Method for predicting treatment resistance of patient with dermatomyositis or interstitial pneumonia, and kit used for the method

Abstract

To provide a method for predicting treatment resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia.SOLUTION: A method for predicting treatment resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonitis includes a step of measuring the concentration of anti-MDA5 antibodies in blood samples collected from the patient. The anti-MDA5 antibodies are anti-MDA5 antibodies that recognize the inside of a region at positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1 as an epitope, and / or anti-MDA5 antibodies that recognize the inside of a region at positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1 as an epitope.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present disclosure relates to a method for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia, and a kit used in the method. [Background technology]

[0002] Dermatomyositis is a systemic inflammatory disease that presents with skin symptoms (heliotrope rash, Gottron's sign, etc.), muscle symptoms (myositis), and respiratory symptoms (interstitial pneumonia). Myositis-specific autoantibodies and myositis-associated autoantibodies have been reported in many cases of dermatomyositis, and because each autoantibody has corresponding clinical characteristics, identifying autoantibodies in dermatomyositis patients is useful for diagnosing / classifying myositis, determining testing or treatment plans, and predicting prognosis.

[0003] Clinically amyopathic dermatomyositis is a type of dermatomyositis characterized by skin symptoms but mild or no muscle symptoms. Clinically amyopathic dermatomyositis is known to frequently be associated with rapidly progressive interstitial pneumonia, often accompanied by a dry cough and progressive dyspnea. Anti-MDA5 antibodies (anti-CADM-140 antibodies) have been identified as autoantibodies associated with clinically amyopathic dermatomyositis, and diagnostic kits using MDA5 have been developed (Patent Document 1). It has also been reported that the prognosis of anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia can be improved by triple therapy with steroids, cyclophosphamide, and calcineurin inhibitors (Non-Patent Document 1, etc.). Today, this triple therapy has been established as a treatment for anti-MDA5 antibody-positive dermatomyositis and interstitial pneumonia.

[0004] Meanwhile, recent studies of the epitopes of anti-MDA5 antibodies found in anti-MDA5 antibody-positive dermatomyositis have reported that the anti-MDA5 antibodies recognize the helicase domains of MDA5 (Hel1, Hel2i, Hel2, and pincer) as epitopes (Non-Patent Documents 2 and 3). It has also been reported that anti-MDA5 antibodies that bind to the region at positions 905 to 1026 of the amino acid sequence of MDA5 have higher antibody titers in women than in men, that the antibody titers of anti-MDA5 antibodies that bind to the region at positions 646 to 801 of the amino acid sequence are associated with muscle symptoms, that the antibody titers of anti-MDA5 antibodies that bind to the region at positions 130 to 284 or 517 to 671 of the amino acid sequence are associated with interstitial pneumonia, and that the antibody titers of anti-MDA5 antibodies that bind to the region at positions 1 to 155 of the amino acid sequence were high in cases of fatal interstitial pneumonia (Non-Patent Document 4). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2010 / 024089 [Non-patent literature]

[0006] [Non-Patent Document 1] Hideki Tsuji et al., Arthritis Rheumatol. 2020, 72(3), 488-498. doi: 10.1002 / art.41105. [Non-patent document 2] Yongxin Mo et al., Rheumatology, 2023, 00, 1-10, https: / / doi.org / 10.1093 / rheumatology / kead397. [Non-patent document 3] Eveline Van Gompel et al., Rheumatology, 2023, 00, 1-8, https: / / doi.org / 10.1093 / rheumatology / kead400 Advance access publication 12 August 2023. [Non-patent document 4] Yamaguchi K, et al. Rheumatology (Oxford). 2023 Oct 10: kead550. doi: 10.1093 / rheumatology / kead550. Summary of the Invention [Problem to be solved by the invention]

[0007] Established treatments for dermatomyositis and interstitial pneumonia (particularly anti-MDA5 antibody-positive dermatomyositis and interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis) involve administering at least one of steroids, cyclophosphamide, and a calcineurin inhibitor. However, some patients exhibit resistance to these drugs and have a poor prognosis. Therefore, when determining treatment strategies for dermatomyositis and interstitial pneumonia, it is desirable to predict patients who will exhibit resistance to these drugs and administer additional treatments to these patients early on. Furthermore, for patients who have already been administered these drugs but have not shown sufficient therapeutic benefit, it is desirable to identify resistance early and add additional treatments. However, no technology has been developed to predict resistance to these drugs. As mentioned above, although there have been reports on the epitopes of anti-MDA5 antibodies found in anti-MDA5 antibody-positive dermatomyositis, the relationship between the epitopes of anti-MDA5 antibodies and resistance to these drugs is unknown.

[0008] Therefore, an objective of the present disclosure is to provide a method for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in patients with dermatomyositis or interstitial pneumonia, and a kit for use in said method. [Means for solving the problem]

[0009] The present inventors conducted extensive research to solve the above-mentioned problems and found that some patients with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis have anti-MDA5 antibodies that recognize an epitope within the region of amino acid sequences 201 to 300 or 601 to 700 of the MDA5 amino acid sequence. Furthermore, the inventors found that patients with high serum concentrations of anti-MDA5 antibodies that recognize these epitopes frequently exhibit resistance to triple-drug combination therapy with prednisolone, cyclophosphamide, and tacrolimus. Based on these findings, the inventors discovered that the concentration of anti-MDA5 antibodies that recognize these epitopes in blood samples from patients with dermatomyositis or interstitial pneumonia can be used as an indicator to predict resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors.

[0010] That is, the present disclosure provides the inventions of the following aspects. Item 1. A method for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia, comprising: measuring the concentration of anti-MDA5 antibodies in a blood sample taken from the patient; The prediction method, wherein the anti-MDA5 antibody is an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and / or an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1. Item 2. The prediction method according to Item 1, wherein the patient is a patient with anti-MDA5 antibody-positive dermatomyositis, a patient with dermatomyositis suspected of being anti-MDA5 antibody-positive, a patient with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis, or a patient with interstitial pneumonia suspected of being anti-MDA5 antibody-positive dermatomyositis. Item 3. The prediction method according to Item 1 or 2, wherein the treatment resistance is treatment resistance to triple therapy of a steroid, cyclophosphamide, and a calcineurin inhibitor. Item 4. The prediction method according to Item 1 or 2, wherein the treatment resistance is treatment resistance to triple therapy of prednisolone, cyclophosphamide, and tacrolimus. Item 5. The prediction method according to Item 1 or 2, wherein the anti-MDA5 antibody to be measured is both an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1. Item 6. The prediction method according to Item 1 or 2, wherein the blood sample is serum. Item 7. The prediction method according to Item 1 or 2, wherein the anti-MDA5 antibody is measured by an immunological assay. Item 8. A kit for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia, comprising: The kit comprises a reagent for measuring an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and / or an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1. Item 9. The kit according to Item 8, wherein the reagent is a reagent for measuring the anti-MDA5 antibody by immunological assay and comprises at least (i) an MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment, and / or (ii) an MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment, as an antigen. Item 10. The kit according to Item 8 or 9, wherein the antigen is immobilized on an enzyme immunoassay plate or magnetic particles. Item 11. The kit according to Item 8 or 9, which includes at least one of a blood sample from a healthy subject, a blood sample from a patient who was resistant to treatment with the drug, and a blood sample from a patient who was non-resistant to treatment with the drug as a control. [Effects of the Invention]

[0011] The present disclosure provides a method and kit for predicting treatment resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in patients with dermatomyositis or interstitial pneumonia. In particular, some patients with anti-MDA5 antibody-positive dermatomyositis and interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis have been found to be resistant to triple therapy consisting of steroids, cyclophosphamide, and calcineurin inhibitors. The technology disclosed herein makes it possible to identify such treatment-resistant patients and provide appropriate additional treatment other than the triple therapy at an early stage, thereby saving their lives. [Brief explanation of the drawings]

[0012] [Figure 1] This is a schematic diagram showing the domains of MDA5 and the locations of each MDA5 fragment peptide used in the study. In Figure 1, CARD stands for the caspase recruitment domain, Hel for the helicase domain, P for the pincer, and CTD for the C-terminal domain. [Figure 2] These are the results of a search using the SELEX method for the epitope of anti-MDA5 antibodies in the serum of a patient with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis. The X axis represents the patient number, the Y axis represents the MDA5 peptide fragments, and the Z axis represents the enrichment score. On the Y axis, each peptide fragment is arranged in order, with the N-terminus at the front and the C-terminus at the back. A shows the results for 16 samples, while B shows the results for 14 samples, excluding two outlier cases, Patient No. 1 and Patient No. 9, for easier visualization. [Figure 3]These are the results of an ELISA search for anti-MDA5 antibody epitopes in the serum of patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia. The X axis represents the patient number, the Y axis represents MDA5 fragment peptides, and the Z axis represents the OD value. On the Y axis, each fragment peptide is arranged in order, with the N-terminus at the front and the C-terminus at the back. Figure A shows the results for 16 samples, while Figure B shows the results for 14 samples, excluding patient numbers 1 and 9, for comparison with Figure 2B. [Figure 4] FIG. 1 shows a correlation between the measurement results of the SELEX method and the measurement results of the ELISA method for the reactivity of anti-MDA5 antibodies in the serum of patients with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis to AA201-300 or AA601-700. [Figure 5] Thirty patients with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis were treated with a unified triple therapy protocol. The patients were divided into a treatment-resistant group (n=16) and a treatment-non-resistant group (n=14), and the reactivity of serum anti-MDA5 antibodies to AA201-300 or AA601-700 was measured using ELISA. [Figure 6] This figure shows the results of univariate analysis by logistic regression for 30 cases of interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis who received uniform treatment using a triple therapy treatment protocol. The treatment-resistant group was defined as positive (1) and the treatment-non-resistant group as negative (0), and the reactivity of serum to AA201-300 or AA601-700 (OD value by ELISA) was used as the explanatory variable. [Figure 7] This figure shows the ELISA unit values of the serum of 30 cases who underwent uniform treatment using a triple therapy protocol for interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis. The ELISA unit values of the serum of each case were calculated based on the reactivity of the control serum to AA201-300 or AA601-700, and the ELISA unit values of AA201-300 and AA601-700 for the 30 cases were plotted. DETAILED DESCRIPTION OF THE INVENTION

[0013] 1.Definition Unless otherwise specified, terms used in this disclosure have the meanings that are commonly understood by those skilled in the art of medicine, pharmacology, molecular biology, microbiology, organic chemistry, etc. If a term defined in this disclosure does not have the same meaning as commonly understood, the contents of this disclosure shall take precedence.

[0014] In the present disclosure, "MDA5 (melanoma differentiation associated gene 5)" is a receptor that recognizes RNA viruses intracellularly and is a molecule that induces type I interferon; it is also referred to as IFIH1. The amino acid sequence of human MDA5 is as shown in SEQ ID NO: 1, and is also registered as UniProt number Q9BYX4. In the present disclosure, the numbers of amino acid residues in the amino acid sequence of human MDA5 (SEQ ID NO: 1) are written with the N-terminus numbered 1. That is, for example, the region from positions 201 to 300 in the amino acid sequence shown in SEQ ID NO: 1 refers to the region from the 201st amino acid residue to the 300th amino acid residue from the N-terminus in the amino acid sequence shown in SEQ ID NO: 1.

[0015] In the present disclosure, an "anti-MDA5 antibody" refers to an antibody that recognizes MDA5 as an antigen. Furthermore, in the present disclosure, an "anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1" refers to an anti-MDA5 antibody that binds to the region of positions 201 to 300 of human MDA5 (SEQ ID NO: 1), and is an anti-MDA5 antibody that can bind to the MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1. Furthermore, in the present disclosure, an "anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1" refers to an anti-MDA5 antibody that binds to the region of positions 601 to 700 of human MDA5 (SEQ ID NO: 1), and is an anti-MDA5 antibody that can bind to the MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1. In the present disclosure, an "anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1" may be referred to as anti-MDA5 antibody A, and an "anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1" may be referred to as anti-MDA5 antibody B.

[0016] In this disclosure, "dermatomyositis" refers to a disease characterized by skin symptoms such as heliotrope rash, Gottron papules, and Gottron sign, as well as weakness of the proximal muscles of the upper or lower limbs, spontaneous muscle pain or pain when gripping the muscles, elevated serum myogenic enzymes (creatine kinase or aldolase), electromyographic changes indicative of myositis, arthritis or arthralgia without bone destruction, signs of systemic inflammation (fever, elevated CRP, or elevated erythrocyte sedimentation rate), positivity for myositis-specific autoantibodies (anti-ARS antibodies (including anti-Jo-1 antibodies), anti-MDA5 antibodies, anti-Mi-2 antibodies, anti-TIF1γ antibodies, anti-NXP2 antibodies, anti-SAE antibodies, anti-SRP antibodies, or anti-HMGCR antibodies), and pathological findings of myositis on muscle biopsy. In this disclosure, dermatomyositis also includes clinically amyopathic dermatomyositis, which is characterized by skin symptoms but mild or no muscle symptoms. Dermatomyositis is diagnosed according to the 2017 ACR / EULAR IIM new classification criteria (PM / DM / ADM) or the diagnostic criteria for the Ministry of Health, Labour and Welfare's designated intractable diseases 50 (dermatomyositis / polymyositis).

[0017] In the present disclosure, "anti-MDA5 antibody-positive dermatomyositis" refers to dermatomyositis in which anti-MDA5 antibodies are detected as myositis-specific autoantibodies. Whether or not dermatomyositis is anti-MDA5 antibody-positive can be determined using a commercially available test kit, etc. Furthermore, in the present disclosure, "dermatomyositis suspected of being anti-MDA5 antibody-positive" refers to dermatomyositis in which anti-MDA5 antibody positivity has not been confirmed, but which is clinically suspected of being anti-MDA5 antibody-positive, such as in cases diagnosed or suspected of dermatomyositis that also develop rapidly progressive interstitial pneumonia.

[0018] In this disclosure, "interstitial pneumonia" refers to a disease in which bilateral diffuse shadows are observed on chest X-rays or CT images, and in which the interstitial space of the lungs is the site of inflammation or fibrotic lesions. In this disclosure, "interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis" refers to anti-MDA5 antibody-positive dermatomyositis complicated with interstitial pneumonia. In addition, in this disclosure, "interstitial pneumonia suspected of being anti-MDA5 antibody-positive dermatomyositis" refers to interstitial pneumonia that has not been diagnosed as anti-MDA5 antibody-positive dermatomyositis but is clinically suspected of having developed anti-MDA5 antibody-positive dermatomyositis, such as a case diagnosed or suspected of dermatomyositis that also develops rapidly progressive interstitial pneumonia.

[0019] In the present disclosure, "treatment resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors" refers to a lack of remission or poor clinical response despite administration of the drug. For example, in the case of interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis, treatment resistance refers to the need for additional treatment, such as plasma exchange or a JAK inhibitor, due to worsening respiratory distress, decreased oxygenation, or worsening interstitial pneumonia on imaging, despite the use of the drug, or death due to exacerbation of interstitial pneumonia without achieving remission. Furthermore, in the present disclosure, the absence of treatment resistance (i.e., remission or a sufficient clinical response is observed upon administration of the drug) is referred to as "treatment non-resistant."

[0020] In this disclosure, a "blood sample" is a sample derived from blood, and includes whole blood, serum, and plasma.

[0021] 2. Method for predicting treatment resistance in patients with dermatomyositis or interstitial pneumonia In one embodiment of the present disclosure, a method for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia is provided. The predictive method of the present disclosure can also be referred to as a method for assisting in predicting therapeutic resistance to the drug. The predictive method of the present disclosure can also be referred to as a method for testing therapeutic resistance to the drug.

[0022] Specifically, the prediction method of the present disclosure comprises a step of measuring the concentration of an anti-MDA5 antibody in a blood sample collected from a patient with dermatomyositis or interstitial pneumonia, wherein the anti-MDA5 antibody recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and / or an anti-MDA5 antibody recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1. The prediction method of the present disclosure is described in detail below.

[0023] [Target patients] In the prediction method of the present disclosure, the target patient is a patient with dermatomyositis or interstitial pneumonia for which treatment resistance is desired to be predicted. In the prediction method of the present disclosure, the type of dermatomyositis or interstitial pneumonia suffered by the target patient is not particularly limited. However, since the prediction method of the present disclosure uses the presence of an anti-MDA5 antibody that recognizes an epitope in a specific region as an indicator, patients predicted to exhibit treatment resistance by the prediction method of the present disclosure are assumed to possess an anti-MDA5 antibody as an autoantibody. Therefore, suitable examples of target patients for the prediction method of the present disclosure include patients with anti-MDA5 antibody-positive dermatomyositis, dermatomyositis suspected of being anti-MDA5 antibody-positive, interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis, and interstitial pneumonia suspected of being anti-MDA5 antibody-positive dermatomyositis. Among these, anti-MDA5 antibody-positive dermatomyositis and interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis are more preferred.

[0024] Furthermore, patients with dermatomyositis who are not suspected of being anti-MDA5 antibody positive, or patients with interstitial pneumonia who are not suspected of having anti-MDA5 antibody-positive dermatomyositis but who have not been confirmed to be anti-MDA5 antibody negative by testing, may possess anti-MDA5 antibodies and can therefore be target patients for the prediction method of the present disclosure.

[0025] In the prediction method of the present disclosure, the target patient may be a patient before starting treatment with at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors, or a patient currently being treated with the drug. When the prediction method of the present disclosure targets a patient before starting treatment with the drug, it can be useful for predicting the effectiveness of treatment with the drug. Furthermore, when the prediction method of the present disclosure targets a patient currently being treated with the drug, it can be useful for determining whether or not to introduce additional treatment.

[0026] [Blood sample] In the prediction method of the present disclosure, a blood sample collected from a subject patient is used as a measurement sample. The blood sample may be any of whole blood, serum, or plasma, with serum being a preferred example.

[0027] [Measurement of anti-MDA5 antibodies] The concentrations in a blood sample of an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence of MDA5 (SEQ ID NO: 1) (sometimes referred to as "anti-MDA5 antibody A") and an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence of MDA5 (SEQ ID NO: 1) (sometimes referred to as "anti-MDA5 antibody B") serve as indicators of treatment resistance in patients with dermatomyositis or interstitial pneumonia. Therefore, the prediction method of the present disclosure measures the concentrations of anti-MDA5 antibody A and / or anti-MDA5 antibody B in a blood sample.

[0028] In the prediction method disclosed herein, it is sufficient to measure at least one of anti-MDA5 antibody A and anti-MDA5 antibody B, but by measuring both anti-MDA5 antibody A and anti-MDA5 antibody B, it becomes possible to predict treatment resistance with higher accuracy.

[0029] Anti-MDA5 antibody A or anti-MDA5 antibody B can be measured by any known method as long as it can specifically measure anti-MDA5 antibody A or anti-MDA5 antibody B.

[0030] Specific examples of methods for measuring anti-MDA5 antibody A include immunological assays using, as an antigen, an MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, or a fusion protein of the MDA5 fragment. Here, the MDA5 fragment fusion protein refers to a fusion protein in which an amino acid, peptide, or protein is bound to at least one of the N-terminus and C-terminus of an MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and the amino acid sequence other than the MDA5 fragment portion may be designed to prevent binding of anti-MDA5 antibodies other than anti-MDA5 antibody A. The type of immunological assay is not particularly limited, and any method commonly used in the art can be used, including, for example, chemiluminescent enzyme immunoassay (CLEIA), chemiluminescent immunoassay (CLIA), electrochemiluminescent immunoassay (ECLIA), enzyme-linked immunosorbent assay (EIA), and enzyme-linked immunosorbent assay (ELISA).

[0031] Specific examples of methods for measuring anti-MDA5 antibody B include immunological assays using, as an antigen, an MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1, or a fusion protein of the MDA5 fragment. Here, the MDA5 fragment fusion protein refers to a fusion protein in which an amino acid, peptide, or protein is bound to at least one of the N-terminus and C-terminus of an MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1, and the amino acid sequence other than the MDA5 fragment may be designed to such an extent that anti-MDA5 antibodies other than anti-MDA5 antibody B do not bind to the fragment. The type of immunological assay is not particularly limited, and any assay commonly used in the art can be used, including, for example, chemiluminescent enzyme immunoassay (CLEIA), chemiluminescent immunoassay (CLIA), electrochemiluminescent immunoassay (ECLIA), enzyme-linked immunosorbent assay (EIA), and enzyme-linked immunosorbent assay (ELISA).

[0032] [Treatments to predict treatment resistance] The prediction method of the present disclosure predicts therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors.

[0033] The type of steroid to be predicted for treatment resistance is not particularly limited, and examples thereof include prednisolone, methylprednisolone, betamethasone, cortisone, hydrocortisone, triamcinolone dexamethasone, fluocinonide, etc. Among these, prednisolone is a suitable example of a steroid to be predicted for treatment resistance.

[0034] The type of calcineurin inhibitor to be predicted for treatment resistance is not particularly limited, but examples thereof include tacrolimus and cyclosporine. A suitable example of a calcineurin inhibitor to be predicted for treatment resistance is tacrolimus.

[0035] In the prediction method of the present disclosure, the treatment for which resistance is predicted may be a treatment using at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors, but is preferably a combination treatment of two or more of these drugs, and more preferably a combination treatment of three of these drugs. In a preferred embodiment of the treatment for which resistance is predicted in the prediction method of the present disclosure, the treatment is a triple-drug combination treatment of prednisolone, cyclophosphamide, and a calcineurin inhibitor. In another preferred embodiment of the treatment for which resistance is predicted in the prediction method of the present disclosure, the treatment is a triple-drug combination treatment of prednisolone, cyclophosphamide, and tacrolimus.

[0036] [Prediction of treatment resistance] In the prediction method of the present disclosure, therapeutic resistance to the drug is predicted using the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in a blood sample as an index. Specifically, the higher the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in a blood sample, the more likely it is predicted that therapeutic resistance to the drug will be exhibited. Furthermore, by measuring both anti-MDA5 antibody A and anti-MDA5 antibody B in a blood sample, if the concentration of at least one of anti-MDA5 antibody A and anti-MDA5 antibody B in the blood sample is high, it is predicted with higher accuracy that therapeutic resistance to the drug will be exhibited.

[0037] In the prediction method of the present disclosure, the level of anti-MDA5 antibody A or anti-MDA5 antibody B in a blood sample can be determined based on at least one of a blood sample from a healthy subject, a blood sample from a patient who was previously resistant to the drug, and a blood sample from a patient who was previously non-resistant to the drug. For example, if the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in the blood sample from the subject patient is higher than the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in blood samples from a healthy subject or a patient who was previously non-resistant to the drug, the subject patient is predicted to be highly likely to exhibit resistance to the drug. Furthermore, for example, if the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in the blood sample from the subject patient is equal to or higher than the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in blood samples from patients who were previously resistant to the drug, the subject patient is predicted to be highly likely to exhibit resistance to the drug. Furthermore, for example, a cutoff value for distinguishing between treatment resistance and treatment non-resistance can be determined in advance based on the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in a blood sample from a healthy individual, a blood sample from a patient who was treatment-resistant to the drug, or a blood sample from a patient who was treatment-non-resistant to the drug, and if the concentration of anti-MDA5 antibody A or anti-MDA5 antibody B in the blood sample of the target patient is equal to or higher than the cutoff value, it can be predicted that the target patient is likely to exhibit treatment resistance to the drug.

[0038] If the target patient is a patient before initiating treatment with the drug and is predicted to be highly likely to develop resistance to the drug, a careful decision can be made as to whether to start treatment with the drug and whether to add a treatment other than the drug from the early stage, taking into account the results of clinical diagnosis, pathological diagnosis, etc. Furthermore, if the target patient is a patient undergoing treatment with the drug and is predicted to be highly likely to develop resistance to the drug, a careful decision can be made as to whether to continue treatment with the drug and whether to add another treatment, taking into account the results of clinical diagnosis, pathological diagnosis, etc.

[0039] 3. A kit for predicting treatment resistance in patients with dermatomyositis or interstitial pneumonia In another embodiment of the present disclosure, there is provided a kit for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia. Specifically, the kit of the present disclosure includes a reagent for measuring anti-MDA5 antibody A and / or anti-MDA5 antibody B. The kit of the present disclosure is a measurement kit used to carry out the above-mentioned prediction method, and the contents described in the section "2. Method for predicting therapeutic resistance in a patient with dermatomyositis or interstitial pneumonia" are also incorporated by reference into the kit of the present disclosure.

[0040] Specifically, the reagent for measuring anti-MDA5 antibody A and / or anti-MDA5 antibody B is a reagent for measuring anti-MDA5 antibody A and / or anti-MDA5 antibody B by immunoassay. A reagent for measuring anti-MDA5 antibody A by immunoassay may contain, as an antigen, at least an MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence set forth in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment. A reagent for measuring anti-MDA5 antibody B by immunoassay may contain, as an antigen, at least an MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence set forth in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment. When the kit of the present disclosure is a kit for EIA or ELISA, the antigen may be provided in a state immobilized on an enzyme immunoassay plate. When the kit of the present disclosure is a kit for CLEIA, CLIA, or ECLIA, the antigen may be provided in a state immobilized on magnetic particles.

[0041] Furthermore, the kit of the present disclosure may contain necessary reagents, such as a labeled secondary antibody (anti-human antibody), a color-developing reagent, a dilution or reaction buffer solution, etc., depending on the type of immunoassay method employed.

[0042] In addition, in order to facilitate prediction of treatment resistance, the kit of the present disclosure preferably includes at least one of a blood sample from a healthy subject, a blood sample from a patient who was treatment resistant to the drug, and a blood sample from a patient who was treatment non-resistant to the drug as a control. [Example]

[0043] The present disclosure is not limited in any way to the above-described embodiments of the invention or the following examples. Various modifications within the scope of the claims and within the scope that can be easily conceived by a person skilled in the art are also included in the present invention. The contents of the documents and other references cited in this specification are incorporated herein by reference in their entirety.

[0044] 1. MDA5 fragment peptide designation An MDA5 fragment peptide consisting of amino acid residues at positions x to y in the amino acid sequence of human MDA5 (SEQ ID NO: 1) is represented as "AAx-y." For example, an MDA5 fragment peptide consisting of amino acid residues at positions 201 to 300 in the amino acid sequence of human MDA5 is represented as "AA201-300," an MDA5 fragment peptide consisting of amino acid residues at positions 601 to 700 in the amino acid sequence of human MDA5 is represented as "AA601-700," etc.

[0045] In the following experiments, the following MDA5 fragment peptides were used: AA1-100, AA51-150, AA101-200, AA151-250, AA201-300, AA251-350, AA301-400, AA351-450, AA401-500, AA451-550, AA501-600, AA551-650, AA601-700, AA651-750, AA701-800, AA751-850, AA801-900, AA851-950, AA901-1000, and AA951-1025. Figure 1 shows the MDA5 domains and the corresponding positions of each MDA5 fragment peptide.

[0046] 2. Test materials and test methods 2-1. Patient serum and clinical information This study was conducted by obtaining serum and clinical information from patients who agreed to participate in a clinical study (R1540) approved by the Kyoto University Medical Ethics Committee.

[0047] (1) Samples used to search for the epitope of anti-MDA5 antibodies Sera were collected from 14 patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia who were treated at Kyoto University Hospital (Japan) between 2017 and 2021. Anti-MDA5 antibody positivity was confirmed by protein immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) (Reference 1). Dermatomyositis was diagnosed using the 2017 ACR / EULAR classification criteria, including cutaneous amyloidotic dermatomyositis (Reference 2). Interstitial pneumonia was confirmed by chest CT. Anti-MDA5 antibody epitope discovery was performed using 16 patient serum samples and 6 healthy control serum samples using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method (described below) and ELISA using MDA5 antigen fragment peptides. Clinical information for the 16 patient serum samples used for anti-MDA5 antibody epitope discovery is shown in Table 1.

[0048] [Table 1]

[0049] (2) Samples used to evaluate the difference in reactivity of anti-MDA5 antibodies to epitopes between the treatment-resistant and treatment-nonresistant groups Serum samples were collected from 30 patients admitted to Kyoto University Hospital (Japan) between 2008 and 2023 and treated with a standard triple therapy protocol either before or within one month of treatment initiation. The triple therapy protocol consisted of oral prednisolone, oral tacrolimus, and intravenous cyclophosphamide at the following doses (Reference 3). Prednisolone was initiated at an initial dose of 1 mg / kg / day. If prednisolone exceeded 30 mg daily, the dose was reduced by 10% every two weeks. If prednisolone was less than 30 mg daily, the dose was reduced by 10% every two to four weeks. The tacrolimus dose was adjusted to maintain a 12-hour trough blood concentration within the range of 10–12 ng / mL. Cyclophosphamide was administered at 500 mg / m 2 The initial dose is 1000 mg / m², and the goal is to achieve a 50% reduction in white blood cell nadir or a white blood cell count of 2000-3000 / μL. 2 The dose interval for cyclophosphamide was set to every 2 weeks up to the sixth dose, and after the sixth dose, the interval was set to 4 to 8 weeks, with the planned number of doses being 10 to 15.

[0050] The treatment-resistant group (n=16) was defined as patients who required additional plasma exchange therapy or JAK inhibitors due to decreased oxygenation or worsening interstitial pneumonia after starting triple therapy, or patients who died from worsening interstitial pneumonia without achieving remission (References 4 and 5). The treatment-nonresistant group (n=14) was defined as patients who achieved remission of interstitial pneumonia with triple therapy alone and survived for more than 6 months. Clinical information for the treatment-resistant and non-resistant groups is shown in Table 2.

[0051] [Table 2]

[0052] 2-2. Epitope discovery using SELEX method (1) Library creation a) DNA fragmentation MDA5 cDNA was fragmented using NEBNext dsDNA Fragmentase (New England Biolabs, NEB). Specifically, 5 μl of MDA5 cDNA (464.7 ng / μl) was first fragmented with 2 μl of buffer v2 and 2 μl of DNA Fragmentase, and the resulting mixture was diluted to 20 μl with distilled water. The mixture was then incubated at 37°C for 20 minutes. 5 μl of 0.5 M EDTA was added to terminate the reaction, and 6 μl of fragmented MDA5 cDNA was eluted using a DNA purification kit (Monarch).

[0053] b) Addition of tag sequences to both ends of fragmented MDA5 cDNA A tagged double-stranded fragment was prepared using Klenow fragment (NEB). First, 5 μl of the fragmented MDA5 cDNA obtained above was mixed with 4 μl of 10 μM ENLY_MDA5_N6_F primer. After 2 minutes at 98°C, 2 μl of 10x NEB buffer, 8 μl of 2.5 mM dNTPs, and 1 μl of Klenow fragment were added. The mixture was then incubated at 30°C for 10 minutes and then at 37°C for 1 hour. 20 μl of DNA was then eluted using a FastGene Gel / PCR Extraction Kit (Nippon Genetics CO., LTD.). This was used as first-strand DNA. Next, the resulting first-strand DNA was subjected to a similar Klenow reaction using the FLAG_MDA5_N6_R primer to obtain 20 μl of tagged second-strand DNA. The nucleotide sequences of the ENLY_MDA5_N6F primer and FLAG_MDA5_N6_R primer used are as follows: ENLY_MDA5_N6_F: 5'-GAAAACCTGTACTTCCAGGGGNNNNNN-3' (SEQ ID NO: 2) FLAG_MDA5_N6_R: 5'-TTTATCATCATCGTCTTTATAGTCAGANNNNNN-3' (SEQ ID NO: 3)

[0054] c) Amplification Next, PCR amplification of tagged second-strand DNA was performed using Eco_ENLY_cDNA_F primer and Hind_FLAG_cDNA_R primer. Specifically, 4 μl of 5x buffer, 0.6 μl of 10 μM Eco_ENLY_cDNA_F primer, 0.6 μl of Hind_FLAG_cDNA_R primer, 1.6 μl of 2.5 mM dNTP, 0.2 μl of PrimeSTAR HS (Takara), and 1 μl of the tagged second-strand DNA were added to a total volume of 20 μl, and PCR was performed for 22 cycles. The 200-400 bps band was then excised, and DNA was extracted using the FastGene Gel / PCR Extraction Kit, yielding 20 μl of DNA product at a concentration of 0.046 pmol / μl. The nucleotide sequences of the Eco_ENLY_cDNA_F primer and Hind_FLAG_cDNA_R primer used are as follows: Eco_ENLY_cDNA_F: 5'-GTCAGGTGTGATGCTCGGGGATCCGGAAAACCTGTACTTCCAGGGG-3' (SEQ ID NO: 4) Hind_FLAG_cDNA_R: 5'-AACTAGTTACTCGAGTGCGGCCGCATTTATCATCATCGTCTTTATAGTCAGA-3' (SEQ ID NO: 5)

[0055] d) Insertion into T7 phage DNA and packaging 0.02 pmol of the amplified DNA product and 0.06 pmol of T7 10-3b phage genomic DNA (EcoRI, HindIII digested) were mixed with 2.5 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB), the total volume was adjusted to 5 μl, and the mixture was incubated at 50°C for 1 hour to obtain the NEBuilder reaction solution. Next, 1 μl of the NEBuilder reaction solution was added to 5 μl of T7 packaging extract (Merck Millipore), and the mixture was incubated at room temperature for 2 hours. 54 μl of LB medium was then added to stop the reaction, thereby obtaining the packaging reaction product. BLT5403 E. coli strain (Merck Millipore, OD ) cultured in 500 ml of medium was used. 600 The entire volume of the packaging reaction mixture was added to a 100-kDa phage (0.7) and incubated at 37°C until complete lysis. This lysate was used as the MDA5 fragmented T7 phage library. The diversity of the library after packaging (count of independent clones) was 2.76 x 10 7 It was.

[0056] (2) Biopanning MDA5: 100 μl of the fragmented T7 phage library, 137 μl of SM buffer (50 mM Tris.HCl (pH 7.5), 100 mM NaCl, 8 mM MgSO4, 0.01% gelatin), 0.28% BSA (Bovine Serum Albumin), and 0.05% Tween 20. st A 250 μl screening mixture was prepared. st250 μl of the screening mixture and 1 μl of patient serum were shaken overnight at 4°C to allow the IgG from the patient serum to react with the T7 phage library. Then, 20 μl of Protein G Mag beads (Cytiva, Tokyo, Japan) washed with 3% BSA-containing PBS (Phosphate Buffered Saline) were added and incubated at room temperature for 1 hour to allow the IgG from the patient serum to bind to the beads. The bead mixture was washed three times with TBST (Tris Buffered Saline with Tween 20) to remove phages that had not bound to the IgG from the patient serum. Then, 50 μl of 1% SDS-containing PBS was added to dissociate the phage, IgG, and beads. The bead mixture was centrifuged, and 10 μl of the phage-containing supernatant was collected.

[0057] The E. coli BLT5403 strain for expression was inoculated into 10 ml of LB liquid medium containing 50 mg / ml ampicillin, and the OD 600 After shaking culture at 37°C until the value reached 0.3, 10 μl of the phage-containing solution collected above was added, and the phage was grown by shaking culture at 37°C until the E. coli lysed. The supernatant of the lysate was collected by centrifugation (15,000 rpm, 10 minutes, room temperature).

[0058] 236 μl of the lysate supernatant obtained above was added to nd 13.25 μl of screening mixture (PBS, 5.3% BSA, 0.94% Tween-2) and 1 μl of the same patient serum used in the first screening were added and shaken overnight at 4°C. Next, 20 μl of Protein G Mag beads (Cytiva, Tokyo, Japan) washed with 3% BSA-containing PBS were added and incubated at room temperature for 1 hour to allow IgG from the patient serum to bind to the beads. The bead mixture was washed three times with TBST to remove phage that had not bound to the IgG from the patient serum. Subsequently, 50 μl of 1% SDS-containing PBS was added to dissociate the phage, IgG, and beads. The bead mixture was centrifuged and the phage-containing supernatant was collected.

[0059] The phage-containing solution was subjected to phenol-chloroform extraction using 50 μl of PCI solution (phenol:chloroform:isoamyl alcohol, volume ratio 25:24:1) and 50 μl of chloroform, and the aqueous layer was collected. Glycogen was added to the resulting aqueous layer as a coprecipitant, and then 3 M acetic acid and 100% ethanol were added, followed by ethanol precipitation at -30°C overnight. The precipitate was dissolved in TE buffer (Tris-EDTA buffer) to obtain a DNA-containing solution.

[0060] (3) Preparation of specimens for next-generation sequencing NGS_1 as primer st _Forward primer and NGS_1 st Using the _R primer, the phage DNA region was amplified from the DNA-containing solution using Prime Star HS DNA Polymerase (Takara Bio Inc., Shiga, Japan). The PCR product was extracted and purified using the FastGene Gel / PCR Extraction Kit. The resulting PCR product was used as a template and amplified using the Nextera XT Index Kit (Illumina, San Diego, CA, USA). nd PCR product was obtained. nd The PCR products were electrophoresed on a 1.5% agarose gel, and the 400-600 bps portion of the gel was excised. DNA was extracted and purified from the excised gel using the FastGene Gel / PCR Extraction Kit, and then sequenced using the Illumina iSeq 100 sequencing system (Illumina). st _Forward primer and NGS_1 st The base sequence of the _R primer is as follows: NGS_1 st _F:TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGTCAGGTGTGATGCTCGG (SEQ ID NO: 6) NGS_1 st_R:GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTAGTTACTCGAGTGCGGC (SEQ ID NO: 7)

[0061] (4) Next-generation sequencing analysis Fastq files generated by the iSeq 100 sequencing system were analyzed using a Python 3.9.12 script. Specifically, the DNA sequence was first translated into amino acid sequence, and the sequence following the g10 capsid protein sequence was extracted as a partial sequence of MDA5. For each peptide fragment, the number of reads per patient sample was counted, and the total number of reads was calculated as 10. 5 A data frame combining all patient datasets was created, and peptide sequences that were hit specifically in patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia were extracted and scored.

[0062] 2-3. Preparation of MDA5 fragment peptides (1) Construction of expression plasmid for MDA5 fragment peptide A partial sequence peptide of the human MDA5 amino acid sequence (SEQ ID NO: 1) was expressed using the E. coli plasmid pET-21b(+) (Merck Millipore). Following the initiation codon ATG downstream of the T7 promoter, the coding regions for the His8 tag, maltose-binding protein (MBP), and TEV cleavage sequence were arranged in this order, and the C-terminal regions were the coding regions for positions 1 to 100, 51 to 150, 101 to 200, 151 to 250, 201 to 300, 251 to 350, 301 to 400, and 401 to 500 of the human MDA5 amino acid sequence (SEQ ID NO: 1). cDNA sequences encoding partial peptides consisting of positions 351-450, 401-500, 451-550, 501-600, 551-650, 601-700, 651-750, 701-800, 751-850, 801-900, 851-950, 901-1000, and 951-1025 were fused in frame. Expression plasmids for each partial peptide were introduced into Escherichia coli Rosetta (DE3) by standard transformation methods, and transformants were selected on LB agar plates supplemented with 100 mg / L ampicillin (Nacalai Tesque). The accuracy of the DNA sequences of the expression plasmids was confirmed by sequencing of both strands.

[0063] (2) Expression and purification of MDA5 fragment peptides The E. coli Rosetta (DE3) expression strain carrying the expression plasmid was inoculated into 200 mL of LB liquid medium supplemented with 100 mg / L ampicillin, and the OD was measured at 37°C under shaking conditions at 250 rpm. 600After culturing until the pH reached 0.7–1.0, IPTG (Nacalai Tesque) was added to a final concentration of 0.1 mM. The cells were then cultured overnight at 23°C with shaking at 250 rpm. E. coli cells were harvested by centrifugation (6,000 g, 15 min, 4°C) and suspended in Buffer 1 (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 20 mM imidazole, 0.1% Triton X-100, protease inhibitors, 1 mM TCEP (tris(2-carboxyethyl)phosphine), 5% glycerol). The cells were then disrupted using an ultrasonicator. A crude E. coli extract was prepared by collecting the supernatant after centrifugation (15,000 g, 10 min, 4°C). This was applied to Ni-NTA resin (Qiagen) equilibrated with buffer 2 (10 mM HEPES-NaOH (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1 mM TCEP, 5% glycerol). The bound protein was eluted with buffer 3 (10 mM Tris-HCl (pH 8.0), 300 mM NaCl, 500 mM imidazole, 1 mM TCEP, 5% glycerol), mixed with His6-tagged TEV protease, and dialyzed overnight at 4°C against buffer 4 (10 mM HEPES-NaOH (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1 mM TCEP, 5% glycerol). The cleaved His8-MBP-tagged and His6-tagged TEV proteases were removed by adsorption onto a HisTrap HP column (Cytiva) equilibrated with buffer 4. The column flow-through fraction was concentrated using an AmiconUltra-15 (MWCO 3K) (Merck Millipore) and then purified using a Superdex 75 10 / 300 GL gel filtration column (Cytiva) equilibrated with buffer 5 (10 mM HEPES-NaOH (pH 7.5), 150 mM NaCl, 1 mM TCEP, 5% glycerol). The peak fraction was collected, concentrated, flash-frozen in liquid nitrogen, and stored frozen at -80°C until use in experiments such as ELISA.

[0064] 2-4. ELISA using MDA5 fragment peptides The MDA5 fragment peptide was dissolved in PBS, and added to an ELISA plate so that 1 μg of antigen peptide and 100 μl of PBS were added per well, followed by immobilization overnight at 4° C. To standardize the reaction conditions, one ELISA plate was used for immobilization of each MDA5 fragment peptide.

[0065] In addition, 1 μg of Escherichia coli Rosetta (DE3) crushed antigen was added to 1 μl of patient serum, and the solution was adjusted to 1 ml with PBS containing 5% skim milk.The solution was then shaken overnight at 4°C to obtain a primary antibody solution with reduced nonspecific reactivity with Escherichia coli-derived proteins.

[0066] The solid-phase ELISA plate was washed four times with PBST (Phosphate Buffered Saline with Tween 20) and then incubated with 5% skim milk in PBS at room temperature for 1 hour. It was then washed four times with PBST. The primary antibody solution was then added at 100 μl per well and incubated for 2 hours at room temperature. After washing four times with PBST, the secondary antibody solution, Anti-Human IgG (H+L), HRP Conjugate (Promega), was diluted 1:10,000 with 5% milk in PBS and added at 100 μl per well and incubated for 2 hours at room temperature. After washing four times with PBST, 100 μl of TMB Substrate (Invitrogen) was added to each well as a colorimetric substrate and incubated for 3 minutes in the dark at room temperature. 50 μl of 1 mol / l H2SO4 (Nacalai Tesque) was added to each well as a reaction stop solution to stop the color reaction. The absorbance was then calculated using an ELISA plate reader by subtracting the absorbance at 550 nm from the absorbance at 450 nm to correct for optical error.

[0067] 2-5.Statistical analysis Comparisons between the two groups were performed using Fisher's exact test for definitive variables and Wilcoxon rank-sum tests for continuous variables. Correlation analyses were performed using Spearman's rank correlation coefficient. Statistical analysis software was R (Version 4.1.2; R Foundation for Statistical Computing).

[0068] 3. Test Results 3-1. Search for epitopes of anti-MDA5 antibodies in the serum of patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia The results of SELEX analysis of anti-MDA5 antibody epitopes in the serum of patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia are shown in Figures 2A and 2B. In Figures 2A and 2B, the X axis represents the patient number, the Y axis represents MDA5 fragment peptides, and the Z axis represents the enrichment score. The enrichment score is calculated by dividing the measured value of each patient-derived sample by the average value of samples from healthy individuals. Figure 2A shows the results for all 16 samples, while Figure 2B shows the results for 14 samples excluding patient numbers 1 and 9, for which some fragment peptides had significantly high enrichment scores.

[0069] Furthermore, the results of ELISA for the epitope of anti-MDA5 antibodies in the serum of patients with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis are shown in Figure 3A and B. In Figure 3A and B, the X axis represents the patient number, the Y axis represents the MDA5 fragment peptide, and the Z axis represents the OD value. The OD value represents the measured value of each patient-derived sample divided by the average value of samples from healthy individuals. Figure 3A shows the results for all 16 samples, and Figure 3B shows the results for 14 samples excluding patient numbers 1 and 9, as in Figure 2B.

[0070] The results of both the SELEX and ELISA methods confirmed the presence of anti-MDA5 antibodies that bind to AA201-300 or AA601-700. Specifically, these results indicated that the sera of anti-MDA5 antibody-positive patients with interstitial pneumonia associated with dermatomyositis contained anti-MDA5 antibodies that recognized an epitope within the region of positions 201-300 or within the region of positions 601-700 of the amino acid sequence of MDA5 (SEQ ID NO: 1). Furthermore, it was confirmed that there was a statistical correlation between the binding of the anti-MDA5 antibodies to AA201-300 or AA601-700 measured by the SELEX method and the ELISA method (Figure 4).

[0071] 3-2. Differences in reactivity of anti-MDA5 antibodies to AA201-300 or AA601-700 between treatment-resistant and treatment-non-resistant groups The presence of anti-MDA5 antibodies binding to AA201-300 or AA601-700 was confirmed by SELEX and ELISA in the sera of patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia. Therefore, we evaluated the clinical significance of anti-MDA5 antibodies binding to AA201-300 or AA601-700. Specifically, 30 patients with anti-MDA5 antibody-positive dermatomyositis-associated interstitial pneumonia were treated with a standard triple therapy protocol. They were divided into a treatment-resistant group (n = 16) and a treatment-nonresistant group (n = 14). The reactivity of serum anti-MDA5 antibodies to AA201-300 or AA601-700 was assessed by ELISA with immobilized AA201-300 or AA601-700.

[0072] As a result, it was found that the reactivity to AA201-300 or AA601-700 was significantly higher in the treatment-resistant group than in the treatment-non-resistant group (Figure 5). In other words, it was revealed that when the concentration of anti-MDA5 antibodies that recognize the epitope within the region of positions 201 to 300 or the region of positions 601 to 700 of the amino acid sequence of MDA5 (SEQ ID NO: 1) as an epitope is high in the serum of patients with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis, there is a high possibility that they will exhibit treatment resistance to triple-drug combination therapy.

[0073] Univariate analysis was performed using logistic regression with AA201-300 or AA601-700 reactivity (ELISA OD value) as the explanatory variable, with the treatment-resistant group defined as positive (1) and the non-resistant group defined as negative (0). The results showed that for AA201-300, the cutoff value was 0.240 (ELISA OD value), with a sensitivity of 87.5% and a specificity of 71.4%, while for AA601-700, the cutoff value was 0.243 (ELISA OD value), with a sensitivity of 62.5% and a specificity of 92.9% (Figure 6). These results suggest that reactivity to AA201-300 or AA601-700 can be used to predict treatment resistance to triple therapy with high accuracy in patients with anti-MDA5 antibody-positive interstitial pneumonia associated with dermatomyositis.

[0074] Furthermore, using sera from cases with high reactivity to both AA201-300 and AA601-700 (included in the non-resistant group) as control sera, the ELISA unit value (AA201-300 or AA601-700) of each case was calculated according to the following formula.

number

[0075] Next, the cutoff values for ELISA unit values for AA201-300 were set at 35, and for AA601-700 at 20. Cases were classified as positive if at least one of the ELISA unit values for AA201-300 and AA601-700 was equal to or greater than the cutoff value, and cases were classified as negative if both the ELISA unit values for AA201-300 and AA601-700 were less than the cutoff value. As a result, cases classified as positive were identified as treatment-resistant with high accuracy (sensitivity 87.5%, specificity 85.7%) (Table 3, Figure 7). These results confirmed that treatment resistance can be predicted with high accuracy by measuring the serum concentration of anti-MDA5 antibodies that recognize epitopes within the 201-300 or 601-700 amino acid region of the MDA5 sequence, using control serum and corresponding cutoff values.

[0076]

Table 3

[0077] 4.References References 1. Koga, T., et al., The diagnostic utility of anti-melanoma differentiation-associated gene 5 antibody testing for predicting the prognosis of Japanese patients with DM. Rheumatology (Oxford), 2012. 51(7): p. 1278-84. References 2. Lundberg, I.E., et al., 2017 European League Against Rheumatism / American College of Rheumatology Classification Criteria for Adult and Juvenile Idiopathic Inflammatory Myopathies and Their Major Subgroups. Arthritis Rheumatol, 2017. 69(12): p. 2271-2282. Reference 3. Tsuji, H., et al., Multicenter Prospective Study of the Efficacy and Safety of Combined Immunosuppressive Therapy with High-Dose Glucocorticoid, Tacrolimus, and Cyclophosphamide in Interstitial Lung Diseases Accompanied by Anti-Melanoma Differentiation-Associated Gene 5-Positive Dermatomyositis. Arthritis Rheumatol, 2020. 72(3): p. 488-498. Reference 4. Shirakashi, M., et al., Efficacy of plasma exchange in anti-MDA5-positive dermatomyositis with interstitial lung disease under combined immunosuppressive treatment. Rheumatology (Oxford), 2020. 59(11): p. 3284-3292. Reference 5. Chen, Z., X. Wang, and S. Ye, Tofacitinib in Amyopathic Dermatomyositis-Associated Interstitial Lung Disease. N Engl J Med, 2019. 381(3): p. 291-293.

Claims

1. A method for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia, comprising: measuring the concentration of anti-MDA5 antibodies in a blood sample taken from the patient; The prediction method, wherein the anti-MDA5 antibody is an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and / or an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO:

1.

2. The prediction method according to claim 1, wherein the patient is a patient with anti-MDA5 antibody-positive dermatomyositis, a patient with dermatomyositis suspected of being anti-MDA5 antibody-positive, a patient with interstitial pneumonia associated with anti-MDA5 antibody-positive dermatomyositis, or a patient with interstitial pneumonia suspected of being anti-MDA5 antibody-positive dermatomyositis.

3. The prediction method according to claim 1 or 2, wherein the treatment resistance is treatment resistance to triple therapy of a steroid, cyclophosphamide, and a calcineurin inhibitor.

4. The prediction method according to claim 1 or 2, wherein the treatment resistance is treatment resistance to a triple therapy of prednisolone, cyclophosphamide, and tacrolimus.

5. The prediction method described in claim 1 or 2, wherein the anti-MDA5 antibodies to be measured are both anti-MDA5 antibodies that recognize an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and anti-MDA5 antibodies that recognize an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO:

1.

6. The prediction method according to claim 1 or 2, wherein the blood sample is serum.

7. The prediction method according to claim 1 or 2, wherein the anti-MDA5 antibody is measured by an immunological assay.

8. A kit for predicting therapeutic resistance to at least one drug selected from the group consisting of steroids, cyclophosphamide, and calcineurin inhibitors in a patient with dermatomyositis or interstitial pneumonia, comprising: The kit comprises a reagent for measuring an anti-MDA5 antibody that recognizes an epitope within the region of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1, and / or an anti-MDA5 antibody that recognizes an epitope within the region of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO:

1.

9. The kit according to claim 8, wherein the reagent is a reagent for measuring the anti-MDA5 antibody by immunological assay and comprises at least (i) an MDA5 fragment consisting of positions 201 to 300 of the amino acid sequence shown in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment as an antigen, and / or (ii) an MDA5 fragment consisting of positions 601 to 700 of the amino acid sequence shown in SEQ ID NO: 1 or a fusion protein of the MDA5 fragment.

10. The kit according to claim 8 or 9, wherein the antigen is immobilized on an enzyme immunoassay plate or magnetic particles.

11. The kit according to claim 8 or 9, comprising at least one of a blood sample from a healthy subject, a blood sample from a patient who was resistant to treatment with the drug, and a blood sample from a patient who was non-resistant to treatment with the drug, as a control.

Images