Genetically engineered multicomponent system for identification and characterization of t-cell receptors and t-cell antigens

Abstract

To provide a systematic approach for developing vaccines effective against common and emergent pathogens.SOLUTION: The present invention relates to the construction, assembly, and use of a multicomponent system composed of at least three components: an engineered antigen-presenting cell (eAPC), a genetically engineered genomic receiver site, and a matching genetic donor vector. The present invention is used for the rapid production of stable derivative cells presenting various forms of antigenic molecules for the identification and characterization of antigens and homologous TCR sequences. Specifically, the eAPC is genetically engineered by genome editing so that there is no cell surface presentation of human leukocyte antigen (HLA) molecules, HLA-like molecules, or other forms of antigen-presenting molecules and antigenic molecules. In addition, the eAPC, as part of the multicomponent system, includes genomic receiver sites for insertion of antigen-presenting molecules encoding open reading frames (ORFs), and, if necessary, insertion of a genetically encoded analyte antigen.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention relates to the construction, assembly, and use of a multi-component system consisting of at least three components: a genetically engineered antigen-presenting cell (eAPC), a genetically engineered genomic acceptor site, and a matching gene donor vector, for rapid, high-throughput generation of stable derivative cells presenting various forms of antigenic molecules for identification and characterization of antigens and cognate TCR sequences. [Background technology]

[0002] Introduction to the Invention Immune surveillance by T lymphocytes (T cells) is a central function in adaptive immunity in all jawed vertebrates. T cell immune surveillance is achieved through extensive functional diversity across T cell subtypes, which contribute to the elimination of pathogen infections and neoplastic cells, orchestrate adaptive immune responses to commensal non-self factors such as invading pathogens, commensal microorganisms, and molecular components of food, and maintain self-immune tolerance. To respond to a variety of foreign and self factors, T cells must be able to specifically detect the molecular components of these foreign and self factors. Thus, T cells must be able to detect the vast majority of self and non-self molecules encountered by an individual with sufficient specificity to mount effective responses against pathogenic organisms and pathological self while avoiding the initiation of such responses against healthy self. The immensely complex nature of this task becomes apparent when considering the virtually infinite diversity of both foreign and self molecules, placing pathogenic organisms under evolutionary pressure to evade T cell detection.

[0003] T cell receptor (TCR) T cells are primarily defined by the expression of T cell receptors (TCRs). TCRs are the components of T cells responsible for interacting with and detecting targets of T cell adaptive immunity. Generally speaking, TCRs consist of heterodimeric protein complexes displayed on the cell surface. Each of the two TCR chains consists of two extracellular domains: a variable (V) region and a constant (C) region, both of which belong to the immunoglobulin superfamily (IgSF) domain and form an antiparallel β-sheet. They are anchored to the plasma membrane by a type I transmembrane domain adjacent to a short cytoplasmic tail. The ability of T cells to adapt to and detect diverse molecular components arises from variations in the TCR chains that occur during T cell development. This variation occurs through somatic recombination in a manner similar to antibody development in B cells.

[0004] TCR chain diversity The T cell pool consists of several functionally and phenotypically heterogeneous subpopulations. However, T cells can be broadly classified as αβ or γδ according to the somatically rearranged TCR isoform expressed on their surface. Two TCR chain pair isoforms exist: TCRα (TRA) and TCRβ (TRB), and TCRgamma (TRG) and TCRdelta (TRD). T cells expressing the TRA:TRB pair are called αβ T cells, while T cells expressing the TRG:TRD pair are often called γδ T cells. Both αβ and γδ TCRs are responsible for recognizing diverse ligands, or "antigens," and each T cell generates either an αβ or a γδ receptor chain de novo during T cell maturation. These new TCR chain pairs achieve recognition diversity by generating receptor sequence diversity in a process called somatic V(D)J recombination, after which each T cell expresses a distinct, rearranged copy of a single TCR. At the TRA and TRG loci, several separate variable (V) and functional (J) gene segments are available for recombination and are juxtaposed to constant (C) gene segments, hence the term VJ recombination. Recombination at the TRB and TRD loci also involves a diversity (D) gene segment, hence the term VDJ recombination. Each engineered TCR has the potential for unique ligand specificity, determined by the structure of the ligand-binding site formed by the α and β chains in αβ T cells, or the γ and δ chains in γδ T cells. The structural diversity of TCRs is primarily limited to three short hairpin loops in each chain, called complementarity-determining regions (CDRs). Three CDRs are provided by each chain of the receptor chain pair, and these six CDR loops collectively reside at the membrane-distal end of the TCR extracellular domain and form the antigen-binding site. Sequence diversity in each TCR chain is achieved in two ways. First, random selection of gene segments for recombination results in basic sequence diversity. For example, TRB recombination occurs between 47 unique V, 2 unique D, and 13 unique J germline gene segments. Typically, V gene segments contribute both the CDR1 and CDR2 loops and are thus germline encoded. The second mode for generating sequence diversity occurs within the hypervariable CDR3 loops, which arise from random deletion of templated nucleotides and addition of non-templated nucleotides at the junctions between the recombining V, D, and J gene segments.

[0005] TCR:CD3 complex The mature αβ and γδ TCR chain pairs are presented on the cell surface as a complex with several accessory CD3 subunits, termed ε, γ, δ, and ζ. These subunits associate with the αβ or γδ TCR as three dimers (εγ, εδ, ζζ). This TCR:CD3 complex forms the unit that initiates cell signaling responses upon binding of the αβ or γδ TCR to its cognate antigen. The CD3 accessories associated with the TCR:CD3 complex contribute signaling motifs called immunoreceptor tyrosine-based activation motifs (ITAMs). CD3ε, CD3γ, and CD3δ each contribute a single ITAM, whereas the CD3ζ homodimer contains three ITAMs. The three CD3 dimers (εγ, εδ, ζζ) that assemble with the TCR thus contribute 10 ITAMs. Upon TCR ligation with cognate antigen, phosphorylation of tandem tyrosine residues creates paired docking sites for proteins containing the Src homology 2 (SH2) domain, such as the critical ζ-chain-associated protein of 70 kDa (ZAP-70). Recruitment of such proteins initiates the formation of the TCR:CD3 signaling complex ultimately responsible for T cell activation and differentiation.

[0006] αβT cells αβ T cells are generally more abundant in humans than their γδ T cell counterparts. Most αβ T cells interact with peptide antigens presented on the cell surface by HLA complexes. Peptide-HLA (pHLA)-recognizing T cells were first described and are the best characterized. Rare forms of αβ T cells have also been described. Mucosal-associated invariant T (MAIT) cells appear to have relatively limited α and β chain diversity and recognize bacterial metabolites rather than protein fragments. Invariant natural killer T cells (iNK T cells) and germline-encoded mycolyl-reactive T cells (GEM T cells) are limited to recognizing glycolipids cross-presented by non-HLA molecules. iNK T cells appear to interact predominantly with glycolipids presented by CD1d, whereas GEM T cells interact with glycolipids presented by CD1b. Yet another type of T cell is thought to interact with glycolipids associated with CD1a and CD1c, but such cells have not yet been characterized in detail.

[0007] Normal αβ T cells A key feature of most αβ T cells is the recognition of peptide antigens in association with HLA molecules. These are often referred to as "conventional" αβ T cells. Within an individual, self-HLA molecules present peptides from self and foreign proteins to T cells, providing an essential basis for adaptive immunity against malignancies and foreign pathogens, and adaptive tolerance toward commensals, food, and self. The HLA loci, which encode HLA proteins, are the most gene-dense and polymorphic regions of the human genome, with over 12,000 alleles described in humans. The high degree of polymorphism at HLA loci ensures diversity in peptide antigen presentation among individuals, which is important for population-level immunity.

[0008] HLA classes I and II Two forms of classical HLA complexes exist: HLA class I (HLA-I) and HLA class II (HLA-II). Three classical HLA-I genes exist: HLA-A, HLA-B, and HLA-C. These genes encode transmembrane α chains associated with the invariant β2 microglobulin (β2M) chain. The HLA-I α chain consists of three domains in the immunoglobulin fold: α1, α2, and α3. The α3 domain is located near the membrane and is largely invariant, while the α1 and α2 domains together form a polymorphic, membrane-distal antigen-binding cavity. Six classical HLA-II genes exist: HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. These genes encode paired DP, DQ, and DR heterodimeric HLA complexes containing α and β chains. Each chain has two major structural domains of the immunoglobulin fold type, where the α2 and β2 domains contain a membrane-proximal, largely invariant module similar to that of the HLA1 α3 domain, and the HLA2 α2 and β2 domains together form the membrane-distal antigen-binding cavity and are highly polymorphic regions. The antigen-binding cavity of HLA1 and HLA2 contains two antiparallel α-helices on a platform of eight antiparallel β-sheets. In this cavity, peptide antigens bind and are presented in an extended conformation. Peptide contact residues in HLA1 and HLA2 are the site of most sequence polymorphism, which constitutes the molecular basis for the diverse peptide repertoires presented by different HLA alleles. Peptides make extensive contact with the antigen-binding cavity, and as a result, each HLA allele imposes distinct sequence constraints and preferences on presented peptides. A given peptide therefore binds only to a limited number of HLA alleles, and reciprocally, each allele accepts only a specific fraction of the peptide collection from a given protein. The set of HLA1 and HLA2 alleles present in each individual is called an HLA haplotype. Polymorphisms in HLA I and HLA II genes and codominant expression of inherited alleles drive the enormous diversity of HLA haplotypes across the human population, which, when combined with the enormous sequence diversity of αβ TCRs, poses a major obstacle to standardizing the analysis of these HLA-antigen-TCR interactions.

[0009] αβTCR binding of HLA-I and HLA-II The αβ TCR recognizes peptides as part of a mixed pHLAI-binding interface formed by residues from both HLA and peptide antigens (altered self). The pHLAI complex is displayed on the surface of nearly all nucleated cells and is generally believed to present peptides derived from endogenous proteins. T cells can therefore interrogate the endogenous cellular proteome of HLAI-presenting cells by sampling the pHLAI complex of interacting cells. Because HLAI binding requires expression of the TCR co-receptor CD8 by the interacting T cell, HLAI sampling is dependent on the expression of CD8. +In contrast, surface expression of HLAII complexes is primarily restricted to professional APCs, which are generally thought to present peptides derived from proteins exogenous to the presenting cell. Interacting T cells can thus survey the proteome of the extracellular microenvironment in which the presenting cell resides. Because HLAII binding requires expression of the TCR co-receptor CD4 by the interacting T cell, HLAII sampling is based on CD4 + Restricted to αβ T cells.

[0010] Thymic selection of αβTCR The role of the αβ TCR described above is to detect pHLA complexes, and TCR-presenting T cells can mount responses that are closely related to the role of these T cells in established immunity. The resulting αβ TCR repertoire in an individual, associated with a particular haplotype, must account for the vast and unpredictable diversity of all foreign antigens likely encountered before diversity actually occurs. This result is achieved against a background in which a highly diverse and numerous αβ TCRs arise in a somewhat randomized manner, capable of recognizing unspecified pHLA complexes that are specifically taught to avoid strong interactions with self-pHLA. This is carefully regulated during T cell maturation in a process called thymic selection. During the first step of T cell maturation in the thymus, T cells with αβ TCRs that cannot interact with self-pHLA complexes with sufficient affinity are deprived of survival signals and eliminated. This process, called positive selection, ensures that surviving T cells have a TCR repertoire that is at least potentially capable of recognizing foreign or altered peptides presented in association with the correct HLA. Subsequently, αβ TCRs that strongly interact with self-pHLA and thus have the potential to drive autoimmunity are actively eliminated through a process of negative selection. This combination of positive and negative selection results in only T cells with αβ TCRs that have low affinity for self-pHLA in the periphery. This establishes an αβ T cell repertoire that is self-restricted but not autoreactive. This highly individualized nature of T cell development in response to HLA haplotypes highlights the challenges of standardized analysis of αβ TCR-antigen-HLA interactions. Furthermore, this forms the basis for both graft rejection and graft-versus-host disease, as well as the general principle that an αβ TCR identified in one individual may have an entirely different effect in a second individual, which has clear implications for TCR- and T cell-based therapeutic and diagnostic strategies emerging in clinical practice.

[0011] Unconventional αβT cells Non-HLA-restricted or "unconventional" forms of αβ T cells have very different molecular antigen targets. These unconventional αβ T cells do not bind classical HLA complexes but rather conserved HLA-like proteins such as the CD1 family or MR1. The CD1 family contains four forms (CD1a, b, c, and d) involved in antigen cross-presentation. These cell surface complexes possess an α chain that is highly similar to HLA1, which forms a heterodimer with β2M. A small hydrophobic pocket displayed on the membrane-distal surface of the α chain forms a binding site for pathogen-derived lipid-based antigens. Innate-like NK T cells (iNK T cells) are the best-understood example of lipid / CD1 family recognition, with GEM T cells representing another prominent example. "Type I" iNK T cells are known to strongly interact with the lipid α-GalCer associated with CD1d. These iNK T cells display very limited TCR diversity, with a fixed TCR α chain (Vα10 / Jα18) and a limited number of β chains (with restricted vβ usage), which have been likened to natural pathogen-associated molecular pattern (PAMPS) recognition receptors such as Toll-like and Nod-like receptors. In contrast, "type II" NK T cells display a more diverse TCR repertoire and appear to have more diverse forms of CD1d-lipid complex binding. GEM T cells recognize mycobacterial-derived glycolipids presented by CD1b, but the molecular details of antigen presentation by CD1a, b, and c and their T cell recognition are only beginning to be understood. MAIT cells primarily express the invariant TCR α chain (TRAV1-2 ligated with TRAJ33, TRAJ20, or TRAJ12), which can pair with a range of TCR β chains. Instead of peptides or lipids, MAIT TCRs can bind pathogen-derived folate- and riboflavin-based metabolites presented by the HLAI-like molecule MR1. The limited but remarkable diversity in TCRs observed for MAIT TCRs likely enables recognition of diverse but correlated metabolites associated with the conserved MR1. How non-classical HLA-restricted αβ T cell TCRs are selected in the thymus during maturation is not well understood, but the basic processes of negative and positive selection outlined above appear to apply, and there is some evidence to suggest that this occurs in specialized niches within the thymus.

[0012] γδT cells In contrast to a detailed mechanistic understanding of αβ TCR development and pHLA binding, relatively little is known about the antigen targets and their relationships with their γδ T cell counterparts. This is partly due to their relatively low abundance in the circulating T cell compartment. However, γδ T cells are widely believed to be not strictly HLA-restricted and appear to recognize surface antigens more freely, similar to antibodies. In addition, more recently, it has become recognized that γδ T cells can dominate the resident T cell compartment in epithelial tissues, the primary site of immune system interaction with foreign antigens. Furthermore, various mechanisms for γδ T cell tumor immune surveillance and other forms of surveillance of dysregulated self are beginning to emerge in the literature. Although the specific antigen targets of both innate-like and adaptive γδ T cells are still largely undefined, the tissue distribution and rapid recognition of PAMPs suggest a fundamental role for γδ T cells both early in the response to foreign antigens and early in life when the adaptive immune system is still maturing. The diverse functions of γδ T cells appear to be based on the use of different VγVδ gene segments and can be broadly understood in two major categories: γδ T cells, primarily in conjunction with the invariant TCR, mediate innate-like recognition of PAMPs very early during infection. In addition to PAMPs, these types of γδ T cells are also thought to recognize self-molecules, including phosphoantigens, which may provide very early signs of cellular stress, infection, and possibly tumorigenesis. The recognition of PAMPs and these so-called damage-associated molecular patterns (DAMPs), as well as the large number of tissue-restricted innate-like γδ T cells, strongly suggests that these cells are well-suited to respond rapidly to antigenic challenge without the need for prior activation, homing, and clonal expansion.

[0013] A second type of γδ T cell is thought to be more adaptive in nature, possessing a highly diverse γδ TCR repertoire and the ability to circulate in the periphery and directly access lymphoid tissues. Such antigen-specific γδ T cells have been described for common human pathogens, such as CMV, and appear to generate memory responses. However, γδ T cells exhibit only relatively limited clonal expansion after activation, and little data is available on the extent of TCR diversity and specific γδ T cell responses in the peripheral circulation or tissues. Furthermore, it is generally believed that γδ TCRs do not interact with pHLA complexes and therefore do not bind peptide antigens in this context; however, only a few antigen targets of γδ T cells have been characterized, and the underlying molecular framework is only poorly understood.

[0014] The low frequency of peripheral γδ T cells and the difficulty of studying tissue-resident T cells in humans have limited our knowledge of how this important and diverse type of T cell participates in adaptive immune responses. This emerging area of research requires more reliable techniques to capture and characterize rare γδ T cells, isolate their TCR pairs, and identify their cognate antigens.

[0015] Antigens and antigen-presenting cells In the context of T cells and TCRs, an antigen can be defined as any molecule capable of binding to the TCR and resulting in signal transduction within the T cell. The best-characterized T cell antigens are peptides presented in the HLA-I and HLA-II complexes and bound by conventional αβ T cells. However, in recent years, it has become clear that unconventional αβ T cells and γδ T cells can bind a wide range of biomolecules as antigens, including lipids, lipopeptides, glycopeptides, glycolipids, and a range of metabolites and catabolic products. Furthermore, it has become clear that γδ T cells can directly bind fully folded proteins in an antibody-like manner. Thus, over the past two decades, the view that T cell antigens are primarily restricted to peptides presented by HLA has expanded to include almost all biomolecules. With this concept in mind, it is appropriate to define what can be considered an antigen-presenting cell (APC). Antigens and antigen-presenting cells

[0016] As defined in the previous section, HLA1 and HLA2 have disparate expression profiles across cell types. It is widely accepted that nearly all nucleated cells present HLA1 complexes on their cell surface and are therefore capable of presenting peptide antigens for T cell sampling. In contrast, HLA2 has a restricted expression profile and is expressed, at least under steady-state conditions, only on the surface of cells with specialized roles in antigen presentation, including dendritic cells (DCs), macrophages, and B cells. These specialized cell types are often referred to as professional APCs. For the purposes of this document, the term "APC" will be used to refer to any nucleated cell capable of presenting antigen for sampling by αβ or γδ T cells. Such antigens include, but are not limited to, those presented as "cargo" in specific antigen-presenting complexes, e.g., HLA and HLA-like molecules, that can bind to αβ or γδ TCR-bearing cells. The polypeptide may include any cell surface-displayed moiety that is capable of displaying a polypeptide on a surface.

[0017] Therapeutic Use of TCRs Adoptive transfer of primary T cells was first tested in a clinical setting in the early 1990s, initially using ex vivo-expanded T cells directed against viral antigens to confer viral immunity to immunocompromised patients. A similar approach using ex vivo-expanded primary T cells against specific cancer antigens was tested in the treatment of malignancies shortly thereafter. One limitation of these early approaches, which remains a challenge today, is the lack of understanding of the nature and diversity of T cells, which conflicts with the need to finely optimize the composition of therapeutic products. Currently, the use of ex vivo-expanded primary T cells has largely been abandoned in the pharmaceutical industry, with the exception of a handful of initiatives using primary T cells with specificity for viral antigens.

[0018] In recent years, the ability to stably introduce genetic material into primary human cells has enabled a growing variety of experimental genetically modified T cell therapeutics. These therapeutic cell products aim to harness the power of the T cell response and redirect T cell specificity toward disease-associated antigen targets, such as those expressed exclusively by malignant cells. These primarily rely on the transfer of chimeric antigen receptors (CARs) into recipient T cells rather than actual TCR chain pairs. CARs are targeting moieties (often single-chain antibody elements targeting surface-expressed proteins on malignant cells) grafted onto signaling receptor elements, such as the ζ chain of the CD3 complex, to generate synthetic chimeric receptors that mimic CD3-TCR function. These so-called CAR T cell (CAR-T) products have shown mixed success in clinical trials to date, and despite their potential, their utility is not readily interpreted beyond tumors with unique, intrinsic molecular targets, such as B-cell malignancies. Instead, there has been growing interest in transferring full-length TCR chain pair ORFs into T cells. Such TCR-engineered T cell therapeutics are currently limited by the difficult manufacturing process and, similar to CAR-T products, the lack of validated antigen targets and targeting constructs. To date, much of the focus has been on the use of αβ TCRs to recognize peptide antigens presented by HLAI on malignant cells, and a fundamental difficulty with this approach is the need for antigens specific to the malignant cells.

[0019] Because the TCR-pHLA interaction is of relatively low affinity, native TCRs are thought to be suboptimal for TCR-engineered T cell therapy. Several approaches have been devised for affinity maturing TCRs in vitro, similar to single-chain antibody affinity maturation. These TCR affinity maturation approaches also generally use a single-chain format in which the V region of one chain is fused to the V region of another chain to create a single polypeptide construct. Such single polypeptides can then be used in phage or yeast display systems adapted from antibody engineering workflows and undergo several rounds of selection based on target binding. Such single-chain TCR approaches have two inherent limitations in obtaining functional TCR chain pairs. First, selection is based on binding affinity with the target. However, it is well documented that TCR affinity does not always correlate with the strength or potency of TCR signaling output. Second, affinity-based selection of single-chain constructs does not always translate to equivalent affinity once they are reconstituted as full-length receptors.

[0020] In the context of therapy, there are additional important limitations to affinity-matured TCR pairs. Given that their sequences have been altered, the resulting constructs, by definition, are no longer subjected to thymic selection, where TCRs that strongly react with self-antigens are deleted from the repertoire. Thus, these modified TCRs have an inherent risk of autoreactivity, a risk that is very difficult to eliminate in vitro using current methods. For the same reason, any selected or engineered TCR for therapeutic use must be individualized. If TCRs are artificially engineered or native TCRs are used across individuals, cross-reactivity must be eliminated based on each specific individual's HLA haplotype and presented peptide repertoire to avoid potentially devastating autoimmunity. This is due to the fact that thymic selection occurs in the context of all available HLA molecules, which are specific only to that given individual. The potential for such cross-reactivity is unknown. However, the ability of our TCR repertoire to recognize pHLA complexes from other individuals of the same species as foreign is a fundamental property of adaptive immunity and supports graft rejection and graft-versus-host disease. A recent clinical trial using a mature TCR chain pair against a cancer-specific melanoma-associated antigen (MAGE) shed light on the potential problems of bypassing thymic selection. When autologous T cells bearing the mature TCR were infused back into two cancer patients, these patients rapidly developed fatal cardiac disease. Subsequent studies found that the MAGE-specific matured TCR was cross-reactive with a peptide presented by HLAI from the cardiac protein titin. This strongly suggests that cross-reactivity is a distinct possibility in the therapeutic use of TCRs.

[0021] Another approach to harnessing TCRs for therapeutic purposes is to use them as affinity reagents in much the same way as antibody therapeutics. Single-chain TCR molecules have been tested to deliver conjugated drug substances to specific HLA-antigen-expressing cell populations. This approach is generally considered safer than CAR-T or TCR-engineered T cell therapy because the drug substance administration can be simply withdrawn. However, potential cross-reactivity and difficult-to-predict off-target effects still present potential limitations in this context.

[0022] TCR repertoire detection in clinical diagnosis In a related aspect, there is growing interest in using the detection of the amount of specific TCR sequences for clinical diagnostic purposes. Particularly with the rise of deep sequencing methods, it is possible to capture the complete TCR diversity within an individual, both overall and for matched αβ pairs in a specific context. This could potentially provide a means to diagnose certain conditions and disease states by simply detecting the amount of expanded T cell clones as a surrogate readout for the establishment of an immune response to disease-associated antigens in a patient. However, such a comprehensive approach is currently limited to very strong immune responses with established clinical timepoints, and the specific antibodies of any particular TCR identified by sequencing cannot be determined. They suffer from the underlying difficulty of identifying the original target.

[0023] Therapeutic and diagnostic uses of T cell antigens The fundamental strength of harnessing the adaptive immune response translates into a central technical challenge: the exquisite specificity of TCR-antigen interactions requires detailed knowledge of the antigens specifically associated with each pathogen, cancer cell, or autoimmune disease. Furthermore, because each antigen can be presented by a specific antigen-presenting complex or its alleles, antigen discovery must be performed for each relevant HLA gene and allele. For several infectious diseases, such as HIV, influenza, and CMV, which are associated with strong adaptive immune responses and generally exhibit a conserved epitope response hierarchy, the most important epitopes have been mapped in association with several common HLAs. Similarly, in the fields of cancer, allergy, and autoimmunity, systematic attempts to map relevant T cell antigens have been increasing. However, these are challenging procedures, and efforts to systematically delineate T cell antigens associated with different clinical situations are hampered by the lack of efficient, robust, rapid, and adaptable protocols. Cancer cells represent a particularly challenging and important target, since most peptides displayed on the surface of malignant cells are self-antigens or closely resemble self-antigens. Thus, thymic selection will eliminate TCRs capable of strongly recognizing these peptides. At the same time, tumors evolve to evade immune recognition. This means that potent immune responses against established tumors are relatively rare, and targets are difficult to predict or discover. However, these responses do exist and, importantly, are usually associated with better outcomes. The targets of such responses, tumor-associated antigens (TAAs), most often have distinguishable characteristics from self and are derived from proteins that are overexpressed during cancer development, absent from the cell type at this stage of development, or specifically altered by genetic mutations or post-translational modifications, such as phosphorylation.

[0024] When available, knowledge of such epitopes will enable the examination of associated T cell responses for basic discovery, diagnostic purposes, and as tests of vaccine efficacy, for example. Importantly, they provide highly specific targets for T cell tolerization in allergy and autoimmunity, and crucially, valuable targets for specific immunotherapy and for combating malignant cells. Malignant lesions are particularly valuable targets for the promise of cellular immunotherapy, and progress in T cell engineering has been slowed by the lack of validated target TAAs beyond the few cases where specific markers for the cancer type happen to be available. Given the potential of cell therapy and the lack of validated targets, the identification of promising TCR antigens remains one of the most pressing obstacles for TCR-based immunotherapy, particularly in efforts to treat cancer.

[0025] Technical aspects of TCR and T cell antigen analysis Overall, the development of TCR-based therapies is still in its early stages and has met with limited success. Despite tremendous potential, diagnostic approaches have rarely been implemented in controlled clinical studies aimed at assessing patients' disease status or response to therapy. The lack of well-developed technologies for stable capture of native TCR chain pairs and systematic analysis of TCR-antigen interactions in the functional context of cell-cell communication at high throughput is a major obstacle to the development of TCR-based therapies and diagnostics.

[0026] Deep sequencing approaches have improved our understanding of T cell receptor diversity in health and disease. However, these approaches have generally focused on short segments spanning the CDR3 region of the TCR β chain. Most studies have ignored the contribution of the TCR α chain, and few have attempted to analyze the paired αβ chains and antigen specificity of a determined TCR of interest. Recent workflows using single-cell encapsulation and genetic barcoding have enabled analysis of the pairing and full-length sequences of native TCR αβ and γδ chain pairs, but such workflows are still experimental.

[0027] Isolated TCR chain pairs can be analyzed for antigen specificity in either biophysical or functional form. Biophysical analysis requires recombinant production of both the TCR and the analyte antigen in soluble form. In the case of HLA-restricted TCRs, this would therefore require production of every individual TCR and cognate pHLA complex. This is technically very challenging, slow, and low-throughput. Furthermore, such analyses provide only interaction affinities, which correlate poorly with functional characteristics in a predictable manner. Until recently, detailed functional analysis of isolated TCR sequences in the context of cells has been limited by cumbersome protocols that require transfection of analyte TCR chain pairs into primary T cells or immortal T cell lines and detection of cellular responses by traditional flow cytometry analysis of cell activation or detection of factors secreted by the transfected cells upon antigen challenge. A recent publication by Guo et al. reported the rapid cloning, expression, and functional characterization of paired TCR chains from single cells (Molecular Therapy - Methods and Clinical Development (2016) 3:15054). In this study, the analyte human αβ TCR pair was expressed in a reporter cell line lacking αβ TCR expression, which contained a green fluorescent protein (GFP) reporter system linked to the Nur77 promoter, which is activated upon TCR stimulation. This system remains inefficient due to the lack of standardized TCR integration into the reporter cell line genome and does not provide a systematic method for antigen challenge of cells bound to APC elements.

[0028] Similar to the workflow for identifying TCRs for known T cell antigens, the de novo discovery of novel T cell antigens in health and disease remains extremely challenging. Most approaches are still biophysical in nature and aim to generate candidate antigens to be tested in immunization protocols, or by identifying cognate TCRs as described above. There is little or no standardization in the field of T cell antigen discovery, and the field is largely limited to academic research.

[0029] With the accumulating interest in TCRs and their cognate receptors for both therapeutic and diagnostic uses, and the emergence of means to capture a significant number of naturally occurring TCR αβ and γδ chain pairs, there is still a lack of reliable, high-throughput, standardized techniques for the systematic analysis of TCR-antigen interactions. Importantly, there is a lack of standardized systems for the functional analysis of TCR chain pairs in the natural context of cell-cell communication, where TCRs and antigens are both presented by living cells. Furthermore, there is a lack of systems that can accomplish TCR candidate selection and / or affinity / functional maturation of TCR chain pairs in the relevant context of cell-cell communication.

[0030] Therapeutic uses of T cell antigens With the rapid expansion of knowledge about T cell biology, interest in the use of T cell antigens in therapeutic formulations has expanded. This has primarily taken the form of several types of immunization strategies. Most prominently, next-generation sequencing approaches can be used to identify mutated sequences in tumor cells. Such sequences may represent T cell antigens that are potentially unique to cancer cells and, therefore, potentially immunogens for personalized therapeutic vaccines against the sequenced tumor. However, given the large number of genetic mutations that can be observed, no high-throughput method exists to analyze these potential T cell antigens for their ability to be presented by a patient's HLA repertoire or whether they are immunogenic. Currently, predictions of mutant peptide binding are performed computationally for only a small number of HLA alleles. These predictive models provide rough information on whether a given peptide sequence binds to HLA and do not generally predict the immunogenic potential of the bound antigen. Furthermore, such computer models are unreliable for antigens that do not display canonical "anchoring" residues for the HLA allele against which the antigen is analyzed. Summary of the Invention [Problem to be solved by the invention]

[0031] For example, tolerance treatments for allergies and autoimmune syndromes and other immunological approaches, including prophylactic vaccination against pathogens, have required detailed knowledge of T cell antigens. In the case of the latter, prophylactic vaccines, knowledge of T cell antigens derived from common pathogens across all HLA alleles remains surprisingly limited, with knowledge of only a handful of HLA alleles remaining. There is a need for a systematic approach to expand this knowledge and develop effective vaccines against common and emerging pathogens. [Means for solving the problem]

[0032] The present invention addresses the above-mentioned needs. Specifically, the present invention relates to the construction, assembly, and use of a multi-component system comprised of at least three components: genetically engineered antigen-presenting cells (eAPCs), genetically engineered genomic acceptors, and matching gene donor vectors. The present invention is used for the rapid, high-throughput generation of stable derivative cells presenting various forms of antigenic molecules for the identification and characterization of antigens and cognate TCR sequences. Specifically, the eAPCs are genetically engineered by genome editing to eliminate cell surface presentation of human leukocyte antigen (HLA) molecules, HLA-like molecules, and distinct forms of antigen-presenting and antigenic molecules. Additionally, the eAPCs as part of the multi-component system contain a genomic acceptor site for insertion of an open reading frame (ORF) encoding an antigen-presenting molecule, and, optionally, a genetically encoded analyte antigen. The system further comprises a gene donor vector designed to target the genomic acceptor site of the APC for rapid delivery of ORFs encoding analyte antigen molecules and / or antigen-presenting complexes. The multi-component system may be used as an assay system in clinical immunodiagnosis. Furthermore, the present invention relates to the use of multicomponent systems to identify and characterize T cell antigens and cognate TCRs for the production of immunotherapeutic and immunodiagnostic agents. .

[0033] The present invention enables a highly standardized system for the assembly of various analyte eAPC forms in a systematic manner. This standardization and systemization is achieved through highly defined and controllable genomic integration of antigen-presenting complexes and antigenic molecule ORFs using matched donor vector / genomic acceptor site subsystems. This controllable and predictable system brings significant efficiency to the process of generating eAPC populations, reducing the cycle time and cost of the process. Previous systems have relied on unguided genomic integration and / or random integration using viral approaches. Furthermore, the system's design, in part, ensures a controllable copy number of the integrated ORF, typically a single copy, allowing for tight control over the achievable expression level of the integrated ORF product. More importantly, the ability to integrate a single copy of an ORF from a vector pool enables so-called "shotgun integration" (each cell integrated with a donor vector can receive only a single ORF from a library of vectors potentially encoding a diverse population of ORFs). This allows the conversion of the ORF library encoded in the donor vector into an eAPC library (essentially a cell-based array system similar to bacteriophage or yeast display systems) in which each eAPC clonal subpopulation expresses a single desired analyte ORF. This array system can facilitate the identification of unknown analyte antigen sequences within the sequence library based on their reactivity with TCRs or other affinity reagents when presented by eAPCs, and the subsequent recovery of the unknown "reactive" sequences from the carrier eAPCs. Furthermore, shotgun integration allows for the efficient production of each analyte antigen within target cells. Compared to transient transfection of a large pool of analyte antigen sequences (resulting in only a small level of transcripts available for any given analyte antigen), each cell in an eAPC library generated by shotgun integration reliably expresses a single analyte for surface presentation by eAPCs, thereby facilitating identification of analyte antigens by various means.

[0034] The present invention provides genetically engineered multi-component systems whose components are used to produce one or more analyte eAPCs. These analyte eAPCs are then combined with one or more analyte TCRs (collectively, eAPC:TCR systems, eAPC:T) to generate one or more outputs, where the analyte TCRs can be provided as soluble or immobilized reagents and can be presented on the surface of cells or presented by non-cell-based particles (NCBPs). The eAPCs present candidate analyte antigens to the analyte TCRs.

[0035] The minimal multi-component system comprises a first component (termed component A) as an eAPC containing a second component as a genome acceptor site, and a third component as a gene donor vector (termed component C) (Figure 1). eAPCs are the fundamental component of a multi-component system to which all other components of the system relate. As such, eAPCs contain certain characteristics, either native or engineered, that make them suitable for use in generating analyte eAPC populations.

[0036] In the context of the present invention, eAPC (component A) is i. lacking endogenous surface expression of at least one family of antigen-presenting complexes (aAPXs) and / or analyte antigenic molecules (aAMs); ii. contains at least one genomic acceptor site (designated component B); wherein i) may be obtained by selection of a naturally occurring cell population lacking expression of aAPX and / or aAM or may be engineered to lack said expression, and ii) may be synthetic or introduced by specific or non-specific genomic integration.

[0037] Selection of candidate eAPC cells lacking the desired aAPX and / or aAM expression from a naturally occurring cell population can be achieved by methods well known in the art, including directly staining target cells with an affinity reagent specific for the aAPX and / or aAM desired to be lacking from the eAPC, and selecting for cells lacking the target aAPX and / or aAM expression. Engineering cells to lack aAPX and / or aAM expression can be achieved by non-targeted or targeted means. Non-targeted mutagenesis of cells can be achieved by providing the cells with a chemical, radiological, or other mutagen, followed by selection of cells lacking the targeted aAPX and / or aAM expression. Targeted mutation of genomic loci can include, but is not limited to: i. zinc finger nucleases, ii. CRISPR / Cas9-mediated targeting; iii. Synthetic Transcription Activator-Like Effector Nucleases (TALENs) This can be achieved by different means, including site-directed mutagenesis by Here, the site-specific nuclease induces site-specific DNA repair error mutagenesis at the target locus, and mutant cells are then obtained by selection of cells lacking the targeted aAPX and / or aAM expression.

[0038] Component A (eAPC) may optionally contain an additional T cell costimulatory receptor. This feature allows for robust or variable forms of communication between the analyte eAPC and the analyte TCR-presenting cell (analyte TC), and tunable communication is suitable for identifying or characterizing specific analyte TCRs and / or analyte antigens. In the context of the present invention, various forms of CD28 ligation on the analyte TC can be facilitated by including one or more of CD80, CD86, and / or additional B7 family proteins. Component A (eAPC) may optionally further comprise the introduction of cell surface adhesion molecule components or the removal of endogenous cell surface adhesion molecules to promote binding of eAPC with the analyte TC and formation of an immune synapse, or to avoid tight binding and the formation of detrimental cell clustering within the eAPC:T combination system, respectively. Adhesion molecules, which may be introduced into component A as additional ORFs or genetically removed from component A, can be selected from the integrin family of adhesion proteins. eAPCs may optionally have the ability to process antigens and load them as cargo onto aAPX via native processing and loading mechanisms (referred to as aAPX:aAM). eAPCs capable of processing antigens and loading them as cargo onto aAPX via native processing and loading mechanisms also have the ability to process and load cargo molecules (CM) endogenous to the eAPC or the culture system (containing the eAPC) (aAPX loaded with CM is referred to as an aAPX:CM complex) (Figure 17).

[0039] The second component of the minimal multi-component system is a gene donor vector (component C) used for the integration of at least one ORF encoding at least one aAPX and / or aAM (Figure 1). Component C is a gene donor vector that is coupled to a genomic acceptor site for component B contained within the genome of an eAPC (component A). Component C is designed for integration of one or more ORFs encoding aAPX and / or aAM, encoded by the gene donor vector, into the genomic acceptor site (component B), where this integration results in expression of aAPX and / or aAM by the target eAPC. In the context of the present invention, the paired gene donor vector and genomic acceptor site are also described as an integration couple. In an expanded version of the multi-component system, component A (eAPC) may further comprise a second genomic acceptor site (designated component D) coupled with a second gene donor vector (designated component E; also added to the system) (Figure 2). The multi-component system may further comprise one or more additional integration couples.

[0040] The multi-component system comprising eAPC and one or two integration couples is a derivative eAPC form: i.e., eAPC-p ii.eAPC-a iii.eAPC-pa wherein each gene donor vector contains one or more ORFs encoding one or more aAPXs and / or aAMs for integration into coupled genomic acceptor sites, i) expressing at least one aAPX, ii) expressing at least one aAM, and iii) expressing at least one aAPX and at least one aAM (Figure 3). The gene donor vector and genomic acceptor site serve as the integration couple subsystem of the multi-component system. The gene donor vector must first be combined with the target ORF, where the basic donor vector encodes the target ORF. The assembled and primed donor vector is then introduced into the target eAPC to exchange the target ORF with the genomic acceptor site, thereby integrating the target ORF into the coupled acceptor site of the target cell (Figure 4).

[0041] A multi-component system comprising gene donor vector components C and / or E may be combined with at least one ORF encoding at least one aAPX and / or aAM to yield components C' and / or E', where combination is defined as ligation of the genetic material into the correct coding frame and in the correct orientation of the gene donor vector. The combination of one or more ORFs into Gene Donor Vectors C and / or E can be performed using a library of unique ORFs: i. Separate reactions to obtain separate libraries of C' and / or E' vectors encoding multiple ORFs ii. A single reaction to obtain a pooled library of C' and / or E' vectors encoding multiple ORFs wherein separate libraries may be combined with component A multiple times to yield separate libraries of eAPCs with unique ORFs encoding unique aAPXs and / or aAMs, or pooled libraries may be combined with component A as a single event to yield a pooled library of eAPCs each with a unique ORF encoding a unique aAPX and / or aAM. Efficient integration of one or more ORFs in a predictable copy number into a genomic acceptor site is highly advantageous for the operation of standardized eAPCs, from which analyte eAPC populations can be rapidly prepared and characterized. Thus, the genomic acceptor site and the coupled donor vector are critical to eAPC function. Furthermore, it is highly desirable to produce eAPCs in which components B and D are isolated from each other, such that donor vector component C is not integrated with component B, and vice versa. Additionally, it is also desirable that component B and / or component D are amenable to methods of generating eAPCs in which the introduction of a defined single aAPX- and / or aAM-containing construct is rapid and repeatable, with a high likelihood of correct integration and delivery of only a single analyte.

[0042] The genomic acceptor site is: i. Synthetic constructs designed for recombinase-mediated cassette exchange (RMCE) ii. Synthetic constructs designed for site-specific homologous recombination iii. Native genomic sites for site-specific homologous recombination The RMCE method can be selected from the following, where i) is preferred. Selected heterospecific sites may be employed that are specific for individual recombinase enzymes, such that The genomic acceptor site, component B and / or component D, may contain the following genetic elements: i. heterospecific recombinase site ii. Homology arm iii. Eukaryotic promoters iv. Eukaryotic conditional regulatory elements v. Eukaryotic terminator vi. Selectable marker vii. splice acceptor site viii. splice donor site ix. Non-protein-coding genes x. Insulator xi. Mobile genetic elements xii. Meganuclease recognition site xiii. Internal ribosome entry site (IRES) xiv. Viral self-cleaving peptide elements xv. Kozak consensus sequence It comprises at least one of the following.

[0043] The preferred genomic acceptor site is constructed in two different configurations using the following selected elements from the list of elements previously described: The first configuration is for accepting, by RMCE integration, a single ORF encoding one or more aAPXs and / or aAMs and / or a selectable marker for integration, wherein the configuration is 5'-[A] [B] [C] [D] [E] [F]-3' where: A) is element iii) a constitutive or inducible eukaryotic promoter; B) is element i) heterospecific recombinase site 1, C) is element xv) Kozak consensus sequence; D) is element vi) FACS and / or MACS compatible encoded protein marker; E) is element i) heterospecific recombinase site 2; F) is element v) a eukaryotic terminator.

[0044] The second configuration is for receiving, by RMCE integration, two ORFs encoding one or more aAPX and / or aAM and / or selectable markers for integration, wherein the configuration is: 5'-[A] [B] [C] [D] [E] [F] [G] [H] [I]-3' where: A) is element iii) a constitutive or inducible eukaryotic promoter; B) is element i) heterospecific recombinase site 1, C) is element xv) Kozak consensus sequence; D) is element vi) FACS and / or MACS compatible encoded protein marker 1 , E) is element v) eukaryotic bidirectional transcription terminator; F) is element vi) FACS and / or MACS compatible encoded protein marker 2; G) is element xv) Kozak consensus sequence; H) is element i) heterospecific recombinase site 2; I) is element iii) a constitutive or inducible eukaryotic promoter, Furthermore, in this second configuration, elements F, G and I are encoded in the antisense orientation.

[0045] Components C and / or E may comprise the following genetic elements: i. heterospecific recombinase site ii. Homology arm iii. Eukaryotic promoters iv. Eukaryotic conditional regulatory elements v. Eukaryotic terminator vi. Selectable marker vii. splice acceptor site viii. splice donor site ix. Non-protein-coding genes x. Insulator xi. Mobile genetic elements xii. Meganuclease recognition site xiii. Internal ribosome entry site (IRES) xiv. Viral self-cleaving f element xv. Kozak consensus sequence xvi. Integrative selectable marker xvii. Antibiotic resistance cassette xviii. Bacterial origins of replication xix.Yeast replication origin xx. Cloning site It consists of at least one of the following:

[0046] In preferred embodiments of the gene donor vector, component C and / or component E are configured in two different possible configurations using the following selected elements from the list of elements previously described: The first configuration is for delivery of a single ORF encoding one or more aAPX and / or aAM and / or a selectable marker for integration by RMCE integration, wherein the configuration is 5'-[A][B][C][D][E]-3' where: A) is element i) heterospecific recombinase site 1, B) is element xv) Kozak consensus sequence, C) comprises element xx) one or more aAPX and / or aAM and / or element xvi) incorporation a cloning site for a single ORF encoding a selectable marker for D) is element i) heterospecific recombinase site 2; E) is element xvii) an antibiotic resistance cassette and element xviii) a bacterial origin of replication in a non-specific orientation; Additionally, elements viii and / or xiv may be used to link together multiple aAPXs and / or aAMs and / or element xvi.

[0047] The second configuration is for delivery of two ORFs encoding one or more aAPX and / or aAM and / or a selectable marker for integration by RMCE integration, wherein the configuration is: 5'-[A] [B] [C] [D] [E] [F]-3' where: A) is element i) heterospecific recombinase site 1, B) is element xv) Kozak consensus sequence, C) is a cloning site for the introduction of one or more aAPX and / or aAM and / or elements xvi) two or more ORFs encoding a selectable marker for integration and having a eukaryotic terminator, D) is element xv) Kozak consensus sequence (antisense orientation); E) is element i) heterospecific recombinase site 2; F) element xvii) antibiotic resistance cassette and element xviii) bacterial origin of replication in a non-specific orientation; Additionally, elements viii and / or xiv may be used to link multiple aAPXs and / or aAMs and / or element xvi together within each ORF.

[0048] Preparation of analyte eAPC using a multicomponent system The above multi-component system may be used in multiple ways to generate distinct forms of analyte eAPCs or libraries thereof that, during operation, serve to present analyte aAPX, aAM, aAPX:aAM and aAPX:CM to the analyte TCR within the eAPC:T combination system (see Figure 27). A multi-component system comprising a single integration couple may be used to generate eAPC-p in one step from component A by providing component C' combined with the ORF of aAPX. This aAPX is incorporated into site B to generate component B'. The resulting cell line expresses the provided aAPX, which is displayed on the cell surface (Figure 5). A multicomponent system comprising two integration couples may be used to generate eAPC-p in one step from component A by providing component C' combined with the ORF of aAPX. This aAPX is integrated into site B to generate component B'. The resulting cell line expresses the provided aAPX, which is displayed on the cell surface. The second integration couple D / E remains unmodified and can be used in downstream integration steps (Figure 6). A multicomponent system comprising a single integration couple may be used to generate eAPC-a in one step from component A by providing component C' combined with the ORF of an aAM. This aAM integrates into site B to generate component B'. The resulting cell line expresses the provided aAM, which is either displayed on the cell surface or retained intracellularly (Figure 7). A multicomponent system comprising two integration couples may be used to generate eAPC-a in one step from component A by providing component C' combined with the ORF of an aAM. This aAM integrates at site B to generate component B'. The resulting cell line expresses the provided aAM, which is either displayed on the cell surface or retained intracellularly. The second integration couple D / E remains unmodified and can be used in a downstream integration step (Figure 8).

[0049] A multicomponent system comprising a single integration couple may be used to generate eAPC-pa in one step from component A by providing component C' combined with two ORFs, one encoding aAPX and the other encoding aAM. Both aAPX and aAM are integrated into site B to generate component B'. The resulting cell line may express the provided aAPX and aAM and display aAPX:aAM on the cell surface (Figure 9). A multicomponent system comprising two integration couples may be used to generate eAPC-pa in one step from component A by providing component C' combined with two ORFs, one encoding aAPX and the other encoding aAM. Both aAPX and aAM are integrated into site B to generate component B'. The resulting cell line may express the provided aAPX and aAM and display aAPX:aAM on the cell surface. The second integration couple D / E may remain unmodified and be used in downstream integration steps (Figure 10). A multicomponent system comprising two integration couples may be used to generate eAPC-pa in one step from component A by providing components C' and E', each combined with one ORF encoding either aAPX or aAM. Both aAPX and aAM are integrated into sites B or D to generate components B' and D'. The resulting cell line may express the provided aAPX and aAM and display aAPX:aAM on the cell surface (Figure 11). A multicomponent system comprising two integration couples may be used to generate eAPC-pa in two steps from component A by first providing component C' combined with an ORF encoding aAPX. This aAPX integrates at site B to generate component B'. The resulting cell line expresses the provided aAPX, which is displayed on the cell surface (eAPC-p intermediate). The second integration couple D / E remains unmodified. In a second step, a donor vector provides E' combined with an ORF encoding an aAM. This aAM integrates at site E to generate component E'. The resulting cell line expresses the provided aAM, which may be processed at aAPX and loaded as cargo to form an aAPX:aAM complex on the cell surface (Figure 12). A multicomponent system comprising two integration couples may be used to generate eAPC-pa in two steps from component A by first providing component C' combined with an ORF encoding an aAM. This aAM is integrated into site B to generate component B'. The resulting cell line expresses the provided aAM (eAPC-a intermediate). The second integration couple D / E remains unmodified. In a second step, a donor vector is provided E' combined with an ORF encoding an aAPX. This aAPX is integrated into site E to generate component E'. The resulting cell line expresses the provided aAPX, which is displayed on the cell surface. The aAM integrated in the first step may be processed at aAPX and loaded as cargo to form an aAPX:aAM complex on the cell surface (Figure 13).

[0050] In the above example of generating analyte eAPC-p, eAPC-a, and eAPC-pa populations from eAPCs, a multi-component system is used to provide known aAPX and aAM candidates in a defined manner to generate distinct populations of analyte eAPCs expressing the defined aAPX and / or aAM. This method may be repeated multiple times to construct a library of eAPC-p, eAPC-a, and eAPC-pa that is provided to the eAPC:T combination system during system operation. An alternative approach is to employ a pooled library of candidate aAPX and / or aAM ORFs that are combined with gene donor vectors and integrated in a single reaction to obtain a pooled library of analyte eAPC-p, eAPC-a, or eAPC-pa expressing multiple aAPXs, aAMs, and / or aAPX:aAMs. This method of converting a vector pool into a pool of eAPC-p, -a, and / or -pa is referred to as shotgun integration. This is particularly useful when analyzing large libraries of candidate aAMs against immobilized aAPX, or vice versa. A multicomponent system comprising two integration couples may be used to generate eAPC-pa in two steps from component A by first providing component C' in combination with an ORF encoding an aAPX. This aAPX integrates into site B to generate component B'. The resulting cell line expresses the provided aAPX on the cell surface (eAPC-p intermediate). The second integration couple D / E remains unmodified. In the second step, a library of E's is provided, where the library of donor vectors comprises a vector pool, each combined with a single ORF encoding an aAM, and each aAM integrates into site E in a single cell to generate component E'. The resulting cell pool comprises a population of cells, each cell integrating a single random aAM ORF from the original vector pool. The aAM integrated in the second step may be processed and loaded as cargo at the aAPX integrated in the first step to form an aAPX:aAM complex on the cell surface (Figure 14).

[0051] A multicomponent system comprising two integration couples may be used to generate eAPC-pa in two steps from component A by first providing component C' combined with an ORF encoding an aAM. This aAM integrates at site B to generate component B'. The resulting cell line expresses the provided aAM (eAPC-a intermediate). The second integration couple D / E remains unmodified. In a second step, a library of E's is provided, where the library of donor vectors comprises a vector pool, each combined with a single ORF encoding an aAPX. Each aAPX integrates at site E in a single cell to generate component E'. The resulting cell pool comprises a population of cells, each cell integrating a single random aAPX ORF from the original vector pool. The aAM integrated in the first step may be processed and loaded as cargo at the aAPX integrated in the second step, forming an aAPX:aAM complex on the cell surface (Figure 15). A multicomponent system comprising two integration couples may be used to generate eAPC-pa in one step from component A by providing components C' and E', each combined with a library of ORFs encoding either a library of aAPXs or a library of aAMs. Both aAPXs and aAMs integrate at sites B or D, generating B' and D'. The resulting cell pool contains a population of cells, each integrating a single random aAPX ORF and a single random aAM ORF from the original vector pool. Within each cell in the pooled library, the integrated aAM may be processed and loaded as cargo onto an aAPX integrated in the same cell, forming an aAPX:aAM complex at the cell surface. This pooled library may contain all possible aAPX:aAM combinations from the provided aAPX and aAM sets (Figure 16). In the above-described shotgun integration method for providing a pooled library of eAPC-pa, the robustness of the system relies on a single copy of the genomic acceptor site. This ensures that only a single analyte is introduced into each cell via the integration couple. This single copy of the genomic acceptor site is an optional aspect of eAPCS, because multiple copies of the same genomic acceptor site can be beneficial in providing an integration step in which multiple "alleles" from the library of provided vectors can be obtained in the produced eAPCs.

[0052] In the context of the present invention, aAPX is: i. one or more members of HLA class I ii. one or more members of HLA class II iii. One or more non-HLA antigen-presenting complexes may be selected from one of: In the context of the present invention, aAPX is: i. a polypeptide or a complex of polypeptides that serves as the analyte antigen ii. A peptide derived from a polypeptide that serves as the analyte antigen iii. A peptide serving as the analyte antigen iv. Metabolites serving as analyte antigens v. A polypeptide or a complex of polypeptides translated from the analyte antigenic molecule ORF vi. Peptides derived from polypeptides translated from the analyte antigenic molecule ORF vii. Peptides derived from modifications of the Component A proteome viii. Polypeptides derived from the component A proteome ix. Component A: Metabolites derived from alterations in the metabolome may be selected from one of:

[0053] Contact of analyte eAPC with analyte TC The present invention provides a genetically engineered multi-component system in which component A and one or more components C' and / or one or more components E' are used to generate one or more analyte eAPC populations. These analyte eAPCs are then combined with one or more analyte TCRs to form an eAPC:TCR analytical system (eAPC:T) and generate one or more outputs (Figure 27). In this system, the eAPCs provide the analyte antigen and the analyte TCRs are: i. TCR molecules and / or ii. A molecule having affinity for the analyte antigen and the analyte TCR may be represented in the eAPC:T system by: i. Analyte TCR presenting cells (TC) and / or ii. a soluble or immobilized affinity reagent and / or iii. Non-cell-based particles (NCBPs) may be presented in a different manner to the eAPC represented as: i) An analyte TCR-presenting cell (TC) is considered to be any TC capable of presenting an analyte TCR to an eAPC; ii) an affinity reagent is considered to be any reagent made as an analyte to probe for TCR binding and / or stimulation on the cell surface of eAPCs in an APC:T system. This reagent can be an analyte TCR multimer reagent (e.g., a TCR "tetramer") used to stain eAPCs. In this regard, the affinity reagent can be an antibody or similar; iii) a non-cell-based particle (NCBP) acts in a manner similar to an affinity reagent insofar as the particle is an analyte TCR or other substance to be evaluated for analyte antigen binding on the surface of eAPCs in an eAPC:T system. However, an NCBP can also be considered as a larger substance capable of carrying additional genetic or other information that acts directly or indirectly as an identifier for the presented analyte TCR or other binder. A typical example of an NCBP is a bacteriophage in a phage display context, where the phage can display antibody fragment-antigen binding (FAB). Positively labeled eAPCs can be recovered along with the phage and sequenced to identify FABs specific for the analyte antigen on the eAPC surface.

[0054] Furthermore, cellular presentation of the analyte TCR may involve: i. Primary T cells ii. Recombinant T cells iii. Genetically engineered TCR-presenting cells iv. Genetically engineered cells that present molecules with affinity for the analyte antigen. (collectively referred to as the analyte TC) may be in any form. The eAPC:T assay system is comprised of one or more analyte eAPC populations and an analyte TCR (Figure 27). The analyte eAPC population is generated using a multicomponent system as described above (Figures 3-16). The eAPC:T system is provided in a format that allows for physical contact between the analyte eAPC and the analyte TCR, which allows for complex formation between the analyte antigen and the analyte TCR presented by the one or more analyte eAPC.

[0055] The analyte antigen is any substance to which the analyte TCR can putatively bind in the eAPC:T system: i.aAPX (analyte antigen presenting complex) and / or ii. aAM (analyte antigenic molecule) and / or iii. aAPX:aAM (analyte antigen presenting complex that presents the analyte antigenic molecule) and / or iv. CM (non-analyte cargo molecule) and / or v. aAPX:CM (analyte antigen-presenting complex that presents cargo molecules) where aAPX is a complex capable of presenting aAM, aAM is any molecule that is recognized by TCR either directly or when loaded onto aAPX, aAPX:aAM is aAPX loaded with aAM, CM is a cargo molecule that can be loaded onto aAPX but is not the analyte and therefore may originate from the analyte antigen-presenting cell (APC) or the assay system itself, and aAPX:CM is aAPX loaded with CM.

[0056] In the context of the present invention, the eAPC:T system: i. Input of a single analyte eAPC or ii. Input of the library of pooled analyte eAPCs It consists of the following: iii. Single analyte TC input, or iv. input of a single analyte affinity reagent; or v. Input of a single analyte NCBP, or vi. Input of a pooled library of analyte TCs; or vii. Input of a pooled library of analyte affinity reagents; or viii. Input of pooled library of analyte NCBP It is combined with one of the following:

[0057] Contact in a buffer system Contact between the analyte eAPC and the analyte TC is carried out in an acceptable cell culture system or buffered medium, where the system includes a medium that allows the function of both the analyte eAPC and analyte TC cells, the analyte affinity reaction agent, or the analyte NCBP. Contact of the soluble analyte TCR, immobilized analyte TCR and / or analyte NCBP with the analyte eAPC is carried out in an acceptable buffered system, wherein the system comprises a buffered medium that permits function of both the analyte TCR and the analyte eAPC cells.

[0058] Labeling of eAPCs with affinity reagents or NCBP The analyte eAPCs obtained from the multicomponent system can be used to characterize the analyte antigens presented by the eAPCs, which can be done in a manner in which the analyte eAPCs are contacted with immobilized or soluble affinity reagents or NCBPs to label the eAPCs (Figure 24). The label on the eAPCs may be detected by direct observation of the label by methods such as flow cytometry, microscopy, spectroscopy, or luminometry, or by capture with an immobilized affinity reagent or NCBP for identification of the analyte antigen.

[0059] Signal Response Definitions The analyte eAPC obtained from the multi-component system is used to characterize the signal response of the analyte eAPC to the analyte TCR, where this signal response can be either binary or graded and can be measured as intrinsic to the eAPC (FIG. 21) and / or intrinsic to the analyte TCR, if included (FIG. 20). This signal can be detected by methods such as flow cytometry, microscopy, spectroscopy or luminometry, or other methods known to those skilled in the art.

[0060] General Method - eAPC Selection A method of selecting an input analyte eAPC or one or more analyte eAPCs from a library of analyte eAPCs from an eAPC:T combination system to obtain one or more analyte eAPCs, wherein expressed analyte antigen binds one or more analyte TCRs, comprises: i. combining one or more analyte eAPCs with one or more analyte TCRs to provide contact between the analyte antigen and the analyte TCR; and at least one of the following: ii. measuring the formation of complexes, if any, between one or more analyte antigens and one or more analyte TCRs; and / or iii. Measuring the signal from the labeled analyte TCR, and / or iv. measuring the signal response, if any, by the analyte eAPC induced by complex formation between one or more analyte antigens and one or more analyte TCRs; and / or v. measuring a signal response, if any, by the analyte TCR induced by complex formation between one or more analyte antigens and one or more analyte TCRs; vi. Selection of one or more analyte eAPCs according to steps ii, iii, iv and / or v, wherein the selection is performed by positive and / or negative determinations. where i, iv and vi or i, v and vi comprise preferred configurations.

[0061] General Methods - Selection of Analyte TCR A method for selecting one or more analyte TCRs from an input analyte TCR or library of analyte TCRs to obtain one or more analyte TCRs, wherein expressed analyte antigen binds to the one or more analyte TCRs, comprises: i. combining one or more analyte APCs with one or more analyte TCRs to bring the analyte antigens presented by the analyte APCs into contact with the one or more analyte TCRs; ii. measuring the formation of complexes, if any, between one or more analyte antigens and one or more analyte TCRs; and / or iii. Measuring the signal from the labeled analyte TCR, and / or iv. measuring the signal response, if any, in one or more analyte TCRs induced by complex formation between the analyte TCR and the analyte antigen; and / or v. measuring a signal response, if any, by the analyte APC induced by complex formation between one or more analyte TCRs and one or more analyte antigens; vi. Selection of one or more analyte APCs from steps ii, iii, iv and / or v, wherein selection is performed by positive and / or negative determinations; where i, iv and v include preferred configurations.

[0062] General methods for signal response A method for selecting an analyte eAPC and / or an analyte TC and / or an affinity reactant and / or an NCBP from an eAPC:T combination system based on a reported signal response includes: i. determining the native signaling response; and / or ii. Determining a synthetic signaling response (if the eAPC contains such a response circuit and / or if the analyte TC contains an equivalent synthetic reporter circuit) Includes. The induced natural or synthetic signal response that is specific to the APC and / or the analyte TC may be: i. Secreted biomolecules ii. Secreted chemicals iii. Intracellular biomolecules iv.Intracellular chemicals v. Surface-expressed biomolecules vi. Cytotoxic effect of analyte TC on analyte eAPC vii. A paracrine effect of the analyte TC on the analyte eAPC, such that a signal response is induced in the analyte APC and determined by detecting an increase or decrease in any of i to v. viii. Proliferation of analyte TC ix. Immune synapse between analyte TC and analyte eAPC and wherein the detected signal response is compared to an uninduced signal response state specific to the analyte eAPC and / or analyte TC prior to assembly of the eAPC:T combination system and / or a parallel assembled combination system, wherein the analyte eAPC and / or analyte TC may present a control analyte antigen and / or analyte TCR species and / or soluble analyte antigen that is known not to induce a signal response in the eAPC:T combination system being used.

[0063] Methods of selection by label and / or signal response A method for selecting an analyte eAPC and / or an analyte affinity reactive agent and / or an analyte NCBP from an eAPC:T combination system includes: i. Determine labeling of eAPCs with affinity reagents or NCBPs This includes: ii. determining the native signaling response, and / or iii. Determining the composite signaling response (if the eAPC contains such a response circuitry) and wherein selecting eAPCs and / or affinity reactants and / or NCBPs by detecting a label on the eAPCs may include detecting the surface label on the eAPCs with the affinity reactant and / or NCBP by including a detectable label on the affinity reactant and / or NCBP. The detectable label may be a fluorescent, luminescent, spectroscopic, chemical, radiochemical, or affinity moiety. Thus, this selection of eAPCs may be based on FACS, MACS, or equivalent high-throughput screening and selection methods.

[0064] summary Within the eAPC:T combination system, measurement of a signal response in one or more analyte eAPCs or one or more analyte TCs, or labeling of eAPCs that may be mediated by complex formation between the analyte antigen and the analyte TCR (FIG. 27, step iv), is critical to the selection of a primary system output (FIG. 27, step v), where the primary system output is a single cell or pool of cells, and / or a single affinity reactant or pool of affinity reactants, and / or a single NCBP or pool of NCBPs, where cell or reactant selection can be based on the presence or absence of a signal response reported in either and / or both of the contacted analyte eAPC or analyte TC cells, or by measurable labeling of the eAPC with the affinity reactant or NCBP.

[0065] Obtaining primary system output from the eAPC:T system The present invention provides a genetically engineered multi-component system. Component A and one or more components C' and / or one or more components E' are used to generate one or more analyte eAPC populations. These analytes are then combined with one or more analyte TCRs by an eAPC:T system to generate one or more outputs. The analyte TCRs may be provided as soluble or immobilized reagents, presented on a cell surface, or presented by a non-cell-based particle (NCBP). Cellular presentation of the analyte TCRs involves the following: i. Primary T cells ii. Recombinant T cells iii. Genetically engineered TCR-presenting cells iv. Genetically engineered cells that display molecules with affinity for the analyte antigen. (These are collectively referred to as the analyte TC) It can be in any of the following forms:

[0066] The system comprises one or more analyte eAPC populations and a selection of analyte TCRs (Figure 27). The analyte eAPC populations are generated using a multicomponent system as described above (Figures 3-16). The eAPC:T system is provided in a format that allows physical contact between the analyte eAPCs and the analyte TCRs, where this contact allows complex formation between the analyte antigens presented by the one or more analyte eAPCs and the analyte TCRs, where the analyte antigens are: i.aAPX and / or ii.aAM and / or iii. aAPX:aAM and / or iv. Commercials and / or v.aAPX:CM wherein the analyte TCR is presented by the analyte TC, or presented by either a soluble or immobilized analyte affinity reagent, or presented by the analyte NCBP, for possible binding to the analyte antigen presented by the analyte eAPC, and complex formation can lead to stabilization of the complex, leading to labeling of the eAPC and / or induction of signaling in the analyte eAPC, and labeling of the eAPC and / or induction of signaling in the analyte eAPC and / or analyte TC can be reported and measured.

[0067] The aspects of reporting the induced signal response and / or labeling of the eAPC are as described above, and it is these reported responses and / or labels that need to be measured when obtaining the primary output of the multi-component system constructed into the eAPC:T system. The primary output from the eAPC:T system is a selected cell population and / or a selected affinity reactant or a selected NCBP, wherein the selection is: i. measurable labeling of eAPCs with an affinity reagent or NCBP, and / or ii. a signal response detected in the eAPC, and / or iii. the absence of a detectable signal response in eAPCs, and / or iv. A signal response detected in the analyte TC, and / or v. Lack of signal response detected in the analyte TC wherein the primary output can be expressed as a single cell or a pool of cells and / or one or more eAPC-bound affinity reactants or NCBPs (affinity reactants or NCBPs bound to eAPCs).

[0068] From the eAPC:T combination system, the analyte affinity reactive agent, NCBP, or analyte TC and / or analyte eAPC can be selected based on the response in the contacted cells. That is, the analyte TC can be selected based on the reported response, or lack thereof, in the contacted analyte eAPC. Conversely, the analyte eAPC can be selected based on the reported response, or lack thereof, in the contacted analyte TCR, or if the analyte TC is an analyte affinity reactive agent or NCBP, the analyte affinity reactive agent or NCBP can be selected from the eAPC response.

[0069] The eAPC and / or analyte TC output from the system are selected cells, where selection is based on the presence or absence of a reported signal response in either the analyte TC or eAPC, and these cells may include one or more eAPCs and / or one or more analyte TCs, where the selected cells may include a single cell, a pool of cells of the same identity, or a pool of cells of different identities (Figure 27 step v). The primary analyte affinity reactant or NCBP output from the system is selected cells with or without bound affinity reactant or NCBP, where selection is based on the presence or absence of labeling or reported signal response by the analyte eAPC, where the selected affinity reactant or NCBP may include a single affinity reactant or NCBP, a pool of affinity reactants or NCBPs of the same identity, or a pool of affinity reactants or NCBPs of different identities (Figure 27 step v).

[0070] Output from binary compositions The signals reported in the analyte eAPCs and / or analyte TCs within the eAPC:T combination system may be used to select an analyte cell population to provide a primary output. For the present invention, a primary output of analyte eAPCs may be achieved by selecting the desired analyte TCR-labeled eAPC population from the eAPC:T combination system when the eAPC:T combination system is of a binary composition of one or more analyte eAPCs and analyte TCRs (e.g., FIG. 24). The primary output of analyte affinity reactive agent or NCBP can be achieved by selecting the desired analyte eAPC population labeled with the analyte affinity reactive agent or analyte NCBP from the binary system when the eAPC:T combination system is a binary composition of one or more analyte eAPCs and an analyte affinity reactive agent or analyte NCBP (e.g., Figure 24). The primary output of the eAPC and / or analyte TC type is determined by the eAPC:T combination system. Where the eAPC:T combination system is of the nature of immobilized analyte TC and pooled library analyte TC (e.g., Figure 22) or where the eAPC:T combination system is of the nature of immobilized analyte TC and pooled analyte eAPC library (e.g., Figure 23), this can be achieved by selecting the desired analyte APC and / or analyte TC populations from the combined culture system. Primary output of analyte eAPCs can be achieved by selecting the desired analyte eAPC population from the combined culture system when the eAPC:T combination system is of immobilized analyte TCR and pooled library analyte eAPCs (e.g., Figure 24) or when the eAPC:T combination system is of immobilized eAPCs and pooled soluble analyte affinity reagent or NCBP library. The primary output of analyte affinity reactants or analyte NCBPs can be achieved by selecting the desired analyte affinity reactant or analyte NCBP population from the combined culture system when the eAPC:T combination system is in the nature of immobilized soluble analyte affinity reactants or analyte NCBPs and pooled library analyte eAPCs (e.g., Figure 24) or when the eAPC:T combination system is in the nature of immobilized eAPCs and pooled analyte affinity reactants or analyte NCBP libraries.

[0071] How to obtain the output There are several different embodiments in which a primary output can be obtained, where each embodiment involves a cell sorting step. Sorting may be achieved by fluorescence activated cell sorting (FACS) and / or magnetic activated cell sorting (MACS) and / or different affinity activated cell sorting methods. The primary output eAPCs and / or analyte TC cells and / or eAPC-binding affinity reagents or NCBPs may be obtained by single cell sorting to obtain single cells and / or by cell pool sorting to obtain cell pools. The primary output eAPCs and / or analyte TC cells may be obtained by single cell sorting to obtain single cells, which may then be expanded, if desired, to obtain a monoclonal pool of selected eAPCs or analyte TC cells. The primary output eAPCs and / or analyte TC cells may also be obtained by cell pool sorting to obtain a cell pool, which may then be expanded, if necessary, to obtain a pool of selected eAPCs and / or TC cells.

[0072] Obtaining end system output from the eAPC:T system Following the above method of obtaining a primary output that is a selected analyte eAPC and / or analyte TC and / or analyte NCBP based on a measured signal response or stable complex formation, a terminal output from the eAPC:T system can be obtained by further processing of the selected eAPC and / or analyte TC and / or NCBP primary output (Figure 27, step vi). The terminal output from the multi-component system is provided by the analyte APC or analyte TC or analyte affinity reactant or analyte NCBP and is obtained as the primary output from the multi-component system by selection from the eAPC:T combination system. i.aAPX and / or ii.aAM and / or iii. aAPX:aAM and / or iv. Commercials and / or v.aAPX:CM and / or vi.TCR is the identity of

[0073] In eAPC:T systems, the analyte molecules presented by the analyte eAPCs and analyte TCs are frequently genetically encoded. For example, when an NCBP is displayed by a bacteriophage, the analyte NCBP may have a genetically encoded identity. Thus, the generated analyte eAPCs, TCs, and NCBPs may be genetically sequenced to identify the analyte molecules presented by the analyte eAPCs, analyte TCs, or analyte NCBPs. The selected primary output is to obtain gene sequences for the genome or transcriptome of the selected and / or expanded cells: i.aAPX and / or ii.aAM and / or iii.aAPX:aAM iv. Commercials and / or v.aAPX:CM and / or vi. Analyte TCR The NCBPs having genetic components may be processed to obtain gene sequences for the genome or transcriptome of the selected NCBPs and to determine the identity of the analyte TCR, where the resulting identity represents the end output of the eAPC:T system. The NCBPs having genetic components may be processed to obtain gene sequences for the genome or transcriptome of the selected NCBPs and to determine the identity of the analyte TCR, where the resulting identity represents the end output of the eAPC:T system.

[0074] The eAPCs may be processed to obtain the gene sequence for component B' and / or component D' of the selected and / or expanded TC cells and determine the identity of the analyte antigen, where the resulting identity of the analyte antigen represents the terminal output of the eAPC:T system. The analyte TC may be processed to obtain gene sequences for the genome or transcriptome of the selected and / or expanded TC cells and to determine the identity of the analyte TCR, where the resulting identity of the TCR represents the terminal output of the eAPC:T system.

[0075] Gene sequencing can be accomplished in a variety of ways, from a variety of genetic material sources, with or without specific processing. i. extracting genomic DNA, and / or ii. Extracting RNA transcripts of components B' and / or D', and / or iii. Amplifying the DNA and / or RNA transcripts of components B' and / or D' by PCR and / or RT-PCR. may be carried out. The sequencing step may be destructive to the eAPCs or TCs, NCBps or pools thereof obtained as the primary output of the multi-component system.

[0076] If it is desired to obtain a primary output from an eAPC:T system in which the sequencing process is destructive to the primary output eAPC, the sequence information obtained as the terminal output of the multi-component system may be used to generate an output eAPC equivalent to the analyte eAPC. In the above scenario of a genetically encoded analyte molecule, the terminal output of the eAPC:T system may be obtained by obtaining sequence information from components B' and / or D' and / or the cellular genome and / or transcriptome. However, in some embodiments, the antigen information is not genetically encoded. Antigens that are post-translationally modified, antigens provided to the eAPC:T combination system by non-genetic means, antigens that emerge from induced or altered states of the analyte eAPC proteome or metabolites, and CMs unique to the eAPC:T system may not be reasonably identified by genetic sequencing means.

[0077] In the important case of aAM that can be provided to the eAPC:T system by non-genetic means, there are two different ways in which the APC can present the provided aAM as an aAPX:aAM complex. In the first scenario, the aAM is provided in a form that can directly bind to aAPX and form an aAPX:aAM complex on the cell surface (Figure 18). An example of such an aAM is a peptide antigen for an HLA complex. In the second scenario, the aAM is provided in a form that can be taken up by the analyte eAPC, loaded as cargo in aAPX, and processed to form an aAPX:aAM complex on the cell surface (Figure 19). A method for selecting and identifying aAM or CM cargo, wherein the cargo is a metabolite and / or peptide that is loaded onto the aAPX of an eAPC selected and obtained as a primary output of a multi-component system, comprises: i. isolating aAPX:aAM or aAPX:CM or cargo aM or cargo CM; ii. Identifying the cargo on board; where the identified loaded cargo (CM or aAM) is the terminal output of the multi-component system.

[0078] In general, there are two ways in which cargo molecules can be identified from selected APCs. First, forced release of cargo from aAPX:aAM or aAPX:CM results in the isolation of the aAM or CM, which can then be used for identification (Figure 25). An example of this is acid washing of eAPCs, which releases peptide-aAM from HLA complexes. Second, capture of aAPX:aAM or aAPX:CM (e.g., by complex release and immunoaffinity isolation) results in the isolation of the aAPX:aAM or aAPX:CM complex, allowing the identification of the aAM or CM (Figure 26). Methods for identifying isolated aAM and / or CM directly or from isolated aAPX:aAM or aAPX:CM complexes include: i.Mass spectrometry ii. Peptide sequencing analysis where the included aAM and / or CM identities are terminal outputs of the multi-component system.

[0079] Determining the affinity of an analyte TCR for an analyte antigen using the eAPC:T system Following the above method of obtaining a primary output, wherein the primary output is an analyte eAPC cell selected based on a measured signal response, the eAPC primary output may be subjected to affinity analysis to determine the affinity of the analyte antigen for a cognate analyte TCR, wherein the analyte antigen is: i.aAPX and / or ii.aAM and / or iii. aAPX:aAM and / or iv. Commercials and / or v.aAPX:CM wherein the analyte TCR is provided as a soluble affinity reactant or is presented by an analyte TC or an analyte NCBP, and the affinity of the analyte antigen is determined by the following method: i. labeling selected analyte eAPCs with a range of concentrations of analyte TCR; ii. performing FACS analysis on the stained analyte eAPCs of step a; iii. determining the intensity of fluorescent labeling of the analyte eAPC for a range of concentrations of the analyte TCR; iv. Calculating the affinity of the analyte antigen for the analyte TCR is determined by

[0080] In the context of the present invention, the affinity of an analyte antigen may be determined by the methods previously described, but optionally including a labeled reference, where the affinity is calculated using the ratio of the fluorescence intensity of the analyte antigen to the fluorescence intensity of the reference, where the labeled reference is: i. analyte eAPCs labeled with an affinity reagent for one analyte antigen; ii. an analyte eTPC-t labeled with one or more affinity reagents for the CD3 protein; iii. Labeled reference analyte antigen-presenting cells or particles is selected from. DESCRIPTION OF THE DRAWINGS The invention is further illustrated in the following non-limiting drawings. [Brief explanation of the drawings]

[0081] [Figure 1] Figure 1 - Illustration of the components of a single integration couple multicomponent system. An example of an MCS comprising three components. The first component, A, is the eAPC line itself, which has all the desired engineered characteristics of the cell. eAPC A contains one further component, B, which is a genomic integration site for integration of aAPX and / or aAM. One additional component, C, represents a gene donor vector for site-specific integration of an ORF into site B, with arrows indicating the coupled specificity. The paired integration site / donor vector couple can be formatted to integrate a single ORF or a pair of ORFs to introduce aAPX and / or aAM expression. [Figure 2]Figure 2 - Illustration of the components of a double integration couple multicomponent system. An example of an MCS comprising five components. The first component, A, is the eAPC line itself, which has all the desired engineered characteristics of the cell. eAPC A contains two additional components, B and D, which are genomic integration sites for integration of aAPX and / or aAM. Two additional components, C and E, represent gene donor vectors for site-specific integration of ORFs into sites B and D, respectively, with arrows indicating paired specificities. Each of the paired integration site / donor vector couples can be formatted to integrate a single ORF or a pair of ORFs to introduce aAPX and / or aAM expression. [Figure 3] Figure 3 - Organization of eAPCs presenting different analyte antigens. MCS begins with eAPCs and utilizes donor vectors to create cells that express analyte antigen-presenting complexes (aAPXs) and / or analyte antigenic molecules (aAMs) on their cell surface. eAPCs that present only aAPXs are called eAPC-p and can be created by introducing an ORF encoding aAPX into the eAPC (step i). eAPCs that express only aAMs are called eAPC-a; the aAMs can be expressed on the cell surface and available for TCR binding, or they can require processing and loading onto aAPX as cargo (as an aAPX:aAM complex). eAPC A can be created by introducing an ORF encoding an aAM into the eAPC (step ii). eAPCs that present aAMs as cargo in aAPXs are called eAPC-pa. eAPC-pa can be generated by either: simultaneous introduction of ORFs encoding aAM and aAPX into eAPC (step iii); introduction of ORFs encoding aAM into eAPC-p (step iv); or introduction of ORFs encoding aAPX into eAPC-a (step v). [Figure 4]Figure 4 - Operation of a Gene Donor Vector and Genomic Acceptor Site Integration Couple A gene donor vector and a genome acceptor site form an integration couple, in which one or more ORFs encoded within the gene donor vector can specifically integrate into the coupled genome acceptor site. Step 1 in the operation of an integration couple is the introduction of one or more target ORFs into the donor vector. The original donor vector is called X, and is modified into a primed donor vector X' by the introduction of the target ORFs. Step 2 results in the combination of primed donor vector X' with cell Y, which contains the genome acceptor site. Introduction of the ORF encoded by the primed donor vector into the acceptor site results in the creation of cell Y', which contains the integration site. [Figure 5] Figure 5 - Example of producing eAPC-p in one step using one integration couple. eAPC A contains genomic acceptor site B. Primed gene donor vector C' is coupled to B and encodes aAPX. When A eAPC is combined with the C' donor vector, the resulting cell has the ORF of C' swapped into the B genomic acceptor site to create site B' and introduce aAPX expression. This results in expression of aAPX on the cell surface and the creation of eAPC-p. [Figure 6] Figure 6 - Example of producing eAPC-p in one step using one integration couple and one unused integration site. eAPC A contains genomic acceptor sites B and D. Primed gene donor vector C' is coupled to B and encodes aAPX. When A eAPC is combined with C' donor vector, the resulting cell has the ORF of C' swapped into the B genomic acceptor site to create site B' and introduce aAPX expression. This results in expression of aAPX at the cell surface and the creation of eAPC-p. Genomic acceptor site D remains unused. [Figure 7]Figure 7 - Example of producing eAPC-a in one step using one integration couple. eAPC A contains genomic acceptor site B. Primed gene donor vector C' is coupled to B and encodes an aAM. When the A eAPC is combined with the C' donor vector, the resulting cell has the ORF of C' swapped into the B genomic acceptor site to create site B' and introduce aAM expression. This results in one of two forms of eAPC-a that express the aAM on the cell surface or intracellularly. [Figure 8] Figure 8 - Example of producing eAPC-a in one step using one integration couple and one unused integration site. eAPC A contains genomic acceptor sites B and D. Primed gene donor vector C' is coupled to B and encodes an aAM. When A eAPC is combined with C' donor vector, the resulting cell has the ORF of C' swapped into the B genomic acceptor site to create site B' and introduce aAM expression. This generates one of two forms of eAPC-a that express the aAM on the cell surface or intracellularly. Genomic acceptor site D remains unused. [Figure 9] Figure 9 - Example of one-step production of eAPC-pa using one integration couple. eAPC A contains genomic acceptor site B. Gene donor vector C' is coupled to B. Donor vector C' encodes aAPX and aAM. A eAPC is combined with donor vector C'. The resulting cell has swapped the ORFs of C' into the B genomic acceptor site to create site B' and deliver the ORFs for aAPX and aAM. This results in cell surface expression of aAPX and intracellular expression of aAM, resulting in loading of aAM on aAPX as cargo, forming an aAPX:aAM complex on the cell surface. [Figure 10]Figure 10 - Example of one-step production of eAPC-pa using one integration couple and one unused integration site. eAPC A contains distinct genomic acceptor sites B and D. Gene donor vector C' is coupled to B. Donor vector C' encodes aAPX and aAM. A eAPC is combined with donor vector C'. The resulting cell has swapped the ORFs of C' into the B genomic acceptor site to create site B' and deliver the ORFs of aAPX and aAM. Genomic acceptor site D remains unused. This results in cell surface expression of aAPX and intracellular expression of aAM, resulting in loading of aAM on aAPX as cargo, forming an aAPX:aAM complex on the cell surface. This creates the eAPC-pa cell line. Genomic acceptor site D remains unused. [Figure 11] Figure 11 - Example of one-step eAPC-pa production using two integration couples. eAPC A contains distinct genomic acceptor sites B and D. Distinct gene donor vectors C' and E' are independently coupled to B and D, respectively. Donor vector C' encodes aAPX, and donor vector E' encodes an aAM. A eAPC is simultaneously combined with donor vectors C' and E'. The resulting cells have the C' ORF swapped into the B genomic acceptor site to create site B' and deliver the aAPX ORF. Concurrently, the E' ORF swapped into the D genomic acceptor site to create site D' and deliver the aAM ORF. This results in cell surface expression of aAPX and intracellular expression of aAM, resulting in the loading of aAPX as cargo with the aAM, forming an aAPX:aAM complex on the cell surface. This creates an eAPC-pa cell line. [Figure 12]Figure 12 - Example of eAPC-p-mediated production of eAPC-pa in two steps using two integration couples. eAPC A contains distinct genomic acceptor sites B and D. Distinct gene donor vectors C' and E' are independently coupled to B and D, respectively. Donor vector C' encodes aAPX, and donor vector E' encodes aAM. In step 1, the A eAPC is combined with the C' donor vector. In the resulting cells, insert C' is exchanged into the B genomic acceptor site to create site B' and deliver the aAPX ORF. This results in expression of aAPX on the cell surface and the creation of eAPC-p. Genomic acceptor site D remains unused. In step 2, the eAPC-p created in step 1 is combined with the E' donor vector. In the resulting cells, insert E' is exchanged into the D genomic acceptor site to create site D' and deliver the aAM ORF. This results in the cell surface expression of aAM as cargo for the expressed aAPX and the creation of eAPC-pa. [Figure 13] Figure 13 - Example of eAPC-a-mediated production of eAPC-pa in two steps using two integration couples. eAPC A contains distinct genomic acceptor sites B and D. Distinct gene donor vectors C' and E' are independently coupled to B and D, respectively. Donor vector C' encodes an aAM, and donor vector E' encodes an aAPX. In step 1, the A eAPC is combined with the C' donor vector. In the resulting cells, insert C' is exchanged into the B genomic acceptor site to create site B' and deliver the aAM ORF. This results in cell surface expression of the aAM and the creation of eAPC-a. Genomic acceptor site D remains unused. In step 2, the eAPC-a created in step 1 is combined with the E' donor vector. In the resulting cells, insert E' is exchanged into the D genomic acceptor site to create site D' and deliver the aAPX ORF. This results in the cell surface expression of aAPX with aAM as cargo and the creation of eAPC-pa. [Figure 14]Figure 14 - Shotgun production of eAPC-pa pools from eAPC-p. eAPC-p contains an exchanged genomic acceptor site B' expressing aAPX and a distinct genomic acceptor site D. A pool of gene donor vectors E'i-iii is coupled to D. Donor vectors E'i-iii each encode a single aAM gene. eAPC-p is simultaneously combined with donor vectors E'i, E'ii, and E'iii. The resulting cell pool has one of the inserts E'i-iii exchanged into the D genomic acceptor site in multiple independent instances, each creating a site D'i-iii that delivers a single ORF of an aAM gene. The resulting eAPC-pa cell pool comprises a mixed population of three distinct cell cohorts, each expressing a distinct combination of B' and presenting the aAM genes contained in the original vector library as aAPX:aAM. [Figure 15] Figure 15 - Shotgun production of eAPC-pa pools from eAPC-a. eAPC-a contain an exchanged genomic acceptor site B' expressing an aAM and a distinct genomic acceptor site D. A pool of gene donor vectors E'i-iii are coupled to D. Donor vectors E'i-iii each encode a single aAPX gene. eAPC-a are simultaneously combined with donor vectors E'i, E'ii, and E'iii. The resulting cell pool has one of the inserts E'i-iii exchanged into the D genomic acceptor site in multiple independent instances, creating sites D'i-iii, each delivering a single ORF of the aAPX gene. The resulting eAPC-pa cell pool comprises a mixed population of three distinct cell cohorts, each expressing a distinct combination of the aAM encoded by B' and one of the aAPX genes contained in the original vector library. [Figure 16]Figure 16 - Shotgun production of a pooled eAPC-pa library from eAPCs containing pairwise combinations of aAM and aAPX genes. eAPC A contains distinct genomic acceptor sites B and D. Distinct gene donor vectors C' and E' are coupled to B and D, respectively. Donor vectors C'i and C'ii each encode a single aAM gene, and donor vectors E'i and E'ii each encode a single aAPX gene. eAPC A is simultaneously combined with donor vectors C'i, C'ii, E'i, and E'ii. The resulting cell pool has insert C'i or C'ii exchanged into the B genomic acceptor site in multiple independent instances to create sites B'i and B'ii, each delivering a single aAM ORF. The resulting cell pool further has insert Ei or Eii exchanged into the D genomic acceptor site in multiple independent instances to create sites E'i and E'ii, each delivering a single ORF of the APX gene. The resulting eAPC-pa cell pool comprises a mixed population of four distinct cell cohorts, each expressing a distinct randomized aAPX:aAM pair (comprising one of each gene contained in the original vector library) on its surface. [Figure 17] Figure 17 - Generation of eAPC-p:CM from eAPC-p expressing native cargo CM. In the absence of aAM expression from the genomic recombination site, aAPX molecules on eAPC-p present native cargo molecule CM on their surface as aAPX:CM complexes. [Figure 18] Figure 18 - Generation of eAPC-p + aAM from eAPC-p by addition of soluble presentable antigen aAM. eAPC-p contains an exchanged genomic acceptor site B' that expresses aAPX. Soluble directly presentable antigen aAM is combined with eAPC-p. This results in the formation of an aAPX:aAM complex on the cell surface and the generation of eAPC-p + aAM. [Figure 19]Figure 19 - eAPC-p and soluble aAM from eAPC-p and soluble aAM eAPC-p contains an exchanged genomic acceptor site B' that expresses aAPX. The soluble antigen aAM combines with eAPC-p, which results in the expression of aAPX on the cell surface, the presence of aAM within the cell, and thus the loading of aAM as cargo on aAPX, resulting in the formation of an aAPX:aAM complex on the cell surface and the creation of eAPC-p + aAM. [Figure 20] Figure 20 - Operation of the eAPC:T combination system showing possible analyte TC output states. The analyte eAPC contains sites C' and E', each incorporating one ORF encoding one aAPX and one aAM, and the aAM is loaded as cargo at the aAPX on the cell surface. The analyte TC expresses TCRsp on its surface. Upon contact between the analyte TC and eAPC-pa populations, four analyte TC response states (one negative and three positive) can be achieved. The negative state is a quiescent state of the analyte TC, with no signal intensity indicating that the eAPC aAPX:aAM complex cannot stimulate the TCRsp presented by the analyte TC. The three positive states show increasing signal intensities *, **, and ***, representing low, medium, and high signal intensities, respectively, and are also indicated by cell shading. This indicates a graded response of the analyte TCRsp expressed by the analyte TC population to the analyte aAPX:aAM presented by eAPC-pa. [Figure 21]Figure 21 - Operation of the eAPC:T combination system showing possible eAPC-pa output states. Analyte eAPC-pa contain sites C' and E', each incorporating one ORF encoding one aAPX and one aAM, and the aAM is loaded as cargo on the cell surface aAPX. Analyte TC expresses TCRsp on its surface. When the analyte TC and eAPC-pa populations contact, four eAPC response states (one negative and three positive states) can be achieved. The negative state is the resting state of the analyte eAPC, representing the inability of the TCRsp chain pair to stimulate the aAPX:aAM complex presented by the analyte eAPC. The three positive states show increasing signal intensities from the contacted aAPX:aAM. The three positive states show increasing signal intensities *, **, and ***, representing low, medium, and high signal intensities, respectively, and are also indicated by cell shading. This indicates that analyte aAPX:aAM is a graded response to analyte TCRsp presented by analyte TC. [Figure 22] Figure 22 - Combinatorial operation of the eAPC:T combination system to identify TCR chain pairs reactive with analyte aAPX:aAM from a library of analyte TCs expressing distinct analyte TCRs. The analyte TC pool expresses various TCRs on its surface. Analyte eAPC-pa contain sites C' and E' incorporating distinct sets of ORFs encoding one aAPX and one aAM, and are loaded with aAM as cargo at the cell surface aAPX. In this example, only the TCRs expressed from analyte TC i are specific for the aAPX:aAM presented by the analyte eAPC-pa, such that when the analyte TC pool and the analyte eAPC-pa population are contacted, only the cell cohort of analyte TC expressing TCRs i binds. [Figure 23]Figure 23 - Combinatorial operation of the eAPC:T combinatorial system to identify aAMs reactive with an analyte TC from a library of analyte eAPC-pas expressing distinct analyte aAPX:aAM complexes. The analyte eAPCs contain sites C' and E' incorporating distinct sets of ORFs, each encoding one aAPX and one aAM, and are loaded with aAMs as cargo at the aAPX on the cell surface. The analyte TCs express a defined TCRsp on their surface. In this example, only the complex aAPX:aAM i is specific for the TCRsp presented by the analyte TC, such that when the analyte eAPC pool and the analyte TC population are contacted, only the cell cohort expressing aAM i expresses the distinct signal*. [Figure 24] Figure 24 - Operation of the eAPC:T combination system to identify aAPX:aAM complexes reactive with a specific analyte TCR. The analyte eAPC-pa pool contains sites C' and E' into which distinct sets of ORFs, each expressing one aAPX and one aAM i-iii, are integrated, and the aAMs are loaded as cargo on the cell surface aAPX. The analyte eAPC-pa pool is contacted with soluble, immobilized, or NCBP forms of analyte TCRs specific for distinct aAPX:aAM complexes expressed by subpopulations of the analyte eAPC-pa pool. In this example, only aAPX:aAM i is formed from the analyte TCR, and as a result, only the cohort of cells in the analyte eAPC-pa pool bearing aAM i responds to the analyte TCR (dark gray). [Figure 25] Figure 25 - Identification of aAM presented by eAPC-p+aAM by forced release of aAM. eAPC-p+aAM contains an exchanged genomic acceptor site B' expressing aAPX as well as internalized aAM presented on the surface as an aAPX:aAM complex. The aAM is released from the aAPX:aAM surface complex by incubation, and the released aAM is available for identification. [Figure 26]Figure 26 - Identification of aAM presented by eAPC-p+aAM by capturing aAPX:aAM complexes. eAPC-p+aAM contain an exchanged genomic acceptor site B' expressing aAPX as well as internalized aAM presented on the surface as an aAPX:aAM complex. The aAPX:aAM surface complex is captured to identify the loaded aAM. [Figure 27]Figure 27 - Operation of a Multi-Component System to Produce Analyte eAPCs for Assembly of an eAPC:T Combination System. The overall system in which the engineered multi-component cell system (MCS) operates comprises contacting manufactured analyte engineered antigen-presenting cells (eAPCs) with various analyte TCRs in the assembly of an eAPC:T combination system. Primary outputs are derived from the eAPC:T combination system, and terminal outputs are derived from these primary outputs. Operation of the overall system comprises two phases: a manufacturing phase and an analytical phase. In one aspect of the first phase, the multi-component system is used to produce analyte eAPCs, and this analyte population can comprise eAPC-p, eAPC-a, and / or eAPC-pa. The analyte eAPCs present antigenic moieties in various forms: analyte antigen-presenting complexes (aAPXs); analyte antigenic molecules (aAMs); aAPXs loaded with aAM cargo (aAPX:aAMs); cargo molecules (CMs); and aAPXs loaded with CMs (aAPX:CMs), where the analyte antigen represents the antigen being tested for affinity or signal induction for the analyte TCR (step i). In another aspect of phase 1, cells (analyte TCRs), non-cell-based particles displaying analyte TCR chain pairs, soluble or immobilized reactants, or other affinity reactants specific for the analyte antigen are prepared, collectively referred to as analyte TCRs (step ii). The second phase of the overall system involves contacting the analyte eAPC population and the analyte TCRs prepared in phase 1 to assemble the eAPC:T combination system (step iii). The contacted analyte eAPC is likely to bind to the analyte TCR, and this binding may result in stable complex formation. Stable complex formation may induce a signal response in the analyte eAPC material and / or the analyte TC material, and / or stable complexes may be directly selected. Within the eAPC:T combination system, the output of the analyte eAPC or analyte TC may change its signal state (represented by an "*" and dark shading), so that the responding species may be identified (step iv). The changed state may also be in the form of direct selection of eAPCs that form stable complexes with the analyte TCR.Based on the altered signaling state within the eAPC:T system, specific analyte eAPCs and / or analyte TCs can be selected based on their ability to induce a response from each other, or based on their inability to induce such a response, and / or by direct selection of the stable complex itself. This selection based on responsiveness or stable complexes generates the primary output of the eAPC:T combination system (step v). By obtaining analyte cells or analyte TCRs from step v, the displayed analyte aAPX, aAM, aAPX:aAM, CM, aAPX:CM, and / or other affinity reactants having specificity for the TCR and / or analyte antigen can be identified as the system's operational terminal output (step vi). [Figure 28] Figure 28 - Selection of cells with targeted mutagenesis of HLA-A, HLA-B, and HLA-C loci in the HEK239 cell line. a) GFP fluorescence signal in two independent cell populations 48 hours after transfection with a plasmid encoding Cas9-P2A-GFP and gRNAs targeting the HLA-A, HLA-B, and HLA-C loci (gray histogram) compared to HEK293 control cells (dashed histogram). Cells with GFP signal within the GFP subset gate were sorted as a polyclonal population. b) Cell surface HLA-ABC signal observed in the two sorted polyclonal populations when labeled with a PE-Cy5 anti-HLA-ABC conjugated antibody (gray histogram). Single cells that showed low PE-Cy5 anti-HLA-ABC signal and presented within the sort gate were sorted to establish monoclones. Unlabeled HEK293 cells (dotted histogram) and PE-Cy5 anti-HLA-ABC labeled HEK293 cells (full black histogram) served as controls. [Figure 29]Figure 29 - Phenotypic analysis of HLA-ABC null monoclones: Monoclonal populations were stained with PE-Cy5 anti-HLA-ABC conjugated antibodies and analyzed by flow cytometry (gray histograms). Unlabeled HEK293 cells (dashed histograms) and PE-Cy5 anti-HLA-ABC labeled HEK293 cells (full black histograms) served as controls. All three monoclonal lines showed fluorescent signals consistent with the unlabeled controls, demonstrating that each line lacked HLA-ABC surface expression. [Figure 30] Figure 30 - Genetic characterization of a selection of monoclones lacking surface HLA-ABC expression, demonstrating genomic deletion in the targeted HLA. PCR amplicons were generated using primers spanning the gRNA genomic target site of specific HLA alleles, and their sizes were determined by electrophoresis. The expected sizes are 1067 bp for the wild-type HLA-A amplicon, 717 bp for the HLA-B amplicon, and 1221 bp for the HLA-C amplicon. [Figure 31]Figure 31 - Selection of cells with targeted genomic integration of synthetic component B with or without synthetic component D. a) GFP fluorescence signal 48 hours after transfection with a plasmid encoding Cas9-P2A-GFP and a gRNA targeting the AAVS1 locus together with the component B genetic element flanked by the AAVS1 left and right homology arms (gray histogram). HEK293 cells served as a GFP negative control (dotted histogram). Cells with GFP signal within the GFP+ gate were sorted as a polyclonal population. b) GFP fluorescence signal 48 hours after transfection with a plasmid encoding Cas9-P2A-GFP and a gRNA targeting the AAVS1 locus together with components B and D flanked by the AAVS1 left and right homology arms (gray histogram). HEK293 cells served as a GFP negative control (dotted histogram). Cells with GFP signal within the GFP+ gate were sorted as a polyclonal population. c) Maintained BFP signal but no detectable RFP signal was observed within the D1 sorted polyclonal population. Single cells showing high BFP signals in the Q3 quadrant were sorted to establish synthetic component B-containing eAPC monoclones. d) Maintained BFP and RFP signals were observed within the D2-sorted polyclonal population. Single cells showing high BFP and RFP signals in the Q2 quadrant were sorted to establish synthetic component B- and D-containing eAPC monoclones. [Figure 32] Figure 32 - Phenotypic analysis of eAPC monoclones. a and b) Monoclonal populations displaying sustained BFP expression suggest the integration of synthetic component B. c) Monoclonal populations displaying sustained BFP and RFP expression suggest the integration of both synthetic component B and synthetic component D. [Figure 33]Figure 33 - Genetic characterization of selection of monoclones for integration of component B or components B and D at the AAVS1 locus. a) PCR amplicons were generated using primers priming at component B and / or D and the size was determined by electrophoresis. The expected size of positive amplicons is 380 bp, indicating stable integration of component B and / or D. b) PCR amplicons were generated using primers priming at AAVS1 genomic sequences distal to the region encoded by the homology arms and the SV40 pA terminator encoded by component B and / or D and the size was determined by electrophoresis. The expected size of positive amplicons is 660 bp, indicating integration of component B and / or D at the AAVS1 site. [Figure 34] Figure 34 - Selection of cells with targeted genomic integration of component C' into component B. a) GFP fluorescence signal 48 hours after transfection with a plasmid encoding Cas9-P2A-GFP and a gRNA targeting the AAVS1 locus with component C' HLA-A*24:02 (left panel) or component C' HLA-B*-07:02 (right panel). Cells with GFP signal within the GFP+ gate were sorted into polyclonal populations ACL-303 or ACL-305. b) When labeled with a PE-Cy5 anti-HLA-ABC conjugated antibody, analyte HLA cell surface expression was observed in the two sorted polyclonal populations (gray histograms). Single cells showing high PE-Cy5 anti-HLA-ABC signal and appearing within the right sort gate were sorted to establish monoclones. Signals detected from PE-Cy5 anti-HLA-ABC labeled ACL-128, HLA-ABC null and HLA-DR,DP,DQ null eAPC cell lines (dotted histogram) served as controls. [Figure 35]Figure 35 - Phenotypic analysis of eAPC-p monoclones expressing analyte HLA class I proteins on their cell surface. Monoclonal populations were stained with PE-Cy5 anti-HLA-ABC conjugated antibodies and analyzed by flow cytometry (gray histograms). ACL-128, HLA-ABCnull, and HLA-DR,DP,DQnull eAPC cell lines (dotted histograms) served as controls. ACL-321 and ACL-331 monoclonal cell lines showed stronger fluorescent signals compared to the HLA-ABCnull and HLA-DR,DP,DQnull eAPC cell line controls, demonstrating that each line expresses its analyte aAPX, HLA-A*24:02, or HLA-B*-07:02 ORF, respectively, and therefore is an eAPC-p cell line. [Figure 36] Figure 36 - Genetic characterization of a selection of monoclones demonstrating integration of component C' into the genome and that integration occurred at the AAVS1 genomic acceptor site to generate component B'. a) PCR amplicons confirmed the presence of the HLA insert; the 810 bp band represents the correct CMV promoter amplicon, and the 380 bp is the amplicon generated from the SV40 pA terminator. b) PCR amplicons were generated using two sets of primers: one primed at the AAVS1 genomic sequence distal to the region encoded by the homology arms, and one unique to the SV40 pA terminator linked to the analyte HLA ORF. The expected sizes of the positive amplicons, 1 kb and 1.1 kb, indicate the generation of component B'. [Figure 37]Figure 37 - Selection of cells with targeted genomic integration of component C' into component B. a) GFP fluorescence signal 48 hours after transfection with a plasmid encoding Cas9-P2A-GFP, a gRNA targeting the AAVS1 locus, and component C' HLA-DRA*01:01 / HLA-DRB1*01:01 (left panel) or component C' HLA-DPA1*01:03 / HLA-DPB1*04:01 (right panel). Cells with GFP signal within the GFP+ gate were sorted as a polyclonal population. b) Analyte HLA cell surface expression was observed in the two sorted polyclonal populations when labeled with 647 anti-HLA-DR,DP,DQ conjugated antibodies (gray histogram). Single cells showing high Alexa 647 anti-HLA-ABC signal and appearing within the right sort gate were sorted to establish monoclonals. Signals detected from Alexa 647 anti-HLA-ABC labeled ACL-128 (HLA-ABC null and HLA-DR,DP,DQ null eAPC cell lines) (dotted histogram) and ARH wild-type cell lines (full black histogram) served as controls. [Figure 38] Figure 38 - Phenotypic analysis of eAPC-p monoclones expressing analyte HLA class II proteins on their cell surface. Monoclonal populations were stained with Alexa 647 anti-HLA-DR,DP,DQ conjugated antibodies and analyzed by flow cytometry (gray histogram). ACL-128 (HLA-ABC null and HLA-DR,DP,DQ null eAPC cell line) (dotted histogram) and ARH wild-type cell line (full black histogram) served as controls. The ACL-341 and ACL-350 monoclonal cell lines showed stronger fluorescent signals compared to the HLA-ABCnull and HLA-DR,DP,DQnull eAPC cell line controls, demonstrating that each line expresses its analyte aAPX, HLA-DRA*01:01 / HLA-DRB1*01:01, or HLA-DPA1*01:03 / HLA-DPB1*04:01, respectively, and therefore is an eAPC-p cell line. [Figure 39]Figure 39 - eAPC-p monoclones generated by RMCE incorporation of analyte HLA class I proteins. a) eAPC-p monoclonal populations ACL-421 and ACL-422 lost BFP fluorescence (gray histogram). The parental eAPC cell line ACL-385 (full black histogram) and a BFP-negative ARH wild-type cell line (dashed histogram) served as controls. b) When labeled with PE-Cy5 anti-HLA-ABC conjugated antibodies, eAPC-p monoclonal populations ACL-421 and ACL-422 achieved HLA-A*02:01 expression (gray histogram). The parental ACL-385 HLA-ABC null and HLA-DR,DP,DQ null eAPC cell lines (dashed histogram) and an ARH wild-type cell line (full black histogram) served as negative and positive PE-Cy5 anti-HLA-ABC labeled controls, respectively. These results strongly suggested that RMCE had occurred successfully between the BFP ORF and the HLA-A*02:01 ORF in both the ACL-421 and ACL-422 cell lines. [Figure 40] Figure 40 - Genetic characterization of a selection of monoclones confirmed HLA-A*02:01 integration by RMCE. The 630 bp amplicon showed the presence of HLA-A2 in monoclones ACL-421 and 422, but not in the control line ACL-128. [Figure 41]Figure 41—Phenotypic analysis of eAPC-pa monoclones expressing analyte HLA class I proteins on their cell surface and expressing aAM. a) eAPC-p monoclonal populations were stained with PE-Cy5 anti-HLA-ABC conjugated antibodies and analyzed by flow cytometry (gray histogram). ACL-128, HLA-ABC null, and HLA-DR,DP,DQ null eAPC cell lines (dotted histogram) served as controls. ACL-321 and ACL-331 monoclonal cell lines showed stronger fluorescent signals compared to the controls, demonstrating that each line expressed its analyte aAPX, HLA-A*02:01, or HLA-B*35:01 ORF, respectively, and therefore was an eAPC-p cell line. b) eAPC-pa monoclonal populations were assessed for GFP fluorescence by flow cytometry (gray histogram). ACL-128, HLA-ABC-null, and HLA-DR,DP,DQ-null eAPC cell lines (dotted histograms) served as controls. The ACL-391 and ACL-395 monoclonal cell lines showed stronger fluorescent signals compared to the controls, demonstrating that each line expresses the analyte aAM selectable marker, thus suggesting aAM expression in cell lines that also express the HLA-LA-A*02:01 or HLA-B*35:01 ORF, respectively. Therefore, ACL-391 and ACL-395 were eAPC-pa lines. [Figure 43]Figure 43 - eACP-p constructed in one step, where component C' encodes a single HLAI ORF. eAPC-p were created by RMCE via electroporation of the cell line ACL-402 harboring a plasmid encoding the Tyr-recombinase Flp (V4.1.8) together with a plasmid encoding an aAPX selected from one component C' HLA-A*02:01 (V4.H.5) or HLA-A*24:02 (V4.H.6). Ten days after electroporation, individual cells positive for HLAI surface expression and a reduced fluorescent protein signal, RFP, encoded by the component B selectable marker were sorted. The resulting monoclonal eAPC-p lines were analyzed by flow cytometry in parallel with the parental eAPC lines; two examples are shown: a) Outgrown individual monoclonal lines (ACL-900 and ACL-963) were assayed by flow cytometry for loss of RFP, presence of BFP, and acquisition of HLA-ABC (aAPX). The left-hand plot shows BFP vs. RFP; parental cells possessed both BFP and RFP (Q2, upper plot, 99.2%), whereas both ACL-900 (Q3, middle plot, 99.7%) and ACL-963 (Q3, lower plot, 99.9%) lacked RFP signal, indicating that an integration couple had occurred between components B / C'. The right-hand plot shows BFP versus HLA-ABC(aAPX), where both ACL-900 (Q2, upper plot, 99.2%) and ACL-963 (Q2, lower plot, 99.2%) showed strong signals for HLA-ABC(aAPX), further reinforcing the B / C' integration. Both ACL-900 and ACL-963 had strong BFP signals, suggesting that component D remained open and isolated from the component B / C' integration couple. b) To further characterize ACL-900 and ACL-963 and a third eAPC-p not presented in a), ACL-907, genomic DNA was extracted and PCR was performed using primers targeting nearby and within component B' (Table 5, 8.B.3, 15.H.2) to selectively amplify only successful integration couple events. Comparison was made to the unmodified parent strain ACL-3, which lacks component B.All three eAPC-p monoclones generated amplicon products specific to component B', whereas no products were detected in the ACL-3 reaction, confirming that a specific integration coupling event had occurred between component B and component C'. [Figure 44]Figure 44 - eAPC-pa constructed in one step from eAPC-p, where component D' encodes a single analyte antigen molecule (aAM) ORF. Multiple eAPC-pa in which the genomic acceptor site (component D) was targeted for integration with a primed gene donor vector (component E' comprising a single ORF encoding an aAM) were constructed from parental eAPC-p (ACL-905). eAPC-p (ACL-900, Example 8) were independently combined by electroporation with vectors encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) and each of component E's V9.E.6, V9.E.7, or V9.E.8. Ten days after electroporation, individual eAPC-pa were selected, and single cells (monoclones) were selected based on a decrease in the signal of the selectable marker BFP for integration encoded by component D. The resulting monoclonal eAPC-pa lines were analyzed by flow cytometry in parallel with the parental eAPC lines, and three examples are shown. In addition, the resulting monoclones were genetically characterized to confirm the integration couple events. a) Monoclones for eAPC-pa, ACL-1219, ACL-1227, and ACL-1233 were analyzed and selected for loss of BFP signal and retention of HLA-ABC signal by flow cytometry. BFP vs. SSC plots were displayed using the BFP gate. An increased number of BFP events was observed compared to the parental eAPC-p, suggesting that integration couples occurred between components D / E'. Single cells from the BFP gate were selected, sorted, and expanded. b) Selected monoclones for ACL-1219, ACL-1227, and ACL-1233 were analyzed by flow cytometry to confirm loss of BFP and retention of HLA-ABC signal. A plot of BFP versus HLA-ABC is shown, and all three monoclones can be seen to have lost the BFP signal compared to the parental eAPC-p (rightmost plot), suggesting successful integration coupling events. c) To verify that the monoclones contained the correct fragment size for the aAM ORF, polymerase chain reaction was performed using primers targeting the aAM ORF (Table 5, 10.D.1, 15.H.4) and a representative agarose gel is shown.Results from two monoclones representing each aAM ORF are shown. Lane 1: 2_log DNA marker; Lanes 2-3: pp28 ORF (expected size 0.8 kb); Lane 4: 2_log DNA marker; Lanes 5-6: pp52 ORF (expected size 1.5 kb); Lane 7: 2_log DNA marker; Lanes 8-9: pp65 ORF (expected size 1.9 kb); Lane 10: 2_log DNA marker. All monoclones analyzed had the expected amplicon size for each aAM, further suggesting that integration couples had occurred. [Figure 45-1]Figure 45 - Shotgun integration of multiple antigens into eAPC-p to generate a single-step pooled eAPC-p library. A pooled library of eAPC-pa was generated by single-step integration into parental eAPC-p from a pool of primed component E vectors (component E') that collectively encode multiple aAM ORFs (HCMVpp28, HCMVpp52, and HCMVpp65), where each individual cell incorporates a single random analyte antigen ORF derived from the original vector pool into component D', such that each generated eAPC-pa expresses a single random aAM, but the pooled library of eAPC-pa collectively represents all of the aAM ORFs encoded in the original pooled vector library. Libraries of eAPC-pa were generated by electroporation by combining eAPC-p (ACL-905, aAPX:HLA-A*02:01) with a pooled vector library containing individual vectors (V9.E.6, V9.E.7, and V9.E.8) encoding one ORF of HCMVpp28, HCMVpp52, or HCMVpp65, mixing them at a molecular ratio of 1:1:1. The resulting eAPC-pa population was analyzed and selected in parallel with the parental eAPC-p line by flow cytometry. a) Ten days after electroporation, putative eAPC-pa cells (transfectants) were analyzed and selected by flow cytometry in parallel with the parental line (ACL-905). The plot shows BFP vs. SSC gated on the BFP population, where an increase in BFP-cells is observed in the BFP-gate compared to the parental line. Bulk cells were sorted to form transfectants based on the BFP-gating (termed ACL-1050). b) After expansion, ACL-1050 cells were analyzed for BFP loss by flow cytometry. The plot shown is BFP vs. SSC, where ACL-1050 was enriched to 96.4% BFP-, while the parental line was ~4% BFP-. Single cells were subsequently sorted from the BFP- population of ACL-1050. [Figure 45-2]Figure 45 - Shotgun integration of multiple antigens into eAPC-p to generate a pooled eAPC-p library in a single step. c) To demonstrate that polyclonal ACL-1050 comprises a mixture of cells encoding HCMVpp28, HCMVpp52, and HCMVpp65, 12 monoclones were randomly selected, expanded, and used for genetic characterization. Cells were characterized by PCR using primers targeted to the aAM ORF (component D') (Table 5, 10.D.1, 15.H.4) to amplify and detect integrated aAMs. All 12 monoclones screened by PCR possess detectable amplicons of one of the expected sizes: pp28 (0.8 kb), pp52 (1.5 kb), or pp65 (1.9 kb). In addition, all three aAMs were represented by the 12 monoclones. In comparison, amplicons from three separate monoclones with known aAMs were amplified in parallel as controls; all three controls produced amplicons of the correct size for pp28 (0.8 kb), pp52 (1.5 kb), and pp65 (1.9 kb), thus confirming that the pool contained eAPC-pa, with each cell carrying a single randomly selected aAM from the original pool of three vectors. [Figure 46]Figure 46 - eAPC-pa induced antigen-specific proliferation of primary CD8+ T cells. Seven different eAPC:T systems were generated using primary CD8+ T cells as the analyte and three different eAPC cell lines: ACL-191 (eAPC-p, aAPX:HLA-A*02:01), ACL-390 (eAPC-pa, aAPX:aM:HLA-A*02:01, HCMVpp65), or ACL-128 (eAPC, HLA-I null, i.e., no aAPX). Furthermore, where applicable, eAPC:T systems comprising ACL-191 or ACL-128 were used with exogenously provided aAM (soluble NLVPMVATV peptide). The systems were prepared as follows. After 9 days of coculture, cells were analyzed for specific staining with the CMV-A.0201-NLVP tetramer (aAPX:aAM) to detect antigen-specific T cell proliferation by flow cytometry. Four eAPC:T systems were prepared, each containing analyte TCs (CD8+ T cells) and either 1) ACL-191 (unpulsed) without aAM, 2) ACL-191 pulsed with aAM, 3) ACL-128 unpulsed, or 4) ACL-128 pulsed with aAM. Systems containing aAM were treated with the NLVP MVATV peptide (aAM) derived from the HCMV pp65 protein at a peptide concentration of 1 μM for 4 hours, as described in the Materials and Methods section. Flow cytometry plots of CD8+ CMV-A.0201-NLVP are shown. The plots represent data from eAPC:T systems (from left to right): 1), 2), 3), and 4). A distinct population (27%) of CD8+ CMV-A.0201-NLVP+ cells (gated) is observed in plot 2 (ACL-191 pulsed with aAM). In contrast, all other eAPC:T systems lacking aAPX, aAM, or both (plots 1, 3, and 4) have between 0.02 and 0.12% positive cells. Thus, specific analyte T cells can proliferate in an antigen-dependent manner via aAPX:aAM presented by eAPC-T cells when provided with exogenous aAM.b) Three eAPC:T systems were generated, comprising analyte TCs (CD8+ T cells) and 1) ACL-128 (eAPC), 2) ACL-191 (eAPC-p), or 3) ACL-390 (eAPC-pa), provided without exogenous aAM. ACL-390 has an integrated aAM ORF, HCMVpp65. Flow cytometry plots of CD8 versus CMV-A.0201-NLVP are shown, where the plots represent data from eAPC:T systems (from left to right): 1), 2), and 3). A distinct population (4.89%) of CD8+CMV-A.0201-NLVP+ cells (gated) was observed in plot 3 (ACL-390 with endogenous aAM). In contrast, other eAPC:T systems lacking aAM or aAPX (plots 1 and 2) had between 0.02 and 0.12% positive cells. Thus, this data supports the idea that eAPC-pa can process the endogenous aAM ORF into aAM by native cellular machinery and present the aAM in complex with aAPX, thereby stimulating the proliferation of specific antigens in analyte TCs. [Figure 47]Figure 47 - eAPC-p and exogenous aAM induced antigen-specific proliferation of primary CD4+ cells. Two different eAPC:T systems were generated using primary CD4+ T cells as analyte T cells and one eAPC-p cell line, ACL-341 (aAPX:HLA-DRB1*01:01). In addition, where applicable, exogenous aAM (PKYVKQNTLKLAT peptide, as SEQ ID NO: 1) was also provided to the systems. Systems were generated as described below, and after 9 days of coculture, cells were analyzed for specific staining with the INFL-DRB1*01:01-PKYV tetramer (aAPX:aAM, SEQ ID NO: 2) to detect antigen-specific T cell proliferation by flow cytometry. As described in the "Materials and Methods" section, two eAPC:T systems were generated containing analyte TCs (CD4+ T cells) and either 1) ACL-341 (unpulsed) without an aAM or 2) ACL-341 pulsed for 2 hours with the PKYVKQNTLKLAT peptide (aAM, SEQ ID NO: 1) at a peptide concentration of 1 μM. Flow cytometry plots of CD4 versus CD4 with INFL-DRB1*01:01-PKYV are shown, where the plots represent data from eAPC:T systems (from left to right) 1) and 2). A distinct population (12%) of CD4+ / INFL-DRB1*01:01-PKYV+ cells (gated) was observed in plot 2 (ACL-341 pulsed with an aAM); in contrast, the control eAPC:T system lacking an aAM (plot 1) had 0.06% positive cells. Thus, specific analyte TC CD4+ cells, when provided with exogenous aAM, can proliferate in an antigen-dependent manner with aAPX:aAM presented by eAPC-p cells. [Figure 48]Figure 48 - Antigen-specific cytotoxicity of eAPC-pa cells cocultured with primary CD8+ cells. Seven different eAPC:T systems were generated using primary CD8+ T cells as the analyte T cells and three different eAPC cell lines: ACL-191 (eAPC-p, aAPX:HLA-A*02:01), ACL-390 (eAPC-pa, aAPX:aM:HLA-A*02:01, HCMVpp65), or ACL-128 (eAPC, HLA-I null, i.e., no aAPX). Additionally, eAPC:T systems comprising ACL-191 or ACL-128, where applicable, used exogenously provided aAM (NLVPMVATV peptide, SEQ ID NO: 3). Systems were generated as described below, and cocultured cells were analyzed for cytotoxic effects on eAPC-p or -pa by staining with Annexin V and PI to detect dead cells by flow cytometry. Four eAPC:T systems were generated containing analyte TCs (CD8+ T cells) and: 1) unpulsed ACL-128; 2) ACL-128 pulsed with aAM; 3) ACL-191 without aAM (unpulsed); and 4) ACL-191 pulsed with aAM. Systems with aAM were treated with the NLVPMVATV peptide (aAM) derived from the HCMVpp65 protein at a peptide concentration of 1 μM for 2 h, as described in the Materials and Methods section. Additionally, systems with eAPC:CD8 ratios of 1:0, 1:1, and 1:8 were generated. A bar graph of the percentage of dead eAPC cells (CD80+ annexin+ PI+) detected by flow cytometry is plotted. Clear killing of eAPC-p cells was observed only in System 4 (ACL-191+ peptide), which contained both eAPCs and CD8+ cells at a ratio of 1:1 or 1:8 (eAPC:CD8). No significant increase in killing above background is observed in systems 1, 2, and 3 lacking aAPX or aAM, or both. Thus, eAPC-p pulsed with exogenous aAM can be used to stimulate antigen-specific cytotoxicity in primary CD8+ T cells (analyte TCs).b) Three eAPC:T systems were generated, comprising analyte TCs (CD8+ T cells) and 1) ACL-128 (eAPC), 2) ACL-191 (eAPC-p), or 3) ACL-390 (eAPC-pa), where no exogenous aAM was provided. ACL-390 has an integrated aAM ORF, HCMVpp65. A bar graph of the percentage of dead eAPC cells (CD80+ Annexin+ PI+) detected by flow cytometry is plotted. Clear killing of eAPC-p cells is observed only in system 3 (ACL-390), which contains both eAPC and CD8+ cells at a ratio of 1:1 or 1:8 (eAPC:CD8) (ACL-191+ peptide). No significant increase in death above background is observed in systems 1, 2, and 3, which lack aAM or aAPX:aAM. Thus, this data supports that eAPC-pa can process endogenous aAM ORFs into aAMs by native cellular machinery and present the aAMs as complexes with aAPX, which can then stimulate antigen-specific cytotoxicity by primary CD8+ T cells (analyte TCs). [Figure 49]Figure 49 - Identification of analyte antigen molecules from eAPC-pa cells by mass spectrometry. Mass spectrometry results are shown for peptide fractions obtained from the following procedure: Two eAPC-p lines, ACL-900 (aAPX:HLA-A*02:01) and ACL-963 (aAPX:HLA-A*24:02), were pulsed with known antigenic peptides, where each eAPC-p underwent four separate pulses consisting of the following peptides: aAM:NLVPMVATV (APD-2, SEQ ID NO:3), NLGPMAAGV (APD-21, SEQ ID NO:4), or VYALPLKML (APD-11, SEQ ID NO:5), or no peptide. APD-2 is known to complex with HLA-A*02:01, APD-11 with HLA-A*24:02, and APD-21 is a triple mutant of APD-2 (V3G, T8G, V6A), where these mutations disrupt its ability to complex with HLA-A*02:01. Pulsed cells were harvested and lysed. The clarified lysate was mixed with nickel agarose resin and HLA was pulled down using 6x-His capture. The bound fraction was eluted with 10% acetic acid and ultrafiltered on a 3 kDa column. The peptide fraction was subjected to liquid extraction, and removal of the organic phase was subjected to solid-phase extraction. The extracted peptide fraction was subjected to mass spectrometry. The peptides NLVPMVATV (SEQ ID NO: 3), VYALPLKML (SEQ ID NO: 5), and NLGPMVAGV (SEQ ID NO: 4) were successfully identified in each pulse experiment (IDs 2, 3, and 11), but not in the other samples. The HLA-mismatched peptides NLVPMVATV (ID 12, HLA-A*24:02, SEQ ID NO: 3) and VYALPLKML (ID 13, HLA-A*02:01, SEQ ID NO: 5), and the triple mutant NLGPAAGV (SEQ ID NO: 4), were not identified. Thus, capture and enrichment of aAPX:aAM complexes from eAPC-p cells can be used to identify, confirm, and / or determine the HLA-restricted presentation of analyte antigen molecules in antigen-presenting complexes. [Example]

[0082] Materials and Methods Electroporation of ARH-77 cells 4 x 10 per reaction 6 Cells were cultured in 500 μl RPMI 1640 using Gene Pulser XCELL TM Electroporation was performed using a Glutamax-I (Life Technologies) electroporator (Bio-Rad) with the following settings: square wave 285 V, 12.5 ms pulse length, 2 pulses separated by 1 second. DNA concentrations used for Cas9 plasmid V1.A.8 were 10 μg / ml and 7.5 μg / ml for gRNAs targeting the integration sites (V2.I.10 and V2.J.1 for integration at the HLA endogenous locus, and V2.J.6 for the target AAVS1 site) (Table 3). Integration vectors were electroporated at a concentration of 7.5 μg / ul. For HDR integration at the HLA locus, HLA class I V1.C.6 and V1.C.9 plasmids were used. For HDR integration at the AAVS1 locus, HLA class I V1.F.8 and V1.F.10 and HLA class II V1.I.5 and V1.I.7 were used. Variants of the pp65 ORF were integrated into previously generated HLA monoallelic strains. Plasmids V1.G.9 and V1.H.1 containing a form of pp65 linked to a GFP marker were used for this purpose. To generate an ARH-77 HLA-null strain with one RMCE site, plasmids with heterologous recombinase sites flanking the marker were used. V4.B.2 was used for RFP, and V4.B.3 was used for BFP. The same plasmids were co-electroporated to generate stable strains containing two RMCE sites. Monoallelic HLA lines were also generated using RMCE, in which vector V4.D.2 was electroporated into cells containing one RMCE site. After electroporation, cells were incubated in RPMI 1640 culture medium containing Glutamax-I + 10% FBS for 2 days (37°C, 5% CO2) before analysis.

[0083] Transfection of HEK293 cells One day before transfection, cells were cultured at 1.2–1.4 × 10 6Cells were seeded at a density of 100 cells / 60 mm dish in 90% DMEM + 2 mM L-glutamine + 10% HI-FBS (Life Technologies). The next day, 65% confluent cells were transfected with a total of 5 μg of DNA and jetPEI® (Polyplus transfection reagent, Life Technologies) (N / P ratio 6). After changing the medium, transfection was performed. DNA and jetPEI® stock solutions were diluted in sterile 1 M NaCl and 150 mM NaCl, respectively. The final volume of each solution was 50% of the total mixed volume. The PEI solution was then added to the diluted DNA, and the mixture was incubated at room temperature for 15 minutes. Finally, the DNA / PEI mixture was carefully added to the 60 mm dish, taking care not to disrupt the cell film. Cells were incubated (at 37°C, 5% CO2, and 95% relative humidity) for 48 hours before GFP expression analysis. For deletion of HLA class I genes, cells were transfected with 0.42 μg of a DNA vector encoding Cas9_GFP (V1.A.8), gRNAs targeting HLA-A, B, and C (V2.A.1, V2.A.7, and V2.B.3, respectively), and an empty vector (V1.C.2). For integration of an RMCE site at the AAVS1 locus, cells were transfected with 0.5 μg of V1.A.8; 0.625 μg of gRNA V2.J.6; and 0.75 μg of plasmids encoding two markers flanked by RMCE sites (V4.B.2 for RFP and V4.B.3 for BFP), and 5 μg of DNA was filled with empty vector V1.C.2.

[0084] Sorting of polyclonal GFP-expressing cells Cells electroporated or transfected with a plasmid encoding Cas9-P2A-GFP (V1.A.8) or a GFP selectable marker (V1.A.4) were analyzed by FACSJAzz TM HEK 293 cells were sorted for transient GFP expression using a cell sorter (BD Biosciences). TMAfter harvesting with Express Trypsin (ThermoFisher Scientific) and resuspending in an appropriate volume of DPBS 1x (Life Technologies), cell sorting was performed in DMEM 1x medium containing 20% HI-FBS and anti-anti 100X (Life Technologies).ARH-77 cells were washed, resuspended in an appropriate volume of DPBS, and then sorted in RPMI 1640 containing Glutamax-I, 20% HI-FBS, and anti-anti 100X (Life Technologies).

[0085] Selection of polyclonal and monoclonal cells with stable expression of the component of interest To obtain a population of cells that constitutively express the integrated protein or marker, cells were sorted 7-15 days after the first GFP+ selection. Cells predicted to express surface proteins were sorted after antibody staining. For HLA class I genes, PE-Cy was used. TM 5 mouse anti-human HLA-ABC antibody (BD Biosciences) was used. HLA-DR and HLA-DP staining was performed using Alexa Fluor® 647 mouse anti-human HLA-DR, DP, DQ (BD Biosciences). For HEK 293-derived cell lines, cells were incubated with TrypLE TM After harvesting with Express Trypsin (ThermoFisher Scientific) and washing with an appropriate volume of DPBS 1x (Life Technologies), cell sorting was performed in DMEM 1x medium containing 20% HI-FBS and anti-anti 100X (Life Technologies). ARH-77-derived cell lines were washed with an appropriate volume of DPBS and then sorted in RPMI 1640 containing Glutamax-I, 20% HI-FBS, and anti-anti 100X (Life Technologies).

[0086] [Table 1]

[0087] For HLA knockout or integration, cells were selected based on the loss or gain of HLA expression, respectively. Cells that integrated the RMCE site were sorted based on the expression of BFP and RFP markers, and HLA monoclones that integrated the pp65 mutant were sorted for GFP expression (Table 4). Monoclonal sorting of cells expressing the gene of interest was performed in 96-well plates containing 200 μl of growth medium. One to two plates per sample were sorted. Immediately after, polyclonal sorting of the remaining cells was performed in FACS tubes using the cell sorter Influx. TM (BD Biosciences) using a bimodal sorting setup.

[0088] Phenotypic screening of monoclonal populations A sample of 20,000 cells of the expanded monoclonal population was transferred to a microtiter plate for analysis, and the cells were resuspended in 250 μl of DPBS 1× (Life Technologies) and incubated in an LRS Fortessa TM The cells were analyzed using a BD Biosciences system. BFP and RFP expression was detected using BV421 PMTs and PE-Texas Red fluorophore, respectively. For proteins with surface expression, cells were first transfected with PE-Cy fluorophore. TMStaining was performed using mouse anti-human HLA-ABC antibody (BD Biosciences) or Alexa Fluor® 647 mouse anti-human HLA-DR, DP, DQ (BD Biosciences). The staining solution was prepared using the recommended antibody volume diluted in 100 μl of staining buffer (DPBS + 2% FBS). Cells were incubated for 1 hour at 4°C and then washed twice with 500 μl of staining buffer before analysis. Selected monoclones were maintained in normal growth medium. HEK239 cells were grown in DMEM + 2 mM L-glutamine + 10% HI-FBS (Life Technologies), and ARH-7 cells were grown in RPMI 1640 containing Glutamax-I + 10% HI-FBS. Cell confluence was measured at 10–12 × 10 6 The DNA was monitored daily until it reached 5 × 10 6 The remaining cells were further grown to a density of 3 × 10 6 Cells / ml were cryopreserved in 70% growth medium + 20% HI-FBS + 10% DMSO.

[0089] [Table 2]

[0090] Verification of integration into the correct genomic location Monoclones with the desired phenotypic characteristics were screened and evaluated at the molecular level by PCR using Q5® Hot Start High-Fidelity DNA Polymerase (NBE) in a 20 μl reaction using the manufacturer's recommended components and volumes. Primers 9.C.4 and 9.D.6 were used to determine whether the HLA I ORF had integrated into the HLA locus; correct right homology arm recombination was indicated by a 1 kb amplicon (Table 5). For HLA integration at the AAVS1 locus, four sets of primers were used: 9.C.3 and 9.C.8, which evaluate correct left homology arm recombination (1.1 kb); 9.C.4 and 9.D.1, which evaluate right homology arm recombination (660 bp); 1.C.5 and 9.C.5, which amplify the CMV promoter (810 bp) of the internal construct; and 1.C.2 and 9.C.10, which obtain an amplicon for the SV40pA terminator (380 bp) of the internal construct. Evaluation of RMCE site integration in HEK293 and ARH-77 HLA-null lines was performed using primer sets 2 and 4. To confirm HLA class I deletion in HEK293 cells, specific HLA primers were used as follows: 4.A.3 and 4.A.4 targeting HLA-A, 4.A.7 and 4.B.1 for HLA-B, and 4.B.5 and 8.A.1 for HLA-C. First, PCR Master Mix was prepared with all components (Q5® Reaction Buffer, dNTPs, Hot-Start Q5® DNA Polymerase, primers Fwd and Rev, 100 ng of DNA template, and H20). PCR reactions were performed using a C1000 Touch TM PCR was performed using a Thermal Cycler (Bio-Rad). PCR products were run on a 1% agarose gel in 1x TAE buffer using a PowerPac Basic (Bio-Rad), stained with 10,000x dilution of Sybersafe, and analyzed using Fusion SL (Vilber Lourmat).

[0091] [Table 3]

[0092] Identification of gene copy number DNA from selected monoclones was analyzed using specific primers targeting the gene of interest and a probe recognizing a fragment of the integrated gene and extending into the homology arms. For HLA class I integration at the HLA locus, primers 4.I.9 and 9.C.4 were used to amplify the gene of interest, and 8.B.2 conjugated with FAM was used as a probe. For constructs integrated at the AAVS1 locus, primers 9.D.6 and 9.D.7 and probe 9.J.2 (also conjugated with FAM) were used. In all cases, the reference gene (TRAC) was simultaneously screened, and chromosomal copy numbers were determined using primers 10.A.9 and 10.A.10 and fluorescent probe 10.B.6 conjugated with HEX. Based on the integration copy numbers, ARH-77 cells were considered diploid and HEK293 cells were considered triploid for the reference gene (TRAC). Prior to digital drop PCR, DNA was digested with MfeI (NEB) to isolate tandem integrations. Reaction setup and cycling conditions were performed using a QX200 TM Droplet Reader, Droplet Generator, and C1000 Touch TM ddPCR using a deep-well thermal cycler (Bio-Rad) TM The protocol for Supermix for Probes (No dUTP) (Bio-Rad) was followed. QuantaSoft TM The software was used to acquire the data, using Channel 1 for detection of FAM and Channel 2 for HEX.

[0093] [Table 4]

[0094] [Table 5]

[0095] HLA-A in eAPC cell lines * Flp-mediated integration of 02:01 sequences The eAPC cells were transfected with a vector encoding Flp, DNA encoding a marker for tracking delivery (a vector encoding GFP), and HLA-A * Electroporated with a vector containing 02:01. HLA-A * The 02:01 sequence also encoded a linker and a 3xMyc-tag at the 3' end. The electroporation conditions used were 258V, 12.5ms, 2 pulses, 1 pulse interval. The ratio of each integration vector to the Flp-vector was 1:3. To set the gate for GFP sorting after 2 days, cells electroporated with only the GFP-vector and cells without electroporation were used as controls, respectively. The next day (2 days after electroporation), cells were analyzed and sorted based on GFP expression. Cells were sorted using a BD Influx cell sorter. Three days after electroporation, sorting based on GFP expression was performed to enrich for electroporated cells. Seven to eight days after electroporation, cells were harvested and surface stained for HLA-ABC expression. BFP+ve, RFP-ve, HLA+ve cells were single-cell sorted to identify monoclonal cells. To genotype the cells, PCR reactions were performed using 100 ng of DNA as template to verify whether integration had occurred at the expected integration site. PCR products were run on a 1% agarose gel using a forward primer (Pan_HLA_GT_F1 (Insert SEQ ID NO)) targeting the integration cassette and a reverse primer (SV40pA_GT_R1 Insert SEQ ID NO) targeting just outside the integration site.

[0096] Flp-mediated integration of HCMV ORF sequences in the eAPC-p cell line eAPC-p cells were electroporated with a vector encoding Flp, DNA encoding a marker for tracking delivery (a vector encoding GFP), and a vector containing the HCMV pp28, pp52, or pp65 aAM-ORF. The HCMV-ORF sequence also encoded a linker and a 3xMyc tag at the 3' end. The electroporation conditions used were 258 V, 12.5 ms, 2 pulses, and 1 pulse interval. The ratio of each integration vector to the Flp-vector was 1:3. To set the gate for GFP sorting after 2 days, cells electroporated with only the GFP-vector and cells without electroporation were used as controls, respectively. The next day (2 days after electroporation), cells were analyzed and sorted based on GFP expression. Cells were sorted using a BD Influx cell sorter.

[0097] Flp-mediated shotgun integration of three HCMV ORF sequences in the eAPC-p cell line eAPC-p cells were electroporated with a vector encoding Flp, DNA encoding a marker for tracking delivery (a vector encoding GFP), and a vector containing the HCMV pp28, pp52, or pp65 aAM-ORF. The HCMV-ORF sequence also encoded a linker and a 3xMyc tag at the 3' end. The electroporation conditions used were 258 V, 12.5 ms, two pulses, and one pulse interval. For shotgun integration, vectors containing HCMV-ORFs were pooled in a 1:1:1 ratio, and the mixture was electroporated into eAPC-p cells. The resulting eAPC-pa cells were polyclonal. Individual monoclonal cells were selected and genetically characterized, demonstrating that the polyclonal cells were composed of cells containing all three HCMV-ORFs.

[0098] PCR reactions to assess RMCE-integration of HCMV ORFs into component D Primers used to assess integration of HCMV ORFs annealed to a linker (forward primer 10.D.1 (Insert SEQ ID)) and the EF1a pIha promoter (reverse primer 15.H.4). Expected sizes were 0.8 kb for pp28, 1.5 kb for pp52, and 1.9 kb for pp65.

[0099] [Table 6]

[0100] [Table 7]

[0101] PCR products were run on a 1% agarose gel in 1× TAE buffer using a PowerPac Basic (Bio-Rad), stained with 10,000 dilutions of sybersafe, and analyzed using Fusion SL (Vilber Lourmat).

[0102] Antigen-specific CD8+ cell proliferation Peripheral blood mononuclear cells (PBMCs) were isolated from healthy blood donors known to harbor CMV-A.0201-NLVP-specific CD8+ T cells using Ficoll-Paque Plus (GE Healthcare). Cells were stained with surface antibodies against CD markers. Specific T cell populations were sorted using a BD Influx cell sorter, pelleted, and resuspended at 200,000 cells / ml in OSG medium + 10% HS.

[0103] Pulsing eAPs with peptide multimers HLA-A * 02:01 eAPCs were pulsed with 1 μM peptide (NLVPMVATV (SEQ ID NO: 3) or in complete OSG medium + 10% HS) for 4 hours. Cells were washed three times in phosphate-buffered saline (PBS) and resuspended at 100,000 cells / ml in OSG medium + 10% human serum (HS).

[0104] Co-culture of antigen-specific CD8+ and eAPCs CD8+ cells were co-cultured with eAPCs in a 1:1 ratio in 96-well polystyrene (wp) round-bottom plates, i.e., 5000 cells of each cell type in a 100 μL culture volume, for a total of 10,000 cells / well. Restimulation was performed on day 9 of culture, resulting in 150 μL of culture maintained and restimulated with 5000 freshly pulsed eAPC cells in a volume of 50 μL per well. In a parallel experiment, CD8+ T cells were cocultured with the eAPC-pa cell line stably expressing pp65 in a 1:1 ratio in a 96wp round-bottom plate at 5,000 cells of each cell type for a total of 10,000 cells / well in a 100 μL culture volume. Unpulsed HLA-null and eAPC-pa cells were included as controls. No restimulation was performed.

[0105] Phenotyping Phenotyping was performed on day 14. Five replicates and pools of 20 wells per condition were phenotyped. Cells were stained separately with 1:100 diluted DCM (Zombie NIR) followed by 1:50 diluted multimers (Table 4) for 10 minutes, after which surface markers (Table 4) were added at 25 μL / sample for 30–60 minutes. Cells were resuspended in staining buffer (PBS + 2% FBS), and data were acquired on an LSRFortessa and analyzed with FlowJo.

[0106] Antigen-specific CD4+ cell proliferation Peripheral blood mononuclear cells (PBMCs), INFL-DRB1 * CD4+ T cells specific for 01:01-PKYV were isolated from healthy blood donors known to have them using Ficoll Paque Plus (GE Healthcare). Cells were stained with surface antibodies against CD markers. Specific T cell populations were sorted using a BD Influx cell sorter, pelleted, and resuspended at 100,000 or 400,000 cells / ml in OSG medium + 10% HS.

[0107] Pulsing eAPCs with peptide multimers HLA-DRB1 * 01:01 eAPCs were pulsed with 1 μM peptide (PKYVKQNTLKLAT (SEQ ID NO: 1) or in complete OSG medium + 10% HS) for 2 hours. Cells were washed three times in phosphate-buffered saline (PBS) and resuspended at 5000 cells / ml in OSG medium + 10% human serum (HS).

[0108] Co-culture of antigen-specific CD4+ and eAPCs CD4+ cells were co-cultured with eAPCs in a 96wp round-bottom tube at a ratio of 250 eAPCs to 5,000:20,000 CD4+ cells in a 100 μL culture volume. Cultures were maintained in OSG + 10% HS. On day 1, some cultures were treated with 100 U / mL IL-2. Cultures without IL-2 received medium. IL-2 was added to 14-day cultures on day 7.

[0109] Phenotyping Phenotyping was performed on day 14. Five replicates and pools of 20 wells per condition were phenotyped. Cells were stained separately with 1:100 diluted DCM (Zombie NIR) followed by 1:50 diluted multimers (Table 4) for 10 minutes, after which surface markers (Table 4) were added at 25 μL / sample for 30–60 minutes. Cells were resuspended in staining buffer (PBS + 2% FBS), and data were acquired on an LSRFortessa and analyzed with FlowJo.

[0110] Cytotoxicity assay Pulsing eAPCs with peptides 2×10 6 Cells were pulsed with 1 μM NLVPMVATV (SEQ ID NO: 3) peptide overnight in 2 ml of complete Roswell Park Memorial Institute (RPMI) medium, harvested, washed three times with PBS, and resuspended in complete RPMI.

[0111] Generation of antigen-specific CD8+ T cells Antigen-specific CD8+ T cells were derived from PBMCs of healthy donors. Cells were stained with surface antibodies against CD markers. Specific T cell populations were sorted using a BD Influx cell sorter, counted, and stored in liquid nitrogen. One day before the experiment, cells were thawed and rested overnight in complete OSG medium. Cells were counted and resuspended in complete OSG medium.

[0112] Co-culture of eAPCs with antigen-specific CD8+ cells Peptide-pulsed and unpulsed eAPCs were co-cultured with cytotoxic CD8+ T cells. 10,000 eAPCs were seeded per well in a 96-well plate (50 μl complete RPMI). eAPCs were co-cultured with CD8+ T cells at increasing ratios. Ratios tested included 1:0 (eAPC:CD8+), 1:1 (eAPC:CD8+), and 1:8 (eAPC:CD8+) eAPCs alone in a total volume of 100 μl. Cells were co-cultured for 4–5 h.

[0113] staining Cells were transferred from the wells to microtubes (1 well = 1 microtube), and 400 μl of RPMI was added per tube. Cells were centrifuged for 3 minutes at 400 g, the supernatant removed, and the cell pellets resuspended in 25 μl of staining mix or RPMI (unstained control) (staining mix: Annexin V BV711 + CD80 APC + CD8 APC-H7) and incubated for 20 minutes at RT at 450 rpm. Staining was terminated by adding 400 μl of RPMI per tube, followed by centrifugation and removal of the supernatant. The staining is described in Table 4. Cell pellets were resuspended in 150 μl of RPMI (stained sample) or 150 μl of RPMI (unstained sample) containing 1 μg / ml propidium iodide, and samples were transferred to a 96-well plate for data acquisition on the Fortessa.

[0114] Metal affinity chromatography Peptides used in the pulse experiments were purchased from Genscript Biotech. APD-2:NLVPMVATV (SEQ ID NO: 3) pp65 is the wild-type peptide and is a target of HLA-A * APD-21:NLGPMAAGV (SEQ ID NO: 4) pp65 is a V3G, T8G, V6A triple mutant peptide of ADP-2 NLVPMVATV (SEQ ID NO: 3) pp65, and APD-11:VYALPLKML (SEQ ID NO: 5) is restricted to binding to HLA-A * The wild-type peptide is restricted to binding to 24:02. Cells were cultured in RPMI supplemented with 10% FBS at 37°C and 5% CO. On the day of the experiment, cells were harvested, washed twice in warm PBS 1x, and diluted to 2x10 6 Cells were replated at 1000 cells / ml and pulsed with 1 μM peptide for 2 h. Pulsed cells were harvested, washed twice with ice-cold PBS, and lysed in ice-cold lysis buffer (150 mM sodium chloride (NaCl), 50 mM Tris pH 8, 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 5 mM imidazole, 0.2 mM iodoacetamide, and 1× Halt protease inhibitor cocktail (Thermo Scientific)), vortexed vigorously, and incubated at 4°C for 20 min. The cleared lysate was purified by HisPur TMThe beads were mixed with nickel-nitriloacetic acid (Ni-NTA) resin (Thermo Scientific) and rotated for 2 hours at 4°C. After removal of the unbound lysate fraction, the resin was washed twice with high-salt buffer (250 mM NaCl, 50 mM Tris pH 8, 25 mM imidazole) and twice with low-salt buffer (50 mM NaCl, 50 mM Tris pH 8). The washed beads were collected in low-salt wash buffer and transferred to a spin column (Thermo Scientific). The bound fraction was eluted with 10% acetic acid and ultrafiltered on a 3 kD Nanosep Omega column (Pall). The peptide fraction was subjected to liquid extraction by mixing 1:1 with water-saturated ethyl acetate, thoroughly vortexing, and removing the organic phase. Subsequent solid-phase extraction was performed on a stage tip assembled with two layers of Empore styrene divinylbenzene-reverse-phase sulfonate (SDB-RPS) matrix 47 mm disks (3M). The SDB-RPS membrane was activated with acetonitrile and equilibrated with SDB wash buffer (0.2% TFA, milli-Q, pH <2) before loading the sample. The membrane was then washed twice, and the adsorbed peptide fraction was eluted with elution buffer (80% acetonitrile (ACN), 1% NH3, milli-Q, pH >10). The sample was transferred to an HPLC-glass vial, dried under vacuum, and stored at -20°C before being subjected to LC-MS / MS analysis.

[0115] mass spectrometry Peptides were resuspended in 10 μl of solvent A (3% CHCl, 0.1% formic acid (FA), MQ) before LC-MS / MS analysis. Each sample was analyzed using a Q Exactive HF (Thermo Fisher Scientific, Germany) connected to a Dionex nano-UHPLC system (Thermo Fisher Scientific), with an 8 μl injection from each sample vial. The UHPLC was equipped with a trap column (Acclaim PepMap 100, 75 μm × 2 cm, nanopiper, C18, 3 μm, 100 Å; Thermo Fisher Scientific) and an analytical column (PepMap RSLC C18, 2 μm, 100 Å, 50 μm × 50 cm; Thermo Fisher Scientific) heated to 50 °C. The mobile phase buffer for nLC separation consisted of solvent A and solvent B (95% CHCl, 0.1% FA, MQ). Peptides were eluted over a 30-minute gradient and sprayed directly into the mass spectrometer. The flow rate was set at 400 nL / min, and the LC gradient was as follows: 2-5% solvent B within 5 minutes, 5-40% solvent B within 30 minutes, 40-47% solvent B within 5 minutes, 47-100% solvent B within 5 minutes, and 100% solvent B for 8 minutes and 2% solvent B for 5 minutes. Nanospray was achieved with an applied voltage of 1.8 kV. The mass spectrometer was programmed in data-dependent acquisition (DDA) mode (10 most intense peaks) and configured to perform a Fourier transform survey scan from 400 to 1600 m / z (60,000 at 200 m / z resolution), with an AGC target of 1e6 and a maximum injection time of 250 ms. MS2 scans were acquired on the 10 most abundant MS1 ions in charge states 1 to 7 using a quadrupole isolation window of 1.2 m / z for HCD fragmentation and 30 s of dynamic exclusion.

[0116] Data analysis The raw MS files were searched using MaxQuant (version 1.5.6.5) against a peptide fasta file containing the peptides used in the experiment and supplemented with a list of common LC-MS / MS contaminants. Digestion specificity was set to nonspecific, peptide variable modification was set to allow oxidation (M), the initial search tolerance was set to 20 ppm, and the FDR was set to 1%.

[0117] Example Example 1: Deletion of the APX gene family by targeted mutagenesis This example describes how targeted mutagenesis of genes encoding the family of antigen-presenting complexes (APXs) was achieved to generate the first trait of genetically engineered antigen-presenting cells (eAPCs), which is the loss of surface expression of at least one member of the APX family. In this example, the targeted APX comprised three members of the major HLA class I family, HLA-A, HLA-B, and HLA-C, in the HEK293 cell line. HEK293 cells were derived from human embryonic kidney cells that exhibit endogenous surface expression of HLA-ABC. Cytogenetic analysis demonstrated that this cell line has a near-triploid karyotype, and therefore HEK293 cells encode three alleles of each HLA-A, HLA-B, and HLA-C gene. Targeted mutagenesis of HLA-A, HLA-B, and HLA-C genes was performed using an engineered CRISPR / Cas9 system, in which Cas9 nuclease activity was targeted to the HLA-A, HLA-B, and HLA-C loci by synthetic guide RNAs (gRNAs). Four to five unique gRNAs were designed to target conserved nucleotide sequences for each HLA gene locus, with the targeted site directed toward the start of the gene coding sequence because this was more likely to generate null alleles. The efficiency of the gRNAs to induce mutations at the targeted loci was determined, and the most efficient gRNAs were identified as HLA-A, HLA-B, and HLA-C null (HLA-ABC) alleles. null) was selected to give rise to the HEK293 cell line.

[0118] Plasmids encoding optimal gRNAs targeting the HLA-A, HLA-B, and HLA-C loci were transfected into HEK293 cells along with a plasmid encoding Cas9-P2A-GFP, as described in the Methods section. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC-sorted based on GFP fluorescence 2 days after transfection (Figure 28a). GFP-sorted cells were further propagated for 5 days or more to allow sufficient time for gene editing events to occur and, in the case of deleterious mutations, for loss of expression of remaining endogenous HLA-A1 proteins. After this expansion period, cells were stained with a pan-HLA-ABC antibody to identify cells with reduced surface HLA-ABC expression (Figure 28b). The lack of pan-HLA-ABC antibody staining indicated that the respective HLA-A, HLA-B, and HLA-C alleles had been mutated. Individual HLA-ABC-negative cells were sorted and expanded into monoclonal populations.

[0119] HLA-ABC null Monoclones were confirmed by the lack of HLA-ABC surface expression. A subset of monoclones demonstrated a lack of HLA-ABC surface expression. Three example monoclones, ACL-414, ACL-415, and ACL-416, are shown in Figure 29. Further genetic characterization of monoclones lacking HLA-A surface expression was performed by determining that the cell lines harbored underlying genetic mutations in all alleles of the HLA-A, HLA-B, and HLA-C genes (Figure 30). Genetic characterization was performed by PCR using primers spanning the gRNA genomic target site for detection of amplicon size changes and / or primers used as templates for sequencing. Figure 30 shows HLA-ABC clones containing genetic deletions in alleles of the HLA-A, HLA-B, and HLA-C genes, detected by shorter PCR amplicons compared to the amplicon size of the base cell line (e.g., ACL-414). null Selection of monoclones is shown. In conclusion, genetically modified HEK293 cell lines (including ACL-414, ACL-415, and ACL-416) were demonstrated to lack surface expression of HLA-ABC and thus possess the primary trait of genetically engineered antigen-presenting cells (eAPCs).

[0120] Example 2: Generation of eAPCs containing component B In this example, component B is HLA-ABC null We describe a method for stable integration into the monoclonal line ACL-414 to generate a second trait of eAPCs, which contains at least one genomic acceptor site for integration of at least one ORF, where the genomic acceptor site was a synthetic construct designed for recombinase-mediated cassette exchange (RMCE). In this example, the genomic integration site (component B) was composed of selected genetic elements: two unique heterospecific recombinase sites, FRT and F3, which flank an ORF encoding the selectable marker blue fluorescent protein (BFP). The 5' side of the FRT site encoded the EF1a promoter, and the 3' side of the F3 site encoded the SV40 polyadenylation signal terminator. The advantage of locating non-coding cis-regulatory elements outside the heterospecific recombinase sites is that they are not required for the matched gene donor vector (component C). Therefore, no transient expression of the encoded ORF was observed after cellular delivery of the gene donor vector. This made the selection of successful RMCE more reliable, as cellular expression of the ORF from the gene donor vector likely occurred only after correct integration into component B, since the appropriate cis-regulatory elements were included (see Example 6).

[0121] To facilitate stable genomic integration of component B into the genomic safe harbor locus (AAVS1), we constructed a plasmid in which the component B DNA element was flanked by AAVS1 left and right homology arms, each consisting of >500 bp of sequence homologous to the AAVS1 genomic locus. Stable integration of component B was achieved through the process of homology-directed recombination (HDR) at the genomic safe harbor locus AAVS1. The ACL-414 cell line was transfected with a plasmid encoding an optimal gRNA targeting the AAVS1 locus, a plasmid encoding Cas9-P2A-GFP, and a plasmid encoding the component B gene element flanked by AAVS1 left and right homology arms. Cells positive for Cas9-P2A-GFP plasmid integration were FACS-sorted based on GFP fluorescence 2 days after transfection (Figure 31a). GFP-sorted cells were further propagated for 7+ days to allow sufficient time for HDR to occur and for the loss of transient expression of the selectable marker BFP. After this growth period, cells were analyzed by FACS, and individual BFP-positive cells were selected and expanded into monoclonal populations (Figure 31c).

[0122] Individual monoclonal lines were selected as eAPCs for single integration of component B into the desired AAVS1 genomic location based on maintained BFP expression. Cell lines ACL-469 and ACL-470 were monoclonal in that BFP expression was maintained (Figures 32a and 32b). Genetic characterization was performed on DNA extracted from monoclones ACL-469 and ACL-470, demonstrating that component B had been integrated into their genomes and that component B had integrated into the AAVS1 locus (Figure 33). Confirmation of genomic integration was determined by detection of PCR amplicons of the expected size using primers specific for component B (Figure 33a). Confirmation of component B integration into the AAVS1 locus was determined by detection of PCR amplicons of the expected size using primers designed against AAVS1 genomic sequences distal to the region encoded by the homology arms and primers unique to the SV40 pA terminator encoded by component B (Figure 33b). The copy number of component B was determined by digital drop PCR, in which the number of component B and reference gene DNA molecules was measured and the ratio was calculated (Table 1). The monoclonal ACL-469 and ACL-470 contained component B molecules and reference gene molecules in a ratio of 1 to 3. Considering that the original HEK293 cell line has a near-triploid karyotype, this demonstrates the single integration of component B in the ACL-469 and ACL-470 cell lines. In conclusion, the genetically modified ACL-469 and ACL-470 cell lines exhibited HLA-ABC null and contained a single copy of a synthetic genomic acceptor site designed for RMCE, thus demonstrating the generation of eAPCs with a single synthetic integration acceptor site.

[0123] Example 3: Generation of eAPCs containing component B and component D In this example, component B and component D were treated with HLA-ABC nullWe describe a method for stable integration into the monoclonal line ACL-414 to generate a second trait of eAPCs, which contains two genomic acceptor sites for integration of at least one ORF, where the genomic acceptor sites were synthetic constructs designed for recombinase-mediated cassette exchange (RMCE). This example uses the same methods and components as described in Example 2, except for the addition of a second genomic acceptor site (component D). The component D genetic element consisted of two unique heterospecific recombinase sites, F14 and F15, distinct from component B. These sites flanked an ORF encoding the selectable marker red fluorescent protein (RFP). The 5' side of the F14 site encoded the EF1a promoter, and the 3' side of the F15 site encoded the SV40 polyadenylation signal terminator. As in Example 2, the component D genetic element was flanked by AAVS1 left and right homology arms, each consisting of >500 bp of sequence homologous to the AAVS1 genomic locus. Components B and D were incorporated into AAVS1 as described in Example 2, except for the addition of a plasmid encoding the component D element to the transfection mix. Cells positive for Cas9-P2A-GFP plasmid uptake were FACS-sorted based on GFP fluorescence 2 days after transfection (Figure 31a). GFP-sorted cells were further expanded for 7 days or more, after which the cells were analyzed on a FACS machine, and individual BFP- and RFP-positive cells were sorted and expanded into monoclonal populations (Figure 31b).

[0124] Individual monoclonal lines were selected as eAPCs for single integration of component B and single integration of component D into different AAVS1 alleles based on maintained BFP and RFP expression. Cell line ACL-472 was a representative monoclone in which BFP and RFP expression was maintained (Figure 32c). Gene characterization was performed on DNA extracted from monoclone ACL-472, as described in Example 2, to demonstrate that components B and D were integrated into their genomes and that both components were integrated into the AAVS1 site (Figure 33). Copy numbers of both components B and D were determined by digital drop PCR, in which the number of component B, D, and reference gene DNA molecules was measured and the ratio was calculated. Monoclone ACL-472 contained a 2:3 ratio of component B and D molecules to the reference gene molecule (Table 2). Considering that the base HEK293 cell line has a near triploid karyotype, this demonstrates a single integration of component B and a single integration of component D into the ACL-472 cell line. In conclusion, the genetically modified ACL-472 cell line exhibits HLA-ABC null and contains a single copy of the synthetic genomic acceptor sites component B and component D designed for RMCE, demonstrating the generation of eAPCs with two unique synthetic integration acceptor sites.

[0125] Example 4: eAPC-p, where component C' encodes a single HLAI ORF, constructed in one step using one integration couple This example describes a method for constructing eAPC-p in one step using a single integration couple, in which the genomic acceptor site (component B) is a native genomic site and the gene donor vector (component C') contains a single ORF encoding one analyte antigen-presenting complex (aAPX). In this example, the eAPC was a genetically modified ARH-77 cell line (designated ACL-128) in which two families of APX major HLA class I and HLA class II were mutated. The original cell line, ARH-77, is a B lymphoblast derived from plasma cell leukemia that exhibits strong HLA-A, B, C, and HLA-DR, DP, and DQ cell surface expression. Cytogenetic analysis demonstrated that the original ARH-77 cell line has a near-diploid karyotype but also exhibits a deletion of chromosome 6p21, the region encoding the HLA locus. DNA sequencing of the ARH-77 locus confirmed that ARH-77 encodes only single alleles of the HLA-A, HLA-B, and HLA-C gene families, as well as the HLA-DRA, HLA-DRB, HLA-DQA, HLA-DQB, HLA-DPA, and HLA-DPB gene families. HLA-ABC null and HLA-DR,DP,DQ null The cell line ACL-128 was generated by CRISPR / Cas9-targeted mutagenesis with gRNAs targeting the HLA-A, HLA-B, and HLA-C, as well as the HLA-DRA, HLA-DRB, HLA-DQA, HLA-DQB, HLA-DPA, and HLA-DPB gene families, using the methods described in Example 1. Surface labeling with pan-anti-HLA-ABC or pan-anti-HLA-DR,DP,DQ confirmed that ACL-128 lacks surface expression of both APX families (Figures 34b and 35 and Figure 37b, respectively).

[0126] In this example, the genomic acceptor site, component B, was a native AAVS1 genomic site, and targeted integration was achieved by HDR. A gene donor vector (component C) was matched to component B by encoding AAVS1 left and right homology arms, each consisting of >500 bp of sequence homologous to the AAVS1 genomic locus. Between the AAVS1 left and right homology arms, the plasmid encoded a CMV promoter and an SV40 terminator. An aAPX of interest was cloned between the promoter and terminator to generate component C'. In this example, component C' contained one aAPX, HLA-A *24:02 or HLA-B * Each component contained a single ORF encoding -07:02 (component C' HLA-A*24:02 and component C' HLA-B*-07:02 (called). The method for constructing eAPC-p was via HDR-induced integration of component C' into component B to generate component B'. The cell line ACL-128 was electroporated with a plasmid encoding an optimal gRNA targeting the AAVS1 locus, Cas9-P2A-GFP, and component C'. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC-sorted 2 days after electroporation based on GFP fluorescence (Figure 34a). GFP-sorted cells were further propagated for 7 days or more to allow sufficient time for HDR to occur and for the loss of transient aAPX expression. After this growth period, cells were stained with a pan-HLA-ABC antibody to identify cells that had acquired surface expression of the analyte HLA (Figure 34b). The presence of pan-HLA-ABC antibody staining indicated genomic integration of the analyte HLA ORF encoded by component C'. Individual HLA-ABC-positive staining cells were sorted and expanded to form eAPC-p monoclonal populations.

[0127] Individual monoclonal lines were selected as eAPC-p based on maintained analyte HLA surface expression and integration of the analyte ORF into the genomic acceptor site (creating component B'). Cell lines ACL-321 and ACL-331 each express HLA-A. * 24:02 or HLA-B *Representative monoclones maintained analyte HLA surface expression at -07:02 (Figure 35). Genetic characterization was performed on DNA extracted from selected monoclones ACL-321, ACL-327, ACL-331, and ACL-332, demonstrating that their genomes integrated component C', which occurred at the AAVS1 genomic acceptor site, generating component B' (Figure 36). Verification of genomic integration was determined by detection of PCR amplicons of the expected size using primers specific for component C' (Figure 36a). The presence of component B' was confirmed by detection of PCR amplicons of the expected size using primers designed against AAVS1 genomic sequences distal to the region encoded by the homology arms and primers unique to the SV40 pA terminator linked to the analyte HLA ORF (Figure 36b). In conclusion, aAPX HLA-A * 24:02 or HLA-B * Generation of genetically modified ACL-321 and ACL-331 cell lines containing a copy of the -07:02 ORF within the genomic acceptor site component B' resulted in the analyte aAPX being the only major HLA class I member expressed on the cell surface, thus demonstrating the generation of two defined eAPC-p cell lines using a multicomponent system.

[0128] Example 5: eAPC-p, where component C' encodes a paired HLAII ORF, constructed in one step using one integration couple This example describes a one-step method for constructing eAPC-p using a single integration couple, in which the genomic acceptor site, component B, was the native genomic site and the gene donor vector (component C') comprised a single ORF encoding two aAPX chains. This example utilized eAPC, ACL-128, and component B, all as defined in Example 4. However, component C′ did not specifically target HLA-DRB1 * HLA-DRA linked to the 01:01 allele by a viral self-cleaving peptide element *01:01 allele, or HLA-DPB1 * HLA-DPA1 linked to the 04:01 allele by a viral self-cleaving peptide element * Each of the 1:03 alleles contained a single ORF encoding the 01:03 allele (component C' HLA-DRA*01:01 / HLA-DRB1*01:01 and component C' HLA-DPA1*01:03 / HLA-DPB1*04:01 The viral self-cleaving peptide element, when transcribed, encoded a peptide sequence that led to self-cleavage of the synthesized peptide, generating two polypeptides that define each HLA chain.

[0129] The method for constructing eAPC-p was as described in Example 4, except that cells that had acquired surface expression of the analyte HLA were identified by cell surface labeling with pan-anti-HLA-DR,DP,DQ antibodies (Figure 37). The presence of pan-anti-HLA-DR,DP,DQ antibody staining indicated that the analyte HLA ORF encoded by component C' had been integrated into the genome. Individual HLA-DR,DP,DQ positive-staining cells were selected and expanded to form monoclonal eAPC-p populations. Individual monoclonal lines were selected as eAPC-p based on maintained analyte HLA surface expression and integration of the analyte ORF into the genomic acceptor site (creating component B') as described in Example 4. Cell lines ACL-341 and ACL-350 express HLA-DRA * 01:01 / HLA-DRB1 * 01:01 or HLA-DPA1 * 01:03 / HLA-DPB1 * The 04:01 analyte was a representative monoclone with maintained HLA surface expression (Figure 38). In conclusion, aAPX HLA-DRA * 01:01 / HLA-DRB1 * 01:01 or HLA-DPA1 * 01:03 / HLA-DPB1 *Generation of genetically modified ACL-341 and ACL-350 cell lines containing a copy of the 04:01 ORF within the genomic acceptor site component B' resulted in the analyte aAPX being the only major HLA class II member expressed on the cell surface, thus demonstrating the generation of two defined eAPC-p cell lines using a multicomponent system.

[0130] Example 6: eAPC-p, where component B is a synthetic construct, constructed in one step using one integration couple This example describes a one-step method for constructing eAPC-p using a single integration couple, where the genomic acceptor site, component B, was a synthetic construct designed for the RMCE genomic site, and the gene donor vector (component C') contained a single ORF encoding one aAPX. In this example, the genomic integration site (component B) consisted of selected genetic elements: two unique heterospecific recombinase sites, FRT and F3, which flank an ORF encoding the selectable marker blue fluorescent protein (BFP). The 5'-side of the FRT site encoded the EF1a promoter, and the 3'-side of the F3 site encoded the SV40 polyadenylation signal terminator. The genetic elements of component B were integrated into the cell line, ACL-128, by electroporation using the same plasmid as described in Example 2. As described in Example 2, individual monoclonal lines were selected based on sustained BFP expression and genetically characterized to contain a single integration of component B at the desired AAVS1 genomic location (Figure 39a). The resulting eAPC cell line, ACL-385, expressed the HLA-ABC gene. null and HLA-DR,DP,DQ null and contained a single copy of a synthetic genomic acceptor site component B designed for RMCE.

[0131] The gene donor vector (component C) was matched to component B so that component C encoded the same heterospecific recombinase sites FRT and F3. The aAPX ORF of interest (additionally encoding a Kozak sequence immediately before the start codon) was cloned between the two heterospecific recombinase sites to create component C'. In this example, component C' encodes one aAPX HLA-A * 02:01(Component C' FRT:HLA-A*02:01:F3 It contained a single ORF encoding the nucleotide sequence (referred to as nucleotide sequence). eAPC-p was transfected with a plasmid encoding the Tyr-recombinase Flp and component C' FRT:HLA-A*02:01:F3 RMCE was generated by electroporation of the cell line ACL-385 using the HLA-ABC allele and the component B selection marker. Four to 10 days after electroporation, individual cells were selected that were positive for HLA-AI surface expression and negative / reduced for the fluorescent protein marker BFP, encoded by the component B selection marker. Further growth of individual monoclonal lines was achieved by selection based on sustained HLA-AI allele expression and loss of BFP fluorescence, indicating the expected RMCE had occurred. Both phenotypic and genetic testing were performed to identify these monoclonal lines. All monoclonal cell lines were first screened for cell surface HLA-ABC expression and lack of BFP fluorescence (Figure 39). Genomic DNA was extracted from the cell lines, e.g., ACL-421 and ACL-422, and the integration of component C' into component B, yielding component B', was confirmed by detection of a PCR product specific for component B' (Figure 40). In conclusion, aAPX HLA-A * Generation of genetically modified ACL-421 and ACL-422 cell lines containing a copy of the 02:01 ORF within the synthetic genomic acceptor site component B' resulted in the analyte aAPX being the only major HLA class I member expressed on the cell surface, thus demonstrating the generation of two defined eAPC-p cell lines using a multicomponent system.

[0132] Example 7: eAPC-pa constructed in two steps using two integration couples This example describes a two-step method for constructing eAPC-pa. Step 1: Genomic acceptor site component B was a native genomic site, and the gene donor vector (component C') contained a single ORF encoding one aAPX. Step 2: Genomic acceptor site (component D) was a second native genomic site, and the gene donor vector component E' contained a single ORF encoding one analyte antigen molecule (aAM). In this example, the eAPC is ACL-128, and the genomic acceptor site component B is the variant HLA-A allele genomic site (HLA-A null Component C is a nucleotide sequence that contains the HLA-A null HLA-A consists of >500 bp of sequence homologous to a genomic locus null The gene donor vector (component C) was matched to component B by encoding the left and right homology arms. HLA-A null Between the left and right homology arms, the plasmid encoded a CMV promoter and an SV40 terminator. The aAPX of interest was cloned between the promoter and terminator to create component C'. In this example, component C' contained one aAPX HLA-A * 02:01 or HLA-B * Each component contained a single ORF encoding -35:01 (component C' HLA-A*02:01 , component C' HLA-B*-35:01 (called). Incorporation of component C' into component B and selection of monoclonal eAPC-p cell lines HLA-A promotes HDR incorporation of C' null The same procedure as in Example 4 was used, except that gRNAs targeting genomic loci were used. Monoclonal eAPC-p ACL-191 and ACL-286 expressed HLA-A on the cell surface, respectively. * 02:01 or HLA-B * -35:01 was expressed (Figure 41a).

[0133] In this example, the genomic acceptor site (component D) was a native AAVS1 genomic site, and step 2 was performed to achieve targeted integration by HDR. Gene donor vector component E was matched to component D by encoding AAVS1 left and right homology arms, each consisting of >500 bp of sequence homologous to the AAVS1 genomic locus. Between the AAVS1 left and right homology arms, the plasmid encoded a CMV promoter and an SV40 terminator. An aAM of interest was cloned between the promoter and terminator to generate component E'. In this example, component E' contained a single ORF encoding the selectable marker GFP linked to an aAM ORF encoding hCMV-pp65 (component E' GFP:2A:pp63 The viral self-cleaving peptide element, when transcribed, encoded a peptide sequence that led to self-cleavage of the synthesized peptide, generating two polypeptides: GFP and the intracellular hCMV-pp65 protein. Integration of component E' into component D was as in Example 4. Individual monoclonal lines ACL-391 and ACL-395 were selected as eAPC-pa based on maintained expression of the selectable marker GFP (Fig. 41b). In conclusion, aAPX HLA-A * 02:01 or HLA-B * Genetically modified ACL-391 and ACL-395 cell lines were generated containing a copy of the -35:01 ORF within genomic acceptor component B' and the aAM ORF pp65 within genomic acceptor component D'. These genetic modifications resulted in the aAPX being the only major HLA class I member expressed on the cell surface, where the aAM was also expressed. This therefore demonstrated the generation of two defined eAPC-pa cell lines using a multicomponent system.

[0134] Example 8: eACP-p constructed in one step, with component C' encoding a single HLAI ORF This example describes the conversion of eAPCs into eAPC-p in one step via a single integration couple event to integrate a single HLAI ORF encoding an analyte antigen-presenting complex (aAPX). Here, the eAPCs contain two synthetic genomic acceptor sites, component B and component D, designed for RMCE-based genomic integration. The generated eAPC-p has one genomic acceptor site (component B') occupied by the HLAI ORF, while the remaining component D is available for additional integration couple events. (Figure 6). This example utilized the eAPC (ACL-402) generated in Example 3, which contained components B and D. Here, component B contained two unique heterospecific recombinase sites, F14 and F15, flanking an ORF encoding the selectable marker red fluorescent protein (RFP). The EF1a promoter was encoded 5' to the F14 site, and the SV40 polyadenylation signal terminator was encoded 3' to the F15 site. Component D contained two unique heterospecific recombinase sites, FRT and F3, flanking an ORF encoding the selectable marker blue fluorescent protein (BFP). The EF1a promoter was encoded 5' to the FRT site, and the SV40 polyadenylation signal terminator was encoded 3' to the F15 site. This example uses a component C gene donor vector that contains heterospecific recombinase sites F14 and F15, thus matching component B. Two independent components C' were generated from component C, where one vector (V4.H.5) contains a Kozak sequence, a start codon, and an HLA-A sequence between the F14 / F15 sites. * The second vector (V4.H.6) contains the aAPX ORF encoding 02:01, and the second vector (V4.H.6) contains the Kozak sequence, the start codon, and the HLA-A gene between the F14 / F15 sites. * Contains the aAPX ORF encoding 24:02.

[0135] eAPC (ACL-402) was combined by electroporation with a vector (Flp, V4.1.8) encoding expression of the RMCE recombinase enzyme and each component C' of either V4.H.5 or V4.H.6, independently. Cells were cultured for 4 to 10 days. Cells were then selected and sorted based on the loss of the integrated selectable marker RFP and the acquisition of HLA-A1 on the cell surface. Individual monoclonal lines that grew longer were then characterized, validated, and selected based on the acquisition of HLA-A1 surface expression and loss of RFP fluorescence, indicating the expected conversion of component B to B' had occurred. The selected eAPC-p monoclonal, ACL-900 (V4.H.5, HLA-A1), was then selected based on the loss of HLA-A1 surface expression and loss of RFP fluorescence, indicating the expected conversion of component B to B'. * 02:01) and ACL-963 (V4.H.6, HLA-A * The eAPC-p monoclones (24:02) were negative for RFP and maintained HLAI surface expression compared to the parental ACL-402 cell line (Figure 43a). Furthermore, both monoclones retained expression of the BFP integration selectable marker, indicating that component D was not coupled to, but segregated from, the component B integration couple event. To further characterize the eAPC-p monoclones, genomic DNA was extracted from the cells, and confirmation of the integration couple between component C' and component B (yielding component B') was performed by detecting a PCR product specific for component B' (Figure 43b; Table 5 lists the primers used for genotyping). Primers targeting regions adjacent to the genomic acceptor site (primer ID 8.B.3) and within the integration couple event (primer ID 15.H.2) were designed. Amplification occurred only in the case of specific integration; no products were generated from control recombination (ACL-3) or off-target recombination. In summary, this example demonstrates two specific examples of eAPC to eAPC-p conversion using a multicomponent system, where two distinct aAPXs are delivered individually (component C') and integrated into a single genomic acceptor site (component B) by RMCE genomic integration, generating a limited library containing two distinct eAPC-p. Furthermore, the second genomic acceptor site (component D) was shown to be isolated and unaffected by the component B / component C' integration couple.

[0136] Example 9: eAPC-pa constructed in one step from eAPC-p, with component D' encoding a single analyte antigen molecule (aAM) ORF This example describes a method for constructing multiple eAPC-pa in parallel from parental eAPC-p (described in Example 8), in which a genomic acceptor site (component D) is targeted for integration with a primed gene donor vector (component E' comprising a single ORF encoding an aAM). In this example, the parental eAPC-p line used contained a single aAPX (HLA-A) integrated into component B'. * The eAPC-p component D was ACL-900 expressing the HCMV-specific αAM (V9.E.02:01) (described in Example 8). The eAPC-p component D remained open and contained two unique heterospecific recombinase sites, FRT and F3, flanking an ORF encoding the selectable marker blue fluorescent protein (BFP). The 5'-side of the FRT site encoded the EF1a promoter, and the 3'-side of the F15 site encoded the SV40 polyadenylation signal terminator. In this example, the gene donor vector component E was used, which contained two heterospecific recombinase sites, F14 and F15, and thus matched component D. In this example, component E was further primed with one aAM ORF of interest selected from HCMVpp28 (V9.E.6), HCMVpp52 (V9.E.7), or HCMVpp65 (V9.E.8), each of which encodes a c-myc tag at the C-terminus. Additionally, each component E' further contains a Kozak sequence and a start codon immediately 5' to the aAM ORF. Thus, a small, separate library of components E' containing three vectors was generated.

[0137] eAPC-p (ACL-900, Example 8) was independently combined by electroporation with vectors encoding the RMCE recombinase enzyme (Flp, V4.1.8) and expression of component E', V9.E.6, V9.E.7, or V9.E.8. After incubating the cells for 4–10 days to allow integration couples to form, individual eAPC-pA were selected, and single cells (monoclones) were selected based on a decrease in the signal of the selectable marker BFP, encoded by component D (Figure 44a). Subsequently, larger individual monoclonal eAPC-pA, ACL-1219 (pp28), ACL-1227 (pp52), and ACL-1233 (pp65), were characterized and confirmed, and selected based on the loss of BFP expression and the maintained surface expression of HLAI (aAPX for component B'), indicating the expected conversion of component D to D' (Figure 44b). Furthermore, the maintained surface expression of aAPX indicated that component B' was unaffected by and isolated from the integration coupling event between components D and E'. To further characterize the selected eAPC-pa monoclones, genomic DNA was extracted, and confirmation of the integration coupling between components E' and D (resulting in component D') was performed by detecting a polymerase chain reaction (PCR) amplicon product specific for component D'. Figure 44c shows two monoclones from each of the three eAPC-pa. Here, amplicon products of the expected size were observed for the aAM ORFs pp28 (0.8 kb), pp52 (1.5 kb), and pp65 (1.9 kb), further confirming that the expected integration events had occurred. In summary, this example demonstrates three specific examples of eAPC-p to eAPC-pa conversion using a multicomponent system. Here, three different aAMs are delivered individually (component E') and integrated into a single genomic acceptor site (component D) via RMCE genomic integration, generating a small library of three distinct eAPC-pas carrying three different aAM ORFs. Furthermore, the loaded second genomic acceptor site (component B') was shown to be isolated and unaffected by the component D / component E' integration couple.

[0138] Example 10: Shotgun integration of multiple analyte antigen molecule ORFs into eAPC-p to generate a pooled eAPC-p library in a single step This example describes a method for integrating a pool of primed component E vectors (component E') that collectively encode multiple aAM ORFs (HCMVpp28, HCMVpp52, and HCMVpp65) into parental eAPC-p (described in Example 8) in a single step to generate a pooled eAPC-p library. Here, each individual cell integrates a single random analyte antigen ORF derived from the original vector pool at component D', such that each eAPC-p expresses a single random aAM, but the pooled library of eAPC-p collectively represents all of the aAM ORFs encoded in the original pooled vector library. This method of generating a pool of eAPC-p, each expressing a single random ORF derived from the vector pool, is referred to as shotgun integration. In this example, the parental eAPC-p line used was aAPX (HLA-A * The cell line was ACL-905, which expresses a AM ORF (V9.E.02:01) on its cell surface (construction of the cell line is described in Example 8), and component D and component E' were as described in Example 9. In this example, the individual component E' vectors V9.E.6, V9.E.7, and V9.E.8 from Example 9, which contain aAM ORFs encoding HCMVpp28, HCMVpp52, and HCMVpp65, respectively, were mixed together at a molar ratio of 1:1:1 to generate a vector pool. eAPC-p (ACL-905) was combined with the vector pool and a vector encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) by electroporation. After incubating the cells for 4 to 10 days, they were bulk-sorted based on a decrease in the signal of the selectable marker for integration, BFP, encoded by component D (Figure 45a), to generate the pooled cell population ACL-1050 (Figure 45b).

[0139] To confirm that eAPC-pa pool ACL-1050 is composed of a mixture of eAPC-pas, each encoding one of HCMVpp28, HCMVpp52, or HCMVpp65 in component D', individual cells were single-cell sorted from the polyclonal population, and 12 cells were randomly selected for genetic characterization. Amplification of component D' was performed using primers spanning each aAM (Table 5, Figure 45c). Figure 45c shows the amplicons generated for the 12 cells, along with the control. Here, a single amplicon product consistent with the expected size for one of the aAM ORFs pp28 (0.8 kb), pp52 (1.5 kb), and pp65 (1.9 kb) was observed for all 12 cells. Furthermore, each aAM ORF was identified at least once. This indicates that the eAPC-pa pool is composed of a mixture of eAPC-pa, each of which incorporates a single random aAM ORF from the original pool of three vectors. In conclusion, this example demonstrates the use of a multicomponent system for the single-step conversion of eAPC-p into a pooled library of eAPC-pa by combining eAPC-p with a pooled library of three vectors (component E') encoding three different analyte antigen molecules and utilizing an RMCE-based shotgun integration approach. Furthermore, this example demonstrates that each eAPC-pa in the resulting eAPC-pa pool incorporates a single random aAM ORF from the original vector pool via an integration couple event between component D and component E', and that all three aAM ORFs are represented in the resulting pooled eAPC-p library.

[0140] Example 11: Demonstration of two eAPC:T systems for eAPC-pa-induced antigen-specific proliferation of primary CD8 cells This example describes the construction and use of two different eAPC:T systems. The first system is composed of eAPC-p, exogenously provided aAM (which produces aAPX:aAM presented by the eAPC-p), and analyte primary T cells (analyte TCs). The second system is composed of eAPC-pa presenting aAPX:aAM and analyte primary T cells (analyte TCs). Using the eAPC:T systems, analyte TCs bearing TCRs capable of responding to the analyte antigen (aAPX:aAM) are identified and selected by detecting proliferation and growth of the analyte TCs. In this example, we monitored the induced proliferation of antigen-specific CD8+ T cells from a CD8+ T cell population, where aAPX is HLA-A * The aAM was 02:01 (HLA class I) and the aAM was the peptide NLVPMVATV. In the eAPC-p system, the aAM was exogenously provided, whereas in the eAPC-pa system, the aAM was naturally processed from the integrated analyte antigen ORF (HCMVpp65). The cell lines used were eAPC-p (ACL-191) and eAPC-pa (ACL-390), described in Examples 8 and 9, respectively. Analyte TC CD8+ T cells were isolated from healthy blood donors known to have CD8+ T cells specific for the NLVPMVATV peptide, as described in "Materials and Methods." In the first eAPC:T system, eAPC-p (ACL-191) cells were pulsed with exogenous NLVP PMVATV (SEQ ID NO: 3) peptide at a peptide concentration of 1 μM for 4 hours, as described in "Materials and Methods." The eAPC:T system was then established by combining the pulsed eAPC-p cells with analyte TCRs (bulk-sorted CD8+ T cells) and co-culturing them under standard conditions. After 9 days of co-culture, the cells were analyzed for cells that formed cooperative complexes between the analyte antigen and the analyte TCR by specific staining with CMV-A.0201-NLVP tetramer (aAPX:aAM as a soluble reactant), and antigen-specific T cell proliferation was detected by flow cytometry. The eAPC:T system containing unpulsed ACL-191 cells (no aAM) or pulsed HLA-null ACL-128 (no aAPX) cells or unpulsed HLA-null ACL-128 cells (aAPX:no aAM) was compared. * Significant proliferation of analyte TCs (CD8+ T cells), confirmed by 02:01-NLVP tetramer staining, was observed only in the eAPC:T system containing eAPC-p cells pulsed with NLVP PMVATV (Figure 46a).

[0141] A second eAPC:T system was established by combining eAPC-pa (ACL-390) cells with analyte TCs (bulk-sorted CD8+ T cells) and co-culturing them under standard conditions (see Materials and Methods). As with the first system, the co-cultured cells were harvested and analyzed for analyte antigen and analyte TCR-induced cell migration by specific staining with CMV-A.0201-NLVP tetramers (aAPX:aAM as soluble reagents). Figure 46b shows the PP65 ORF (aAM) and aAPX (HLA-A *We demonstrate antigen-specific proliferation of primary CD8+ T cells cocultured with eAPC-pa(ACL-390) cells stably expressing the pp65 ORF (ACL-191) and thus presenting aAPX:aAM. This was compared with two other eAPC:T systems, including eAPC-p(ACL-191) cells with and without stable expression of the pp65 ORF and HLA-null ACL-128 cells. The proliferation of CD8+ T cells specific for aAPX:aAM presented by eAPC-pa was identified by CMV-A.0201-NLVP tetramer staining only in the eAPC:T system containing eAPC-pa(ACL-390). In summary, this example demonstrates the use of eAPC-p and eAPC-pa cells in an organized eAPC-T system capable of selectively expanding analyte TCs (CD8+ T cells) for the identification and selection of analyte TCs bearing an analyte TCR that allows T cell stimulation by the presented analyte antigen (aAPX:aAM). Furthermore, two eAPC:T systems demonstrate the use of different forms of aAPX:aAM, where in one system the aAM is provided exogenously and in the second system the aAM is provided by processing by native cellular machinery from the expressed, integrated analyte antigen ORF of eAPC-pa.

[0142] Example 12: Demonstration of the eAPC:T system for eAPC-pa-induced antigen-specific proliferation of primary CD4 cells This example describes the construction and use of an eAPC:T system, which is composed of eAPC-p, exogenously provided aAMs (which produce aAPX:aAMs presented by the eAPC-p), and analyte primary T cells (analyte TCs). Using the eAPC:T system, analyte TCs bearing TCRs capable of responding to the analyte antigen (aAPX:aAM) and analyte TCRs were identified and selected by detecting proliferation and growth of specific analyte TCs. In this example, a specific aAPX:AM (aAPX is HLA-DRB1 *Induced proliferation of antigen-specific CD4+ T cells from a CD4+ T cell population by exogenously provided 01:01 (HLA class II) aAM, the peptide PKYVKQNTLKLAT (SEQ ID NO: 1). The cell line used was eAPC-p(ACL-341), constructed in a manner similar to that described in Examples 8 and 9. Analyte TC CD4+ T cells were isolated from a healthy blood donor known to have CD4+ T cells specific for the PKYVKQNTLKLAT peptide, as described in the Materials and Methods section.

[0143] In this example, eAPC-p (ACL-341) cells were pulsed with exogenous PKYVKQNTLKLAT (SEQ ID NO: 1) peptide at a peptide concentration of 1 μM for 2 hours as described in the "Materials and Methods" section. The eAPC:T system was generated by combining pulsed eAPC-p cells with analyte TCs (bulk-sorted CD4+ T cells) and co-culturing them under standard conditions. After 7 days of co-culture, the cells were analyzed. The cells induced by the presented aAPX:aAM were analyzed for INFL-DRB1 expression. * Antigen-specific T cell proliferation was detected by flow cytometry, analyzed by specific staining with 01:01-PKYV tetramer (aAPX:aAM as a soluble reactant), and compared with eAPC:T systems containing unpulsed ACL-341 cells (aAPX:CM). Significant proliferation of analyte TCs (CD4+ T cells), confirmed by CMV-A.0201-NLVP tetramer staining as specific for the PKYVKQNTLKLAT (SEQ ID NO: 1) peptide, was observed only in eAPC:T systems containing eAPC-p cells pulsed with PKYVKQNTLKLAT (Figure 47). In conclusion, this example demonstrates the use of HLA class II-based eAPC-p organized into an eAPC:T system capable of selectively expanding analyte TCs (CD4+ T cells) for the identification and selection of analyte TCs bearing analyte TCRs that form cooperative complexes with presented analyte antigens (aAPX:aAM).

[0144] Example 13: Antigen-specific cells induced by eAPC-pa by co-cultured primary CD8 cells Evidence for eAPC:T toxic effects This example describes the construction and use of two different eAPC:T systems. The first system is composed of eAPC-p, exogenously provided aAM (which produces aAPX:aAM presented by the eAPC-p), and analyte primary T cells (analyte TCs). The second system is composed of eAPC-pa presenting aAPX:aAM and analyte primary T cells (analyte TCs). Using the eAPC:T systems, the specificity of the analyte TCs for the presented analyte antigen (aAPX:aAM) was confirmed by detecting the cytotoxic effect of the analyte TCs on eAPC-p or -pa. In this example, we demonstrate the cytotoxic effect of antigen-specific CD8+ T cells derived from a CD8+ T cell population that form a cooperative complex between the analyte TCR and aAPX:AM, where aAPX is associated with HLA-A * 02:01 (HLA class I), and the aAM is the peptide NLVPMVATV (SEQ ID NO: 3). In the system composed of eAPC-p, the aAM is exogenously provided, whereas in the system composed of eAPC-pa, the aAM is naturally processed from the integrated analyte antigen ORF (HCMVpp65). The cell lines used were eAPC-p (ACL-191) and eAPC-pa (ACL-390), described in Examples 8 and 9, respectively. Analyte TC CD8+ T cells were isolated from healthy blood donors known to have CD8+ T cells specific for the NLVPMVATV peptide, as described in "Materials and Methods." In the first eAPC:T system, eAPC-p (ACL-191) cells were pulsed with exogenous NLVPMVATV peptide at a peptide concentration of 1 μM for 2 hours, as described in Materials and Methods. eAPC:T systems were then established by combining pulsed eAPC-p cells with analyte TCRs (bulk-sorted CD8+ T cells) and co-culturing them under standard conditions. Co-cultured cells were analyzed for cooperative complexes between the analyte antigen and the analyte TCR by Annexin V and PI staining and by assessing eAPC-p cell killing by flow cytometry. Comparisons were made with eAPC:T systems containing pulsed HLA-null ACL-128 cells (without aAPX) or unpulsed HLA-null ACL-128 cells (without aAPX:aAM). A significant cytotoxic effect by the analyte TC (CD8+ T cells) is confirmed only in the eAPC:T system containing eAPC-p cells pulsed with NLVPMVATV (FIG. 48a).

[0145] A second eAPC:T system was established by combining eAPC-pa (ACL-390) cells with analyte TCs (bulk-sorted CD8+ T cells) and co-culturing them under standard conditions. As with the first system, the co-cultured cells were harvested and analyzed for cooperative complexes between the analyte antigen and the analyte TCR by Annexin V and PI staining and by assessing eAPC-pa cell killing by flow cytometry. Figure 48b shows the interaction of pp65 ORF (aAM, component D') and aAPX (HLA-A * This study demonstrates the antigen-specific cytotoxicity of primary CD8+ T cells cocultured with eAPC-pa(ACL-390) cells stably expressing PP65 ORF (component B') and thus presenting aAPX:aAM. Comparisons were made with two other eAPC:T systems, including eAPC-p(ACL-191) cells lacking stable expression of the pp65 ORF (without aAM) and HLA-null ACL-128 cells (without aAPX:aAM). The antigen-specific cytotoxicity of CD8+ T cells specific for aAPX:aAM presented by eAPC-pa was observed only in the eAPC:T system containing eAPC-pa(ACL-390). In conclusion, this example demonstrates the use of eAPC-p and eAPC-pa cells in an organized eAPC-T system capable of selectively inducing cytotoxic effects by analyte TCs (CD8+ T cells) for the identification and selection of analyte TCs bearing an analyte TCR that forms a cooperative complex with a presented analyte antigen (aAPX:aAM). Furthermore, two eAPC:T systems demonstrate the use of different forms of aAPX:aAM, where in one system the aAM is provided exogenously and in the second system the aAM is provided by processing by the native cellular machinery from the expressed, integrated analyte antigen ORF of eAPC-pa.

[0146] Example 14: Identification of aAM loaded onto eAPC-p by mass spectrometry This example describes the use of eAPC-p challenged with exogenous analyte antigen molecules (aAM), where the aAPX:aAM complexes are subsequently captured by metal affinity chromatography and the aAM cargo is identified by mass spectrometry, thereby identifying the aAPX:aAM as containing the aAM, i.e., HLA-restricted presentation of the antigenic peptide. This example uses the eAPC-p cell line of Example 8. Here, the eAPC-p has aAPX incorporated into component B' (ACL-900 (HLA-A * 02:01) and ACL-963 (HLA-A * 24:02). The aAPX ORF also encodes a 6x histidine tag at the C-terminus for capture by metal affinity chromatography. eAPC-p were pulsed with peptides at a concentration of 1 μM in combination with exogenous aAM for 2 hours. Four separate pulses were performed, consisting of one of the following aAMs as the peptide: NLVPMVATV (APD-2, SEQ ID NO: 3), NLGPMAAGV (APD-21, SEQ ID NO: 4), or VYALPLKML (APD-11, SEQ ID NO: 5), or no peptide. After pulsing, eAPC-p were harvested and lysed, and then aAPX:aAM were captured by metal affinity chromatography as described in Materials and Methods. After capture, the peptides (aAM and CM) were isolated from aAPX, acid washed, and filtered. The peptide fractions were then subjected to liquid extraction and removal of the organic phase, followed by solid-phase extraction and mass spectrometry for identification of the peptide fractions.

[0147] Figure 49 shows a table summarizing the mass spectrometry results of different eAPC-p / aAM pulse combinations. The results show that peptides NLVPMVATV and VYALPLKML bind to aAPX HLA-A, respectively. * 02:01 and aAPX HLA-A * We show that aAPX:aAM binds to and forms a complex with 24:01, whereas all other aAPX:aAM combinations fail to form detectable aAPX:aM complexes, consistent with the known peptide-HLA binding affinities of the three peptides. In conclusion, this example demonstrates that eAPC-p can be used to identify selective binding of aAM to aAPX by aAPX:aAM capture, and subsequent release and enrichment of aAM for identification by mass spectrometry, thus demonstrating that eAPC-p can be used to determine HLA-restricted presentation of analyte antigenic molecules.

[0148] SEQUENCE LISTING <110> Genovie AB <120> An Engineered Multi-component System for Identification and Characterization of T-cell receptors and T-cell antigens <130> P018243PCT1 <160> 72 <170> BiSSAP 1.3 <210> 1 <223> Analyte Antigenic Molecule <210> 2 <223> Analyte Antigenic Molecule <210> 3 <223> Analyte Antigenic Molecule, APD-2 <210> 4 <223> Analyte Antigenic Molecule, APD-21 <210> 5 <223> Analyte Antigenic Molecule, APD-11 <210> 6 <223> V1.A.4 pcDNA3.1_GFP <210> 7 <223> SpCas9-2A-GFP Vector V1.A.8 <210> 8 <223> pMA-SV40pA vector V1.C.2 <210> 9 <223> HLA-A 02:01 6xHis + Exon2 / 3-HA-L+R vector V1.C.6 <210> 10 <223> HLA-B 35:01 6xHis + Exon2 / 3-HA-L+R vector V1.C.9 <210> 11 <223> AAVS1-S_A24_6xH vector V1.F.8 <210> 12 <223> AAVS1-L_B07_6xH vector V1.F.10 <210> 13 <223> AAVS1-l_GFP_HCMVpp65_WT vector V1.G.10 <210> 14 <223> AAVS1-l_GFP_HCMVpp65 ANET vector V1.G.9 <210> 15 <223> AAVS1-l_GFP_HCMVpp65 AIN vector V1.H.1 <210> 16 <223> AAVS1_DRA_Flag-DRB1_6xHis vector V1.I.5 <210> 17 <223> AAVS1_DPA1_Flag-DPB1_6xHis vector V1.I.7 <210> 18 <223> HLA-A-sg-sp-opti1 vector V2.A.1 <210> 19 <223> HLA-B-sg-sp-3 vector V2.A.7 <210> 20 <223> HLA-C-sg-sp-4 vector V2.B.3 <210> 21 <223> HLA-A-ex2-3_sg-sp-opti_1 vector V2.I.10 <210> 22 <223> HLA-A-ex2-3_sg-sp-opti_2 vector V2.J.1 <210> 23 <223> AAVSI_sg-sp-opti_3 vector V2.J.6 <210> 24 <223> AAVS_Efla-intron_F14_RFPnls_F15 vector V4.B.2 <210> 25 <223> AAVS_Efla-intron_FRT_BFPnls_F3 vector V4.B.3 <210> 26 <223> pMA_FRT_HLA-A*02:01-6xHis_F3 vector V4.D.2 <210> 27 <223> pMA_F14_HLA-A*02:01-6xHis_F15 vector V4.H.5 <210> 28 <223> pMA_F14_HLA-A*24:02-6xHis_F15 vector V4.H.6 <210> 29 <223> pMA_F14_HLA-B*07:02-6xHis_F15 vector V4.H.7 <210> 30 <223> pMA_F14_HLA-B*35:01-6xHis_F15 vector V4.H.8 <210> 31 <223> CMVpro_FLP_Sv40pA_V2 vector V4.1.8 <210> 32 <223> FRT_HCMVpp28-3xMYC_F3 vector V9.E.6 <210> 33 <223> FRT_HCMVpp52-3xMYC_F3 vector V9.E.7 <210> 34 <223> FRT_HCMVpp52-3xMYC_F3 vector V9.E.8 <210> 35 <223> pMA-sv40_OE_F1 primer 1.C.2 <210> 36 <223> pMA-sv40_OE_R1 primer 1.C.3 <210> 37 <223> HLA-A-GT-Rg3 primer 4.A.3 1 <210> 38 <223> HLA-A-GT-Fg2 primer 4.A.4 <210> 39 <223> HLA-B-GT-Fg2 primer 4.A.7 <210> 40 <223> HLA-B-GT-Rg2 primer 4.B.1 <210> 41 <223> HLA-C-GT-Fg2 primer 4.B.5 <210> 42 <223> HLA-A-02_GT_Rg4 primer 4.I.9 <210> 43 <223> HLA-A-Exon3_HA-RE-BglII_F1 primer 6.I.9 <210> 44 <223> HLA-C-04-GT-Rg1 primer 8.A.1 <210> 45 <223> CMV-pA-HLA-Ex3_Probe_F1 primer 8.B.2 <210> 46 <223> CMV-pro_GT_R1 primer 9.C.3 <210> 47 <223> sv40pA_GT_F1 primer 9.C.4 <210> 48 <223> AAVS1_GT_F1 primer 9.C.5 <210> 49 <223> AAVS1_GT_F3 primer 9.C.7 <210> 50 <223> AAVS1_GT_F4 primer 9.C.8 <210> 51 <223> AAVS1_GT_R2 primer 9.C.10 <210> 52 <223> AAVS1_GT_R3 primer 9.D.1 <210> 53 <223> AAVS1_GT_R4 primer 9.D.2 <210> 54 <223> HLA-A-intron4_GT_R1 primer 9.D.6 <210> 55 <223> sv40pA-GT primer 9.D.7 <210> 56 <223> sv40pA-AAVS1-probe-FAM-F1 primer 9.J.2 <210> 57 <223> TRAC_TCRA-ex1_R1 primer 10.A.9 <210> 58 <223> TRAC_TCRA-promoter_F1 primer 10.A.10 <210> 59 <223> TRAC_probe (HEX) primer 10.B.6 <210> 60 <223> Pan-HLA_GT_F1 primer 8.B.3 <210> 61 <223> SV40pA_GT_R1 primer 15.H.2 <210> 62 <223> 3xMyc_OE_R1 primer 10.C.4 <210> 63 <223> CtermCysLink_OE_R1 primer 10.D.1 <210> 64 <223> Ef1a_intron_GT_F2 primer 15.H.4 <210> 65 <223> HCMVpp65_GT_F2ddPCR primer / probe 21.I.1 <210> 66 <223> HCMVpp28_GT_F1 ddPCR primer / probe 21.I.2 <210> 67 <223> HCMVpp52_GT_F1 ddPCR primer / probe 21.I.3 <210> 68 <223> Myc-Tag_GT_R1 ddPCR primer / probe 20.H.10 <210> 69 <223> Linker-Myc_Probe_Fam ddPCR primer / probe 20.H.9 <210> 70 <223> TRAC-TCRA-ex1-F1 ddPCR primer / probe 10.A.9 <210> 71 <223> TRAC-TCRA-ex1-F1 ddPCR primer / probe <210> 72 <223> TRAC-probe (HEX) ddPCR primer / probe

[0149] List of Abbreviations aAPX Analyte Antigen Presenting Complex aAM Analyte antigenic molecule APC antigen presenting cells APX antigen presenting complex BFP Blue Fluorescent Protein CAR-T CAR T cells CM cargo molecule CRISPR Clustered Regularly Interspaced Short Palindromic Repeats gRNA Cas9 guide RNA

[0150] CAR chimeric antigen receptor CDR Complementarity Determining Region C region Steady region CMV cytomegalovirus DAMPS Danger Associated Molecular Patterns DC dendritic cells DNA deoxyribonucleic acid D Area Diversity Area eAPCs Genetically engineered antigen-presenting cells eAPC-p: Genetically engineered antigen-presenting cells that present the analyte antigen-presenting complex

[0151] eAPC-pa: a genetically engineered antigen-presenting cell that presents the analyte antigen-presenting complex and the analyte antigenic molecule. eAPC-a: Genetically engineered antigen-presenting cells that express the analyte antigenic molecule eAPC:T eAPC:TCR system in which an analyte eAPC is combined with an analyte TCR FACS Fluorescence-activated cell sorting GEM T cells: germline-encoded mycolyl-reactive T cells GFP Green Fluorescent Protein HLAI HLA class I HLAII HLA class II HDR homology-directed recombination HLA human leukocyte antigen IgSF immunoglobulin superfamily

[0152] IRES internal ribosome entry site iNK T cells Invariant natural killer T cells J area Consolidated area MACS magnetically activated cell sorting MAGE melanoma-associated antigens MAIT mucosa-associated invariant T NCBP Non-Cell-Based Particles ORF Open Reading Frame PAMPS Pathogen-Associated Molecular Patterns PCR polymerase chain reaction

[0153] RMCE Recombinase-Mediated Cassette Exchange RFP Red Fluorescent Protein DNA ribonucleic acid SH2 Src homology 2 T cell T lymphocyte Cells presenting TCR or TCR mimetic affinity reagents TCR T cell receptor TRA TCRα TRB TCRβ TRD TCRδ

[0154] TCRsp TCR surface protein complexed with CD3 TALEN transcription activator-like effector nucleases TRG TRCγ TAA tumor-associated antigen V region variable region β2M β2-microglobulin ZAP-70 70 kDa ζ-chain associated protein

[0155] definition Complementary TCR chain pair: two TCR chains whose translated proteins are capable of forming a TCRsp on the surface of a TCR-presenting cell. affinity dynamic or equilibrium parameter of the interaction between two or more molecules or proteins Affinity Reagent: Any reagent designed to have specific affinity for an analyte. Often used for affinity for HLA-antigen complexes. Allele: A variant form of a given gene. AM: Analyte antigenic molecule. Generally, it is a protein expressed by cells from genomic DNA and / or specific transgene sequences, but it can also be a metabolic product. AMs are expressed in cells, and fragments can then be presented on the cell surface by APX or by themselves as cargo. Whether as cargo or not, AMs can then be targeted by T cell receptor-bearing cells or associated affinity reactants. Amplicon: A piece of DNA or RNA that is the source and / or product of artificial amplification using various methods, including PCR.

[0156] Analyte: A substance of interest that is identified and / or measured and / or interrogated in a combination system. Analyte TC: An analyte cell that displays an analyte TCR on its surface, which can be a primary T cell, a recombinant T cell, or a genetically engineered TCR-presenting cell. Analyte TCR: A TCRsp or TCR mimetic affinity reactant provided in the form of a soluble reactant, an immobilized reactant, presented by an NCBP, or presented on a cell surface. Antigen: Any molecule that can be bound by a TCR, resulting in a signal that is transduced within a T cell, and presented by an antigen-presenting complex. Analyte Antigen: Collectively refers to any substance that presents an antigen for analytical determination in the eAPC:T system. Antibody: A two-chain affinity molecule expressed by specialized cells of the immune system called B cells. B cells express a large and highly diverse repertoire of antibodies that generally do not bind to self-proteins but can bind to and neutralize pathogens or toxins that threaten the host. Natural or artificially engineered antibodies are often used as affinity reactants. APC: Antigen-presenting cell. A cell that carries AM, APX, and APX on its surface. APX: Antigen-presenting complex. Proteins expressed and presented at the cell surface by nucleated cells from genes / ORFs encoding genomic DNA and / or specific transgene sequences. APX presents cargo that can be peptides or other metabolite molecules. C region: Constant region. One of the gene segments used to assemble a T cell receptor. The c region is a distinct segment that does not drive TCR diversity but rather determines its overall function in the immune system.

[0157] Cargo loading apparatus: A set of cellular proteins that generate and load cargo molecules onto APX from proteins or other displayed molecules found in the cell. CDR: Complementarity Determining Region. Short sequences at the antigen-facing ends of TCRs and antibodies that perform most of the target binding function. Each antibody and TCR contains six CDRs, which are generally the most variable parts of the molecule, allowing for the detection of a large number of different target molecules. CM: cargo molecule. A peptide or metabolite presented by an antigen-presenting complex, such as HLA I or HLA II. CM can be expressed by cells inherently from genomic DNA, or from gene sequences introduced into the culture medium or specifically introduced. Copy number: The total number of occurrences of a defined sequence encoded within a cell's genome. Cytogenetic: The genetics of chromosome structure and function; i.e., the determination of a cell's karyotype. Cytotoxicity / Cytotoxicity: The process by which T cells release factors that directly and specifically damage target cells. D region: Diversity region. One of the gene segments used to assemble the T cell receptor. Each individual has many different variations of these regions, allowing each individual to be armed with T cells with a wide variety of different TCRs. DNA: Deoxyribonucleic acid, the chemical name for the molecules that make up the genetic material that codes for genes and proteins. eAPC:TCR system: an eTPC:T system in which an analyte eAPC is combined with an analyte TCR to provide a primary and terminal output. Endogenous: Substances that originate within the cell.

[0158] Genetically engineered cells: modified cells whose genomes have been genetically altered through genetic modification. eukaryotic conditional regulatory element DNA sequence that can affect the activity of a promoter, either induced or repressed under defined conditions Eukaryotic promoter: A DNA sequence that encodes an RNA polymerase binding site and response elements. The sequence of the promoter region controls the binding of RNA polymerase and transcription factors, and therefore the promoter plays a major role in determining where and when a gene of interest is expressed. Eukaryotic terminator / signal terminator: DNA sequence recognized by a protein factor that binds to RNA polymerase II and triggers the transcription termination process. It also encodes a polyA signal. FACS / Flow Cytometry: Fluorescence-activated cell sorting. An analytical technique in which individual cells can be analyzed for the expression of specific cell surface and intracellular markers. A variation of this technique, cell sorting, allows cells bearing a defined set of markers to be recovered for further analysis. APX family: A set of several similar genes that encode functionally related proteins that constitute antigen-presenting complexes. Fluorescent (protein) marker: A molecule that has specific quenching and emission characteristics and can be detected by microscopy, FACS, and related techniques. Gene donor vector: A gene-based vector for delivering genetic material to a genomic recipient site.

[0159] Genomic acceptor site: A site within the genome for targeted integration of donor genetic material encoded in a gene donor vector. Heterospecific recombinase site: A DNA sequence recognized by a recombinase enzyme to promote the crossover of two DNA molecules. HLA I: Human Leukocyte Antigen Class I. A gene expressed in all nucleated cells in humans. Expressed HLA I is transported to the cell surface, where it presents short fragments of internal proteins, peptides, as cargo to T cell receptors. In this way, it presents fragments of unique proteins that may be involved in ongoing infection. HLA I can also present peptides as cargo that are added to the culture medium, generated from proteins expressed from transgene elements, or generated from proteins taken up by the cell. HLA class I genes are polymorphic, meaning that different individuals may have variations in the same gene that lead to variations in presentation. Related to HLA class II. HLA II: Human Leukocyte Antigen Class II. A gene expressed in specific cells (e.g., dendritic cells) that coordinate and support the adaptive immune response in humans. It is related to HLA Class I. HLA Class II proteins are transported to the cell surface, where they present short fragments of foreign proteins, peptides, as cargo to T cell receptors. In this way, they present fragments of unique proteins that may be present in an ongoing infection. In addition, HLA II can present peptides as cargo generated from proteins added to the culture medium, expressed from transgene elements, or taken up by the cell. HLA Class II genes are polymorphic, meaning that different individuals may have variations in the same gene that lead to variations in presentation.

[0160] Homologous arm: A stretch of DNA that has nearly identical sequence identity to a complementary homologous arm, thus facilitating the exchange of two DNA molecules by the cellular process of homology-directed repair. Immunosurveillance: The process by which the immune system detects and is activated by infection, malignancy, or other potentially pathogenic changes. Insulator: a DNA sequence that prevents genes from being affected by the activation or repression of nearby genes. Insulators also prevent heterochromatin from spreading from silenced genes to actively transcribed genes. Integration: The physical ligation of a DNA sequence into a cell's chromosome. Integration couple: paired integration vector and genomic acceptor site Internal ribosome entry site (IRES): A DNA sequence that encodes an RNA element that, when transcribed, allows for the initiation of translation in a cap-independent manner. J region: Joining region. One of the gene segments used to assemble the T cell receptor. Each individual has many different variations of these regions, allowing each individual to be armed with T cells with a wide variety of different TCRs. Karyotype: The chromosomal composition of a cell. Kozak sequence: a short sequence required for efficient initiation of translation

[0161] Major HLA class I: A family of APXs composed of the genes HLA-A, HLA-B and HLA-C. Matched: When two components encode genetic elements that guide and restrict interactions between complementary components. meganuclease recognition site: DNA sequence recognized by endodeoxyribonucleases commonly called meganucleases metabolite molecule produced or modified by a cell's metabolic pathways Mobile genetic element: A DNA sequence that allows the integration of DNA with the activity of a transposase enzyme. Monoclonal cell line: A defined population of cells generated from a single founder cell by repeated cell replication. Native: A substance that occurs naturally in cells. Non-coding gene: a non-protein-coding DNA sequence that is transcribed into a functional non-coding RNA molecule. ORF: Open Reading Frame. A stretch of genetic material that encodes the translation frame for the synthesis of a protein (polypeptide) by ribosomes. Paracrine: Signaling by soluble factors that act directly on nearby cells.

[0162] PCR polymerase chain reaction in which specific target DNA molecules are exponentially amplified Peptide: A short stretch of amino acids between 6 and 30 amino acids in length. Phenotypic analysis: analysis of the observable characteristics of cells. Polymorphism: the existence of different forms in individuals of the same species due to the presence of different alleles of the same gene. Polypeptide: A protein consisting of a series of peptides that form a three-dimensional structure. Primary output: eAPC cells, analyte TCR cells, NCBPs or other analyte TCR forms that can induce and / or determine terminal output. Primer: A short DNA sequence that allows for specific recognition of a target DNA sequence, for example during PCR. Promoter: A regulatory DNA element for the controlled initiation of gene expression. Selectable marker: A DNA sequence that confers a trait suitable for artificial selection methods. Shotgun integration: A process in which a library of vectors is introduced into a cell population such that only a single copy of any given vector insert can be integrated into the genome of each single cell. Used to refer to the integration of pooled vectors into a given cell population via integration couples.

[0163] Splice acceptor site: A DNA sequence at the 3' end of an intron AM, APX CM, or affinity reagent for interaction with cells bearing TCRsp on their surface or with TCRsp-based reagents. Splice donor site: DNA sequence at the 5' end of an intron. Synthetic: A substance produced or introduced into a cell artificially. T cell: T lymphocyte. A white blood cell that expresses a T cell receptor on its surface. It is selected by the immune system for its ability to not react with self, but to recognize infection and malignant disease and to reject grafts from most members of the same species. TCR: T cell receptor. An affinity molecule expressed by a subpopulation of lymphocytes called T lymphocytes. TCR mimetic affinity reactant: A protein or molecule that is capable of interacting with and binding to an analyte antigen in a manner that mimics a native TCRsp. TCRsp: A complementary TCR chain pair expressed as a surface protein in complex with CD3, or as a protein in the form of a soluble or immobilized reagent, or as a protein presented by an NCBP. Terminal output: Analyte antigen and TCR sequence in the form of AM, APX, APX:CM, APX:AM, TCRsp or TCR mimetic affinity reactant.

[0164] TRA: TCRα-encoding locus. One of four distinct loci that encode genes capable of forming VDJ recombined TCR chains. The translated TCRα chain protein typically pairs with the translated TCRβ chain protein to form the α / βTCRsp. TRB: TCRβ-encoding locus. One of four distinct loci that encode genes capable of forming VDJ recombined TCR chains. The translated TCRβ chain protein typically pairs with a TCRα chain protein to form an α / β TCRsp. TRD: TCR delta-encoding locus. One of four distinct loci that encode genes capable of forming VDJ recombined TCR chains. The translated TCR delta chain protein typically pairs with the translated TCR gamma chain protein to form the gamma / delta TCRsp. TRG: TCRγ-encoding locus. One of four distinct loci that encode genes capable of forming VDJ recombined TCR chains. The translated TCRγ chain protein typically pairs with the transcribed TCRδ chain protein to form the γ / δTCRsp. V region: Variable region. One of the gene segments used to assemble a T cell receptor. Each individual has many different variations of these regions, allowing each individual to be armed with T cells with a wide variety of different TCRs.

[0165] The present invention is further described in the following sections: item 1. A multi-component system in which the first component is a genetically engineered antigen-presenting cell (eAPC) (designated component A) and the second component is a gene donor vector for delivery of one or more ORFs encoding an analyte antigen-presenting complex (aAPX) and / or an analyte antigenic molecule (aAM) (designated component C). 2. Component A is a. lacking endogenous surface expression of at least one family of aAPX and / or aAM; b. Contains at least one genomic integration site (designated component B) for the integration of at least one ORF encoding at least aAPX and / or aAM. Item 1. The multi-component system according to item 1. 3. Component C matches component B, and component C a. a single ORF encoding at least one aAPX and / or aAM, and / or b. two or more ORFs encoding at least one aAPX and / or aAM wherein a and / or b may or may not encode a selectable marker for integration such that said ORF can be stably integrated into a B genome acceptor site and aAPX and / or aAM are expressed. 4. A delivery site for eAPC (referred to as component A) and one or more ORFs encoding aAPX and / or aAM. and a gene donor vector (referred to as component C), wherein component A is a. lacking endogenous surface expression of at least one family of aAPX and / or aAM; b. contains at least one genomic integration site (designated component B) for the integration of at least one ORF encoding at least one aAPX and / or aAM; Component C matches component B, and component C c. a single ORF encoding at least one aAPX and / or aAM; or d. two or more ORFs encoding at least one aAPX and / or aAM wherein c and / or d may or may not encode a selectable marker for integration such that the ORF can be stably integrated into a B genome acceptor site and aAPX and / or aAM are expressed.

[0166] 5. A multicomponent system according to any one of items 1 to 4, wherein component A comprises a further component (designated component D) which is a genomic integration site for the integration of one or more ORFs encoding at least one aAPX and / or aAM. 6. A further component (called E) is a gene vector that matches D, and component E a. a single ORF encoding at least one aAPX and / or aAM; or b. two or more ORFs encoding at least one aAPX and / or aAM wherein a and / or b may or may not encode a selectable marker for integration such that the ORF can be stably integrated into the D genome acceptor site and aAPX and / or aAM are expressed. 7. A multi-component system according to any one of items 1 to 6, wherein one or more additional genomic acceptor sites and matching gene donor vectors are added as additional components of the system. 8. Contains genomic acceptor site B and / or D, and genomic acceptor site B and / or D a. Synthetic constructs designed for recombinase-mediated cassette exchange (RMCE) b. Synthetic constructs designed for site-specific homologous recombination c. native genomic site for site-specific homologous recombination 8. The multi-component system according to any one of items 1 to 7, wherein the multi-component system is selected from the group consisting of: 9. The multicomponent system according to any one of items 1 to 8, wherein component A expresses a T cell co-stimulatory receptor.

[0167] 10. The multicomponent system according to item 9, wherein component A expresses the T cell costimulatory receptors CD80 and / or CD83 and / or CD86. 11. A multi-component system according to any one of items 1 to 10, wherein component A is capable of loading a cargo molecule (CM) when provided together with genetic material encoding one or more ORFs encoding at least one or more aAPXs such that the aAPX is expressed at the cell surface (referred to as aAPX:CM). 12. The multicomponent system according to item 11, wherein the aAPX is capable of loading CM by the native processing and cargo loading mechanism. 13. A multicomponent system according to item 11 or 12, in which the aAPX can be loaded with the aAM as CM (referred to as aAPX:aAM). 14.aAPX is as follows One or more members of HLA class I b. One or more members of HLA class II c. one or more non-HLA antigen-presenting complexes d. Or a combination of a, b and / or c 14. The multi-component system according to any one of items 1 to 13,

[0168] 15.aAM a. A polypeptide or complex of polypeptides that serves as the analyte antigen b. a peptide derived from a polypeptide that serves as the analyte antigen C. a peptide serving as the analyte antigen d. a metabolite serving as the analyte antigen e. A polypeptide or complex of polypeptides translated from the analyte antigenic molecule ORF f. a peptide derived from a polypeptide translated from the analyte antigenic molecule ORF g. Peptides derived from modifications of the component A proteome h. Polypeptides derived from modifications of the component A proteome i. Component A: Metabolites derived from alterations in the metabolome and / or combinations thereof. 16. A genetic element comprising components B and / or D, wherein components B and / or D are: a. heterospecific recombinase site b. Homology arm C. eukaryotic promoter d. Eukaryotic conditional regulatory elements e. eukaryotic terminator f.Selection marker g. splice acceptor site h. splice donor site i. Non-protein-coding genes j. Insulator k. mobile genetic element l. meganuclease recognition site m. Internal ribosome entry site (IRES) n. viral self-cleaving peptide element o. Kozak consensus sequence 16. The multi-component system according to any one of items 1 to 15, comprising at least one of the following:

[0169] 17. A genetic element comprising components C and / or E, wherein components C and / or E are: a. heterospecific recombinase site b. Homology arm C. eukaryotic promoter d. Eukaryotic conditional regulatory elements e. eukaryotic terminator f.Selection marker g. Integrated selectable marker h. splice acceptor site i. splice donor site j. non-protein-coding genes k. Insulator l. mobile genetic elements m. meganuclease recognition site n. Internal ribosome entry site (IRES) o. viral self-cleaving peptide element P. antibiotic resistance cassette q. Bacterial origin of replication r. yeast replication origin s. cloning site T. Kozak consensus sequence 17. The multi-component system according to any one of items 1 to 16, comprising at least one of: 18. Contains components B and / or D, wherein components B and / or D are for RMCE integration of a single ORF, and are as follows: A eukaryotic promoter b. A pair of heterospecific recombinase sites C. Kozak consensus sequence d.Selection marker e. eukaryotic terminator 18. The multi-component system according to any one of items 1 to 17, comprising:

[0170] 19. Components B and / or D, wherein components B and / or D are for RMCE integration of two or more ORFs, and the following genetic elements: A eukaryotic promoter b. A pair of heterospecific recombinase sites c. 2 or more Kozak consensus sequences d.Selection marker e. eukaryotic terminator f. a second eukaryotic promoter g. Secondary selection marker h. second eukaryotic terminator 19. The multi-component system according to any one of items 1 to 18, comprising: 20. Components C and / or E are present and are for RMCE integration of a single ORF and include the following genetic elements: a pair of heterospecific recombinase sites b. Kozak consensus sequence c. antibiotic resistance cassette d. Bacterial origin of replication e. Cloning site for introduction of a single ORF encoding one or more aAPX and / or aAM and / or a selection marker for integration 20. The multi-component system according to any one of items 1 to 19.

[0171] 21. Components C and / or E are present and are for RMCE integration of two or more ORFs, and are as follows: a pair of heterospecific recombinase sites b. Two or more Kozak consensus sequences c. antibiotic resistance cassette d. bacterial or yeast replication origin e. A multicomponent system according to any one of items 1 to 20, comprising a cloning site for the introduction of two or more ORFs encoding one or more aAPXs and / or aAMs and / or an integrated selectable marker, together with a eukaryotic terminator. 22. A multicomponent system according to any one of items 1 to 21, wherein components C and / or E are combined with at least one ORF encoding at least one aAPX and / or aAM to obtain components C' and / or E'. 23. A multicomponent system according to item 22, wherein the combination is carried out multiple times to obtain a library of components C' and / or E'. 24. A multi-component system according to item 22 or 23, wherein one or more components C' and / or E' are combined with component A to obtain cells (called eAPC-p) by incorporating one or more aAPX ORFs encoded by components C' and / or E' into components B and / or D, such that the eAPC-p express aAPX on the cell surface, wherein components B and / or D become components B' and / or D'. 25. The multi-component system according to item 22 or 23, wherein one or more components C' and / or E' are combined with component A to obtain cells (eAPC-a) by incorporating one or more aAM ORFs encoded by components C' and / or E' into components B and / or D, such that the eAPC-a expresses the aAM on the cell surface or intracellularly, wherein components B and / or D become components B' and / or D'.

[0172] 26. The multi-component system according to item 22 or 23, wherein one or more components C' and / or E' are combined with component A to obtain cells (eAPC-pa) by incorporating one or more aAPX ORFs and / or one or more aAMs encoded by components C' and / or E' into components B and / or D, such that the eAPC-pa express aAPX and aAM and / or aAPX:aAM, wherein components B and / or D become components B' and / or D'. 27. The multi-component system according to item 24, wherein one or more components C' or E' are combined with eAPC-p to obtain cells (eAPC-pa) by incorporating one or more aAM ORFs encoded by components C' or E' into component B or D, such that the eAPC-pa expresses aAPX and aAM and / or aAPX:aAM, wherein component B or D becomes component B' or D'. 28. The multi-component system according to item 25, wherein one or more components C' or E' are combined with eAPC-a to obtain cells (eAPC-pa) by incorporating one or more aAPX ORFs encoded by component C' or E' into component B or D, such that the eAPC-pa expresses aAPX and aAM and / or aAPX:aAM, wherein component B or D becomes component B' or D'. 29.a. Combining component A with at least one component C' and / or E', wherein one or more components C' and / or E' encode one or more aAPXs and are combined with an integration factor, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the acquisition of surface expression of one or more aAPXs. d. Selecting for the acquisition of one or more integrated selectable markers. 25. A method for producing eAPC-p according to item 24, comprising at least one of the following steps:

[0173] 30. The method according to item 29, including steps b, c and d. 31. The method according to item 29 or 30, wherein one or more components C' and / or E' encode a single aAPX in step a of item 29. 32. The method of item 31, which is performed multiple times to obtain a library of discrete and defined eAPC-p, and each time step a of item 29 is performed with a unique aAPX to obtain a unique eAPC-p. 33. The method of item 29 or 30, wherein one or more components C' and / or E' encode a mixed pool of two or more unique aAPXs in step a of item 29 to obtain a library, wherein the library comprises a mixed population of eAPC-p, each eAPC-p expressing a single aAPX from the pool used in step a of item 29. 34.a. Combining component A with at least one component C' and / or E', wherein one or more of components C' and / or E' encode one or more aAMs and are combined with an integration factor, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the gain of expression of one or more aAMs. d. Selecting for the acquisition of one or more integrated selectable markers. 26. A method for producing eAPC-a according to item 25, comprising at least one of the following steps: 35. The method according to item 34, including b and d.

[0174] 36. The method according to item 34 or 35, wherein one or more components C' and / or E' encode a single aAM in step a of item 34. 37. The method according to item 36, which is performed multiple times to obtain a library of discrete and defined eAPC-a, and each time step a of item 34 is performed with a unique aAM so as to obtain a unique eAPC-a. 38. The method of item 34 or 35, wherein one or more components C' and / or E' encode a mixed pool of two or more unique aAMs in step a of item 34 to obtain a library, wherein the library comprises a mixed population of eAPC-a, each eAPC-a expressing a single aAM from the pool used in step a of item 34. 39. a. Combining eAPC-a with at least one component C' or E', wherein one or more components C' or E' encode one or more aAPX ORFs and are combined with an integration factor, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the acquisition of surface expression of one or more aAPXs. d. Selecting for the acquisition of one or more integrated selectable markers. 29. A method for producing eAPC-pa according to item 28, comprising at least one of the following steps: 40. The method according to item 39, including b, c and d. 41. The method according to item 39 or 40, wherein one or more components C' or E' encode a single aAPX in step a of item 39. 42. The method according to item 41, which is performed multiple times to obtain a library of discrete and defined eAPC-pas, and each time step a of item 39 is performed using a unique aAPX so as to obtain a unique eAPC-pa. 43. The method according to item 39 or 40, wherein one or more components C' or E' encode a mixed pool of two or more unique aAPXs in step a of item 39 to obtain a library, wherein the library comprises a mixed population of eAPC-pas, each eAPC-pa expressing a single aAPX from the pool used in step a of item 39.

[0175] 44. a. combining eAPC-p with at least one component C' or E', wherein one or more of components C' or E' encode one or more aAM ORFs and are combined with integration factors, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the gain of expression of one or more aAMs. d. Selecting for the acquisition of one or more integrated selectable markers. 28. A method for producing eAPC-pa according to item 27, comprising at least one of the following steps: 45. The method according to item 44, including b and d. 46. The method according to item 44 or 45, wherein one or more components C' or E' encode a single aAM in step a of item 44. 47. The method according to item 46, which is carried out multiple times to obtain a library of discrete and defined eAPC-pas, and each time step a of item 44 is carried out using a unique aAM so as to obtain a unique eAPC-pa. 48. The method of item 44 or 45, wherein one or more components C' or E' encode a mixed pool of two or more unique aAMs in step a of item 44 to obtain a library, wherein the library comprises a mixed population of eAPC-pas, each eAPC-pa expressing a single aAM from the pool used in step a of item 44. 49.a. Combining EAPC with at least one component C' or E', wherein one or more of components C' and / or E' encode one or more aAM ORFs and one or more aAPX ORFs, and in combination with integration factors, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for expression of one or more aAMs and / or gain of surface expression of one or more aAPXs. d. Selecting for the acquisition of one or more integrated selectable markers. 27. A method for producing eAPC-pa according to item 26, comprising at least one of the following steps:

[0176] 50. The method according to item 49, including b, c and d. 51. The method according to item 49 or 50, wherein one or more components C' and / or E' encode a single aAM and a single aAPX in step a of item 49. 52. The method according to item 51, wherein step a of item 49 is performed multiple times to obtain a library of discrete and defined eAPC-pas, and each time step a of item 49 is performed using at least one unique aAM and / or unique aAPX so as to obtain a unique eAPC-pa. 53. The method according to item 49 or 50, wherein one or more components C' and / or E' encode a mixed pool of two or more unique aAMs and / or two or more unique aAPXs in step a of item 49 to obtain a library, wherein the library comprises a mixed population of eAPC-pas, each eAPC-pa expressing a single aAM and a single aAPX from the pool used in step a of item 49. 54. Characterize the following: a. the specificity of the expressed analyte antigen for the analyte affinity reagent, and / or b. the affinity of the expressed analyte antigen for the analyte affinity reactant c. an expressed analyte from an analyte cell (analyte TCR) expressing one or more analyte TCRs 29. An analyte eAPC obtained from the multicomponent system according to any one of items 1 to 28 for use in a signal response to an analyte antigen, wherein the analyte antigen is selected from aAPX:aAM and / or aAM and / or aAPX and / or aAPX:CM and the analyte eAPC is selected from eAPC-p and / or eAPC-a and / or eAPC-pa.

[0177] 55. A method for selecting one or more analyte eAPCs from an input analyte eAPC or a library of analyte eAPCs to obtain one or more analyte eAPCs that bind to one or more analyte TCRs, comprising: a. combining one or more analyte eAPCs with one or more analyte TCRs to create contact between the analyte antigens presented by the analyte eAPCs and the analyte TCRs; b. if formed, measuring the formation of a complex between one or more analyte antigens and one or more analyte TCRs; and / or c. If induced, measuring a signal response of one or more analyte eAPCs induced by complex formation between the analyte antigen and one or more analyte TCRs; and / or d. If induced, measuring a signal response of one or more analyte TCs induced by complex formation between the analyte antigen and one or more analyte TCRs expressed by the one or more analyte TCs; and e. Measuring one or more analytes eAPC, step b, wherein selection is by positive and / or negative determination. wherein the analyte antigen is selected from aAPX:aAM and / or aAM and / or aAPX and / or aAPX:CM, the analyte eAPC is selected from eAPC-p and / or eAPC-a and / or eAPC-pa, the analyte TCR is a TCR chain pair or a TCR-mimetic affinity reactant in the form of at least one of the following: a soluble reactant, a non-cell-based particle (NCBP), an immobilized reactant presented by a cell surface (TC), and the cell can be selected from a primary T cell and / or a recombinant T cell and / or a genetically engineered cell.

[0178] 56. The method according to item 55, wherein the selection step is carried out by single cell sorting and / or cell sorting into pools. 57. The method according to item 56, wherein sorting precedes expansion of the sorted single cells. 58. The method according to item 56, wherein sorting precedes expansion of the sorted cell pool. 59. The method according to any one of items 56 to 58, further comprising the step of sequencing component B' and / or component D' of the selected and / or expanded cells. 60. The sequencing step is as follows: a. Extracting genomic DNA, and / or b. Extracting RNA transcripts of component B' and / or component D', and / or c. Amplifying the DNA and / or RNA transcripts of component B' and / or component D' by PCR and / or RT-PCR. Item 59. The method according to item 59, following item 59. 61. The method of item 59 or 60, wherein the sequencing step is destructive to the cell and the resulting sequencing information is used to produce the analyte eAPCs selected in step e of item 55. 62. The selected analyte eAPCs are subjected to affinity analysis to determine the affinity of the analyte antigen for the analyte TCR, as follows: a. labeling selected analyte eAPCs with a range of concentrations of analyte TCR; b. performing FACS analysis on the labeled analyte eAPCs of step a; c. determining the intensity of fluorescent labeling of the analyte eAPC over a range of concentrations of the analyte affinity reagent; d. Calculating the affinity of the analyte antigen for the analyte TCR; 62. The method of any one of items 55, 56, 57, 58, 61, further comprising:

[0179] 63. The method of claim 62, wherein steps b-c are performed using a labeled reference, and step d is calculating affinity using the ratio of the fluorescence intensity of the analyte affinity reagent to the fluorescence intensity of the reference. 64. The labeled reference is a. Analyte eAPCs labeled with an affinity reagent for the analyte antigen b. Labeled reference analyte antigen-presenting cells or particles Item 64. The method of item 63, wherein the method is selected from the group consisting of: 65. Selected analyte eAPCs are subjected to signal response characterization, including: a. determining the native signaling response, and / or b. Determining the composite signaling response 62. The method according to any one of items 55, 56, 57, 58, 61, further comprising: 66. The induced signal response compared to the non-induced signal response state: A secreted biomolecule B secreted chemicals C. intracellular biomolecules d. Intracellular chemicals e. Surface-expressed biomolecules f. Cytotoxic effect of analyte TC on analyte eAPC g. Paracrine effect of analyte TC on analyte eAPC (wherein a signal response is induced in the analyte eAPC and is determined by detecting an increase or decrease in any of a to e) h. Amplification of the analyte TC i. Immunological synapse formation between analyte TC and analyte eAPC Item 66. The method according to Item 65, wherein the determination is made by detecting an increase or decrease in one or more of:

[0180] 67. A method for selecting one or more analyte TCRs from an input analyte TCR or a library of analyte TCRs (wherein the analyte TCRs bind to one or more analyte eAPCs) to obtain the sequences of one or more pairs of TCR chains encoded by the analyte TCRs and / or to obtain the analyte TCRs, comprising: a. combining one or more analyte eAPCs with one or more analyte TCRs to create contact between the analyte antigen presented by the analyte eAPCs and the one or more analyte TCRs; b. if so, measuring the formation of a complex between the analyte antigen and one or more analyte TCRs; and / or c. If induced, measuring a signal response of one or more analyte TCs induced by complex formation between the analyte antigen and one or more TCRs expressed by one or more analyte TCs; and / or d. If induced, measuring a signal response of one or more analyte eAPCs induced by complex formation between the analyte antigen and one or more analyte TCRs; and e. Selecting one or more analyte TCRs from steps b, c, and / or d, wherein the selection is by positive and / or negative determination. wherein the analyte antigen is selected from aAPX:aAM and / or aAM and / or aAPX and / or aAPX:CM, the analyte eAPC is selected from eAPC-p and / or eAPC-a and / or eAPC-pa, the analyte TCR is a TCR chain pair or a TCR-mimetic affinity reactant in the form of at least one of a soluble reactant or an immobilized reactant presented by a non-cell-based particle (NCBP) or on a cell surface (TC), and the cells can be selected from primary T cells and / or recombinant T cells and / or genetically engineered cells.

[0181] 68. The method according to item 67, wherein the selection step is carried out by single cell sorting and / or cell sorting into pools. How to do it. 69. The method according to item 68, wherein sorting precedes expansion of the sorted single cells. 70. The method of item 68, wherein sorting precedes expansion of the sorted cell pool. 71. The method according to any one of items 67 to 70, further comprising the step of sequencing the analyte TCR chain of the sorted and / or expanded cells. 72. The sequencing process is as follows: a. Extracting genomic DNA, and / or b. extracting analyte TCR chain RNA transcripts, and / or c. The method of claim 71, followed by amplifying the DNA and / or RNA transcripts of the analyte TCR chain by PCR and / or RT-PCR. 73. The selected analyte TC is characterized in signal response, as follows: a. determining the native signaling response, and / or b. Determining the composite signaling response 71. The method according to any one of items 67, 68, 69, 70, further comprising:

[0182] 74. The effect of an induced signal response compared to a non-induced signal response state is: A secreted biomolecule B secreted chemicals C. intracellular biomolecules d. Intracellular chemicals e. Surface-expressed biomolecules f. Cytotoxic effect of analyte TC on analyte eAPC g. Paracrine effect of analyte TC on analyte eAPC (wherein a signal response is induced in the analyte eAPC and is determined by detecting an increase or decrease in any of a to e) h. Amplification of the analyte TC i. Immunological synapse between analyte TC and analyte eAPC Item 74. The method according to Item 73, wherein the determination is made by detecting an increase or decrease in one or more of: 75. A method for selecting and identifying aAM or CM cargo, wherein the cargo is a metabolite and / or peptide loaded on an aAPX of an analyte eAPC, comprising: a. isolating the aAPX:aAM or aAPX:CM or cargo aM or cargo CM; and b. Identifying the cargo being loaded The method comprising:

[0183] 76. Step b comprises treating the isolated aAPX:aAM or aAPX:CM with one or more of the following: a.Mass spectrometry b. Peptide sequencing analysis 76. The method according to Item 75, comprising subjecting the 77. Below: Diagnosis b. Medicine c. Beauty d. Research and Development A TCR chain pair sequence or a library of TCR chain pair sequences selected by the method defined in any one of items 67 to 74, for use in at least one of the above. 78. Below: Diagnosis b. Medicine c. Beauty d. Research and Development An antigenic molecule and / or an ORF encoding said antigenic molecule selected by the method defined in any one of items 55 to 66 or 75 and 76, or a library thereof, for use in at least one of the above. 79. Below: Diagnosis b. Medicine c. Beauty d. Research and Development An antigen-presenting complex carrying an antigenic molecule as a cargo and / or an ORF encoding said complex, or a library thereof, selected by the method defined in Items 55 to 66 or 75 or 76, for use in at least one of the above.

[0184] 80. Below: Diagnosis b. Medicine c. Beauty d. Research and Development 67. An eAPC or a library of eAPCs selected by the method defined in items 55 to 66 for use in at least one of the above. 81. Below: Diagnosis b. Medicine c. Beauty d. Research and Development 7. Cells or a library thereof expressing a TCR selected by the method defined in any one of items 67 to 74 in a complex with CD3 on the cell surface, for use in at least one of the above. 82. Below: Diagnosis b. Medicine c. Beauty d. Research and Development 29. The multi-component system according to any one of items 1 to 28, for use in at least one of the following:

[0185] 83. Below: Diagnosis b. Medicine c. Beauty d. Research and Development A TCR-mimetic affinity reactant sequence or a library of TCR-mimetic affinity reactant sequences selected by the method defined in items 67 to 74 for use in at least one of the above. 84. Below Diagnosis b. Medicine c. Beauty NCBP having a TCR pair or a TCR-mimetic affinity reactant selected by the method specified in Items 67 to 74, or NCBP having a TCR pair or a TCR-mimetic affinity reactant, for use in at least one of Library.

[0186] SEQUENCE LISTING <110> Genovie AB <120> An Engineered Multi-component System for Identification and Characterization of T-cell receptors and T-cell antigens <130> P018243PCT1 <160> 72 <170> BiSSAP 1.3 <210> 1 <211> 13 <212> PRT <213> Homo sapiens <220> <223> Analyte Antigenic Molecule <400> 1 Pro Lys Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr 1 5 10 <210> 2 <211> 4 <212> PRT <213> Homo sapiens <220> <223> Analyte Antigenic Molecule <400> 2 Pro Lys Tyr Val 1 <210> 3 <211> 17 <212> PRT <213> Homo sapiens <220> <223> Analyte Antigenic Molecule, APD-2 <400> 3 Asn Leu Val Pro Met Val Ala Thr Asn Leu Val Pro Met Val Ala Thr 1 5 10 15 Val <210> 4 <211> 9 <212> PRT <213> Homo sapiens <220> <223> Analyte Antigenic Molecule, APD-21 <400> 4 Asn Leu Gly Pro Met Ala Ala Gly Val 1 5 <210> 5 <211> 9 <212> PRT <213> Homo sapiens <220> <223> Analyte Antigenic Molecule, APD-11 <400> 5 Val Tyr Ala Leu Pro Leu Lys Met Leu 1 5 <210> 6 <211> 6071 <212> DNA <213> Artificial Sequence <220> <223> V1.A.4 pcDNA3.1_GFP <400> 6 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgcccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagaccacaa gctggctagc 900 gtttaaactt aagcttggta ccgccaccat ggaatccgat gagtctggcc tgcccgccat 960 ggaaatcgag tgcagaatca ccggcaccct gaacggcgtg gaatttgagc tcgtgggcgg 1020 aggcgagggc acacctgaac agggcagaat gaccaacaag atgaagtcca ccaagggggc 1080 cctgaccttc agcccctacc tgctgtctca cgtgatgggc tacggcttct accacttcgg 1140 cacctacccc agcggctacg agaacccttt cctgcacgcc atcaacaacg gcggctacac 1200 caacacccgg atcgagaagt acgaggacgg cggcgtgctg cacgtgtcct tcagctacag 1260 atacgaggcc ggcagagtga tcggcgactt caaagtgatg ggcaccggat tccccgagga 1320 cagcgtgatc ttcaccgaca agatcatccg gtccaacgcc accgtggaac atctgcaccc 1380 catgggcgac aacgacctgg acggcagctt caccagaacc ttctccctgc gggatggcgg 1440 ctactacagc agcgtggtgg acagccacat gcacttcaag agcgccatcc accccagcat 1500 cctccagaac ggcggaccca tgttcgcctt cagacgggtg gaagaggacc acagcaacac 1560 cgagctgggc atcgtggaat accagcacgc cttcaagacc cccgatgccg atgccggcga 1620 ggaatgagtc gagtctagag ggcccgttta aacccgctga tcagcctcga ctgtgccttc 1680 tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 1740 cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg 1800 tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa 1860 tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaaccagctg 1920 gggctctagg gggtatcccc acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt 1980 ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt 2040 cttcccttcc tttctcgcca cgttcgccgg ctttccccgt caagctctaa atcgggggct 2100 ccctttaggg ttccgattta gtgctttacg gcacctcgac cccaaaaaac ttgattaggg 2160 tgatggttca cgtagtgggc catcgccctg atagacggtt tttcgccctt tgacgttgga 2220 gtccacgttc tttaatagtg gactcttgtt ccaaactgga acaacactca accctatctc 2280 ggtctattct tttgatttat aagggatttt gccgatttcg gcctattggt taaaaaatga 2340 gctgatttaa caaaaattta acgcgaatta attctgtgga atgtgtgtca gttagggtgt 2400 ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct caattagtca 2460 gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat 2520 ctcaattagt cagcaacat agtcccgccc ctaactccgc ccatcccgcc cctaactccg 2580 cccagttccg cccattctcc gccccatggc tgactaattt tttttattta tgcagaggcc 2640 gaggccgcct ctgcctctga gctattccag aagtagtgag gaggcttttt tggaggccta 2700 ggcttttgca aaaagctccc gggagcttgt atatccattt tcggatctga tcaagagaca 2760 ggatgaggat cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct 2820 tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc 2880 gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc 2940 ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc 3000 gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg 3060 ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc 3120 atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac 3180 caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat 3240 caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc 3300 aaggcgcgca tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg 3360 aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg 3420 gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc 3480 gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc 3540 gccttctatc gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg 3600 accaagcgac gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa 3660 ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc 3720 tcatgctgga gttcttcgcc caccccaact tgtttattgc agcttataat ggttacaaat 3780 aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 3840 gtttgtccaa actcatcaat gtatcttatc atgtctgtat accgtcgacc tctagctaga 3900 gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc 3960 cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct 4020 aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc 4080 agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt 4140 ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag 4200 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca 4260 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 4320 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 4380 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 4440 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 4500 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 4560 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 4620 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 4680 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 4740 actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct 4800 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggttttt 4860 ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 4920 tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga 4980 gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa 5040 tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac 5100 ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga 5160 taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc 5220 cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca 5280 gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta 5340 gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg 5400 tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc 5460 gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg 5520 ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt 5580 ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt 5640 cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata 5700 ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc 5760 gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac 5820 ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa 5880 ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct 5940 tcctttttca atattattga agcatttatc agggttattg tctcatgagc ggatacatat 6000 ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc 6060 cacctgacgt c 6071 <210> 7 <211> 10428 <212> DNA <213> Artificial Sequence <220> <223> SpCas9-2A-GFP Vector V1.A.8 <400> 7 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgcccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagaccacaa gctggctagc 900 gtttaaactt aagcttggta ccgccaccat ggactataag gaccacgacg gagactacaa 960 ggatcatgat attgattaca aagacgatga cgataagatg gccccaaaga agaagcggaa 1020 ggtcggtatc cacggagtcc cagcagccga caagagtac agcatcggcc tggacatcgg 1080 caccaactct gtgggctgggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt 1140 caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct 1200 gttcgacagc ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagagata 1260 caccagacgg aagaaccgga tctgctatct gcaagagatc ttcagcaacg agatggccaa 1320 1380 gcacgagcgg caccccacatct tcggcaacat cgtggacgag gtggcctacc aggaagaga 1440 ccccaccatc taccacctga gaagaaact ggtggacagc accgacaagg ccgacctgcg 1500 gctgatctat ctggccctgg cccacatgat caagttccgg ggccacttcc tgatcgaggg 1560 cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg tgcagaccta 1620 caaccagctg ttcgaggaaa accccacatcaa cgccagcggc gtggacgcca aggccatcct 1680 gtctgccaga ctgagcaaga gcagacggct ggaaaatctg atcgcccagc tgcccggcga 1740 gaagagaat ggcctgttcg gaacctgat tgccctgagc ctgggcctga cccccaactt 1800 caagagcaac ttcgacctgg ccgaggatgc caaactgcag ctgagcaagg acacctacga 1860 cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc tgtttctggc 1920 cgccaagaac ctgtccgacg ccatcctgct gagcgacatc ctgagagtga acaccgagat 1980 caccaaggcc cccctgagcg cctctatgat caagagatac gacgagcacc accaggacct 2040 gaccctgctg aaagctctcg tgcggcagca gctgcctgag aagtcaaag agattttctt 2100 cgaccagagc aagaacggct acgccggcta cattgacggc ggagccagcc aggaagagtt 2160 ctacaagttc atcaagccca tcctggaaaa gatggacggc accgaggaac tgctcgtgaa 2220 gctgaacagagagaccctgc tgcggaagca gcggaccttc gcaacggca gcatccccca 2280 ccagatccac ctgggagagc tgcacgccat tctgcggcgg caggaagaatt tttacccatt 2340 cctgaaggac aaccgggaaa agatcgagaa gatcctgacc ttccgcatcc cctactacgt 2400 gggccctctg gccaggggaa acagcagatt cgcctggatg accagaaaga gcgaggaaac 2460 catcacccc tggaacttcg aggaagtggt ggacaagggc gcttccgcccc agagcttcat 2520 cgagcggatg accaacttcg atagaacct gcccaacgag aaggtgctgc ccaagcacag 2580 cctgctgtac gagtacttca ccgtgtataa cgagctgacc aaagtgaaat acgtgaccga 2640 gggaatgaga aagcccgcct tcctgagcgg cgagcagaa aaggccatcg tggacctgct 2700 gttcaagacc aaccggaaag tgaccgtgaa gcagctgaaa gaggactact tcaagaaat 2760 cgagtgctc gactccgtgg aaatctccgg cgtggagat cggttcacg cctccctggg 2820 cacataccac gatctgctga aaattatcaa ggacaggac ttcctggaca atgaggaaaa 2880 cgaggacatt ctggaagata tcgtgctgac cctgacactg tttgaggaca gagagatgat 2940 cgaggaacgg ctgaaaacct atgcccacct gttcgacgac aaagtgatga agcagctgaa 3000 gcggcggaga tacaccggct ggggcaggct gagccggaag ctgatcaacg gcatccggga 3060 caagcagtcc ggcagacaa tcctggattt cctgaagtcc gacggctcg ccacagaaa 3120 cttcatgcag ctgatccacg acgacagcct gacctttaaa gaggacatcc agaaagccca 3180 ggtgtccggc cagggcgata gcctgcacga gcacattgcc aatctggccg gcagccccgc 3240 cattaagaag ggcatcctgc agacagtgaa ggtggtggac gagctcgtga aagtgatggg 3300 ccggcacaag cccgagaaca tcgtgatcga aatggccaga gagaaccaga ccacccagaa 3360 gggacagaag aacagccgcg agaatgaa gcggatcgaa gagggcatca aagagctggg 3420 cagccagatc ctgaaagaac accccgtgga aaacacccag ctgcagaacg agaagctgta 3480 cctgtactac ctgcagaatg ggcgggatat gtacgtggac caggaactgg acatcaaccg 3540 gctgtccgac tacgatgtgg accatatcgt gcctcagagc tttctgaagg acgactccat 3600 cgacaacaag gtgctgacca gaagcgacaa gaaccggggc aagagcgaca acgtgccctc 3660 cgaagaggtc gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg ccaagctgat 3720 tacccagaga aagttcgaca atctgaccaa ggccgagaga ggcggcctga gcgaactgga 3780 taaggccggc ttcatcaaga gacagctggt ggaaacccgg cagatcacaa agcacgtggc 3840 acagatcctg gactcccgga tgaacactaa gtacgacgag aatgacaagc tgatccggga 3900 agtgaaagtg atcaccctga agtccaagct ggtgtccgat ttccggaagg atttccagtt 3960 ttacaaagtg cgcgagatca acaactacca ccacgcccac gacgcctacc tgaacgccgt 4020 cgtgggaacc gccctgatca aaaagtaccc taagctggaa agcgagttcg tgtacggcga 4080 ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaaa tcggcaaggc 4140 taccgccaag tacttcttct acagcaacat catgaacttt ttcaagaccg agattaccct 4200 ggccaacggc gagatccgga agcggcctct gatcgagaca aacggcgaaa ccggggagat 4260 cgtgtgggat aagggccggg attttgccac cgtgcggaaa gtgctgagca tgccccaagt 4320 gaatatcgtg aaaaagaccg aggtgcagac aggcggcttc agcaaagagt ctatcctgcc 4380 caagaggaac agcgataagc tgatcgccag aaagaaggac tgggacccta agaagtacgg 4440 cggcttcgac agccccaccg tggcctattc tgtgctggtg gtggccaaag tggaaaaggg 4500 caagtccaag aaactgaaga gtgtgaaaga gctgctgggg atcaccatca tggaaagaag 4560 cagcttcgag aagaatccca tcgactttct ggaagccaag ggctacaaag aagtgaaaaa 4620 ggacctgatc atcaagctgc ctaagtactc cctgttcgag ctggaaaacg gccggaagag 4680 aatgctggcc tctgccggcg aactgcagaa gggaaacgaa ctggccctgc cctccaaata 4740 tgtgaacttc ctgtacctgg ccagccacta tgagaagctg aagggctccc ccgaggataa 4800 tgagcagaaa cagctgtttg tggaacagca caagcactac ctggacgaga tcatcgagca 4860 gatcagcgag ttctccaaga gagtgatcct ggccgacgct aatctggaca aagtgctgtc 4920 cgcctacaac aagcaccggg ataagcccat cagagagcag gccgagaata tcatccacct 4980 gtttaccctg accaatctgg gagcccctgc cgccttcaag tactttgaca ccaccatcga 5040 ccggagaagg tacaccagca ccaaagaggt gctggacgcc accctgatcc accagagcat 5100 caccggcctg tacgagacac ggatcgacct gtctcagctg ggaggcgaca aaaggccggc 5160 ggccacgaaa aaggccggcc aggcaaaaaa gaaaaaggaa ttcggcagtg gagagggcag 5220 aggaagtctg ctaacatgcg gtgacgtcga ggagaatcct ggcccagtga gcaagggcga 5280 ggagctgttc accggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca 5340 caagttcagc gtgtccggcg agggcgagg cgatgccacc tacggcaagc tgaccctgaa 5400 gttcatctgc accaccggca agctgcccgt gccctggccc accctcgtga ccaccctgac 5460 ctacggcgtg cagtgcttca gccgctaccc cgaccacatg aagcagcacg acttcttcaa 5520 gtccgccatg cccgaaggct acgtccagga gcgcaccatc ttcttcaagg acgacggcaa 5580 ctacaagacc cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc gcatcgagct 5640 gaagggcatc gacttcaagg aggacggcaa catcctgggg cacaagctgg agtacaacta 5700 caacagccac aacgtctata tcatggccga caagcagaag aacggcatca aggtgaactt 5760 caagatccgc cacaacatcg aggacggcag cgtgcagctc gccgaccact accagcagaa 5820 cacccccatc ggcgacggcc ccgtgctgct gcccgacaac cactacctga gcacccagtc 5880 cgccctgagc aaagacccca acgagaagcg cgatcacatg gtcctgctgg agttcgtgac 5940 cgccgccggg atcactctcg gcatggacga gctgtacaag gaattctaac gctagagggc 6000 ccgtttaaac ccgctgatca gcctcgactg tgccttctag ttgccagcca tctgttgttt 6060 gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 6120 aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 6180 tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 6240 tgggctctat ggcttctgag gcggaaagaa ccagctgggg ctctaggggg tatccccacg 6300 cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta 6360 cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt 6420 tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg 6480 ctttacggca cctcgacccc aaaaaacttg attagggtga tggttcacgt agtgggccat 6540 cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac 6600 tcttgttcca aactggaaca acactcaacc ctatctcggt ctattctttt gatttataag 6660 ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg 6720 cgaattaatt ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc 6780 aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc 6840 aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt 6900 cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc 6960 ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctctg cctctgagct 7020 attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agctcccggg 7080 agcttgtata tccattttcg gatctgatca agagacagga tgaggatcgt ttcgcatgat 7140 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta 7200 tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca 7260 ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactgcagga 7320 cgaggcagcg cggctatcgt ggctggccac gacggcgtt ccttgcgcag ctgtgctcga 7380 cgttgtcact gagcggga gggactggct gctattgggc gagtgccgg ggcaggatct 7440 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 7620 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcgcatgc ccgacggcga 7680 ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg 7740 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 7800. gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 7860. gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 7920 gttcttctga gcgggactct ggggttcgaa atgaccgacc aagcgacgcc caacctgcca 7980 tcacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc 8040 cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt cttcgcccac 8100 cccaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc 8160 acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta 8220 tcttatcatg tctgtatacc gtcgacctct agctagagct tggcgtaatc atggtcatag 8280 ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc 8340 ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 8400 tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa 8460 cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct cactgactcg 8520 ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 8580 ttatccacag aatcaggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 8640 gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 8700 gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 8760 taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 8820 accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 8880 tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 8940 cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 9000 agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 9060 gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctcac tagagaaca 9120 gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaagagt tggtagctct 9180 tgatccggca aaaaaccac cgctggtagc ggtttttttg tttgcaagca gcagattacg 9240 cgcagaaaaa areatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 9300 tggaacgaaa actcacgtta agggatttg gtcatgagat tatcaaaaag gatcttcacc 9360 tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagttata tgagtaaact 9420 tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 9480 cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 9540 ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta 9600 tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 9660 gcctccatcc agtctattaa ttgttgccgg gaagctagag tagtagttc gccagttaat 9720 agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt 9780 atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 9840 tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 9900 gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 9960 agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 10020 cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 10080 ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 10140 ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 10200 actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 10260 ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 10320 atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtc <210> 8 <211> 2508 <212> DNA <213> Artificial Sequence <220> <223> pMA-SV40pA vector V1.C.2 <400> 8 ctaaattgta agcgttaata ttttgttaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt gggaaggggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360 aggccgcatg aattgttgtt gttaacttgt ttattgcagc ttataatggt tacaaataaa 420 gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt 480 tgtccaaact catcaatgta tcttatcatg tctggatctg cggatccaat ctcgagctgg 540 gcctcatggg ccttccgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 600 cattaacatg gtcatagctg tttccttgcg tattgggcgc tctccgcttc ctcgctcact 660 gactcgctgc gctcggtcgt tcgggtaaag cctggggtgc ctaatgagca aaaggccagc 720 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 780 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 840 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 900 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct 960 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtggcacg 1020 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 1080 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 1140 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 1200 gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 1260 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg ttttttgtt tgcaagcagc 1320 agattacgcg cagaaaaaaa ggatctcaag aagatcctttt gatctttct acggggtctg 1380 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 1440 tcttcaccta gatcctttta attaaaaat gaagttttaa atcaatctaa agtatatatg 1500 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 1560 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 1620 agggcttacc atctggcccc agtgctgcaa tgataccgcg agaaccacgc tcaccggctc 1680. cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccgggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 1920 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttctttc ggggcgaaaa ctctcaagga 2220 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 2280 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 2340 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 2400 attgaagcat tttcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 2460 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccac 2508 <210> 9 <211> 4341 <212> DNA <213> Artificial Sequence <220> <223> HLA-A 02:01 6xHis + Exon2 / 3-HA-L+R vector V1.C.6 <400> 9 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 atttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag atagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360 aggccgcatg aattcgctac cggtatagta atcaattacg gggtcattag ttcatagccc 420 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 480 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 540 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 600 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 660 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 720 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg 780 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg 840 gcaccaaaat caacgggact ttccaaatg tcgtaacaac tccgccccat tgacgcaat 900 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctggtttag tgaaccgtca 960 gatcaggtac catggccgtc atggcgcccc gaaccctcgt cctgctactc tcgggggctc 1020 tggccctgac ccagacctgg gcggggctctc actccatgag gtatttctc acatccgtgt 1080 ctcggccagg acgcggagag ccacgcttca tcgcagtggg ctcgtggac ccacgcagt 1140 tcgtgcggtt cgacagcgac gccgcgagcc agaggatgga gccgcggcg ccgtggatag 1200 agcaggagggg tccggagtat tgggacgggg agacacggaa agtgaggcc cactcacaga 1260 ctcaccgagt ggacctgggg accctgcgcg gctacaca ccagagcgag gccggttctc 1320 acaccgtcca gaggatgtat ggctgcgacg tggggtcgga ctggcgcttc ctccgcggat 1380 accaccagta cgcctacgac ggcaaggatt acatcgccct gaaagaggac ctgcgctctt 1440 ggaccgcggc ggacatggca gctcagacca ccaagcacaa gtgggaggcg gcccatgtgg 1500 cggagcagtt gagagcctac ctggagggca cgtgcgtgga gtggctccgc agatacctgg 1560 agaacgggaa ggagacgctg cagcgcacgg acgcccccaa aacgcatatg actcaccacg 1620 ctgtctctga ccatgaagcc accctgaggt gctgggccct gagcttctac cctgcggaga 1680 tcacactgac ctggcagcgg gatggggagg accagaccca ggacacggag ctcgtggaga 1740 ccaggcctgc aggggatgga accttccaga agtgggcggc tgtggtggtg ccttctggac 1800 aggagcagag atacacctgc catgtgcagc atgagggttt gcccaagccc ctcaccctga 1860 gatgggagcc gtcttcccag cccaccatcc ccatcgtggg catcattgct ggcctggttc 1920 tctttggagc tgtgatcact ggagctgtgg tcgctgctgt gatgtggagg aggaagagct cagatagaaa aggagggagc tactctcagg ctgcaagcag tgacagtgcc cagggctctg atgtgtctct cacagcttgt aaagtgcccg ggcatcatca ccatcaccac tgactatagt cgtctagacc tgatcataat caagccatat cacatctgta gaggtttact tgctttaaaa aacctccaca cctccccctg aacctgaaac father tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctggat ctgcggatcc aatctcgagc tgggcctcat gggccttccg ctcactgccc 2400 2460. gctttccagt cgggaaacct gtcgtgccag ctgcattaac atggtcatag ctgtttcctt gcgtattggg cgctctccgc ttcctcgctc actgactcgc tgcgctcggt cgttcgggta 2520 aagcctgggg tgcctaatga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 2580 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 2640 caagtcagag gtggcgaaac ccgacaggac tataagata ccaggcgttt ccccctggaa 2700 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 2760 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 2820 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 2880 ccttatccgg taactatcgt cttgagtcca accccggtaag acacgactta tcgccactgg 2940 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct agagagttct 3000 tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc 3060 tgaagccagt taccttgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 3120 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 3180 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 3240 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 3300 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 3360 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct 3420 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg 3480 caatgatacc gcgagaacca cgctcaccgg ctccagattt atcagcaata aaccagccag 3540 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta 3600 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 3660 ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 3720 gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct 3780 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta 3840 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg 3900 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc 3960 cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg 4020 gaaaacgtc ttcggggcga aaactctcaa gatcttacc gctgttgaga tccagttcga 4080 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg 4140 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat 4200 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc 4260 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca 4320 catttccccg aaaagtgcca c 4341 <210> 10 <211> 4332 <212> DNA <213> Artificial Sequence <220> <223> HLA-B 35:01 6xHis + Exon2 / 3-HA-L+R vector V1.C.9 <400> 10 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360 aggccgcatg aattcgctac cggtatagta atcaattacg gggtcattag ttcatagccc 420 atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 480 cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc caatagggac 540 tttccattga cgtcaatggg tggagtattt acggtaaact gcccacttgg cagtacatca 600 agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat ggcccgcctg 660 gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca tctacgtatt 720 agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc gtggatagcg 780 gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga gtttgttttg 840 gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat 900 gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctggtttag tgaaccgtca 960 gatcaggtac catgcgggtc acggcgcccc gaaccgtcct cctgctgctc tggggggcag 1020 tggccctgac cgagacctgg gccggctccc actccatgag gtatttctac accgccatgt 1080 cccggccagg acgcggagag ccacgcttca tcgcagtggg ctacgtggac gacacccagt 1140 tcgtgaggtt cgacagcgac gccgcgagtc cgaggacgga gcctcgggcg ccatggatag 1200 agcaggaggg gccggagtat tgggaccgga acacacagat cttcaagacc aacacacaga 1260 cttaccgaga gagcctgcgg aacctgcgcg gctactacaa ccagagcgag gccgggtctc 1320 acatcatcca gaggatgtat ggctgcgacc tggggcccga cgggcgcctc ctccgcgggc 1380 atgaccagtc cgcctacgac ggcaaggatt acatcgccct gaacgaggac ctgagctcct 1440 ggaccgcggc ggacaccgcg gctcagatca cccagcgcaa gtgggaggcg gcccgtgtgg 1500 cggagcagct gagagcctac ctggagggcc tgtgcgtgga gtggctccgc agatacctgg 1560 agaacgggaa ggagactctt cagcgcgcag atcctccaaa gacacacgtg acccaccacc 1620 ccgtctctga ccatgaggcc accctgaggt gctgggccct gggcttctac cctgcggaga 1680 tcacactgac ctggcagcgg gatggcgagg accaaactca ggacactgag cttgtggaga ccagaccagc aggagaga accttccaga agtgggcagc tgtggtggtg ccttctggag aagagcagag atacacatgc catgtacagc atgaggggct gccgaagccc ctcaccctga gatgggagcc atcttcccag tccaccatcc ccatcgtggg cattgttgct ggcctggctg tcctagcagt tgtggtcatc ggagctgtgg tcgctactgt gatgtgtagg aggaagagct caggtggaaa aggagggagc tactctcagg ctgcgtccag cgacagtgcc cagggctctg atgtgtctct cacagctccc gggcatcatc accatcacca ctgactatag tcgtctagac ctgatcataa tcaagccata tcacatctgt agaggtttac ttgctttaa aaacctccac acctccccct gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttata tggttacaaa taagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctgga 2340 tctgcggatc caatctcgag ctgggcctca tgggccttcc gctcactgcc cgctttccag 2400 tcgggaaacc tgtcgtgcca gctgcattaa catggtcata gctgtttcct tgcgtattgg 2460 gcgctctccg cttcctcgct cactgactcg ctgcgctcgg tcgttcgggt aaagcctggg 2520 gtgcctaatg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 2580 cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 2640 ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 2700 tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 2760 gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 2820 gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 2880 gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 2940 ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 3000 ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg ctgaagccag 3060 ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 3120 gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 3180 ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 3240 tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 3300 ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 3360 gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 3420 tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 3480 cgcgagaacc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 3540 ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 3600 gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 3660 caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 3720 gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 3780 ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 3840 tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 3900 caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 3960 tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 4020 cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 4080 ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 4140 aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 4200 tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 4260 gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 4320 gaaaagtgcc ac 4332 <210> 11 <211> 5520 <212> DNA <213> Artificial Sequence <220> <223> AAVS1-C_A24_6xH vector V1.F.8 <400> 11 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 atttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag atagaccga 120 gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180 gggaagggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240 gctgcaaggc gattaagttg ggtaacgcca gggttttcc agtcacgacg ttgtaaaacg 300 acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360 aggccgcatg aattgctgcc caaggatgct ctttccggag cacttccttc tcggcgctgc 420 accacgtgat gtcctctgag cggatcctcc ccgtgtctgg gtcctctccg ggcatctctc 480 ctccctcacc caaccccatg ccgtgttcac tcgctgggtt cccttttcct tctccttctg 540 gggcctgtgc catctctcgt ttcttaggat ggccttctcc gacggatgtc tcccttgcgt 600 cccgcctccc cttcttgtag gcctgcatca tcaccgtttt tctggacaac cccaaagtac 660 cccgtctccc tggcttagca cctctccatc ctcttgcttt ctttgcctgg acaccccgtt 720 ctcctgtgga ttcgggtcac ctctcactcc tttcatttgg gcagctcccc tacccccctt 780 acctctctag tctgtgctag ctcttccagc cccctgtcat ggcatcttcc aggggtccga 840 gagctcagct agtcttcttc ctccaacccg ggccctatgt ccacttcagg acagcatgtt 900 tgctgcctcc agggatcctg tgtccccgag ctgggaccac cttatattcc cagggccggt 960 taatgtggct ctggttctgg gtacttttat ctgtcccctc caccggtata gtaatcaatt 1020 acggggtcat tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat 1080 ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat gacg...

Claims

1. A multi-component system in which a first component is a genetically engineered antigen-presenting cell (eAPC) (referred to as component A), and a second component is a gene donor vector (referred to as component C) and a further gene donor vector (referred to as component E) for delivery of one or more ORFs encoding an analyte antigen-presenting complex (aAPX) and / or an analyte antigenic molecule (aAM), wherein component A is a. lacking endogenous surface expression of at least one family of aAPXs and / or aAMs; b. contains at least two genomic acceptor sites (designated component B and component D) for the integration of at least one ORF, each encoding at least one aAPX and / or aAM; Component C matches component B, component E matches component D, and components C and E c. a single ORF encoding at least one aAPX and / or aAM, or d. Two or more ORFs encoding at least one aAPX and / or aAM It is designed to deliver Component C contains one or more aAPX ORFs to obtain cells expressing aAPX on the cell surface (referred to as eAPC-p), and component E contains one or more aAM ORFs to obtain cells expressing aAPX and aAM and / or aAPX:aAM (referred to as eAPC-pa), Components B and D are synthetic constructs designed for recombinase-mediated exchange (RMCE), and analyte aAPX and / or analyte aAM can be expressed by component A and identified based on the reactivity of a TCR or other affinity reactant (or analyte TC) to the APX and / or aAM expressed by component A, in a multi-component system.

2. A multi-component system in which a first component is a genetically engineered antigen-presenting cell (eAPC) (referred to as component A), and a second component is a gene donor vector (referred to as component C) and a further gene donor vector (referred to as component E) for delivery of one or more ORFs encoding an analyte antigen-presenting complex (aAPX) and / or an analyte antigenic molecule (aAM), wherein component A is a. lacking endogenous surface expression of at least one family of aAPXs and / or aAMs; b. contains at least two genomic acceptor sites (designated component B and component D) for the integration of at least one ORF, each encoding at least one aAPX and / or aAM; Component C matches component B, component E matches component D, and components C and E c. a single ORF encoding at least one aAPX and / or aAM, or d. Two or more ORFs encoding at least one aAPX and / or aAM It is designed to deliver Component C contains one or more aAM ORFs to obtain cells expressing aAM on the cell surface or intracellularly (referred to as eAPC-a), and component E contains one or more aAPX ORFs to obtain cells expressing aAPX and aAM and / or aAPX:aAM (referred to as eAPC-pa), Components B and D are synthetic constructs designed for recombinase-mediated exchange (RMCE), a multi-component system in which analyte aAPX and / or analyte aAM can be expressed by component A and identified based on the reactivity of a TCR or other affinity reactant (or analyte TC) to the APX and / or aAM expressed by component A.

3. 3. The multicomponent system of claim 1 or 2, wherein c and / or d encode a selectable marker for integration such that the ORF can be stably integrated into components B and / or D and aAPX and / or aAM are expressed.

4. A multi-component system according to any one of claims 1 to 3, wherein one or more additional genomic acceptor sites and matching gene donor vectors are added as additional components.

5. aAPX is: a. One or more members of HLA class I b. One or more members of HLA class II c. one or more non-HLA antigen-presenting complexes, or d. Any combination of a, b, and c The multi-component system according to any one of claims 1 to 4, wherein

6. aAM is below: a. A polypeptide or a complex of polypeptides that serves as the analyte antigen b. Peptides derived from polypeptides that serve as analyte antigens c. Peptides serving as analyte antigens d. Metabolites serving as analyte antigens e. A polypeptide or a complex of polypeptides translated from the analyte antigenic molecule ORF f. Peptides derived from polypeptides translated from the analyte antigenic molecule ORF g. Peptides derived from alterations of the component A proteome h. Polypeptides resulting from alterations of the component A proteome i. Metabolites resulting from alterations of the Component A metabolome and / or combinations thereof The multi-component system according to any one of claims 1 to 5, selected from:

7. Components B and / or D are the following genetic elements: a. Heterospecific recombinase site b. homology arm c. Eukaryotic promoters d. Eukaryotic Conditional Regulatory Elements e. Eukaryotic terminator f. Selectable marker g. splice acceptor site h. splice donor site i. Non-protein-coding genes j. Insulator k. Mobile Genetic Elements l. Meganuclease Recognition Site m. Internal ribosome entry site (IRES) n. viral self-cleaving peptide element o. Kozak consensus sequence The multi-component system according to any one of claims 1 to 6, comprising at least one of:

8. Components B and / or D are for RMCE integration of a single ORF, and are as follows: a. Eukaryotic promoters b. A pair of heterospecific recombinase sites c. Kozak consensus sequence d. Selectable marker e. Eukaryotic terminator The multi-component system according to any one of claims 1 to 7, comprising:

9. Components C and / or E are for RMCE integration of a single ORF and contain the following genetic elements: a. A pair of heterospecific recombinase sites b. Kozak consensus sequence c. Antibiotic Resistance Cassette d. Bacterial origin of replication e. Cloning sites for the introduction of a single ORF encoding one or more aAPX and / or aAM and / or a selectable marker for integration. The multi-component system according to any one of claims 1 to 8, comprising:

10. The multi-component system of claim 1, wherein two or more components C each contain an ORF encoding a different aAPX, and / or two or more components E each contain an ORF encoding a different aAM, so that two or more components C and / or two or more components E can deliver multiple ORFs encoding a library of aAPXs and / or aAMs to components B and / or D.

11. The multi-component system of claim 2, wherein two or more components C each contain an ORF encoding a different aAM, and / or two or more components E each contain an ORF encoding a different aAPX, so that two or more components C and / or two or more components E can deliver multiple ORFs encoding a library of aAPXs and / or aAMs to components B and / or D.

12. a. combining component A with one or more components E, in combination with integration factors, wherein the one or more components E comprise one or more ORFs encoding one or more aAMs, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the gain of expression of one or more aAMs d. Selecting for the acquisition of one or more integrated selectable markers At least one of A method for producing eAPC-pa as defined in claim 1, comprising:

13. 13. The method of claim 12, comprising b and d.

14. 14. The method of claim 12 or 13, wherein one or more components E comprise an ORF encoding a single aAM in step a.

15. The method of claim 14, wherein step a is performed multiple times to obtain a library of discrete and defined eAPC-pas, and each time step a is performed using a different aAM so as to obtain a different eAPC-pa.

16. The method of claim 12 or 13, wherein one or more components E contain one or more ORFs encoding two or more different aAMs in step a to obtain a library, wherein the library comprises a mixed population of eAPC-pas, each eAPC-pa expressing a single aAM from the pool used in step a.

17. a. combining component A with one or more components E, in combination with integration factors, wherein the one or more components E comprise one or more ORFs encoding one or more aAPXs, and b. Selecting for loss of the genomic acceptor site selectable marker c. Selecting for the gain of surface expression of one or more aAPXs. d. Selecting for the acquisition of one or more integrated selectable markers A method for producing eAPC-pa as defined in claim 2, comprising at least one of the following:

18. 18. The method of claim 17, comprising steps b, c, and d.

19. 19. The method of claim 17 or 18, wherein one or more components E comprise an ORF encoding a single aAPX in step a.

20. The method of claim 19, wherein step a is performed multiple times to obtain a library of discrete and defined eAPC-pas, and each time step a is performed using a different aAPX so as to obtain a different eAPC-pa.

21. The method of claim 17 or 18, wherein one or more components E contain one or more ORFs encoding two or more different aAPXs in step a to obtain a library, wherein the library comprises a mixed population of eAPC-pas, each eAPC-pa expressing a single aAPX from the pool used in step a.

22. Use of a multicomponent system according to any one of claims 1 to 11 for the preparation of one or more analytes eAPC-pa.

Images