Production of dsrna in plant cells for pest protection via gene silencing
By producing long dsRNA molecules in plant cells that target pest genes using RNA-dependent RNA polymerase, the method effectively silences pest genes, addressing the limitations of current pest control methods and enabling pest-resistant plants.
Patent Information
- Application Number
- JP2025067723
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-03-14
- Filing Date
- 2025-04-16
- Publication Date
- 2025-08-13
AI Technical Summary
Current methods for pest control in plants, such as genome editing and RNA interference, are limited in their ability to efficiently produce long dsRNA molecules that can specifically silence pest genes, and there is a need for more effective and targeted gene silencing strategies.
A method is developed to produce long dsRNA molecules in plant cells by selecting a nucleic acid sequence that encodes a silencing molecule capable of recruiting RNA-dependent RNA polymerase (RdRp) and modifying the nucleic acid sequence to confer silencing specificity for a pest gene, forming base complementarity with the silencing molecule to produce dsRNA that can silence the pest gene.
This approach enables efficient and targeted silencing of pest genes in plants, potentially leading to pest-resistant or tolerant plants without the need for DNA editing agents, and can be applied to various pests including insects, nematodes, and fungi.
Smart Images

Figure 2025118671000019 
Figure 2025118671000020 
Figure 2025118671000021
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims the benefit of priority to UK Patent Application No. 1903521.1 filed on March 14, 2019, the entire contents of which are incorporated herein by reference.
[0002] Sequence Listing Description An ASCII file entitled 81321 Sequence Listing.txt, containing 73,728 bytes and created on March 12, 2020, which was filed concurrently with the filing of this application, is incorporated herein by reference.
[0003] FIELD OF THE INVENTION AND BACKGROUND ART In some embodiments, the present invention relates to the generation and amplification of dsRNA molecules in host cells for silencing target genes in pests. [Background technology]
[0004] Recent advances in genome editing technology have made it possible to change the DNA sequence in living cells by editing just a few of the billions of nucleotides in the genome of those cells. Over the past decade, the tools and expertise for using genome editing in human somatic cells and pluripotent cells have increased, to the point where this approach is now widely deployed as a strategy for treating human diseases. The basic process relies on creating a site-specific DNA double-strand break (DSB) in the genome and then allowing the cell's endogenous DSB repair mechanism to repair the break (e.g., by non-homologous end joining (NHEJ) or homologous recombination (HR)). The latter allows for precise changes of one or more nucleotides to the DNA sequence using an exogenously provided donor template (Non-Patent Document 1).
[0005] For example, for potential therapeutics, three major approaches use mutagenic genome editing (NHEJ) in cells: (a) knocking out functional genetic elements by causing spatially precise insertions or deletions, (b) creating insertions or deletions that compensate for the underlying frameshift mutation, reactivating partially functional or nonfunctional genes, and (c) creating defined gene deletions. While NHEJ editing is used in several different applications, perhaps the broadest application of editing utilizes genome editing via homologous recombination (HR). HR is a rare event, but is highly accurate as it relies on an exogenously provided template to copy precise sequences during the repair process.
[0006] Currently, the four main applications of HR-mediated genome editing are (a) gene correction (i.e., correcting diseases caused by point mutations in a single gene), (b) functional gene correction (i.e., correcting diseases caused by mutations scattered throughout a gene), (c) safe harbor gene addition (i.e., when precise regulation is not required or when above-physiological levels of the transgene are desired), and (d) targeted transgene addition (i.e., when precise regulation is required) (Non-Patent Document 1, preface).
[0007] Previous studies on genome editing of RNA molecules in various eukaryotes (e.g., mice, humans, shrimp, and plants) have focused on, for example, knocking out the activity of miRNA genes or altering binding sites in target RNAs.
[0008] Regarding genome editing in human cells, Non-Patent Document 2 used CRISPR / Cas9 to delete human miR-93 from the cluster by targeting its 5' region in HeLa cells. Various small deletions were induced in the targeted region, including the Drosha processing site (i.e., the site where Drosha, a double-stranded RNA-specific RNase III enzyme, binds to and cleaves the primary miRNA (pri-miRNA) in the host cell nucleus, thereby processing it into pre-miRNA) and the seed sequence (i.e., a conserved heptametric sequence essential for miRNA binding to mRNA, typically located 2-7 positions from the 5' end of the miRNA). According to Non-Patent Document 2, even a single-nucleotide deletion completely knocked out the targeted miRNA with high specificity.
[0009] Regarding genome editing in mouse species, Non-Patent Document 3 provided a strategy for inhibiting miRNA using the CRISPR-Cas9 system in mouse cells. Non-Patent Document 3 used a specially designed sgRNA to cleave the miRNA gene at a single site with Cas9 nuclease, resulting in the knockout of miRNA in these cells.
[0010] Regarding genome editing in plants, Non-Patent Document 4 discusses the use of CRISPR-Cas9 technology in plants in comparison with ZFN and TALEN, and Non-Patent Document 5 teaches that CRISPR-Cas9 technology has been applied to knockdown of protein-encoding genes in model plants such as Arabidopsis and tobacco, as well as in crops including wheat, maize, and rice.
[0011] In addition to disrupting miRNA activity or target binding sites, gene silencing has been achieved using artificial miRNAs (amiRNAs) to silence endogenous and exogenous target genes (Non-Patent Document 6). Similar to miRNAs, amiRNAs are single-stranded, approximately 21 nucleotides (nt) long, and are designed by substituting the double-stranded mature miRNA sequence within a pre-miRNA (Non-Patent Document 6). These amiRNAs are introduced as transgenes within artificial expression cassettes (containing promoters, terminators, etc.) (Non-Patent Document 7), where they are processed via the small RNA biogenesis and silencing mechanisms to downregulate target expression. According to Non-Patent Document 8, amiRNAs are active when expressed under tissue-specific or inducible promoters and can be used for specific gene silencing in plants, especially when several related but non-identical target genes need to be downregulated.
[0012] Non-Patent Document 9 discloses the introduction of a promoterless antiviral RNAi hairpin into an endogenous miRNA locus. Specifically, Non-Patent Document 9 inserts an amiRNA precursor transgene (hairpin-type pri-amiRNA) adjacent to a naturally occurring miRNA gene (e.g., miR122) by homology-dependent DNA recombination induced by sequence-specific nucleases such as Cas9 or TALEN nuclease. In this approach, a promoter- and terminator-free amiRNA is used by utilizing a transcriptionally active DNA locus expressing a natural miRNA (miR122), i.e., the endogenous promoter and terminator drive and regulate the transcription of the inserted amiRNA transgene.
[0013] Various methods for introducing RNA and / or proteins into cells without using DNA have already been reported. For example, RNA transfection using electroporation and lipofection is described in Patent Document 1. Non-Patent Document 10 describes direct delivery of Cas9 / sgRNA ribonucleoprotein (RNP) complexes into cells by microinjection of Cas9 protein and sgRNA complexes. Non-Patent Document 11 describes direct delivery of Cas9 protein / sgRNA complexes via electroporation. Non-Patent Document 12 reports liposome-mediated delivery of Cas9 protein-associated sgRNA complexes. [Prior art documents] [Patent documents]
[0014] [Patent Document 1] U.S. Patent Application Publication No. 20160289675 [Non-patent literature]
[0015] [Non-Patent Document 1] Porteus, Annu Rev Pharmacol Toxicol.(2016)56:163-90 [Non-patent document 2] Jiang et al.,RNA Biology(2014)11(10):1243-9 [Non-patent document 3] Zhao et al.,Scientific Reports(2014)4:3943 [Non-patent document 4] Bortesi and Fischer,Biotechnology Advances(2015)33:41-52 [Non-patent document 5] Basak and Nithin,Front Plant Sci.(2015)6:1001 [Non-patent document 6] Tiwari et al.Plant Mol Biol(2014)86:1 [Non-Patent Document 7] Carbonell et al.,Plant Physiology(2014)pp.113.234989 [Non-Patent Document 8] Schwab et al.The Plant Cell(2006)Vol.18,1121-1133 [Non-Patent Document 9] Senis et al.,Nucleic Acids Research(2017)Vol.45(1):e3 [Non-Patent Document 10] Cho et al.,“Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins,”Genetics(2013)195:1177-1180 [Non-Patent Document 11] Kim et al.,“Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins”Genome Res.(2014)24:1012-1019 [Non-Patent Document 12] Zuris et al.,“Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo”Nat Biotechnol.(2014)doi:10.1038 / nbt.3081 [Summary of the Invention]
[0016] According to some embodiments of the present invention, there is provided a method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, the method comprising: (a) selecting a nucleic acid sequence in the genome of the plant that encodes a silencing molecule having a plant gene as a target, the silencing molecule being capable of recruiting RNA-dependent RNA polymerase (RdRp); and (b) modifying the nucleic acid sequence of the plant gene to confer silencing specificity for the pest gene, such that a transcript of the plant gene having the silencing specificity forms base complementarity with the silencing molecule capable of recruiting the RdRp to produce a long dsRNA molecule capable of silencing the pest gene, thereby silencing the pest gene. and producing in said plant cell a long dsRNA molecule capable of
[0017] According to some embodiments of the present invention, there is provided a method for producing a long dsRNA molecule in a plant cell that is capable of silencing a pest gene in the plant cell, the method comprising: (a) selecting a nucleic acid sequence in the genome of the plant that encodes a silencing molecule having a plant gene as a target, the silencing molecule being capable of recruiting RNA-dependent RNA polymerase (RdRp); and (b) modifying the nucleic acid sequence of the plant gene to confer silencing specificity for the pest gene, such that a transcript of the plant gene having the silencing specificity forms base complementarity with the silencing molecule capable of recruiting the RdRp to produce a long dsRNA molecule that is capable of silencing the pest gene in the plant cell, thereby producing a long dsRNA molecule in the plant cell that is capable of silencing the pest gene in the plant cell.
[0018] According to some embodiments of the present invention, there is provided a method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, the method comprising: (a) selecting a nucleic acid sequence of a plant gene that exhibits predetermined sequence homology to the nucleic acid sequence of the pest gene; and (b) modifying an endogenous nucleic acid sequence of the plant that encodes an RNA molecule to confer silencing specificity for the plant gene, such that a small RNA molecule processed from the RNA molecule that can recruit an RNA-dependent RNA polymerase (RdRp) forms base complementarity with a transcript of the plant gene to produce a long dsRNA molecule capable of silencing the pest gene, thereby producing in the plant cell a long dsRNA molecule capable of silencing the pest gene.
[0019] According to an aspect of some embodiments of the present invention, there is provided a method of producing a pest-tolerant or resistant plant, the method comprising producing in a plant cell a long dsRNA molecule capable of silencing a pest gene according to some embodiments of the present invention.
[0020] According to an aspect of some embodiments of the present invention there is provided a plant produced according to the method of some embodiments of the present invention.
[0021] According to an aspect of some embodiments of the present invention there is provided a cell of the plant of some embodiments of the present invention.
[0022] According to an aspect of some embodiments of the present invention there is provided a seed of the plant of some embodiments of the present invention.
[0023] According to an aspect of some embodiments of the present invention, there is provided a method for producing a pest-tolerant or resistant plant, comprising: (a) breeding a plant of some embodiments of the present invention; (b) selecting progeny plants that express a long dsRNA molecule capable of silencing a pest gene and that are free of a DNA editing agent, thereby producing a pest-tolerant or resistant plant; A method is provided that includes:
[0024] According to an aspect of some embodiments of the present invention there is provided a method of producing a plant or plant cell of some embodiments of the present invention comprising growing the plant or plant cell under conditions that allow propagation.
[0025] According to some embodiments of the present invention, silencing agents capable of recruiting RdRp The molecule contains 21 to 24 nucleotides.
[0026] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 21 nucleotides.
[0027] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 22 nucleotides.
[0028] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 23 nucleotides.
[0029] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 24 nucleotides.
[0030] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 21 nucleotides.
[0031] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 22 nucleotides.
[0032] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 23 nucleotides.
[0033] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 24 nucleotides.
[0034] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRps is selected from the group consisting of trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous translocating RNA.
[0035] According to some embodiments of the invention, the miRNA comprises a mature small RNA of 22 nucleotides.
[0036] According to some embodiments of the invention, the miRNA is selected from the group consisting of miR-156a, miR-156c, miR-162a, miR-162b, miR-167d, miR-169b, miR-173, miR-393a, miR-393b, miR-402, miR-403, miR-447a, miR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828, miR-830, miR-831, miR-833a, miR-833b, miR-840, miR-841, miR-842, miR-843, miR-844a, miR-845, miR-846, miR-847b, miR-848, miR-849, miR-850, miR-851, miR-852, miR-853, miR-854, miR-855, miR-856, miR-857, miR-858, miR-859, miR-860, miR-861, miR-862, miR-863, miR-864, miR-865, miR-866, miR-867, miR-868, miR-869, miR-870, miR-871, miR-872, miR-873, miR-874, miR-875, miR-876, miR-877, miR-878, miR-879, miR-880, miR-881, miR-882, miR-883, miR-884, miR-885, miR miR-845b, miR-848, miR-850, miR-853, miR-855, miR-856, miR-864, miR-2933a, miR-2933b, miR-2936, miR-4221, miR-5024, miR-5629, miR-5648, miR-5996, miR-8166, miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f, miR-8177, and miR-8182.
[0037] According to some embodiments of the invention, the plant gene is a non-protein-coding gene.
[0038] According to some embodiments of the invention, the plant gene is a coding gene.
[0039] According to some embodiments of the invention, the plant gene does not encode a molecule with endogenous silencing activity.
[0040] According to some embodiments of the invention, the method further comprises introducing into the plant cell a DNA editing agent that confers plant gene silencing specificity for a pest gene.
[0041] According to some embodiments of the invention, the modification in step (b) comprises introducing into the plant cell a DNA editing agent that confers plant gene silencing specificity for a pest gene.
[0042] According to some embodiments of the present invention, the plant gene encodes a molecule that has endogenous silencing activity for the native plant gene.
[0043] According to some embodiments of the invention, the method further comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the plant gene towards a pest gene that is different from the native plant gene.
[0044] According to some embodiments of the invention, the method further comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the plant gene towards a pest gene that is different from the native plant gene.
[0045] According to some embodiments of the invention, the modification in step (b) comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the plant gene towards a pest gene that is different from the native plant gene.
[0046] According to some embodiments of the present invention, the plant gene with endogenous silencing activity is selected from the group consisting of trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), autonomous and non-autonomous translocating RNA.
[0047] According to some embodiments of the present invention, the plant gene with endogenous silencing activity encodes a phased secondary siRNA generating molecule.
[0048] According to some embodiments of the present invention, the plant gene with endogenous silencing activity is a trans-acting siRNA generating (TAS) molecule.
[0049] According to some embodiments of the present invention, the silencing specificity of a plant gene is determined by measuring transcript levels of the pest gene.
[0050] According to some embodiments of the present invention, the silencing specificity of a plant gene is determined phenotypically.
[0051] According to some embodiments of the present invention, the phenotypic determination is made by determining the pest resistance of the plant.
[0052] According to some embodiments of the present invention, the silencing specificity of a plant gene is determined genotypically.
[0053] According to some embodiments of the present invention, the phenotype of the plant is determined before the genotype of the plant.
[0054] According to some embodiments of the present invention, the genotype of the plant is determined before the phenotype of the plant.
[0055] According to some embodiments of the present invention, the silencing specificity of a plant gene is determined by measuring transcript levels of the pest gene.
[0056] According to some embodiments of the present invention, the phenotypic determination is made by determining the pest resistance of the plant.
[0057] According to some embodiments of the invention, the predetermined sequence homology comprises between 75 and 100% identity.
[0058] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp comprises 21 to 24 nucleotides.
[0059] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp comprises 21 nucleotides.
[0060] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp comprises 22 nucleotides.
[0061] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp comprises 23 nucleotides.
[0062] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp comprises 24 nucleotides.
[0063] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp consists of 21 nucleotides.
[0064] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp consists of 22 nucleotides.
[0065] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp consists of 23 nucleotides.
[0066] According to some embodiments of the invention, the small RNA molecule capable of recruiting RdRp consists of 24 nucleotides.
[0067] According to some embodiments of the present invention, small RNA molecules capable of recruiting RdRp include microRNAs (miRNAs), small interfering RNAs (siRNAs), short hairpin The RNA is selected from the group consisting of small interfering RNA (shRNA), Piwi-binding RNA (piRNA), trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous translocating RNA.
[0068] According to some embodiments of the invention, the RNA molecule has no intrinsic silencing activity.
[0069] According to some embodiments of the invention, the method further comprises introducing into the plant cell a DNA editing agent that confers silencing specificity of the RNA molecule for a plant gene.
[0070] According to some embodiments of the present invention, the RNA molecule has endogenous silencing activity against a native plant gene.
[0071] According to some embodiments of the invention, the method further comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the RNA molecule towards a plant gene that is different from the native plant gene.
[0072] According to some embodiments of the invention, the modification in step (b) comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the RNA molecule towards a plant gene that is different from the native plant gene.
[0073] According to some embodiments of the present invention, the plant gene that exhibits predetermined sequence homology to the nucleic acid sequence of the pest gene does not encode a silencing molecule.
[0074] According to some embodiments of the present invention, the silencing specificity of an RNA molecule is determined by measuring the transcript levels of a plant gene or a pest gene.
[0075] According to some embodiments of the present invention, the silencing specificity of an RNA molecule is determined phenotypically.
[0076] According to some embodiments of the present invention, the phenotypic determination is made by determining the pest resistance of the plant.
[0077] According to some embodiments of the present invention, the silencing specificity of an RNA molecule is determined genotypically.
[0078] According to some embodiments of the present invention, the phenotype of the plant is determined before the genotype of the plant.
[0079] According to some embodiments of the present invention, the genotype of the plant is determined before the phenotype of the plant.
[0080] According to some embodiments of the invention, the DNA editing agent comprises at least one sgRNA.
[0081] According to some embodiments of the invention, the DNA editing agent comprises at least one sgRNA operably linked to a plant-expressible promoter.
[0082] According to some embodiments of the invention, the DNA editing agent does not comprise an endonuclease.
[0083] According to some embodiments of the invention, the DNA editing agent comprises an endonuclease.
[0084] According to some embodiments of the invention, the DNA editing agent is a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR endonucleases, dCRISPR endonucleases, and homing endonucleases.
[0085] According to some embodiments of the invention, the endonuclease comprises Cas9.
[0086] According to some embodiments of the invention, the DNA editing agent is applied to the cell as DNA, RNA, or RNP.
[0087] According to some embodiments of the invention, the DNA editing agent is linked to a reporter for monitoring expression in the plant cell.
[0088] According to some embodiments of the invention, the reporter is a fluorescent protein.
[0089] According to some embodiments of the invention, the plant cell is a protoplast.
[0090] According to some embodiments of the invention, the dsRNA molecule is processable by the intracellular RNAi processing machinery.
[0091] According to some embodiments of the invention, the dsRNA molecule is processed into secondary small RNAs.
[0092] According to some embodiments of the present invention, the dsRNA and / or secondary small RNA has silencing specificity for a pest gene.
[0093] According to some embodiments of the present invention, the pest is an invertebrate.
[0094] According to some embodiments of the invention, the pest is selected from the group consisting of viruses, ants, termites, bees, wasps, caterpillars, crickets, locusts, beetles, snails, slugs, nematodes, cockroaches (bugs), flies, fruit flies, whiteflies, mosquitoes, grasshoppers, planthoppers, earwigs, aphids, scale insects, vorticella, spiders, mites, psyllids, ticks, moths, caterpillars, scorpions, and fungi.
[0095] According to some embodiments of the invention, the plant is selected from the group consisting of a crop, a floriculture, a weed, and a tree.
[0096] According to some embodiments of the invention, the plant is non-transgenic.
[0097] According to some embodiments of the invention, the plant is a transgenic plant.
[0098] According to some embodiments of the present invention, the plants are not genetically modified (non-GMO).
[0099] According to some embodiments of the present invention, the plants are genetically modified (GMO).
[0100] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting. [Brief explanation of the drawings]
[0101] Some embodiments of the present invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is emphasized that the features shown are by way of example and are intended to provide an illustrative discussion of embodiments of the invention. In this regard, the description accompanying the drawings will make apparent to those skilled in the art how embodiments of the invention may be practiced.
[0102] In the figure, [Figure 1]Figure 1 is a photograph illustrating our first proposed model (referred to as Model 1) for target gene amplification by gene editing-induced gene silencing (GEiGS). According to this model (see corresponding numbers in the figure): 1. Pest gene "X" is the target gene (when silenced, the pest is controlled). 2. Host-associated gene X is identified by homology search (plant gene "X"). 3. GEiGS is performed to redirect the silencing specificity of an amplifier small RNA (e.g., a 22-nt miRNA) to plant gene "X". 4. The amplifier small GEiGS RNA forms a RISC complex that binds with RdRp (an amplification enzyme). 5. RdRp synthesizes an antisense RNA strand complementary to the transcript of plant gene "X", forming dsRNA. 6. The dsRNA of plant gene "X" is processed into secondary sRNA by Dicer(s) or Dicer-like proteins. 7. dsRNA of plant gene "X" is taken up by the pest. Within the pest, plant dsRNA-X is processed into small RNAs that downregulate the corresponding homologous pest gene "X" via RNAi. 8. In some cases, secondary sRNAs are taken up by the pest and silence the target gene "X." [Figure 2]Figure 2 is a photograph illustrating a second proposed model (referred to as Model 2) for target gene amplification by GEiGS. According to this model (see corresponding numbers in the figure): 1. Pest gene "X" is the target gene (when silenced, the pest is controlled). 2. GEiGS is performed to redirect the silencing specificity of a naturally occurring amplified RNAi precursor to pest gene "X" (e.g., TAS; amplified and processed into tasiRNA). 3. Wild-type amplifier sRNA forms a RISC complex that binds with RdRp (amplification enzyme). 4. RdRp synthesizes an antisense RNA strand complementary to the amplified GEiGS precursor transcript, forming dsRNA. 5. The amplified GEiGS dsRNA is processed into secondary sRNA by Dicer(s). 6. The GEiGS dsRNA is taken up by the pest. Within the pest, the plant GEiGS-dsRNA is processed into small RNAs that downregulate the corresponding homologous pest gene "X" via RNAi. 7 In some cases, secondary sRNAs derived from the GEiGS-dsRNA (e.g., tasiRNAs in the case of TAS precursors) are also taken up by the pest and silence the target gene "X." [Figure 3A] Figure 3A shows the identification of endogenous genes in plants with regions of homology to pest sequences (according to Model 1). Specifically, a blast alignment of the pest AF502391.1 (H. glycines, SEQ ID NO: 1) to the plant gene NM_001037071.1 (Arabidopsis thaliana, SEQ ID NO: 2). [Figure 3B] Figure 3B shows a designed miRNA-based GEiGS oligo carrying an siRNA sequence that targets a region downstream of the homologous region in plants (described in Figure 3A). Top: GEiGS oligo, SEQ ID NO: 3 (red is siRNA). Bottom: Plant target gene with homology to a pest (SEQ ID NO: 4). Green is the homologous pest sequence (SEQ ID NO: 1). The sequence predicted to be targeted by the GEiGS-siRNA is shown in red. [Figure 4A] Figure 4A shows the identification of endogenous genes in plants with regions of homology to pest sequences (according to Model 1). Specifically, a blast alignment of the pest AF500024.1 (soybean cyst nematode, SEQ ID NO: 5) to the plant gene NM_116351.7 (Arabidopsis thaliana, SEQ ID NO: 6). [Figure 4B] Figure 4B shows a designed miRNA-based GEiGS oligo carrying an siRNA sequence that targets a region downstream of the homologous region in plants (described in Figure 4A). Top: GEiGS oligo, SEQ ID NO: 7 (red is siRNA). Bottom: Target gene with homology to a pest (SEQ ID NO: 8). Green is the homologous pest sequence (SEQ ID NO: 5). The sequence predicted to be targeted by the GEiGS-siRNA is shown in red. [Figure 5A] Figure 5A shows the identification of endogenous genes in plants with regions of homology to pest sequences (according to Model 1). Specifically, a blast alignment of the pest AF469060.1 (soybean cyst nematode, SEQ ID NO: 9) to the plant gene NM_001203752.2 (Arabidopsis thaliana, SEQ ID NO: 10). [Figure 5B] Figure 5B shows a designed miRNA-based GEiGS oligo carrying an siRNA sequence that targets a region downstream of the homologous region in plants (described in Figure 5A). Top: GEiGS oligo, SEQ ID NO: 11 (red is siRNA). Bottom: Target gene with homology to a pest (SEQ ID NO: 12). Green is the homologous pest sequence (SEQ ID NO: 9). The sequence predicted to be targeted by the GEiGS-siRNA is shown in red. [Figure 6] Figure 6 is a flowchart of an embodiment of a computational pipeline for generating GEiGS templates. The computational GeiGS pipeline applies biological metadata and allows for the automated generation of GeiGS DNA donor templates that are used to minimally edit endogenous non-coding RNA genes (e.g., miRNA genes) to de novo gain-of-function, i.e., redirect their silencing capacity to target gene expression of interest. [Figure 7] Figure 7 is a flowchart of an embodiment of genome editing-induced gene silencing (GEiGS), which replaces endogenous miRNAs with siRNAs targeting PDS genes, thereby inducing gene silencing of the endogenous PDS genes. A two-component system is used to introduce the modifications. First, the CRISPR / CAS9 system cleaves the selected locus through a specific guide RNA designed in a GFP-containing vector, promoting homologous DNA repair (HDR) at that site. Second, a DONOR sequence, which modifies the miRNA sequence as desired to target the newly assigned gene, is introduced as a template for HDR. This system is used to transform protoplasts, which are then enriched by FACS due to the GFP signal of the CRISPR / CAS9 vector, recovered, and regenerated into plants. [Figure 8A-C] Figures 8A-C are photographs showing that silencing the PDS gene causes photobleaching. Silencing the PDS gene in Nicotiana (Figures 8A-B) and Arabidopsis (Figure 8C) plants causes photobleaching in N. benthamiana (Figure 8B) and Arabidopsis (Figure 8C, right). Photographs were taken 3.5 weeks after PDS silencing. [Figure 9A]Figure 9A shows an example of HDR-mediated genome exchange in Col-0 cells, as well as a schematic diagram of the primers used for PCR and genotyping of such an exchange. CRISPR / Cas9 and sgRNA targeted the exchange region, generating dsDNA breaks. The DONOR template carried homology arms for insertion into its genomic locus (AtTAS1b or AtTAS3a) by homology-directed DNA repair (HDR) to introduce the desired exchange. The exchange region is the sequence modified to target the nematode gene. The short arrows represent the exchange-specific or wt-specific forward primer and the nonspecific reverse primer used in PCR to demonstrate genome exchange. The reverse primer was designed to anneal further downstream from the recombination site to avoid amplification of the DONOR template. The exchange-specific forward primer was designed to allow amplification only if the exchange had occurred. An additional forward primer was designed to control for PCR amplification with only the wild-type (WT) sequence. The dotted line represents the PCR product. The oval indicates the reverse primer used in the Sanger sequencing reaction. [Figure 9B-C] Figures 9B-C show electrophoretic micrographs of PCR products generated using WT primers. A nonspecific reverse primer and a WT-specific primer were used for PCR on DNA extracted from all treatments described in Example 3. PCR products were run on a 1.6% agarose gel. Small arrows and numbers indicate the expected PCR product bands and sizes. (Figure 9B) represents the PCR reaction for the AtTAS1b locus, and (Figure 9C) represents the reaction for the AtTAS3a locus. Y25: Y25, β subunit of the COPI complex; Splicing: splicing factor; Ribo3a: ribosomal protein 3a; Spliceo: spliceosomal SR protein; WT: wild type. HO: no template, water PCR negative control. MW: 1 kb+ molecular weight ladder (NEB). [Figure 9D-E]Figures 9D-E show micrographs of electrophoresis of PCR products generated using exchange-specific primers. A nonspecific reverse primer and an exchange-specific forward primer were used for PCR on DNA extracted from all exchange treatments in Example 3. WT DNA was also used as a template to control for reaction specificity. PCR products were run on a 1.6% agarose gel. Small arrows and numbers indicate the expected PCR product bands and sizes. (Figure 9D) represents a PCR reaction for exchange at the AtTAS1b (Tas1b) locus, and (Figure 9E) represents a reaction for exchange at the AtTAS3a (Tas3a) locus. Y25: Y25, β subunit of the COPI complex; Splicing: splicing factor; Ribo3a: ribosomal protein 3a; Spliceo: spliceosomal SR protein; WT: wild type. HO: no template, water PCR negative control. MW: 1 kb+ molecular weight ladder (NEB). [Figure 9F-G] Figures 9F-G show the Sanger sequencing reaction schemes for PCR products. The nonspecific reverse primer from Figure 9A was used for Sanger sequencing of each PCR product. The arrows indicate the specific forward primers used for PCR amplification. Additional nucleotide changes introduced after the HDR event (not derived from the primers used in the reaction) are highlighted and shaded gray. Chromatograms show the sequences of PCR products aligned to the predicted sequence (top line). (Figure 9F) represents the sequencing reaction for the exchange at the AtTAS1b (Tas1b) locus, and (Figure 9G) represents the reaction for the exchange at the AtTAS3a (Tas3a) locus. Y25: Y25, β subunit of the COPI complex; Splicing: splicing factor; Ribo3a: ribosomal protein 3a; Spliceo: spliceosomal SR protein; WT: wild type. [Figure 10A-B]Figures 10A-B are schematic diagrams of the sense (Figure 10A) and antisense (Figure 10B) strands of dsRNA generated through HDR-mediated genome exchange in Col-0 cells. The exchange region is the sequence modified to target the nematode gene. The short arrows represent the nonspecific primers used for reverse transcription PCR (RT-PCR) and cDNA generation. Additional short arrows represent the exchange-specific and nonspecific primers common to all reactions used for PCR (PCR) on cDNA to verify the expression of the exchange. The PCR reactions were designed so that all PCR products were less than 200 nucleotides in length. The specific primers were designed to allow amplification only if the exchange occurred. The dotted lines represent the expected PCR products. The ovals indicate the primers used for Sanger sequencing reactions. The direction indicates the 5' to 3' end of the transcript. [Figure 10C-D] Figures 10C-D show micrographs of electrophoresis of PCR products to examine the expression of the sense and antisense RNA strands of AtTAS1b and detect dsRNA containing exchanges. RT-PCR reactions were performed to generate cDNA, followed by PCR reactions using the primers described in Figures 10A-B. The PCR products were run on a 1.6% agarose gel. Small arrows and numbers indicate the expected PCR product bands and sizes. (Figure 10C) shows the PCR reaction for the AtTAS1b sense RNA transcript, and (Figure 10D) shows the PCR reaction for the AtTAS1b antisense RNA transcript. Y25: Y25, the β subunit of the COPI complex; WT: wild type; HO: no template, water PCR negative control; MW: 1 kb + molecular weight ladder (NEB). +RT: PCR reaction using reverse transcriptase-amplified cDNA as a template. -RT: reverse transcription control—no reverse transcriptase was used, and no cDNA was generated. [Figure 10E-F]Figures 10E-F show micrographs of electrophoresis of PCR products to examine the expression of the sense and antisense RNA strands of AtTAS3a and detect dsRNA containing exchanges. RT-PCR reactions were performed to generate cDNA, followed by PCR reactions using the primers described in Figures 10A-B. The PCR products were run on a 1.6% agarose gel. Small arrows and numbers indicate the expected PCR product bands and sizes. (Figure 10E) represents the PCR reaction for the AtTAS3a sense RNA transcript, and (Figure 10F) represents the PCR reaction for the AtTAS3a antisense RNA transcript. Ribo3a: ribosomal protein 3a; WT: wild type. HO: no template, water PCR negative control. MW: 1 kb + molecular weight ladder (NEB). +RT: PCR reaction using reverse transcriptase-amplified cDNA as a template. -RT: reverse transcription control—no reverse transcriptase was used, and no cDNA was generated. [Figure 10G] Figure 10G shows a schematic of the Sanger sequencing reaction of PCR products amplified from the sense strand of the RNA containing the exchange. The nonspecific forward primer shown in Figure 10A was used for Sanger sequencing of each PCR product. The arrow indicates the specific reverse primer used for PCR amplification. The additional nucleotide changes introduced by the DONOR template are highlighted and shaded gray. The chromatogram shows the sequence of the PCR product aligned to the predicted sequence. The upper panel shows the sequencing reaction to verify expression of the exchange at the AtTAS1b (Tas1b) locus, and the lower panel shows the reaction to verify expression of the exchange at the AtTAS3a (Tas3a) locus. Y25: Y25, β subunit of the COPI complex; Ribo3a: ribosomal protein 3a; WT: wild type. [Figure 10H]Figure 10H shows a schematic of the Sanger sequencing reaction of PCR products amplified from the antisense strand of the RNA containing the exchange. The nonspecific reverse primer shown in Figure 10B was used for Sanger sequencing of each PCR product. The arrows indicate the specific forward primer used for PCR amplification. The additional nucleotide changes introduced by the DONOR template are highlighted and shaded gray. Chromatograms show the sequences of the PCR products aligned to the predicted sequence. The top row represents a sequencing reaction to verify expression of the exchange at the AtTAS1b (Tas1b) locus, and the bottom row represents a reaction to verify expression of the exchange at the AtTAS3a (Tas3a) locus. Y25: Y25, β subunit of the COPI complex; Ribo3a: ribosomal protein 3a; WT: wild type. [Figure 10I] Figure 10I shows the Sanger sequencing reaction scheme for PCR products amplified from the sense and antisense strands of wild-type RNA transcribed from Tas1b and Tas3a. For the sense transcripts, the nonspecific forward primer in Figure 10A was used for Sanger sequencing of each PCR product. For the antisense transcripts, the nonspecific reverse primer in Figure 10B was used for Sanger sequencing of each PCR product. The arrows indicate the forward primer used for PCR amplification. The chromatogram shows the sequences of the PCR products aligned to the annotated WT sequence. [Figure 11A]Figure 11A provides a bar graph showing TuMV infection levels in N. benthamiana leaves after inoculation with various treatments, as represented by quantifying TuMV transcript levels and measuring relative expression through GFP visualization in the lower panel. Controls and treatments were infiltrated side-by-side on the same leaf. From left to right: (1) Leaves were infiltrated with Agrobacterium containing a TuMV vector (n = 3; left side of leaf) or Agrobacterium without any vector (n = 3; right side of leaf). (2) Leaves were infiltrated with Agrobacterium containing a vector overexpressing miR173 (n = 3; left side) or Agrobacterium without a vector (n = 3; right side). (3) Leaves were infiltrated with a vector overexpressing GEiGS-dummy (n = 3; left side) or GEiGS-TuMV (n = 3; right side). (4) Agrobacteria containing a vector overexpressing GEiGS-dummy (n = 3, left) or a vector endocytosing GEiGS-TuMV (n = 2, right) were infiltrated into leaves simultaneously with Agrobacteria containing a vector overexpressing miR173. The micrographs in the top panel are representative of the samples analyzed. TuMV was monitored by GFP signal visualized under UV light. Bars show mean values; error bars represent standard errors; * - p value < 0.05; ** - p value < 0.01 according to one-way ANOVA and post-hoc Tukey HSD test. [Figure 11B] Figure 11B shows photographs of whole Nicotiana benthamiana leaves that were simultaneously infiltrated with Agrobacterium containing GEiGS-dummy and miR173-overexpressing vectors (center) or GEiGS-TuMV and miR173-overexpressing vectors (right). Control leaves were infiltrated with Agrobacterium containing no vector (left). TuMV was monitored by GFP signal visualized under UV light. [Figure 12A]Figure 12A is a bar graph showing the relative expression of ribosomal protein 3a in nematodes fed with total RNA extracted from Nicotiana benthamiana leaves co-infiltrated with vectors overexpressing miR390 and TAS3a modified to target ribosomal protein 3a. Nematodes fed with RNA from explants overexpressing the TAS3a wt backbone and miR390 amplifier were used as controls. Analysis of nematodes fed with the RNA extracts for 3 days was performed by qRT-PCR using actin as the endogenous normalizer gene. (Error bars represent standard error; *** - p-value < 0.001). [Figure 12B] Figure 12B is a bar graph showing the relative expression of spliceosomal SR proteins in nematodes fed with total RNA extracted from Nicotiana benthamiana leaves co-infiltrated with vectors overexpressing miR390 and TAS3a modified to target spliceosomal SR proteins. Nematodes fed with RNA from explants overexpressing the TAS3a wt backbone and miR390 amplifier were used as controls. Analysis of nematodes fed with the RNA extracts for 3 days was performed by qRT-PCR using actin as the endogenous normalizer gene. (Error bars represent standard error; **-p value < 0.01). [Figures 13A-D] Figures 13A-D show RNA-seq (Figures 13A-13C) and small RNA-seq (Figures 13B-13D) analyses of N. benthamiana leaves infiltrated with GEiGS designs for ribosomal protein 3a (Figures 13A-13B) and spliceosomal SR proteins (Figures 13C-13D) and vectors expressing miR390 aligned against the GEiGS designs 48-72 hours after infiltration. The light gray rectangle in each plot indicates the miR390-binding region in the transcript. The black square in each plot indicates the homologous region to the target gene that generates the secondary siRNA targeting the gene in nematodes. The upper chromatogram in each plot represents the sense strand, while the lower chromatogram represents the antisense strand. DETAILED DESCRIPTION OF THE INVENTION
[0103] In some embodiments, the present invention relates to the generation and amplification of dsRNA molecules in host cells for silencing target genes in pests.
[0104] The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.
[0105] Before describing at least one embodiment of the present invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following specification or illustrated by way of examples. The invention is capable of other embodiments or of being practiced or carried out in various ways and in different organisms. Also, it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting.
[0106] Previous studies on genome editing of RNA molecules in various organisms (e.g., mice, humans, and plants) have focused on disrupting miRNA activity or target binding sites using gene transfer. Genome editing in plants has focused on using nucleases such as CRISPR-Cas9 technology, ZFN, and TALEN to knock down genes or insertions in model plants. Furthermore, gene silencing in plants has also been reported using artificial miRNA transgenes to silence endogenous and exogenous target genes [Molnar A et al. Plant J. (2009) 58(1):165-74. doi:10.1111 / j.1365-313X.2008.03767.x. Epub 2009 Jan 19; Borges and Martienssen, Nature Reviews Molecular Cell Biology | AOP, published online 4 November 2015; doi:10.1038 / nrm4085]. Artificial miRNA transgenes are introduced into plant cells within artificial expression cassettes (containing promoters, terminators, selectable markers, etc.) to downregulate the expression of their targets.
[0107] Recent advances in genome editing technology have made it possible to alter the DNA sequence of living cells by inducing a site-specific double-strand break (DSB) at a desired location in the genome and then editing one or more nucleotides in the cells of a human patient using genome editing (NHEJ and HR). While NHEJ is primarily, but not exclusively, used for knockout purposes, HR is used to introduce precise editing of specific sites, such as point mutations, or to correct naturally occurring or genetically inherited deleterious mutations.
[0108] Mature small RNAs (i.e., Dicer products and non-Dicer products) and dsRNAs (i.e., Dicer substrates, e.g., small RNA precursors) can mediate efficient intracellular gene knockdown. miRNA biogenesis requires the presence of dsRNA structures (e.g., hairpin precursors). However, hairpin RNAs may not be efficiently taken up by pests because (i) they are unstable and therefore low in abundance (e.g., they are processed by Dicer) and (ii) there is no RNA-RNA amplification step by RNA-dependent RNA polymerase (RdRp). This makes pests more susceptible to ingested small RNA precursors (e.g., dsRNA).
[0109] In practical application of the present invention, the inventors have devised a gene editing technique aimed at producing long dsRNA molecules in plant cells and tissues to target pest genes. Such dsRNA molecules are mobile and can be moved between cells and tissues. Therefore, once produced intracellularly, dsRNA molecules may appear extracellularly. Furthermore, such dsRNA molecules can also be transferred between organisms through the ingestion of materials derived from hosts expressing the dsRNA (e.g., plant leaves and stems). Specifically, the present inventors have developed a GEiGS system that includes one of two models.
[0110] The model described below is based in part on gene editing-induced gene silencing (GEiGS) technology, as described in International Publication No. 2019 / 058255, the entire contents of which are incorporated herein by reference. As used herein, the phrase "GEiGS is performed" refers to using GEiGS technology to redirect the silencing specificity of a silencing RNA, which essentially involves modifying a nucleic acid sequence encoding the silencing RNA so that the encoded silencing RNA targets a selected target. According to some embodiments, GEiGS is performed by inducing a double-strand break in the nucleic acid sequence encoding the silencing RNA within a cell (e.g., by expressing or introducing into the cell an endonuclease such as, but not limited to, Cas9) and providing a nucleic acid template containing the desired nucleotide change in the nucleic acid sequence encoding the silencing RNA. According to such embodiments, the nucleotide change is then introduced into the nucleic acid sequence encoding the silencing RNA via homology-dependent recombination (HDR) when the relevant portion of the nucleic acid template is introduced. According to some embodiments, the nucleic acid template introduces nucleotide changes into the nucleic acid sequence encoding the silencing RNA so that the silencing RNA targets a selected target sequence. Examples of using GEiGS to make nucleotide changes in a nucleic acid sequence encoding a miRNA or tasiRNA are illustrated in Examples 1B and 3 herein below.
[0111] In the first model, a plant gene homologous to the pest target gene is identified. GEiGS is then performed to redirect the silencing specificity of a small RNA molecule to the plant gene (homologous to the pest target gene). This small RNA molecule (also called an amplifier or primer small RNA) forms a complex with RdRp, which synthesizes an antisense RNA strand complementary to the plant gene transcript to form dsRNA. The dsRNA is then further processed into secondary small RNAs (sRNAs). Importantly, the primary small RNA, dsRNA, and secondary small RNA molecules (i.e., products of RNAi processing of the newly generated dsRNA, e.g., by Dicer-like processes) can be taken up by the pest and mediate gene silencing in the pest. Essentially, by using GEiGS to redirect the targeting specificity of the amplifier small RNA molecule, the first model allows for the formation of new long dsRNAs from sequences that have not previously formed long dsRNAs, resulting in the generation of phased RNA-producing loci. Because this locus bears natural similarity to a pest gene, the resulting long dsRNA possesses the ability to silence the corresponding gene in the pest.
[0112] In the second model, GEiGS is performed on plant genes naturally converted into double-stranded RNA forms (naturally amplified loci that generate long dsRNA and phased RNA, e.g., naturally occurring TASs) to redirect silencing specificity toward pest target genes. First, a native silencing RNA molecule (also referred to herein as an amplifier or primer small RNA; e.g., a 22-nt miRNA such as miR-173) is selected that has the plant gene as a target and can form a complex with RdRp. RdRp synthesizes an antisense RNA strand complementary to the transcript of the plant gene to form a long dsRNA. The long dsRNA is then further processed into secondary sRNA (i.e., the product of RNAi processing of the newly generated dsRNA, e.g., by Dicer-like processes). According to this model, the long dsRNA and secondary small RNA molecules can be taken up by pests and mediate pest gene silencing.
[0113] Thus, the present invention provides for the formation of amplifiable dsRNA molecules in plant cells and tissues, resulting in greater amounts and larger populations of small RNAs, and therefore much higher silencing efficacy. Furthermore, the multiple secondary small RNAs generated from the dsRNA molecules increase the chances of efficient target knockdown. The dsRNA molecules generated by this method are efficiently taken up by pests, allowing for efficient gene silencing and safe control of pest genes without harming the plant. Furthermore, the gene editing technology described herein does not implement classical molecular genetic and transgenic tools, which include expression cassettes with promoters, terminators, and selection markers.
[0114] Thus, according to one aspect of the present invention there is provided a method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, comprising the steps of: (a) selecting a nucleic acid sequence of a plant gene that exhibits a predetermined sequence homology to a nucleic acid sequence of a pest gene; (b) modifying an endogenous nucleic acid sequence of the plant encoding an RNA molecule to confer silencing specificity for the plant gene, such that a small RNA molecule capable of recruiting an RNA-dependent RNA polymerase (RdRp) processed from the RNA molecule is base-complementary to a transcript of the plant gene to produce a long dsRNA molecule capable of silencing the pest gene; thereby producing in the plant cell a long dsRNA molecule capable of silencing the pest gene; A method is provided that includes:
[0115] The term "long dsRNA molecule" as used herein refers to a double-stranded polyribonucleic acid sequence having a first strand (sense strand) and a second strand (antisense strand) that is the reverse complement of the first strand, where the polyribonucleic acid is bound by base pairing (e.g., two sequences that are reverse complements of each other in the base-paired region), and the double-stranded polyribonucleic acid can be a substrate for enzymes from the Dicer family, and typically the long dsRNA molecule is at least 26 bp or more. The two strands may be the same length or different lengths, provided that there is sufficient sequence homology between the two strands to form a stable double-stranded structure with at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementarity over the entire length.
[0116] The use of the terms "complementary," "complementarity," or "complementary" means that an RNA molecule (or at least a portion thereof present in the form of a processed small RNA, or at least one strand or portion thereof of a double-stranded polynucleotide, or a portion of a single-stranded polynucleotide) hybridizes to a target RNA (e.g., a transcript of a plant gene) or a fragment thereof under physiological conditions to regulate RdRp-mediated synthesis of the target gene or to exert a function. For example, in some embodiments, an RNA molecule (e.g., a small RNA molecule) may be selected from the group consisting of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 20, 21, 22, 23, 24, 2 100% sequence identity, or at least about 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, compared to a sequence of 7, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, or more consecutive nucleotides , 93, 94, 95, 96, 97, 98, or 99% sequence identity.
[0117] As used herein, an RNA molecule, or its processed small RNA form (discussed in more detail below), is said to exhibit "perfect complementarity" if every nucleotide of one of the sequences, read 5' to 3', is complementary to every nucleotide of the other sequence, read 3' to 5'. A nucleotide sequence that is perfectly complementary to a reference nucleotide sequence exhibits a sequence identical to the reverse complement of the reference nucleotide sequence.
[0118] Methods for determining sequence complementarity are well known in the art and include, but are not limited to, bioinformatics tools well known in the art (e.g., BLAST, multiple sequence alignment).
[0119] According to one embodiment, the long dsRNA molecule is longer than 20 bp.
[0120] According to one embodiment, the long dsRNA molecule is longer than 21 bp.
[0121] According to one embodiment, the long dsRNA molecule is longer than 22 bp.
[0122] According to one embodiment, the long dsRNA molecule is longer than 23 bp.
[0123] According to one embodiment, the long dsRNA molecule is longer than 24 bp.
[0124] According to one embodiment, the long dsRNA molecule comprises 20 to 100,000 bp.
[0125] According to one embodiment, the long dsRNA molecule comprises 20 to 10,000 bp.
[0126] According to one embodiment, the long dsRNA molecule comprises 20 to 1,000 bp.
[0127] According to one embodiment, the long dsRNA molecule comprises 20 to 500 bp.
[0128] According to one embodiment, the long dsRNA molecule comprises 20 to 50 bp.
[0129] According to one embodiment, the long dsRNA molecule comprises 200 to 5000 bp.
[0130] According to one embodiment, the long dsRNA molecule comprises 200 to 1000 bp.
[0131] According to one embodiment, the long dsRNA molecule comprises 200 to 500 bp.
[0132] According to one embodiment, the long dsRNA molecule comprises 2000 to 100,000 bp.
[0133] According to one embodiment, the long dsRNA molecule comprises 2000 to 10,000 bp.
[0134] According to one embodiment, the long dsRNA molecule comprises 2000 to 5000 bp.
[0135] According to one embodiment, the long dsRNA molecule comprises 10,000 to 100,000 bp.
[0136] According to one embodiment, the long dsRNA molecule comprises 1,000 to 10,000 bp.
[0137] According to one embodiment, the long dsRNA molecule comprises 100 to 10,000 bp.
[0138] According to one embodiment, the long dsRNA molecule comprises 100 to 1,000 bp.
[0139] According to one embodiment, the long dsRNA molecule comprises 10 to 1,000 bp.
[0140] According to one embodiment, the long dsRNA molecule comprises 10 to 100 bp.
[0141] According to one embodiment, the long dsRNA molecule comprises an overhang, ie, a non-double-stranded region of the dsRNA molecule (ie, single-stranded RNA).
[0142] According to one embodiment, the long dsRNA molecule does not include an overhang.
[0143] According to one embodiment, the long dsRNA molecules of the present invention can be processed into small RNA molecules that can associate with the RNA-induced silencing complex (RISC).Therefore, the long dsRNA molecules of the present invention can serve as substrates for the intracellular RNAi processing machinery (i.e., can be precursor RNA molecules), and as will be discussed in detail below, the DICER protein family (e.g., DCR1 and DCR2), the DICER-LIKE protein family (e.g., DCL1, DCL2, DCL3, DCL4), the ARGONAUTE protein family (e.g., AGO1, AGO2, AGO3, AGO4), tRNA cleavage enzymes (e.g., RNY1, ANGIOGENIN, RNase P, RNase P-like, SLFN3, ELAC1, and ELAC2), and Piwi-binding RNA (piRNA)-associated proteins (e.g., AGO3, AUBERGINE, HIWI, HIWI2, HIWI3, PIWI, ALG1, and ALG2) into small RNA molecules.
[0144] The term "plant" as used herein includes whole plants, grafted plants, plant ancestors and progeny, and plant parts including seeds, shoots, stems, roots (including tubers), rootstocks, shoots, and plant cells, tissues, and organs. Plants may be in any form, including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that may be useful in the methods of the present invention include all plants belonging to the superfamily Chlorophyta, in particular monocotyledonous and dicotyledonous plants, including forage or fodder plants, ornamental plants, food crops, trees, or shrubs selected from the list comprising: Acacia species, Acer species, Actinidia species, Aesculus species, Agathis australis, Albizia amara, Alsophila tricolor, Andropogon species, Arachis species, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga plurijuga, Birch (Betuila) species, Brassica (Brassica) species, Bruguiera gymnorrhiza, Burkea africana, and Mangrove Butea frondosa, Cadaba farinosa, Calliandra species, Camellia sinensis, Cannabaceae, Cannabis indica, Cannabis species, Cannabis sativa, cannabis, industrial hemp, Capsicum species, Cassia species, Centroema pubescens, Chacoomeles species, Cinnamomum cassia, Coffee arabica, Colophospe Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus species, Cucumber species ucumis species, Cupressus, Silver fern (Cyathea dealbata), Quince (Cydonia oblonga), Japanese cedar (Cryptomeria japonica), Cymbopogon species, Cynthea dealbata, Quince, Veronica (Dalbergia monetaria), Davallia divaricata, Desmodium species , Dicksonia squarosa, Dibeteropogon amplectens, Dioclea species, Dolichos species, Dorycnium rectum, Echinochloa pyramidalis, Ehraffia species, Eleusine coracana, Eragrestis species, Erythrina species, Eucalypfus species, Euclea schimperi, Eulalia vi / losa, Pagopyrum species, Feijoa sellowiana sellowlana, Fragaria species, Flemingia species, Freycinetia banksli, Geranium thunbergii, Ginkgo biloba, Glycine javanica, Gliricidia species, Gossypium hirsutum, Grevillea species, Guibourtia coleosperma, Hedysarum species, Hemaffhia altissima, Heteropogon contoffus, Hordeum vulgare, Hyperrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris species, Leptarrhena pyrolifolia, Lespediza species, Lettuca species, Leucaenaleucocephala, Loudetia simplex, Lotonus bainesli, Lotus species, Macrotyloma axillare, Malus species, Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum sapientum, banana, Nicotianum species, Onobrychis species, Ornithopus species, Oryza species, Peltophorum africanum, Pennisetum species, avocado (Persea gratissima), petunia species, Phaseolus species, Canary palm (Phoenix canariensis), Phormium cookianum, Photinia species, Picea glauca, Pinus species, pea (Pisum sativam), Podocarpus totara totara), Pogonalusia freckii (Pog onarthria fleckii, Pogonaffhria squarrosa, Populus species, Prosopis cineraria, Douglas fir (Pseudotsuga menziesii), Pterolobium stellatum stellatum), European pear (Pyrus communis), oak (Quercus species), Umbellata umbellata ), Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes species, Robinia pseudoacacia, Rosa species, Rubus species, Salix species, Schyzachyrium sanguineum, Sciadopitys beficillata vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia species, Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Polygonum species, Bald cypress (Taxodium distichum), Themeda triandra, Trifolium species, Triticum species, Western hemlock (Tsuga heterophylla), Vaccinium species, Vicia species, Vitis vinifera, Watsonia pyramidata, calla lily (Zantedeschia aethiopica), corn (Zea mays), amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, rapeseed, okra, onion, potato, rice, soybean, strawberry, sugar beet, sugarcane, sunflower, tomato, pumpkin, tea plant. Alternatively, algae and other non-green plants can be used in the methods of some embodiments of the present invention.
[0145] According to certain embodiments, the plant is a crop, a flowering plant, a weed, or a tree.
[0146] According to certain embodiments, the plant is a woody plant species, such as Actinidia chinensis (Actinidiaceae), Manihotesculenta (Euphorbiaceae), Firiodendron tulipera (Magnoliaceae), Populus (Salicaceae), Santalum album (Santalaceae), elm (Ulmus) (Ulmaceae), and different species of the families Rosaceae (Malus, Prunus, Pyrus) and Rutaceae (Citrus, Microcitrus), gymnosperms, for example Picea abies glauca and loblolly pine (Pinus taeda), forest trees (e.g., birch (Betulaceae), beech (Fagaceae), gymnosperms, and tropical tree species), fruit trees, shrubs or herbs, such as (banana, cocoa, coconut palm, coffee, date palm, grape, and tea), and oil palm.
[0147] According to a particular embodiment, the plant is a tropical crop, such as coffee, macadamia, These are bananas, pineapples, taro, papaya, mango, barley, beans, cassava, chickpeas, cocoa (chocolate), cowpeas, maize (corn), millet, rice, sorghum, sugarcane, sweet potato, tobacco, taro, tea, and yam.
[0148] "Grain," "seed," or "bean" refers to the reproductive unit of a flowering plant that can grow into another flowering plant. As used herein, these terms are used synonymously and interchangeably.
[0149] According to certain embodiments, the plant is a plant cell, for example a plant cell in an embryonic cell suspension.
[0150] According to a particular embodiment, the plant cell is a protoplast.
[0151] Protoplasts can be derived from any plant tissue, such as fruit, flowers, roots, leaves, embryos, embryonic cell suspensions, callus, or seedling tissue.
[0152] According to certain embodiments, the plant cell is an embryogenic cell.
[0153] According to certain embodiments, the plant cell is a somatic embryogenic cell.
[0154] The term "plant gene," as used herein, refers to any gene in a plant, e.g., endogenous, that can be modified to confer specificity of silencing for a pest gene.
[0155] According to one embodiment, the plant gene is a non-coding gene (eg, a non-protein-coding gene).
[0156] According to one embodiment, the plant gene is a coding gene (eg, a protein-coding gene).
[0157] According to one embodiment, the plant gene (ie exhibiting said predetermined sequence homology to the nucleic acid sequence of the pest gene) does not encode a silencing molecule.
[0158] According to one embodiment, the plant gene does not encode a molecule with endogenous silencing activity (eg, an RNA molecule, eg, a non-coding RNA molecule, as discussed in detail below).
[0159] According to one embodiment, the plant gene encodes a molecule with endogenous silencing activity (eg, an RNA molecule, eg, a non-coding RNA molecule, as discussed in detail below).
[0160] As used herein, the term "pest" refers to an organism that directly or indirectly harms plants. Direct effects include, for example, feeding on plant leaves. Indirect effects include, for example, transmitting disease-causing agents (e.g., viruses, bacteria, etc.) to plants. In the latter case, the pest acts as a vector for pathogen transmission.
[0161] According to some embodiments, the pest is an invertebrate pest, including invertebrate pests that are susceptible to long dsRNA via methods such as, but not limited to, ingestion and / or immersion. Each possibility represents a separate embodiment of the present invention. According to some embodiments, the invertebrate pest that is susceptible to long dsRNA is selected from the group consisting of 26b Each possibility represents a separate embodiment of the present invention.
[0162] According to one embodiment, the pest is an invertebrate organism.
[0163] Exemplary pests include, but are not limited to, insects, nematodes, snails, slugs, spiders, caterpillars, scorpions, mites, ticks, fungi, and the like.
[0164] Insect pests include insects from the order Coleoptera (e.g., beetles), Diptera (e.g., flies, mosquitoes), Hymenoptera (e.g., sawflies, wasps, bees, and ants), Lepidoptera (e.g., butterflies and moths), Pycnophora (e.g., lice, such as chewing lice, biting lice, and bird lice), Hemiptera (e.g., stink bugs), Pycnophora (e.g., aphids, whiteflies, and scale insects), Auchenorrhyncha (e.g., cicadas, leafhoppers, treehoppers, planthoppers, and spittlebugs), and Coleorrhyncha (e.g., moss bugs and beetles). insects selected from the order Homoptera (e.g., grasshoppers, migratory locusts, and crickets, including katydids and wetas), order Thripida (e.g., thrips), order Dermaptera (e.g., earwigs), order Termitida (e.g., termites), order Phthiraptera (e.g., lice), order Siphonaptera (e.g., fleas), order Trichoptera (e.g., caddisflies), and the like.
[0165] Insect pests of the present invention include corn: European corn borer (Ostrinia nubilalis); brown cutworm (Agrotis ipsilon); American tobacco budworm (Helicoverpa zea); fall armyworm (Spodoptera frugiperda); southwestern corn borer (Diatraea grandiosella); corn borer (Elasmopalpus lignosellus); sugarcane borer (Diatraea saccharalis); western corn rootworm (Diabrotica virgifera); northern corn rootworm (Diabrotica longicornis barberi); and eight-spotted cucumber beetle (Diabrotica undecimpunctata howardi; Melanotus species, wireworms; Cyclocephala borealis, northern masked chafer (earthworm); Cyclocephala immaculata (earthworm); Japanese beetle (Popillia japonica); bagworm (Chaetocnema pulicaria); corn weevil (Sphenophorus maidis); corn aphid (Rhopalosiphum maidis); corn root aphid (Anuraphis maidiradicis); American long-horned stink bug (Blissus leucopterus leucopterus); red-legged grasshopper (Melanoplus femurrubrum); migratory grasshopper (Melanoplus sanguinipes, migratory grasshopper) grasshopper); seed fly (Hylemya platura); corn blot leafminer (Agromyza parvicornis); flower thrips (Anaphothrips obscrurus);Thief ant (Solenopsis milesta); Twospotted spider mite (Tetranychus urticae); Sorghum: Sorghum borer (Chilo partellus); Fall armyworm (Spodoptera; frugiperda); Helicoverpa zea; Elasmopalpus lignosellus; granulate cutworm (Feltia subterranea); Phyllophaga crinita; species of the genera Eleodes, Conoderus, and Aeolus; click beetle larvae; Oulema melanopus; bagworms; corn weevils; corn aphids; yellow sugarcane aphid (Sipha flava); American long-horned stink bug; sorghum gall midge (Contarinia sorghicola); Tetranychus japonica cinnabarinus); Two-spotted spider mite; Wheat: Armyworm (Pseudaletia unipunctata); Armyworm moth; Sorghum mealybug; Western cutworm (Agrotis orthogonia, western cutworm); Sorghum mealybug; Red-necked leaf beetle; Giant weevil (Hypera punctata); Eight-spotted melon leaf beetle; Russian wheat aphid; Green wheat aphid (Schizaphis graminum); Wheat long-horned aphid (Macrosiphum avenae); Red-legged grasshopper; Differential grasshopper (Melanoplus differentialis, differential grasshopper); Migratory grasshopper; Hessian fly (Mayetiola destructor); Wheat stalk midge (Sitodiplosis mosellana); Wheat stem miner (Meromyza americana; wheat stem thrips (Hylemya coarctata); wheat stem thrips (Frankliniella fusca); wheat stem sawfly (Cephus cinctus); tulip rust mite (Aceria tulipae); sunflower: sunflower tortrix (Suleima helianthana); sunflower moth (Homoeosoma electellum); sunflower beetle (zygogramma exclamationis); carrot beetle (Bothyrus gibbosus); sunflower seed midge (Neolasioptera murtfeldtiana); cotton: false tobacco moth (Heliothis virescens); tobacco budworm; beetle armyworm (Spodoptera exigua); pink bollworm (Pectinophora gossypiella); Mexican boll weevil (Anthonomus grandis);Cotton aphid (Aphis gossypii); cotton flea beetle (Pseudatomoscelis seriatus); greenhouse whitefly (Trialeurodes abutilonea); green mistletoe bug (Lygus lineolaris); red-legged grasshopper; differential grasshopper; onion thrips (Thrips tabaci); light green thrips (Franklinkiella fusca); false two-spotted spider mite; two-spotted spider mite; rice: sugarcane borer (Diatraea saccharalis); rice armyworm; tobacco budworm; grape colaspis (Colaspis brunnea, grape colaspis); rice water weevil (Lissorhoptrus oryzophilus); rice weevil (Sitophilus oryzae); black-striped rice leafhopper (Nephotettix nigropictus); American long-horned stink bug; green lace bug; soybean: soybean looper (Pseudoplusia includens); velvet bean caterpillar (Anticarsia gemmatalis); green cloverworm (Plathypena scabra); European corn borer; cutworm; beet armyworm; false tobacco moth; tobacco moth; common ladybug (Epilachna varivestis); green peach aphid (Myzus persi; cae); potato leafhopper (Empoasca fabae); green lace bug; red-legged grasshopper; differential grasshopper; seed fly; soybean thrips (Sericothrips variabilis); onion thrips; strawberry spider mite (Tetranychus turkestani, strawberry spider mite); two-spotted spider mite; barley: European corn borer; cutworm moth; wheat green aphid, American long-horned stink bug; green lace bug; brown stink bug (Euschistus servus, brown stink bug); seed fly (Delia platura); Hessian fly; brown spider mite (Petrobia latens); rapeseed: radish aphid (Brevicoryne brassicae); free beetle (Phyllotreta cruciferae, Flea beetle; Mamestra configurata; Plutella xylostella; Delia species, root borers. According to one embodiment, the pathogen is a nematode.
[0166] Exemplary nematodes include Radopholus similis, nematodes, Radopholus arabocoffeae, Pratylenchus coffeae, root-knot nematodes (Meloidogyne species), cyst nematodes (Heterodera and Globodera species), root-lesion nematodes (Pratylenchus species), stem nematodes (Ditylenchus dipsaci), pinewood nematode (Bursaphelenchus xylophilus), false nematode (Rotylenchulus reniformis), grape spur nematode (Xiphinema index), Nacobbus aberrans, aberrans, and Aphelenchoides besseyi.
[0167] Exemplary fungi include Fusarium oxysporum, Leptosphaeria maculans (cabbage root rot fungus (Phoma lingam)), Sclerotinia sclerotiorum, Pyricularia grisea, Gibberella fujikuroi (Fusarium moniliforme), Magnaporthe oryzae, Botrytis cinereal, Puccinia species, Fusarium graminearum, Blumeria graminis, Mycosphaerella graminicola, Colletotrichum species, Ustilago maydis, Melampsora lini, Phakopsora pachyrhizi, and Rhizoctonia solani.
[0168] According to certain embodiments, the pests are ants, termites, bees, wasps, caterpillars, crickets, migratory locusts, beetles, snails, slugs, nematodes, cockroaches, flies, fruit flies, whiteflies, mosquitoes, grasshoppers, planthoppers, earwigs, aphids, scale insects, vorticella, spiders, mites, psyllids, ticks, moths, caterpillars, and scorpions, at different stages of their life cycle. These include earwigs, aphids, scale insects, vorticella, spiders, mites, psyllids, and scorpions.
[0169] According to certain embodiments, the pest is at any life cycle stage of its life. According to one embodiment, the pest is a virus.
[0170] The phrase "silencing a pest gene" refers to reducing the expression level of a polynucleotide or polypeptide encoded thereby by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to a pest gene not targeted by the designed long dsRNA molecule of the present invention.
[0171] Assays for measuring the expression level of a polynucleotide or the polypeptide encoded thereby include, but are not limited to, RT-PCR, Western blot, immunohistochemistry and / or flow cytometry, sequencing, or any other detection method (discussed further below).
[0172] Preferably, silencing the pest gene results in the suppression, control, and / or killing of the pest, thereby limiting the damage the pest causes to the plant. Controlling a pest includes, but is not limited to, killing the pest, inhibiting the development of the pest, altering the fecundity or growth of the pest so that it causes less damage to the plant, reducing the number of offspring produced, producing a less fit pest, producing a pest that is more susceptible to attack by predators, or preventing the pest from feeding on the plant.
[0173] The term "pest gene," as used herein, refers to any gene in a pest that is essential for growth, development, reproduction, or infectivity. The gene can be expressed in any tissue of the pest, but in certain embodiments, genes targeted for inhibition in pests are expressed in cells of the pest's intestinal tissue, cells of the pest's midgut, cells lining the intestinal lumen or midgut, cells of the pest's intestinal flora, and cells of the pest's immune system. Such target genes may be involved, for example, in intestinal cell metabolism, growth, differentiation, and the immune system.
[0174] Exemplary pest genes that can be targeted by the present methods include, but are not limited to, the genes listed in Tables 1A-B below.
[0175] According to a particular embodiment, the nematode gene comprises calreticulin 13 (CRT) or collagen 5 (col-5), which are genes of the banana root nematode (Radopholus similis).
[0176] According to certain embodiments, the fungal genes include the Fusarium oxysporum genes FOW2, FRP1, and OPR.
[0177] In one embodiment, silencing the pest gene reduces disease symptoms in the plant or reduces damage to the plant (caused by the pest) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to a plant that has been harmed by the pest and not subjected to a designed long dsRNA molecule of the invention.
[0178] Assays for measuring pest control are generally known in the art, e.g., See, e.g., U.S. Patent No. 5,614,395, incorporated herein by reference. Such techniques include measuring average lesion diameter, pathogen biomass, and the overall percentage of decayed plant tissue over time. See, e.g., Thomma et al. (1998) Plant Biology 95:15107-15111, incorporated herein by reference. See also Baum et al. (2007) Nature Biotech 11:1322-1326 and WO 2007 / 035650, which provide both whole plant and maize root feeding assays.
[0179] According to one embodiment, the method comprises selecting a nucleic acid sequence of a plant gene that exhibits a predetermined sequence homology to a nucleic acid sequence of a pest gene.
[0180] According to one embodiment, the sequence homology between the nucleic acid sequence of the plant gene and the nucleic acid sequence of the pest gene comprises 60% to 100%, 70% to 80%, 70% to 90%, 70% to 100%, 75% to 100%, 80% to 90%, 80% to 100%, 85% to 100%, 90% to 100%, or 95% to 100% identity.
[0181] According to a particular embodiment, the sequence homology comprises between 75% and 100% identity between the nucleic acid sequence of the plant gene and the nucleic acid sequence of the pest gene.
[0182] According to a particular embodiment, the sequence homology comprises 85% to 100% identity between the nucleic acid sequence of the plant gene and the nucleic acid sequence of the pest gene.
[0183] According to a particular embodiment, the sequence homology comprises between 75% and 100% identity between the nucleic acid sequence of the plant gene and the nucleic acid sequence of the pest gene.
[0184] According to one embodiment, the sequence homology comprises at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity between the nucleic acid sequence of the plant gene and the nucleic acid sequence of the pest gene.
[0185] Homology (eg, percent homology, sequence identity plus sequence similarity) can be determined using any homology comparison software that calculates pairwise sequence alignments.
[0186] As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to residues in the two sequences that are the same when aligned. When percent sequence identity is used with respect to proteins, it is recognized that non-identical residue positions often differ by conservative amino acid substitutions, in which an amino acid residue is substituted with another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), thereby not altering the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically, this involves scoring conservative substitutions as partial rather than complete mismatches to increase the percent sequence identity. Thus, for example, where identical amino acids are assigned a score of 1 and non-conservative substitutions are assigned a score of 0, conservative substitutions are assigned a score between 0 and 1. Scoring of conservative substitutions is calculated, for example, according to the algorithm of Henikoff S and Henikoff JG [Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. USA 1992, 89(22):10915-9].
[0187] Identity (e.g., percent homology) can be determined using any homology comparison software, including BlastN software from the National Center of Biotechnology Information (NCBI), such as by using default parameters.
[0188] According to some embodiments of the invention, the identity is a global identity, ie, identity over the entire amino acid or nucleic acid sequence of the invention, and not over a portion thereof.
[0189] According to some embodiments of the invention, the term "homology" or "homologous" refers to the identity of two or more nucleic acid sequences; or the identity of two or more amino acid sequences; or the identity of an amino acid sequence to one or more nucleic acid sequences.
[0190] According to some embodiments of the invention, the homology is global, ie, homology over the entire amino acid or nucleic acid sequence of the invention, and not over a portion thereof.
[0191] The degree of homology or identity between two or more sequences can be determined using a variety of known sequence comparison tools. The following is a non-limiting description of such tools that can be used with some embodiments of the present invention.
[0192] When starting with a polynucleotide sequence and comparing it to another polynucleotide sequence, the EMBOSS-6.0.1 Needleman-Wunsch algorithm (available from emboss(dot)sourceforge(dot)net / apps / cvs / emboss / apps / needle(dot)html) can be used with the following default parameters: (EMBOSS-6.0.1) gapopen=10; gapextend=0.5; datafile=EDNAFULL; brief=YES.
[0193] According to some embodiments of the present invention, the parameters used in the EMBOSS-6.0.1 Needleman-Wunsch algorithm are gapopen=10; gapextend=0.2; datafile=EDNAFULL; brief=YES.
[0194] According to some embodiments of the invention, the threshold used to determine homology using the EMBOSS-6.0.1 Needleman-Wunsch algorithm for comparing polynucleotides is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0195] According to some embodiments, determining the degree of homology further requires the use of the Smith-Waterman algorithm (for protein-protein or nucleotide-nucleotide comparisons).
[0196] The default parameters for the GenCore6.0 Smith-Waterman algorithm include: model=sw.model.
[0197] According to some embodiments of the invention, the threshold used to determine homology using the Smith-Waterman algorithm is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0198] According to some embodiments of the present invention, before performing global homology to a polypeptide or polynucleotide of interest (e.g., 80% global homology over the entire sequence), global homology is performed on sequences pre-selected by local homology to the polypeptide or polynucleotide of interest (e.g., 60% identity over 60% of the sequence length). For example, in a first step, homologous sequences are selected using the BLAST software, which uses the Blastp and tBlastn algorithms as filters, and in a second step, alignment is performed using the needle (EMBOSS package) or Frame+ algorithm. Since local identity (Blast alignment) is used only as a filter for the global alignment step, a very permissive cutoff is defined—60% identity over 60% of the sequence length. In this particular embodiment (when using local identity), the default filtering of the Blast package is not utilized (by setting the parameter "-FF").
[0199] In the second step, homologs are defined based on at least 80% global identity to the polypeptide sequence of the core gene. According to some embodiments, the homology is local homology or local identity.
[0200] Local alignment tools include, but are not limited to, the National Center of Biotechnology Information's (NCBI) BlastP, BlastN, BlastX, or TBLASTN software, FASTA, and Smith-Waterman algorithms.
[0201] According to certain embodiments, homology is determined using BlastN with the following parameters: max target sequences=1000, expect threshold=10, word size=11, match score=2, mismatch score=-3, gap existence cost=5, gap extension cost=2.
[0202] According to certain embodiments, selecting a nucleic acid sequence of a plant gene that exhibits a predetermined sequence homology to a nucleic acid sequence of a pest gene is carried out by identifying a transcript of the plant that has a "stretch of homology" to the transcript of the pest. According to particular embodiments, the stretch of homology is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 7000, 8000, 9000, 10,000 or more nucleotides (e.g., 20-50 nucleotides, 20-25 nucleotides, e.g., 21 nucleotides) across the plant transcript. Within a range of 20 to 50 nucleotides (eg, 21 nucleotides), the homology of the plant transcript to the pest transcript is preferably 75%, 80%, 85%, 90%, 95%, 99%, or 100%.
[0203] According to particular embodiments, when the pest is a nematode (Heterodera glycines), the pest gene is as set forth in accession number AF469060.1 (Heterodera glycines ubiquitin extension protein) and the plant gene is as set forth in NM_001203752.2 (Arabidopsis thaliana ubiquitin 11 (UBQ11)).
[0204] According to a particular embodiment, when the pest is a nematode (soybean cyst nematode), the pest The organism gene is as described under accession number AF500024.1 (Soybean cyst nematode putative gland protein G8H07), and the plant gene is as described under accession number NM_116351.7 (Arabidopsis thaliana glycosyltransferase family 1 protein (AT4G01210)).
[0205] According to certain embodiments, when the pest is a nematode (soybean cyst nematode), the pest gene is as set forth in accession number AF502391.1 (soybean cyst nematode putative gland protein G10A06) and the plant gene is as set forth in NM_001037071.1 (Arabidopsis thaliana bZIP transcription factor family 1 protein (TGA1)).
[0206] According to one embodiment, the method comprises modifying an endogenous nucleic acid sequence of a plant encoding an RNA molecule to confer silencing specificity for a plant gene, such that a small RNA molecule processed from the RNA molecule capable of recruiting an RNA-dependent RNA polymerase (RdRp) forms base complementarity with a transcript of the plant gene to produce a long dsRNA molecule capable of silencing the pest gene.
[0207] According to one embodiment, the RNA molecule is a non-coding RNA molecule.
[0208] As used herein, the term "non-coding RNA molecule" refers to an RNA sequence that is not translated into an amino acid sequence and does not encode a protein.
[0209] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in a non-coding gene (e.g., a non-protein-coding gene). Exemplary non-coding portions of the genome include, but are not limited to, introns, genes for non-coding RNAs, DNA methylation regions, enhancers and locus control regions, insulators, S / MAR sequences, non-protein-coding pseudogenes, transposons, non-autonomous transposable elements (e.g., Alu, SINES, and mutated non-coding transposons and retrotransposons), and simple repeats in the centromeric and telomeric regions of chromosomes.
[0210] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in a ubiquitously expressed non-coding gene.
[0211] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in a non-coding gene that is expressed in a tissue-specific manner (eg, in leaves, fruits, or flowers).
[0212] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in an inducibly expressed non-coding gene.
[0213] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in a developmentally regulated non-coding gene.
[0214] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located between genes, ie, in an intergenic region.
[0215] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within an intron of a non-coding gene.
[0216] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is a coding gene (e.g., , protein-coding genes).
[0217] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within an exon of a coding gene (eg, a protein-coding gene).
[0218] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within an exon encoding an untranslated region (UTR) of a coding gene (eg, a protein-encoding gene).
[0219] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within a translated exon of a coding gene (eg, a protein-coding gene).
[0220] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within an intron of a coding gene (eg, a protein-coding gene).
[0221] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within a ubiquitously expressed coding gene.
[0222] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within a coding gene that is expressed in a tissue-specific manner (eg, in leaves, fruits, or flowers).
[0223] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located within an inducibly expressed coding gene.
[0224] According to one embodiment, the nucleic acid sequence encoding the RNA molecule is located in a developmentally regulated coding gene.
[0225] According to one embodiment, RNA molecules (e.g., non-coding RNA molecules) are typically subject to RNA silencing processing mechanisms or activities. However, changes of a few nucleotides (e.g., up to 24 nucleotides in miRNAs) that can trigger processing mechanisms leading to recruitment of RdRPs, RNA interference, or translational inhibition are also contemplated herein.
[0226] According to certain embodiments, the RNA molecule is endogenous (naturally occurring, e.g., native) to the plant cell. It will be understood that the RNA molecule may also be exogenous (i.e., added externally and not naturally occurring within the plant cell) to the cell.
[0227] According to some embodiments, the RNA molecule (eg, a non-coding RNA molecule) has intrinsic translation inhibitory activity.
[0228] According to some embodiments, the RNA molecule (eg, a non-coding RNA molecule) has intrinsic RNA interference (RNAi) activity.
[0229] According to some embodiments, the RNA molecule (e.g., the non-coding RNA molecule) does not contain intrinsic translation inhibitory activity or intrinsic RNAi activity (i.e., the non-coding RNA molecule does not have RNA silencing activity).
[0230] According to embodiments of the present invention, the RNA molecule (e.g., a non-coding RNA molecule) is specific for native plant RNA (e.g., naturally occurring plant RNA) and, unless designed to do so (as described below), does not specifically target pest RNA or plant RNA (i.e., plant genetic material). and do not mutually inhibit or silence any of the target genes (e.g., gene products or gene sequences) and exhibit less than 100% global homology to the target gene, e.g., less than 99%, less than 98%, less than 97%, less than 96%, less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87%, less than 86%, less than 85%, less than 84%, less than 83%, less than 82%, or less than 81% global homology to the target gene, as determined at the RNA or protein level by RT-PCR, Western blot, immunohistochemistry, and / or flow cytometry, sequencing, or any other detection method.
[0231] According to one embodiment, the RNA molecule (eg, a non-coding RNA molecule) is an RNA silencing or RNA interference (RNAi) molecule (also referred to as a "silencing molecule").
[0232] The terms "RNA silencing" or "RNAi" refer to a cellular regulatory mechanism in which non-coding RNA molecules ("RNA silencing molecules," "silencing molecules," or "RNAi molecules") mediate the co- or post-transcriptional inhibition of gene expression or translation in a sequence-specific manner.
[0233] As used herein, "silencing molecule capable of recruiting RNA-dependent RNA polymerase (RdRp)" refers to a silencing molecule that can associate RdRp with its target transcript interaction site, thereby enabling the formation of a long dsRNA based on another RNA molecule as a template. In a non-limiting example, the silencing molecule capable of recruiting RdRp is a miRNA, such as but not limited to a 22nt-long miRNA, and the TAS transcript serves as a template for the miRNA / RISC / RdRp complex, resulting in a long dsRNA based on the TAS transcript.
[0234] According to one embodiment, an RNA molecule (eg, an RNA silencing molecule) is capable of mediating the suppression of RNA during transcription (co-transcriptional gene silencing).
[0235] According to certain embodiments, co-transcriptional gene silencing comprises epigenetic silencing (e.g., a chromosomal condition that prevents functional gene expression).
[0236] According to one embodiment, the RNA molecule (eg, RNA silencing molecule) is capable of mediating post-transcriptional RNA suppression (post-transcriptional gene silencing).
[0237] Post-transcriptional gene silencing (PTGS) typically refers to the process (typically occurring in the cytoplasm of a cell) of degradation or cleavage of messenger RNA (mRNA) molecules, which reduces their activity by preventing translation. For example, as described in more detail below, the guide strand of an RNA silencing molecule pairs with a complementary sequence in an mRNA molecule and induces cleavage by, for example, Argonaute 2 (Ago2).
[0238] Co-transcriptional gene silencing typically refers to the inactivation of gene activity (i.e., transcriptional repression) and typically occurs in the cell nucleus. Such repression of gene activity is mediated by epigenetic factors, such as methyltransferases, which methylate target DNA and histones. Thus, in co-transcriptional gene silencing, binding of small RNAs to target RNAs (small RNA-transcript interactions) destabilizes the target nascent transcript, recruiting enzymes that modify DNA and histones (i.e., epigenetic factors) that induce chromatin remodeling into a structure that represses gene activity and transcription. Co-transcriptional gene silencing also involves the binding of long non-coding RNA scaffolds bound to chromatin. These co-transcriptional silencing mechanisms form an RNA surveillance system that detects and silences inappropriate transcriptional events, providing memory of these events through self-reinforcing epigenetic loops [as reviewed in D. Hoch and D. Moazed, RNA-mediated epigenetic regulation of gene expression, Nat Rev Genet. (2015) 16(2):71-84].
[0239] According to embodiments of the present invention, RNA silencing molecules are generated by the RNAi biogenesis / processing machinery.
[0240] According to embodiments of the present invention, RNA silencing molecules are generated by the RNAi biogenesis / processing machinery, but the specific targets have not been identified.
[0241] According to one embodiment, the RNA molecule (eg, a non-coding RNA molecule) is capable of inducing RNA interference (RNAi).
[0242] According to one embodiment, the RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from a precursor.
[0243] According to one embodiment, an RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from a single-stranded RNA (ssRNA) precursor.
[0244] According to one embodiment, an RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from a double-stranded single-stranded RNA precursor.
[0245] According to one embodiment, an RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from a dsRNA precursor (eg, containing perfect and imperfect base pairing).
[0246] According to one embodiment, an RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from an unstructured RNA precursor.
[0247] According to one embodiment, the RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from a protein-coding RNA precursor.
[0248] According to one embodiment, the RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed from an RNA precursor.
[0249] According to one embodiment, an RNA molecule (eg, a non-coding RNA molecule or an RNA silencing molecule) is processed and associates with an RNA-induced silencing complex (RISC).
[0250] According to one embodiment, an RNA molecule (e.g., a non-coding RNA molecule or an RNA silencing molecule) is processed and cleaved by the RNAi processing machinery, for example, Dicer, Ago2, the DICER protein family (e.g., DCR1 and DCR2), the DICER-LIKE protein family (e.g., DCL1, DCL2, DCL3, DCL4), the ARGONAUTE protein family (e.g., AGO1, AGO2, AGO3, AGO4), tRNA cleavage enzymes (e.g., RNY1, ANGIOGENIN, RNase P, RNase P-like, SLFN3, ELAC1, and ELAC2), and Piwi-binding RNA (piRNA)-associated proteins (e.g., AGO3, AUBERGINE, HI The ribonucleases associated with the ribonucleases include, but are not limited to, WI, HIWI2, HIWI3, PIWI, ALG1, and ALG2) (discussed further below).
[0251] According to one embodiment, the dsRNA may be derived from two different, complementary RNAs, or may be derived from a single RNA that folds back on itself to form the dsRNA.
[0252] Below is a detailed description of RNA silencing molecules (e.g., non-coding RNA molecules) that associate with an RNA-induced silencing complex (RISC) and have intrinsic RNAi activity (e.g., are RNA silencing molecules) that can be used in accordance with certain embodiments of the present invention.
[0253] Perfectly and imperfectly paired RNAs (i.e., double-stranded RNAs; dsRNAs), siRNAs, and shRNAs—the presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme called Dicer. Dicer (also known as endoribonuclease Dicer or helicase with an RNase motif) is an enzyme typically referred to as a Dicer-like (DCL) protein in plants. The number of DCL genes varies among plants; for example, the Arabidopsis genome typically has four DCL genes, rice has eight DCL genes, and the maize genome has five DCL genes. Dicer is involved in processing dsRNA into short pieces of dsRNA known as small interfering RNAs (siRNAs). siRNAs derived from Dicer activity are typically about 21 to about 23 nucleotides long and contain approximately 19 base pair duplexes with two 3' nucleotide overhangs.
[0254] According to one embodiment, dsRNA precursors longer than 21 bp are used. Various studies have demonstrated that long dsRNAs can be used to silence gene expression without inducing stress responses or causing significant off-target effects—for example, [Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al.Brain Res.Protoc.2004;13:115-125;Diallo M.,et al.,Oligonucleotides.2003;13:381-392;Paddison PJ,et al.,Proc.Natl Acad. Sci. USA. 2002; 99: 1443-1448; Tran N., et al., FEBS Lett. 2004; 573: 127-134].
[0255] The term "siRNA" refers to small inhibitory RNA duplexes (typically 18-30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21-mers with a central 19-bp duplex region and symmetric two-base 3' overhangs at the termini. However, it has recently been reported that chemically synthesized RNA duplexes of 25-30 bases in length can exhibit up to 100-fold increased potency compared to 21-mers at the same positions. The observed increased potency obtained with longer RNAs in inducing RNAi is due to providing Dicer with a substrate (27-mer) rather than a product (21-mer), suggesting that this improves the speed or efficiency of RISC entry of siRNA duplexes.
[0256] The position, but not the composition, of the 3' overhang influences the potency of siRNA, and asymmetric duplexes with a 3' overhang on the antisense strand have generally been found to be more potent than those with a 3' overhang on the sense strand (Rose et al., 2005).
[0257] The strands of double-stranded interfering RNA (e.g., siRNA) can be joined to form a hairpin or stem-loop structure (e.g., shRNA). Thus, as mentioned above, the RNA silencing molecule of some embodiments of the present invention can be a short hairpin RNA (shRNA).
[0258] The term "shRNA," as used herein, refers to a short hairpin RNA molecule having a stem-loop structure, comprising first and second regions of complementary sequence, the degree and orientation of which are sufficient to allow base pairing between the regions, the first and second regions joined by a loop region, and the loop resulting from the lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is between 3 and 23, or between 5 and 15, or between 7 and 13, or between 4 and 9, or between 9 and 11. Some of the nucleotides in the loop may participate in base-pairing interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form a loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (WO2013126963 and WO2014107763). Those skilled in the art will recognize that the resulting single-stranded oligonucleotide forms a stem-loop or hairpin structure that contains a double-stranded region that can interact with the RNAi machinery.
[0259] The RNA silencing molecules of some embodiments of the present invention need not be limited to molecules containing only RNA, but also encompass chemically modified nucleotides and non-nucleotides.
[0260] Various types of siRNAs are contemplated by the present invention, including trans-acting siRNAs (TasiRNAs), repeat-associated siRNAs (Ra-siRNAs), and siRNAs derived from natural antisense transcripts (Nat-siRNAs).
[0261] According to certain embodiments, the RNA molecule (e.g., a non-coding RNA molecule) is a phased small interfering RNA (phasiRNA). "PhasiRNA" is derived from mRNA that is converted to dsRNA by RDR6 and processed by DCL4, as exemplified by the class of trans-acting siRNAs (tasiRNAs) in Arabidopsis (Vazquez et al., 2004). In exceptional cases, in herbaceous reproductive tissues, phasiRNAs can also be the 24-nucleotide product of DCL5 (formerly known as DCL3b) (Song et al., 2012). The trans-acting name (tasiRNA) of some phasiRNAs comes from their ability to function like miRNAs in a homology-dependent manner, directing AGO1-dependent cleavage of mRNAs from genes other than the original mRNA (see below).
[0262] According to certain embodiments, the RNA molecule (e.g., non-coding RNA molecule) is a tasiRNA. "TasiRNA" is a class of secondary siRNAs that are generated from non-coding TAS transcripts by miRNA triggers in a phased pattern (Peragine (Peragine et al., 2004; Vazquez et al., 2004; Allen et al., 2005; Yoshikawa et al., 2005). The term "phased" simply refers to the precise head-to-tail configuration of small RNAs, starting at specific nucleotides; this configuration results from miRNA-triggered initiation followed by DCL4-catalyzed cleavage. Key proteins involved in tasiRNA biogenesis include, but are not limited to, RDR6, SUPPRESSOR OF GENE SILENCING3 (SGS3), DCL4, AGO1, AGO7, and DOUBLE-STRANDED RNA BINDING FACTOR4 (Peragine et al., 2004; Vazquez et al., 2004). (Z et al., 2004; Xie et al., 2005; Adenot et al., 2006; Montgomery et al., 2008a; Fukudome et al., 2011). Most importantly, there are two mechanisms by which 21-nucleotide tasiRNAs are generated, known as the "one-hit" or "two-hit" pathways. In the one-hit mechanism, a single miRNA directs the cleavage of an mRNA target, triggering the generation of phasiRNAs at (or downstream of) the target site (Allen et al., 2004). (Chen et al., 2010; Cuperus et al., 2010). One-hit miRNA triggers are typically 22 nucleotides in length (Chen et al., 2010; Cuperus et al., 2010). The two-hit model uses pairs of 21-nucleotide miRNA target sites, of which only 39 target sites undergo cleavage, generating phasiRNA fragments (or upstream) of the target site (Axtell et al., 2006).
[0263] According to one embodiment, the silencing RNA comprises "piRNA," a class of Piwi-binding RNAs approximately 26 and 31 nucleotides in length. piRNAs typically form RNA-protein complexes through interactions with Piwi proteins, i.e., antisense piRNAs are typically loaded onto Piwi proteins (e.g., Piwi, Ago3, and Aubergine (Aub)).
[0264] miRNA - According to another embodiment, the RNA silencing molecule may be a miRNA.
[0265] The terms "microRNA," "miRNA," and "miR" are synonymous and refer to a collection of non-coding, single-stranded RNA molecules approximately 19-24 nucleotides in length that regulate gene expression. miRNAs are found in a wide range of organisms (e.g., insects, mammals, plants, and nematodes) and have been shown to play roles in development, homeostasis, and disease pathogenesis.
[0266] Pre-miRNAs initially exist as long, imperfect double-stranded stem-loop RNAs that are synthesized by Dicer into the mature guide strand (miRNA) and similarly sized fragments known as passenger strands (miRNAs). * ) are further processed into siRNA-like duplexes containing miRNA and miRNA * can be derived from opposing arms of the pri-miRNA and pre-miRNA. * Although sequences may be found in libraries of cloned miRNAs, they are typically found less frequently than miRNAs because they are often non-functional and degraded within the cell.
[0267] First, miRNA * Although miRNAs exist as double-stranded species along with miRNAs, they are ultimately incorporated as single-stranded RNA into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). A variety of proteins can form RISC, which allows the miRNA / miRNA complex to be integrated into the ribonucleoprotein complex. * Duplex specificity, binding site of target gene, miRNA activity (repression or activation), and miRNA / miRNA * Which strand of the duplex is loaded into RISC can vary.
[0268] miRNA:miRNA * When the double-stranded miRNA strand is loaded into RISC, the miRNA * miRNA is removed and degraded. miRNA loaded into RISC: miRNA * The strand of the duplex is the one that is less tightly paired at the 5' end. miRNA:miRNA * If both ends of the miRNA have approximately equivalent 5' pairing, the miRNA and miRNA * Both may have gene silencing activity.
[0269] RISC identifies target nucleic acids based on the high level of complementarity between miRNA and mRNA, specifically by the second to eighth nucleotides of the miRNA (referred to as the "seed sequence").
[0270] Numerous studies have investigated the base-pairing requirements between miRNAs and their mRNA targets for efficient translation inhibition (reviewed by Bartel 2004, Cell 116-281). Computational studies analyzing genome-wide miRNA binding suggest that bases 2-8 of the 5' end of the miRNA (also known as the "seed sequence") play a special role in target binding, although the role of the first nucleotide, usually found to be "A," has also been recognized (Lewis et al. 2005, Cell 120-15). Similarly, Krek et al. (2005, Nat Genet 37-495) identified and validated targets using nucleotides 1-7 or 2-8. Target sites in mRNAs can be located in the 5' UTR, 3' UTR, or coding region. Interestingly, multiple miRNAs can regulate the same mRNA target by recognizing the same site or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs results in the most efficient translation inhibition.
[0271] miRNAs can instruct RISC to downregulate gene expression through one of two mechanisms: mRNA cleavage or translational repression. If the mRNA has a certain degree of complementarity to the miRNA, the miRNA can direct mRNA cleavage. When the miRNA induces cleavage, cleavage typically occurs between the nucleotide pairings with the 10th and 11th residues of the miRNA. Alternatively, if the miRNA does not have the required degree of complementarity to the miRNA, the miRNA can repress translation. Translational repression may be more prevalent in animals, as the degree of complementarity between the miRNA and the binding site may be lower in animals.
[0272] miRNA and miRNA * It should be noted that there may be variability in the 5' and 3' ends of any pair of miRNAs. This variability may be due to variability in the enzymatic processing of Drosha and Dicer relative to the cleavage site. * The variation in the 5' and 3' ends of the miRNAs may also be due to mismatches in the stem structures of the pri-miRNA and pre-miRNA. Mismatches in the stem strands may lead to a population of different hairpin structures. Variation in stem structure may also lead to variations in the products of Drosha and Dicer cleavage.
[0273] According to one embodiment, miRNAs can be processed independently of Dicer, for example, by Argonaute 2.
[0274] It will be understood that a pre-miRNA sequence may comprise 45 to 90, 60 to 80, or 60 to 70 nucleotides, while a pri-miRNA sequence may comprise 45 to 30,000, 50 to 25,000, 100 to 20,000, 1,000 to 1,500, or 80 to 100 nucleotides.
[0275] Antisense - Antisense is a single-stranded RNA designed to specifically hybridize with the mRNA of a gene, thereby blocking or inhibiting the expression of that gene. Antisense polynucleotides capable of specifically hybridizing with the mRNA transcript encoding the target RNA can be used to downregulate the target RNA.
[0276] transposable element RNA Transposable elements (TEs) contain vast DNA sequences, all of which can be transposed either directly by a cut-and-paste mechanism (transposons) or indirectly via an RNA intermediate (retrotransposons). TEs (transposons) have the ability to move to new sites in the genome. TEs are divided into autonomous and non-autonomous classes depending on whether they contain ORFs encoding proteins required for transposition. RNA-mediated gene silencing is one of the mechanisms by which the genome controls TE activity and the deleterious effects resulting from genetic and epigenetic instability of the genome.
[0277] As mentioned above, the RNA molecule (e.g., a non-coding RNA molecule) may not have standard (intrinsic) RNAi activity (e.g., it is not a standard RNA silencing molecule or its target has not been identified). Such RNA silencing molecules include:
[0278] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is a transfer RNA (tRNA). The term "tRNA" refers to an RNA molecule that serves as a physical link between the nucleotide sequence of a nucleic acid and the amino acid sequence of a protein, and was previously referred to as soluble RNA or sRNA. tRNAs are typically about 76-90 nucleotides in length.
[0279] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is ribosomal RNA (rRNA). The term "rRNA" refers to the RNA component of a ribosome, i.e., either the small ribosomal subunit or the large ribosomal subunit.
[0280] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is a small nuclear RNA (snRNA or U-RNA). The terms "sRNA" or "U-RNA" refer to small RNA molecules found in splicing speckles and Cajal bodies in the nucleus of eukaryotic cells. snRNAs are typically about 150 nucleotides in length.
[0281] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is a small nucleolar RNA (snoRNA). The term "snoRNA" refers to a class of small RNA molecules that primarily direct the chemical modification of other RNAs, such as rRNA, tRNA, and snRNA. snoRNAs typically fall into one of two classes: C / D box snoRNAs, which are typically about 70-120 nucleotides in length and are associated with methylation, and H / ACA box snoRNAs, which are typically about 100-200 nucleotides in length and are associated with pseudouridylation.
[0282] ScaRNAs (i.e., small Cajal body RNA genes), which play a similar role in RNA maturation as snoRNAs, are similar to snoRNAs but target spliceosomal snRNAs, performing site-specific modifications of spliceosomal snRNA precursors (in nuclear Cajal bodies).
[0283] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is extracellular RNA (exRNA). The term "exRNA" refers to an RNA species that exists outside the cell from which it was transcribed (e.g., exosomal RNA).
[0284] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is a repeat-derived RNA. The term "repeat-derived RNA" refers to RNA encoded by DNA derived from an inverted genomic repeat (e.g., but not limited to, DNA generated by DNA recombination, duplication of a genomic locus, transposition events, etc.).
[0285] According to one embodiment, the RNA molecule (e.g., a non-coding RNA molecule) is a long non-coding RNA (lncRNA). The term "lncRNA" or "long ncRNA" typically refers to a refers to non-protein-coding transcripts longer than 200 nucleotides.
[0286] According to certain embodiments, non-limiting examples of RNA molecules (e.g., non-coding RNA molecules) that associate with RISC include, but are not limited to, microRNAs (miRNAs), Piwi-binding RNAs (piRNAs), small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), phased small interfering RNAs (phasiRNAs), trans-acting siRNAs (tasiRNAs), small nuclear RNAs (snRNAs or URNAs), transposable element RNAs (e.g., autonomous and non-autonomous transposable RNAs), transfer RNAs (tRNAs), small nucleolar RNA molecules (snoRNAs), small Cajal body RNAs (scaRNAs), ribosomal RNAs (rRNAs), extracellular RNAs (exRNAs), repeat-derived RNAs, and long non-coding RNAs (lncRNAs).
[0287] According to certain embodiments, non-limiting examples of RNAi molecules that associate with RISC include, but are not limited to, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), Piwi-binding RNA (piRNA), phased small interfering RNA (phasiRNA), and trans-acting siRNA (tasiRNA).
[0288] According to one embodiment, small RNA molecules processed from RNA molecules (eg, non-coding RNA molecules) of some embodiments of the present invention are capable of recruiting an RNA-dependent RNA polymerase (RdRp).
[0289] The term "processed" refers to the biogenesis in which an RNA molecule is cleaved into a small RNA form that can associate with an RNA-induced silencing complex (RISC). For example, a pre-miRNA is processed into a mature miRNA, for example, by Dicer.
[0290] As used herein, the term "small RNA form" or "small RNA" or "small RNA molecule" refers to a mature small RNA that is capable of hybridizing to a target RNA, e.g., a transcript (or fragment thereof) of a plant gene.
[0291] According to one embodiment, the small RNA has a length of 250 nucleotides or less, and contains, for example, 20 to 250, 20 to 200, 20 to 150, 20 to 100, 20 to 50, 20 to 40, 20 to 30, 20 to 25, 20 to 26, 30 to 100, 30 to 80, 30 to 60, 30 to 50, 30 to 40, 50 to 150, 50 to 100, 50 to 80, 50 to 70, 100 to 250, 100 to 200, 100 to 150, 150 to 250, or 150 to 200 nucleotides.
[0292] According to a particular embodiment, the small RNA molecule comprises between 20 and 50 nucleotides.
[0293] According to a particular embodiment, the small RNA molecule comprises 20 to 30 nucleotides.
[0294] According to certain embodiments, the small RNA molecule comprises 21 to 29 nucleotides.
[0295] According to a particular embodiment, the small RNA molecule comprises 21 to 24 nucleotides.
[0296] According to a particular embodiment, the small RNA molecule comprises 21 nucleotides.
[0297] According to a particular embodiment, the small RNA molecule comprises 22 nucleotides.
[0298] According to a particular embodiment, the small RNA molecule comprises 23 nucleotides.
[0299] According to a particular embodiment, the small RNA molecule comprises 24 nucleotides.
[0300] According to a particular embodiment, the small RNA molecule consists of 20 to 50 nucleotides.
[0301] According to a particular embodiment, the small RNA molecule consists of 20 to 30 nucleotides.
[0302] According to a particular embodiment, the small RNA molecule consists of 21 to 29 nucleotides.
[0303] According to a particular embodiment, the small RNA molecule consists of 21 to 24 nucleotides.
[0304] According to a particular embodiment, the small RNA molecule consists of 21 nucleotides.
[0305] According to a particular embodiment, the small RNA molecule consists of 22 nucleotides.
[0306] According to a particular embodiment, the small RNA molecule consists of 23 nucleotides.
[0307] According to a particular embodiment, the small RNA molecule consists of 24 nucleotides.
[0308] According to one embodiment, the small RNA molecule has silencing activity (ie is a silencing molecule).
[0309] As mentioned above, silencing molecules (eg, RNA silencing molecules) of some embodiments of the present invention are capable of recruiting RNA-dependent RNA polymerase (RdRp).
[0310] The term "RNA-dependent RNA polymerase" or "RdRp" refers to an enzyme that catalyzes the replication of RNA from an RNA template.
[0311] According to one embodiment, the small RNA molecule has amplifier or primer activity for RdRp.
[0312] According to particular embodiments, the silencing molecule capable of recruiting RdRps is selected from microRNAs (miRNAs), small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), Piwi-binding RNAs (piRNAs), trans-acting siRNAs (tasiRNAs), phased small interfering RNAs (phasiRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), ribosomal RNAs (rRNAs), small nucleolar RNAs (snoRNAs), extracellular RNAs (exRNAs), repeat-derived RNAs, autonomous and non-autonomous translocating RNAs.
[0313] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 21 to 24 nucleotides.
[0314] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 21 nucleotides.
[0315] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 22 nucleotides.
[0316] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 23 nucleotides.
[0317] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp comprises 24 nucleotides.
[0318] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 21 nucleotides.
[0319] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 22 nucleotides.
[0320] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 23 nucleotides.
[0321] According to some embodiments of the invention, the silencing molecule capable of recruiting RdRp consists of 24 nucleotides.
[0322] According to certain embodiments, the silencing molecule capable of recruiting RdRp is an miRNA.
[0323] According to certain embodiments, the miRNA comprises a mature small RNA of 21 to 25 nucleotides.
[0324] According to certain embodiments, the miRNA comprises a mature small RNA of 21 nucleotides.
[0325] According to certain embodiments, the miRNA comprises a mature small RNA of 22 nucleotides.
[0326] According to certain embodiments, the miRNA comprises a mature small RNA of 23 nucleotides.
[0327] According to certain embodiments, the miRNA comprises a mature small RNA of 24 nucleotides.
[0328] According to certain embodiments, the miRNA comprises a mature small RNA of 25 nucleotides.
[0329] According to certain embodiments, miRNAs are mature small RNAs of 21 to 25 nucleotides.
[0330] According to certain embodiments, the miRNA is a mature small RNA of 21 nucleotides.
[0331] According to certain embodiments, the miRNA comprises a mature small RNA of 22 nucleotides.
[0332] According to certain embodiments, the miRNA is a mature small RNA of 23 nucleotides.
[0333] According to certain embodiments, the miRNA is a mature small RNA of 24 nucleotides.
[0334] According to certain embodiments, the miRNA is a mature small RNA of 25 nucleotides.
[0335] Exemplary miRNAs include miR-156a, miR-156c, miR-162a, miR-162b, miR-167d, miR-169b, miR-173, miR-393a, miR-393b, miR-402, miR-403, miR- 447a, miR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828, miR-830, miR-831, miR-831, miR-833a, miR-833a, miR-840, miR-845b, These include, but are not limited to, miR-848, miR-850, miR-853, miR-855, miR-856, miR-864, miR-2933a, miR-2933b, miR-2936, miR-4221, miR-5024, miR-5629, miR-5648, miR-5996, miR-8166, miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f, miR-8177, and miR-8182.
[0336] As noted above, the methods of some embodiments of the present invention involve modifying an endogenous nucleic acid sequence of a plant that encodes an RNA molecule to confer silencing specificity for a plant gene.
[0337] According to one embodiment, if the RNA molecule does not have intrinsic silencing activity, the method further comprises introducing into the plant cell a DNA editing agent that confers silencing specificity of the RNA molecule for a plant gene.
[0338] According to one embodiment, if the RNA molecule has endogenous silencing activity against a native plant gene, the method further comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the RNA molecule toward a plant gene that is different from the native plant gene.
[0339] Methods for altering nucleic acid sequences are discussed in detail below.
[0340] In some embodiments, such as the second model described herein, the nucleic acid sequence of a plant gene is modified to encode a long dsRNA molecule that confers silencing specificity to a pest gene. In some embodiments, the nucleic acid sequence encodes an RNA molecule that has endogenous silencing activity for the native plant gene, such that the modification results in a silencing RNA with novel silencing activity (e.g., for a pest gene) in addition to or instead of the endogenous silencing activity. Each possibility represents a separate embodiment of the present invention.
[0341] Thus, according to another aspect of the present invention there is provided a method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, comprising the steps of: (a) selecting a nucleic acid sequence in the genome of a plant that encodes a silencing molecule having a plant gene as a target, the silencing molecule being capable of recruiting an RNA-dependent RNA polymerase (RdRp); (b) modifying the nucleic acid sequence of the plant gene to confer silencing specificity for a pest gene, thereby inhibiting transcription of the plant gene with the silencing specificity; the substance forms base complementarity with the silencing molecule capable of recruiting the RdRp to produce a long dsRNA molecule capable of silencing the pest gene; thereby producing in the plant cell a long dsRNA molecule capable of silencing the pest gene; A method is provided that includes:
[0342] According to one embodiment, the plant gene does not encode a molecule with endogenous silencing activity.
[0343] According to one embodiment, if the plant gene does not encode a molecule with endogenous silencing activity, the method further comprises introducing into the plant cell a DNA editing agent that confers silencing specificity of the plant gene for a pest gene.
[0344] According to one embodiment, the plant gene encodes a molecule that has endogenous silencing activity against the native plant gene.
[0345] According to one embodiment, the plant gene with endogenous silencing activity is selected from microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous translocating RNA.
[0346] According to some embodiments, the plant gene encoding an RNA with endogenous silencing activity encodes a phased secondary siRNA generating molecule.
[0347] As used herein, the phrase "phased secondary siRNA-generating molecule" refers to an RNA transcript that can form base complementarity with a primary silencing molecule (e.g., miRNA) that recruits an RNA-dependent RNA polymerase (RdRp), thereby being transcribed into a long dsRNA molecule, which is then processed into a secondary silencing RNA molecule (i.e., phased RNA). According to some embodiments, the phased secondary siRNA-generating molecule is selected from the group consisting of tasiRNA and phasiRNA.
[0348] According to some embodiments, the phased secondary siRNA-generated molecule can be processed into multiple secondary silencing RNA molecules, i.e., at least two secondary silencing RNA molecules. According to some embodiments, modifying the gene encoding the phased secondary siRNA-generated molecule comprises modifying only a portion of the secondary silencing RNA molecules formed by the processing of the phased secondary siRNA-generated molecule. According to certain embodiments, modifying the gene encoding the phased secondary siRNA-generated molecule comprises modifying only one secondary silencing RNA molecule formed by the processing of the phased secondary siRNA-generated molecule. According to some embodiments, modifying the gene encoding the phased secondary siRNA-generated molecule comprises modifying at least one secondary silencing RNA molecule formed by the processing of the phased secondary siRNA-generated molecule. According to other embodiments, modifying the gene encoding the phased secondary siRNA-generated molecule comprises modifying all secondary silencing RNA molecules formed by the processing of the phased secondary siRNA-generated molecule. Without being bound by theory or mechanism, the gene encoding the phased secondary siRNA generating molecule may be silencing specificity of only one of the secondary silencing RNA molecules to a new target (e.g., the R gene of a pest). NA) is sufficient to induce at least partial silencing of this new target.
[0349] According to some embodiments, the length of the sequence of the modified secondary silencing RNA molecule is the length of the secondary silencing molecule in the target pest (e.g., if the tasiRNA is processed in the pest to form a 24-nt secondary sRNA, the sequence of the gene encoding the phased secondary siRNA-generating molecule in the plant cell is modified so that at least one 24-nt sequence targets the RNA of the selected pest). According to some embodiments, modifying the nucleic acid sequence of a plant gene (e.g., a plant gene encoding a phased secondary siRNA-generating molecule) to confer silencing specificity for a pest gene comprises modifying a 21-30 nt, optionally a 24 nt, or even a 30 nt sequence in the plant gene such that the encoded sequence is substantially complementary to the RNA encoded by the pest gene. Each possibility represents a separate embodiment of the present invention. Without being bound by theory or mechanism, it is believed that modifying the gene encoding the phased secondary siRNA-generating molecule so that 30 nt of the encoded sequence is complementary to the pest gene ensures that processing of the long dsRNA (which may differ from processing in plant genes) yields secondary RNA molecules with functional silencing activity in the pest.
[0350] According to a particular embodiment, the plant gene with endogenous silencing activity is a trans-acting siRNA generating (TAS) molecule.
[0351] According to a particular embodiment, the plant gene comprises a binding site for the silencing molecule.
[0352] According to a particular embodiment, the plant gene comprises a binding site for the miRNA molecule.
[0353] According to certain embodiments, the miRNAs include miR-156a, miR-156c, miR-162a, miR-162b, miR-167d, miR-169b, miR-173, miR-393a, miR-393b, miR-402, miR-403, miR-447a, miR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828, miR-830, miR-831, miR-833a, miR-833b, miR-840, miR-841, miR-842, miR-843, miR-844, miR-845, miR-846, miR-847, miR-848, miR-849, miR-850, miR-851, miR-852, miR-853, miR-854, miR-855, miR-856, miR-857, miR-858, miR-859, miR-860, miR-861, miR-862, miR-863, miR-864, miR-865, miR-866, miR-867, miR-868, miR-869, miR-870, miR-871, miR-872, miR-873, miR-874, miR-875, miR-876, miR-877, miR-878, miR-879, miR-880, miR-881, miR-882, miR-883, miR-884, miR-885, miR-886, miR-88 Examples of miR-45b, miR-848, miR-850, miR-853, miR-855, miR-856, miR-864, miR-2933a, miR-2933b, miR-2936, miR-4221, miR-5024, miR-5629, miR-5648, miR-5996, miR-8166, miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f, miR-8177, and miR-8182.
[0354] According to one embodiment, if the plant gene encodes a molecule with endogenous silencing activity, the method further comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the plant gene toward a pest gene that is different from the native plant gene.
[0355] As used herein, the term "redirecting silencing specificity" refers to reprogramming the original specificity of an RNA molecule or a plant gene transcript toward a non-natural target of the RNA molecule or plant gene transcript. Thus, the original specificity of the RNA molecule or plant transcript is destroyed (i.e., loss of function), and the new specificity is directed toward a target (i.e., plant or pest RNA, respectively) different from the natural target, i.e., gain of function. When an RNA molecule or plant gene transcript has endogenous silencing activity, It will be appreciated that if the gene does not have a function, then only a gain of function occurs.
[0356] As used herein, the term "native target RNA" refers to the RNA sequence that an RNA molecule (e.g., a non-coding RNA molecule, e.g., a silencing molecule) naturally binds to.Therefore, native plant RNA (i.e., the transcript of a native plant gene) is considered by those skilled in the art to be the natural substrate (i.e., the target) of an RNA molecule (e.g., a non-coding RNA, e.g., a silencing molecule).
[0357] As used herein, the term "plant RNA" or "plant target RNA" refers to an RNA sequence (coding or non-coding) that is not naturally associated with an RNA molecule (e.g., a non-coding RNA, e.g., a silencing molecule). Thus, the plant RNA (i.e., a transcript of a plant gene) is not a natural substrate (i.e., a target) for the RNA molecule (e.g., a non-coding RNA, e.g., a silencing molecule).
[0358] As used herein, the term "pest RNA" or "pest target RNA" refers to an RNA sequence that is silenced by a designed plant RNA and / or by a generated dsRNA molecule and a secondary small RNA (generated by processing of the dsRNA). Thus, the pest RNA (i.e., a transcript of a pest gene) is not a natural substrate (i.e., a target) of the plant RNA or dsRNA or secondary small molecule.
[0359] As used herein, the phrase "silencing a gene" refers to the absence or observable reduction of mRNA and / or protein products from a target gene (e.g., by co-transcriptional and / or post-transcriptional gene silencing). Thus, compared to a gene not targeted by a designed RNA molecule of the present invention, the target gene may be silenced by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%.
[0360] The silencing results can be confirmed by examining the external characteristics of plant cells or whole plants or other organisms (e.g., pests) that take up the engineered RNA from the plant (as further discussed herein), or by biochemical techniques.
[0361] It will be understood that the designed RNA molecules of some embodiments of the present invention may have some off-target specific effect(s), so long as they do not affect agriculturally valuable traits (e.g., plant biomass, yield, growth, etc.).
[0362] Specific binding of an RNA molecule (e.g., a silencing molecule) to a target RNA can be determined by computational algorithms (e.g., BLAST) and verified by methods including, for example, Northern blot, in situ hybridization, QuantiGene Plex Assay, etc.
[0363] According to one embodiment, when the RNA molecule is an siRNA or is processed into an siRNA, the complementarity is in the range of 90-100% (eg, 100%) to its target sequence.
[0364] According to one embodiment, when the RNA molecule is an miRNA or piRNA or is processed into an miRNA or piRNA, the complementarity is in the range of 33 to 100% to its target sequence.
[0365] According to one embodiment, when the RNA molecule is miRNA, the complementarity of the seed sequence (i.e., the 2nd to 8th nucleotides from the 5' end) to its target sequence is 85 to 100% ( For example, in the range of 100%).
[0366] According to one embodiment, the complementarity to the target sequence is at least about 33% (e.g., 33% of 21-28 nt) of the processed small RNA form. Thus, for example, if the RNA molecule is an miRNA, 33% of the mature miRNA sequence (e.g., 21 nt) contains seed complementarity (e.g., 7 nt of 21 nt).
[0367] According to one embodiment, the complementarity to the target sequence is at least about 45% (e.g., 45% of 21-28 nt) of the processed small RNA form. Thus, for example, if the RNA molecule is an miRNA, 45% of the mature miRNA sequence (e.g., 21 nt) contains seed complementarity (e.g., 9-10 nt of the 21 nt).
[0368] According to one embodiment, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have less than about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementarity to a sequence of the plant RNA or pest RNA, respectively.
[0369] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 99% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0370] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 98% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0371] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 97% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0372] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 96% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0373] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 95% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0374] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 94% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0375] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 93% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0376] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 92% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0377] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically are selected to have 91% or less complementarity to a sequence of plant RNA or pest RNA, respectively.
[0378] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 90% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0379] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 85% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0380] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 50% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0381] According to certain embodiments, the RNA molecule or plant RNA (i.e., before modification) is typically selected to have 33% or less complementarity to the sequence of the plant RNA or pest RNA, respectively.
[0382] According to one embodiment, the RNA molecule (e.g., RNA silencing molecule) or plant RNA is designed to have at least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity to a sequence of the plant RNA or pest RNA, respectively.
[0383] According to certain embodiments, the RNA molecule (e.g., RNA silencing molecule) or plant RNA is designed to have at least 33% complementarity to the plant RNA or pest RNA, respectively (e.g., 85-100% seed match).
[0384] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 40% complementarity to the plant RNA or pest RNA, respectively.
[0385] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 45% complementarity to the plant RNA or pest RNA, respectively.
[0386] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 50% complementarity to the plant RNA or pest RNA, respectively.
[0387] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 55% complementarity to the plant RNA or pest RNA, respectively.
[0388] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 60% complementarity to the plant RNA or pest RNA, respectively.
[0389] In certain embodiments, RNA molecules (e.g., RNA silencing molecules) or plant The RNA is designed to have at least 70% complementarity to the plant RNA or pest RNA, respectively.
[0390] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 80% complementarity to the plant RNA or pest RNA, respectively.
[0391] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 85% complementarity to the plant RNA or pest RNA, respectively.
[0392] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 90% complementarity to the plant RNA or pest RNA, respectively.
[0393] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 91% complementarity to the plant RNA or pest RNA, respectively.
[0394] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 92% complementarity to the plant RNA or pest RNA, respectively.
[0395] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 93% complementarity to the plant RNA or pest RNA, respectively.
[0396] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 94% complementarity to the plant RNA or pest RNA, respectively.
[0397] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 95% complementarity to the plant RNA or pest RNA, respectively.
[0398] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 96% complementarity to the plant RNA or pest RNA, respectively.
[0399] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 97% complementarity to the plant RNA or pest RNA, respectively.
[0400] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 98% complementarity to the plant RNA or pest RNA, respectively.
[0401] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have at least 99% complementarity to the plant RNA or pest RNA, respectively.
[0402] According to certain embodiments, the RNA molecule (eg, RNA silencing molecule) or plant RNA is designed to have 100% complementarity to the plant RNA or pest RNA, respectively.
[0403] According to certain embodiments, the RNA molecule or antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity to the sequence of the pest RNA.
[0404] According to certain embodiments, the RNA molecule or antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 33% complementarity to the sequence of the pest RNA (e.g., 85-100% seed match).
[0405] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 40% complementarity to the sequence of the pest RNA.
[0406] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 45% complementarity to the sequence of the pest RNA.
[0407] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (eg, the product synthesized by the RdRp) is designed to have at least 50% complementarity to the sequence of the pest RNA.
[0408] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (eg, the product synthesized by the RdRp) is designed to have at least 55% complementarity to the sequence of the pest RNA.
[0409] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 60% complementarity to the sequence of the pest RNA.
[0410] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 70% complementarity to the sequence of the pest RNA.
[0411] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 80% complementarity to the sequence of the pest RNA.
[0412] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 85% complementarity to the sequence of the pest RNA.
[0413] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 90% complementarity to the sequence of the pest RNA.
[0414] According to certain embodiments, the RNA molecule or the antisense strand of the plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 91% complementarity to the sequence of the pest RNA.
[0415] According to certain embodiments, the RNA molecule or antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 92% complementarity to the sequence of the pest RNA.
[0416] According to certain embodiments, the RNA molecule or the antisense strand of the plant RNA (eg, the product synthesized by the RdRp) is designed to have at least 93% complementarity to the sequence of the pest RNA.
[0417] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 94% complementarity to the sequence of the pest RNA.
[0418] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (eg, the product synthesized by the RdRp) is designed to have at least 95% complementarity to the sequence of the pest RNA.
[0419] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., the product synthesized by the RdRp) is designed to have at least 96% complementarity to the sequence of the pest RNA.
[0420] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 97% complementarity to the sequence of the pest RNA.
[0421] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (e.g., a product synthesized by an RdRp) is designed to have at least 98% complementarity to the sequence of the pest RNA.
[0422] According to certain embodiments, the RNA molecule or the antisense strand of a plant RNA (eg, the product synthesized by the RdRp) is designed to have at least 99% complementarity to the sequence of the pest RNA.
[0423] According to certain embodiments, the RNA molecule or the antisense strand of the plant RNA (e.g., the product synthesized by the RdRp) is designed to have 100% complementarity to the sequence of the pest RNA.
[0424] A DNA editing agent is used to modify a gene encoding an RNA molecule or plant RNA (e.g., an RNA silencing molecule) to induce the silencing activity and / or specificity of the RNA molecule or plant RNA, or to redirect the silencing activity and / or specificity of the RNA molecule or plant RNA (e.g., an RNA silencing molecule) towards a plant RNA or a pest RNA.
[0425] Below are descriptions of various non-limiting examples of methods and DNA editing agents used to introduce nucleic acid changes into genes, as well as agents to do so that can be used in accordance with certain embodiments of the present disclosure.
[0426] Genome editing using engineered endonucleases—This approach refers to a reverse genetic method in which artificially engineered or modified naturally occurring nucleases are used to cut at desired locations in the genome, typically creating specific double-strand breaks (DSBs), which are then repaired by endogenous cell processes such as homologous recombination (HR) or non-homologous end joining (NHEJ). NHEJ directly joins the DNA ends of a double-strand break (DSB) with or without minimal end trimming, whereas HR utilizes a homologous donor sequence as a template (i.e., a sister chromatid formed during S phase) to regenerate / copy the missing DNA sequence at the break site. To introduce specific nucleotide modifications into genomic DNA, a donor DNA repair template (exogenously provided single-stranded or double-stranded DNA) containing the desired sequence must be present during HR.
[0427] Genome editing cannot be performed using conventional restriction endonucleases because most restriction enzymes target a few base pairs in DNA, and these sequences are often found in many locations throughout the genome, resulting in multiple cuts that are not limited to the desired location. To overcome this challenge and create site-specific single- or double-strand breaks (DSBs), several different classes of nucleases have been discovered and bioengineered. These include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR / Cas9 system.
[0428] Meganucleases—Meganucleases (also known as homing nucleases) are generally classified into at least four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys Box family, and the HNH and PD-(D / E)xK families, which are related to EDxHD enzymes and are considered by some to be separate families. These families are characterized by structural motifs that influence catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases differ significantly from each other with respect to conserved structural elements and, therefore, DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having very long recognition sequences (>14 bp), which allow for exceptional specificity for cleavage at the natural, desired site.
[0429] This can be used to create site-specific double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this problem, using mutagenesis and high-throughput screening methods, meganuclease variants that recognize unique sequences have been created. For example, various meganucleases have been fused to create hybrid enzymes that recognize new sequences.
[0430] Alternatively, the DNA-interacting amino acids of the meganuclease can be altered to design sequence-specific meganucleases (see, e.g., U.S. Patent No. 8,021,867). Meganucleases can be engineered using methods described, for example, in Certo, MT et al. Nature Methods (2012) 9:073-975, U.S. Patent Nos. 8,304,222, 8,021,867, 8,119,381, 8,124,369, 8,129,134, 8,133,697, 8,143,015, 8,143,016, and U.S. Patent Nos. 8,143,017, 8,143,018, 8,143,019, and 8,153,020, the entire contents of each of which are incorporated herein by reference. Meganucleases with site-specific cleavage properties can be designed using the methods described in US Pat. Nos. 48,098, ...
[0431] ZFNs and TALENs—Two different classes of engineered nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven effective in creating targeted double-strand breaks (DSBs) ( Christian et al., 2010 ; Kim et al., 1996 ; Li et al., 2011 ; Mahfouz et al., 2011 ; Miller et al., 2010 ).
[0432] Essentially, ZFN and TALEN restriction endonuclease technologies utilize a nonspecific DNA-cleaving enzyme linked to a specific DNA-binding domain (either a series of zinc finger domains or TALE repeats, respectively). Typically, a restriction enzyme is selected whose DNA recognition and cleavage sites are separated from each other. The cleavage portion is then ligated to the DNA-binding domain, thereby resulting in an endonuclease with extremely high specificity for the desired sequence. An exemplary restriction enzyme with such properties is Fokl. Furthermore, Fokl has the advantage of requiring dimerization for nuclease activity, meaning that specificity is dramatically enhanced when each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases have been engineered to function only as heterodimers and have high catalytic activity. Nucleases that function as heterodimers avoid the potential for unwanted homodimer activity, thereby enhancing the specificity of double-strand breaks (DSBs).
[0433] Thus, for example, to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind to adjacent sequences at the target site. When transiently expressed in cells, the nuclease binds to its target site, and the FokI domain heterodimerizes to create double-strand breaks (DSBs). Repair of these double-strand breaks (DSBs) through the non-homologous end joining (NHEJ) pathway often results in small deletions or small sequence insertions (indels). Because each repair performed by NHEJ is unique, a single nuclease pair can be used to create a variety of alleles with different insertions or deletions at the target site.
[0434] Generally, NHEJ is relatively accurate (about 85% of DSBs in human cells are repaired by NHEJ within about 30 minutes of detection). Gene editing relies on incorrect NHEJ because if the repair were accurate, the nuclease would continue to cut until the repair product becomes mutagenic and the recognition / cleavage site / PAM motif is lost / mutated, or until the transiently introduced nuclease is no longer present.
[0435] Typically, deletions range in length from a few base pairs to several hundred base pairs; however, the simultaneous use of two pairs of nucleases has been successful in generating larger deletions in cell culture (Carlson et al., 2012; Lee et al., 2010). Furthermore, the introduction of a DNA fragment homologous to the target region in conjunction with the nuclease pair can repair double-strand breaks (DSBs) via homologous recombination (HR), generating specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).
[0436] Although the nuclease moieties of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases lies in their DNA recognition peptides. Cys2-His2 zinc fingers, and TALENs rely on TALEs. Both of these DNA-recognition peptide domains are characterized by naturally occurring combinations in proteins. Cys2-His2 zinc fingers are typically found in repeats spaced 3 bp apart and in diverse combinations in various nucleic acid-interacting proteins. TALEs, on the other hand, are found in repeats with a 1:1 recognition ratio between amino acids and recognized nucleotide pairs. Because both zinc fingers and TALEs occur in a repetitive pattern, various combinations can be tried to generate diverse sequence specificities. Approaches for generating site-specific zinc finger endonucleases include, for example, modular assembly (arrangement and binding of zinc fingers correlated with triplet sequences to cover the required sequence), OPEN (low-stringency selection of peptide domains versus triplet nucleotides, followed by high-stringency selection of peptide combinations versus final targets in a bacterial system), and bacterial one-hybrid screening of zinc finger libraries, among others. ZFNs are designed, for example, at Sangamo Biosciences™ (Richmond, Calif.), and are also commercially available.
[0437] Methods for designing and obtaining TALENs are described, for example, in Reyon et al. Nature Biotechnology 2012 May;30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29:143-148; Cermak et al. Nucleic Acids Research (2011) 39(12):e82, and Zhang et al. Nature Biotechnology (2011) 29(2):149-53. A recently developed web-based program named Mojo Hand has been introduced by Mayo Clinic to design TAL and TALEN constructs for genome editing applications (accessible through www(dot)talendesign(dot)org). TALENs are designed, for example, by Sangamo Biosciences™ (Richmond, CA), and can also be commercially obtained.
[0438] T-GEE System (Target Gene Genome Editing Engine) - A programmable nucleoprotein molecular complex containing a polypeptide moiety and a specificity-conferring nucleic acid (SCNA) is provided that can assemble in vivo in a target cell and interact with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex can specifically modify and / or edit a target site within the target nucleic acid sequence and / or modify the function of the target nucleic acid sequence. The nucleoprotein composition includes (a) a polynucleotide molecule encoding a chimeric polypeptide and including (i) a functional domain capable of modifying the target site and (ii) a linking domain capable of interacting with the specificity-conferring nucleic acid, and (b) a specificity-conferring nucleic acid (SCNA) that includes (i) a nucleotide sequence complementary to a region of the target nucleic acid adjacent to the target site and (ii) a recognition region capable of specifically binding to the linking domain of the polypeptide. Through base pairing between the specificity-conferring nucleic acid and the target nucleic acid, the composition enables precise, reliable, and cost-effective modification of a predetermined nucleic acid sequence target with high specificity and the binding ability of the molecular complex to the target nucleic acid. The compositions have low genotoxicity, are modularly assembled, utilize a single platform without customization, are practical for independent use outside of specialized core facilities, have short development times, and are low cost.
[0439] CRISPR-Cas systems and all their variants (also referred to herein as "CRISPR") - Many bacteria and archaea contain endogenous RNA-based adaptive immune systems that can degrade the nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeats (CRISPR) nucleotide sequences that generate the RNA components, and CRISPR-associated (CRISPR-Cas) sequences that encode the protein components. The CRISPR / Cas system consists of a Cas9 gene and a CRISPR-specific gene. CRISPR RNA (crRNA) contains short stretches of homology to specific viral and plasmid DNA and acts as a guide to instruct the Cas nuclease to degrade complementary nucleic acids in the corresponding pathogen. Studies of the type II CRISPR / Cas system in Streptococcus pyogenes have shown that three components—the Cas9 nuclease, the crRNA containing 20 base pairs of homology to the target sequence, and the transactivating crRNA (tracrRNA)—form an RNA / protein complex that, when combined, is sufficient for sequence-specific nuclease activity (Jinek et al. Science (2012) 337:816-821).
[0440] Furthermore, it has been demonstrated that synthetic chimeric guide RNAs (gRNAs) composed of a fusion between crRNA and tracrRNA can direct Cas9 to cleave DNA targets complementary to the crRNA in vitro. It has also been demonstrated that transient expression of Cas9 in conjunction with synthetic gRNAs can be used to generate targeted double-strand breaks (DSBs) in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013). al.,2013a,b;Jinek et al.,2013;Mali et al.,2013).
[0441] The CRISPR / Cas system for genome editing contains two distinct components: an sgRNA and an endonuclease, such as Cas9.
[0442] The gRNA (also referred to herein as short guide RNA (sgRNA)) is typically a 20-nucleotide sequence encoding a target homologous sequence (crRNA) in a single chimeric transcript combined with an endogenous bacterial RNA (tracrRNA) that links the crRNA to the Cas9 nuclease. The sgRNA / Cas9 complex is recruited to the target sequence through base pairing between the sgRNA sequence and complementary genomic DNA. For Cas9 to successfully bind, the target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. Binding of the sgRNA / Cas9 complex localizes Cas9 to the target sequence so that it can cleave both strands of DNA, creating a double-strand break (DSB). Similar to ZFNs and TALENs, the double-strand break (DSB) generated by CRISPR / Cas can undergo homologous recombination or NHEJ and is susceptible to specific sequence modification during DNA repair.
[0443] The Cas9 nuclease has two functional domains, RuvC and HNH, which each cleave a different DNA strand. When both of these domains are active, Cas9 creates a double-strand break (DSB) in genomic DNA.
[0444] A major advantage of CRISPR / Cas is its combination of high efficiency and the ability to easily generate synthetic gRNAs. This provides a system that can be easily modified to target modifications at different genomic sites and / or to target different modifications at the same site. Furthermore, protocols have been established that allow for simultaneous targeting of multiple genes. The majority of cells carrying mutations have biallelic mutations in the targeted genes.
[0445] However, the apparent flexibility in base-pairing interactions between the sgRNA sequence and the target sequence in genomic DNA allows Cas9 to cleave even imperfect matches to the target sequence.
[0446] Cas9 enzymes containing a single inactive catalytic domain, either RuvC or HNH. Modified versions of the original are called "nickases." Because they contain only one active nuclease domain, Cas9 nickases cleave only one strand of the target DNA, creating single-strand breaks or "nicks." These single-strand breaks or nicks are repaired mostly by single-strand break repair mechanisms involving proteins such as, but not limited to, PARP (sensor) and the XRCC1 / LIG III complex (ligation). Single-strand breaks (SSBs) generated by topoisomerase I poisons or drugs that trap PARP1 at naturally occurring SSBs can persist and become single-ended DSBs that can only be repaired by HR when cells enter S phase and a replication fork encounters such an SSB. However, two adjacent, opposite-strand nicks introduced by Cas9 nickases are treated as double-strand breaks and are often referred to as "double-nick" CRISPR systems. Double nicks are essentially nonparallel DSBs that, like other DSBs, can be repaired by HR or NHEJ, depending on the desired effect on the gene target and the presence of donor sequences and the stage of the cell cycle (HR is much less abundant and can only occur in the S and G2 phases of the cell cycle). Thus, when reduced off-target effects and specificity are important, using Cas9 nickase to create a double nick by designing two sgRNAs with target sequences in close proximity on opposite strands of genomic DNA would reduce, if not eliminate, these events, because it would create a nick where neither sgRNA alone could alter the genomic DNA.
[0447] A modified version of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9 or dCas9) lacks nuclease activity but can still bind to DNA based on the specificity of the sgRNA. dCas9 can be used as a platform for DNA transcription regulators to activate or repress gene expression by fusing the inactive enzyme to a known regulatory domain. For example, binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.
[0448] Additional variants of Cas9 that can be used in some embodiments of the present invention include, but are not limited to, CasX and Cpf1. The CasX enzyme is smaller in size than Cas9 and comprises a distinct family of RNA-guided genome editors found in bacteria (typically not in humans), making it less likely to provoke an immune system response in humans. CasX also utilizes a different PAM motif than Cas9 and can be used to target sequences lacking the Cas9 PAM motif (see Liu JJ et al., Nature. (2019) 566(7743):218-223). Cpf1, also referred to as Cas12a, is particularly advantageous for editing AT-rich regions, where the Cas9 PAM (NGG) is much less abundant (see Li T et al., Biotechnol Adv. (2019) 37(1):21-27; Murugan K et al., Mol Cell. (2017) 68(1):15-25).
[0449] According to another embodiment, the CRISPR system may be fused to various effector domains, such as a DNA cleavage domain. The DNA cleavage domain can be derived from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which the DNA cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases (e.g., New England (See Biolabs Catalog or Belfort et al. (1997) Nucleic Acids Res.). In exemplary embodiments, the cleavage domain of the CRISPR system is a Fokl endonuclease domain or a modified Fokl endonuclease domain. Another option is to use a homing endonuclease (HE). HEs are small proteins (<300 amino acids) found in bacteria, archaea, and unicellular eukaryotes. A distinctive feature of HEs is that they are different from other parts, such as restriction enzymes. The key feature of HEs is their ability to recognize relatively long sequences (14-40 bp) compared to site-specific endonucleases (4-8 bp). HEs have historically been classified by small, conserved amino acid motifs. At least five such families have been identified: LAGLIDADG; GIY-YIG; HNH; and EDxHD enzymes. The His-Cys Box and PD-(D / E)xK enzymes, which are related to, and are considered by some to be separate families, share a common fold (designated ββα-metallo) in the HNH and His-Cys Box structures, as do the PD-(D / E)xK and EDxHD enzymes. Each family has different catalytic and DNA recognition strategies, making them to varying degrees amenable to genetic engineering for various applications. See, for example, Methods Mol Biol. (2014) 1123:1-26. Exemplary homing endonucleases that can be used in accordance with some embodiments of the present invention include, but are not limited to, I-CreI, I-TevI, I-HmuI, I-PpoI, and I-Ssp68031.
[0450] Modified versions of CRISPR, such as dead CRISPR (dCRISPR endonuclease), can also be used to inhibit CRISPR transcription (CRISPRi) or activate CRISPR transcription (CRISPRa). See, e.g., Kampmann M., ACS Chem Biol. (2018) 13(2):406-416; La Russa MF and Qi LS., Mol Cell Biol. (2015) 35(22):3800-9.
[0451] Other versions of CRISPR that can be used in accordance with some embodiments of the invention include genome editing, which uses components of the CRISPR system, along with other enzymes, to create point mutations directly in a cell's DNA or RNA.
[0452] Thus, according to one embodiment, the editing agent is a DNA or RNA editing agent.
[0453] According to one embodiment, the DNA or RNA editing agent induces base editing.
[0454] The term "base editing," as used herein, refers to introducing point mutations into a cell's DNA or RNA without creating double- or single-stranded DNA breaks.
[0455] In base editing, DNA base editors typically contain a catalytically impaired Cas nuclease fused to a base-modifying enzyme that acts on single-stranded DNA (ssDNA). Upon binding to its target DNA locus, the gRNA base-pairs with the target DNA strand, displacing a small segment of single-stranded DNA in an "R-loop." The DNA bases within this ssDNA bubble are then modified by a base-editing enzyme (e.g., a deaminase enzyme). To improve efficiency in eukaryotic cells, the catalytically impaired nuclease also creates nicks in the unedited DNA strand, inducing the cell to repair the unedited strand using the edited strand as a template.
[0456] Two classes of DNA base editors have been reported: cytosine base editors (CBEs), which convert CG base pairs to TA base pairs, and adenine base editors (ABEs), which convert AT base pairs to GC base pairs. Collectively, CBEs and ABEs can mediate all four possible pairwise mutations (C → T, A → G, T → C, and G → A). Similarly, in RNA, targeted adenosine-to-inosine conversion utilizes both antisense and Cas13-guided RNA targeting methods.
[0457] According to one embodiment, the DNA or RNA editing agent comprises a catalytically inactive endonuclease (e.g., CRISPR-dCas).
[0458] According to one embodiment, the catalytically inactive endonuclease is an inactive Cas9 (e.g., dCas9).
[0459] According to one embodiment, the catalytically inactive endonuclease is an inactive Cas13 (e.g., dCas13).
[0460] According to one embodiment, the DNA or RNA editing agent comprises an enzyme capable of epigenetic editing (i.e., making chemical changes to DNA, RNA, or histone proteins).
[0461] Exemplary enzymes include, but are not limited to, DNA methyltransferases, methylases, and acetyltransferases. More specifically, exemplary enzymes include, for example, DNA (cytosine-5) methyltransferase 3A (DNMT3a), histone acetyltransferase p300, 10-11 translocation methylcytosine dioxygenase 1 (TET1), lysine (K)-specific demethylase 1A (LSD1), and calcium and integrin binding protein 1 (CIB1).
[0462] In addition to catalytically deficient nucleases, the DNA or RNA editing agents of the present invention may also include nucleobase deaminase enzymes and / or DNA glycosylase inhibitors.
[0463] According to certain embodiments, the DNA or RNA editing agent comprises BE1 (APOBEC1-XTEN-dCas9), BE2 (APOBEC1-XTEN-dCas9-UGI), or BE3 (APOBEC-XTEN-dCas9(A840H)-UGI) in conjunction with an sgRNA. APOBEC1 is the full-length or catalytically active fragment of the deaminase, XTEN is a protein linker, UGI is a uracil DNA glycosylase inhibitor that prevents subsequent repair of the U:G mismatch back to a C:G base pair, and dCas9(A840H) is a nickase that nicks only the unedited strand, restoring catalytic activity of the HNH domain and restoring dCas9 to its original state to prime newly synthesized DNA and produce the desired U:A product.
[0464] Additional enzymes that can be used for base editing according to some embodiments of the present invention are set forth in Rees and Liu, Nature Reviews Genetics (2018) 19:770-788, which is incorporated herein by reference in its entirety.
[0465] In addition to the tools available to aid in the selection and / or design of target sequences, numerous bioinformatically determined lists of sgRNAs specific to different genes in different species are publicly available, including, but not limited to, Target Finder from the Feng Zhang Laboratory, Target Finder (E-CRISP) from the Michael Boutros Laboratory, RGEN Tools:Cas-OFFinder, CasFinder: A Flexible Algorithm for Identifying Specific Cas9 Targets in Genomes, and CRISPR Optimal Target Finder.
[0466] To use the CRISPR system, both the sgRNA and Cas endonuclease (e.g., Cas9) must be expressed or present in the target cell (e.g., as a ribonucleoprotein complex). The insertion vector may contain both cassettes on a single plasmid, or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available, such as the px330 plasmid from Addgene (75 Sidney St, Suite 550A, Cambridge, MA 02139). Clustered regularly interspaced short sequences (CRISPR) are used to modify plant genomes. The use of Critical Ion Receptor Repeat (CRISPR)-associated (Cas) guide RNA technology and Cas endonucleases is also disclosed at least in Svitashev et al., 2015, Plant Physiology, 169(2):931-945; Kumar and Jain, 2015, J Exp Bot 66:47-57; and U.S. Patent Application Publication No. 20150082478, the entire contents of which are specifically incorporated by reference herein. Cas endonucleases that can be used to perform DNA editing in conjunction with sgRNAs include, but are not limited to, Cas9, Cpf1 (Zetsche et al., 2015, Cell. 163(3):759-71), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97).
[0467] "Hit-and-run" or "in-out" recombination involves a two-step recombination procedure. In the first step, the desired sequence change is introduced using an insertion vector containing a dual positive / negative selectable marker cassette. The insertion vector contains a single contiguous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at one site within the homologous region and introduced into cells, where positive selection is performed to isolate homologous recombination-mediated events. DNA containing the homologous sequence can be provided as a plasmid or as a single- or double-stranded oligo. These homologous recombinants contain local duplications separated by intervening vector sequences containing the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the overlapping sequences. The duplication is removed by a local recombination event, and depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild-type. Ultimately, the desired modifications are introduced without retaining any exogenous sequences.
[0468] The "double replacement" or "tag and exchange" strategy involves a two-step selection procedure similar to the hit-and-run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a double positive / negative selectable cassette adjacent to the desired mutation site. After introducing the system components into cells and applying positive selection, HR-mediated events can be identified. Next, a second targeting vector containing a region homologous to the desired mutation is introduced into the targeted clone, and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation but excludes unwanted exogenous sequences.
[0469] According to certain embodiments, the DNA editing agent comprises a DNA targeting module (e.g., sgRNA).
[0470] According to certain embodiments, the DNA editing agent does not comprise an endonuclease.
[0471] According to certain embodiments, the DNA editing agent comprises a nuclease (e.g., an endonuclease) and a DNA targeting module (e.g., an sgRNA).
[0472] According to certain embodiments, the DNA editing agent is CRISPR / Cas, e.g., sgRNA and Cas9.
[0473] According to certain embodiments, the DNA editing agent is a TALEN.
[0474] According to certain embodiments, the DNA editing agent is a ZFN.
[0475] According to certain embodiments, the DNA editing agent is a meganuclease.
[0476] According to certain embodiments, the DNA editing agent comprises a CRISPR endonuclease and an sgRNA that directs cleavage of a plant gene.
[0477] In certain embodiments, an oligonucleotide that serves as a template for homology-dependent recombination (HDR) is introduced into a cell together with a DNA editing agent, the oligonucleotide comprising the sequence of a plant gene having nucleotide changes that allow the nucleic acid sequence of the plant gene to be modified to confer silencing specificity for a pest gene.
[0478] According to one embodiment, the DNA editing agent is linked to a reporter to monitor its expression in the plant cell.
[0479] According to one embodiment, the reporter is a fluorescent reporter protein.
[0480] The term "fluorescent protein" refers to a polypeptide that emits fluorescence, typically detectable by flow cytometry, microscopy, or any fluorescent imaging system, and can therefore be used as the basis for selection of cells expressing such a protein.
[0481] Examples of fluorescent proteins that can be used as reporters include, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein (e.g., dsRed, mCherry, RFP). A non-limiting list of fluorescent or other reporters includes proteins that are detectable by luminescence (e.g., luciferase) or colorimetric assays (e.g., GUS). According to certain embodiments, the fluorescent reporter is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.
[0482] A review of new classes of fluorescent proteins and applications can be found in Trends in Biochemical Sciences [Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y. "The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins". Trends in Biochemical Sciences. doi:10.1016 / j.tibs.2016.09.010].
[0483] According to another embodiment, the reporter is an endogenous gene of the plant. An exemplary reporter is the phytoene desaturase gene (PDS3), which encodes one of the key enzymes in the carotenoid biosynthesis pathway. Its silencing results in an albino / albino phenotype. Thus, plants with reduced PDS3 expression have reduced chlorophyll levels, leading to complete albino and dwarfism. Additional genes that can be used in accordance with the present teachings include, but are not limited to, genes involved in crop protection.
[0484] According to another embodiment, the reporter is an antibiotic selection marker. Examples of antibiotic selection markers that can be used as reporters include, but are not limited to, neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Additional marker genes that can be used in accordance with the present teachings include, but are not limited to, gentamicin acetyltransferase (accC3) resistance and bleomycin and phleomycin resistance genes. .
[0485] It will be appreciated that the enzyme NPTII inactivates by phosphorylation many aminoglycoside antibiotics, such as kanamycin, neomycin, genetin (or G418), and paromomycin, of which kanamycin, neomycin, and paromomycin are used in a variety of plant species.
[0486] According to another embodiment, the reporter is a toxic selectable marker. An exemplary toxic selectable marker that can be used as a reporter is, but is not limited to, allyl alcohol selection using the alcohol dehydrogenase (ADH1) gene. ADH1, which contains a group of dehydrogenase enzymes that catalyze the interconversion between alcohol and aldehydes or ketones while simultaneously reducing NAD+ or NADP+, degrades alcoholic toxic substances in tissues. Plants with reduced expression of ADH1 exhibit increased tolerance to allyl alcohol. Therefore, plants with reduced ADH1 are resistant to the toxic effects of allyl alcohol.
[0487] Regardless of the DNA editing agent used, the methods of the invention are used such that a gene encoding an RNA molecule or plant gene (e.g., an RNA silencing molecule) is modified by at least one of a deletion, an insertion, or a point mutation.
[0488] According to one embodiment, the structured region of a non-coding RNA molecule (eg, an RNA silencing molecule) is modified.
[0489] According to one embodiment, the stem region of a non-coding RNA molecule (eg, an RNA silencing molecule) is modified.
[0490] According to one embodiment, the loop region of a non-coding RNA molecule (eg, an RNA silencing molecule) is modified.
[0491] According to one embodiment, the stem and loop regions of a non-coding RNA molecule (eg, an RNA silencing molecule) are modified.
[0492] According to one embodiment, the unstructured region of a non-coding RNA molecule (eg, an RNA silencing molecule) is modified.
[0493] According to one embodiment, the stem and loop regions and unstructured regions of a non-coding RNA molecule (eg, an RNA silencing molecule) are modified.
[0494] According to certain embodiments, the modification comprises a modification of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0495] According to one embodiment, the modification comprises modification of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0496] According to one embodiment, a contiguous nucleic acid sequence (eg, at least 5, 10, 20, 30, 40, 50, 100, 150, 200 bases) may be modified.
[0497] According to one embodiment, for example, 20, 50, 100, 150, 200, 500, 1000 nucleic acids may be discontinuously modified throughout the sequence.
[0498] According to particular embodiments, the modification comprises modification of up to 200 nucleotides.
[0499] According to particular embodiments, the modification comprises modification of up to 150 nucleotides.
[0500] According to particular embodiments, the modification comprises modification of up to 100 nucleotides.
[0501] According to particular embodiments, the modification comprises modification of up to 50 nucleotides.
[0502] According to particular embodiments, the modification comprises modification of up to 25 nucleotides.
[0503] According to particular embodiments, the modification comprises the modification of up to 20 nucleotides.
[0504] According to particular embodiments, the modification comprises modification of up to 15 nucleotides.
[0505] According to particular embodiments, the modification comprises the modification of up to 10 nucleotides.
[0506] According to particular embodiments, the modification comprises modification of up to 5 nucleotides.
[0507] According to one embodiment, the modification depends on the structure of the RNA molecule (eg, the silencing molecule).
[0508] Thus, if the RNA molecule contains non-essential structures (i.e., secondary structures of the RNA silencing molecule that do not play a role in its proper biogenesis and / or function) or is purely dsRNA (i.e., an RNA silencing molecule having complete or nearly complete dsRNA), several modifications (e.g., 20-30 nucleotides, e.g., 1-10 nucleotides, e.g., 5 nucleotides) are introduced to redirect the silencing specificity of the RNA molecule.
[0509] According to another embodiment, if the RNA molecule has an essential structure (i.e., the proper biogenesis and / or activity of the RNA silencing molecule is dependent on its secondary structure), larger modifications (e.g., 100-200 nucleotides, e.g., 50-150 nucleotides, e.g., more than 30 nucleotides and up to 200 nucleotides, 30-200 nucleotides, 35-200 nucleotides, 35-150 nucleotides, 35-100 nucleotides) are introduced to redirect the silencing specificity of the RNA molecule.
[0510] According to one embodiment, the modification is performed such that the recognition / cleavage site / PAM motif of the RNA silencing molecule is modified to eliminate the original PAM recognition site.
[0511] According to certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleic acids in the PAM motif are modified.
[0512] According to one embodiment, the modification comprises an insertion.
[0513] According to certain embodiments, the insertion comprises an insertion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., an RNA silencing molecule).
[0514] According to one embodiment, the insertion comprises an insertion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., RNA silencing molecule).
[0515] According to particular embodiments, the insertion comprises an insertion of up to 200 nucleotides.
[0516] According to particular embodiments, the insertion comprises an insertion of up to 150 nucleotides.
[0517] According to particular embodiments, the insertion comprises an insertion of at most 100 nucleotides.
[0518] According to certain embodiments, the insertion comprises an insertion of up to 50 nucleotides.
[0519] According to certain embodiments, the insertion comprises an insertion of up to 25 nucleotides.
[0520] According to certain embodiments, the insertion comprises an insertion of at most 20 nucleotides.
[0521] According to certain embodiments, the insertion comprises an insertion of at most 15 nucleotides.
[0522] According to particular embodiments, the insertion comprises an insertion of at most 10 nucleotides.
[0523] According to particular embodiments, the insertion comprises an insertion of at most 5 nucleotides.
[0524] According to one embodiment, the modification comprises a deletion.
[0525] According to certain embodiments, the deletion comprises a deletion of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0526] According to one embodiment, the deletion comprises a deletion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., RNA silencing molecule).
[0527] According to certain embodiments, the deletion comprises a deletion of up to 200 nucleotides.
[0528] According to certain embodiments, the deletion comprises a deletion of up to 150 nucleotides.
[0529] According to certain embodiments, the deletion comprises a deletion of up to 100 nucleotides.
[0530] According to certain embodiments, the deletion comprises a deletion of up to 50 nucleotides.
[0531] According to certain embodiments, the deletion comprises a deletion of up to 25 nucleotides.
[0532] According to certain embodiments, the deletion comprises a deletion of up to 20 nucleotides.
[0533] According to certain embodiments, the deletion comprises a deletion of up to 15 nucleotides.
[0534] According to certain embodiments, the deletion comprises a deletion of at most 10 nucleotides.
[0535] According to certain embodiments, the deletion comprises a deletion of up to 5 nucleotides.
[0536] According to one embodiment, the modification comprises a point mutation.
[0537] According to certain embodiments, the point mutation comprises a point mutation of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0538] According to one embodiment, the point mutations comprise point mutations at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0539] According to certain embodiments, the point mutation comprises a point mutation at most 200 nucleotides.
[0540] According to certain embodiments, the point mutation comprises a point mutation at most 150 nucleotides.
[0541] According to certain embodiments, the point mutations comprise point mutations at most 100 nucleotides.
[0542] According to certain embodiments, the point mutations comprise point mutations at most 50 nucleotides.
[0543] According to certain embodiments, the point mutations comprise point mutations at a maximum of 25 nucleotides.
[0544] According to certain embodiments, the point mutations comprise point mutations at a maximum of 20 nucleotides.
[0545] According to certain embodiments, the point mutations comprise point mutations at a maximum of 15 nucleotides.
[0546] According to certain embodiments, the point mutations comprise point mutations in at most 10 nucleotides.
[0547] According to certain embodiments, the point mutations comprise point mutations in at most 5 nucleotides.
[0548] According to one embodiment, the modifications comprise any combination of deletions, insertions, and / or point mutations.
[0549] According to one embodiment, the modification comprises a nucleotide substitution (eg, a nucleotide exchange).
[0550] According to certain embodiments, the replacement comprises a replacement of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides, or about 100 to 200 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0551] According to one embodiment, the nucleotide exchanges comprise nucleotide substitutions at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or at most 250 nucleotides (compared to the native plant RNA or native RNA molecule, e.g., the RNA silencing molecule).
[0552] According to certain embodiments, the nucleotide exchange comprises nucleotide substitutions in up to 200 nucleotides.
[0553] According to certain embodiments, the nucleotide exchange comprises nucleotide substitutions in up to 150 nucleotides.
[0554] According to certain embodiments, the nucleotide exchange comprises nucleotide substitutions in up to 100 nucleotides.
[0555] According to certain embodiments, the nucleotide exchanges comprise nucleotide substitutions in up to 50 nucleotides.
[0556] According to certain embodiments, the nucleotide exchanges comprise nucleotide substitutions in a maximum of 25 nucleotides.
[0557] According to certain embodiments, the nucleotide exchanges comprise nucleotide substitutions in up to 20 nucleotides.
[0558] According to certain embodiments, the nucleotide exchanges comprise nucleotide substitutions in a maximum of 15 nucleotides.
[0559] According to certain embodiments, the nucleotide exchange comprises nucleotide substitutions in a maximum of 10 nucleotides.
[0560] According to certain embodiments, the nucleotide exchange is a nucleotide exchange of up to 5 nucleotides. Contains oxide substitutions.
[0561] According to one embodiment, a gene encoding a plant RNA or RNA molecule (e.g., an RNA silencing molecule) is modified by replacing the sequence of the endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA).
[0562] According to one embodiment, the guide strand of an RNA molecule (e.g., an RNA silencing molecule), such as a miRNA precursor (pri / pre-miRNA) or a siRNA precursor (dsRNA), is modified to preserve the originality of its structure and maintain the same base-pairing profile.
[0563] According to one embodiment, the passenger strand of an RNA molecule (e.g., an RNA silencing molecule), such as a miRNA precursor (pri / pre-miRNA) or a siRNA precursor (dsRNA), is modified to preserve the originality of its structure and maintain the same base-pairing profile.
[0564] As used herein, the term "structural originality" refers to the secondary RNA structure (i.e., base pairing profile). Maintaining structural originality is important for accurate and efficient biogenesis / processing of non-coding RNA molecules (e.g., RNA silencing molecules such as siRNA or miRNA), which are structure-dependent rather than purely sequence-dependent.
[0565] According to one embodiment, an RNA (e.g., an RNA silencing molecule) is modified in the guide strand (silencing strand) to have about 50-100% complementarity to the target RNA (as described above), while the passenger strand is modified to retain the structure of the original (unmodified) RNA (e.g., non-coding RNA).
[0566] According to one embodiment, an RNA sequence (eg, an RNA silencing molecule) is modified so that the seed sequence (eg, in the case of an miRNA, nucleotides 2-8 from the 5' end) is complementary to the target sequence.
[0567] According to certain embodiments, RNA silencing molecules (i.e., RNAi molecules) are designed to retain the originality of their structure and to modify the sequence of the RNAi molecule so that it is recognized by cellular RNAi processing and execution factors.
[0568] According to certain embodiments, RNA molecules, e.g., non-coding RNA molecules (i.e., rRNA, tRNA, lncRNA, snoRNA, etc.), are engineered such that the sequence of the RNAi molecule is modified so that it is recognized by cellular RNAi processing and execution factors.
[0569] It will be appreciated that additional mutations can be introduced by additional editing events (i.e., simultaneously or sequentially).
[0570] The DNA editing agents of the present invention may be introduced into plant cells using DNA delivery methods (e.g., by expression vectors) or using DNA-free methods.
[0571] According to one embodiment, the sgRNA (or any other DNA recognition module used, depending on the DNA editing system used) may be provided to the cell as RNA.
[0572] Therefore, this technology is suitable for RNA transfection (e.g., mRNA + sgRNA transfection). It will be understood that this relates to introducing the DNA editing agent using transient DNA or DNA-free methods, such as transfection (e.g., protein-RNA complex transfection, e.g., Cas9 / sgRNA ribonucleoprotein (RNP) complex transfection) or ribonucleoprotein (RNP) transfection (e.g., protein-RNA complex transfection, e.g., Cas9 / sgRNA ribonucleoprotein (RNP) complex transfection).
[0573] For example, Cas9 can be introduced as a DNA expression plasmid, an in vitro transcript (i.e., RNA), or as a recombinant protein bound to an RNA moiety in a ribonucleoprotein particle (RNP). The sgRNA can be delivered, for example, as a DNA plasmid or as an in vitro transcript (i.e., RNA).
[0574] For example, microinjection (described in Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics (2013) 195:1177-1180, which is incorporated by reference herein), electroporation (described in Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res. (2014) 24:1012-1019, which is incorporated by reference herein), or lipid-mediated transfection using, for example, liposomes (described in Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo," Nat Any method known in the art for RNA or RNP transfection can be used in accordance with the present teachings, such as, but not limited to, those described in U.S. Patent Application Publication No. 20160289675, which is incorporated herein by reference in its entirety.
[0575] One advantage of the RNA transfection method of the present invention is that RNA transfection is essentially transient and vector-free. The RNA transgene can be delivered to cells as a minimal expression cassette and expressed therein without the need for any additional sequences (e.g., viral sequences).
[0576] According to one embodiment, the DNA editing agent of the present invention is introduced into a plant cell using an expression vector.
[0577] The "expression vectors" (also referred to herein as "nucleic acid constructs," "vectors," or "constructs") of some embodiments of the present invention contain additional sequences that render the vector suitable for replication in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
[0578] Constructs useful in the methods according to some embodiments of the present invention can be constructed using recombinant DNA techniques well known to those skilled in the art. The nucleic acid sequence may be inserted into a vector, which may be commercially available, suitable for transformation into plants and for transiently expressing the gene of interest in the transformed cells. The gene construct may be an expression vector in which the nucleic acid sequence is operably linked to one or more regulatory sequences that enable its expression in plant cells.
[0579] According to one embodiment, to express a functional DNA editing agent, if the cleavage module (nuclease) is not an integral part of the DNA recognition unit, the expression vector may encode the cleavage module and the DNA recognition unit (e.g., sgRNA in the case of CRISPR / Cas).
[0580] Alternatively, the cleavage module (nuclease) and the DNA recognition unit (e.g., sgRNA) can be cloned into separate expression vectors. In such cases, at least two different expression vectors must be transformed into the same plant cell.
[0581] Alternatively, if nucleases are not utilized (i.e., not administered to the cells from an exogenous source), a single expression vector may be used to clone and express the DNA recognition units (e.g., sgRNAs).
[0582] Typical expression vectors may contain transcription and translation initiation sequences, transcription and translation terminators and optionally, a polyadenylation signal.
[0583] According to one embodiment, the DNA editing agent comprises a nucleic acid agent encoding at least one DNA recognition unit (e.g., sgRNA) operably linked to a cis-acting regulatory element (e.g., a promoter) active in a plant cell.
[0584] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., sgRNA) are encoded by the same expression vector. Such a vector may contain a single cis-acting regulatory element (e.g., promoter) active in plant cells to express both the nuclease and the DNA recognition unit. Alternatively, the nuclease and the DNA recognition unit may each be operably linked to a cis-acting regulatory element (e.g., promoter) active in plant cells.
[0585] According to one embodiment, the nuclease (e.g., endonuclease) and the DNA recognition unit (e.g., sgRNA) are encoded from different expression vectors, each operably linked to a cis-acting regulatory element (e.g., a promoter) active in plant cells.
[0586] As used herein, the phrases "plant-expressible" or "active in a plant cell" refer to a promoter sequence (including any additional regulatory elements attached to or contained within it) that is capable of at least inducing, conferring, activating, or enhancing expression in a cell, tissue, or organ of a plant, preferably a cell, tissue, or organ of a monocotyledonous or dicotyledonous plant.
[0587] The plant promoter used may be a constitutive promoter, a tissue-specific promoter, an inducible promoter, a chimeric promoter, or a developmentally-regulated promoter.
[0588] Examples of preferred promoters useful in the methods of some embodiments of the present invention are provided in Tables I, II, III, and IV.
[0589] [Table 1]
[0590] [Table 2]
[0591] [Table 3]
[0592] [Table 4-1]
[0593] [Table 4-2]
[0594] Inducible promoters are promoters that are induced in specific plant tissues, depending on the developmental stage, or by specific stimuli such as light, temperature, chemicals, drought, high salinity, osmotic shock, stress conditions including oxidant conditions, or pathogenicity. Examples of inducible promoters include, but are not limited to, the light-inducible promoter derived from the pea rbcS gene, the promoter derived from the alfalfa rbcS gene, the promoters DRE, MYC, and MYB that are active under drought, the promoters INT, INPS, prxEa, Ha hsp17.7G4, and RD21 that are active under high salinity and osmotic stress, and the promoters hsr203J and str246C that are active under pathogenic stress.
[0595] According to one embodiment, the promoter is a pathogen-inducible promoter. These promoters direct gene expression in plants after infection with pathogens such as bacteria, fungi, viruses, nematodes, and insects. Such promoters include those derived from pathogenesis-related proteins (PR proteins) that are induced after pathogen infection; for example, PR proteins, SAR proteins, β-1,3-glucanases, chitinases, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathogens. 1 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116.
[0596] According to one embodiment, when more than one promoter is used in an expression vector, the promoters are identical (eg, all identical, at least two identical).
[0597] According to one embodiment, when more than one promoter is used in an expression vector, the promoters are different (eg, at least two are different, all are different).
[0598] According to one embodiment, the promoter in the expression vector includes, but is not limited to, CaMV 35S, 2x CaMV 35S, CaMV 19S, ubiquitin, AtU626, or TaU6.
[0599] According to a particular embodiment, the promoter of the expression vector comprises a 35S promoter.
[0600] According to a particular embodiment, the promoter of the expression vector comprises a U6 promoter.
[0601] Expression vectors may contain transcription and translation initiation sequences, transcription and translation terminator sequences, and optionally, a polyadenylation signal.
[0602] According to certain embodiments, the expression vector comprises a termination sequence, such as, but not limited to, a termination sequence such as a G7 termination sequence, an AtuNos termination sequence, or a CaMV-35S termination sequence.
[0603] Plant cells can be stably or transiently transformed with the nucleic acid constructs of some embodiments of the present invention. In stable transformation, the nucleic acid molecules of some embodiments of the present invention are integrated into the plant genome, thereby representing a stable and heritable trait. In transient transformation, the nucleic acid molecules are expressed in the transformed cells but are not integrated into the genome, thereby representing a transient trait.
[0604] Various methods exist for introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276).
[0605] The basic methods for stably integrating exogenous DNA into plant genomic DNA include two main approaches: (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L.K., Academic Publishers, San Diego, Calif. (1989) pp. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S., and Arntzen, C.J., Butterworth Publishers, Boston, Massachusetts. s.(1989)pp.93-112. (ii) Direct uptake of DNA, including: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, LK, Academic Publishers, San Diego, Calif. (1989) pp. 52-68; direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio / Technology 6: 1072-1074; DNA uptake induced by brief electric shock to plant cells: Zhang et al. Plant Cell Rep. (1988) 7: 379-384; Fromm et al. Nature (1986) 319: 791-793; DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio / Technology (1988) 6: 559-563; McCabe et al. al. Bio / Technology (1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by use of a micropipette system: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fiber or silicon carbide whisker transformation of cell cultures, embryos, or callus tissue, U.S. Patent No. 5,464,765, or by directly incubating DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, GP and Mantell, SH and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.
[0606] The Agrobacterium system involves the use of a plasmid vector containing a defined DNA segment that is integrated into the plant's genomic DNA. Methods for inoculating plant tissue vary depending on the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure, which can be performed with any tissue explant, providing an excellent source for initiating whole plant differentiation. Horsch et al., Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) pp. 1-9. An adjunct approach uses the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is particularly viable for creating transgenic dicotyledonous plants.
[0607] According to one embodiment, an Agrobacterium-free expression method is used to introduce the foreign gene into the plant cell. According to one embodiment, the Agrobacterium-free expression method is transient. According to a particular embodiment, a bombardment method is used to introduce the foreign gene into the plant cell. According to another particular embodiment, plant root bombardment is used to introduce the foreign gene into the plant cell. Exemplary bombardment methods that can be used according to some embodiments of the present invention are discussed in the Examples section below.
[0608] Additionally, various cloning kits or gene synthesis can be used in accordance with the teachings of some embodiments of the present invention.
[0609] According to one embodiment, the nucleic acid construct is a binary vector. Examples of binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen, or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol. 25, 989 (1 994) and Hellens et al, Trends in Plant Science 5,446 (2000)).
[0610] Examples of other vectors used in other methods of DNA delivery (e.g., transfection, electroporation, bombardment, viral inoculation, etc., as discussed below) include pGE-sgRNA (Zhang et al. Nat. Comms. 2016 7:12697), pJIT163-Ubi-Cas9 (Wang et al. Nat. Biotechnol 2004 32,947-951), pICH47742::2x35S-5'UTR-hCas9(STOP)-NOST (Belhan et al. Plant Methods 2013 11;9(1):39), pAHC25 (Christensen, A.H. & P.H. Quail, 1996. Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants. Transgenic Research 5:213-218), pHBT-sGFP(S65T)-NOS(Sheen et al.Protein phosphatase activity is required for light-inducible gene expression in maize,EMBO J.12(9),3497-3505(1993).
[0611] According to one embodiment, the methods of some embodiments of the present invention further comprise introducing a donor oligonucleotide into the plant cell.
[0612] According to one embodiment, when the modification is an insertion, the method further comprises introducing a donor oligonucleotide into the plant cell.
[0613] According to one embodiment, when the modification is a deletion, the method further comprises introducing a donor oligonucleotide into the plant cell.
[0614] According to one embodiment, when the modification is a deletion and insertion (e.g., an exchange), the method further comprises introducing a donor oligonucleotide into the plant cell.
[0615] According to one embodiment, when the modification is a point mutation, the method further comprises introducing a donor oligonucleotide into the plant cell.
[0616] As used herein, the term "donor oligonucleotide" or "donor oligo" refers to an exogenous nucleotide, i.e., a nucleotide that is introduced externally into a plant cell to produce a precise change in the genome. According to one embodiment, the donor oligonucleotide is synthetic.
[0617] According to one embodiment, the donor oligo is an RNA oligo.
[0618] According to one embodiment, the donor oligo is a DNA oligo.
[0619] According to one embodiment, the donor oligo is a synthetic oligo.
[0620] According to one embodiment, the donor oligonucleotide comprises a single-stranded donor oligonucleotide (ssODN).
[0621] According to one embodiment, the donor oligonucleotide is a double-stranded donor oligonucleotide. (dsODN).
[0622] According to one embodiment, the donor oligonucleotide comprises double-stranded DNA (dsDNA).
[0623] According to one embodiment, the donor oligonucleotide comprises a double-stranded DNA-RNA duplex (DNA-RNA duplex).
[0624] According to one embodiment, the donor oligonucleotide comprises a double-stranded DNA-RNA hybrid.
[0625] According to one embodiment, the donor oligonucleotide comprises a single-stranded DNA-RNA hybrid.
[0626] According to one embodiment, the donor oligonucleotide comprises single-stranded DNA (ssDNA).
[0627] According to one embodiment, the donor oligonucleotide comprises double-stranded RNA (dsRNA).
[0628] According to one embodiment, the donor oligonucleotide comprises single-stranded RNA (ssRNA).
[0629] According to one embodiment, the donor oligonucleotide comprises the DNA or RNA sequence for exchange (as described above).
[0630] According to one embodiment, the donor oligonucleotide is provided in a non-expression vector format or oligo.
[0631] According to one embodiment, the donor oligonucleotide comprises a DNA donor plasmid (e.g., a circular or linearized plasmid).
[0632] According to one embodiment, the donor oligonucleotide has a nucleotide sequence of about 50 to 5000, about 100 to 5000, about 250 to 5000, about 500 to 5000, about 750 to 5000, about 1000 to 5000, about 1500 to 5000, about 2000 to 5000, about 2500 to 5000, about 3000 to 5000, about 4000 to 5000, about 50-4000, approx. 100-4000, approx. 250-4000, approx. 500-4000, approx. 750-4000, approx. 1000-4000, approx. 1500-4000, approx. 2000-4000, approx. 2500-4000, approx. 3000-4000, approx. 50-3000, approx. 100-3000, approx. 250-3000, approx. 500-300 0, approx. 750-3000, approx. 1000-3000, approx. 1500-3000, approx. 2000-3000, approx. 50-2000, approx. 100-2000, approx. 250-2000, approx. 500-2000, approx. 750-2000, approx. 1000-2000, approx. 1500-2000, approx. 50-1000, approx. 100-1000, approx. 250- It contains about 1000, about 500 to 1000, about 750 to 1000, about 50 to 750, about 150 to 750, about 250 to 750, about 500 to 750, about 50 to 500, about 150 to 500, about 200 to 500, about 250 to 500, about 350 to 500, about 50 to 250, about 150 to 250, or about 200 to 250 nucleotides.
[0633] According to certain embodiments, the donor oligonucleotide, including ssODN (eg, ssDNA or ssRNA), comprises about 200-500 nucleotides.
[0634] According to certain embodiments, the donor oligonucleotide, including a dsODN (eg, a dsDNA or a dsRNA), comprises between about 250 and 5000 nucleotides.
[0635] According to one embodiment, to genetically replace an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA), an expression vector, ssODN (e.g., ssDNA or ssRNA), or dsODN (e.g., dsDNA or dsRNA) need not be expressed in the plant cell but can serve as a non-expressing template. According to certain embodiments, in such cases, only the DNA editing agent (e.g., Cas9 / sgRNA module) needs to be expressed when provided in DNA form.
[0636] According to some embodiments, a DNA editing agent (e.g., a gRNA) may be introduced into a eukaryotic cell with or without (e.g., an oligonucleotide donor DNA or RNA as discussed herein) to gene-edit an endogenous RNA molecule (e.g., an RNA silencing molecule) without the use of nucleases.
[0637] According to one embodiment, the donor oligonucleotide is introduced into the plant cell using any of the methods described above (e.g., using an expression vector or RNP transfection).
[0638] According to one embodiment, the sgRNA and DNA donor oligonucleotide are co-introduced into the plant cell (e.g., via bombardment). It will be understood that any additional factors (e.g., nucleases) may also be co-introduced.
[0639] According to one embodiment, the sgRNA is introduced into the plant cell before (e.g., within minutes or hours of) the DNA donor oligonucleotide. It will be understood that any additional factors (e.g., nucleases) may be introduced before, simultaneously with, or after the sgRNA or DNA donor oligonucleotide.
[0640] According to one embodiment, the sgRNA is introduced into the plant cell after (e.g., within minutes or hours of) the DNA donor oligonucleotide. It will be understood that any additional factors (e.g., nucleases) may be introduced before, simultaneously with, or after the sgRNA or DNA donor oligonucleotide.
[0641] According to one embodiment, a composition for genome editing is provided comprising at least one sgRNA and a DNA donor oligonucleotide.
[0642] According to one embodiment, a composition for genome editing is provided comprising at least one sgRNA, a nuclease (e.g., an endonuclease), and a DNA donor oligonucleotide.
[0643] There are various methods for directly introducing DNA into plant cells, and those skilled in the art will understand which method to choose. Electroporation involves briefly exposing protoplasts to a strong electric field. Microinjection involves mechanically injecting DNA directly into cells using a very small micropipette. Biolistic bombardment involves adsorbing DNA onto microprojectiles, such as magnesium sulfate crystals or gold or tungsten particles, and physically accelerating the microprojectiles toward protoplasts, cells, or plant tissue.
[0644] Thus, delivery of nucleic acids can be achieved by, for example, protoplast transformation (see, e.g., U.S. Pat. No. 5,508,184); desiccation / inhibition-mediated DNA uptake (see, e.g., Potrykus et al., J. Immunol. 2004; 2006; 2007; 2009; 2010). Methods for delivering DNA, RNA, peptides, and / or proteins, or combinations of nucleic acids and peptides, to plant cells include, for example, by protoplast transformation (see, e.g., U.S. Pat. No. 5,508,184); by desiccation / inhibition-mediated DNA uptake (see, e.g., Potrykus et al., J. Immunol. 2004; 2007; 2010). al. (1985) Mol. Gen. Genet. 199:183-8); by electroporation (see, e.g., U.S. Pat. No. 5,384,253); by stirring with silicon carbide fibers (see, e.g., U.S. Pat. Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (see, e.g., U.S. Pat. Nos. 5,563,055; 5,591,616; 5,693,512; 5,824,877; 5,981,840; and 6,384,301); by co-transfection with DNA. In embodiments of the present invention, the plant cells may be introduced by any method known to those of skill in the art, including, but not limited to, by acceleration of coated particles (see, e.g., U.S. Patent Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865), and by nanoparticles, nanocarriers, and cell-penetrating peptides (WO 201126644A2, WO 2009046384A1, WO 2008148223A1).
[0645] Other methods of transfection include transfection reagents (e.g., Lipofectin, ThermoFisher), dendrimers (Kukowska-Latallo, JF et al., 1996, Proc. Natl. Acad. Sci. USA 93, 4897-902), and cell-penetrating peptides (Mae et al., 2002). 005, Internalization of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta 1669(2):101-7), or polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3):359-366).
[0646] According to certain embodiments, for introducing DNA into plant cells (e.g., protoplasts), the method involves polyethylene glycol (PEG)-mediated DNA uptake. For further details, see Karesch et al. (1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant Cell Rep. See Cell Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol. 8:363-373. The plant cells (e.g., protoplasts, etc.) are then cultured under conditions that allow cell walls to grow, initiate division to form callus, develop shoots and roots, and regenerate whole plants.
[0647] After stable transformation, plants are propagated. The most common method of plant propagation is by seed. However, regeneration by seed propagation has the problem of heterozygosity, which is a loss of crop uniformity because plants produce seeds according to genetic variance governed by Mendelian laws. Essentially, each seed is genetically different and grows with unique traits. Therefore, it is preferable to generate transformed plants so that the regenerated plants have the same traits and characteristics as the parent transgenic plant. Therefore, it is preferable to regenerate transformed plants by micropropagation, which allows for rapid and consistent regeneration of genetically identical transformed plants.
[0648] Micropropagation is the process of growing a new generation of plants from a single piece of tissue cut from a selected parent plant or variety. This process allows for the reproduction of large quantities of plants with desired traits. The newly generated plants are genetically identical to the original plant and possess all of the characteristics of the original plant. Micropropagation (or cloning) can produce large quantities of high-quality plant material in a short period of time, allowing for the rapid propagation of selected varieties while retaining the characteristics of the original transgenic or transformed plant. The advantages of clonal plants are the speed of plant propagation and the quality and uniformity of the plants generated.
[0649] Micropropagation is a multi-step procedure that requires changing culture media or growth conditions between steps. Therefore, the micropropagation process includes four basic steps: step 1, initial tissue culture; step 2, tissue culture propagation; step 3, differentiation and plant formation; and step 4, greenhouse cultivation and hardening. During step 1, initial tissue culture, the tissue culture is established and certified free of contaminants. During step 2, the initial tissue culture is propagated until a sufficient number of tissue samples are generated to achieve production goals. During step 3, the tissue samples grown in step 2 are divided and grown into individual plantlets. In step 4, the transformed plantlets are transferred to a greenhouse for hardening, where the plants' tolerance to light is gradually increased so that they can grow in a natural environment.
[0650] Although stable transformation is currently preferred, transient transformation of leaf cells, meristematic cells, or whole plants is also contemplated by some embodiments of the present invention.
[0651] Transient transformation can be achieved by any of the direct DNA transfer methods described above or by viral infection with modified plant viruses.
[0652] Viruses that have been shown to be useful for transforming plant hosts include CaMV, TMV, TRV, and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), European Patent No. 67,553 (TMV), Japanese Patent Application Laid-Open No. 63-14693 (TMV), European Patent No. 194,809 (BV), European Patent No. 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, are described in International Publication No. WO 87 / 06261.
[0653] In addition to the above references, the construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants is also described by Dawson, WO et al., Virology (1989) 172:285-292; Takamatsu et al., EMBO J. (1987) 6:307-311; French et al., Science (1986) 231:1294-1297; and Takamatsu et al., FEBS Letters (1990) 269:73-76.
[0654] If the virus is a DNA virus, suitable modifications may be made to the virus itself. Alternatively, to facilitate the construction of the desired viral vector carrying foreign DNA, the virus may first be cloned into a bacterial plasmid. The virus may then be excised from the plasmid. If the virus is a DNA virus, the viral DNA may be attached to a bacterial replication origin and then replicated by the bacteria. Transcription and translation of this DNA produces a coat protein that encapsidates the viral DNA. If the virus is an RNA virus, the virus is generally cloned as cDNA and inserted into a plasmid. The plasmid is then used to carry out all constructions. The plasmid is then used to The viral sequences in the mide are transcribed and the viral genes are translated to produce the coat protein(s) that encapsidate the viral RNA, thereby producing an RNA virus.
[0655] In addition to the above references, construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants, such as those contained in the constructs of some embodiments of the present invention, is taught by U.S. Pat. No. 5,316,931.
[0656] In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from the viral nucleic acid and a non-native plant viral coat protein coding sequence and non-native promoter, preferably a subgenomic promoter for the non-native coat protein coding sequence, has been inserted that is capable of expressing the non-native plant viral coat protein in the plant host, packaging the recombinant plant viral nucleic acid, and ensuring systemic infection of the host with the recombinant plant viral nucleic acid. Alternatively, the coat protein gene may be inactivated by inserting a non-native nucleic acid sequence therein so that the protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing an adjacent gene or nucleic acid sequence in the plant host and is incapable of recombining with each other and with the native subgenomic promoter. When more than one nucleic acid sequence is included, the non-native (foreign) nucleic acid sequence may be inserted adjacent to the native plant viral subgenomic promoter or the native and non-native plant viral subgenomic promoters. The non-native nucleic acid sequence is transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the desired product.
[0657] In a second embodiment, a recombinant plant viral nucleic acid is provided similar to the first embodiment, except that instead of the coding sequence for the non-native coat protein, the coding sequence for the native coat protein is positioned adjacent to one of the subgenomic promoters for the non-native coat protein.
[0658] In a third embodiment, a recombinant plant viral nucleic acid is provided in which a native coat protein gene is adjacent to its subgenomic promoter and one or more non-native subgenomic promoters are inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombining with each other and with the native subgenomic promoters. A non-native nucleic acid sequence may be inserted adjacent to the non-native subgenomic plant viral promoter such that the sequence is transcribed or expressed in the host plant under the control of the subgenomic promoter to produce a desired product.
[0659] In a fourth embodiment, a recombinant plant viral nucleic acid is provided similar to the third embodiment, except that the coding sequence for the native coat protein is replaced with a coding sequence for a non-native coat protein.
[0660] The viral vector is encapsidated by a coat protein encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect a suitable host plant. The recombinant plant viral nucleic acid is capable of replicating in the host, spreading systemically in the host, and transcribing or expressing the foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
[0661] In addition to the above, the nucleic acid molecules of some embodiments of the present invention can be introduced into the chloroplast genome and Thus, chloroplast expression may also be possible.
[0662] A technique for introducing exogenous nucleic acid sequences into the chloroplast genome is known. This technique involves the following steps: First, plant cells are chemically treated to reduce the number of chloroplasts to approximately one per cell. Then, exogenous nucleic acids are introduced into the cells via particle bombardment, with the goal of introducing at least one exogenous nucleic acid molecule into the chloroplast. The exogenous nucleic acid is selected so that it can be integrated into the chloroplast genome via homologous recombination, facilitated by enzymes native to chloroplasts. For this purpose, the exogenous nucleic acid contains, in addition to the gene of interest, at least one nucleic acid stretch derived from the chloroplast genome. Furthermore, the exogenous nucleic acid contains a selectable marker that aids in such a selection procedure to confirm that all or substantially all copies of the chloroplast genome after sequential selection contain the exogenous nucleic acid. Further details regarding this technique can be found in U.S. Patent Nos. 4,945,050 and 5,693,507, which are incorporated herein by reference. In this manner, polypeptides can be produced by the chloroplast protein expression system and integrated into the inner membrane of the chloroplast.
[0663] Regardless of the transformation / infection method used, the present teachings further select for transformed cells that contain genome editing events.
[0664] According to certain embodiments, selection is performed such that only cells that have successfully made the correct modification (e.g., replacement, insertion, deletion, point mutation) at a particular locus are selected, and thus cells containing any event involving a modification (e.g., insertion, deletion, point mutation) at an unintended locus are not selected.
[0665] According to one embodiment, selection of modified cells can be performed at the phenotypic level, by detection of a molecular event, by detection of a fluorescent reporter, or by growth in the presence of selection (e.g., an antibiotic).
[0666] According to one embodiment, the selection of modified cells is performed by analyzing the biogenesis and appearance of newly generated dsRNA molecules.
[0667] According to one embodiment, selection of modified cells is performed by analyzing the biogenesis and appearance of secondary small RNAs (produced by further processing of dsRNA).
[0668] According to one embodiment, the selection of modified cells is performed by analyzing the biogenesis and appearance of newly edited RNA molecules (e.g., the presence of new miRNA versions, the presence of newly edited siRNAs, piRNAs, tasiRNAs, etc.).
[0669] According to one embodiment, selection of modified cells is performed by analyzing the biogenesis and occurrence of newly edited plant RNA transcripts (i.e., of the modified plant gene).
[0670] According to one embodiment, the selection of modified cells is performed by analyzing the silencing activity and / or specificity of the modified RNA molecule (e.g., RNA silencing molecule) or modified plant RNA for plant RNA or pest RNA, respectively, or the silencing activity and / or specificity of the dsRNA molecule or secondary small RNA processed therefrom for pest RNA, to determine the plant (e.g., plant leaf color development, e.g., partial or complete loss of chlorophyll in leaves and other organs (chlorosis), presence or absence of necrotic patterns, flower color development, fruit traits (e.g., shelf life, firmness, and aroma), growth rate, plant size (e.g., dwarfism), crop yield, biotic stress resistance), or pest resistance. This is done by examining at least one phenotype in a plant (e.g., nematode mortality, beetle fecundity, or other resistance phenotype associated with bacteria, viruses, fungi, parasites, insects, weeds, and either cultivated or native plants).
[0671] According to one embodiment, the silencing specificity of an RNA molecule, plant RNA, dsRNA, or secondary small RNA processed therefrom is determined genotypically, for example, by gene expression or lack of expression.
[0672] According to one embodiment, the silencing specificity of the RNA molecule, plant RNA, dsRNA, or secondary small RNAs processed therefrom is determined phenotypically.
[0673] According to one embodiment, the phenotype of the plant is determined before the genotype.
[0674] According to one embodiment, the genotype of the plant is determined prior to phenotyping.
[0675] In one embodiment, the modified cells are selected by measuring the RNA levels of the plant RNA or pest RNA and analyzing the silencing activity and / or specificity of the RNA molecule (e.g., RNA silencing molecule), plant RNA, dsRNA, or secondary small RNA processed therefrom, for the plant RNA or pest RNA, which can be performed using any method known in the art, such as, for example, Northern blotting, nuclease protection assay, in situ hybridization, or quantitative RT-PCR.
[0676] According to one embodiment, the selection of modified cells is carried out by analyzing plant cells or clones containing DNA editing events, also referred to herein as "mutations" or "edits," depending on the type of editing desired, e.g., insertions, deletions, insertion-deletions (indels), inversions, substitutions, and combinations thereof.
[0677] Methods for detecting sequence variations are well known in the art and include, but are not limited to, DNA and RNA sequencing (e.g., next-generation sequencing), electrophoresis, enzyme-based mismatch detection assays, and hybridization assays such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blot, Northern blot, and dot blot analysis. Various methods used to detect single nucleotide polymorphisms (SNPs) may also be used, such as PCR-based T7 endonuclease, heteroduplex, and Sanger sequencing, or PCR followed by restriction enzyme digestion to detect the appearance or disappearance of unique restriction site(s).
[0678] Another method for verifying the presence of DNA editing events such as indels involves mismatch cleavage assays, which utilize structure-selective enzymes (e.g., endonucleases) that recognize and cleave mismatched DNA.
[0679] According to one embodiment, selection of transformed cells is performed by flow cytometry (FACS) selection of transformed cells that exhibit fluorescence emitted by the fluorescent reporter. After FACS sorting, the positively selected pool of transformed plant cells displaying the fluorescent marker can be collected, and an aliquot can be used to test for DNA editing events as described above.
[0680] If an antibiotic selection marker is used, after transformation, the plant cell clones are cultured in the presence of selection (e.g., antibiotic) until colonies, i.e., clones, and microcallus develop. A portion of the cells in the callus are then analyzed for DNA editing events, as described above. Analyze (verify).
[0681] Thus, according to one embodiment of the present invention, the method further comprises verifying in the transformed cell the complementarity of the RNA molecule (e.g., RNA silencing molecule), plant RNA, dsRNA, or secondary small RNA processed therefrom to plant RNA or pest RNA.
[0682] As described above, after modification, the RNA molecule (e.g., RNA silencing molecule), plant RNA, dsRNA (e.g., its sense or antisense strand), or secondary small RNA processed therefrom has at least about 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity to the target sequence of the plant RNA or pest RNA.
[0683] Specific binding of the designed RNA molecule to the target plant or pest RNA can be determined by any method known in the art, for example, by computational algorithms (e.g., BLAST), and verified by methods including, for example, Northern blot, in situ hybridization, QuantiGene Plex Assay, etc.
[0684] It will be understood that positive clones may be homozygous or heterozygous for the DNA editing event. In the case of heterozygous cells, the cells (e.g., in the case of diploids) may contain copies of the modified gene and copies of the unmodified gene. Those skilled in the art will select clones for further culture / regeneration depending on the intended use.
[0685] According to one embodiment, if a transient method is desired, clones showing the presence of a DNA editing event are optionally further analyzed to select for the absence of the DNA editing agent, i.e., the loss of the DNA sequence encoding the DNA editing agent, by analyzing the loss of expression of the DNA editing agent (e.g., at the mRNA or protein level), for example, by fluorescent detection of GFP or q-PCR, HPLC, etc.
[0686] According to one embodiment, if a transient method is desired, the cells may be analyzed for the absence of a nucleic acid construct described herein or a portion thereof, e.g., a nucleic acid sequence encoding a DNA editing agent. This can be confirmed by fluorescence microscopy, q-PCR, FACS, and / or any other method, such as Southern blot, PCR, sequencing, HPLC).
[0687] According to one embodiment, plants are crossed to obtain plants that are free of DNA editing agents (eg, endonucleases), as described below.
[0688] Positive clones can be stored (eg, cryopreserved).
[0689] Alternatively, plant tissue culture techniques can be used to regenerate whole plants from plant cells (e.g., protoplasts) by first growing them into clusters of plant cells, causing them to develop into callus, and then regenerating shoots from the callus (callus development). To grow the protoplasts into callus and regenerate shoots, the tissue culture medium must contain the appropriate balance of plant growth regulators, which must be customized for each plant species.
[0690] Protoplasts can also be used for plant breeding using a technique called protoplast fusion. This technique can be used to generate somatic cell hybrids in tissue culture.
[0691] Methods for regenerating protoplasts are well known in the art. Several factors influence protoplast isolation, culture, and regeneration: genotype, donor tissue and its pretreatment, enzymatic treatment to isolate protoplasts, protoplast culture method, culture medium, and physical environment. For a complete review, see Maheshwari et al. 1986 Differentiation of Protoplasts and of Transformed Plant Cells: 3-36. Springer-Verlag, Berlin.
[0692] The regenerated plants can be subjected to further breeding and selection as deemed appropriate by those skilled in the art.
[0693] Accordingly, embodiments of the present invention further relate to plants, plant cells, and plant processing products comprising dsRNA molecules capable of silencing pest RNA according to the present teachings.
[0694] According to one aspect of the present invention, there is provided a method for producing a pest-tolerant or -resistant plant, the method comprising producing a long dsRNA molecule capable of silencing a pest gene in a plant cell according to the methods of some embodiments of the present invention.
[0695] According to one aspect of the present invention, there is provided a method for producing a pest-tolerant or resistant plant, comprising the steps of: (a) breeding a plant of some embodiments of the present invention; (b) selecting progeny plants that express the long dsRNA molecule capable of silencing the pest gene and that do not contain the DNA editing agent; thereby producing pest-resistant or resistant plants; A method is provided that includes:
[0696] According to one aspect of the invention, there is provided a method of producing a plant or plant cell of some embodiments of the invention, comprising growing the plant or plant cell under conditions that allow propagation.
[0697] According to one embodiment, breeding comprises crossing or selfing.
[0698] The term "crossing," as used herein, refers to the fertilization of a female plant (or gamete) by a male plant (or gamete). The term "gamete" refers to a haploid reproductive cell (egg or sperm) produced in a plant by mitosis from a gametophyte and involved in sexual reproduction, in which two gametes of the opposite sex fuse to form a diploid zygote. The term generally includes reference to pollen (including sperm cells) and ovules (including egg cells). Thus, "crossing" generally refers to the fertilization of an ovule from one individual with pollen from another individual, while "selfing" refers to the fertilization of an ovule from one individual with pollen from the same individual. Crossing is widely used in plant breeding, where one chromosome from the mother crosses with one chromosome from the father, resulting in the mixing of genomic information between the two plants. This results in new combinations of genetically inherited traits.
[0699] As mentioned above, plants may be crossed to obtain plants that are free of undesirable factors, such as DNA editing agents (e.g., endonucleases).
[0700] According to some embodiments of the invention, the plant is non-transgenic.
[0701] According to some embodiments of the invention, the plant is a transgenic plant.
[0702] According to one embodiment, the plants are not genetically modified (non-GMO).
[0703] According to one embodiment, the plant is genetically modified (GMO).
[0704] According to one aspect of the present invention, there is provided a cell of a plant of some embodiments of the present invention.
[0705] According to one aspect of the present invention, there is provided a seed of the plant of some embodiments of the present invention.
[0706] According to one embodiment, a plant produced by the method is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% more resistant or tolerant to a pest compared to a plant not produced by the method (i.e., compared to a wild-type plant).
[0707] Any method known in the art for assessing plant pest resistance or tolerance can be used in accordance with the present invention. Exemplary methods include those described by Ramir et al. ez V1, Garcia-Andrade J, Vera P., Plant Sig nal Behav. 2011 Jun;6(6):911-3. Epub 2011 Jun 1, reducing MYB46 expression in Arabidopsis thaliana, which increases resistance to Botrytis cinerea; or down-regulating HCT in alfalfa, which promotes activation of defense responses in plants, as described in Gallego-Giraldo L. et al. New Phytologist (2011) 190:627-639 doi:10.1111 / j.1469-8137.2010.03621.x), both of which are incorporated herein by reference.
[0708] According to a further embodiment, there is provided a method for producing in a plant cell a molecule of long dsRNA capable of silencing a target gene of interest, the method comprising: (a) selecting a first nucleic acid sequence of a plant gene that exhibits predetermined sequence homology to the nucleic acid sequence of the target gene of interest; and (b) modifying an endogenous nucleic acid sequence of a second plant that encodes an RNA molecule to confer silencing specificity for the first plant gene, such that small RNAs processed from the RNA molecule capable of recruiting RNA-dependent RNA polymerase (RdRp) form base complementarity with a transcript of the first plant gene to produce a long dsRNA molecule capable of silencing the target gene of interest.
[0709] According to some embodiments, the first nucleic acid sequence does not encode a silencing RNA before the method is used. According to some embodiments, long dsRNA is not naturally produced from the first nucleic acid sequence before the method is used. Without being bound by theory or mechanism, the first nucleic acid sequence in the method does not necessarily naturally produce long dsRNA (or any silencing RNA), but the modification of the second endogenous plant nucleic acid sequence results in the production of an RNA molecule (e.g., miRNA) that acts as an amplifier and associates with RdRp, thereby producing long dsRNA from the RNA transcript of the first nucleic acid sequence. Therefore, in effect, according to some embodiments, the method can produce long dsRNA from a gene that has not previously produced long dsRNA.
[0710] In some embodiments, the target gene of interest is an endogenous gene of the plant cell. In other embodiments, the target gene of interest is a gene exogenous to the plant cell (e.g., a gene of a pest, e.g., an invertebrate pest).
[0711] According to some embodiments, the RNA molecule encoded by the second plant endogenous nucleic acid sequence is an miRNA.
[0712] According to some embodiments, the predetermined sequence homology to the nucleic acid sequence of the target gene of interest comprises at least two stretches of homology of at least 28 nt each, each having at least 90% homology to the sequence of the target gene of interest.
[0713] According to some embodiments, modifying the nucleic acid sequence includes using a DNA editing agent, such as, but not limited to, a CRISPR endonuclease (e.g., Cas9). According to some embodiments, the DNA editing agent includes a CRISPR endonuclease and a guide RNA that directs cleavage of a nucleic acid sequence of interest (e.g., a sequence of a second endogenous plant nucleic acid). According to some embodiments, modifying the nucleic acid sequence of interest includes using a DNA editing agent (optionally including a guide RNA that directs cleavage of the nucleic acid of interest), and further includes introducing into the plant cell an additional nucleic acid sequence that is similar to the nucleic acid sequence to be modified but that contains a desired nucleotide change. Without being bound by theory or mechanism, it is believed that the DNA editing agent cleaves the nucleic acid sequence of interest, and a portion of the additional nucleic acid sequence (including the desired nucleotide change) is introduced into the nucleic acid sequence of interest via homology-dependent recombination (HDR).
[0714] As used herein, the term "about" refers to ±10%.
[0715] The terms "comprises," "comprising," "includes," "including," "having," and their cognates mean "including, but not limited to."
[0716] The term "consisting of" means "including and limited to."
[0717] The term "consisting essentially of" means that a composition, method, or structure may include additional ingredients, steps, and / or components, so long as the additional ingredients, steps, and / or components do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.
[0718] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" can include multiple compounds, including mixtures thereof.
[0719] Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be deemed to include all the possible subranges and individual numerical values specifically disclosed within that range. For example, the description of a range such as 1 to 6 should be deemed to include the specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0720] Whenever a numerical range is specified herein, it is meant to include any recited numbers (fractional or integer) within the specified range. The phrases "ranging between" a first specified number and a second specified number and "ranging from" a first specified number to a second specified number are used interchangeably herein and are meant to include the first and second specified numbers and all fractional and integer numbers therebetween.
[0721] As used herein, the term "method" refers to manners, means, techniques, and procedures for accomplishing a given task, including, but not limited to, manners, means, techniques, and procedures known to those skilled in the arts of chemistry, pharmacy, biology, biochemistry, and medicine, or readily developed from known manners, means, techniques, and procedures.
[0722] As used herein, the term "treating" includes halting, substantially inhibiting, slowing, or reversing the progression of a condition, substantially ameliorating the clinical or outward symptoms of a condition, or substantially preventing the appearance of clinical or outward symptoms of a condition.
[0723] It is understood that certain features of the invention that are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment, may also be suitably provided separately or in any suitable subcombination, or in any other described embodiment of the invention. A particular feature described in the context of various embodiments should not be construed as an essential feature of that embodiment, unless the embodiment is functionally ineffective without that element.
[0724] Various embodiments and aspects of the present invention as delineated above and as claimed in the claims section below find experimental support in the following examples.
[0725] It is understood that any sequence identification number (SEQ ID NO) disclosed herein, even if the SEQ ID NO is expressed only in DNA or RNA sequence format, can refer to either a DNA sequence or an RNA sequence, depending on the context in which the SEQ ID NO is referenced. For example, SEQ ID NO: 1 is expressed in DNA sequence format (e.g., T for thymine is written), but it can refer to either the DNA sequence corresponding to the nucleic acid sequence or the RNA sequence of the nucleic acid sequence of an RNA molecule. Similarly, some sequences are expressed in RNA sequence format (e.g., U for uracil is written), but it can refer to either the sequence of an RNA molecule making up a dsRNA or the sequence of a DNA molecule corresponding to the depicted RNA sequence, depending on the actual type of molecule being described. In any event, both DNA and RNA molecules having the disclosed sequences with any substitutions are contemplated. [Example]
[0726] The present invention is now illustrated by reference to the following examples, which, together with the above descriptions, illustrate, but do not limit, the present invention.
[0727] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological, microscopic, and recombinant DNA techniques. Such techniques are fully explained in the literature. See, for example, "Molecular Cloning: A Laboratory Manual" by Sambrook et al. (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R.M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press. Ress, New York (1998); the methodology described in U.S. Patent Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659, and 5,272,057; "Cell Biology: A Laboratory Handbook," Volumes I-III Cellis, JE, ed. (1994); "Current Protocols in Immunology," Volumes I-III Coligan JE, ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8 thEdition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, WHFreeman and Co., New York (1980); available immunoassays are widely described in the patent and scientific literature, see, e.g., U.S. Patent Nos. 3,791,932, 3,839,153, 3,850,752, 3,850,578, 3,853,987, 3,867,517, 3,879,262, 3,901,654, 3,935,074, 3,984,533, 3,996,345, 4,034,074, 4,098,876, 4,879,219, 5,011,771, and 5,281,521; “Synthesis” Gait, MJ, ed. (1984); “Nucleic Acid Hybridization” Hames, BD, and Higgins SJ, eds. (1985); “Transcription and Translation” Hames, BD, and Higgins SJ, Eds. (1984); “Animal Cell Culture” Freshney, RI, ed. (1986); “Immobilized Cells and Enzymes” IRL Press,(1986);“A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press;“PCR Protocols:A Guide To Methods and Applications”, Academic Press, San Diego, CA (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual”, CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are set forth throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All information contained therein is incorporated herein by reference.
[0728] General Materials and Experimental Procedures Computational pipeline for generating GEiGS templates The computational GEiGS pipeline applies biological metadata and allows for the automatic generation of GEiGS DNA templates that are used to minimally edit non-coding RNA genes (e.g., miRNA genes) to de novo gain-of-function, i.e., redirect their silencing capacity to target sequences of interest.
[0729] As shown in Figure 6, the pipeline begins with input and submission of a) the target sequence to be silenced by GEiGS, b) the host organism that will be gene-edited and express GEiGS, and c) the option to choose whether to express GEiGS ubiquitously. If specific GEiGS expression is required, several options can be selected (e.g., specific expression in specific tissues, developmental stages, stress, heat / cold shock, etc.).
[0730] Once all required inputs have been submitted, the computational process begins by searching miRNA datasets (e.g., small RNA sequencing, microarrays, etc.) to filter only relevant miRNAs that match the input criteria. Next, the sequences of the selected mature miRNAs are aligned to the target sequence, and miRNAs with the highest level of complementarity are filtered. The sequences of these naturally target-complementary mature miRNAs are then modified to perfectly match the target sequence. The modified mature miRNA sequences are then run through an algorithm that predicts siRNA potency, and the top 20 miRNAs with the highest silencing scores are filtered. These final modified miRNA genes are then used to generate 200-500nt ssDNA or 250-5000nt dsDNA sequences as follows:
[0731] Based on the genomic DNA sequence flanking the modified miRNA, 200-500nt ssDNA oligos and 250-5000nt dsDNA fragments are designed. The pre-miRNA sequence is located in the center of the oligo. The guide strand (silencing) sequence of the modified miRNA is 100% complementary to the target. However, the sequence of the modified passenger miRNA strand is further modified to retain the structure of the original (unmodified) miRNA in order to maintain the same base-pairing profile.
[0732] Next, a differential sgRNA is designed to specifically target the unmodified original miRNA gene, rather than the modified replacement version. Finally, a comparative restriction enzyme site analysis is performed between the modified and original miRNA genes to compile the differential restriction sites.
[0733] Thus, the output of the pipeline includes: a) A 200-500 nt ssDNA oligo or a 250-5000 nt dsDNA fragment sequence containing a minimally modified miRNA b) Two to three differential sgRNAs that specifically target the original miRNA gene but not the modified miRNA. c) List of differential restriction enzyme sites between the modified and original miRNA genes.
[0734] Design of dsRNA by GEiGS Model 1 (numbers correspond to those in Figure 1): 1. Pest gene "X" is the target gene (when silenced, the pest is controlled) 2. Host-associated gene X is identified by a homology search against pest gene "X" (plant gene "X"). According to some embodiments, plant gene X is identified according to Model 1 if it contains at least two stretches of at least 28 nt, each with at least 90% homology to the sequence of pest gene X. 3. Perform GEiGS in plant cells to redirect the silencing specificity of a small RNA (e.g., a 22-nt miRNA) toward host-associated gene X, thereby allowing the small RNA to act as an amplifier of RdRp-mediated transcription for the transcript of plant gene “X.” 4. Amplifier small RNAs (also referred to herein as "small GEiGS RNAs") whose silencing specificity has been redirected using GEiGS form a RISC complex associated with RdRp (an amplification enzyme). 5. RdRp synthesizes an antisense RNA strand complementary to the transcript of plant gene “X,” forming a long dsRNA. 6. The long dsRNA is then at least partially processed into secondary sRNAs by Dicer(s) or other nucleases within the plant cell. These secondary sRNAs Among A, the silencing specificity of some of the secondary sRNAs is directed against pest gene X. 7. dsRNA is also at least partially taken up by the pest and, in some cases, processed into sRNA in the pest, as described above. 8. In some cases, secondary sRNA from the plant cell is also taken up by the pest and, in addition to the long dsRNA produced, also silences the target gene "X", for example.
[0735] Model 2 (numbers correspond to those in Figure 2): 1. Pest gene "X" is the target gene (when silenced, the pest is controlled) 2. GEiGS is performed in plant cells to redirect the silencing specificity of a naturally occurring RNAi precursor known to be amplified in its wild-type form (i.e., to produce long dsRNA) toward pest gene "X" (e.g., a TAS gene; amplified in its wild-type form to long dsRNA and processed into tasiRNA). This transcript is marked "Amplified GEiGS Precursor" in Figure 2. According to some embodiments, RNAi precursors that can be used with Model 2 are those that form long dsRNA and are processed into secondary small RNAs, including, but not limited to, precursors that are processed into trans-acting siRNAs (tasiRNAs) or phased small interfering RNAs (phasiRNAs). Gene editing-induced gene silencing (GEiGS) is performed on the gene encoding the RNAi precursor by inducing a double-strand break in the gene using an endonuclease (such as CAS9) and providing a DNA "GEiGS oligonucleotide" that introduces the nucleotide changes necessary for redirection of specificity into the gene through the use of homology-dependent recombination (HDR). Thus, depending on the "GEiGS oligonucleotide" used, the specificity of a portion of the RNAi precursor (e.g., tTAS) is altered to target pest gene X. The redirected RNAi precursor is processed by the cellular Dicer into secondary small RNAs (e.g., tasiRNAs) that also match pest gene X. In the example shown in Figure 2, only one of the tasiRNAs is altered, resulting in a TAS that is processed into both the wild-type and altered tasiRNAs. 3. Wild-type amplifier small RNAs form a RISC complex associated with RdRp (amplification enzyme). 4. RdRp synthesizes an antisense RNA strand complementary to the amplified GEiGS precursor transcript, forming a long dsRNA. 5. The amplified GEiGS dsRNA is at least partially processed into secondary sRNAs in the plant cell by Dicer(s) or other nucleases. Among these secondary sRNAs, the secondary small RNAs corresponding to the sites of GEiGS have silencing specificity for pest gene X. 6. At least a portion of the unprocessed GEiGS long dsRNA is taken up by the pest and, in some cases, processed into small RNAs in the pest as described above. 7. In some cases, secondary sRNAs (e.g., tasiRNAs in the case of TAS precursors) previously made in the plant cell are also taken up by the pest and silence target gene "X".
[0736] Tables 1A and 1B below provide exemplary pest genes that can be targeted by the present methods, particularly Model 1. Table 2 below provides exemplary pest genes that can be targeted by the present methods, particularly Model 2. Table 2 also provides proposed RNAi precursors (designated "backbones") that can be targeted by GEiGS, such as TAS RNA precursors. Table 2 shows that GEiGS can be used to introduce into the proposed backbones, such that the backbones are processed into these siRNAs in the pest, resulting in the target siRNAs. The proposed small interfering RNA (labeled "desired siRNA") that silences the target gene is shown.
[0737] [Table 5-1]
[0738] [Table 5-2]
[0739] [Table 6-1]
[0740] [Table 6-2]
[0741] [Table 7-1]
[0742] [Table 7-2]
[0743] [Table 7-3]
[0744] [Table 7-4]
[0745] Bombardment and plant regeneration of Arabidopsis and tomato Arabidopsis root preparation Chlorine-sterilized Arabidopsis thaliana (cv. Col-0) seeds were sown on MS minus sucrose plates and vernalized for 3 days at 4°C in the dark. They were then germinated vertically at 25°C under constant light. After 2 weeks, roots were excised into 1cm root fragments and placed on callus induction medium (CIM: 1 / 2 MS containing B5 vitamins, 2% glucose, pH 5.7, 0.8% agar, 2mg / L IAA, 0.5mg / L 2,4-D, 0.05mg / L kinetin) plates. After 6 days of incubation at 25°C in the dark, the root fragments were transferred to filter paper discs and placed on CIMM plates (1 / 2 MS without vitamins, 2% glucose, 0.4M mannitol, pH 5.7, and 0.8% agar) for 4–6 hours in preparation for bombardment.
[0746] Tomato explant preparation: Tomato seeds were surface sterilized with commercial bleach for 20 minutes and then washed three times with sterile water under aseptic conditions. Seeds were cultured on germination medium (MS + vitamins, 0.6% agarose, pH = 5.8) and kept at 25°C with a 16 / 8 hour light / dark cycle.
[0747] Remove approximately 1 cm of cotyledons from an 8-day-old tomato plant. 2 The cells were cut into strips and placed on a pre-bombardment culture (MS + vitamins, 3% sucrose, 0.6% agarose, pH 5.8, 1 mg / L BAP, 0.2 mg / L IAA) for 2 days in the dark at 25°C, then transferred to the center of a target plate (containing MS + vitamins, 3% mannitol, 0.6% agarose, pH 5.8) for 4 hours.
[0748] Bombardment Plasmid constructs were introduced into root tissue via PDS-1000 / He Particle Delivery (Bio-Rad; PDS-1000 / He System #1652257). This procedure requires several preliminary steps, which are outlined below.
[0749] Preparation of gold stock Forty mg of 0.6 μm gold (Bio-Rad; Cat: 1652262) was mixed with 1 mL of 100% ethanol, pelleted by pulse centrifugation, and the ethanol was removed. This washing procedure was repeated two more times.
[0750] After washing, resuspend the pellet in 1 mL of sterile distilled water and dispense into 1.5 mL tubes in 50 µL aliquot working volumes.
[0751] Preparation of beads In brief, do the following:
[0752] Typically, one tube of gold is sufficient to bombard Arabidopsis roots on two plates (two shots per plate), so each tube is distributed onto four (1,100 psi) Biolistic Rupture discs (Bio-Rad).
[0753] For bombardments requiring multiple plates of the same sample, combine tubes and adjust volumes of DNA and CaCl2 / spermidine mix accordingly to maintain sample consistency and minimize overall preparation.
[0754] The following protocol summarizes the process for preparing one gold tube: These must be adjusted depending on the number of gold tubes used.
[0755] All subsequent processes are carried out at 4°C in an Eppendorf Thermomixer.
[0756] Prepare plasmid DNA samples and add them to each tube containing 11 µg of DNA at a concentration of 1000 ng / µL. 1) Add 493 μL of ddH2O to one aliquot (7 μL) of spermidine (Sigma-Aldrich) for a final concentration of 0.1 M spermidine. Add 1250 μL of 2.5 M CaCl2 to the spermidine mixture, vortex, and place on ice. 2) Place the previously prepared gold tube in a thermomixer and rotate it at a speed of 1400 rpm. 3) Add 11 μL of DNA to the tube, vortex, and return to the rotating thermomixer. 4) To bind the DNA / gold particles, add 70 μL of spermidine-CaCl2 mixture to each tube (in the thermomixer). 5) Vortex the tube vigorously for 15-30 seconds and place on ice for approximately 70-80 seconds. 6) The mixture is centrifuged at 7000 rpm for 1 minute, the supernatant is removed and placed on ice. 7) Add 500 μL of 100% ethanol to each tube and resuspend the pellet by pipetting and vortexing. 8) Centrifuge the tube at 7000 rpm for 1 minute. 9) Remove the supernatant and resuspend the pellet in 50 μL of 100% ethanol and store on ice.
[0757] Preparation of macrocarriers The following is done in a laminar flow cabinet: 1) Sterilize and dry macrocarriers (Bio-Rad), stopping screens (Bio-Rad), and macrocarrier disc holders. 2) Place the macrocarrier flat into the macrocarrier disc holder. 3) Vortex the DNA-coated gold mixture and spread (5 μL) onto the center of each Biolistic Rupture disc. The ethanol is evaporated.
[0758] PDS-1000 (Helium Particle Delivery System) In brief, do the following:
[0759] Adjust the control valve on the helium bottle to an input pressure of at least 1300 psi. Create a vacuum by pressing the vac / vent / hold switch and holding the fire switch for 3 seconds. This ensures that the helium flows into the piping.
[0760] Place the 1100 psi rupture disk in the isopropanol, mix, and remove static electricity. 1) Place one rupture disk into the disk retaining cap. 2) Construct a microcarrier launch assembly (using a stopping screen and gold-containing microcarriers). 3) Arabidopsis root callus in a Petri dish is placed 6 cm below the launch assembly. 4) Set the vacuum pressure to 27 inches Hg (mercury) and open the helium valve (approximately 1100 psi). 5) Release the vacuum and remove the microcarrier launch assembly and rupture disk retaining cap. 6) Bombard the same tissue (i.e., bombard each plate twice). 7) The bombarded roots are then placed on CIM plates for a further 24 hours in the dark at 25°C.
[0761] Simultaneous Bombardment When bombarding a combination of GEiGS plasmids, mix 5 μg (1000 ng / μL) of sgRNA plasmid with 8.5 μg (1000 ng / μL) of exchange plasmid (e.g., DONOR) and add 11 μL of this mixture to the sample. When bombarding more GEiGS plasmids simultaneously, adjust the concentration ratio of sgRNA plasmid to exchange plasmid (e.g., DONOR) to 1:1.7 and add 11 μg (1000 ng / μL) of this mixture to the sample. When bombarding plasmids unrelated to the GEiGS exchange simultaneously, mix them in equal ratios and add 11 μg (1000 ng / μL) of the mixture to each sample.
[0762] Transfection of Col-0 protoplasts Arabidopsis (Col-0) protoplasts were transfected with a vector encoding Crispr / Cas9 and a donor template for HDR-mediated exchange. Experiments were designed to exchange sequences in the Tas1b (AtTAS1b_AT1G50055) or Tas3a (AtTAS3a_AT3G17185) genes to generate sRNAs targeting 30-bp sequences in the target genes of these nematodes. Without being bound by theory or mechanism, the rationale for generating long dsRNAs targeting 30-bp sequences in nematodes is to ensure that functional silencing RNA molecules are generated when the dsRNA is processed into secondary silencing RNAs in nematodes, even though the lengths of the secondary silencing RNAs formed in nematodes differ from those formed in plants.
[0763] Two exchanges were designed in the TAS1b locus and two exchanges in the TAS3a locus. The exchanges were independent of each other. The DONOR template (1 kb) was synthesized into a plasmid (synthesized by Twist, USA).
[0764] Protoplast concentration was determined using a hemocytometer, and viability was determined using trypan blue (approximately 30 μL of protoplasts, 65 μL of mmg, and 5 μL of trypan blue). Protoplasts were diluted or concentrated to a final protoplast density of 2 × 10 6 cells / mL.
[0765] For PEG transfection, the molar ratio of sgRNA vector (Crispr / Cas9, sgRNA, mCHERRY):DONOR vector was 1:20, resulting in 3.9 μg of sgRNA vector and approximately 21.61 μg of DONOR vector per transposon. To 1 mL of protoplasts, 1 mL of PEG solution was slowly added. The PEG solution was refreshed (2 g of PEG 4000 (Sigma), 0.2 M mannitol, and 0.5 mL of 1 M CaCl per 5 mL). The tube was incubated at room temperature in the dark for 20 minutes, after which 4 mL of W5 was added and mixed by inverting the tube. The protoplasts were then centrifuged and the pellet resuspended in 5 mL of PCA (protoplast regeneration medium) to allow cell division and HDR.
[0766] cell analysis Cells are harvested 24-72 hours after plasmid delivery and resuspended in D-PBS medium. Half of the solution is used for luciferase activity analysis, and the other half is analyzed for small RNA sequencing. Dual-Glo® Luciferase Assay System (Promega, USA) is used according to the manufacturer's instructions. Analysis by ferase assay is performed. Total RNA is extracted using a Total RNA Purification Kit (Norgene Biotek Corp., Canada) according to the manufacturer's instructions. Small RNA sequencing is performed to identify the desired mature small RNAs in these samples.
[0767] Arabidopsis plant regeneration Shoot regeneration was performed using a modified version of the protocol by Valvekens et al. [Valvekens, D. et al., Proc Natl Acad Sci USA (1988) 85(15):5536-5540]. Bombarded roots were placed on shoot induction medium (SIM) plates containing 1 / 2 MS with vitamin B5, 2% glucose, pH 5.7, 0.8% agar, 5 mg / L 2iP, and 0.15 mg / L IAA. Plates were maintained on a 16-hour light cycle at 25°C and 8-hour dark cycle at 23°C. After 10 days, the plates were transferred to MS plates containing 3% sucrose and 0.8% agar for 1 week, and then transferred to new, similar plates. Once regenerated, plants were detached from the roots and placed on MS plates containing 3% sucrose and 0.8% agar until analysis.
[0768] Post-bombardment culture and plant regeneration of tomato. Bombarded explants were placed on MS medium (MS + vitamins, 3% sucrose, 0.4% agar gel, pH 5.8, 1 mg / L BAP, 0.2 mg / L IAA) at 25°C in the dark for 2 days. The explants were transferred to a 16 / 8 light / dark cycle and subcultured every 2 weeks. The regenerating shoots were transferred to root induction medium (MS + vitamins, 3% sucrose, 2.25% Gelrite, pH 5.8, 2 mg / L IBA).
[0769] The rooted plants are washed with water to remove any remaining agar, placed in soil and covered. After a week of acclimation, the lids are gradually removed to harden off the plants.
[0770] Genotyping Tissue samples are processed and amplicons are amplified using the Phire Plant Direct PCR Kit (Thermo Scientific) according to the manufacturer's recommendations. The oligos used in these amplifications are designed to amplify a genomic region extending from the region at the modified site of the GEiGS system to outside the region used as the HDR template to distinguish DNA integrations. Different modifications at the modified locus are identified through the distinct digestion patterns of the amplicons imparted by specially selected restriction enzymes.
[0771] Genomic PCR reaction Cell samples (A, B, C, D, E, discussed in Example 3 below) were processed for genomic DNA using an RNA / DNA Purification Kit (Norgen) according to the manufacturer's instructions. Samples were quantified by Qubit and DNA was stored at -20°C.
[0772] For Tas1b (AtTAS1b_AT1G50055) and Tas3a (AtTAS3a_AT3G17185) sequences, nonspecific primers flanking the exchange region were used. As a negative control, the same exchange-specific reaction was performed using wild-type (WT) DNA as template. As a positive PCR control, specific PCR on WT DNA was performed on all samples. PCR amplification was performed using Q5® High-Fidelity 2X Master Mix.
[0773] 5 μL of each PCR reaction was run on a 0.8% agarose gel. Band sizes were estimated by comparing with a molecular weight marker (MW): 1 kb Plus DNA Ladder (NEB). did.
[0774] To confirm the exchange, a nested PCR reaction was performed. The initial genomic PCR contained nonspecific forward and reverse primers flanking the HDR region. The PCR product was diluted 1 / 100 with milli-q ultrapure water, and then the specific exchange PCR described above was performed. In the nested approach, the nonspecific primer used in the initial PCR had an annealing site adjacent to that of the nested primer.
[0775] Primers used: Non-specific primers for Tas1b: - Tas1b_WT_Nested_Non_Specific_DNA_R: 5'-accaatttgacccaaaaaggc-3' (SEQ ID NO: 63) Exchange-specific primers for Tas1b: - Tas1b_Splicing30_Nested_DNA_F: 5'-GCAGCAGATCAATGAAATTCAACG-3' (SEQ ID NO: 64) - Tas1b_Y2530_Nested_DNA_F: 5'-agCCGCTCTGTGGATTCTTG-3' (SEQ ID NO: 65) Non-specific primers for Tas3a: - Tas3a_WT_Nested_Non_Specific_DNA_R: 5'-aaactcctcgcctcttggtg-3' (SEQ ID NO: 66) Exchange-specific primers for Tas3a: - Tas3a_Ribo3a30_Nested_DNA_F: 5'-TCTTCAGCACCTTCACCTTACG-3' (SEQ ID NO: 67) - Tas3a_Spliceo30_Nested_DNA_F: 5'-TCCTTTTTGACCAACATTTGTTTGT-3' (SEQ ID NO: 68)
[0776] Positive control reaction WT Tas1b specific: - Tas1b_WT_Nested_Non_Specific_DNA_R: 5'-accaatttgacccaaaaaggc-3' (SEQ ID NO: 69) - Tas1b_WT_Nested_DNA_F: 5'-tggacttagaatatgctatgttggac-3' (SEQ ID NO: 70) WT Tas3a specific: - Tas3a_WT_Nested_Non_Specific_DNA_R 5'-aaactcctcgcctcttggtg-3' (SEQ ID NO: 71) - Tas3a_WT_Nested_DNA_F 5'-tctatctctacctctaattcgttcgag-3' (SEQ ID NO: 72)
[0777] DNA and RNA isolation Samples are collected in liquid nitrogen and stored at -80°C until processing. The tissue is pulverized using plastic Tissue Grinder Pestles (Axygen, US) in a tube placed on dry ice. DNA and total RNA are isolated from the pulverized tissue using an RNA / DNA Purification kit (Norgen Biotek Corp., Canada) according to the manufacturer's instructions. If the 260 / 230 ratio of the RNA fraction is low (<1.6), the isolated RNA is precipitated overnight at -20°C with 1 μL of glycogen (Invitrogen, US), 10% V / V sodium acetate, 3 M pH 5.5 (Invitrogen, US), and three volumes of ethanol. This solution is centrifuged at maximum speed for 30 minutes at 4°C. It is then washed twice with 70% ethanol, air-dried for 15 minutes, and resuspended in nuclease-free water. The mixture is then resuspended in PBS (Invitrogen, US).
[0778] RNA extraction Cell samples (A, B, C, D, E, discussed in Example 3 below) were processed for RNA purification using an RNA / DNA Purification Kit (Norgen) according to the manufacturer's instructions. Samples were quantified by Qubit. RNA was stored at -80°C.
[0779] DNAse treatment of RNA samples To demonstrate the biogenesis of dsRNA capable of targeting nematode target genes, we used PCR followed by RT-PCR to specifically search for small dsRNA fragments (<200 bp) containing the exchange. To do so, we used the Turbo DNA-Free Kit (Invitrogen) according to the manufacturer's instructions. Further DNAse treatment was performed, and the sample concentrations were normalized.
[0780] Reverse transcription (RT) and quantitative real-time PCR (qRT-PCR) One microgram of isolated total RNA was purified with DNase I according to the manufacturer's instructions. Treat with I (AMPD1; Sigma-Aldrich, US). Reverse transcribe the samples according to the instruction manual of the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, US).
[0781] For gene expression, quantitative real-time PCR (qRT-PCR) analysis was performed using the CFX96 Touch™ Real-Time PCR Detection System (BioRad, US) and SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich, US) according to the manufacturer's protocol and analyzed with the Bio-Rad CFX Manager program (version 3.1).
[0782] RT-PCR of RNA samples for expression analysis of Tas1b and Tas3a exchange in Col-0 cells For RT-PCR, use qScript Flex cDNA Synthesis cDNA was generated using a nonspecific primer set for Tas1b and Tas3a using a kit (Quanta BioSciences). One cDNA reaction was performed for the sense strand of Tas1b and Tas3a, respectively, and another reaction was performed for the antisense strand. Samples contained 165 ng / μL of RNA.
[0783] A negative control without reverse transcriptase (-RT control) was used for all RT-PCR reactions (same treatment except for using H2O instead of reverse transcriptase). This was to ensure that amplification due to DNA carryover was not occurring in the downstream PCR reaction. A water negative control was performed for each PCR reaction. A master mix was made with RNA for +RT / -RT for each treatment. For all samples, an additional master mix was made with (i) reverse transcriptase and buffer (+RT) and (ii) water and buffer (-RT). Final primer concentration: 1 μM
[0784] Primer: Tas1b - Tas1b sense: Tas1b_RT_A_R: 5'-TAACATAAAAATATTACAAATATCATTCCG-3' (SEQ ID NO: 93) - Tas1b antisense: Tas1b_RT_B_F: 5'-TCAGAGTAGTTATGATTGATAGGATGG-3' (SEQ ID NO: 94) These primers were used for treatments A, B, and E. Tas3a - Tas3a Sense: Tas3a_RT_A_R: 5'-GCTCAGGAGGGATAGACAAGG-3' (SEQ ID NO: 95) - Tas3a antisense: Tas3a_RT_B_F: 5'-CTCGTTTTACAGATTCTATTCTATCTC-3' (SEQ ID NO: 96) These primers were used in treatments C, D, and E.
[0785] PCR on cDNA to detect redirected expression of Tas1b and Tas3a towards nematode targets To detect dsRNA transcribed from the redirected Tas1b or Tas3a gene targeting a nematode gene, PCR reactions were performed using cDNA as a template, with one nonspecific primer for Tas3a or Tas1b and another exchange-specific primer (i.e., binding only to the relevant Tas sequence with the nucleotide exchange after GEiGS-mediated redirection). The annealing site of the nonspecific primer was located slightly downstream of the sequence used to generate the cDNA. The annealing site of the specific primer was located less than 200 bp downstream from the annealing site of the nonspecific primer. The approach was the same for analyzing the expression of both strands of dsRNA: sense and antisense. To confirm that amplification did not occur from DNA remaining in the sample after DNAse treatment, RT cDNA reactions were also performed. As a negative control, each reaction was also performed with WT DNA to demonstrate that amplification was exchange-specific. An HO negative control was included in each PCR reaction. 5 μL of each cDNA PCR reaction was used as template.
[0786] Primer: Tas3a sense strand specific reaction: - Ribosomal protein 3a specific: Tas3a_RNA_Non_Specific_A_F: 5'-TGACCTTGTAAGACCCCATCTC-3' (SEQ ID NO: 97) Tas3a_RNA_Ribo3a30_Specific_A_R:5'-AggagaaaATTCGTAAGGTGAAGG-3' (SEQ ID NO: 98) - WT specific: Tas3a_RNA_Non_Specific_A_F: 5'-TGACCTTGTAAGACCCCATCTC-3' (SEQ ID NO: 99) Tas3a_RNA_WT_Specific_A_R: 5'-GGTAGGAGAAAATGACTCGAACG-3' (SEQ ID NO: 100) Tas3a antisense strand specific reaction: - Ribosomal protein 3a specific: Tas3a_RNA_Non_Specific_B_R: 5'-CAACCATACATCAATAACAAACAAAAG-3' (SEQ ID NO: 101) Tas3a_RNA_Ribo3a30_Specific_B_F: 5'-ATATAGAATAGATatCGGCTTCTTCAG-3' (SEQ ID NO: 102) - WT specific: Tas3a_RNA_Non_Specific_B_R: 5'-CAACCATACATCAATAACAAACAAAAG-3' (SEQ ID NO: 103) Tas3a_RNA_Spliceo30_Specific_B_F: 5'-TCCTTTTTGACCAACATTTGTTTGT-3' (SEQ ID NO: 104) Tas1b sense strand specific reaction: - Y25, specific for the β subunit of the COPI complex: Tas1b_RNA_Non_Specific_A_F: 5'-GAGTCATTCATCGGTATCTAACC-3' (SEQ ID NO: 105) Tas1b_RNA_Y2530_Specific_A_R: 5'-agCCGCTCTGTGGATTCTTG-3' (SEQ ID NO: 106) - WT specific: Tas1b_RNA_Non_Specific_A_F: 5'-GAGTCATTCATCGGTATCTAACC-3' (SEQ ID NO: 107) Tas1b_RNA_WT_Specific_A_R: 5'-TGGACTTAGAATATGCTATGTTGGAC-3' (SEQ ID NO: 108) Tas1b antisense strand specific reaction: - Y25, specific for the β subunit of the COPI complex: Tas1b_RNA_Non_Specific_B_R: 5'-GCATATCCTAAAATATGTTTCGTTAAC-3' (SEQ ID NO: 109) Tas1b_RNA_Y2530_Specific_B_F: 5'-TCGCCAAGAATCCACAGAGC-3' (SEQ ID NO: 110) - WT specific: Tas1b_RNA_Non_Specific_B_R: 5'-GCATATCCTAAAATATGTTTCGTTAAC-3' (SEQ ID NO: 111) Tas1b_RNA_WT_Specific_B_F: 5'-TAAGTCCAACATAGCATATTCTAAGTC-3' (SEQ ID NO: 112)
[0787] TuMV Study on the silencing activity of long dsRNA in Nicotiana benthamiana against plant material N. benthamiana plants were grown in soil at 21°C under long-day conditions (16 hours light, 8 hours dark) for 4 weeks before treatment.
[0788] Cloning of TuMV-GFP vector The TuMV-GFP cDNA cassette was prepared by Tourino, A. et al. (Tourino, A., Sanchez, F., Fereres, A. and Ponz, F. (2008). High expression of foreign proteins from a biosafe viral vector derived from Turnip mosaic virus (Spanish Journal of Agricultural Research, 6(S1), p. 48) was amplified using the primer set 5'-ATGTTTGAACGATCGGGCCCaagggacgaagtgatccg-3' (SEQ ID NO: 113) and 5'-CTCCACCATGTTCCCGGGggcacagtgttcaacccc-3' (SEQ ID NO: 114). This amplicon was cloned into a binary vector carrying the NPTII resistance gene in the T-DNA region via an infusion reaction according to the manufacturer's protocol. The vector was then transformed into Agrobacterium strain GV3101 for Agrobacterium infiltration.
[0789] Agroinduction and leaf infiltration 1. Liquid cultures of Agrobacterium were grown in LB. 2. The cells were spun down and washed once with MMA medium (10 mM MES, 10 mM MgCl2, and 200 μM acetosyringone, pH=5.6). 3. The cells were spun down and the supernatant was discarded. The pellet was resuspended in MMA medium to an OD600 of 0.5. 4. The culture was gently shaken in the dark for 6 hours. 5. Combine cultures as needed (1:1 ratio between bacteria containing different vectors, each Agrobacterium containing a vector expressing a single gene). Final total Agrobacterium density - OD600 = 0.5. Add TuMV-GFP vector to a final density of OD600 = 0.0001. 6. Leaves of 4-week-old Nicotiana benthamiana plants were infiltrated with the induced cultures using a needleless syringe.
[0790] Gene sequences used for silencing with GEiGS-dsRNA AtTAS1B (At1g50055) - SEQ ID NO: 115 - GEiGS-TuMV-SEQ ID NO: 116 - GEiGS-TuMV-mature siRNA-SEQ ID NO: 117 - GEiGS-Dummy-SEQ ID NO: 118 - GEiGS-dummy-mature siRNA-SEQ ID NO: 119 - miR173_AT3G23125-SEQ ID NO: 120 miR173-mature miRNA-SEQ ID NO: 121
[0791] Studies on the protection of Arabidopsis thaliana from TuMV infection and disease plant material Arabidopsis seeds from plants carrying the desired GEiGS sequence are sterilized with chlorine gas and sown at one seed per well on MS-S agar plates. Two-week-old seedlings are transferred to soil. Plants are grown at 24°C under a 16-hour light / 8-hour dark cycle. Wild-type unmodified plants are grown and treated in parallel as controls.
[0792] Plant inoculation and analysis The procedures for inoculating and analyzing plants with TuMV vectors are well established in the art and have been described previously [Sardaru, P. et al., Molecular Plant Pathology (2018), 19:1984-1994]. Four-week-old Arabidopsis seedlings were inoculated with TuMV expressing viral vectors as previously described [Sanchez, F. et al. (1998) Virus Research (2018), 19:1984-1994]. rch, 55(2):207-219] or TuMV-GFP as previously described [Tourino, A., et al. (2008) Spanish Journal of Agricultural Research, 6(S1), p.48]. For TuMV, symptoms are scored 10 to 28 days after inoculation. For TuMV-GFP, GFP signal analysis is performed 7 to 14 days after inoculation.
[0793] Furthermore, 14 days after inoculation, new leaves growing above the inoculation site were collected and purified using a Total RNA Purification Kit (Norgene) according to the manufacturer's instructions. Total RNA will be extracted using a PCR kit (BioTek Corp, Canada). Small RNA analysis and RNA-seq will be performed on these samples to profile gene and small RNA expression.
[0794] Studies on whitefly infection of tomatoes plant material Tomato plants are grown from seeds collected from plants carrying the desired GEiGS sequence, one per pot, under a 16-hour light / 8-hour dark cycle at 22° C. As a control, wild-type unmodified plants are grown and treated in parallel.
[0795] Whitefly inoculation Five female whiteflies are introduced onto four-week-old tomato plants. The whiteflies are placed in a clip cage holding one leaf. After five days, dead and live whiteflies, as well as eggs, are counted.
[0796] Furthermore, infected leaves were collected 5 days after inoculation and total RNA was extracted. Dead and surviving whiteflies were collected separately and total RNA was extracted from them. These samples were then subjected to small RNA analysis and RNA-seq to profile gene and small RNA expression.
[0797] Research on dsRNA targeting nematode genes Nematodes The potato cyst nematode Globodera rostochiensis (pathotype Ro1, obtained from the James Hutton Institute collection), a plant-parasitic cyst nematode, was maintained at the University of Cambridge under DEFRA license 125034 / 359149 / 3. Nematodes were maintained on potato (Solanum tuberosum) cultivar Desiree. Fifty cysts were combined in a 50:50 sand:loam mixture in 7-inch diameter pots. One tuber per pot was planted and watered regularly at 20°C for three months. The plants were allowed to dry for one month, and cysts were recovered from the soil using a mesh sieve followed by flotation. Larvae were hatched from the cysts by inoculation with tomato root dialysate, which was changed every 2–3 days for up to 14 days. Hatched larvae were stored in water containing 0.01% Tween-20 at 4°C for up to 1 week before being used in subsequent assays.
[0798] Sequence used - AtTAS3a_AT3G17185-SEQ ID NO: 122 - GEiGS-ribosomal protein 3a-transcript-SEQ ID NO: 123 - GEiGS - Ribosomal protein 3a - Transcript - SEQ ID NO: 124 - Shows the region of homology to the target gene generated through GEiGS design to generate siRNA in nematodes (i.e. predicted processed siRNA). - GEiGS-Spliceosome SR Protein-Transcript-SEQ ID NO: 125 - GEiGS-Spliceosome SR Protein-Transcript-SEQ ID NO: 126 - Shows the region of homology to the target gene generated through GEiGS design to generate siRNA in nematodes (i.e. predicted processed siRNA). - miR173_AT2G38325-SEQ ID NO: 127
[0799] RNA preparation for feeding Total RNA was extracted from infiltrated Nicotiana benthamiana leaves using Tri-Reagent (Sigma-Aldrich, USA), washed twice with chloroform, and precipitated overnight with isopropanol. The recovered RNA was further purified by standard sodium acetate precipitation.
[0800] All recovered RNA was cleaned using Amicon® Ultra 0.5 mL Centrifugal Filters with a 3KD cutoff (Merck, USA) according to the manufacturer's instructions and washed three times with DDW. RNA was quantified using a nanodrop.
[0801] Nematode Feeding Protocol The RNA was diluted to 1.76 μg / μL in 1x M9 and 50 mM octopamine. For each repeat, add 3500J2 to a volume of approximately 5 μL in a 1.5 mL Eppendorf flask. The worms were pelleted with 25 μL of RNA solution. 25 μL of RNA solution was added to the worms and incubated at 20°C with rotation at 300 rpm in a heat block (final RNA concentration was 1.47 μg / μL). After 72 hours, the worms were spun down (10 kg for 1 minute) and washed by removing the supernatant. Washing was repeated three times with 500 μL of RNAse-free water. The pellet was flash-frozen in liquid nitrogen and stored at -80°C until processing.
[0802] Nematode RNA extraction and purification RNA isolation was performed using Direct-zol RNA Miniprep: Zymo Research Catalog No. R2052 according to the manufacturer's recommendations.
[0803] Frozen (liquid nitrogen or dry ice) tissue samples (≤25 mg) were ground to a powder in an Eppendorf tube using a microtube pestle. 600 μL of TRI Reagent was added to the sample, and grinding was continued until completely homogenized. The following steps were then performed at room temperature and centrifuged at 10,000–16,000 × g for 30 seconds, unless otherwise specified: 1. To the sample dissolved in TRI Reagent or similar 1, add an equal volume of ethanol (95-100%) and mix thoroughly. 2. The mixture was transferred to a Zymo-Spin™ IICR Column 2 in a collection tube and centrifuged. The column was transferred to a new collection tube and the flow-through was discarded. 3. DNase I treatment was performed on the column (3a) 400 μL of RNA Wash Buffer was added to the column and centrifuged. (3b) 5 μL of DNase I (6 U / μL) and 75 μL of DNA Digestion Buffer were added to an RNase-free tube and mixed. The mixture was then added directly to the column matrix. (3c) Incubate at room temperature (20-30°C) for 15 minutes. 4. Add 400 μL of Direct-zol™ RNA PreWash to the column and centrifuge. Discard the flow-through and repeat the process. 5. Add 700 μL of RNA Wash Buffer to the column and centrifuge for 2 minutes to ensure complete removal of the Wash Buffer. Carefully transfer the column to an RNase-free tube. 6. To elute the RNA, 30 μL of DNase / RNase-Free Water was added directly to the column matrix and centrifuged. 7. RNA was quantified using a NanoDrop spectrophotometer / fluorometer or Qubit fluorometer and the RNA was used immediately or stored frozen at ≦−70°C.
[0804] Preparation of qRT cDNA library (Quanta BIOSCIENCE:qScript Flex cDNA Synthesis Kit) 1. All components (except enzymes) were thawed, mixed thoroughly, centrifuged (before use), and placed on ice (before use). 2. Add the following to a 0.2 mL thin-walled PCR tube or 96-well PCR reaction plate placed on ice: 3. Ingredients Volume RNA (1μg~10pg total RNA) variable Nuclease-free water Variable Oligo dT 2 μL Final volume 15.0 μL (Note: For the mixed primer strategy, 2 μL of Oligo dT was used.) For the reaction, a master mix was prepared at RT using the reaction mix and 5 μL was dispensed into each tube. 4. The components were mixed by gentle vortexing, then centrifuged for 10 seconds to collect the contents. 5. Incubate at 65°C for 5 minutes, then quickly chill in ice. 6. The following was added to the primed RNA template mixture: Ingredients Volume qScript Flex Reaction Mix (5×) 4μL qScript Reverse Transcriptase 1μL Final volume 20.0 μL (Note: For multiplex first strand reactions, prepare a master mix at RT using the reaction mix and dispense 5 μL into each tube). 7. The components were mixed by gentle vortexing and then incubated as follows: 42°C for 60 minutes 85℃ 5 minutes Keep at 4°C 8. After cDNA synthesis was completed, add an additional 30 μL of dH2O or TE buffer [10 mM Tris (pH 8.0), 0.1 mM EDTA] and use 2–3 μL per 20 μL qRTPCR reaction. cDNA can be stored at -20°C.
[0805] SYBR Green Jump Start Taq Ready Reaction Protocol 1. Thaw all components (except enzymes), mix thoroughly, and centrifuge before use. Keep on ice before use. 2. Add the following to a 0.2 mL thin-walled PCR tube or 96-well PCR reaction plate placed on ice: Ingredients Volume 2x SYBR master mix 10 μL Specific forward primer (10uM) 1μL Specific reverse primer (10uM) 1μL cDNA template 2-3 μL Nuclease-free dH2O variable Final volume 20 μL 3. Samples were incubated as follows: 94℃ 2 minutes 94℃ 15 seconds 55-60℃ 60 seconds, 35-40 cycles, read SYBR signal Melting curve: 95℃→65℃, 20℃ / cycle, continuous signal collection 65℃→95℃ / 0.2 seconds
[0806] Reactions were performed in technical triplicate for both the gene of interest and the endogenous calibrator.
[0807] Primer sequences - Spliceosomal SR proteins: qRTSpSR_FWD GCTCAACTGACAAAGAATCTCTCAC - SEQ ID NO: 128 qRTSpSR_REV TTGAAAATTGGGTCAAAGAAATGCG - SEQ ID NO: 129 - Ribosomal protein 3a qRTRib3a_FWD GAACGGTCGCTACGATTACGA - SEQ ID NO: 130 qRTRib3a_REV CAAACGCTCTGTTGAACAGGC-SEQ ID NO: 131 - Endogenous genes for normalization: NEMAACTIN_09251_F TTCCAGCAGATGTGGATCAG-SEQ ID NO: 132 NEMAACTIN_09251_R CGGCCTTATTCTTCAAGCAC-SEQ ID NO: 133
[0808] Materials for bioinformatics analysis The raw Small-RNA data in FASTQ format was processed using cutadapt 2.8 with the parameters "-m18-u4-a NNNNTGGAATTCGGGTGCCAAGG" (SEQ ID NO: 138) to trim the sequencing adapters and remove random adapters, leaving only reads longer than 18 nt. The raw RNA-seq data in FASTQ format was processed using cutadapt 2.8 with the parameters "-m18-a AGATCGGAAGAGCACGTCTGAACTCCAGTCA -A AGATCGGAAGCGTCGTAGGGAAAGAGTGT" (SEQ ID NO: 139) to remove the sequencing adapters and leave only reads longer than 18 nt.
[0809] To accommodate small pseudogenomes, an alignment index was generated for the pseudogenome constructed by the target sequence using STAR version 2.7.1a with the parameter "--genomeSAindexNbases 3."
[0810] Small-RNA adaptor-trimmed reads were aligned to the pseudogenome using STAR 2.7.1a with the parameters "--outSAMtype BAM Unsorted--outFilterMismatchNmax 0--alignIntronMax 1--alignEndsType EndToEnd--scoreDelOpen-10000--scoreInsOpen-10000." RNA-seq adaptor-trimmed reads were aligned using the same resources with the parameters "--outSAMtype BAM Unsorted--alignEndsType EndToEnd--alignIntronMax 500."
[0811] A custom python script was used to filter aligned small-RNA reads to lengths of 20–24 nucleotides and RNA-seq reads to lengths of >50 nucleotides.
[0812] Read coverage for target sequences was calculated using bedtools 2.29.2 with the parameter "genomecov-bg-scale{factor}", which calculates a factor for normalizing read counts to reads per million (RPM).
[0813] Coverage plots were generated using the Sushi package in R (version 1.25.0).
[0814] Example 1A Genome editing-induced gene silencing (GEiGS) To design GEiGS oligos, a template non-coding RNA molecule (precursor) is required that is processed to generate a derivative small silencing RNA molecule (mature). Two precursor sources and their corresponding mature sequences were used to generate GEiGS oligos. For miRNAs, sequences were obtained from the miRBase database [Kozomara, A. and Griffiths-Jones, S., Nucleic Acids Res (2014) 42:D68, AiD73]. The precursor and mature sequences of tasiRNAs were obtained from the tasiRNAdb database [Zhang, C. et al,Bioinformatics(2014)30:1045,Ai1046].
[0815] Silencing targets were selected in various host organisms (data not shown). siRNAs against these targets were designed using siRNArules software [Holen, T., RNA (2006) 12:1620, Ai1625.]. Each of these siRNA molecules was used to replace the mature sequence present in each precursor, generating "naive" GEiGS oligos. The structures of these naive sequences were adjusted to resemble the wild-type precursor structure as closely as possible using ViennaRNA Package v2.6 [Lorenz, R. et al., ViennaRNA Package 2.0. Algorithms for Molecular Biology (2011) 6:26.]. After adjusting the structures, the sequence number and secondary structure changes between the wild-type and modified oligos were calculated. These calculations are essential for identifying potentially functional GEiGS oligos that require minimal sequence modifications relative to the wild-type.
[0816] CRISPR / Cas9 small guide RNAs (sgRNAs) against wild-type precursors were generated using CasOT software [Xiao, A. et al., Bioinformatics (2014) 30:1180, Ai1182]. sgRNAs were selected in which the modifications applied to generate the GEiGS oligos affected the PAM region of the sgRNA, rendering it ineffective against the modified oligo.
[0817] Example 1B Gene silencing of endogenous plant genes - PDS To establish a high-throughput screen for quantitatively assessing endogenous gene silencing using genome editing-induced gene silencing (GEiGS), we investigated several promising visual markers. We chose to focus on genes involved in pigment accumulation, such as those encoding phytoene desaturase (PDS). Silencing PDS induces photobleaching (Figure 8B), enabling its use as a robust seedling screen after gene editing as a proof-of-concept (POC). Figures 8A-C show representative experiments using Nicotiana benthamiana and Arabidopsis thaliana plants silenced for PDS. The plants exhibit a characteristic photobleaching phenotype observed in plants with reduced carotenoid levels.
[0818] For POC experiments, siRNA selection was performed as follows:
[0819] To use the GEiGS application to trigger RNAi mechanisms in Arabidopsis or Nicotiana benthamiana against PDS genes, we need to identify effective 21-24 bp siRNAs targeting PDS. To find active siRNA sequences, we use two approaches: 1) Literature screening—Because PDS silencing is a well-known assay in many plants, we identify well-characterized short siRNA sequences in different plants that are likely to match 100% with the gene in Arabidopsis or Nicotiana benthamiana. 2) Numerous algorithms have been published that predict which siRNAs will be effective in triggering gene silencing for a given gene. Because these algorithms are not 100% accurate, we use a 24-bp siRNA library. We only use sequences that are the product of at least two different algorithms.
[0820] To use siRNA sequences to silence the PDS gene, the present inventors used the CRISPR / Cas9 system to exchange them with known endogenous non-coding RNA gene sequences (e.g., by modifying miRNA sequences, modifying long dsRNA sequences, creating antisense RNAs, modifying tRNAs, etc.). While numerous databases of characterized non-coding RNAs, such as miRNAs, exist, the present inventors selected several known endogenous non-coding RNAs, such as miRNAs, from Arabidopsis thaliana or Nicotiana benthamiana that have different expression profiles (e.g., low constitutive expression, high expression, stress-induced expression, etc.). For example, the present inventors used a homologous recombination (HR) approach to exchange endogenous miRNA sequences with siRNAs targeting the PDS gene. When using HR, two options are envisioned: using a donor ssDNA oligo sequence of approximately 250–500 nt containing a modified miRNA sequence in the center, or using a plasmid carrying a 1–4 kb insert with minimal modifications to the surrounding miRNA in the plant genome except for 2 × 21 bp of the miRNA modified with siRNA in the PDS and the *miRNA (500–2,000 bp upstream and downstream of the siRNA, as shown in Figure 7). The transfection includes the following constructs: a CRISPR:Cas9 / GFP sensor for tracking and enriching positive transformants, and a gRNA to guide Cas9 to generate a double-strand break (DSB) that is repaired by HR depending on the insertion vector / oligo. The insertion vector / oligo contains two contiguous regions of homology surrounding the target locus to be replaced (i.e., miRNA) and modified to carry the mutation of interest (i.e., siRNA). When using a plasmid, the targeting construct, which may or may not contain restriction enzyme recognition sites, is used as a template for homologous recombination, which terminates in replacement of the miRNA with the siRNA of choice. After transfection into protoplasts, FACS is used to enrich for Cas9 / sgRNA-transfected eve...
Claims
1. 1. A method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, comprising: (a) selecting a nucleic acid sequence in the genome of a plant that encodes a silencing molecule having a plant gene as a target, the silencing molecule being capable of recruiting an RNA-dependent RNA polymerase (RdRp); (b) modifying the nucleic acid sequence of the plant gene to confer silencing specificity for the pest gene, such that transcripts of the plant gene having the silencing specificity form base complementarity with the silencing molecule capable of recruiting the RdRp to produce long dsRNA molecules capable of silencing the pest gene; thereby producing in said plant cells long dsRNA molecules capable of silencing said pest gene; A method comprising:
2. The method of claim 1, wherein the silencing molecule capable of recruiting the RdRp comprises 21 to 24 nucleotides.
3. 3. The method of any one of claims 1 to 2, wherein the silencing molecule capable of recruiting the RdRp is selected from the group consisting of trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous translocating RNA.
4. 4. The method of claim 3, wherein the miRNA comprises a mature small RNA of 22 nucleotides.
5. The miRNA is miR-156a, miR-156c, miR-162a, miR-162b, miR-167d, miR-169b, miR-173, miR-393a, miR-393b, miR-402, miR-403, miR-447a, m iR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828, miR-830, miR-831, miR-831, miR-833a, miR-833a, miR-840, miR-845b, miR-848 5. The method of claim 3 or 4, wherein the target gene is selected from the group consisting of miR-8166, miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f, miR-8177, and miR-8182.
6. The method according to any one of claims 1 to 5, wherein the plant gene is a non-protein-coding gene.
7. The method of any one of claims 1 to 6, wherein the plant gene encodes a molecule that has endogenous silencing activity against a native plant gene.
8. The modification in step (b) modifies the silencing specificity of the plant gene to that of the native plant.
8. The method of claim 1, further comprising introducing into the plant cell a DNA editing agent that redirects said pest gene toward a different pest gene.
9. 9. The method of claim 7 or 8, wherein the plant gene having endogenous silencing activity is selected from the group consisting of trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), autonomous and non-autonomous translocating RNA.
10. The method of any one of claims 7 to 9, wherein the plant gene with endogenous silencing activity encodes a phased secondary siRNA generating molecule.
11. The method according to any one of claims 7 to 9, wherein the plant gene with endogenous silencing activity is a trans-acting siRNA generating (TAS) molecule.
12. The method of any one of claims 1 to 11, wherein the plant gene silencing specificity is determined by measuring the transcript level of the pest gene.
13. The method of any one of claims 1 to 12, wherein the silencing specificity of the plant gene is determined phenotypically.
14. 14. The method of claim 13, wherein the phenotypic determination is performed by determining the pest resistance of the plant.
15. The method of any one of claims 1 to 14, wherein the plant gene silencing specificity is determined genotypically.
16. 16. The method of claim 15, wherein the phenotype of the plant is determined before the genotype of the plant.
17. 16. The method of claim 15, wherein the genotype of the plant is determined before the phenotype of the plant.
18. 1. A method for producing in a plant cell a long dsRNA molecule capable of silencing a pest gene, comprising: (a) selecting a nucleic acid sequence of a plant gene that exhibits a predetermined sequence homology to the nucleic acid sequence of the pest gene; (b) modifying an endogenous nucleic acid sequence of the plant encoding an RNA molecule to confer silencing specificity for the plant gene, such that small RNA molecules capable of recruiting RNA-dependent RNA polymerase (RdRp) processed from the RNA molecule form base complementarity with a transcript of the plant gene to produce long dsRNA molecules capable of silencing the pest gene; thereby producing in said plant cells long dsRNA molecules capable of silencing said pest gene; A method comprising:
19. 19. The method of claim 18, wherein the predetermined sequence homology comprises 75 to 100% identity.
20. 20. The method of any one of claims 18 to 19, wherein the small RNA molecule capable of recruiting the RdRp comprises 21 to 24 nucleotides.
21. 21. The method of any one of claims 18 to 20, wherein the small RNA molecule capable of recruiting the RdRp is selected from the group consisting of microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-binding RNA (piRNA), trans-acting siRNA (tasiRNA), phased small interfering RNA (phasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous translocating RNA.
22. The method of any one of claims 18 to 21, wherein the RNA molecule has endogenous silencing activity against a native plant gene.
23. 23. The method of any one of claims 18 to 22, wherein the modification in step (b) comprises introducing into the plant cell a DNA editing agent that redirects the silencing specificity of the RNA molecule towards a plant gene that is different from the native plant gene.
24. 24. The method of any one of claims 18 to 23, wherein the plant gene exhibiting the predetermined sequence homology to the nucleic acid sequence of the pest gene does not encode a silencing molecule.
25. The method of any one of claims 18 to 24, wherein the silencing specificity of the RNA molecule is determined by measuring the transcript level of the plant gene or the pest gene.
26. The method of any one of claims 18 to 25, wherein the silencing specificity of the RNA molecule is determined phenotypically.
27. 27. The method of claim 26, wherein the phenotypic determination is performed by determining the pest resistance of the plant.
28. The method of any one of claims 18 to 27, wherein the silencing specificity of the RNA molecule is determined genotypically.
29. 29. The method of claim 28, wherein the phenotype of the plant is determined before the genotype of the plant.
30. 29. The method of claim 28, wherein the genotype of the plant is determined before the phenotype of the plant.
31. 31. The method of any one of claims 8-17 or 23-30, wherein the DNA editing agent comprises at least one sgRNA.
32. 32. The method of any one of claims 8 to 17 or 23 to 31, wherein the DNA editing agent does not comprise an endonuclease.
33. 32. The method of any one of claims 8 to 17 or 23 to 31, wherein the DNA editing agent comprises an endonuclease.
34. The method according to any one of claims 8 to 17 or 23 to 33, wherein the DNA editing agent is a member of a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR endonucleases, dCRISPR endonucleases, and homing endonucleases.
1. The method according to claim 1.
35. 35. The method of claim 33 or 34, wherein the endonuclease comprises Cas9.
36. 36. The method of any one of claims 8-17 or 23-35, wherein the DNA editing agent is applied to the cell as DNA, RNA, or RNP.
37. The method of any one of claims 1 to 36, wherein the plant cell is a protoplast.
38. The method of any one of claims 1 to 37, wherein the dsRNA molecule is processable by intracellular RNAi processing machinery.
39. 39. The method of any one of claims 1 to 38, wherein the dsRNA molecule is processed into secondary small RNAs.
40. 40. The method of any one of claims 1 to 39, wherein the dsRNA and / or the secondary small RNA has silencing specificity for a pest gene.
41. A method for producing a pest-tolerant or -resistant plant, comprising producing in a plant cell a long dsRNA molecule capable of silencing a pest gene according to any one of claims 1 to 40.
42. 42. The method of claim 41, wherein the pest is an invertebrate.
43. 43. The method of claim 41 or 42, wherein the pest is selected from the group consisting of viruses, ants, termites, bees, wasps, caterpillars, crickets, migratory locusts, beetles, snails, slugs, nematodes, cockroaches, bug flies, fruit flies, whiteflies, mosquitoes, grasshoppers, planthoppers, earwigs, aphids, scale insects, vorticella, spiders, mites, psyllids, ticks, moths, caterpillars, scorpions, and fungi.
44. 44. A plant produced by the method of any one of claims 1 to 43.
45. 45. The plant of claim 44, selected from the group consisting of crops, ornamental plants, weeds, and trees.
46. 46. The plant of claim 44 or 45, which is non-transgenic.
47. A cell of a plant according to any one of claims 44 to 46.
48. A seed of the plant according to any one of claims 44 to 46.
49. 1. A method for producing a pest-tolerant or resistant plant, comprising: (a) breeding a plant according to any one of claims 44 to 46; (b) selecting progeny plants that express the long dsRNA molecule capable of silencing the pest gene and that do not contain the DNA editing agent; thereby producing said pest-tolerant or resistant plants; A method comprising:
50. 48. A method of producing a plant or plant cell according to any one of claims 44 to 47, comprising growing the plant or plant cell under conditions which allow reproduction.
Citation Information
Patent Citations
Guide RNA with chemical modifications
US20160289675A1