aspects of the invention, as appropriate. It is also intended that any of the embodiments or aspects may be freely combined with one or more other such embodiments or aspects, as appropriate. When elements are presented in a list, for example, in Markush group format or a similar format, it is understood that each subgroup of elements is also disclosed, and that any element(s) may be removed from the group. Generally, when the invention or aspects of the invention are described as including certain elements, features, etc., it should be understood that certain embodiments of the invention or aspects of the invention consist of, or consist essentially of, such elements, features, etc. For the sake of brevity, those embodiments may not be specifically described in these terms herein. It should also be understood that any embodiment or aspect of the invention may be explicitly excluded from the claims, regardless of whether a specific exclusion is described herein.For example, any one or more active agents, additives, ingredients, any drug, organism, disorder, subject, or combinations thereof may be excluded.

[0228] Where a claim or description is directed to a composition, it should be understood that methods of making or using the composition in accordance with any of the methods disclosed herein, and methods of using the composition for any of the purposes disclosed herein, are aspects of the invention, unless otherwise stated or it would be obvious to one of ordinary skill in the art that a contradiction or inconsistency would occur. Where a claim or description is directed to a method, it should be understood that, for example, methods of making compositions useful for carrying out the method, and products produced by the method, are aspects of the invention, unless otherwise stated or it would be obvious to one of ordinary skill in the art that a contradiction or inconsistency would occur.

[0229] When ranges are given herein, the invention includes embodiments in which the endpoints are included, embodiments in which the endpoints are excluded, and embodiments in which one endpoint is included and the other endpoint is excluded. Unless otherwise specified, it should be assumed that both endpoints are included. Furthermore, unless otherwise specified or apparent from the context and the understanding of one of ordinary skill in the art, values expressed as ranges should be understood to contemplate any specific value or subrange within the range specified in different embodiments of the invention, down to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. When a series of numerical values is specified herein, it is also understood that the invention includes embodiments relating to any intermediate value or range defined by any two values in the series, where the lowest value may be the minimum and the highest value may be the maximum. As used herein, numerical values include values expressed as percentages. In any embodiment of the invention in which a numerical value is preceded by "about" or "approximately," the invention includes embodiments in which the exact value is recited. In any embodiment of the invention where a numerical value is not preceded by "about" or "approximately," the invention encompasses embodiments where the value is preceded by "about" or "approximately."

[0230] "Approximately" or "about," unless otherwise specified or otherwise clear from the context, typically encompasses a number within 1% in either direction (more than or less than a number), or in some embodiments, within 5%, or in some embodiments, within 10% of a number (except where such number would unacceptably exceed 100% of the possible values). Unless expressly specified to the contrary, in any method claimed herein that includes two or more actions, the order of the actions of the method is not necessarily limited to the order in which the actions of the method are listed, although it should be understood that the invention encompasses embodiments in which the order is so limited. It should also be understood that, unless otherwise specified or otherwise clear from the context, any product or composition described herein can be considered "isolated." [Example]

[0231] Example 1

[0232] In vitro condensate formation:

[0233] Numerous condensate components are known to form in vitro condensates. Generally, one or more condensate components are added to a solution (e.g., an aqueous solution) at different concentrations in the presence of a salt (e.g., NaCl) and, optionally, a crowding agent (e.g., polyethylene glycol, Ficoll). See, for example, Boija et al., Cell, vol. 175, no. 7, pp. 1842-1855 (2018); Sabari et al., Science, vol. 361, pp. 361-371 (2018); Bergeron-Sandoval et al., Cell, vol. 165, no. 5, pp. 1067-1079 (2016). May 19; 165(5): 1067-1079 (particularly the related methods are incorporated herein). In some embodiments, in vitro condensates containing MED1 are formed by adding about 10 μM MED1 to a solution containing 150 μM NaCl and 10% PEG (e.g., PEG-8000). In some embodiments, in vitro condensates containing MED1 and estrogen receptor (ER) are formed by adding about 10 μM each of MED1 and ER to a solution containing 150 μM NaCl and 10% PEG (e.g., PEG-8000) or 16% Ficoll-400.

[0234] Imaging of condensates

[0235] Methods for imaging condensates in vitro and within cells are taught in the art and include, but are not limited to, deconvolution microscopy, structured illumination microscopy, or interference microscopy. In some embodiments, deconvolution microscopy, structured illumination microscopy, or interference microscopy are used to image condensates. See, e.g., Boija et al., Cell, vol. 175, no. 7, pp. 1842-1855 (2018) and Sabari et al., Science, vol. 361, pp. 361-371 (2018) (these related methods are specifically incorporated herein).

[0236] In some specific embodiments, cells containing associated condensates are grown on 35 mm glass plates and imaged in 2i / LIF medium using an LSM880 confocal microscope equipped with an Airyscan detector. Cells are heated to 37°C and imaged on a stage supplemented with humidified air at 37°C. Additionally, the microscope is surrounded by an incubation chamber heated to 37°C. A ZEN black edition, version 2.3 (Zeiss, Thornwood, NY) can be used for acquisition. Images can be acquired with a Plan-Apochromat 63x / 1.4 oil immersion objective in super-resolution (SR) mode using the Airyscan detector. Raw Airyscan images can be processed using ZEN 2.3 (Zeiss, Thornwood, NY).

[0237] In some embodiments, DNA-FISH or RNA-FISH can be used to localize associated condensates within cells by labeling the location of associated RNA transcripts or genomic DNA (e.g., Myc). See, e.g., Boija et al., Cell, vol. 175, no. 7, pp. 1842-1855 (2018). This technique can be used in combination with other methods disclosed herein (e.g., by fluorescent microscopy of tagged drugs) to determine whether drugs colocalize with associated condensates.

[0238] To analyze in vitro phase separation imaging experiments, MATLAB scripts can be written to identify droplets and characterize their size, aspect ratio, enrichment ratio, and partition coefficient. For any particular experimental condition, an intensity threshold based on the histogram peak and a size threshold (2-pixel radius) can be used to segment the image, at which point regions of interest can be defined and signal intensities inside and outside the droplets quantified.

[0239] Calculation of partition coefficient

[0240] As used herein, a partition coefficient or enrichment ratio is the ratio of the concentrations of a compound (e.g., a drug) inside a condensate to those outside the condensate (e.g., the surrounding solution). A drug partition coefficient can be obtained as described herein using any suitable technique for ascertaining drug concentration, such as the microscopy techniques described herein. In some embodiments, partition coefficients in live-cell imaging can be calculated using Fiji. Using a single focal plane per cell, the average signal intensity within the condensate can be quantified and compared to the average signal intensity from 8-12 non-heterochromatic regions within the cell's nuclear boundary. The limits of heterochromatic regions and nuclear boundaries can be defined using Hoechst channels. For quality control, partition coefficients can be calculated for cells with more than three heterochromatic formations within the selected plane.

[0241] Example 2

[0242] The core contains a variety of phase-separated condensates that compartmentalize and concentrate biomolecules with different physicochemical properties. We investigated whether condensates could concentrate small molecule cancer therapeutics in a way that altered their pharmacodynamic properties. We discovered that anticancer drugs concentrate within specific protein condensates in vitro, a process that occurs due to physicochemical properties independent of the drug target. This behavior was also observed in tumor cells, where drug partitioning affected drug activity. Altering the condensate properties was found to affect drug concentration and activity. These results suggest that selective partitioning and concentration of small molecules within condensates contribute to drug pharmacodynamics, and further understanding of this phenomenon could facilitate advances in disease treatment.

[0243] The 5–10 billion protein molecules of cells are compartmentalized within membrane-bound and non-membrane-bound organelles (1–3). Many non-membrane-bound organelles are phase-separated biomolecular condensates with distinct physicochemical properties that can absorb and concentrate specific proteins and nucleic acids (4–17). It was speculated that selective partitioning into condensates may also occur for small molecule drugs whose targets are present within the condensates (Figure 28A). Therefore, it was speculated that the therapeutic index and efficacy of such compounds may be related to their ability to partition into condensates that harbor their targets. To test this idea, this study focused on collecting nuclear condensates previously reported in various cell lines and demonstrated their presence in both normal human and tumor cells. An in vitro condensate droplet assay was then developed using each key component of the nuclear condensate to enable the testing of small molecules.

[0244] Although nuclear condensates have been described in various cultured cell lines, the presence of transcriptional, splicing, heterochromatin, and nucleolar condensates in primary human normal and malignant tissues has not yet been demonstrated. Each of these condensates contains one or more proteins that can function as both condensate markers and scaffolds for condensate formation in in vitro droplet assays (10-12, 18-32). Specifically, transcriptional condensates are characterized by the condensate-forming proteins MED1 and BRD4 (10, 12, 19), splicing speckles by SRSF2 (11, 20), heterochromatin by HP1α (21, 22), and nucleoli by FIB1 and NPM1 (23-25) (Figure 32A). To determine whether such condensates could be observed in cells from healthy and malignant human tissues, we collected biopsies from breast ductal epithelium, invasive ductal carcinoma, normal colon, and colon cancer (Figures 32B and 32C). Immunofluorescence revealed nuclear structures containing these marker proteins in normal and transformed tissues (Figures 1B and 1C). The size and number of nuclear structures showed a wide distribution, as expected for dynamic biomolecular condensates, with no significant differences observed between benign and malignant tissues (Figures 33A–33C). However, tumor cells acquire long super-enhancers in driver oncogenes (33), which, as described below, can form tumor-specific transcriptional condensates.

[0245] To model these nuclear condensates and study the behavior of small molecules within these droplets, an assay was developed (Figure 28D). The proteins characterizing each nuclear condensate have previously been shown to form condensates independently in vitro (10, 11, 21, 23). Fluorescently labeled recombinant versions of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 (Figure 34) were generated and purified, and the ability of these proteins to form droplets was confirmed in an in vitro assay (Figures 35A and 35B). To investigate the partitioning behavior of small molecules, the dyes fluorescein (332 Da) and Hoechst (452 Da) were first added to solutions containing each of the six protein condensates, along with fluorescently labeled dextran averaging 4.4 kilodaltons (kDa). The dye and dextran appeared to diffuse throughout all condensates without substantial partitioning (Figure 28E, Figures 36, 37A–37D). Because small molecule drugs are generally smaller than 1 kDa, these results suggested that small molecule drugs could diffuse freely through these intranuclear condensates unless factors other than size influenced their partitioning.

[0246] Next, we sought to determine whether various clinically important drugs with targets present within nuclear condensates also exhibit free diffusion across these condensates. We initially focused on cisplatin and mitoxantrone, members of a class of antitumor compounds that can be modified to have fluorescent properties (cisplatin) (34) or are intrinsically fluorescent (mitoxantrone) by modifying DNA through platinization or intercalation. When added to droplet formation buffer containing purified MED1, BRD4, SRSF2, HP1α, FIB1, or NPM1, cisplatin was found to be selectively concentrated within MED1 droplets with a partition coefficient of up to 600 (Figures 39A–39C) (Figures 29A, 38A). Fluorescent modification of cisplatin did not appear to contribute to this behavior in vitro, as the modified drug could be displaced from the condensates by unmodified cisplatin, and cisplatin isomers did not exhibit the same behavior (Figures 38B–38D). Mitoxantrone was also concentrated within MED1 condensates, as well as FIB1 and NPM1 condensates (Figures 29B, 38A, and 39A-39C). Consistent with these results, mitoxantrone is known to concentrate within nucleoli where FIB1 and NPM1 reside (35, 36). These results indicate that condensates formed in vitro possess physicochemical properties that allow selective concentration of specific small molecule drugs, even in the absence of the drug target.

[0247] Anticancer drugs targeting transcriptional regulators predicted to be contained within transcriptional condensates in cells were selected for further study. These targets included a) the estrogen receptor (ER), a transcription factor and nuclear hormone receptor; b) CDK7, a cyclin-dependent kinase that functions in transcription initiation and cell cycle control; and c) BRD4, a bromodomain protein and coactivator involved in oncogene regulation (Figure 40). To monitor drug behavior by confocal fluorescence microscopy, we used a fluorescent tamoxifen analog (FLTX1) that targets the ER, as well as modified fluorescent THZ1 and JQ1 (37, 38) that target CDK7 and BRD4, respectively. These compounds were added in parallel to droplet formation assays using MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 proteins. FLTX1 and THZ1 preferentially enriched in MED1 droplets (Figures 29C-29D, 38A), and this behavior was not due to fluorescent moieties (Figures 38B, 38D). JQ1 showed a different enrichment pattern, enriching in MED1, BRD4, and NPM1 droplets (Figures 29E, 38A, 38B). Corroborating these results, we found that small molecules that enrich in MED1 condensates were also enriched in condensates formed from purified intact Mediator complexes (Figure 41) and in MED1 condensates formed with alternative crowding agents (Figure 42). The targets of these three compounds (ERα, CDK7, and the bromodomain of BRD4) are not present in these in vitro condensates but are present in super-enhancers that form condensates in vivo with transcription factors and mediators (10, 12, 39) (Figures 40A and 40B), suggesting that the ability of some small molecules to preferentially concentrate in the same condensates as their protein targets may contribute to the pharmacological properties of these drugs.

[0248] To gain further insight into the nature of the interactions governing small molecule enrichment within condensates, our study focused on MED1-IDR condensates. Fluorescence recovery after photobleaching (FRAP) experiments demonstrated that cisplatin molecules were highly mobile within these condensates (Figures 43A and 43B). This suggests that condensates create a dynamic, highly mobile physicochemical environment that promotes drug enrichment. To gain insight into the chemical features of small molecules that may contribute to their selective association with MED1 within condensates, we used a small molecule library of 81 compounds in which the fluorescent molecule boron dipyrromethene (BODIPY) was modified with various combinations of chemical side groups (Figure 44A). The relative abilities of these molecules to enrich within MED1 condensates were measured by confocal fluorescence microscopy. Molecules containing aromatic rings were found to preferentially enrich within MED1 condensates (Figures 44A–44D, Figure 45A). This suggests that π-π or π-cation interactions are part of the physicochemical properties that favor the partitioning of small molecules into MED1 condensates. The number of aromatic amino acids in MED1 exceeds that in the other condensate-forming proteins studied here (Figure 34B), and may contribute to such interactions. To investigate this possibility, mutant MED1 proteins in which all 30 aromatic amino acids were mutated to alanine were generated and their ability to form condensates and concentrate small molecules was tested (Figure 45B). Although the aromatic mutant MED1 protein retained the ability to form droplets in vitro (Figure 45C), suggesting that aromatic amino acids are not required for droplet formation, small molecule probes containing aromatic rings and the polar molecule cisplatin no longer partitioned into condensates formed by the aromatic mutant MED1 protein (Figures 45D and 45E). These results suggest that aromatic residues in MED1 condensates contribute to the physicochemical properties that selectively concentrate these small molecules.

[0249] The ability of small molecules to concentrate within specific condensates is expected to affect target binding and, therefore, drug pharmacodynamics. To investigate this, the ability of MED1 and HP1α condensates to incorporate DNA (Figure 30A) was exploited to measure the relative efficiency of DNA platinization by cisplatin in cisplatin-concentrated MED1 condensates compared to HP1α condensates in which cisplatin freely diffuses (Figure 29A). DNA and proteins were mixed under droplet-forming conditions, where DNA strongly partitioned into the droplet phase (Figure 46). These condensates were then treated with cisplatin, and DNA platinization was visualized by size shift on a bioanalyzer. The results show that DNA was more efficiently platinized in MED1 condensates than in HP1α condensates (Figure 30B), consistent with the expectation that increasing cisplatin concentration within MED1 condensates would result in enhanced target binding. If cisplatin concentrates within cellular Mediator condensates, DNA colocalized with the Mediator condensates would be preferentially platinized. To test this idea, co-immunofluorescence using an antibody that specifically recognizes platinized DNA (40) (Figure 47A) together with antibodies specific for MED1, HP1α, or FIB1 was performed in cisplatin-treated HCT116 colon cancer cells. Consistent with cisplatin's preference for MED1 condensates in vitro, platinized DNA was found to frequently colocalize with MED1 condensates, but not with HP1α or FIB1 condensates (Figure 40C). To determine whether cisplatin's ability to bind DNA depends on the presence of MED1 condensates, cells were treated with JQ1, which caused a loss of MED1 condensates (Figure 47B), and a concomitant decrease in platinized DNA at the MYC oncogene was observed (Figures 47C, 47D). These results are consistent with the idea that the concentration of small molecules within specific condensates can affect the efficiency of target binding.

[0250] In cells, preferential modification of DNA within MED1-containing condensates is predicted to selectively disrupt these condensates with long-term treatment. To test this, HCT116 colon cancer cells were genetically engineered to express GFP-tagged marker proteins for each of six nuclear condensates (Figures 48A–48F, 49A, 49B). Upon exposure to cisplatin, a selective and progressive decrease in MED1 condensates was observed (Figure 30D, 50A, 50B, 51). Consistent with this, cisplatin treatment caused a preferential loss of MED1 ChIP-seq signal at super-enhancers (Figure 40E, 52). Furthermore, data from high-throughput sequencing of platinized DNA pulldowns (41) revealed that cisplatin-modified DNA is preferentially present in super-enhancers (SEs) where MED1 is enriched (Figure 30F) (42). These results are consistent with reports that cisplatin preferentially modifies transcribed genes (41, 43) and argue that this effect is due to preferential partitioning into condensates. Collectively, these results suggest a model in which cisplatin preferentially modifies SE DNA, which in turn leads to the dissolution of these condensates. Previous studies have shown that a variety of tumor cells become highly dependent on super-enhancer-driven oncogene expression (44-48). This may explain why platinum drugs, which can broadly modify DNA, are effective therapeutic agents in a variety of cancers (49).

[0251] To assess whether drug response and resistance are associated with partitioning into condensates, we investigated the behavior of tamoxifen, another clinically important anticancer drug (Figure 31A). ERα is incorporated into MED1 condensates in vitro in an estrogen-dependent manner (12). Droplet assays confirmed this, revealing that the addition of tamoxifen resulted in the clearance of ERα from MED1 condensates (Figure 31B). The effects of estrogen and tamoxifen on MED1 condensates in breast cancer cells were further investigated, focusing on the MYC oncogene due to its prominent role in carcinogenesis and responsiveness to estrogen (50). MED1 condensates were observed on the MYC oncogene in the ER+ breast cancer cell line MCF7 (Figure 40A, Figures 53A-53D). DNA FISH together with MED1 IF revealed that estrogen enhanced the formation of MED1 condensates at the MYC oncogene, and treatment with tamoxifen reduced them (Figure 54A, B). ER-free MED1 artificial condensates concentrated FLTX1 at the condensate sites (Figure 55), indicating that ER is not required for the partitioning of FLTX1 into cellular MED1 condensates. These results are consistent with a model in which ERα interacts with MED1 condensates in an estrogen-dependent, tamoxifen-sensitive manner to drive oncogene expression in breast cancer cells.

[0252] The mechanisms underlying drug resistance may provide clues regarding drug activity in clinical settings. Tamoxifen resistance is a long-standing clinical challenge and can be mediated by multiple mechanisms, including ERα mutations and MED1 overexpression (Figure 31A, Figure 56) (51, 52). To investigate whether ERα mutations alter ERα behavior within condensates, we generated mutant ERα proteins from four patients and examined their partitioning in the presence of tamoxifen. In contrast to WT ERα, condensates composed of patient-derived ERα mutants and MED1 were not disrupted by treatment with tamoxifen (Figure 31B, Figure 57A, Figure 57B). ERα point mutations reduce affinity for tamoxifen by approximately 10-fold (52), indicating that drug concentration within droplets is insufficient to eliminate these mutant ER proteins when this affinity is reduced.

[0253] MED1 overexpression is associated with tamoxifen resistance and poor prognosis in breast cancer (51), but it is unclear why overexpression of one subunit of the Mediator complex causes resistance. One possibility is that overexpressed MED1 is incorporated into transcriptional condensates containing clusters of Mediator molecules (39), thereby expanding their volume and diluting available tamoxifen (Figure 58A). The tamoxifen-resistant breast cancer cell line TAMR7, derived from the tamoxifen-sensitive cell line MCF7 (53), was found to produce fourfold higher levels of MED1 protein (Figure 58B). The volume of MED1-containing condensates was twofold larger in these cells (Figure 31C, Figure 58C). When modeled in an in vitro droplet assay, a fourfold increase in MED1 levels was found to result in a corresponding increase in droplet size (Figure 59A, Figure 59B). Furthermore, we found that 100 μM tamoxifen prevented ERα incorporation into MED1 aggregates (Figures 31B and 31D), but was significantly less effective at preventing ERα incorporation into larger MED1 aggregates formed by higher levels of MED1 (Figure 31D). To confirm that tamoxifen levels are more diluted in larger droplets, we measured the enrichment of FLTX1, a fluorescent tamoxifen analog, into MED1 droplets and found that larger aggregates had lower concentrations of drug (Figure 31E). These results were reproduced in cells where tethered ERα molecules form clusters of MED1 aggregates (the aggregates are cleared by tamoxifen, but when MED1 is overexpressed, tamoxifen is unable to dissociate ERα-MED1 aggregates) (Figure 60). These results support a tamoxifen resistance model in which MED1 overexpression leads to the formation of larger transcriptional condensates in which tamoxifen is diluted and therefore less effective at dissociating the ER from the condensates (Figure 31F).

[0254] These results suggest that drugs selectively partition into condensates, that this can occur due to physicochemical properties that exist independently of the drug's molecular target, and that cells can develop resistance to drugs through mechanisms that alter condensates. This may also explain the surprising observation that inhibition of global gene regulators such as BRD4 or CDK7 can have selective effects on cancer genes that have acquired long super-enhancers (46). Selective partitioning of inhibitors such as JQ1 and THZ1 into super-enhancer condensates would preferentially disrupt transcription at those loci. These results also have implications for the future development of effective disease therapeutics. Effective target binding depends on measurable factors, such as drug partitioning into condensates (Figures 61A–61D). Thus, condensate assays of the type described here may help optimize small molecule drug partitioning into condensates, target binding, and therapeutic index.

[0255] Materials and Methods

[0256] cell line

[0257] Cell lines were obtained as indicated. TamR7 (ECACC 16022509). V6.5 mouse embryonic stem cells were a gift from R. Jaenisch at the Whitehead Institute. V6.5 are male cells derived from a C57BL / 6(F) × 129 / sv(M) cross. MCF7 cells were a gift from R. Weinberg at the Whitehead Institute. HCT116 cells were from ATCC (CCL-247). V6.5 mouse embryonic stem cells endogenously tagged with MED1-mEGFP (10), BRD4-mEGFP (10), SRSF2-mEGFP (11), or HP1α-mEGFP were used. Cells tested negative for mycoplasma. The CRISPR / Cas9 system was used to generate endogenously tagged genetically modified ESCs and HCT116 cells. Target-specific sequences were cloned into a plasmid containing an sgRNA backbone, a codon-optimized version of Cas9, and either BFP or mCherry. Homologous repair templates were cloned into pUC19 using NEBuilder HiFi DNA Master Mix (NEB E2621S). Homologous repair templates, consisting of mCherry or mEGFP cDNA sequences flanked by 800-bp homology arms, were amplified from genomic DNA using PCR. To generate genetically modified cell lines, 750,000 cells were transfected with 833 ng of Cas9 plasmid and 1,666 ng of non-linearized homologous repair. PCR genotyping was performed using Phusion polymerase (Thermo Scientific F531S). Products were amplified according to the kit's recommendations and visualized on a 1% agarose gel. The following primers were used for PCR genotyping:

[0258] HP1α-mCherry_fwd(mES):AACGTGAAGTGTCCACAGATTG (SEQ ID NO: 2)

[0259] HP1α-mCherry_rev(mES):TTATGGATGCGTTTAGGATGG (SEQ ID NO: 3)

[0260] HP1α-GFP_fwd(HCT116):CCAAGGTGAGGAGGAAATCA (SEQ ID NO: 4)

[0261] HP1α-GFP_rev(HCT116): CACAGGGAAGCAGAAGGAAG (SEQ ID NO: 5)

[0262] MED1α-GFP_fwd(HCT116): GAAGTTGAGAGTCCCCATCG (SEQ ID NO: 6)

[0263] MED1-GFP_rev(HCT116): CGAGCACCCTTCTCTTCTTG (SEQ ID NO: 7)

[0264] BRD4-GFP_fwd(HCT116):CTGCCTCTTGGGCTTGTTAG (SEQ ID NO: 8)

[0265] BRD4-GFP_rev(HCT116):TTTGGGGAGAGGAGACATTG (SEQ ID NO: 9)

[0266] SRSF2-GFP_fwd(HCT116): CAAGTCTCCTGAAGAGGAAGGA (SEQ ID NO: 10)

[0267] SRSF2-GFP_rev(HCT116): AAGGGCTGTATCCAAACAAAAAC (SEQ ID NO: 11)

[0268] FIB1-GFP_fwd(HCT116):CCTTTTAATCAGCAACCCACTC (SEQ ID NO: 12)

[0269] FIB1-GFP_rev(HCT116):GTGACCGAGTGAGAATTTACCC (SEQ ID NO: 13)

[0270] NPM1-GFP_fwd(HCT116):TCAAATTCCTGAGCTGAAGTGA (SEQ ID NO: 14)

[0271] NPM1-GFP_rev(HCT116): AACACGGGTAGGGAAAGTTCTCA (SEQ ID NO: 15)

[0272] cell culture

[0273] V6.5 mouse embryonic stem cells (mES) were grown in 2i+LIF conditions. mES cells were grown in 0.2% gelatinized (Sigma, G1890) tissue culture plates. The medium used for the 2i+LIF media condition was as follows: 967.5 mL DMEM / F12 (GIBCO 11320), 5 mL N2 supplement (GIBCO 17502048), 10 mL B27 supplement (GIBCO 17504044), 0.5 mM L-glutamine (GIBCO 25030), 0.5X non-essential amino acids (GIBCO 11140), 100 U / mL penicillin-streptomycin (GIBCO 15140), 0.1 mM b-mercaptoethanol (Sigma), 1 uM PD0325901 (Stemgent 04-0006), 3 uM CHIR99021 (Stemgent 04-0004), and 1000 U / mL Recombinant LIF (ESGRO ESG1107). TrypLE Express Enzyme (Life Technologies, 12604021) was used to detach cells from plates. TrypLE was quenched with FBS / LIF medium (DMEM K / O (GIBCO, 10829-018), 1X non-essential amino acids, 1% penicillin-streptomycin, 2 mM L-glutamine, 0.1 mM b-mercaptoethanol, and 15% fetal bovine serum, FBS (Sigma Aldrich, F4135)). Cells were centrifuged at 1000 rpm for 3 minutes at room temperature, resuspended in 2i medium, and diluted to 5 x 10 6 The cells were plated in a 15 cm petri dish.

[0274] MCF7 and HCT116 cells were grown in complete DMEM medium (DMEM (Life Technologies 11995073), 10% fetal bovine serum, FBS (Sigma Aldrich, F4135), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin-streptomycin (Life Technologies, 15140163)). For growth in estrogen-free conditions, MCF7 cells in standard medium were washed three times with PBS and then changed to estrogen-free medium containing phenol red-free DMEM (Life Technologies 21063029), 10% charcoal-stripped FBS (Life Technologies A3382101), 1% L-glutamine (GIBCO, 25030-081), and 1% penicillin-streptomycin (Life Technologies, 15140163) for 48 h before use.

[0275] TamR7 cells were cultured in TAMR7 medium (phenol red-free DMEM / F12, (Life Technologies 21041025), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin-streptomycin (Life Technologies, 15140163), 1% fetal bovine serum, FBS (Sigma Aldrich, F4135), 6 ng / mL insulin (Santa Cruz)). Cells were grown in PBS (Life Technologies, sc-360248). For passage, cells were washed with PBS (Life Technologies, AM9625). To detach cells from the plate, TrypLE Express Enzyme (Life Technologies) was used. Technologies, 12604021) was used. TrypLE was quenched with the indicated medium.

[0276] Live cell imaging

[0277] Cells were grown on glass dishes (Mattek P35G-1.5-20-C). Before imaging, the culture medium was replaced with phenol red-free 2i medium and imaged using an Andor Revolution spinning disk confocal microscope. Raw images were processed using FIJI. For imaging of mESCs, coated glass dishes were used (5 μg / ml poly-L-ornithine (Sigma-Aldrich, P4957) for 30 minutes at 37°C and 5 μg / ml laminin (Corning, 354232) for 2–16 hours at 37°C). For imaging of FIB1 and NPM1 in mESCs, vectors encoding GFP-tagged NPM1 or FIB1 were transfected as described above using Lipofectamine 3000 according to the package instructions.

[0278] Immunofluorescence of tissue samples

[0279] Fresh frozen breast and colon tissues were purchased from BioIVT. Frozen breast tissues were fixed in 2% PFA in PBS for 30 minutes to 1 hour. Fixed tissues were incubated in 30% sucrose in PBS at 4°C for 4 days. Tissues were embedded in OCT and frozen. Fresh frozen colon tissues were embedded in OCT and frozen. Tissues were sectioned into 10-µm sections using a cryostat at a temperature setting of -25°C or -30°C. Sections were stored at -20°C. For IF, sections were allowed to reach room temperature and then fixed in 4% PFA in PBS for 10 minutes. After three washes with PBS, tissues were permeabilized using 0.5% TX100 in PBS, washed three times with PBS, and blocked with 4% BSA in PBS for 30 minutes. Primary antibodies were diluted in 4% BSA in PBS, added to the tissue samples, and incubated overnight at RT. After three washes with PBS, samples were incubated with secondary antibody diluted 1:500 in 4% BSA in PBS. Samples were washed with PBS, and DNA was stained using 20 μm / mL Hoechst 33258 (Life Technologies, H3569) for 5 minutes and mounted using Vectashield (VWR, 101098-042). Images were acquired using an Elyra super-resolution microscope at the Harvard Center for Biological Imaging. Images were post-processed using Fiji Is Just ImageJ (https: / / fiji.sc / ).

[0280] Determination of the volume of nuclear condensate

[0281] Image acquisition: 10 z-sections were imaged. Nuclear contours were measured using the Fiji Is Jus t were manually defined in ImageJ (https: / / fiji.sc / ), and the volume of each nucleus was calculated as nuclear area (μm) * number of z-sections imaged (10) * voxel depth (0.1 μm).

[0282] The volume of condensates within the nuclei was measured using a custom Python script and the scikit-image package. Condensates were segmented from 3D images of protein channels using two criteria: (1) an intensity threshold of 3 standard deviations above the image mean; and (2) a size threshold (minimum condensate size of 10 pixels). The estimated volume of segmented objects was then calculated by multiplying width (μm) * height (μm) * voxel depth (0.1 μm). For each protein element, the mean volume and standard deviation of condensates in healthy and malignant tissues were reported. The number of condensates per nucleus was defined as the number of segmented objects contained within the defined nuclear perimeter. For each protein element, the mean number and standard deviation of condensates per nucleus in healthy and malignant tissues were reported. The percentage of nuclear volume occupied by condensates was calculated as follows: (Σ volume of all detected condensates within the nucleus) / (estimated nuclear volume).

[0283] antibody

[0284] The following antibodies were used for immunofluorescence: NPM1 (ab10530), BRD4 (ab128874), MED1 (ab64965), HP1a (ab109028), FIB1 (ab5821), SRSF2 (ab11826), ER (ab32063), CDK7 (sc-7344), cisplatin-modified DNA (ab103261), goat anti-rat A11077, goat anti-rabbit IgG Alexa Fluor 488, Life Technologies A11008.

[0285] Protein purification

[0286] Human cDNA was cloned into a modified version of the T7 pET expression vector. The base vector was engineered to contain a 5' 6xHIS followed by either BFP, mEGFP, or mCherry and a 14-amino acid linker sequence, "GAPGSAGSAAGGSG" (SEQ ID NO: 16). These sequences (generated by PCR) were inserted in frame with the linker amino acids using the NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621S). All expression constructs were sequenced to confirm sequence identity.

[0287] For protein expression, the plasmids were transformed into LOBSTR cells (gift from Chessman Lab) and grown as follows: A fresh bacterial colony containing the tagged MED1 construct was inoculated into LB medium containing kanamycin and chloramphenicol and grown overnight at 37°C. The cells were diluted 1:30 into 500 ml of room temperature LB containing freshly added kanamycin and chloramphenicol and grown at 16°C for 1.5 hours. IPTG was added to 1 mM and growth continued for 20 hours. The cells were harvested and stored frozen. Cells containing all other expression plasmids were treated in a similar manner, except that they were grown at 37°C for 5 hours after IPTG induction.

[0288] The SRSF1 and SRSF2-IDR cell pellets were resuspended in 15 ml of denaturing buffer (50 mM Tris 7.5, 300 mM NaCl, 10 mM imidazole, 8 M urea) containing cOmplete protease inhibitor (Roche, 11873580001) and sonicated (10 cycles of 15 seconds on, 60 seconds off). The lysate was clarified by centrifugation at 12,000 g for 30 minutes and added to 1 ml of Ni-NTA agarose (Invitrogen, R901-15) pre-equilibrated with 10 volumes of the same buffer. The tube containing the agarose lysate slurry was rotated at room temperature for 1.5 hours, then centrifuged at 3,000 rpm for 10 minutes, washed with 2 × 5 ml of lysis buffer, and eluted with 3 × 2 ml of lysis buffer containing 250 mM imidazole. The eluate was incubated at room temperature for at least 10 minutes while rotating and then centrifuged at 3,000 rpm for 10 minutes to collect the protein. Fractions were run on a 12% acrylamide gel, and proteins of the appropriate size were dialyzed first against a buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, 1 mM DTT, and 4 M urea, followed by dialysis against the same buffer containing 2 M urea, and finally against two changes of buffer containing 10% glycerol but no urea. Any precipitate after dialysis was removed by centrifugation at 3,000 rpm for 10 minutes. All other proteins were purified in a similar manner by resuspending the cell pellet in 15 ml of buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, and cOmplete protease inhibitors, sonicating, and centrifuging at 12,000 x g for 30 minutes at 4°C. The lysate was added to 1 ml of pre-equilibrated Ni-NTA agarose and rotated for 1.5 hours at 4° C. The resin slurry was centrifuged at 3,000 rpm for 10 minutes, washed with 2×5 ml lysis buffer containing 50 mM imidazole, and eluted with 2 ml lysis buffer containing 250 mM imidazole by incubation with rotation for 10 minutes or more, three times, followed by centrifugation and gel analysis.Fractions containing proteins of the appropriate size were dialyzed against two changes of a buffer containing 50 mM Tris 7.5, 125 mM NaCl, 10% glycerol, and 1 mM DTT at 4°C or the same buffer containing 500 mM NaCl for the HP1a construct.

[0289] The following human proteins or protein fragments were used for production:

[0290] NPM1: full length, amino acids 1–294.

[0291] SRSF2: full length, amino acids 1–221.

[0292] HP1α: full length, amino acids 1–191.

[0293] MED1: amino acids 600–1581.

[0294] MED1: aromatic mutant, amino acids 600–1581, all aromatic residues changed to alanine.

[0295] MED1: basic mutant, amino acids 600–1581, all basic residues changed to alanine.

[0296] BRD4: amino acids 674–1351.

[0297] FIB1: full length, amino acids 1–321.

[0298] ER and ER mutants: full length, amino acids 1 to 595 (WT).

[0299] Acquiring data from Cbioportal

[0300] For patient mutation frequencies, cbioportal ( www.cbioportal.org / ) was queried for ESR1 mutations present in any breast cancer sequencing dataset.

[0301] Drugs and small molecules

[0302] Drugs and small molecules were obtained and processed as follows: Hoechst 33258 (Life Technologies H3569) was obtained and utilized in liquid form. Fluorescein (Sigma F2456) was dissolved in DMSO at 10 mM and then further diluted in droplet formation buffer for use. Dextran conjugated to either TRITC or FITC, ROX (Life Technologies 12223012), and Texas Red (Sigma Aldrich 60311-02-6) with sizes of 4.4 kDa (Sigma T1037), 10 kDa (Invitrogen D1816), 40 kDa (Invitrogen D1842), or 70 kDa (Invitrogen D1864) was diluted in droplet formation buffer. FLTX1 (AOBIO 4054) was dissolved in DMSO and then further diluted in droplet formation buffer. THZ1-TMR and JQ1-ROX were synthesized as follows to obtain the molecular structures shown in Figure 2D-E. Texas Red (Ursa Bioscience)-conjugated cisplatin was dissolved in DMSO to 2 mM and diluted in droplet formation buffer for further use. Mitoxantrone (Sigma F6545) was dissolved in DMSO and diluted in droplet formation buffer for further use. Chemical structures were generated using ChemDraw software.

[0303] The unlabeled molecules used in the displacement experiments in live cells were as follows: JQ1 (Cayman Chemical 11187), cisplatin (Selleck S1166), transplatin (Toku-E T108), tamoxifen (Sigma Aldrich T5648), and 4-hydroxytamoxifen (Sigma H7904).

[0304] In vitro droplet assay

[0305] Recombinant BFP, GFP, or mCherry fusion proteins were concentrated and purified using Amicon Desalting was performed using an Ultra centrifugal filter (30K MWCO, Millipore) to the appropriate protein concentration and 125 mM NaCl. Recombinant proteins were added to droplet formation buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT) with the indicated amount of salt and the indicated crowding agent (Ficol or PEG). The protein solution was immediately loaded into a glass-bottom 384-well plate (Cellvis P384-1.5HN) and imaged using an Andor confocal microscope with a 150x objective. Unless otherwise indicated, images shown are of droplets placed on a coverslip.

[0306] The concentrations of drugs and small molecules used in the droplet experiments were as follows:

[0307] Texas Red-Cisplatin: 5uM

[0308] FLTX1: 100 μM

[0309] Mitoxantrone: 50 μM

[0310] Fluorescein: 5 μM

[0311] Hoechst: 1 mg / mL

[0312] Labeled dextran: 0.05 mg / mL

[0313] THZ1-TMR: 5 μM

[0314] JQ1-ROX: 1 μM

[0315] ROX: 1 μM

[0316] TR: 5 μM

[0317] For the expulsion experiments, 5 μM labeled cisplatin-TR was added to the MED1 droplet reaction (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG) to form cisplatin-TR-enriched MED1 droplets. Unlabeled transplatin or unlabeled cisplatin (vehicle, 10 μM, 100 μM, or 500 μM) was added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplets was measured after expulsion. For the formation of FLTX1-enriched MED1 droplets, 100 μM fluorescent FLTX1 was added to the MED1 droplet reaction (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG). 1 mM of the non-fluorescent version of the drug tamoxifen was added to the droplet mixture, and the amount of fluorescent FLTX1 remaining in the droplets was measured after expulsion. To analyze the displacement of ER from MED1 condensates, fluorescently labeled ER and MED1 were mixed with the indicated components at the indicated concentrations in droplet formation buffer in the presence of 100 μM estrogen (Sigma E8875). For conditions with tamoxifen treatment, 4-hydroxytamoxifen (Sigma H7904) was then added to a final concentration of 100 μM, and the droplets were imaged on a confocal fluorescence microscope as described above.

[0318] For droplet assays with fluorescent DNA, a 451-base pair DNA fragment was commercially synthesized into a vector with flanking M13F and M13R primer binding sites. Primers M13F and M13R covalently linked to a Cy5 fluorophore were commercially synthesized, and the fragment was amplified using these primers. The DNA fragment was then purified from the PCR reaction and diluted into droplet formation buffer for use in droplet assays as described. To test the ability of recombinant CDK7 to partition into MED1 or HP1α droplets, recombinant CDK activation complex (Millipore 14-476) was supplemented at 0.4 mg / mL in 150 mM NaCl at pH 7.5. One vial of monoreactive dye Cy5 (Amersham PA23001) was resuspended in 30 μL of 0.2 M sodium bicarbonate (pH 9.3) in 150 mM NaCl. 5 μL of this reaction mixture was added to 5 μL of protein and incubated at room temperature for 1 hour. Free dye was removed by passage through Zeba Spin Desalting Columns, 40 MWCO (87764, Thermo Scientific) as described in the package insert, and the protein was placed in droplet formation buffer containing 1 mM DTT in 125 mM NaCl at a final concentration of 1 μM. This protein was used for droplet assays as needed.

[0319] For screening of the modified BODIPY library of 80 modified BODIPYs, molecules were selected from a larger collection of libraries as previously described (54). These molecules were diluted to 1 mM in DMSO and then to 10 μM in droplet formation buffer. MED1-IDR-BFP droplets were formed with 5 μM protein in droplet formation buffer containing 125 mM NaCl and 10% PEG. The probe was added to the reaction to a final concentration of 1 μM. The mixture was added to a single well of a 384-well plate and imaged at 150x magnification in the 488 (BODIPY) and 405 (protein) channels on an Andor confocal fluorescence microscope. These images were quantified using the pipeline described above, quantifying the maximum 488 signal intensity within the droplet defined by the 405 channel. These values were then ranked to determine the top and bottom "hits." To ensure that the probes were comparable in fluorescence intensity, 18 random probes were imaged at 1 μM in droplet formation buffer, and the average fluorescence intensity within the field of view was determined. The same method was used to measure the fluorescence intensity of BODIPY alone (Sigma 795526), MED1 in both droplet and diffuse states.

[0320] FRAP of drug-containing in vitro droplets

[0321] For in vitro droplet FRAP, five laser pulses with a 50 μs pause were applied to the MED1 channel, and 20 laser pulses with a 100 μs pause were applied to the cisplatin channel. Recovery was imaged every second on an Andor microscope for the times indicated. Fluorescence intensity was measured using FIJI. FRAP recovery data after bleaching were averaged across six replicates for each channel.

[0322] Calculation of drug enrichment ratio

[0323] To analyze in vitro droplet experiments, we wrote a custom Python script using the scikit-image package to identify droplets and characterize their size, shape, and intensity. Droplets were segmented from the average image of the captured channels using various criteria: (1) an intensity threshold of 3 standard deviations above the image mean; (2) a size threshold (minimum droplet size of 20 pixels); and (3) a minimum circularity (circularity = 4π·area / perimeter²) of 0.8 (where 1 is a perfect circle). After segmentation, the average intensity of each droplet was calculated, excluding pixels near the phase interface and background-corrected by subtracting the intensity of the dark image containing only the droplet formation buffer. For each experiment, droplets identified in the fluorescent protein channels were quantified from 10 independent fields of view. The maximum signal intensity within a droplet was calculated for each channel, and the maximum intensity in the drug channel was designated "maximum drug intensity." To obtain the intensity of the drug or dye alone in the diffused state (termed "diffused drug intensity"), the compound was added to the droplet formation buffer at the same concentration as used in the droplet assay. This was then imaged using a confocal fluorescence microscope. The resulting images were processed in FIJI to obtain the fluorescence intensity of the field of view. To obtain the fluorescence intensity of protein droplets spilling into the drug channel (termed "background intensity"), the protein droplet was imaged in the fluorescent channel in which the drug fluoresced and processed as described above to obtain the average maximum intensity within the droplet across 10 images. The enrichment ratio was obtained using the following formula: [(maximum drug intensity) - (background intensity)] / (diffused drug intensity). Box plots show the distribution of all droplets. Each point represents an individual droplet.

[0324] Chromatin immunoprecipitation (ChIP) and sequencing

[0325] MCF7 cells were grown in complete DMEM medium to 80% confluence. Cells were crosslinked for 15 minutes using 1% formaldehyde in PBS, followed by quenching with glycine at a final concentration of 125 mM on ice. Cells were washed with cold PBS and collected by scraping the cells in cold PBS. Collected cells were pelleted at 1000 g for 3 minutes at 4°C, flash-frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared cOmplete protease inhibitors (Roche, 11873580001). Frozen crosslinked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitors), rotated for 10 minutes at 4° C., and then centrifuged at 1350 rcf for 5 minutes at 4° C. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitors), rotated for 10 minutes at 4° C., and centrifuged at 1350 rcf for 5 minutes at 4° C. The pellet was resuspended in sonication buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA pH 8.0, 0.1% SDS, and 1% Triton® X-100 (protease inhibitor)) and then sonicated in a Misonix 3000 sonicator (10 cycles of 30 s each on ice (18-21 W), with 60 s on ice between cycles). The sonicated lysate was clarified once by centrifugation at 16,000 rcf for 10 min at 4°C. The input material was retained, and the remainder was incubated overnight at 4°C with magnetic beads coupled to Bethyl A300-405A CDK7 antibody to enrich for DNA fragments bound by CDK7.The beads were washed twice with each of the following buffers: Wash Buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na deoxycholate, 1% Triton® X-100, 0.1% SDS), Wash Buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na deoxycholate, 1% Triton® X-100, 0.1% SDS), Wash Buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% Na deoxycholate, 0.5% IGEPAL). C-630, 0.1% SDS), Wash Buffer D (TE containing 0.2% Triton® X-100), and TE buffer. DNA was eluted from the beads by incubation at 65°C for 1 hour with intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS). Crosslinks were reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE was added, and RNA was then degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 hours. Protein was degraded by adding 10 mL of 20 mg / mL Proteinase K (Invitrogen, 25530049) and incubating at 55°C for 2 hours. Phenol:chloroform:isoamyl alcohol extraction followed by ethanol precipitation was performed. The DNA was then resuspended in 50 mL of TE and used for sequencing. ChIP libraries were sequenced using the Swift Biosciences Accel-NGS 2S Plus DNA Library. Library preparation was performed using the ChIP Kit according to the kit's instructions. After library preparation, ChIP libraries were run on a 2% gel using a PippinHT with a collection size window of 200-600 bases. The final library was quantified by qPCR using Roche's KAPA Library Quantification Kit and sequenced on an Illumina HiSeq 2500 in single-read mode at 40 bases.

[0326] HCT116 cells were grown in complete DMEM medium to 80% confluence and subsequently treated with JQ1 or DMSO for 24 hours. Cells were then permeabilized (1:1000 in medium with a solution of tx100 in PBS for 10 minutes at 37°C) and subsequently treated with DMF or cisplatin for 6 hours. Cells were crosslinked for 15 minutes using 1% formaldehyde in PBS, followed by quenching with glycine to a final concentration of 125 mM on ice. Cells were washed with cold PBS and collected by scraping in cold PBS. Collected cells were pelleted at 1000 g for 3 minutes at 4°C, flash-frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared cOmplete protease inhibitor (Roche, 11873580001). Frozen crosslinked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitors), rotated for 10 minutes at 4° C., and then centrifuged at 1350 rcf for 5 minutes at 4° C. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitors) and then sonicated in a Misonix 3000 sonicator (10 cycles of 30 seconds each (18–21 W) on ice, with 60 seconds on ice between cycles). The sonicated lysate was clarified once by centrifugation at 16,000 rcf for 10 minutes at 4° C. The input material was set aside, and the remainder was incubated overnight at 4° C. with magnetic beads coupled to Bethyl A300-405A CDK7 antibody to enrich for DNA fragments bound by CDK7.The beads were washed twice with each of the following buffers: Wash Buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na deoxycholate, 1% Triton® X-100, 0.1% SDS), Wash Buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na deoxycholate, 1% Triton® X-100, 0.1% SDS), Wash Buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% Na deoxycholate, 0.5% IGEPAL). C-630, 0.1% SDS), Wash Buffer D (TE containing 0.2% Triton® X-100), and TE buffer. DNA was eluted from the beads by incubation at 65°C for 1 hour with intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS). Crosslinks were reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE was added, and RNA was then degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 hours. Protein was degraded by adding 10 mL of 20 mg / mL Proteinase K (Invitrogen, 25530049) and incubating at 55°C for 2 hours. Phenol:chloroform:isoamyl alcohol extraction followed by ethanol precipitation was performed. The DNA was then resuspended in 50 mL of TE and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit's instructions. After library preparation, ChIP libraries were run on a 2% gel using a collection size window of 200-600 bases in PippinHT. The final libraries were quantified by qPCR using Roche's KAPA Library Quantification Kit and sequenced on an Illumina HiSeq 2500 in single-read mode at 40 bases.

[0327] HCT116 cells were grown in complete DMEM medium to 80% confluence and subsequently treated with JQ1 or DMSO for 24 hours. Cells were then permeabilized (1:1000 in medium with a solution of tx100 in PBS for 10 minutes at 37°C) and subsequently treated with DMF or cisplatin for 6 hours. Cells were crosslinked for 15 minutes using 1% formaldehyde in PBS, followed by quenching with glycine to a final concentration of 125 mM on ice. Cells were washed with cold PBS and collected by scraping in cold PBS. Collected cells were pelleted at 1000 g for 3 minutes at 4°C, flash-frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared cOmplete protease inhibitor (Roche, 11873580001). Frozen crosslinked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitors), rotated for 10 minutes at 4° C., and then centrifuged at 1350 rcf for 5 minutes at 4° C. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitors), rotated for 10 minutes at 4° C., and centrifuged at 1350 rcf for 5 minutes at 4° C. The pellet was resuspended in sonication buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% Na-deoxycholate, 0.1% SDS, protease inhibitors) and then sonicated in a Misonix 3000 sonicator (10 cycles of 30 s each on ice (18-21 W), with 60 s between cycles on ice). The sonicated lysate was clarified once by centrifugation at 16,000 rcf for 10 min at 4°C. The input material was retained, and the remainder was incubated overnight at 4°C with magnetic beads coupled to MED1 antibody (Bethyl A300-793A) to enrich for DNA fragments bound by MED1.The beads were washed with each of the following buffers: twice with sonication buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% Na-deoxycholate, 0.1% SDS), once with high salt sonication buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% Na-deoxycholate, 0.1% SDS), once with LiCl wash buffer (20 mM Tris pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% NP-40, 0.5% Na-deoxycholate), and once with TE buffer. DNA was eluted from the beads by incubation in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS) at 65°C for 15 minutes with agitation. Crosslinks were reversed at 65°C for 12 hours. To purify the eluted DNA, 200 mL of TE was added, and then RNA was degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 hours. Protein was degraded by adding 4 μl of 20 mg / mL Proteinase K (Invitrogen, 25530049) and incubating at 55°C for 30 minutes. DNA was purified using a Qiagen PCR purification kit, eluted in 30 μl of buffer EB, and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library. Library preparation was performed using the ChIP Kit according to the kit's instructions. After library preparation, ChIP libraries were run on a 2% gel using a PippinHT with a collection size window of 200-400 bases. The final library was quantified by qPCR using the Roche KAPA Library Quantification Kit and sequenced on an Illumina HiSeq 2500 in single-read mode at 50 bases.

[0328] ChIP-Seq data were aligned to the mm9 version of the mouse reference genome using bowtie, with the parameters -k 1, -m 1, -best, and -l set to read length. Wiggle files displaying binned read coverage were generated using MACS with the parameters -w, -S, -space=50, -nomodel, and -shiftsize=200. Read counts per bin were normalized to millions of aligned reads and used to generate wiggle files. Wiggle files normalized to reads per million were viewed in the UCSC Genome Browser. For ChIP-Seq of ER, MED1, BRD4, and H3K9me3 in MCF7 cells, published datasets were used (GEO GSE60270, GSM1348516, and GSM945857, respectively).

[0329] Purification of CDK8-mediator

[0330] CDK8-mediator samples were purified as described (55) with modifications. Prior to affinity purification, the P0.5M / QFT fraction was concentrated to 12 mg / mL (35%) by ammonium sulfate precipitation. Before the affinity purification step, the pellet was resuspended in a pH 7.9 buffer containing 20 mM KCl, 20 mM HEPES, 0.1 mM EDTA, 2 mM MgCl, and 20% glycerol, and then dialyzed against a pH 7.9 buffer containing 0.15 M KCl, 20 mM HEPES, 0.1 mM EDTA, 20% glycerol, and 0.02% NP-40. Affinity purification was performed as described, and the eluted material was loaded into a 2.2 mL centrifuge tube containing 2 mL of 0.15 M KCl HEMG (20 mM HEPES, 0.1 mM EDTA, 2 mM MgCl, 10% glycerol) and centrifuged at 500 RPM for 4 hours at 4 °C. This served to remove excess free GST-SREBP and concentrate the CDK8-mediator in the final fraction. Prior to droplet assays, the purified CDK8-...

Claims

[Claim 1] The invention described in the specification.

Images