Amplification methods and systems for merfish and other applications

Abstract

To provide methods for imaging or determining nucleic acids in cells or other samples.SOLUTION: A method comprises: exposing a sample to nucleic acid probes; exposing the nucleic acid probes to primary amplifier nucleic acids able to bind to the nucleic acid probes; determining a distribution of the nucleic acid probes within the sample using fluorescence; and creating codewords based on the fluorescence distribution within the sample.SELECTED DRAWING: Figure 1-2

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 62 / 779,333, filed December 13, 2018, by Zhuang et al., entitled "Amplification Methods and Systems for MERFISH and Other Applications," which is incorporated herein by reference in its entirety.

[0002] Government funding This invention was made with government support under Nos. MH113094, MH111502, and MH114830 awarded by the National Institutes of Health. The United States Federal Government has certain rights in this invention.

[0003] Field The present invention relates generally to systems and methods for imaging or determining nucleic acids in cells or other samples. [Background technology]

[0004] Single-molecule fluorescence in situ hybridization (smFISH) reveals both the abundance and spatial location of RNA molecules within single cells through the direct detection of individual RNA molecules. Using this technique, RNA localization has been shown to be associated with multiple cellular functions, including the development of body patterning, cell fate determination during cell division, localized translation, cell migration, and polarity establishment. To study RNA localization on a transcriptome scale within intact cells and tissues, MERFISH (multiplexed error-robust fluorescence in situ hybridization) and in situ sequencing have been developed. Among these, MERFISH uses error-robust binary barcoding and sequential imaging to multiplex smFISH measurements with high detection efficiency. However, a higher signal photon count would improve throughput, which is limited by the image acquisition speed, light scattering caused by imaging deep tissues, and a low signal-to-background ratio due to sample autofluorescence. Therefore, improvements in photon counting are needed to substantially increase imaging throughput, enable targeting of short RNAs that may not allow sufficient probe binding to provide a signal above background levels, and / or extend multiplex measurements to sample types with high levels of background signal.

[0005] However, the performance of multiplexed single-molecule RNA imaging depends on many characteristics that can be compromised or challenged by signal amplification. For example, it is often important that the variation in signal intensity between molecules be relatively small. Similarly, it is often important that the physical size of the signal, or the spread from individual molecules, be as small as possible to prevent substantial overlap of signals from physically adjacent molecules. In parallel, amplification methods may not be highly efficient, resulting in some molecules not being amplified while others are, resulting in a reduced proportion of detected molecules. In addition, it is often important to be able to amplify multiple, orthogonal molecular signals, and it is extremely important that the amplification method be able to be rapidly extended to more significantly different molecular signals. Finally, such amplification methods should be rapid so as to reduce sample preparation time. For these reasons, there is a need for amplification methods that do not introduce variation in signal intensity or increase the physical spread of signals from individual molecules, are highly efficient in amplifying signals from all target molecules, and can be rapidly extended to multiple significantly different targets. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention relates generally to systems and methods for imaging or determining nucleic acids in cells or other samples. The subject matter of the invention sometimes involves interrelated products, alternative solutions to a particular problem, and / or multiple different uses of one or more systems and / or items. [Means for solving the problem]

[0007] In one aspect, the invention is generally directed to a method. According to a first set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplifier nucleic acid capable of binding to the nucleic acid probe, wherein a maximum number of the primary amplifier nucleic acids are capable of binding to the nucleic acid probe, exposing the primary amplifier nucleic acid to a secondary amplifier nucleic acid capable of binding to the primary amplifier nucleic acid, wherein a maximum number of the secondary amplifier nucleic acids are capable of binding to the primary amplifier nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, creating codewords based on the fluorescence distribution in the sample, and matching the codewords to valid codewords for at least some of the codewords, and if a match is not found, optionally applying error correction to the codeword to form a valid codeword.

[0008] In another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, creating code words based on the fluorescence distribution in the sample, and, for at least some of the code words, matching the code words to valid code words, where if a match is not found, optionally applying error correction to the code words to form valid code words.

[0009] In yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, creating code words based on the fluorescence distribution in the sample, and for at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words.

[0010] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, creating code words based on the fluorescence distribution in the sample, and, for at least some of the code words, matching the code words to valid code words, where if a match is not found, optionally applying error correction to the code words to form valid code words.

[0011] In yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, creating code words based on the fluorescence distribution in the sample, and, for at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words.

[0012] In one set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to primary amplified nucleic acids that are capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0013] In another set of embodiments, a method includes exposing a sample to nucleic acid probes, exposing the nucleic acid probes to primary amplified nucleic acids capable of binding to the nucleic acid probes, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probes, determining a distribution of the nucleic acid probes in the sample using fluorescence, and creating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, wherein if a match is not found, optionally applying error correction to the code words to form valid code words.

[0014] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0015] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, wherein if a match is not found, optionally applying error correction to the code words to form valid code words.

[0016] In one set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid binds to the nucleic acid probe within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0017] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0018] A method according to yet another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, wherein if a match is not found, optionally applying error correction to the code words to form valid code words.

[0019] According to yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acids to secondary amplified nucleic acids capable of binding to the primary amplified nucleic acids, wherein a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acids, determining a distribution of the nucleic acid probes in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0020] In another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable, using fluorescence to determine a distribution of the nucleic acid probe in the sample, and creating a code word based on the fluorescence distribution in the sample.

[0021] In yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0022] In yet another set of embodiments, a method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, using fluorescence to determine a distribution of the nucleic acid probe in the sample, and creating a code word based on the fluorescence distribution in the sample.

[0023] In yet another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, using fluorescence to determine a distribution of the nucleic acid probe in the sample, and creating a code word based on the fluorescence distribution in the sample.

[0024] A method according to another set of embodiments includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0025] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0026] According to yet another set of embodiments, a method includes exposing a sample to a binding entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0027] In yet another set of embodiments, the method includes exposing a sample to a binding entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplified nucleic acid to the target is saturable, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0028] In one set of embodiments, the method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0029] In another set of embodiments, a method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable, using fluorescence to determine a distribution of the nucleic acid probe in the sample, and creating a code word based on the fluorescence distribution in the sample.

[0030] According to yet another set of embodiments, a method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, determining a distribution of the nucleic acid probe in the sample using fluorescence, and creating a code word based on the fluorescence distribution in the sample.

[0031] In yet another set of embodiments, the method includes exposing a sample to a targeting entity conjugated to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of four naturally occurring nucleotides, using fluorescence to determine a distribution of the nucleic acid probe in the sample, and creating a code word based on the fluorescence distribution in the sample.

[0032] In one set of embodiments, a method includes exposing a sample to a nucleic acid probe, the nucleic acid probe comprising a first portion comprising a target sequence and a second portion comprising one or more read sequences, at least some of the plurality of nucleic acid probes comprising distinguishable nucleic acid probes formed from a combinatorial combination of one or more read sequences taken from the plurality of read sequences, and exposing the nucleic acid probe to primary amplified nucleic acids and secondary amplified nucleic acids, wherein the primary amplified nucleic acids are capable of binding to the nucleic acid probes and the secondary amplified nucleic acids are capable of binding to the primary nucleic acid probes, and wherein the maximum number of targets in the sample associated with the primary amplified nucleic acids and the secondary amplified nucleic acids is constant.

[0033] In another set of embodiments, the method includes exposing a sample to a nucleic acid probe, exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, determining a distribution of the secondary amplified nucleic acid in the sample using fluorescence, creating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, and if a match is not found, applying error correction to the code words to form valid code words.

[0034] In another aspect, the invention includes methods of performing one or more of the embodiments described herein. In yet another aspect, the invention includes methods of using one or more of the embodiments described herein.

[0035] Other advantages and novel features of the present invention will become apparent from the following detailed description of various non-limiting embodiments of the invention when considered in conjunction with the accompanying drawings.

[0036] Non-limiting embodiments of the present invention are described, by way of example, with reference to the accompanying drawings, which are schematic and are not intended to be drawn to scale. In the figures, each identical or nearly identical component illustrated is typically represented by a single numeral. For purposes of clarity, unless illustration is necessary to enable those skilled in the art to understand the invention, not every component will be shown in every figure, nor will every component of every embodiment of the invention be shown. [Brief explanation of the drawings]

[0037] [Figure 1-1] 1A-1E provide schematic illustrations of embodiments in which primary and secondary amplification nucleic acids are used to amplify a signal. [Figure 1-2] Same as above [Figure 2-1] 2A-2F illustrate that amplification can dramatically increase signal brightness without a substantial change in spot size, according to another embodiment of the present invention. [Figure 2-2] Same as above [Figure 3-1] 3A-3F illustrate MERFISH measurements on 130 RNAs in yet another embodiment of the present invention. [Figure 3-2] Same as above [Figure 4] 4A-4C illustrate amplification in a tissue sample in yet another embodiment of the present invention. [Figure 5-1] 5A-5C illustrate certain example sequences used for amplification in one embodiment of the present invention. [Figure 5-2] Same as above [Figure 5-3] Same as above DETAILED DESCRIPTION OF THE INVENTION

[0038] The present invention generally relates to systems and methods for imaging or determining nucleic acids in cells or other samples. In some cases, the transcriptome of a cell may be determined. Certain embodiments are generally directed to determining nucleic acids and other targets in a sample at relatively high resolution. For example, a nucleic acid probe may be applied to the sample, and binding of the nucleic acid probe to the target may be amplified using primary and secondary amplification nucleic acids. In some cases, there is a maximum number of amplified nucleic acids that can bind to the target; for example, binding is saturable and cannot grow indefinitely, even in the presence of abundant reagents. This may be advantageous, for example, to control the brightness of each binding event, control the size of the amplified region (e.g., during imaging), and / or limit amplification noise (i.e., the ultimate variability of the amplified signal between molecules), etc. Additionally, in some embodiments, the primary and / or secondary amplification nucleic acids may be formed from only three of the four naturally occurring nucleotides, which may result in reduced secondary structure, increased binding rates, etc. These properties potentially facilitate the rapid design of multiple orthogonal amplification sequences, allowing the extension of such techniques to many significantly different molecular targets.

[0039] In one aspect, the present invention is generally directed to systems and methods for amplifying the signals of targets (potentially tens, hundreds, thousands, or more) in a biological sample using MERFISH or other techniques, e.g., for imaging. For example, in some embodiments, these techniques provide a rapid, simple, and / or efficient way to simultaneously amplify the signals of hundreds or thousands of RNA targets, e.g., within the native environment of a biological sample. Such amplification can, in certain embodiments, be well-controlled by using a saturable system, as discussed herein. This allows for minimization of spot-to-spot brightness variations during amplification, which can be useful in decoding using MERFISH or other techniques. In some embodiments, the size of the amplified spots is also not increased. This can, for example, improve the ability to identify targets located relatively close to each other. For example, if the spot size is increased too much, the signal from one target may overlap with the signal from another target. In addition, as discussed below, in some embodiments, the amplification nucleic acid does not contain, for example, a hairpin structure that may be involved in the amplification process, which can facilitate the creation of a saturable system and / or allow the design of a multiplex amplification sequence (amplifier) system to be applied to multiple targets. In addition, as also discussed below, the amplification nucleic acid can be constructed using only three nucleotides. Three-letter nucleotides can have significantly less secondary structure and faster binding rates than four-letter nucleotides. In addition, in some cases, for example, by reducing the possibility of unintended secondary structures, the likelihood that any given amplification sequence will function reliably is increased.

[0040] A non-limiting example of such a system is now illustrated in Figures 1A-1E. In Figure 1A, a target 10 (in this example, RNA) is illustrated. Hundreds or thousands of targets may be distributed within a biological sample (e.g., within a cell or tissue), and their distribution can be determined by using the binding of nucleic acid probes to the targets, e.g., using fluorescent probes, and imaging the sample. Note, however, that for clarity, only a single target is illustrated in this figure.

[0041] In some embodiments, multiple nucleic acid probes with different sequences are used, and the distribution of each nucleic acid probe is analyzed sequentially and used to create a "code word" for each location based on the binding pattern of each nucleic acid probe. By selecting nucleic acid probes that define the appropriate code space, apparent errors in the observed binding pattern may be identified and / or discarded and / or corrected to identify the correct code word, thereby identifying the correct target of the nucleic acid probe in the sample. This error-robust system and error correction system were first introduced for MERFISH (multiplexed error-robust fluorescence in situ hybridization) and have since been used in a variety of related techniques. See, for example, International Patent Application Publication Nos. WO 2016 / 018960 and WO 2016 / 018963, each of which is incorporated herein by reference in its entirety.

[0042] An example of an encoding nucleic acid probe is shown in FIG. 1A , in which encoded nucleic acid probe 15 (indicated by a dotted box) is bound to target 10, e.g., target RNA. Other nucleic acid probes 16, 17 may also bind to target RNA and / or other targets in a sample. Probe 15 may include target sequence 11 capable of binding to target RNA (e.g., via specific binding) and lead sequence 12 (or "readout" sequence), i.e., a sequence that can be "read" to determine whether binding occurred or not. There may be one, two, three, or more lead sequences on a probe. For example, in this example, there are two such lead sequences on probe 15 (identified as lead sequence 12 and lead sequence 19). Each lead sequence may independently be the same or different. Additionally, probes such as 16 and 17 may have the same or different number of lead sequences and / or the same or different structure as nucleic acid probe 15.

[0043] If no amplification is applied, nucleic acid probe 15 can be exposed to a suitable secondary nucleic acid probe 32 containing a signaling entity 40, as shown in Figure 1E. In this example, the signaling entity is linked to the secondary nucleic acid probe via a disulfide linkage, although other techniques can be used in other embodiments. However, in this case, only one signaling entity can be linked to the target. Therefore, detecting and using a single signaling entity to determine binding of nucleic acid probe 15 to target 10 is relatively difficult due to the low signal intensity resulting after such a binding event.

[0044] Thus, in FIG. 1B , a primary amplification nucleic acid 20 can be used according to certain embodiments. The primary amplification nucleic acid can contain a first primary recognition sequence 22 capable of binding (e.g., specifically) to the lead sequence of the nucleic acid probe 15, as discussed below, and one or more primary read sequences 23 capable of binding (e.g., specifically) to one or more secondary amplification nucleic acids. In this example, "N" such read sequences are shown schematically within the primary amplification nucleic acid (N can be, for example, 5, 7, 9, or other numbers, as discussed herein). The primary read sequences can each have the same or different sequences and can have the same or different lengths. In this example, each read sequence is 20 nucleotides long, but this is for illustrative purposes only. Additionally, as already mentioned, while two such primary amplification nucleic acids are shown in this example, this is for illustrative purposes only, and other numbers of primary amplification nucleic acids can be attached to a nucleic acid probe in other embodiments.

[0045] 1C, a secondary amplified nucleic acid 30 can then be attached to the primary amplified nucleic acid. The secondary amplified nucleic acid can contain a first recognition sequence 33 capable of binding (e.g., specifically) to the lead sequence 23 of the primary amplified nucleic acid 20, and one or more secondary lead sequences 34 capable of binding to a signal-generating entity, as discussed below.

[0046] As with the primary amplified nucleic acid, there can be any number of secondary read sequences within the secondary amplified nucleic acid, as shown in this figure. The secondary read sequences can each have the same or different sequence compared to one another and can have the same or different length. The secondary read sequences can also be the same or different from the read sequence of the primary amplified nucleic acid. In this example, each secondary amplified nucleic acid can have "M" read sequences. M can be, for example, 5, 7, 9, or other numbers, as discussed herein, and M can be the same or different from N.

[0047] In Figure ID, multiple signal-generating entities 40 are attached to the lead sequence of the secondary amplified nucleic acid. In this example, the signal-generating entities are each attached via a disulfide linkage, although other techniques may be used in other embodiments, as discussed herein.

[0048] In addition, in this case, it is expected that there is a maximum number or saturation limit for the signal-generating entities bound to each lead sequence of the target sequence. In this particular example, assuming that both have substantially the same structure (they do not necessarily have the same structure, i.e., for example, if amplified nucleic acids with different structures are used, the same number of N x M positions are available), N x M such positions are available for each lead sequence of the nucleic acid probe (two such lead sequences in this figure). Therefore, the number of signal-generating entities that can associate with a given target is a finite and predictable number and cannot grow indefinitely or without binding.

[0049] In this example, two read sequences, read sequences 12 and 19, are discussed, each of which may have a primary amplified nucleic acid and a secondary amplified nucleic acid, and an associated signal-generating entity. These may or may not have the same or different structures, e.g., the signal-generating entity and / or amplified nucleic acid associated with read sequence 12 is not associated with read sequence 19, and vice versa. (However, as noted above, in this example, the two read sequences are presented for illustrative purposes only; in other embodiments, there may be one, two, three, four, etc. significantly different read sequences that may be amplified in parallel using similar techniques, including, e.g., techniques involving significantly different amplified nucleic acids.) The read sequences may be determined independently, e.g., sequentially or simultaneously, by determining the signal-generating entity associated with each of the read sequences, which may be the same or different. For example, as shown in Figure 1D, signal generating entity 40 can be associated with primary amplified nucleic acid 20 and secondary amplified nucleic acid 30, and ultimately with lead sequence 12, but not with lead sequence 19 or the primary amplified nucleic acid and secondary amplified nucleic acid associated therewith, primary amplified nucleic acid 29 and secondary amplified nucleic acid 39, respectively.

[0050] Additionally, in some embodiments, amplification can involve combining only one round of amplified nucleic acids (resulting in an N-fold amplification), two rounds (resulting in an N×M-fold amplification), three rounds (resulting in an N×M×O-fold amplification, where the third round molecule contains O lead sequences), or more rounds, as the case may be. Any number of rounds of amplification can be applied, as the case may be.

[0051] In addition, a sample may contain nucleic acid probes with many different readout sequences that can be recognized, for example, using different amplification nucleic acids or signal-generating entities. For example, 8, 10, 12, 14, 16, 24, 32, 48, 64, or other numbers of readout sequences, including more than 64 rounds, could be used. In some cases, a unique amplification nucleic acid can be used to amplify a readout sequence, for example, by amplifying the original readout sequence using an appropriate amplification nucleic acid, for example, into N x M copies. In certain cases, the amplification nucleic acid can be efficiently designed. For example, by utilizing only three of the four nucleotides in the sequence of the amplification nucleic acid, the probability of unexpected secondary structures in the amplified nucleic acid can be reduced. Without wishing to be bound by theory, it is believed that because the effect of such secondary structures on the amplified nucleic acid itself or on the binding of subsequent amplified nucleic acids is difficult to predict, reducing or eliminating secondary structure can increase the probability that a given amplified nucleic acid will assemble properly, which may facilitate the design and use of multiple orthogonal amplified nucleic acids. In addition, because reducing secondary structure may also inhibit the binding rate of these amplified nucleic acids, such design considerations may shorten the time required to assemble such structures, reduce the amount of amplified nucleic acid required for each sample, etc.

[0052] The controlled amplification provided by this approach is in contrast to techniques such as hairpin unfolding or rolling circle amplification, in which signal amplification virtually uncontrollably or indefinitely occurs when sufficient reagents are present. Such uncontrolled amplification can be difficult to accurately determine because the amount of signal present may not correlate well with the number of targets or the location of the targets (e.g., because a large amount of signal is created by uncontrolled amplification, the "spot size" that appears in the microscope image may grow large and not necessarily be centered near the target, impairing image resolution or interfering with signals from other nearby targets). In contrast, the use of saturable amplification methods discussed herein can create the maximum number of signal-generating entities that can associate with the target, which limits the spot size, creates uniformity in the brightness or intensity of the spot, improves detection, etc.

[0053] As mentioned, in certain embodiments, such techniques can be combined with error correction, for example, as used in MERFISH or other similar techniques. For example, a code word can be based on the binding (or non-binding) of multiple nucleic acid probes, and in some cases, the code word can define an error correction code that helps reduce or prevent misidentification of nucleic acid probes. In some cases, for example, by using a variety of combinatorial methods, a relatively large number of different targets can be identified using a relatively small number of labels. Image acquisition methods such as STORM can also be used to image such samples and facilitate the determination of nucleic acid probes. For example, for further details regarding techniques such as MERFISH, see U.S. Patent No. 9,712,805 or U.S. Patent No. 10,073,035, or International Patent Application Publication No. WO2008 / 091296 or WO2009 / 085218, each of which is incorporated herein by reference in its entirety.

[0054] The above discussion is a non-limiting example of one embodiment of the present invention that may be used to improve the determination of targets in a sample using MERFISH or other techniques. However, in addition to the embodiments described above, other embodiments may also be possible. Thus, more generally, various aspects of the present invention are directed to various systems and methods for imaging or determining nucleic acids in cells or other samples.

[0055] Thus, certain embodiments are directed to determining samples that may include cell cultures, cell suspensions, biological tissues, biopsies, organisms, etc. The sample may also be acellular, but may nevertheless optionally contain nucleic acids. If the sample contains cells, the cells may be human cells or any other suitable cells, e.g., mammalian cells, fish cells, insect cells, plant cells, etc. In some cases, more than one cell may be present.

[0056] In a sample, the targets to be determined may include nucleic acids, proteins, etc. The nucleic acids to be determined may include, for example, DNA (e.g., genomic DNA), RNA, or other nucleic acids present in the cell (or in other samples). The nucleic acids may be endogenous to the cell or may be added to the cell. For example, the nucleic acids may be viral or artificially created. In some cases, the nucleic acids to be determined may be expressed by the cell. In some embodiments, the nucleic acid is RNA. The RNA may be coding RNA and / or non-coding RNA. For example, the RNA may encode a protein. Non-limiting examples of RNA that may be studied in a cell include mRNA, siRNA, rRNA, miRNA, tRNA, lncRNA, snoRNA, snRNA, exRNA, piRNA, etc.

[0057] In some cases, a substantial portion of the nucleic acids in a cell can be studied. For example, in some cases, a sufficient amount of RNA present in a cell can be determined to provide a partial or complete cellular transcriptome. In some cases, at least four mRNAs in the cell are determined, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 300, at least 315, at least 325, at least 326, at least 327, at least 328, at least 329, at least 400, at least 401, at least 402, at least 403, at least 404, at least 405, at least 406, at least 407, at least 408, at least 409, at least 509, at least 510, at least 511, at least 512, at least 513, at least 514, at least 515, at least 516, at least 518, at least 519 ... At least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000, or at least 100,000 mRNAs can be determined.

[0058] In some cases, the transcriptome of a cell can be determined. It should be understood that transcriptome generally includes all RNA molecules produced in a cell, not just mRNA. Thus, for example, transcriptome can also include rRNA, tRNA, siRNA, etc. in certain cases. In some embodiments, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the transcriptome of a cell can be determined.

[0059] In some embodiments, other targets to be determined may include targets linked to nucleic acids, proteins, etc. For example, in one set of embodiments, a binding entity capable of recognizing a target may be conjugated to a nucleic acid probe. The binding entity may be any entity that can recognize a target, for example, specifically or non-specifically. Non-limiting examples include enzymes, antibodies, receptors, complementary nucleic acid strands, aptamers, etc. For example, an antibody linked to an oligonucleotide may be used to determine the target. The target may be capable of binding to an antibody linked to an oligonucleotide, and the oligonucleotide may be determined as discussed herein.

[0060] The determination of a target, such as a nucleic acid, in a cell or other sample may be qualitative and / or quantitative. In addition, the determination may be spatial, for example, the location of a nucleic acid or other target in a cell or other sample may be determined in two or three dimensions. In some embodiments, the location, number, and / or concentration of a nucleic acid or other target in a cell or other sample may be determined.

[0061] In some cases, a substantial portion of the genome of a cell may be determined. The determined genome segments may be continuous or interrupted in the genome. For example, in some cases, at least four genome segments are determined in the cell, and in some cases, at least 3, at least 4, at least 7, at least 8, at least 12, at least 14, at least 15, at least 16, at least 22, at least 30, at least 31, at least 32, at least 50, at least 63, at least 64, at least 72, at least 75, at least 100, at least 127, at least 128, at least 140, at least 255, at least 256, at least 300, at least 315, at least 320, at least 325, at least 326, at least 327, at least 328, at least 328, at least 329, at least 330, at least 335, at least 336, at least 337, at least 338, at least 339, at least 340, at least 341, at least 342, at least 343, at least 344, at least 345, at least 346, at least 348, at least 349, at least 349, at least 349, at least 349, at least 349, at least 350, at least 351, at least 352, at least 353, at least 354, at least 355, at least 356, at least 357, at least 358, at least 359 ... At least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 4,000, at least 5,000, at least 7,500, at least 10,000, at least 12,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 40,000, at least 50,000, at least 75,000, or at least 100,000 genome segments may be determined.

[0062] In some cases, the entire genome of a cell can be determined. It should be understood that a genome generally encompasses all DNA molecules produced in a cell, not just chromosomal DNA. Thus, for example, a genome can also optionally include, for example, mitochondrial DNA, chloroplast DNA, plasmid DNA, etc., in addition to (or rather than) chromosomal DNA. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% of the genome of a cell can be determined.

[0063] As discussed herein, various nucleic acid probes can be used to determine one or more targets in cells or other samples. The probe can include nucleic acids (or entities that can specifically hybridize with nucleic acids, for example), such as DNA, RNA, LNA (locked nucleic acid), PNA (peptide nucleic acid), and / or combinations thereof. In some cases, additional components can also be present in the nucleic acid probe, for example, as discussed below. In addition, any suitable method can be used to introduce the nucleic acid probe into cells.

[0064] For example, in some embodiments, cells are fixed before introducing a nucleic acid probe, e.g., to preserve the location of nucleic acids or other targets within the cells. Techniques for fixing cells are known to those skilled in the art. By way of non-limiting example, cells can be fixed using chemicals such as formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, acetone, and acetic acid. In one embodiment, cells can be fixed using HEPES-glutamate buffer-mediated organic solvent (HOPE).

[0065] Nucleic acid probes can be introduced into cells (or other samples) using any suitable method. In some cases, cells can be sufficiently permeabilized so that the nucleic acid probes can be introduced into the cells by bringing a fluid containing the nucleic acid probes into the vicinity of the cells. In some cases, cells can be sufficiently permeabilized as part of a fixation process, and in other embodiments, cells can be permeabilized by exposure to certain chemicals, such as ethanol, methanol, Triton, etc. Additionally, in some embodiments, techniques such as electroporation or microinjection can be used to introduce nucleic acid probes into cells or other samples.

[0066] Thus, certain embodiments are generally directed to nucleic acid probes that are introduced into cells (or other samples). Depending on the application, the probes may comprise any of a variety of entities that can hybridize to nucleic acids, such as DNA, RNA, LNA, PNA, etc., typically by Watson-Crick base pairing. The nucleic acid probe typically contains a target sequence that is capable of binding to at least a portion of a target, e.g., a target nucleic acid. In some cases, the binding can be specific (e.g., via complementary binding). Once introduced into a cell or other system, the target sequence can be capable of binding to a specific target (e.g., mRNA or other nucleic acid discussed herein). The nucleic acid probe may also contain one or more lead sequences, discussed below.

[0067] In some cases, more than one type of nucleic acid probe may be applied to a sample, for example, sequentially or simultaneously. For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinguishable nucleic acid probes may be applied to a sample. In some cases, nucleic acid probes may be added sequentially. However, in some cases, more than one nucleic acid probe may be added simultaneously.

[0068] Nucleic acid probes can include one or more target sequences, which can be located anywhere within the nucleic acid probe.Target sequences can contain a region that is substantially complementary to a target, for example, a portion of a target nucleic acid.For example, in some cases, a portion can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary, for example, to achieve specific binding.Typically, complementarity is determined based on Watson-Crick nucleotide base pairing.

[0069] In some cases, the target sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the target sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible; for example, the target sequence may have a length of between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0070] For targets that are likely to exist in cells or other samples, the target sequence of a nucleic acid probe can be determined.For example, the target nucleic acid for a protein can be determined using the sequence of the protein, for example, by determining the nucleic acid that is expressed to form the protein.In some cases, only a portion of the nucleic acid that encodes the protein, for example, having the length discussed above, can be used.In addition, in some cases, more than one target sequence can be used to identify a specific target.For example, multiple probes can be used that can sequentially and / or simultaneously bind to the same or different regions of the same target, or sequentially and / or simultaneously hybridize with it.Hybridization typically refers to the annealing process in which complementary single-stranded nucleic acids associate through Watson-Crick nucleotide base pairing (for example, hydrogen bonds between guanine and cytosine and between adenine and thymine) to form double-stranded nucleic acid.

[0071] In some embodiments, a nucleic acid probe may also include one or more "lead" sequences. The lead sequence may be used to identify the nucleic acid probe, for example, through association with a signal-generating entity, as discussed below. In some embodiments, a nucleic acid probe may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 24 or more, 32 or more, 40 or more, 48 or more, 50 or more, 64 or more, 75 or more, 100 or more, or 128 or more lead sequences. The lead sequences may be located anywhere within the nucleic acid probe. When more than one lead sequence is present, the lead sequences may be located adjacent to each other and / or may be interrupted by other sequences.

[0072] The lead sequence can be any length. When more than one lead sequence is used, the lead sequences can be independently the same or different. For example, the lead sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence may have a length between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0073] In some embodiments, the lead sequence may be arbitrary or random. In certain cases, the lead sequence is selected to reduce or minimize homology with other components of a cell or other sample, for example, so that the lead sequence itself does not bind or hybridize with other nucleic acids likely to be present in the cell or other sample. In some cases, the homology may be less than 10%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%. In some cases, there may be less than 20 base pairs, less than 18 base pairs, less than 15 base pairs, less than 14 base pairs, less than 13 base pairs, less than 12 base pairs, less than 11 base pairs, or less than 10 base pairs of homology. In some cases, such base pairs are consecutive.

[0074] In one set of embodiments, the nucleic acid probe population may contain a certain number of lead sequences, which may in some cases be less than the number of nucleic acid probe targets. Those skilled in the art will appreciate that when there is one signal-generating entity and n lead sequences, generally there are 2 n It will be appreciated that up to 1 different nucleic acid target can be uniquely identified. However, not all possible combinations need to be used. For example, a nucleic acid probe population can target 12 different nucleic acid sequences but contain no more than 8 lead sequences. As another example, a nucleic acid population can target 140 different nucleic acid sequences but contain no more than 16 lead sequences. By using different combinations of lead sequences within each probe, different nucleic acid sequence targets can be individually identified. For example, each probe can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, etc., or more lead sequences. In some cases, nucleic acid probe populations can each contain the same number of lead sequences, but in other cases, different numbers of lead sequences can be present on various probes.

[0075] By way of non-limiting example, a first nucleic acid probe may contain a first target sequence, a first lead sequence, and a second lead sequence, while a second, different nucleic acid probe may contain a second target sequence, the same first lead sequence, but not the second lead sequence, but a third lead sequence. Such probes may thus be distinguished by determining the various lead sequences present in or associated with a given probe or location, as discussed herein. For example, probes may be sequentially identified and encoded using "code words," as discussed below. Code words may also be subject to error detection and / or correction.

[0076] Additionally, in certain embodiments, nucleic acid probe populations (and their corresponding, complimentary sites on coded probes) can be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G"s or excluding all "C"s within the probe population. In certain embodiments, sequences lacking "G"s or "C"s may form fewer secondary structures and contribute to more homogeneous and rapid hybridization. Thus, in some cases, nucleic acid probes can contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0077] In one embodiment, the lead sequence on the nucleic acid probe may be capable of binding (e.g., specifically) to a recognition sequence on the corresponding primary amplified nucleic acid. Thus, when the nucleic acid probe recognizes a target in a biological sample, such as a DNA or RNA target, the primary amplified nucleic acid may also associate with the target via the nucleic acid probe through interaction, e.g., complementary binding, between the lead sequence of the nucleic acid probe and the corresponding recognition sequence on the primary amplified nucleic acid. For example, the recognition sequence may be capable of recognizing the target lead sequence but not substantially recognizing or substantially binding to other non-target lead sequences. The primary amplified nucleic acid may also include any of a variety of entities capable of hybridizing with nucleic acids, such as DNA, RNA, LNA, and / or PNA, depending on the application. For example, such entities may form part or all of the recognition sequence.

[0078] In some cases, the recognition sequence can be substantially complementary to the target lead sequence.In some cases, the sequence can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.Typically, complementarity is determined based on Watson-Crick nucleotide base pairing.The structure of the target lead sequence can include the structures previously described.

[0079] In some cases, the recognition sequence can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the recognition sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible; for example, the recognition sequence may have a length of between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0080] In some embodiments, the primary amplified nucleic acid may also include one or more lead sequences capable of binding to the secondary amplified nucleic acid, as discussed below. For example, the primary amplified nucleic acid may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 32 or more, 40 or more, 50 or more, 64 or more, 75 or more, 100 or more, or 128 or more lead sequences. The lead sequences may be located anywhere within the primary amplified nucleic acid. When more than one lead sequence is present, the lead sequences may be located adjacent to each other and / or may be interrupted by other sequences. In one embodiment, the primary amplified nucleic acid includes a recognition sequence at a first end and multiple lead sequences at a second end.

[0081] In some cases, the lead sequence in the primary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence may have a length of between 10 and 20 nucleotides, between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0082] Any number of lead sequences can be present in the primary amplified nucleic acid. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more lead sequences can be present in the primary amplified nucleic acid. When more than one lead sequence is present in the primary amplified nucleic acid, the lead sequences can be the same or different. In some cases, for example, the lead sequences can all be identical.

[0083] In some embodiments, the population of primary amplified nucleic acids may be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G"s or excluding all "C"s in the nucleic acid population. In certain embodiments, sequences lacking "G"s or "C"s may form fewer secondary structures and contribute to more homogeneous and rapid hybridization. Thus, in some cases, the primary amplified nucleic acids may contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0084] In some cases, more than one type of primary amplification nucleic acid may be applied to sample, for example, sequentially or simultaneously.For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinct primary amplification nucleic acids may be applied to sample.In some cases, primary amplification nucleic acids may be added sequentially.However, in some cases, more than one primary amplification nucleic acid may be added simultaneously.

[0085] In one set of embodiments, the lead sequence on the primary amplified nucleic acid may be capable of binding (e.g., specifically) to a recognition sequence on the corresponding secondary amplified nucleic acid. Thus, if the nucleic acid probe recognizes a target in a biological sample, e.g., a DNA or RNA target, the secondary amplified nucleic acid may also associate with the target via the primary amplified nucleic acid through interaction, e.g., complementary binding, between the lead sequence of the primary amplified nucleic acid and the recognition sequence on the corresponding secondary amplified nucleic acid. For example, the recognition sequence on the secondary amplified nucleic acid may be capable of recognizing the lead sequence on the primary amplified nucleic acid, but may not substantially recognize or substantially bind to other non-target lead sequences. The secondary amplified nucleic acid may also include any of a variety of entities capable of hybridizing to nucleic acids, such as DNA, RNA, LNA, and / or PNA, depending on the application. For example, such entities may form part or all of the recognition sequence.

[0086] In some cases, the recognition sequence on the secondary amplified nucleic acid can be substantially complementary to the lead sequence on the primary amplified nucleic acid. In some cases, the sequence can be at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.

[0087] In some cases, the recognition sequence on the secondary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the recognition sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible; for example, the recognition sequence may have a length of between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0088] In some embodiments, the secondary amplified nucleic acid may also contain one or more lead sequences capable of binding to a signal-generating entity, as discussed herein. For example, the secondary amplified nucleic acid may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more, 20 or more, 32 or more, 40 or more, 50 or more, 64 or more, 75 or more, 100 or more, or 128 or more lead sequences capable of binding to a signal-generating entity. The lead sequences may be located anywhere within the secondary amplified nucleic acid. When more than one lead sequence is present, the lead sequences may be located adjacent to each other and / or may be interrupted by other sequences. In one embodiment, the secondary amplified nucleic acid contains a recognition sequence at a first end and multiple lead sequences at a second end. This structure may also be the same as or different from the structure of the primary amplified nucleic acid.

[0089] In some cases, the lead sequence in the secondary amplified nucleic acid can be at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 65, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 nucleotides in length. In some cases, the lead sequence may be no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 175, no more than 150, no more than 125, no more than 100, no more than 75, no more than 60, no more than 65, no more than 60, no more than 55, no more than 50, no more than 45, no more than 40, no more than 35, no more than 30, no more than 20, or no more than 10 nucleotides in length. Combinations of any of these may also be possible, for example, the lead sequence in the secondary amplified nucleic acid may have a length between 10 and 20 nucleotides, between 10 and 30 nucleotides, between 20 and 40 nucleotides, between 5 and 50 nucleotides, between 10 and 200 nucleotides, or between 25 and 35 nucleotides, between 10 and 300 nucleotides, etc.

[0090] Any number of read sequences may be present in the secondary amplified nucleic acid. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more read sequences may be present in the secondary amplified nucleic acid. When more than one read sequence is present in the secondary amplified nucleic acid, the read sequences may be the same or different. In some cases, for example, the read sequences may all be identical. In addition, the same or different numbers of read sequences may be present independently in the primary amplified nucleic acid and the secondary amplified nucleic acid.

[0091] In certain embodiments, the population of secondary amplified nucleic acids may be made using only two or three of the four naturally occurring nucleotide bases, such as excluding all "G"s or excluding all "C"s in the nucleic acid population. In certain embodiments, sequences lacking "G"s or "C"s may form fewer secondary structures and contribute to more homogeneous and rapid hybridization. Thus, in some cases, the secondary amplified nucleic acids may contain only A, T, and G; only A, T, and C; only A, C, and G; or only T, C, and G.

[0092] In some cases, more than one type of secondary amplification nucleic acid may be applied to a sample, for example, sequentially or simultaneously.For example, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinct secondary amplification nucleic acids may be applied to a sample.In some cases, secondary amplification nucleic acids may be added sequentially.However, in some cases, more than one type of secondary amplification nucleic acid may be added simultaneously.

[0093] Additionally, in certain embodiments, this pattern is instead repeated, e.g., with a tertiary amplification nucleic acid, a quaternary amplification nucleic acid, etc., similar to the discussion above, before the signal-generating entity. Thus, the signal-generating entity can be attached to the final amplified nucleic acid. Thus, by way of non-limiting example, a coded nucleic acid probe can be attached to a target, which can be attached to a primary amplified nucleic acid, which can be attached to a secondary amplified nucleic acid, which can be attached to a tertiary amplified nucleic acid, which can be attached to a signal-generating entity; or a coded nucleic acid probe can be attached to a target, which can be attached to a primary amplified nucleic acid, which can be attached to a secondary amplified nucleic acid, which can be attached to a tertiary amplified nucleic acid, which can be attached to a quaternary amplified nucleic acid, which can be attached to a signal-generating entity, etc. Thus, in all embodiments, the final amplified nucleic acid does not necessarily have to be a secondary amplified nucleic acid.

[0094] Other components may also be present in the nucleic acid probe or the amplified nucleic acid. For example, in one set of embodiments, one or more primer sequences may be present, for example, to facilitate enzymatic amplification. Those skilled in the art will be familiar with primer sequences suitable for applications such as amplification (e.g., using PCR or other suitable techniques). Many such primer sequences are commercially available. Other examples of sequences that may be present in the primary nucleic acid probe include, but are not limited to, promoter sequences, operons, discriminator sequences, nonsense sequences, etc.

[0095] Typically, a primer is a single-stranded or partially double-stranded nucleic acid (e.g., DNA) that serves as a starting point for nucleic acid synthesis, allowing a polymerase enzyme, such as a nucleic acid polymerase, to extend the primer and replicate the complementary strand. A primer is complementary to and hybridizes with (e.g., is designed to be complementary to and hybridize with) a target nucleic acid. In some embodiments, a primer is a synthetic primer. In some embodiments, a primer is not naturally occurring. A primer typically has a length of 10 to 50 nucleotides. For example, a primer can have a length of 10 to 40, 10 to 30, 10 to 20, 25 to 50, 15 to 40, 15 to 30, 20 to 50, 20 to 40, or 20 to 30 nucleotides. In some embodiments, a primer has a length of 18 to 24 nucleotides.

[0096] In some embodiments, one or more signal-generating entities can be bound to recognition entities on the secondary amplified nucleic acid (or other final amplified nucleic acid). Non-limiting examples of signal-generating entities include, for example, fluorescent entities (fluorophores) or phosphorescent entities, as discussed below. The signal-generating entities can then be determined, for example, to determine the nucleic acid probe or target. In some cases, the determination can be spatial, for example, in two or three dimensions. Additionally, in some cases, the determination can be quantitative, for example, the amount or concentration of the signal-generating entity and / or target can be determined.

[0097] In one set of embodiments, the signal-generating entity may be conjugated to the secondary amplified nucleic acid (or other final amplified nucleic acid). The signal-generating entity may be conjugated to the secondary amplified nucleic acid (or other final amplified nucleic acid) before or after the secondary amplified nucleic acid associates with the target in the sample. For example, the signal-generating entity may be conjugated to the secondary amplified nucleic acid first, or after the secondary amplified nucleic acid has been applied to the sample. In some cases, the signal-generating entity is added and then reacted to conjugate it to the amplified nucleic acid.

[0098] In one set of embodiments, the signal-generating entity may be attached to the nucleotide sequence via a bond that can be cleaved to release the signal-generating entity. For example, after determining the distribution of nucleic acid probes in a sample, the signal-generating entity may be released or inactivated prior to another round of nucleic acid probes and / or amplified nucleic acids. Thus, in some embodiments, the bond may be a cleavable bond, such as a disulfide bond or a photocleavable bond. Examples of photocleavable bonds are discussed in detail herein. In some cases, such bonds may be cleaved upon exposure to, for example, a reducing agent or light (e.g., ultraviolet light). For further details, see below. Other examples of systems and methods for inactivating and / or removing signal-generating entities are discussed in detail herein.

[0099] In certain embodiments, the use of primary and secondary amplification nucleic acids implies that there is a maximum number of signal-generating entities that can be bound to a given nucleic acid probe. For example, there is a maximum number of primary amplification nucleic acids that can be bound to a nucleic acid probe, due to the maximum number of secondary amplification nucleic acids that can be bound to a finite number of primary amplification nucleic acids and / or the maximum number of primary amplification nucleic acids that can be bound to lead sequences on a finite number of nucleic acid probes. While each potential position need not actually be filled with a signal-generating entity, this structure implies the existence of a saturation limit of signal-generating entities beyond which any additional signal-generating entities that may by chance be present cannot associate with the nucleic acid probe or its target.

[0100] Accordingly, certain embodiments of the present invention are generally directed to systems and methods for amplifying a signal indicative of a nucleic acid probe or its target that is saturable, i.e., there is a saturation limit, which is an upper limit on how many signal-generating entities can associate with the nucleic acid probe or its target. Typically, this number is greater than 1. For example, the upper limit of signal-generating entities can be at least 2, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 250, at least 300, at least 400, at least 500, etc. In some cases, the upper limit may be less than 500, less than 400, less than 300, less than 250, less than 200, less than 175, less than 150, less than 125, less than 100, less than 75, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10, less than 5, etc. In some cases, the upper limit may be determined as the maximum number of signal-generating entities that can bind to secondary amplified nucleic acids multiplied by the maximum number of secondary amplified nucleic acids that can bind to primary amplified nucleic acids multiplied by the maximum number of primary amplified nucleic acids that can bind to nucleic acid probes that bind to targets. In contrast, techniques such as rolling circle amplification or hairpin unfolding allow for uncontrolled signal amplification, i.e., when sufficient reagents are present, amplification can continue without a predetermined end point or saturation limit. Therefore, such techniques do not have a theoretical upper limit for the number of signal-generating entities that can associate with nucleic acid probes or their targets.

[0101] However, it should be understood that the average number of signal-generating entities actually bound to the nucleic acid probe or its target need not actually be the same as that upper limit, i.e., the signal-generating entities may not actually fully saturate (although fully saturating is possible). For example, the saturating amount (or the number of signal-generating entities bound compared to the maximum number that can be bound) can be less than 97%, less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, etc., and / or at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, etc. In some cases, allowing time for binding to occur and / or increasing the concentration of reagents can increase the saturating amount.

[0102] Due to a potential upper limit on the number of signal-generating entities actually bound to a nucleic acid probe or its target, binding events distributed, for example, spatially, in a sample may exhibit substantially uniform size and / or brightness, in contrast to uncontrolled amplification, such as the uncontrolled amplification discussed above. For example, due to the specific number of secondary amplified nucleic acids that may bind to a primary amplified nucleic acid, the secondary amplified nucleic acid may not be found beyond a fixed distance from the nucleic acid probe or its target, which may limit the "spot size," or diameter of fluorescence from the signal-generating entity, indicating binding.

[0103] In certain embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the binding events may exhibit substantially the same brightness, size (e.g., apparent diameter), color, etc., which may facilitate distinguishing the binding events from other events, such as non-specific binding, noise, etc.

[0104] Additionally, as previously discussed, certain embodiments of the present invention may use a code space that encodes multiple binding events, but may use error detection and / or correction to determine the binding of nucleic acid probes to their targets. In some cases, a population of nucleic acid probes may contain a specific "lead sequence" that can bind to a specific amplified nucleic acid, as discussed above, but the location of the nucleic acid probe or target may be determined within a specific code space using a signal-generating entity associated with the amplified nucleic acid in the sample, e.g., as discussed herein. See also International Patent Application Publication Nos. WO2016 / 018960 and WO2016 / 018963, each of which is incorporated herein by reference in its entirety. As mentioned, in some cases, a population of lead sequences within a nucleic acid probe may be combined in various combinations, e.g., as discussed herein, such that a relatively small number of lead sequences can be used to determine a relatively large number of different nucleic acid probes.

[0105] Thus, in some cases, each nucleic acid probe population may contain a certain number of lead sequences, some of which are shared among different nucleic acid probes, such that the nucleic acid probe population may contain a certain number of lead sequences. A nucleic acid probe population may have any suitable number of lead sequences. For example, a nucleic acid probe population may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. lead sequences. In some embodiments, more than 20 lead sequences may also be possible. Additionally, in some cases, a nucleic acid probe population may have a total of 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 20 or more, 24 or more, 32 or more, 40 or more, 50 or more, 60 or more, 64 or more, 100 or more, 128 or more, etc., lead sequences out of the possible lead sequences present, although some or all of the probes may each contain more than one lead sequence, as discussed herein. Additionally, in some embodiments, a nucleic acid probe population may have no more than 100, no more than 80, no more than 64, no more than 60, no more than 50, no more than 40, no more than 32, no more than 24, no more than 20, no more than 16, no more than 15, no more than 14, no more than 13, no more than 12, no more than 11, no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, or no more than 2 lead sequences present. Combinations of any of these may also be possible; for example, a nucleic acid probe population may include between 10 and 15 lead sequences in total.

[0106] As a non-limiting example of a combinatorial approach to identifying a relatively large number of nucleic acid probes from a relatively small number of lead sequences contained in the nucleic acid probes, in a population of six different types of nucleic acid probes, each containing one or more lead sequences, the total number of lead sequences in the population may not exceed four. In this example, for ease of explanation, four lead sequences are used, but it should be understood that in other embodiments, a large number of nucleic acid probes can be achieved using, for example, 5, 8, 10, 16, 32, or more lead sequences, or any other suitable number of lead sequences described herein depending on the application. For example, if each nucleic acid probe contains two different lead sequences, a maximum of six probes can be individually identified by using four such lead sequences (A, B, C, and D). In this example, the order of the lead sequences on the nucleic acid probes is not critical, i.e., "AB" and "BA" can be treated as synonymous (although in other embodiments, the order of the lead sequences may be critical, and "AB" and "BA" may not necessarily be synonymous). Similarly, if five lead sequences (A, B, C, D, and E) are used in a population of nucleic acid probes, then up to ten probes (e.g., AB, AC, AD, AE, BC, BD, BE, CD, CE, DE) can be individually identified. For example, assuming that the order of the lead sequences is not critical, one skilled in the art would know that for k lead sequences in a population, with n lead sequences on each probe, up to

[0107]

number

[0108] In some embodiments, the lead sequence and / or binding pattern of a nucleic acid probe in a sample can be used to define an error detection and / or error correction code, e.g., to reduce or prevent misidentification or errors of nucleic acids. Thus, for example, if binding is indicated (e.g., determined using a signal-generating entity), the location can be identified by a "1"; conversely, if binding is not indicated, the location can be identified by a "0" (or vice versa, as the case may be). Multiple rounds of binding determination, e.g., using different nucleic acid probes, can then be used to create a "code word," e.g., for this spatial location. In some embodiments, the code word can be subjected to error detection and / or correction. For example, the code word can be configured such that, for a given set of lead sequences or binding patterns of a nucleic acid probe, if no match is found, the match can be identified as an error, and error correction can be applied to determine the correct target for the nucleic acid probe. In some cases, for example, when each code word encodes a different nucleic acid, a code word may have fewer "letters" or positions than the total number of nucleic acids encoded by the code word.

[0109] Such error detection and / or error correction codes can take a variety of forms. A variety of such codes, such as Golay or Hamming codes, have already been developed in other contexts, such as the telecommunications industry. In one set of embodiments, the read sequences or binding patterns of the nucleic acid probes are assigned such that not all possible combinations are assigned.

[0110] For example, if four lead sequences are possible and a nucleic acid probe contains two lead sequences, a maximum of six nucleic acid probes can be identified, although the number of nucleic acid probes used can be less than six. Similarly, for k lead sequences in a population with n lead sequences on each nucleic acid probe,

[0111]

number

[0112]

number

[0113] As another example, when multiple rounds of nucleic acid probes are used, the number of rounds can be chosen arbitrarily. If, within each round, each target can have two possible outcomes, such as detection or non-detection, then for n rounds of probes, at most 2 n Although different targets are possible, the number of targets actually used is limited to 2 n For example, if within each round each target can have more than two possible outcomes, such as detection in different color channels, then for n rounds of probes, 2 nMore than (e.g., 3 n , 4 n , , , different targets may be possible. In some cases, the number of targets actually used may be any number less than this number. In addition, these may be assigned randomly or in a specific manner that increases the ability to detect and / or correct errors.

[0114] Code words can be used to define various code spaces. For example, in one set of embodiments, code words or nucleic acid probes can be assigned within the code space such that the assignments are separated by a Hamming distance, which measures the number of incorrect "reads" in a given pattern that will cause a nucleic acid probe to be misinterpreted as a different, legitimate nucleic acid probe. In certain cases, the Hamming distance can be at least 2, at least 3, at least 4, at least 5, at least 6, etc. Additionally, in one set of embodiments, the assignments can be formed as Hamming codes, e.g., a Hamming (7,4) code, a Hamming (15,11) code, a Hamming (31,26) code, a Hamming (63,57) code, a Hamming (127,120) code, etc. In another set of embodiments, the assignments may form a SECDED code, e.g., a SECDED(8,4) code, a SECDED(16,4) code, a SECDED(16,11) code, a SECDED(22,16) code, a SECDED(39,32) code, a SECDED(72,64) code, etc. In yet another set of embodiments, the assignments may form an extended binary Golay code, a full binary Golay code, or a ternary Golay code. In another set of embodiments, the assignments may represent a subset of possible values taken from any of the codes described above.

[0115] For example, an error-correcting code may be formed by encoding a target using only binary words containing a fixed or constant number of "1" bits (or "0" bits). For example, the code space may include only 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, etc. "1" bits (or "0" bits), e.g., all of the codes have the same number of "1" bits or "0" bits, etc. In another set of embodiments, the assignment may represent a subset of possible values taken from any of the codes described above for purposes of addressing asymmetric readout errors. For example, in some cases, a code in which the number of "1" bits may be fixed for all binary words used may eliminate bias measurements of words with different numbers of "1"s if the proportion of "0" bits measured as "1" or the proportion of "1" bits measured as "0" differs.

[0116] Thus, in some embodiments, once a code word is determined (e.g., as discussed herein), the code word can be compared to known nucleic acid code words. If a match is found, the nucleic acid target can be identified or determined. If no match is found, an error in reading the code word can be identified. Optionally, error correction can also be applied to determine the correct code word, thereby resulting in the correct identification of the nucleic acid target. Optionally, the code word can be selected such that, assuming only one error is present, only one possible correct code word is available, thereby allowing only one correct identification of the nucleic acid target. Optionally, this can also be generalized to larger code word intervals or Hamming distances; for example, the code word can be selected such that if two, three, or four errors (or, in some cases, more errors) are present, only one possible correct code word is available, thereby allowing only one correct identification of the nucleic acid target.

[0117] The error-correcting code may be a binary error-correcting code or may be based on other numbering systems, such as a ternary or quaternary error-correcting code. For example, in one set of embodiments, more than one type of signal-emitting entity may be used and assigned different numbers within the error-correcting code. Thus, by way of non-limiting example, a first signal-emitting entity (or, as the case may be, more than one signal-emitting entity) may be assigned as a "1," a second signal-emitting entity (or, as the case may be, more than one signal-emitting entity) may be assigned as a "2" (with a "0" indicating the absence of a signal-emitting entity), and the code words may be distributed to define a ternary error-correcting code. Similarly, a third signal-emitting entity may additionally be assigned as a "3," etc., to create a quaternary error-correcting code.

[0118] As discussed herein, in certain embodiments, the signal-generating entity is determined, for example, by imaging to determine a nucleic acid probe and / or creating a code word. Examples of signal-generating entities include those discussed herein. In some cases, the signal-generating entity in a sample can be determined, for example, spatially, using various techniques. In some embodiments, the signal-generating entity can be fluorescent, and techniques for determining fluorescence in a sample, such as fluorescence microscopy or confocal microscopy, can be used to spatially identify the location of the signal-generating entity within a cell. In some cases, the location of the entity in a sample can be determined in two or even three dimensions. In addition, in some embodiments, more than one signal-generating entity can be determined simultaneously (e.g., signal-generating entities with different colors or emissions) and / or sequentially.

[0119] Additionally, in some embodiments, a confidence level for an identified target, e.g., a nucleic acid target, can be determined. For example, the confidence level can be determined using the ratio of the number of exact matches to the number of matches with one or more 1-bit errors. In some cases, only matches with a confidence ratio above a certain value can be used. For example, in certain embodiments, a match can be accepted only if the confidence ratio for the match is greater than about 0.01, greater than about 0.03, greater than about 0.05, greater than about 0.1, greater than about 0.3, greater than about 0.5, greater than about 1, greater than about 3, greater than about 5, greater than about 10, greater than about 30, greater than about 50, greater than about 100, greater than about 300, greater than about 500, greater than about 1000, or any other suitable value. Additionally, in some embodiments, a match may be accepted only if the confidence ratio for the identified target exceeds the internal standard or false positive control by about 0.01, about 0.03, about 0.05, about 0.1, about 0.3, about 0.5, about 1, about 3, about 5, about 10, about 30, about 50, about 100, about 300, about 500, about 1000, or any other suitable value.

[0120] In some embodiments, the spatial location of an entity (and thus a nucleic acid probe that may be associated with the entity) can be determined at a relatively high resolution. For example, the location can be determined at a spatial resolution of greater than about 100 micrometers, greater than about 30 micrometers, greater than about 10 micrometers, greater than about 3 micrometers, greater than about 1 micrometer, greater than about 800 nm, greater than about 600 nm, greater than about 500 nm, greater than about 400 nm, greater than about 300 nm, greater than about 200 nm, greater than about 100 nm, greater than about 90 nm, greater than about 80 nm, greater than about 70 nm, greater than about 60 nm, greater than about 50 nm, greater than about 40 nm, greater than about 30 nm, greater than about 20 nm, or greater than about 10 nm, etc.

[0121] A variety of techniques exist that can optically determine or image the spatial location of an entity, for example, using fluorescence microscopy. In some embodiments, more than one color may be used. In some cases, spatial location may be determined at ultra-high resolution, or at a resolution that exceeds the wavelength or diffraction limit of light. Non-limiting examples include stochastic optical reconstruction microscopy (STORM), stimulated emission depletion microscopy (STED), near-field scanning optical microscopy (NSOM), 4Pi microscopy, structured illumination microscopy (SIM), spatially modulated illumination microscopy (SMI), reversible saturable optically linear fluorescence transition microscopy (RESOLFT), ground state depletion microscopy (GSD), saturated structured-illumination microscopy (SSIM), spectral precision distance microscopy (SPDM), photoactivated localization microscopy (PALM), fluorescence photoactivated localization microscopy (FPALM), 3D light microscopical nanosizing microscopy (LIMON), super-resolution optical fluctuation imaging (SOFI), and the like.See, for example, U.S. Patent No. 7,838,302 to Zhuang et al., entitled "Sub-Diffraction Limit Image Resolution and Other Imaging Techniques," issued on November 23, 2010; U.S. Patent No. 8,564,792 to Zhuang et al., entitled "Sub-Diffraction Limit Image Resolution in Three Dimensions," issued on October 22, 2013; or International Patent Application Publication No. WO2013 / 090360 to Zhuang et al., entitled "High Resolution Dual-Objective Microscopy," published on June 20, 2013, each of which is incorporated herein by reference in its entirety.

[0122] As an illustrative, non-limiting example, in one set of embodiments, a sample may be imaged with a high-numerical aperture, 100x magnification oil-immersion objective and light collected on an electron-multiplying CCD camera. In another example, a sample may be imaged with a high-numerical aperture, 40x magnification oil-immersion objective and light collected by a wide-field academic CMOS camera. In various non-limiting embodiments, different combinations of objectives and cameras may result in a single field of view corresponding to a field of view not exceeding 40x40 microns, 80x80 microns, 120x120 microns, 240x240 microns, 340x340 microns, or 500x500 microns, etc. Similarly, in some embodiments, a single camera pixel may correspond to a sample area not exceeding 80x80 nm, 120x120 nm, 160x160 nm, 240x240 nm, or 300x300 nm, etc. In another example, the sample can be imaged with a low numerical aperture, 10x magnification air lens and light collected by an sCMOS camera. In a further embodiment, the sample can be optically resolved by focusing light through a single or multiple pinholes and illuminating it through a diffraction-limited focused beam generated by a scanning mirror or a rotating disk in one or more scans. In another embodiment, the sample can also be illuminated through a slab of light generated through any one of several methods known to those skilled in the art.

[0123] In one embodiment, the sample can be illuminated with a single Gaussian mode laser beam. In some embodiments, the illumination profile can be flattened by passing these laser beams through a multimode fiber vibrated via piezoelectric or other mechanical means. In some embodiments, the illumination profile can be flattened by passing the single-mode Gaussian beam through various refractive beam shapers, such as a π-shaper, or a series of stacked Powell lenses. In yet another set of embodiments, the Gaussian beam can be passed through a variety of different diffusing elements, such as ground glass or an optical diffuser, which can optionally be spun at high speed to remove residual laser speckle. In yet another embodiment, the laser illumination can be passed through a series of lenslet arrays to produce overlapping illumination images that approximate a planar illumination field.

[0124] In some embodiments, the centroid of the spatial location of the entity can be determined. For example, the centroid of the signal-emitting entity can be determined within an image or within a series of images using image analysis algorithms known to those skilled in the art. In some cases, the algorithm can be selected to determine non-overlapping single emitters and / or partially overlapping single emitters in the sample. Non-limiting examples of suitable techniques include maximum likelihood algorithms, least squares algorithms, Bayesian algorithms, compressed sensing algorithms, etc. In some cases, combinations of these techniques can also be used.

[0125] Additionally, in some cases, the signal-generating entity can be inactivated. For example, in some embodiments, a first secondary nucleic acid probe that can associate with a signal-generating entity (e.g., using an amplified nucleic acid) and that can recognize a first lead sequence (e.g., on a nucleic acid probe) can be applied to a sample, and then the signal-generating entity can be inactivated, for example, before a second secondary nucleic acid probe that can associate with the signal-generating entity (e.g., using an amplified nucleic acid) is applied to the sample. When multiple signal-generating entities are used, the same or different techniques can be used to inactivate the signal-generating entities, and some or all of the multiple signal-generating entities can be inactivated, for example, sequentially or simultaneously.

[0126] Inactivation may be caused by removal of the signal-generating entity (e.g., from the sample or from the nucleic acid probe, etc.) and / or by chemically altering the signal-generating entity in some way (e.g., by photobleaching the signal-generating entity, by photobleaching the signal-generating entity, by chemically altering the structure of the signal-generating entity, e.g., by reduction, etc.). For example, in one set of embodiments, fluorescent signal-generating entities may be inactivated by chemical or optical techniques such as oxidation, photobleaching, chemically bleaching, rigorous washing, or reaction by digestion or exposure to enzymes, dissociating the signal-generating entity from other components (e.g., the probe), chemical reaction of the signal-generating entity (e.g., a reactant capable of altering the structure of the signal-generating entity), etc. For example, bleaching may occur by exposure to oxygen, a reducing agent, or the signal-generating entity may be chemically cleaved from the nucleic acid probe and washed away via fluid flow.

[0127] In some embodiments, for example, using the amplified nucleic acids discussed herein, multiple nucleic acid probes can be associated with one or more signal-generating entities. When more than one nucleic acid probe is used, the signal-generating entities can be the same or different. In certain embodiments, the signal-generating entity is any entity capable of emitting light. For example, in one embodiment, the signal-generating entity is a fluorescent entity. In other embodiments, the signal-generating entity can be a phosphorescent entity, a radioactive entity, a light-absorbing entity, or the like. In some cases, the signal-generating entity is any entity that can be determined in a sample at a relatively high resolution, for example, at a resolution exceeding the wavelength or diffraction limit of visible light. The signal-generating entity can be, for example, a dye, a small molecule, a peptide, or a protein. In some cases, the signal-generating entity can be a single molecule. When multiple secondary nucleic acid probes are used, the nucleic acid probes can be associated with the same or different signal-generating entities.

[0128] Non-limiting examples of signal-generating entities include fluorescent entities (fluorophores) or phosphorescent entities, such as cyanine dyes (e.g., Cy2, Cy3, Cy3B, Cy5, Cy5.5, Cy7, etc.), Alexa Fluor dyes, Atto dyes, photoswitchable dyes, photoactivatable dyes, fluorescent dyes, metal nanoparticles, semiconductor nanoparticles, or "quantum dots," fluorescent proteins such as GFP (green fluorescent protein), or photoactivatable fluorescent proteins such as PAGFP, PSCFP, PSCFP2, Dendra, Dendra2, EosFP, tdEos, mEos2, mEos3, PAmCherry, PAtagRFP, mMaple, mMaple2, and mMaple3. Other suitable signal-generating entities are known to those skilled in the art. See, for example, U.S. Patent No. 7,838,302 or International Patent Application Publication No. WO 2015 / 160690, each of which is incorporated herein by reference in its entirety.

[0129] In one set of embodiments, the signal-generating entity may be joined to the oligonucleotide sequence via a bond that may be cleaved to release the signal-generating entity. In one set of embodiments, the fluorophore may be conjugated to the oligonucleotide via a cleavable bond, such as a photocleavable bond. Non-limiting examples of photocleavable bonds include 1-(2-nitrophenyl)ethyl, 2-nitrobenzyl, biotin phosphoramidite, acryl phosphoramidite, diethylaminocoumarin, 1-(4,5-dimethoxy-2-nitrophenyl)ethyl, cyclododecyl(dimethoxy-2-nitrophenyl)ethyl, 4-aminomethyl-3-nitrobenzyl, (4-nitro-3-(1-chlorocarbonyloxyethyl)phenyl)methyl-S-acetylthioate, [4-nitro-3-(1-chlorocarbonyloxyethyl)phenyl]methyl-3-(2-pyridyldithiopropionic acid) ester [(4-nitro-3-(1-thlorocarbonyloxyethyl)phenyl)methyl-3-(2-pyridyldithiopropionic acid) ester]. acid)ester], 3-(4,4'-dimethoxytrityl)-1-(2-nitrophenyl)-propane-1,3-diol-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-trifluoroacetylcaproamidomethyl)phenyl]-ethyl-[2-cyano-ethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-(4,4'-dimethoxytrityloxy)butylamidomethyl)phenyl]-ethyl-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, 1-[2-nitro-5-(6-(N-(4,4'-dimethoxytrityl))-biotinamidocaproamido-methyl)phenyl]-ethyl-[2-cyanoethyl-(N,N-diisopropyl)]-phosphoramidite, or similar linkers. The oligonucleotide sequences can be, for example, primary or secondary (or other) amplified nucleic acids, such as the amplified nucleic acids discussed herein.

[0130] In another set of embodiments, the fluorophore may be conjugated to the oligonucleotide via a disulfide bond. Disulfide bonds can be cleaved by a variety of reducing agents, such as, but not limited to, dithiothreitol, dithioerythritol, beta-mercaptoethanol, sodium borohydride, thioredoxin, glutaredoxin, trypsinogen, hydrazine, diisobutylaluminum hydride, oxalic acid, formic acid, ascorbic acid, phosphoric acid, stannous chloride, glutathione, thioglycolate, 2,3-dimercaptopropanol, 2-mercaptoethylamine, 2-aminoethanol, tris(2-carboxyethyl)phosphine, bis(2-mercaptoethyl)sulfone, N,N'-dimethyl-N,N'-bis(mercaptoacetyl)hydrazine, 3-mercaptopropionate, dimethylformamide, thiopropyl agarose, tri-n-butylphosphine, cysteine, ferrous sulfate, sodium sulfite, phosphite, hypophosphite, phosphorothioates, and the like, and / or any combination thereof. The oligonucleotide sequences can be, for example, primary or secondary (or other) amplified nucleic acids, such as the amplified nucleic acids discussed herein.

[0131] In another embodiment, a fluorophore can be conjugated to an oligonucleotide via one or more phosphorothioate-modified nucleotides, in which sulfur modifications replace bridging and / or non-bridging oxygens. In certain embodiments, a fluorophore can be cleaved from an oligonucleotide via the addition of compounds such as, but not limited to, iodoethanol (iodine mixed in ethanol), silver nitrate, or mercuric chloride. In yet another set of embodiments, a signal-generating entity can be chemically inactivated via reduction or oxidation. For example, in one embodiment, a chromophore such as Cy5 or Cy7 can be reduced to a stable, non-fluorescent state using sodium borohydride. In yet another set of embodiments, a fluorophore can be conjugated to an oligonucleotide via an azo bond, which can be cleaved with 2-[(2-N-arylamino)phenylazo]pyridine. In yet another set of embodiments, the fluorophore can be conjugated to the oligonucleotide via a suitable nucleic acid segment that can be cleaved upon appropriate exposure to a DNase, such as an exodeoxyribonuclease or an endodeoxyribonuclease. Examples include, but are not limited to, DNase I or DNase II. In one set of embodiments, cleavage can occur via a restriction endonuclease. Non-limiting examples of potentially suitable restriction endonucleases include BamHI, BsrI, NotI, XmaI, PspAI, DpnI, MboI, MnlI, Eco57I, Ksp632I, DraIII, AhaII, SmaI, MluI, HpaI, ApaI, BclI, BstEII, TaqI, EcoRI, SacI, HindII, HaeII, DraII, Tsp509I, Sau3AI, PacI, and the like. Over 3000 restriction enzymes have been extensively studied, and of these, over 600 are commercially available. In yet another set of embodiments, the fluorophore may be conjugated to biotin, and the oligonucleotide may be conjugated to avidin or streptavidin.While the interaction of biotin with avidin or streptavidin conjugates the fluorophore to the oligonucleotide, upon sufficient exposure to excess, free biotin may "overcome" the ligation, thereby causing cleavage. Additionally, in another set of embodiments, the probe may be removed using a corresponding "toe-hold probe" that contains the same sequence as the probe as well as an extra number of bases (e.g., 1 to 20 extra bases, e.g., 5 extra bases) that have homology to the coded probe. These probes may remove the labeled readout probe through strand displacement interactions. The oligonucleotide sequence may be, for example, a primary or secondary (or other) amplified nucleic acid, such as the amplified nucleic acids discussed herein.

[0132] As used herein, the term "light" generally refers to electromagnetic radiation having any suitable wavelength (or, equivalently, frequency). For example, in some embodiments, light can include wavelengths in the optical or visible range (e.g., light having a wavelength between about 400 nm and about 700 nm, i.e., "visible light"), infrared wavelengths (e.g., light having a wavelength between about 300 micrometers and 700 nm), ultraviolet wavelengths (e.g., light having a wavelength between about 400 nm and about 10 nm), etc. In certain cases, as discussed in detail below, more than one entity can be used, i.e., chemically distinct or significantly, e.g., structurally distinct entities. However, in other cases, the entities can be chemically identical, or at least substantially chemically identical.

[0133] In one set of embodiments, the signal-generating entity is "switchable," i.e., the entity can be switched between two or more states, at least one of which emits light having a desired wavelength. In the other state(s), the entity may not emit light or may emit light of a different wavelength. For example, the entity can be "activated" to a first state capable of providing light having a desired wavelength, and "inactivated" to a second state incapable of emitting light of the same wavelength. An entity is "photoactivatable" when activated by incident light of the appropriate wavelength. As a non-limiting example, Cy5 can be switched between a fluorescent state and a non-luminescent state in a controlled and reversible manner by light of different wavelengths; i.e., red light at 633 nm (or 642 nm, 647 nm, 656 nm) can switch Cy5 to a stable non-luminescent state or inactivate it, while green light at 405 nm can switch Cy5 to a fluorescent state or activate it back. In some cases, an entity can be reversibly switched between two or more states, for example, upon exposure to an appropriate stimulus. For example, a first stimulus (e.g., light of a first wavelength) can be used to activate the switchable entity, while a second stimulus (e.g., light of a second wavelength) can be used to inactivate the switchable entity, for example, to a non-luminescent state. Any suitable method can be used to activate the entity. For example, in one embodiment, incident light of an appropriate wavelength can be used to activate the entity, causing it to emit light, i.e., the entity is "photoswitchable." Thus, a photoswitchable entity can be switched between different emitting or non-emitting states, for example, by incident light of different wavelengths. The light can be monochromatic (e.g., provided using a laser) or polychromatic. In another embodiment, the entity can be activated when stimulated with an electric and / or magnetic field. In other embodiments, the entity can be activated when exposed to an appropriate chemical environment, for example, by adjusting the pH or inducing a reversible chemical reaction involving the entity.Similarly, any suitable method may be used to inactivate an entity, and the method of activating an entity need not be the same as the method of inactivating an entity, for example, an entity may be inactivated upon exposure to incident light of an appropriate wavelength, or an entity may be inactivated by waiting for a sufficient period of time.

[0134] Typically, a "switchable" entity can be identified by one skilled in the art by determining the conditions under which the entity in a first state will emit light when exposed to an excitation wavelength, switching the entity from the first state to a second state, e.g., by exposing it to light of a switched wavelength, and then demonstrating that when the entity is in the second state, it no longer emits light (or emits light of a reduced intensity) when exposed to the excitation wavelength.

[0135] As discussed, in one set of embodiments, the switchable entity may be switched upon exposure to light. In some cases, the light used to activate the switchable entity may come from an external light source, such as a laser light source, another light-emitting entity in close proximity to the switchable entity, etc. In some cases, the second light-emitting entity may be a fluorescent entity, and in certain embodiments, the second light-emitting entity may also itself be a switchable entity.

[0136] In some embodiments, the switchable entity comprises a first light-emitting moiety (e.g., a fluorophore) and a second moiety that activates or "switches" the first moiety. For example, upon exposure to light, the second moiety of the switchable entity may activate the first moiety, causing the first moiety to emit light. Examples of activator moieties include, but are not limited to, Alexa Fluor 405 (Invitrogen), Alexa Fluor 488 (Invitrogen), Cy2 (GE Healthcare), Cy3 (GE Healthcare), Cy3B (GE Healthcare), Cy3.5 (GE Healthcare), or other suitable dyes. Examples of light-emitting moieties include, but are not limited to, Cy5, Cy5.5 (GE Healthcare), Cy7 (GE Healthcare), Alexa Fluor 647 (Invitrogen), Alexa Fluor 680 (Invitrogen), Alexa Fluor 700 (Invitrogen), Alexa Fluor 750 (Invitrogen), Alexa Fluor 790 (Invitrogen), DiD, DiR, YOYO-3 (Invitrogen), YO-PRO-3 (Invitrogen), TOT-3 (Invitrogen), TO-PRO-3 (Invitrogen), or other suitable dyes.These may be linked together, for example, covalently, e.g., directly, or via a linker, and examples thereof include Cy5-Alexa Fluor 405, Cy5-Alexa Fluor 488, Cy5-Cy2, Cy5-Cy3, Cy5-Cy3.5, Cy5.5-Alexa Fluor 405, Cy5.5-Alexa Fluor 488, Cy5.5-Cy2, Cy5.5-Cy3, Cy5.5-Cy3.5, Cy7-Alexa Fluor 405, Cy7-Alexa Fluor 488, Cy7-Cy2, Cy7-Cy3, Cy7-Cy3.5, Alexa Fluor 647-Alexa Fluor 405, Alexa Fluor 647-Alexa Fluor 488, Alexa Fluor 647-Cy2, Alexa Fluor The activator moiety can be linked to form compounds such as, but not limited to, Alexa Fluor 647-Cy3, Alexa Fluor 647-Cy3.5, Alexa Fluor 750-Alexa Fluor 405, Alexa Fluor 750-Alexa Fluor 488, Alexa Fluor 750-Cy2, Alexa Fluor 750-Cy3, or Alexa Fluor 750-Cy3.5. Those skilled in the art will be familiar with the structures of these and other compounds, many of which are commercially available. The moieties may be linked via a covalent bond or by a linker, such as those described in detail below. Other luminescent or activator moieties may include moieties having two quaternized nitrogen atoms connected by a polymethine chain, where each nitrogen is independently part of a heteroaromatic moiety, such as pyrrole, imidazole, thiazole, pyridine, quinoline, indole, or benzothiazole, or part of a non-aromatic amine. In some cases, there may be 5, 6, 7, 8, 9, or more carbon atoms between the two nitrogen atoms.

[0137] In certain cases, when the light-emitting moiety and the activator moiety are separated from each other, each can be a fluorophore, i.e., an entity that can emit light of a specific emission wavelength when exposed to a stimulus, such as an excitation wavelength. However, when a switchable entity is formed that includes a first fluorophore and a second fluorophore, the first fluorophore forms a first light-emitting moiety, and the second fluorophore forms an activator moiety that activates or "switches" the first moiety in response to a stimulus. For example, the switchable entity can include a first fluorophore directly bonded to a second fluorophore, or the first and second entities can be connected via a linker or a common entity. Whether a pair of a light-emitting moiety and an activator moiety results in a suitable switchable entity can be determined by methods known to those skilled in the art. For example, light of various wavelengths may be used to stimulate the pair and the light emission from the light emitting moiety may be determined to determine whether the pair results in an appropriate switch.

[0138] As a non-limiting example, Cy3 and Cy5 can be linked together to form such an entity. In this example, Cy3 is an activator moiety capable of activating Cy5, the light-emitting moiety. Thus, light at or near the absorption maximum of the activating or second portion of the entity (e.g., light near 532 nm for Cy3) can cause this portion to activate the first light-emitting moiety, thereby causing the first portion to emit light (e.g., near 647 nm for Cy5). See, e.g., U.S. Pat. No. 7,838,302, incorporated herein by reference in its entirety. Optionally, the first light-emitting moiety can then be inactivated by any suitable technique (e.g., by directing 647 nm red light toward the Cy5 portion of the molecule).

[0139] Other non-limiting examples of potentially suitable activator moieties include 1,5 IAEDANS, 1,8-ANS, 4-methylumbelliferone, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein (5-FAM), 5-carboxynaphthofluorescein, 5-carboxytetramethylrhodamine (5-TAMRA), 5-FAM (5-carboxyfluorescein), 5-HAT (hydroxytryptamine), 5-hydroxytryptamine (HAT), 5-ROX (carboxy-X-rhodamine), 5-TAMRA (5-carboxytetramethylrhodamine), 6-carboxyrhodamine 6G, 6-CR 6G, 6-JOE, 7-amino-4-methylcoumarin, 7-aminoactinomycin D (7-AAD), 7-hydroxy-4-methylcoumarin, 9-amino-6-chloro-2-methoxyacridine, ABQ, acid fuchsin, ACMA (9-amino-6-chloro-2-methoxyacridine), acridine orange, acridine red, acridine yellow, acriflavine, acriflavine feulgen SITSA, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 635, Alizarin Complexone, Alizarin Red, AMC, AMCA-S, AMCA (Aminomethylcoumarin), AMCA-X, Aminoactinomycin D, Aminocoumarin, Aminomethylcoumarin (AMCA), Aniline Blue, Anthrosyl Stearate, APTRA-BTC, APTS, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon Yellow 7 GLL, Atabrine, ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 520, ATTO 532, ATTO 550, ATTO 565, ATTO590, ATTO 594, ATTO 610, ATTO 611X, ATTO 620, ATTO 633, ATTO 635, ATTO 647, ATTO 647N, ATTO 655, ATTO 680, ATTO 700, ATTO 725, ATTO 740, ATTO-TAG CBQCA, ATTO-TAG FQ, Auramine, Aurophosphine G, Aurophosphine, BAO9 (Bisaminophenyloxadiazole), BCECF (High pH), BCECF (Low pH), Berberine Sulfate, Bimane, Bisbenzamide, Bisbenzimide (Hoechst), Bis-BTC, Blancophor FFG, Blancophor SV, BOBO-1, BOBO-3, Bodipy 492 / 515, Bodipy 493 / 503, Bodipy 500 / 510, Bodipy 505 / 515, Bodipy 530 / 550, Bodipy 542 / 563, Bodipy 558 / 568, Bodipy 564 / 570, Bodipy 576 / 589, Bodipy 581 / 591, Bodipy 630 / 650-X, Bodipy 650 / 665-X, Bodipy 665 / 676, Bodipy Fl, Bodipy FL ATP, Bodipy Fl-ceramide, Bodipy R6G, Bodipy TMR, Bodipy TMR-X conjugate, Bodipy TMR-X, SE, Bodipy TR, Bodipy TR ATP, Bodipy TR-X SE, BO-PRO-1, BO-PRO-3, Brilliant SulphoflavinFF, BTC, BTC-5N, Calcein, Calcein Blue, Calcium Crimson, Calcium Green, Calcium Green-1 Ca 2+ Pigment, Calcium Green-2 Ca 2+ , Calcium Green-5N Ca 2+ , Calcium Green-C18 Ca 2+, Calcium Orange, Calcofluor White, Carboxy-X-rhodamine (5-ROX), Cascade Blue, Cascade Yellow, Catecholamine, CCF2 (GeneBlazer), CFDA, Chromomycin A, Chromomycin A, CL-NERF, CMFDA, Coumarin phalloidin, CPM methylcoumarin, CTC, CTC formazan, Cy2, Cy3.18, Cy3.5, Cy3, Cy5.18, Cyclic AMP fluorosensor (FiCRhR), Dabcyl, Dansyl, Dansylamine, Dansylcadaverine, Dansyl chloride, DansylDHPE, Dansyl fluoride, DAPI, Dapoxyl, Dapoxyl 2, Dapoxyl 3'DCFDA, DCFH (dichlorodihydrofluorescein diacetate), DDAO, DHR (dihydrorhodamine 123), di-4-ANEPPS, di-8-ANEPPS [non-ratio], DiA (4-di-16-ASP), dichlorodihydrofluorescein diacetate (DCFH), DiD (lipophilic tracer), DiD [DiIC18(5)], DIDS, dihydrorhodamine 123 (DHR), DiI [DiIC18(3)], dinitrophenol, DiO [DiOC18(3)], DiR, DiR [DiIC18(7)], DM-NERF (high pH), DNP, dopamine, DTAF, DY-630-NHS, DY-635-NHS, DyLight 405, DyLight 488, DyLight 549, DyLight 633, DyLight 649, DyLight 680, DyLight 800, ELF97, Eosin, Erythrosin, Erythrosin ITC, Ethidium Bromide, Ethidium Homodimer 1 (EthD-1), Euchrisin, EukoLight, Europium(III) Chloride, Fast Blue, FDA, Feulgen (pararosaniline), FIF [Formaldehyde-Induced Fluorescence], FITC, FlazoOrange, Fluo-3, Fluo-4, Fluorescein (FITC), Fluorescein diacetate, Fluoro-Emerald, Fluoro-Gold (hydroxystilbamidine), Fluor-Ruby, FluorX, FM1-43, FM4-46, Fura Red (high pH), Fura Red / Fluo-3, Fura-2, Fura-2 / BCECF, Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl Pink 3G, Genacryl Yellow 5GF, GeneBlazer (CCF2), Gloxalic Acid, Granular blue, Hematoporphyrin, Hoechst 33258, Hoechst 33342, Hoechst 34580, HPTS, Hydroxycoumarin, Hydroxystilbamidine (FluoroGold), Hydroxytryptamine, Indo-1 (High Calcium), Indo-1 (Low Calcium), Indodicarbocyanine (DiD), Indotricarbocyanine (DiR), Intrawhite Cf, JC-1, JO-JO-1, JO-PRO-1, LaserPro, Laurodan, LDS 751 (DNA), LDS 751 (RNA), Leucophor PAF, Leucophor SF, Leucophor WS, Lissamine Rhodamine, Lissamine Rhodamine B, Calcein / Ethidium Homodimer, LOLO-1, LO-PRO-1, Lucifer Yellow, Lyso Tracker Blue, Lyso Tracker Blue-White, Lyso Tracker Green, Lyso Tracker Red, Lyso Tracker Yellow, LysoSensor Blue, LysoSensor Green, LysoSensor Yellow / Blue, Mag Green, Magdala Red (Phloxin B), Mag-Fura Red, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, Magnesium Green, Magnesium Orange, Malachite Green, Marina Blue, Maxilon Brilliant Flavin 10 GFF, MaxilonBrilliant Flavin 8 GFF, merocyanine, methoxycoumarin, Mitotracker Green FM, Mitotracker Orange, Mitotracker Red, mithramycin, monobromobimane, monobromobimane (mBBr-GSH), monochlorobimane, MPS (Methyl Green Pyronine Stilbene), NBD, NBD-amine, Nile Red, nitrobenzoxadiazole, noradrenaline, Nuclear Fast Red, Nuclear Yellow, Nylosan Brilliant Iavin E8G (Nylosan Brilliant Iavin E8G), Oregon Green, Oregon Green 488-X, Oregon Green, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, pararosaniline (Feulgen), PBFI, Phloxin B (Magdala Red), Phorwite AR, Phorwite BKL, Phorwite Rev, Phorwite RPA, Phosphine 3R, PKH26 (Sigma), PKH67, PMIA, Pontochrome Blue Black, POPO-1, POPO-3, PO-PRO-1, PO-PRO-3, primulin, Procion Yellow, propidium iodide (PI), PyMPO, pyrene, pyronine, pyronine B, pyrazole brilliant flavin 7GF, QSY 7, quinacrine mustard, resorufin, RH 414, Rhod-2, rhodamine, rhodamine 110, rhodamine 123, rhodamine 5 GLD, rhodamine 6G, rhodamine B, rhodamine B 200, Rhodamine B Extra, Rhodamine BB, Rhodamine BG, Rhodamine Green, Rhodamine phallicidin, Rhodamine phalloidin, Rhodamine Red, Rhodamine WT, Rose Bengal, S65A, S65C, S65L, S65T, SBFI, Serotonin, Sevron Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant RedB, Sevron Orange, Sevron Yellow L, SITS, SITS (primulin), SITS (stilbene isothiosulfonate), SNAFL calcein, SNAFL-1, SNAFL-2, SNARF calcein, SNARF1, Sodium Green, Spectrum Aqua, Spectrum Green, Spectrum Orange, Spectrum Red, SPQ [6-methoxy-N-(3-sulfopropyl)quinolinium], stilbene, sulforhodamine B and C, sulforhodamine Extra, SYTO 11, SYTO 12, SYTO 13, SYTO 14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, S SYTO 40, SYTO 41, SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, SYTOX Blue, SYTOX Green, SYTOX Orange, tetracycline, tetramethylrhodamine (TAMRA), Texas Red, Texas Red-X conjugate, thiadicarbocyanine (DiSC3), thiazine red R, thiazole orange, thioflavin 5, thioflavin S, thioflavin TCN, thiolyte, thiazole orange, Tinopol CBS (Calcofluor White), TMR, TO-PRO-1, TO-PRO-3, TO-PRO-5, TOTO-1, TOTO-3, TRITC (tetramethylrhodamine isothiocyanate), True Blue, TruRed, Ultralite, Uranine B, Uvitex SFC, WW 781, X-rhodamine, XRITC, Xylene Orange, Y66F, Y66H, Y66W, YO-PRO-1, YO-PRO-3, YOYO-1, YOYO-3, SYBR Green, thiazole orange (interchelating dye), or combinations thereof.

[0140] Another aspect of the present invention is directed to computer-implemented methods. For example, a computer and / or automated system may be provided that can automatically and / or repeatedly perform any of the methods described herein. As used herein, an "automated" device refers to a device that can operate without human direction; that is, an automated device can perform a function at a time after any human has taken any action to facilitate the function, for example, by inputting instructions into a computer to initiate the process. Typically, an automated apparatus can perform a repetitive function after this point. In some cases, the process steps may also be recorded on a computer-readable medium.

[0141] For example, in some cases, a computer may be used to control the imaging of a sample using, for example, a fluorescence microscope, STORM, or other ultra-high resolution techniques, such as the techniques described herein. In some cases, a computer may also control operations in image analysis, such as drift correction, physical registration, hybridization, and cluster alignment, cluster decoding (e.g., decoding fluorescent clusters), error detection or correction (e.g., as discussed herein), noise reduction, distinguishing foreground features from background features (such as noise or debris in an image), and the like. By way of example, a computer may be used to control the activation and / or excitation of signal-generating entities in a sample and / or the collection of images of the signal-generating entities. In one set of embodiments, a sample may be excited using light having various wavelengths and / or intensities, and using a computer, the sequence of wavelengths of light used to excite the sample may be correlated with images collected of the sample containing the signal-generating entities. For example, the computer may direct light having various wavelengths and / or intensities onto the sample to result in an average number of different signal-generating entities within each region of interest (e.g., one activating entity per location, two activating entities per location, etc.), optionally, this information may be used to construct an image of the signal-generating entities and / or determine the location of the signal-generating entities, optionally at high resolution, as mentioned above.

[0142] In some embodiments, the sample is placed on a microscope. In some cases, the microscope may contain one or more channels, such as microfluidic channels, that direct or control fluid to or from the sample. For example, in one embodiment, nucleic acid probes, such as those discussed herein, may be fluidically introduced and / or removed to or from the sample through one or more channels. In some cases, there may also be one or more chambers or reservoirs for holding fluid, for example, in fluid communication with the channel and / or the sample. Those skilled in the art will be familiar with channels, including microfluidic channels, for moving fluid to or from a sample.

[0143] U.S. Provisional Patent Application No. 62 / 779,333, filed December 13, 2018, by Zhuang et al., entitled "Amplification Methods and Systems for MERFISH and Other Applications," is incorporated herein by reference in its entirety. The following documents are also incorporated herein by reference in their entirety: U.S. Patent Application Nos. 2017 / 0220733 and 2017 / 0212986; International Patent Application Publication Nos. WO2016 / 018960, WO2016 / 018963, WO2018 / 089445, and WO2018 / 089438; and International Patent Application No. PCT / US18 / 34651. [Example]

[0144] The following examples are intended to illustrate certain embodiments of the present invention, but do not exemplify the full scope of the invention. [Example]

[0145] Multiplexed error-robust fluorescence in situ hybridization (MERFISH) directly images and profiles hundreds to thousands of RNA species in their native intracellular environments, enabling spatially resolved, single-cell transcriptomics. The following examples use controlled or saturable amplification methods for MERFISH measurements. These examples demonstrate substantial signal enhancement in RNA FISH samples without increasing spot size or spot-to-spot brightness variability. 130 RNA species were accurately measured and identified with nearly 100% detection efficiency. These advances should substantially expand the range of biological questions that can be addressed by MERFISH, both in cell culture and in tissues.

[0146] In particular, these examples demonstrate a method for combining MERFISH amplification to dramatically increase MERFISH signal intensity. These examples demonstrate that this method amplified RNAsmFISH signals up to 30.6-fold with a constant coefficient of variation and no change in spot size. This method provided a rapid, simple, and efficient method for simultaneously amplifying signals from hundreds of RNAs in the same single cell with nearly 100% detection efficiency.

[0147] Designs incorporating DNA amplification into MERFISH: These examples demonstrate that this amplification strategy has certain advantages when combined with MERFISH using certain modifications described herein. The scaffold that determines the amplification fold was found to be predictable and designable. Even when multiple amplification sequences have different binding kinetics, sufficient time is given for all tested amplification sequences to reach saturation, making amplification controllable, reproducible, and less variable, benefiting the decoding step of MERFISH.

[0148] The labeling method used in these examples is illustrated in Figures 1A-1E. The MERFISH system was used to stain a composite library of oligonucleotide probes having a 30-mer target region sequence complementary to a target RNA template and multiple 20-mer readout sequences, referred to as coding probes (see, e.g., International Patent Application Publication Nos. WO2016 / 018960 and WO2016 / 018963, each of which is incorporated herein by reference in its entirety).

[0149] The amplified sequence sets were named primary and secondary amplified sequences according to the amplified sequence staining round. Each of the primary amplified sequence sets had a complementary sequence that bound to one of the readout sequences of the coded probe and N (N) 20-mer repeat sequences. Each of the secondary amplified sequence sets had a complementary sequence to one 20-mer repeat sequence on the primary amplified sequence and N 20-mer repeat sequences that were complementary to the final readout. After staining of the primary and secondary amplified sequences, the original readout signal was converted into a final readout signal by N 2 The amplification was performed 1:1, and this amplification was called NxN amplification (Figures 1A to 1E).

[0150] These amplifications have made several notable advances. First, amplification sequences were designed using only three nucleotides. Probe sequences containing only three of the four nucleotides exhibited a higher hybridization rate than sequences using all four nucleotides. This is believed to be due to the significantly reduced secondary structure within such sequences. In addition, to maintain the binding of the coding probe to RNA during the staining and washing steps of the amplification sequences, a 20-mer binding sequence was used in the amplification sequence, which was stained and washed with 10% formamide at 37°C. A 30-mer coding probe containing a targeting region for RNA was washed with 30% formamide at 47°C. Amplification was performed on gel-embedded, cleared MERFISH samples, which allows for the inherent ability to remove fluorescent background. See, for example, International Patent Application Publication No. WO2018 / 089445, incorporated herein by reference in its entirety.

[0151] Figures 1A-1E show a schematic illustration of amplification for MERFISH imaging. Figure 1A shows a sample stained with a MERFISH-encoded probe library and cleared in a polyacrylamide gel. Each encoded probe has a 30-mer target sequence and multiple readout sequences. Figure 1B shows the boxed region in Figure 1A, in which a primary amplification sequence was hybridized to the original readout on the encoded probe, followed by a wash step to remove excess primary amplification sequence. The primary amplification sequence had a sequence complementary to the readout sequence on the encoded probe and N 20-mer repeat sequences. Figure 1C shows a secondary amplification sequence that binds to the repeat region of the primary amplification sequence. The secondary amplification sequence had a sequence complementary to one of the 20-mer repeat sequences on the primary amplification sequence and N 20-mer repeat sequences complementary to the final readout. After washing, the sample was used in multi-round MERFISH imaging, in which the final readout uses a disulfide-linked fluorophore. Figure ID shows the final readout staining from the first round of MERFISH with an NxN amplified sample, compared to Figure IE, which shows the readout staining from the first round of MERFISH with an unamplified sample. [Example]

[0152] DNA amplification characteristics: In this example, to realize the design, a coding probe containing a readout sequence was hybridized with filamin A (FLNA) mRNA, and 5x5 amplification was performed on the coding probe in U-2 OS cells, with 15 minutes per amplification sequence staining round. Average FLNA smFISH spot brightness was measured using either direct labeling of the readout on the coding probe or 5x5 amplified labeling with the readout on the coding probe. A 10.5-fold increase in signal was observed, achieving 42% of the theoretical value. See Figures 2A and 2B.

[0153] One possible reason for not reaching the theoretical amplification fold was that the staining time of the amplified sequences was insufficient. The same 5 × 5 amplification was performed, with each round of staining of the amplified sequences taking a time sequence of 15, 30, 60, and 180 minutes (Figure 2C). The results showed that the amplified signal was saturated with the hybridized amplified sequences within 15 minutes in each round. Saturation after 15 minutes indicates that the complete assembly of the amplified sequences was rapid, further illustrating the advantage of using a three-letter alphabet to design the amplification probes in this example. In comparison, other methods often require 45 minutes or more per round of amplification.

[0154] Next, we investigated whether the length of the amplification sequence affected amplification performance. We investigated 4x4 and 9x9 amplification sequences. A 5.5-fold and 30.6-fold increase in brightness was observed for the 4x4 and 9x9 amplification sequences, respectively. The results suggested that all three amplification sequence lengths resulted in approximately 40% of the theoretical amplification value (Figure 2D).

[0155] One potential consequence of amplification is an increase in FISH spot size, which may reduce the ability to identify these RNAs due to overlap of signals from one molecule with signals from other molecules. The scaffold of the 9x9 amplified sequence has a length of approximately 132 nm (200 nucleotides x 2 x 0.33 nm per nucleotide), which is considered to be within the diffraction limit. The measured spot sizes from 4x4, 5x5, and 9x9 amplifications were identical, as expected (Figure 2E). Based on this design, it was predicted that the variability in spot-to-spot brightness would not increase substantially. To confirm this, the coefficient of variation in spot brightness was measured for unamplified, 4x4, 5x5, and 9x9 amplified samples. It was found that the variability in spot-to-spot brightness did not increase with amplification (Figure 2F).

[0156] Figures 2A-2F show that DNA amplification dramatically increased signal intensity without substantially changing spot size or spot-to-spot intensity variability. Figure 2A shows images of U-2 OS cells stained with FLNA smFISH probes, unamplified samples labeled with a readout probe (left). The contrast was increased 10-fold compared to the left image to better illustrate the fluorescent signal (middle) or stained with a readout probe after 5x5 amplification (right) (scale bar: 10 micrometers). Figure 2B shows a magnified view of the boxed area in Figure 2A (scale bar: 2 micrometers).

[0157] Figure 2C shows the average brightness of individual FLNA mRNA spots over a time series of amplified array staining. The average brightness was normalized to the non-amplified control sample stained directly with the readout probe. Figure 2D shows the average brightness of individual FLNA mRNA spots in 4x4-amplified and 9x9-amplified samples. The average brightness was normalized to the non-amplified control sample stained directly with the readout probe. Figure 2E shows the average FLNA mRNA spot size in non-amplified, 4x4-amplified, 5x5-amplified, and 9x9-amplified cells. The width (half-width) was determined by fitting a Gaussian point spread function (PSF) to the RNA spots. Figure 2F shows the coefficient of variation for RNA spot brightness in non-amplified, 4x4-amplified, 5x5-amplified, and 9x9-amplified samples. [Example]

[0158] Screening of amplified sequences for MERFISH imaging: In this example, 16 pairs of primary and secondary amplified sequences were used to extend the amplification to MERFISH measurement using a 16-bit modified Hamming distance 4 (MHD4) encoding scheme. Briefly, 20-mer tri-letter repeat sequences were designed by generating a random set of sequences with per-base probabilities of 25% A, 25% T, and 50% C, or 25% A, 25% T, and 50% G for the primary and secondary amplified sequences, respectively. BLAST analysis was performed against the human transcriptome to match the sequences within themselves and avoid homologous regions longer than 11 nucleotides. The 5x5 amplified sequence resulted in orders of magnitude changes in spot brightness. Therefore, the 5x5 amplified sequence was also used in subsequent MERFISH measurements. We also found that approximately 20% of the amplified sequences strongly induced secondary amplification, were RNA-dependent, or had background or low amplification efficiency. These could be corrected by changing the amplified sequence pair. Sixteen pairs were screened from 20 pairs of 5 × 5 amplified sequences for MERFISH imaging (Figures 5A–5C). [Example]

[0159] MERFISH measurements with DNA amplification: To verify whether the 16-pair amplification sequence described in Example 3 works with MERIFSH, a 5x5 amplification was performed using a MERFISH library of 130 RNAs in U-2 OS cells. Eight rounds of two-color imaging were used to read out 16 bits. In addition, disulfide bond cleavage by reduction was used to remove the fluorophore linked to the readout probe between successive rounds of imaging with both amplified and non-amplified samples. Figure 3A shows that individual RNA molecules could be detected in each of the eight hybridization and imaging rounds for the 5x5 amplified sample, allowing their identities to be decoded.

[0160] To determine the quality of the RNA decoding of the 5x5 amplified MERFISH assay, we considered several aspects of the non-zero misidentification error caused by misidentifying some RNAs as the wrong molecular species and the non-100% call rate caused by missing some RNAs during detection and decoding. First, we considered the RNA counts of blank barcodes and 130 actual RNA barcodes per cell, which correlate with the misidentification rate. We found that 121 of the 130 RNA molecular species in the 5x5 amplified MERFISH assay had copy numbers per cell greater than the maximum copy number per cell observed with blank barcodes (Figure 3B).

[0161] Next, for each bit, the average 1 to 0 error rate and the average 0 to 1 error rate were determined. If these error rates were low, a theoretically potentially high call rate would be observed. A 1 to 0 error rate of approximately 1.7% and a 0 to 1 error rate of approximately 0.6% were observed (Figure 3C). The 5x5 amplified data were further compared to the previous unamplified MERFISH data, which had a detection efficiency of nearly 100%. Figure 3D shows that the copy number per cell observed in the amplified samples correlated strongly with the copy number per cell measured in the unamplified samples, with a Pearson correlation coefficient of 0.98 [ρ for 121 RNA species whose measured copy number was greater than the copy number observed for the largest blank barcode count]. 10 (rho) = 0.98]. The ratio of copy number t measured in the amplified sample to the copy number measured in the unamplified sample was 0.98 ± 0.12 (SEM; n = 121 RNAs), so the 5 × 5 amplification retained nearly 100% detection efficiency.

[0162] For these RNAs, the average copy number per cell detected by MERFISH was compared to the 5 × 5 amplifications in which RNA abundance was measured by RNA-seq (Figure 3E). The Pearson correlation coefficient was 0.90. Copy number results per cell were also highly reproducible across multiple MERFISH experiments with amplification (Figure 3F).

[0163] Figures 3A-3F show MERFISH measurements of 130 RNAs with 5x5 amplification in U-2 OS cells. Figure 3A, left panel: All identified RNAs detected in 5x5 amplified MERFISH measurements of 130 RNA molecular species with RNA barcodes represented by marker colors (represented by shading in this figure) (scale bar: 10 micrometers). Right panel: Two-color smFISH images from each of eight rounds of hybridization and imaging using readout probes labeled with Cy5 (green) or Alexa750 (red) for the boxed area in the photograph on the left panel (scale bar: 2 micrometers). Figure 3B shows the average RNA copy numbers per cell, sorted from maximum to minimum, for actual RNA barcodes (dark) and blank control barcodes (light) detected in approximately 1200 cells with 5x5 amplification. Figure 3C shows the error rate, which is the fraction of measured barcodes containing a given bit inversion, for each bit with 5x5 amplified MERFISH measurements. The 1 to 0 error rate (left) and 0 to 1 error rate (right) are shown for each bit. Figure 3D shows the average copy number per cell observed for these RNA species in 5x5 amplified U-2 OS cells compared to the copy number obtained from unamplified samples. The Pearson correlation coefficient was 0.98. Figure 3E shows the average RNA copy number per cell determined by MERFISH with 5x5 amplification compared to abundance determined by RNAseq. The Pearson correlation coefficient for the log10 values of RNA abundance was 0.9. Figure 3F shows the average copy number per cell detected in a single 5x5 amplified sample compared to replicate samples. The Pearson correlation coefficient was 0.96. [Example]

[0164] These examples demonstrate the combination of MERFISH and tri-letter amplification to measure hundreds of RNAs in a single cell. The tri-letter amplification sequences were shown to bind to the target and reach saturation within 15 minutes per amplification sequence staining round. Using this approach, RNA smFISH signals were amplified 5.5-fold, 10.5-fold, and 30.6-fold using 4x4, 5x5, and 9x9 amplifications, respectively, without any change in spot size. The coefficients of variation for spot brightness in unamplified, 4x4-amplified, 5x5-amplified, and 9x9-amplified samples were very close, indicating that spot brightness variability did not increase during DNA amplification, which is important for MERFISH decoding. Finally, accurate identification and counting of 130 RNA species was supported by a nearly 100% detection efficiency in the amplified samples, with a ratio of copy numbers measured in amplified samples to those measured in unamplified samples of 0.98.

[0165] The amplification fold was observed to be approximately 40% of the theoretical value for all three amplifications, including 4x4, 5x5, and 9x9 amplifications. It is believed that the binding efficiency of the amplification sequences and readouts was not 100%. The average binding rate per round was approximately 73.5%. In addition, 80% of the screened amplification sequence sets performed well, resulting in substantial amplification. The remaining 20% had high background or low amplification efficiency. This probability that the amplification sequence sets would work without further refinement illustrates the ability to rapidly scale up this approach to the amplification of a large number of readout sequences, which would be useful for expanding multiplexing capabilities.

[0166] Amplification was applied to an existing MERFISH library. The substantial increase in signal brightness afforded by amplification should open up several additional applications of MERFISH. In this example, MERFISH measurements were performed using 92 coding probes per RNA. This signal increase using amplification should enable the detection of much shorter RNAs, potentially as short as 300-mers, with as few as 10 coding probes. The ability to detect RNA molecules with a relatively small number of probes would also dramatically improve RNA isoform discrimination. Second, MERFISH measurements used a dynamic time proportional to the number of imaging fields (FOVs) and the time required for fixation of readout stains, readout cleavage, and washing. If the number of fields of view increases to a large number, the imaging time will dominate the throughput of MERFISH. Shortening the exposure time to the amplified signal should enable the imaging duration to be substantially shortened, thereby improving the throughput of MERFISH. In addition, spinning disk confocal imaging provided greater contrast but was less sensitive than wide-field microscopy in detecting photons in thicker samples. Therefore, incorporating amplification with MERFISH would facilitate the detection of FISH signals in tissues, for example, by spinning disk confocal microscopy. [Example]

[0167] Below are various materials and methods used in the above examples.

[0168] Encoding probe design: MERFISH measurements in human osteosarcoma cells (U-2 OS) (ATCC) were performed as follows. Briefly, RNA was encoded using a 16-bit MHD4 code. In this encoding scheme, each of the 140 possible barcodes had a constant Hamming weight (i.e., the number of "1" bits in each barcode) of 4 to avoid potential bias in the measurement of different barcodes due to the differential rate of "1" to "0" errors and "0" to "1" errors. In addition, all barcodes had a Hamming distance of at least 4 to enable error detection and correction. Of the 140 possible barcodes, 130 were used to encode intracellular RNA, and 10 barcodes were used as blank controls. Within the encoding probe library, each RNA molecular species contained 92 encoding probes, each containing three of the four readout sequences assigned to each RNA.

[0169] Construction of coded probes: The coded probe library was amplified from a complex oligonucleotide pool. Briefly, the oligo pool (CustomArray) was first amplified via limited-cycle PCR to generate an in vitro transcription template, which was converted to RNA and amplified via in vitro transcription (New England Biolabs). The RNA was then converted back to DNA via reverse transcription (Maxima RT H-, Thermo Fisher Scientific). See, for example, U.S. Patent Application Publication No. 2017 / 0212986, incorporated herein by reference. Excess NTPs or NTPs were removed after both in vitro transcriptions via a desalting column (Thermo Fisher Scientific), and phenol-chloroform extraction was performed to improve purity and reaction yield. The final DNA probes were purified via alkaline hydrolysis to remove the RNA template, phenol-chloroform extraction to remove proteins, and ethanol precipitation to concentrate the probes. The final probes were resuspended in RNAse-free water and stored at -20°C.

[0170] Coverslip silanization: To stabilize the polyacrylamide (PA) gel, coverslips were silanized. Briefly, 40-mm-diameter No. 1.5 coverslips (Bioptechs, 0420-0323-2) were washed for 30 minutes in a 1:1 mixture of 37% (v / v) methanol and hydrochloric acid at room temperature in a fume hood. The coverslips were then washed three times in demineralized water and once in 70% (v / v) ethanol. The coverslips were dried under a stream of nitrogen gas and then immersed in chloroform with 0.1% (v / v) triethylamine (Sigma) and 0.2% (v / v) allyltrichlorosilane (Sigma) for 30 minutes at room temperature. The coverslips were washed once each with pure chloroform and pure ethanol, then dried under nitrogen gas. The silanized coverslips were then stored at room temperature in a dry chamber for several weeks without any obvious deterioration in the quality of the silane layer.

[0171] Cell culture and fixation: U-2 OS cells were cultured in Eagle's minimum essential medium (ATCC) containing 10% (vol / vol) fetal bovine serum (FBS) (Thermo Fisher Scientific) and penicillin-streptomycin (Thermo Fisher Scientific). To aid cell attachment, silanized coverslips were coated with 0.1 mg / mL poly-D-lysine (PDL) (Sigma) diluted in nuclease-free water for 1 hour at room temperature. Coverslips were washed three times with water, incubated overnight in water at room temperature, then dried and UV-sterilized before seeding. U-2 OS cells were then seeded at 250,000 cells per coverslip for 48 hours at 37°C with 5% CO2. Cells were fixed with 4% (v / v) paraformaldehyde (PFA) (Electron Microscopy Sciences) in 1x PBS for 15 min at room temperature, washed three times with 1x PBS, then permeabilized with 0.5% (v / v) Triton X-100 (Sigma) in 1x PBS for 10 min, and washed again three times with 1x PBS.

[0172] Staining of the coding probe was performed as follows: fixed and permeabilized U-2 OS cells were incubated for 5 minutes in coding wash buffer containing 2x sodium citrate saline (SSC) (Ambion) and 30% (vol / vol) formamide (Ambion) in nuclease-free water. Then, 30 microliters of approximately 300 micromoles of MERFISH-encoded probe or approximately 1 micromoles of FLNA-encoded probe and 3.3 micromoles of poly(dT)LNA anchor probe (having the sequence: 5Acryd / TTGAGTGGATGGAGTGTAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT (SEQ ID NO: 65), a 20-nucleotide sequence in which dT alternates with thymidine-locked nucleic acid (dT+), with the 20-nucleotide reverse complement of the readout sequence and 5'-acrydite modifications (Integrated DNA Technologies)) in encoding hybridization buffer was added to the surface of the Parafilm and covered with a coverslip containing the cells. The coding hybridization buffer contained coding wash buffer supplemented with 10% (wt / vol) dextran sulfate (Sigma), 0.1% (wt / vol) yeast tRNA (Life Technologies), and 1% (vol / vol) mouse RNase inhibitor (New England Biolabs). Samples were incubated for 36 hours at 37°C in a humidified chamber inside the hybridization oven. Cells were then washed twice with coding wash buffer and incubated at 47°C for 30 minutes each time.

[0173] Embedding and clearing of samples: RNA was anchored in place in the coded probe-stained samples using 4% PA gel. Briefly, the coded probe-stained samples on coverslips were first incubated for 2 minutes with degassed PA solution containing 4% (volume / volume) 19:1 acrylamide / bis-acrylamide (BioRad), 60 mM Tris-HCl pH 8 (Thermo Fisher), 0.3 M NaCl (Thermo Fisher), and a 1:100,000 dilution of 0.1 micrometer diameter carboxylic acid-modified orange fluorescent beads (Life Technologies, F-8800). The beads were used as fiducial markers for aligning images taken across multiple rounds of MERFISH imaging. The cell-containing coverslip was then incubated again for 2 minutes with the same PA gel solution containing the polymerization inducer ammonium persulfate (Sigma) and the accelerator TEMED (Sigma) at final concentrations of 0.05% (wt / vol) and 0.05% (v / vol), respectively. 50 microliters of this gel solution was added to the surface of a glass plate (TED Pella) pretreated with 1 mL of GelSlick (Lonza) to prevent adhesion of the PA. The sample was aspirated to remove excess PA gel solution and then inverted onto the 50 microliter drop to form a thin layer of PA between the coverslip and the glass plate without any air bubbles. After 1.5 hours of gel casting at room temperature, the coverslip and glass plate were gently separated, and the coverslip was washed twice with digestion buffer containing 2% (wt / vol) sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific), 50 mM Tris-HCl pH 8 (Ambion), 1 mM EDTA (Ambion), and 0.5% (vol / vol) Triton X-100 in nuclease-free water. The gel was then immersed and digested for >12 hours in digestion buffer supplemented with 1% (vol / vol) proteinase K (New England Biolabs) in a humidified 37°C incubator.The digested samples were washed three times for 15 minutes each with 2x SSC on a rocker. Samples were either stored for no more than 48 hours at 4°C in 2x SSC supplemented with 0.1% (v / v) mouse RNase inhibitor for non-amplified MERFISH measurements or proceeded to staining for amplified sequences.

[0174] Staining of amplified sequences: Primary and secondary amplified sequences were stained in gel-embedded, cleared samples. Samples were incubated for 5 minutes in a 10% formamide wash buffer containing 2x SSC (ThermoFisher) and 10% (v / v) formamide (ThermoFisher) in nuclease-free water. Next, 50 microliters of 5 nM primary amplified sequence in an amplified sequence hybridization buffer containing 2x SSC, 10% (v / v) formamide, 0.1% (w / v) yeast tRNA (Life Technologies), 1% (v / v) mouse RNase inhibitor (New England Biolabs), and 10% (w / v) dextran sulfate (Sigma) was added to the Parafilm surface. The samples covered in 50-microliter droplets on Parafilm were incubated in a humidity-controlled 37°C incubator for 30 minutes (MERFISH) or for a time series of 15, 30, 60, and 180 minutes for binding rate measurements after removing excess 10% formamide wash buffer with Kimwipes. The samples were then washed three times in a Petri dish with 10% formamide wash buffer at room temperature for 5 minutes each. Fifty microliters of 5 nM secondary amplification sequence in amplification sequence hybridization buffer was added to the unused Parafilm. The washed samples were re-covered on the droplets and incubated in a 37°C incubator for the same time as the primary amplification sequence staining. Samples were then washed twice for 5 minutes each in 10% formamide wash buffer at room temperature, and the third wash was for 15 minutes in 10% formamide wash buffer in a 37° C. incubator. Samples were either imaged immediately or stored in 2× SSC supplemented with 0.1% (v / v) mouse RNase inhibitor at 4° C. for no more than 48 hours.

[0175] MERFISH Imaging Platform: Samples were imaged on a home-built, high-throughput imaging platform at the Center for Advanced Imaging, Harvard University. Briefly, the microscope was built around an Olympus IX-71 microscope body and a Nikon CFI Plan Apo Lambda 60x oil objective. Illumination at 750, 647, 560, 488, and 405 nm was provided using solid-state lasers (MBP Communications, 2RU-VFL-P-500-750-B1R; MBP Communications, 2RU-VFL-P-2000-647-B1R; MBP Communications, 2RU-VFL-P-2000-560-B1R; MBP Communications, 2RU-VFL-P-500-488-B1R; Coherent, Cube 405). These laser beams were used to excite Alexa750 and Cy5, orange reference beads, poly(dT) readout, and DAPI-labeled readout probes, respectively. The illumination profile was flattened using a πShaper (Pishaper). Fluorescence emission from the sample was separated from the laser illumination using a pentaband dichroic mirror (Chroma, zy405 / 488 / 561 / 647 / 752RP-UF1) and imaged with an academic CMOS camera (sCMOS; Hamamatsu Photonics, C11440-C22CU) after filtering out stray excitation light through two custom-made overlapping Venta notch filters (Chroma, ZET405 / 488 / 561 / 647-656 / 752m). The pixel size for the sCMOS camera was determined to correspond to 109 nm in the sample plane. The exposure time was 500 ms for each imaging frame.Sample position was controlled via a motorized microscope stage (Ludl), and focus was maintained via a custom-built focus locking system achieved through a feedback system between an objective nanopositioner (Mad City Labs, Nano-F100S) and the reflected light of an IR laser (Thorlabs, LP980-SF15) onto a CMOS camera (Thorlabs, DCC1545M). Sample coverslips were held within a flow chamber (Bioptechs, FCS2), and buffer exchange within this chamber was directed using a custom-built automated fluidics system controlling three 8-way valves (Hamilton, MVP and HVXM 8-5) and a peristaltic pump (Gilison, Minipuls 3).

[0176] Sample imaging: Sequential MERFISH imaging was performed on the high-throughput imaging platform described above. Briefly, each MERFISH round involved staining the readout probe (10 min), washing with wash buffer (5 min), flowing with imaging buffer (3 min), imaging with 100-400 fields of view, fluorophore cleavage of the readout (15 min), and washing with 2x SSC (5 min). Eight rounds of two-color MERFISH imaging were performed for each sample. Specifically, staining of the readout probe was performed by flowing 3 nM readout probe into hybridization buffer containing 2x SSC, 10% (v / v) ethylene carbonate (Sigma-Aldrich), and 0.1% (v / v) mouse RNase inhibitor (NEB) in nuclease-free water. The wash buffer contained 2x SSC and 10% (v / v) ethylene carbonate in nuclease-free water. The imaging buffer was 2x SSC, 50 mM Tris-HCl pH 8, 10% (w / v) glucose, 2 mM Trolox (Sigma-Aldrich), 0.5 mg / mL glucose oxidase (Sigma-Aldrich), 40 micrograms per mL catalase (Sigma-Aldrich), and 0.1% (v / v) mouse RNase inhibitor in nuclease-free water. A cleavage buffer containing 2x SSC and 50 mM tris(2-carboxyethyl)phosphine (TCEP; Sigma) was used to cleave the disulfide bond conjugating the dye to the probe. SmFISH imaging was similar to single-round MERFISH imaging, but without the cleavage and 2x SSC wash steps.

[0177] Image processing and decoding: For FLNA smFISH data, the intensity and PSF size of unamplified and amplified FISH spots were calculated using a Gaussian fitting routine. For MERFISH data, registration of images of the same field across different imaging rounds and decoding of RNA barcodes were performed as follows. Briefly, the offset between images in each imaging round was corrected using the localization of fiducial beads in each imaging round. Next, the background in the images was removed using a high-pass filter, RNA spots were tightened by deconvolution, and RNA centroids with slightly different positions between images were connected using a low-pass filter. The intensities of the different color channels of the RNA spots were then normalized by equalizing their intensity histograms through an iterative process. Barcodes were assigned to individual pixels by comparing the normalized intensity of each pixel across all 16 images in the eight two-color rounds.

[0178] The calculations were performed on a desktop server containing two 10-core Intel Xeon E5-2680 2.8-GHz CPUs and 256 GB of RAM. [Example]

[0179] To confirm 5x5 amplification in tissue samples, in this example, mouse medial preoptic area (MPOA) was selected. The tissue was cut into 10 micrometer sections and stained with a 135-gene MERFISH library, then embedded in a gel and cleared. 5x5 amplification was then performed on the tissue samples using the same technique as described above.

[0180] Figure 4A shows a first-round raw image of a 5x5 amplified bright spot, and Figure 4B is a magnified view of the area outlined in white in Figure 4A (scale bar in Figure 4A is 10 micrometers, scale bar in Figure 4B is 2 micrometers).

[0181] After decoding, RNA counts from MERFISH measurements were compared with RNA abundance data from RNA-seq. They were strongly correlated, with a Pearson correlation coefficient of 0.81. This can be seen in Figure 4C, which shows plots of FPKM (fragments per kilobase of transcript per million mapped reads) and counts per field of view (FOV).

[0182] While several embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions and / or obtaining one or more of the results and / or advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications for which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Accordingly, the foregoing embodiments are presented by way of example only, and it should be understood that, within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, item, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, items, materials, kits, and / or methods is also included within the scope of the present invention, to the extent that such features, systems, items, materials, kits, and / or methods are not mutually inconsistent.

[0183] In the event that the present specification and a document incorporated by reference include conflicting and / or inconsistent disclosure, the present specification shall control. In the event that two or more documents incorporated by reference include conflicting and / or inconsistent disclosure with respect to each other, the document having the later publication date shall control.

[0184] All definitions provided and used herein are to be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0185] The indefinite articles "a" and "an," as used in this specification and claims, unless indicated to the contrary, shall be understood to mean "at least one."

[0186] As used in the specification and claims, the term "and / or" shall be understood to mean "one or both" of the elements so conjoined, i.e., elements that are present conjunctively in some cases and disjunctively in other cases. Multiple elements listed with "and / or" shall be understood in the same manner, i.e., "one or more" of the elements so conjoined. The "and / or" clause indicates that other elements may be present other than the elements specifically identified, whether related or unrelated to the elements specifically identified. Thus, by way of non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising," may, in one embodiment, refer only to A (which may include elements other than B); in another embodiment, it may refer only to B (which may include elements other than A); in yet another embodiment, it may refer to both A and B (which may include other elements), etc.

[0187] As used herein and in the claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., the inclusion of at least one of a number or list of elements, but also including more than one number or list, and may include additional, unlisted items. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," will refer to exactly one element of a number or list of elements. Generally, the term "or" as used herein shall be interpreted to indicate exclusive alternatives (i.e., "one or the other, but not both") only when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."

[0188] The phrase "at least one," as used herein and in the claims, in reference to a list having one or more elements, shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for elements, whether related or unrelated to the specifically identified element, that may be present other than the elements specifically identified in the list of elements to which the phrase "at least one" refers. Thus, by way of non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer, in one embodiment, to at least one A (and may include elements other than B), which may include more than one A, but no B; in another embodiment, to at least one B (and may include elements other than A), which may include more than one B, but no A; in yet another embodiment, to at least one A, which may include at least one A and more than one B, which may include at least one B (and may include other elements), etc.

[0189] When the word "about" is used herein in reference to a number, it should be understood that further embodiments of the present invention also include numbers that are not modified by the word "about."

[0190] It is also to be understood that, unless expressly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order of the method steps or acts recited.

[0191] In the claims, as well as in the above specification, all transitional phrases such as "comprising," "including," "holding," "having," "containing," "with," "holding," "consisting of," etc., shall be understood to be open-ended, i.e., meaning "including, but not limited to." Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as expressly set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

1. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

2. 10. The method of claim 1, comprising exposing the sample to at least five different nucleic acid probes.

3. 3. The method of claim 1 or 2, comprising exposing the sample to at least 10 different nucleic acid probes.

4. 4. The method of claim 1, comprising exposing the sample to at least 100 different nucleic acid probes.

5. 5. The method of claim 1, comprising sequentially exposing the sample to a plurality of nucleic acid probes.

6. The method of any one of claims 1 to 5, wherein the plurality of nucleic acid probes comprises a combinatorial combination of nucleic acid probes with different sequences.

7. 7. The method of claim 6, wherein the combinatorial combination of nucleic acid probes targets a combinatorial combination of RNA species in the sample.

8. 8. The method of claim 6 or 7, wherein the combinatorial combination of nucleic acid probes targets combinatorial combinations of DNA sequences in the sample.

9. 9. The method of claim 1, wherein at least some of the plurality of nucleic acid probes comprise DNA.

10. 10. The method of claim 1, wherein at least some of the plurality of nucleic acid probes comprise RNA.

11. 11. The method of any one of claims 1 to 10, wherein the plurality of nucleic acid probes has an average length of between 10 and 300 nucleotides.

12. 12. The method of claim 1, wherein at least some of the plurality of nucleic acid probes are configured to bind to nucleic acids in the sample.

13. 13. The method of claim 1, wherein at least some of the plurality of nucleic acid probes comprise a target sequence and one or more lead sequences.

14. 14. The method of claim 13, wherein the target sequences of the plurality of nucleic acid probes have an average length of between 10 and 200 nucleotides.

15. 15. The method of claim 13 or 14, wherein the target sequence is substantially complementary to a nucleic acid sequence encoding a protein.

16. 16. The method of any one of claims 13 to 15, wherein the target sequence binds to the target via specific binding.

17. 17. The method of claim 16, wherein the target comprises RNA.

18. 18. The method of claim 17, wherein the RNA comprises non-coding RNA.

19. 19. The method of claim 17 or 18, wherein the RNA comprises mRNA.

20. 20. The method of any one of claims 17 to 19, wherein the RNA comprises transfer RNA (tRNA).

21. 21. The method of any one of claims 17 to 20, wherein the RNA comprises ribosomal RNA (rRNA).

22. 22. The method of any one of claims 16 to 21, wherein the target comprises DNA.

23. 23. The method of claim 22, wherein the DNA comprises genomic DNA.

24. 24. The method of any one of claims 13 to 23, wherein the primary amplified nucleic acid is bound to the nucleic acid probe via a lead sequence.

25. 25. The method of any one of claims 13 to 24, wherein the plurality of nucleic acid probes comprises distinguishable nucleic acid probes formed from combinatorial combination of one or more pools of lead sequences.

26. 26. The method of claim 25, wherein the pool has at least 8 possible lead sequences.

27. 27. The method of claim 25 or 26, wherein the pool has at least 16 possible lead sequences.

28. 28. The method of any one of claims 25 to 27, wherein the pool has at least 24 possible lead sequences.

29. 29. The method of any one of claims 25 to 28, wherein the pool has at least 32 possible lead sequences.

30. 30. The method of any one of claims 25 to 29, wherein the pool has at least 48 possible lead sequences.

31. 31. The method of any one of claims 25 to 30, wherein the pool has at least 64 possible lead sequences.

32. 32. The method of any one of claims 25 to 31, wherein the pool has no more than 32 possible lead sequences.

33. 33. The method of any one of claims 25 to 32, wherein the pool has no more than 16 possible lead sequences.

34. 34. The method of any one of claims 25 to 33, wherein the plurality of read sequences are distributed over the plurality of nucleic acid probes so as to define an error-correcting code.

35. 35. The method of any one of claims 13 to 34, wherein the lead sequence has an average length of between 5 and 50 nucleotides.

36. 36. The method of any one of claims 13 to 35, wherein at least some of the plurality of nucleic acid probes comprise no more than 10 lead sequences.

37. 37. The method of any one of claims 13 to 36, wherein at least some of the plurality of nucleic acid probes comprise no more than five lead sequences.

38. 38. The method of any one of claims 1 to 37, wherein no more than 20 primary amplified nucleic acids are allowed to bind to the nucleic acid probe.

39. 39. The method of any one of claims 1 to 38, wherein no more than 10 primary amplified nucleic acids are allowed to bind to the nucleic acid probe.

40. 40. The method of any one of claims 1 to 39, wherein no more than five primary amplified nucleic acids are allowed to bind to the nucleic acid probe.

41. 41. The method of any one of claims 1 to 40, wherein the primary amplified nucleic acids have an average length of less than 300 nucleotides.

42. 42. The method of any one of claims 1 to 41, wherein the primary amplified nucleic acids have an average length of less than 200 nucleotides.

43. 43. The method of any one of claims 1 to 42, wherein the primary amplified nucleic acid has a repeat sequence to which the secondary amplified nucleic acid can bind.

44. 44. The method of any one of claims 1 to 43, wherein the secondary amplified nucleic acids each target a sequence of less than 10 nucleotides on the primary amplified nucleic acid.

45. 45. The method of any one of claims 1 to 44, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides.

46. 46. The method of any one of claims 1 to 45, wherein no more than 20 secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid.

47. 47. The method of any one of claims 1 to 46, wherein no more than 10 secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid.

48. 48. The method of any one of claims 1 to 47, wherein no more than five secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid.

49. 49. The method of any one of claims 1 to 48, wherein the secondary amplified nucleic acids have an average length of less than 300 nucleotides.

50. 50. The method of any one of claims 1 to 49, wherein the secondary amplified nucleic acids have an average length of less than 200 nucleotides.

51. 51. The method of any one of claims 1 to 50, wherein the secondary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides.

52. 52. The method of any one of claims 1 to 51, wherein the secondary amplified nucleic acid comprises a fluorescent signal generating entity.

53. 53. The method of any one of claims 1 to 52, further comprising exposing the secondary amplified nucleic acid to a fluorescent signal generating entity.

54. 54. The method of claim 52 or 53, wherein the secondary amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

55. 55. The method of any one of claims 52 to 54, wherein the fluorescent signal generating entity is linked to the secondary amplified nucleic acid by a disulfide.

56. 52. The method of any one of claims 1 to 51, further comprising exposing the secondary amplified nucleic acid to a tertiary amplified nucleic acid capable of binding to the secondary amplified nucleic acid.

57. 57. The method of claim 56, wherein the tertiary amplified nucleic acid comprises a fluorescent signal generating entity.

58. 57. The method of claim 56, further comprising exposing the tertiary amplified nucleic acid to a fluorescent signal generating entity.

59. 59. The method of claim 57 or 58, wherein the tertiary amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

60. 57. The method of claim 56, further comprising exposing the tertiary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each amplified nucleic acid capable of binding to a preceding round of amplified nucleic acid.

61. 61. The method of claim 60, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

62. 61. The method of claim 60, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

63. 63. The method of claim 61 or 62, wherein the final round of amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

64. 64. The method of any one of claims 52 to 55, 57 to 59, or 61 to 63, wherein the fluorescent signal generating entity comprises a protein.

65. 65. The method of any one of claims 52 to 55, 57 to 59, or 61 to 64, wherein the fluorescent signal generating entity comprises a dye.

66. 66. The method of any one of claims 52 to 55, 57 to 59, or 61 to 65, wherein the fluorescent signal generating entity comprises Alexa Fluor 750.

67. 67. The method of any one of claims 52 to 55, 57 to 59, or 61 to 66, wherein the fluorescent signal generating entity comprises Cy5.

68. 68. The method of any one of claims 52 to 55, 57 to 59, or 61 to 67, wherein the fluorescent signal generating entity comprises a nanoparticle.

69. 69. The method of any one of claims 52 to 55, 57 to 59, or 61 to 68, comprising inactivating the fluorescent signal generating entity during exposure of the sample to the nucleic acid probe.

70. 70. The method of claim 69, comprising inactivating the fluorescent signal generating entity by removing the fluorescent signal generating entity.

71. 71. The method of claim 69 or 70, comprising inactivating the fluorescent signal generating entity using a reducing agent.

72. 72. The method of any one of claims 69 to 71, comprising inactivating the fluorescent signal generating entity using disulfide cleavage.

73. 73. The method of any one of claims 69 to 72, comprising inactivating the fluorescent signal generating entity by photobleaching the fluorescent signal generating entity.

74. 74. The method of any one of claims 69 to 73, comprising inactivating the fluorescent signal generating entity by chemical bleaching of the fluorescent signal generating entity.

75. 75. A method according to any one of claims 69 to 74, comprising inactivating the fluorescent signal generating entity by enzymatic cleavage of the fluorescent signal generating entity.

76. 76. The method of any one of claims 1 to 75, wherein the plurality of nucleic acid probes defines a code space having a Hamming distance of at least 2.

77. 77. The method of any one of claims 76, wherein the plurality of nucleic acid probes defines a code space having a Hamming distance of at least 3.

78. 78. The method of claim 76 or 77, wherein the code space is a Hamming (7,4) code, a Hamming (15,11) code, a Hamming (31,26) code, a Hamming (63,57) code, or a Hamming (127,120) code.

79. 79. The method of any one of claims 76 to 78, wherein the code space is a SECDED code.

80. 80. The method of claim 79, wherein the code space is a SECDED(8,4) code, a SECDED(16,4) code, a SECDED(16,11) code, a SECDED(22,16) code, a SECDED(39,32) code, or a SECDED(72,64) code.

81. 81. The method of any one of claims 76 to 80, wherein the nucleic acid probe defines a code space having a fixed number of ones only.

82. 82. The method of any one of claims 1 to 81, comprising determining the distribution of nucleic acid probes by imaging at least a portion of the sample.

83. 83. The method of claim 82, comprising determining binding of the nucleic acid probe using optical imaging.

84. 84. The method of claim 82 or 83, comprising determining binding of the nucleic acid probe using fluorescent imaging.

85. 85. The method of any one of claims 82 to 84, comprising determining binding of the nucleic acid probe using multi-colour fluorescence imaging.

86. 86. The method of any one of claims 82 to 85, comprising determining binding of the nucleic acid probe using ultra-high resolution fluorescence imaging.

87. 87. The method of claim 86, comprising determining binding of the nucleic acid probe using STORM (stochastic optical reconstruction microscopy).

88. 88. The method of any one of claims 82 to 87, comprising determining the centroid of the image for the secondary amplified nucleic acid using an algorithm for determining non-overlapping single emitters.

89. 89. The method of any one of claims 82 to 88, comprising determining the centroid of the image for the secondary amplified nucleic acid using an algorithm for determining partially overlapping single emitters.

90. 90. The method of claim 88 or 89, further comprising determining a confidence level for the secondary amplified nucleic acid.

91. 91. The method of claim 90, comprising determining a confidence level using a ratio of the number of exact matches to the number of matches with one or more single-bit errors to the code word.

92. 92. A method according to claim 90 or 91, comprising determining the confidence level using the ratio of the number of exact matches to the number of matches with exactly one single-bit error for the code word.

93. 93. The method of claims 82 to 92, comprising determining the distribution of nucleic acid probes in a sample at a resolution of greater than 300 nm.

94. 94. The method of claims 82 to 93, comprising determining the distribution of nucleic acid probes in a sample at a resolution of better than 100 nm.

95. 95. The method of claims 82 to 94, comprising determining the distribution of nucleic acid probes in a sample at a resolution of better than 50 nm.

96. 96. The method of any one of claims 1 to 95, wherein the sample comprises cells.

97. 97. The method of claim 96, wherein the cell is a human cell.

98. 98. The method of any one of claims 96 to 97, wherein the cells are fixed.

99. 99. The method of any one of claims 1 to 98, wherein the sample comprises tissue.

100. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

101. 101. The method of claim 100, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

102. 102. The method of claim 101, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

103. 102. The method of claim 101, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

104. 104. The method of claim 102 or 103, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

105. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

106. 106. The method of claim 105, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

107. 107. The method of claim 106, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

108. 107. The method of claim 106, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

109. 109. The method of claim 107 or 108, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

110. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

111. 111. The method of claim 110, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

112. 112. The method of claim 111, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

113. 112. The method of claim 111, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

114. 114. The method of claim 112 or 113, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

115. 115. The method of any one of claims 111 to 114, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides.

116. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; generating a code word based on the fluorescence distribution in the sample; and For at least some of the code words, matching the code words to valid code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

117. 117. The method of claim 116, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

118. 118. The method of claim 117, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

119. 118. The method of claim 117, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

120. 120. The method of claim 118 or 119, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

121. 121. The method of any one of claims 117 to 120, wherein at least one of the amplified nucleic acids of the one or more further rounds is formed from only three of the four naturally occurring nucleotides.

122. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

123. 123. The method of claim 122, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity.

124. 123. The method of claim 122, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity.

125. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

126. 126. The method of claim 125, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity.

127. 126. The method of claim 125, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity.

128. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplification nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

129. 129. The method of claim 128, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity.

130. 129. The method of claim 128, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity.

131. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplification nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

132. 132. The method of claim 131, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity.

133. 132. The method of claim 131, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity.

134. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplified nucleic acid binds to the nucleic acid probe within a fixed distance; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

135. 135. The method of claim 134, wherein for at least a portion of the code words, the code words are matched to valid code words.

136. 136. The method of claim 135, wherein if a match is not found, error correction is applied to the code word to form a valid code word.

137. 137. The method of any one of claims 134 to 136, further comprising exposing the primary amplified nucleic acid to a fluorescent signal generating entity.

138. 137. The method of any one of claims 134 to 136, wherein the primary amplified nucleic acid comprises a fluorescent signal generating entity.

139. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

140. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and generating code words based on the fluorescence distribution in the sample, and matching the code words to valid code words for at least some of the code words, and if a match is not found, optionally applying error correction to the code words to form valid code words. A method comprising:

141. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to primary amplified nucleic acids capable of binding to the nucleic acid probe, wherein a maximum number of primary amplified nucleic acids are capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to secondary amplified nucleic acids capable of binding to the primary amplified nucleic acid, wherein a maximum number of secondary amplified nucleic acids are capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

142. 142. The method of claim 141, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

143. 143. The method of claim 142, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

144. 143. The method of claim 142, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

145. 145. The method of claim 143 or 144, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

146. 146. The method of any one of claims 141 to 145, wherein for at least some of the code words, the code words are matched to valid code words.

147. 147. The method of claim 146, wherein if a match is not found, optionally error correction is applied to the code word to form a valid code word.

148. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

149. 149. The method of claim 148, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

150. 150. The method of claim 149, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

151. 150. The method of claim 149, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

152. 152. The method of claim 150 or 151, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

153. 153. A method according to any one of claims 148 to 152, wherein for at least some of the code words, the code words are matched to valid code words.

154. 154. The method of claim 153, wherein if a match is not found, optionally error correction is applied to the code word to form a valid code word.

155. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid binds to the primary amplified nucleic acid within a fixed distance; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

156. 156. The method of claim 155, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

157. 157. The method of claim 156, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

158. 157. The method of claim 156, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

159. 159. The method of claim 157 or 158, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

160. 160. A method according to any one of claims 155 to 159, wherein for at least some of the code words, the code words are matched to valid code words.

161. 161. The method of claim 160, wherein if no match is found, optionally error correction is applied to the code word to form a valid code word.

162. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

163. 163. The method of Claim 162, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

164. 164. The method of claim 163, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

165. 164. The method of claim 163, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

166. 166. The method of claim 164 or 165, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

167. 167. A method according to any one of claims 162 to 166, wherein for at least some of the code words, the code words are matched to valid code words.

168. 168. The method of claim 167, wherein if no match is found, optionally error correction is applied to the code word to form a valid code word.

169. 169. The method of any one of claims 162 to 168, wherein at least one of the amplified nucleic acids of one or more further rounds is formed from only three of the four naturally occurring nucleotides.

170. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

171. 171. The method of claim 170, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

172. 172. The method of claim 171, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

173. 172. The method of claim 171, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

174. 174. The method of claim 172 or 173, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

175. 175. The method of any one of claims 170 to 174, wherein for at least some of the code words, the code words are matched to valid code words.

176. 176. The method of claim 175, wherein if no match is found, optionally error correction is applied to the code word to form a valid code word.

177. 177. The method of any one of claims 170 to 176, wherein at least one of the amplified nucleic acids of one or more further rounds is formed from only three of the four naturally occurring nucleotides.

178. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

179. exposing the sample to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

180. 180. The method of claim 179, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

181. 181. The method of claim 180, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

182. 181. The method of claim 180, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

183. 183. The method of claim 181 or 182, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

184. exposing the sample to a binding entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

185. exposing the sample to a binding entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein binding of the primary amplification nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

186. exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

187. 187. The method of claim 186, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

188. 188. The method of claim 187, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

189. 188. The method of claim 187, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

190. 190. The method of claim 188 or 189, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

191. exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein binding of the primary amplified nucleic acid and the secondary amplified nucleic acid to the target is saturable; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

192. 192. The method of claim 191, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

193. 193. The method of claim 192, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

194. 193. The method of claim 192, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

195. 195. The method of claim 193 or 194, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

196. exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplification nucleic acid capable of binding to the nucleic acid probe, wherein the primary amplification nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

197. 200. The method of claim 196, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, each of which is capable of binding to amplified nucleic acid from a preceding round.

198. 200. The method of claim 197, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

199. 200. The method of claim 197, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

200. 200. The method of claim 198 or 199, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

201. 201. The method of any one of claims 196 to 200, wherein for at least some of the code words, the code words are matched to valid code words.

202. 202. The method of claim 201, wherein if no match is found, optionally error correction is applied to the code word to form a valid code word.

203. 203. The method of any one of claims 196 to 202, wherein at least one of the amplified nucleic acids of one or more further rounds is formed from only three of the four naturally occurring nucleotides.

204. exposing the sample to a targeting entity conjugated to a nucleic acid probe; exposing the nucleic acid probe to a primary amplified nucleic acid capable of binding to the nucleic acid probe; exposing the primary amplified nucleic acid to a secondary amplified nucleic acid capable of binding to the primary amplified nucleic acid, wherein the secondary amplified nucleic acid is formed from only three of the four naturally occurring nucleotides; Using fluorescence to determine the distribution of nucleic acid probes in a sample; and Creating a code word based on the fluorescence distribution in the sample A method comprising:

205. 205. The method of claim 204, further comprising exposing the secondary amplified nucleic acid to one or more additional rounds of amplified nucleic acid, including a final round of amplified nucleic acid, wherein each amplified nucleic acid is capable of binding to a preceding round of amplified nucleic acid.

206. 206. The method of claim 205, wherein the final amplified nucleic acid comprises a fluorescent signal generating entity.

207. 206. The method of claim 205, further comprising exposing the final round of amplified nucleic acid to a fluorescent signal generating entity.

208. 208. The method of claim 206 or 207, wherein the final amplified nucleic acid has a repeat sequence to which a fluorescent signal generating entity can bind.

209. 209. The method of any one of claims 204 to 208, wherein for at least some of the code words, the code words are matched to valid code words.

210. 210. The method of claim 209, wherein if no match is found, optionally error correction is applied to the code word to form a valid code word.

211. 211. The method of any one of claims 204 to 210, wherein at least one of the amplified nucleic acids of one or more further rounds is formed from only three of the four naturally occurring nucleotides.

Images