Biomarker for myasthenia gravis

Biomarkers in the CDR3 regions of CD8-positive TCR α and β chains aid in diagnosing and treating myasthenia gravis, offering a companion diagnostic tool for personalized treatment and reducing side effects.

JP2025132375APending Publication Date: 2025-09-10DENKA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024029886
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-02-29
Publication Date
2025-09-10

AI Technical Summary

Technical Problem

Current treatments for myasthenia gravis are often burdensome and have significant side effects, with only 6% of patients achieving a full cure, necessitating a less burdensome treatment regimen that minimizes quality of life decline and effectively addresses the disease progression.

Method used

Identification of biomarkers in the CDR3 regions of the α and β chains of the T cell receptor (TCR) in CD8-positive T cells, specifically amino acid and nucleic acid sequences with 90% or more sequence identity to SEQ ID NOs 1-10, for diagnosing and treating myasthenia gravis.

Benefits of technology

Provides a companion diagnostic tool for myasthenia gravis, enabling personalized treatment selection by identifying disease progression and minimizing side effects, thus improving patient quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025132375000005
    Figure 2025132375000005
  • Figure 2025132375000006
    Figure 2025132375000006
  • Figure 2025132375000007
    Figure 2025132375000007
Patent Text Reader

Abstract

To provide a biomarker for myasthenia gravis.SOLUTION: A method for assisting diagnosis of myasthenia gravis, comprises measuring at least one selected from the group consisting of a protein comprising an amino acid sequence having at least 90% sequence identity with a specific amino acid sequence and a nucleic acid comprising a base sequence having at least 90% sequence identity with a specific base sequence in a sample derived from a subject.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to biomarkers for myasthenia gravis. [Background technology]

[0002] Myasthenia gravis (MG) is an organ-specific autoimmune disease directed against molecules on the postsynaptic membrane of the neuromuscular junction. The main symptoms of myasthenia gravis are muscle weakness and easy fatigability, which are mainly seen in the eyes and surrounding areas (ptosis, diplopia), as well as in the limbs and trunk. Myasthenia gravis is designated as an intractable disease in Japan.

[0003] In myasthenia gravis, autoantibodies are produced in the patient's body against acetylcholine receptors (AChRs) and muscle-specific receptor tyrosine kinases (MuSKs), molecules present in the postsynaptic membrane of the neuromuscular junction, and these antibodies inhibit neurotransmission, resulting in various symptoms. It is known that autoantibodies against AChRs account for approximately 80% of cases of myasthenia gravis.

[0004] For example, Non-Patent Document 1 discloses biomarkers expressed in CD4-positive T cells of patients with myasthenia gravis. Non-Patent Document 2 discloses types of T cells associated with myasthenia gravis and cytokines whose expression is increased in myasthenia gravis. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] WanlinJin et al., "Single-cell RNA-Seq reveals transcriptional heterogeneity and immune subtypes associated with diseaseactivity in human myasthenia gravis", Cell Discov. 7:85 (2021). [Non-patent document 2] SoniaBerrih-Aknin et al., "Myasthenia gravis: a comprehensive review of immune dysregulation and etiological mechanisms", Journal of Autoimmunity 52,90-100 (2014). [Non-patent document 3] JezabelVarade et al., "Novel genetic loci associated HLA-B*08:01 positivemyasthenia gravis", Journal of Autoimmunity 88, 43-49 (2018). Summary of the Invention [Problem to be solved by the invention]

[0006] Only 6% of patients with myasthenia gravis are fully cured. Therefore, the remaining majority of patients must continue treatment, even if they are able to return to their daily lives. As such, it cannot be said that there is an established treatment for myasthenia gravis. Furthermore, because continuous treatment is often required, there is a need to establish a treatment regimen that is less burdensome for patients and that can prevent a decline in their quality of life (QOL).

[0007] Currently used therapeutic agents for myasthenia gravis include antibody drugs, immunosuppressants, steroids, and cholinesterase inhibitors. Among these, antibody drugs, immunosuppressants, and steroids are known to cause side effects because they may also affect the normal immune system. Furthermore, while cholinesterase inhibitors are effective in alleviating symptoms, their effects are, in principle, temporary, and they are intended as symptomatic treatment rather than a cure. Therefore, in order to achieve a complete cure of myasthenia gravis while minimizing the decline in the patient's quality of life by alleviating symptoms and suppressing side effects, it is considered important to appropriately select the above-mentioned drugs according to each patient and the progression of symptoms.

[0008] The present disclosure aims to provide biomarkers for myasthenia gravis. [Means for solving the problem]

[0009] The present inventors discovered biomarkers specific to patients with myasthenia gravis in the CDR3 regions of the α chain (TCRα) and β chain (TCRβ) of the T cell receptor (TCR) in CD8-positive T cells.

[0010] The present disclosure relates, for example, to the following: [1] A method for assisting in the diagnosis of myasthenia gravis, comprising measuring, in a sample derived from a subject, (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. [2] A method for obtaining data for diagnosing myasthenia gravis, comprising measuring, in a sample derived from a subject, (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. [3] A method for diagnosing myasthenia gravis, comprising measuring in a sample derived from a subject (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. [4] The method according to any one of [1] to [3], wherein, when (a) and / or (b) are detected in the sample, it indicates that the subject is likely to suffer from myasthenia gravis. [5] A method according to any one of [1] to [3], wherein, when (a) and (b) are detected in the sample, it indicates that the subject is likely to suffer from myasthenia gravis. [6] A method for treating myasthenia gravis, comprising measuring (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, in a sample derived from the subject; and administering a therapeutic drug for myasthenia gravis to the subject from whom the sample in which (a) and / or (b) were detected was derived. [7] The method according to any one of [1] to [6], wherein measuring (a) and / or (b) above means measuring (a) and (b) above. [8] The method according to any one of [1] to [7], wherein the protein in (a) above is TCRα. [9] The method according to any one of [1] to [8], wherein the nucleic acid in (a) above is a nucleic acid encoding TCRα.

[10] The method according to any one of [1] to [9], wherein the protein in (b) above is TCRβ.

[11] The method according to any one of [1] to

[10] , wherein the nucleic acid in (b) above is a nucleic acid encoding TCRβ.

[12] The method according to any one of [1] to

[11] , wherein (a) above includes a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 1, and (b) above includes a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 3.

[13] The method according to any one of [1] to

[11] , wherein (a) above includes a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2, and (b) above includes a protein comprising an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 4.

[14] The method according to any one of [1] to

[11] , wherein (a) above comprises a nucleic acid comprising a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6, and (b) above comprises a nucleic acid comprising a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 8 or SEQ ID NO: 9.

[15] The method according to any one of [1] to

[11] , wherein (a) above comprises a nucleic acid comprising a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 7, and (b) above comprises a nucleic acid comprising a base sequence having 90% or more sequence identity with the base sequence shown in SEQ ID NO: 10.

[16] The method according to any one of [1] to

[15] , wherein measuring (a) and / or (b) includes measuring both (a) and (b) for each cell.

[17] The method according to any one of [1] to

[16] , wherein measuring (a) and / or (b) comprises determining whether one protein complex has both (a) and (b).

[18] The method according to

[17] , wherein the one protein complex is one TCR.

[19] The method according to any one of [1] to

[18] , wherein (a) and (b) are expressed on CD8-positive T cells.

[20] The method according to any one of [1] to

[19] , wherein the myasthenia gravis is early-onset myasthenia gravis.

[21] The method according to any one of [1] to

[20] , wherein the myasthenia gravis is positive for anti-acetylcholine receptor antibodies.

[22] The method according to any one of [1] to

[21] , wherein the subject is a Caucasian subject.

[23] The method according to any one of [1] to

[22] , wherein the subject has at least one HLA allele selected from the group consisting of HLA-B*08:01, HLA-A*01:01, HLA-C*07:01, HLA-DRB1*03:01, HLA-DRB3*01:01, HLA-DQA1*05:01, and HLA-DQB1*02:01.

[24] The method according to any one of [1] to

[23] , wherein the subject has an HLA allele of HLA-B*08:01.

[25] The method according to any one of [1] to

[24] , wherein the myasthenia gravis is myasthenia gravis accompanied by activation of cellular immunity.

[26] A diagnostic kit for myasthenia gravis, comprising: (a') at least one selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and a primer for amplifying a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7; and / or (b') at least one selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and a primer for amplifying a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[27] The kit according to

[26] , further comprising an attached document stating that the kit is used in the method according to any one of [1] to

[25] . [Effects of the Invention]

[0011] According to the present disclosure, a biomarker for myasthenia gravis is provided. Such a biomarker is useful as a companion diagnostic or an indicator for diagnosing the progression of myasthenia gravis in patients. That is, such a biomarker is useful as information for selecting a medication to be administered to a patient with myasthenia gravis.

[0012] The present disclosure also provides a method for assisting in the diagnosis of myasthenia gravis, which includes measuring such a biomarker for myasthenia gravis, and a method for obtaining data for diagnosing myasthenia gravis, as well as kits for the same. [Brief explanation of the drawings]

[0013] [Figure 1] FIG. 1 shows clusters of whole cells in a specimen derived from a myasthenia gravis patient subjected to single-cell RNA analysis in an example. [Figure 2] FIG. 1 shows the expression levels of marker genes used for cell type annotation for each cluster in the Examples. [Figure 3] FIG. 1 shows the results of hierarchical clustering of the amino acid sequences of the α and β chains of TCR in an example. DETAILED DESCRIPTION OF THE INVENTION

[0014] Hereinafter, embodiments for carrying out the present disclosure will be described, but the present disclosure is not limited to the following embodiments.

[0015] <Sequence identity> In the present disclosure, "sequence identity" refers to the percentage (%) of identical residues or bases in overlapping amino acid sequences or nucleotide sequences in optimal alignment of two amino acid sequences or two nucleotide sequences. In the present disclosure, a mutation in an amino acid sequence or nucleotide sequence that does not have 100% sequence identity with a certain amino acid sequence or nucleotide sequence may be, for example, a substitution, deletion, or insertion of an amino acid residue or nucleotide base, or more specifically, a substitution, deletion, or insertion of a single residue or nucleotide, and such deletion or insertion may occur at or other than the end of the amino acid sequence or nucleotide sequence.

[0016] <Diagnostic aid method> A first aspect of the present disclosure is a method for assisting in the diagnosis of myasthenia gravis (hereinafter also referred to as the "diagnostic assistance method of the first aspect"), comprising measuring (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, in a sample derived from a subject (measuring step).

[0017] <Biomarkers> The diagnostic auxiliary method of the first aspect comprises measuring (a) and / or (b). (a) and (b) are biomarkers specific to myasthenia gravis patients. Thus, the diagnostic auxiliary method of the first aspect can assist in the diagnosis of myasthenia gravis by including measuring (a) and / or (b). The diagnostic auxiliary method of the first aspect may include measuring (a) and (b).

[0018] The above (a) is at least one selected from the group consisting of proteins comprising an amino acid sequence with 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and nucleic acids comprising a nucleotide sequence with 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7. The above (b) is at least one selected from the group consisting of proteins comprising an amino acid sequence with 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and nucleic acids comprising a nucleotide sequence with 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10. SEQ ID NO:5 and SEQ ID NO:6 are nucleic acids encoding SEQ ID NO:1 in myasthenia gravis patients. SEQ ID NO:7 is a nucleic acid encoding SEQ ID NO:2 in myasthenia gravis patients. SEQ ID NO:8 and SEQ ID NO:9 are nucleic acids encoding SEQ ID NO:3 in myasthenia gravis patients. SEQ ID NO:10 is a nucleic acid encoding SEQ ID NO:4 in myasthenia gravis patients. SEQ ID NO: 1: CAAYQTGANNLFF SEQ ID NO: 2: CASYQTGANNLFF SEQ ID NO: 3: CAIRTGTDNEQFF SEQ ID NO: 4: CAIRTGSDNEQFF SEQ ID NO: 5: TTGCTGCCTATCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 6: TGTGCTGCCTACCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 7: TGTGCGTCCTATCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 8: TGTGCCATCAGGACTGGGACGGACAATGAGCAGTTCTTC SEQ ID NO: 9: TGTGCCATCAGGACCGGGACAGACAATGAGCAGTTCTTC SEQ ID NO: 10: TGTGCCATCAGAACAGGGTCGGACAATGAGCAGTTCTTC

[0019] In the present disclosure, when the amino acid sequences in (a) and (b) above have 90% or more sequence identity to a predetermined amino acid sequence (e.g., the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2, or SEQ ID NO:3 or SEQ ID NO:4), the amino acid sequence may have a sequence identity of more than 90% to the predetermined amino acid sequence, for example, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity. Furthermore, when the amino acid sequences in (a) and (b) above have 90% or more sequence identity to a predetermined amino acid sequence (e.g., the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2, or SEQ ID NO:3 or SEQ ID NO:4), the amino acid sequence may be, for example, the predetermined amino acid sequence or an amino acid sequence comprising one or two mutations in the predetermined amino acid sequence, and in a preferred embodiment, the predetermined amino acid sequence or an amino acid sequence comprising one mutation in the predetermined amino acid sequence.

[0020] In the present disclosure, when the base sequences in (a) and (b) above have a sequence identity of 90% or more to a predetermined base sequence (for example, the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10), the base sequence may have a sequence identity of more than 90% to the predetermined base sequence, for example, the sequence identity may be 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100%. Furthermore, when the base sequences in (a) and (b) above have a sequence identity of 90% or more with a predetermined base sequence (for example, the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10), the base sequence may be, for example, the predetermined base sequence or a base sequence containing one, two, three, four, or five base mutations in the predetermined base sequence, and in a preferred embodiment, the base sequence may be the predetermined base sequence or a base sequence containing one or two base mutations in the predetermined base sequence.

[0021] The amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 were found in the CDR3 region of the α chain (TCRα, TRA) of the T cell receptor (TCR) in CD8+ T cells of a myasthenia gravis patient. Thus, in one embodiment, the protein in (a) above may be TCRα. In one embodiment, the nucleic acid in (a) above may be a nucleic acid encoding TCRα. Also, in one embodiment, the amino acid sequence in (a) above may be the amino acid sequence of the CDR3 region of TCRα. In one embodiment, the base sequence in (a) above may be a base sequence encoding the CDR3 region of TCRα. Also, in one embodiment, (a) above may be expressed in CD8-positive T cells.

[0022] The amino acid sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 were found in the CDR3 region of the β chain (TCRβ, TRB) of the T cell receptor (TCR) in CD8+ T cells of a myasthenia gravis patient. Thus, in one embodiment, the protein in (b) above may be TCRβ. In one embodiment, the nucleic acid in (b) above may be a nucleic acid encoding TCRβ. Also, in one embodiment, the amino acid sequence in (b) above may be the amino acid sequence of the CDR3 region of TCRβ. In one embodiment, the nucleotide sequence in (b) above may be a nucleotide sequence encoding the CDR3 region of TCRβ. Also, in one embodiment, (b) above may be expressed in CD8-positive T cells (CD8+ T cells).

[0023] Here, in autoimmune diseases, CD4+ T cells, which contribute to antibody production, among immune cells, play a central role in degrading muscle receptors by autoantibodies. Therefore, previous searches for biomarkers for autoimmune diseases have focused on proteins and nucleic acids expressed in CD4+ T cells. In contrast, the biomarkers related to the diagnostic support method of the first aspect (above (a) and / or above (b)) were discovered in CD8+ T cells of patients with myasthenia gravis. That is, above (a) and / or above (b) were discovered by the inventors' unique approach of attempting to identify autoimmune diseases from proteins and nucleic acids expressed in CD8+ T cells.

[0024] A clonotype in which the CDR3 region of TCRα comprises the amino acid sequence set forth in SEQ ID NO: 1 and the CDR3 region of TCRβ comprises the amino acid sequence set forth in SEQ ID NO: 3 has been found uniquely in CD8+ T cells of patients with myasthenia gravis. Thus, in one embodiment, (a) above may comprise a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, and (b) above may comprise a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 3. Furthermore, in one embodiment, (a) above may comprise a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 6, and (b) above may comprise a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 9.

[0025] A clonotype in which the CDR3 region of TCRα comprises the amino acid sequence set forth in SEQ ID NO: 2 and the CDR3 region of TCRβ comprises the amino acid sequence set forth in SEQ ID NO: 4 has been found uniquely in CD8+ T cells of patients with myasthenia gravis. Thus, in one embodiment, (a) above may comprise a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 2, and (b) above may comprise a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 4. Furthermore, in one embodiment, (a) above may comprise a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7, and (b) above may comprise a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 10.

[0026] As described above, in one embodiment, (a) and (b) may be expressed in CD8-positive T cells. Also, in one embodiment, measuring (a) and / or (b) may include determining whether one protein complex has both (a) and (b). In this case, the one protein complex may be one TCR. Also, in one embodiment, measuring (a) and / or (b) may include determining both (a) and (b) for each cell.

[0027] <Subject / Sample> In the measuring step in the diagnostic auxiliary method of the first aspect, the above (a) and / or (b) is measured in a sample derived from a subject.

[0028] The subject of the diagnostic assistance method of the first aspect is a human subject. The human subject is not particularly limited, and may be a human subject who has been definitively diagnosed with myasthenia gravis, a human subject who may be suffering from myasthenia gravis, or a human subject whose presence or absence of myasthenia gravis is unknown.

[0029] In one embodiment, a subject for use in the diagnostic support method of the first aspect may have at least one, two, three, four, or five HLA alleles selected from the group consisting of HLA-B*08:01, HLA-A*01:01, HLA-C*07:01, HLA-DRB1*03:01, HLA-DRB3*01:01, HLA-DQA1*05:01, and HLA-DQB1*02:01. Also, in one embodiment, a subject for use in the diagnostic support method of the first aspect may have the HLA allele HLA-B*08:01. In one embodiment, the subject of the diagnostic support method of the first aspect may have HLA alleles of HLA-B*08:01, HLA-A*01:01, HLA-C*07:01, HLA-DRB1*03:01, HLA-DRB3*01:01, HLA-DQA1*05:01, and HLA-DQB1*02:01. Human leukocyte antigens (HLA) are major histocompatibility complex (MHC) in humans. In humoral immunity, HLA is exposed to the cell surface of antigen-presenting cells (APCs) in an antigen-bound state, thereby activating the antibody production mechanism against the antigen. Depending on the HLA genotype, human leukocytes have tens of thousands of different genotypes. HLA genotype is one of the risk factors for autoimmune disease, and it is known that people with specific HLA genotypes are more likely to develop autoimmune disease. According to the notation system established by the WHO Nomenclature Committee for Factors of the HLA System, HLA genotypes (alleles) are expressed as follows: "HLA-(gene symbol)*(region 1):(region 2):(region 3):(region 4)." Regions 1 to 4 are each represented by a two-digit number. Region 1 represents the HLA specificity (antigen type), region 2 represents nonsynonymous substitutions (variations in the amino acid sequence within the same antigen type), region 3 represents synonymous substitutions (variations in the exon region that do not result in changes to the encoded amino acid sequence), and region 4 represents base substitutions outside the coding region (variations in the intron region sequence). In this notation, the gene symbol, region 1, and region 2 contain information that directly affects the amino acid sequence of the HLA and are clinically important.

[0030] In one embodiment, the subject of the diagnostic assistance method of the first aspect may be a Caucasian. The above-mentioned HLA alleles may be associated with myasthenia gravis in Caucasians. For example, it has been reported that HLA-B*08 was identified as a high-risk factor for early-onset myasthenia gravis by genome-wide association studies in Caucasians (Non-Patent Document 3).

[0031] The sample used in the diagnostic support method of the first aspect is not limited as long as it can be obtained from a subject and can support the diagnosis of myasthenia gravis by measuring (a) and / or (b), and may be, for example, blood, plasma, serum, lymph, bone marrow fluid, cerebrospinal fluid, or saliva. In a preferred embodiment, the sample may be blood, plasma, serum, or lymph. For example, when (a) and (b) are proteins, the sample may be blood, plasma, serum, lymph, bone marrow fluid, cerebrospinal fluid, or saliva, or a sample containing a protein prepared therefrom. For example, when (a) and (b) are nucleic acids, the sample may be blood, plasma, serum, lymph, bone marrow fluid, cerebrospinal fluid, or saliva, or a sample containing a nucleic acid prepared therefrom.

[0032] Furthermore, when measuring (a) and / or (b) above includes measuring both (a) and (b) above for each cell, the sample may be a sample containing cells collected from blood, plasma, serum, lymph, bone marrow fluid, cerebrospinal fluid, or saliva, and may be, for example, a cell population or cell suspension. Such a cell population may be, for example, human peripheral blood mononuclear cells (human PBMCs). Human PBMCs are obtained by separation from human peripheral blood and contain various mononuclear cells that constitute the immune system, such as lymphocytes, monocytes, and dendritic cells. Human PBMCs can be isolated from blood (e.g., peripheral blood) collected from a human subject by methods commonly used by those skilled in the art, such as by removing plasma components, red blood cells, platelets, and polymorphonuclear granulocytes (neutrophils, basophils, eosinophils, etc.) from peripheral blood.

[0033] <Myasthenia gravis> In one embodiment, the myasthenia gravis in the diagnostic aid method of the first aspect may be early-onset myasthenia gravis, which is a type of myasthenia gravis that develops in subjects aged 10 to 49 years.

[0034] In one embodiment, myasthenia gravis in the diagnostic support method of the first aspect may be anti-acetylcholine receptor antibody-positive. In other words, myasthenia gravis in the diagnostic support method of the first aspect may be caused by overproduction of anti-acetylcholine receptor antibodies. Anti-acetylcholine receptor antibody positivity in myasthenia gravis can be determined by a method commonly used clinically for myasthenia gravis, such as enzyme-linked immunosorbent assay (ELISA) or radioimmunoassay (RIA) using a subject's blood sample. Acetylcholine receptors (AChRs) are receptors that play an essential role in neurotransmission, transmitting information between neurons by binding extracellularly secreted acetylcholine. In autoimmune diseases in which antibodies against acetylcholine receptors are overproduced, neurotransmission mediated by acetylcholine receptors is partially inhibited, resulting in the development of various symptoms. Furthermore, it is known that acetylcholine receptors, particularly the α1 subunit of the human acetylcholine receptor (human AChRα1), are recognized as an autoantigen in approximately 80% of patients with early-onset myasthenia gravis.

[0035] The present inventors have found that CD8+ T cells are activated in patients with myasthenia gravis. Furthermore, CD8+ T cells play a central role in cellular immunity as effector CD8+ T cells, memory CD8+ T cells, and the like. Thus, in one embodiment, myasthenia gravis diagnosed in the diagnostic aid method of the first aspect may be myasthenia gravis accompanied by activation of cellular immunity.

[0036] Measurement and Usefulness The measurement of (a) and (b) in a sample can be carried out according to a method commonly used by those skilled in the art for measuring proteins or nucleic acids, examples of which are given below.

[0037] When (a) and (b) are nucleic acids, an example of a measurement method is the single-cell RNA sequencing method. The single-cell RNA sequencing method involves extracting mRNA from individual cells and determining its base sequence using a next-generation sequencer (NGS) to measure the mRNA expression pattern for each cell. This measurement method allows both (a) and (b) to be measured for each cell. Furthermore, by comparing the obtained mRNA expression pattern with a known genome database, information on changes in protein expression levels and amino acid sequences for each cell can be obtained. Furthermore, by analyzing the obtained mRNA expression pattern and information using statistical techniques such as clustering, the expression patterns in cells for each sample can be compared and analyzed. A suitable single-cell RNA sequencing analysis method is, for example, the single-cell RNA sequencing VDJ analysis method, which is optimized for the detection and analysis of TCRs.

[0038] When (a) and (b) are nucleic acids, the measurement method can be exemplified by PCR. For example, by real-time PCR using a primer set that amplifies the nucleic acid to be measured but does not amplify the corresponding nucleic acid derived from a subject not suffering from myasthenia gravis, (a) and (b) can be measured using the presence or absence and rate of nucleic acid amplification as indicators. Alternatively, by TaqMan probe method using the same primers, (a) and (b) can be measured using fluorescence intensity as an indicator.

[0039] When (a) and (b) are proteins, an example of a measurement method is ELISA. In ELISA, one antibody is immobilized on a substrate, the analyte is brought into contact with the antibody to trap it, and then the other antibody is brought into contact with the analyte to allow binding. The analyte is then labeled with an enzyme such as luciferase and a luminescent substrate is added, allowing measurement (quantification) of the analyte. For example, (a) can be measured by using, as one of the antibodies used in ELISA, an antibody that specifically binds to a protein containing an amino acid sequence that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 in (a). For example, (b) can be measured by using, as one of the antibodies used in ELISA, an antibody that specifically binds to a protein containing an amino acid sequence that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 in (b). Furthermore, by using as one antibody in the ELISA an antibody that specifically binds to a protein comprising an amino acid sequence that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 in (a) above, and by using as the other antibody an antibody that specifically binds to a protein comprising an amino acid sequence that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 in (b) above, it is possible to measure the above (a) and (b) possessed by one protein complex (TCR).

[0040] In the diagnostic aid method of the first aspect, detection of (a) and / or (b) in a sample may indicate that the subject is likely to be affected by myasthenia gravis, and detection of (a) and (b) in a sample may indicate that the subject is likely to be affected by myasthenia gravis. For example, detection of (a) or (b) in a sample may mean that the measurement value obtained by the measurement method described above is larger than that of a sample derived from a subject not affected by myasthenia gravis.

[0041] The diagnostic support method of the first aspect can be used to support the diagnosis of the severity (progression) of myasthenia gravis, for example, in patients with myasthenia gravis. In other words, the above (a) and (b) of the diagnostic support method of the first aspect can be used as surrogate markers. Drugs for treating myasthenia gravis include antibody drugs, immunosuppressants, steroids, and cholinesterase inhibitors. However, some of these drugs have significant side effects, and others are primarily used for symptomatic treatment. Therefore, in order to achieve a complete cure of myasthenia gravis by appropriately selecting and combining these drugs to alleviate symptoms and suppress side effects, thereby minimizing a decline in the patient's quality of life, it is important to accurately grasp the severity (progression) of myasthenia gravis in real time. In this regard, the diagnostic support method of the first aspect can support the diagnosis of the severity (progression) of myasthenia gravis. Therefore, the diagnostic support method of the first aspect can be used as a method for obtaining indicators for the above-mentioned treatments and drug selection.

[0042] The diagnostic support method of the first aspect can be used for companion diagnosis, for example, in patients with myasthenia gravis. As described above, since multiple treatment options are available for myasthenia gravis, an index for selecting an appropriate treatment for each patient is useful for selecting an appropriate treatment. In this regard, the above-mentioned (a) and (b) of the diagnostic support method of the first aspect are biomarkers found in the T cell receptor (TCR) of CD8+ T cells in myasthenia gravis patients with activated cellular immunity (activated CD8+ T cells). Therefore, the diagnostic support method of the first aspect is considered to be usable for so-called companion diagnosis, which obtains information on whether or not cellular immunity is activated in myasthenia gravis patients. For example, for a myasthenia gravis patient determined to have activated cellular immunity by the diagnostic support method of the first aspect, it is possible to select a treatment appropriate for patients with activated cellular immunity.

[0043] <Other aspects> In one embodiment, the first aspect of the present disclosure may be a method for obtaining data for diagnosing myasthenia gravis, comprising measuring (a) and / or (b) above in a sample derived from a subject. In one embodiment, the first aspect of the present disclosure may also be a method for diagnosing myasthenia gravis, comprising measuring (a) and / or (b) above in a sample derived from a subject. In these methods, the biomarkers (a) and / or (b) above), subjects, samples, myasthenia gravis, measurement, and usefulness are the same as those described in the diagnostic assistance method of one aspect of the present disclosure.

[0044] <Treatment method> A second aspect of the present disclosure is a method for treating myasthenia gravis, comprising measuring, in a sample derived from a subject, (a) at least one selected from the group consisting of a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and a nucleic acid comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence having 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and a nucleic acid comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10 (measurement step), and administering a therapeutic agent for myasthenia gravis to the subject from whom the sample in which (a) and / or (b) was detected was derived (administration step). The measurement step can be performed in the same manner as in the diagnostic support method of the first aspect. The subject may be the same subject as in the diagnostic support method of the first aspect.

[0045] In the administration step, a therapeutic drug for myasthenia gravis is administered to the subject from whom the sample in which (a) and / or (b) above was detected was derived. Detection of (a) and / or (b) above can be determined in the same manner as described in the diagnostic aid method of the first aspect.

[0046] The therapeutic drug for myasthenia gravis is not particularly limited as long as it is a drug commonly used in the treatment of myasthenia gravis. For example, the therapeutic drug for myasthenia gravis may be at least one selected from the group consisting of antibody drugs, immunosuppressants, steroids, cholinesterase inhibitors, and proteasome inhibitors. For example, the therapeutic drug for myasthenia gravis may be a therapeutic drug for myasthenia gravis described in the "Myasthenia Gravis / Lambert-Eaton Myasthenic Syndrome Clinical Practice Guidelines 2022" (Japanese Society of Neurology, 2022).

[0047] For example, the antibody drug may be an anti-CD20 antibody, an anti-CD19 antibody, an anti-IL-6 receptor antibody, an anti-complement C5 antibody, or an anti-FcRn antibody, or an antigen-binding fragment thereof. An example of an anti-CD20 antibody is rituximab. An example of an anti-CD19 antibody is inebilizumab. An example of an anti-IL-6 receptor antibody is satralizumab. An example of an anti-complement C5 antibody is eculizumab. An example of a formulation containing an anti-FcRn antibody is rozanolixizumab. An example of a formulation containing an antigen-binding fragment of an anti-FcRn antibody is efgartigimod alfa.

[0048] Examples of immunosuppressants include azathioprine, cyclophosphamide, mycophenolate mofetil, cyclosporine, tacrolimus, and methotrexate.

[0049] The steroid may be an oral steroid or a parenteral steroid.

[0050] Examples of cholinesterase inhibitors include pyridostigmine (brand name of bromide preparation: Mestinon), distigmine (brand name of bromide preparation: Ubretide), ambenonium (brand name of chloride preparation: Mytelase), and neostigmine (brand name of chloride preparation: Vagostigmine).

[0051] An example of a proteasome inhibitor is bortezomib.

[0052] The administration method (dosage, administration interval, administration form, administration route, etc.) of the therapeutic agent for myasthenia gravis described above may be performed according to the method commonly used by those skilled in the art in the treatment of myasthenia gravis. For example, the therapeutic agent for myasthenia gravis may be administered according to the method described in its package insert. For example, the therapeutic agent for myasthenia gravis may be administered according to the method described in the "Myasthenia Gravis / Lambert-Eaton Myasthenic Syndrome Clinical Practice Guidelines 2022" (Japanese Society of Neurology, 2022).

[0053] <Kit> A third aspect of the present disclosure is a diagnostic kit for myasthenia gravis, comprising: (a') at least one primer selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and a primer for amplifying a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7; and / or (b') at least one primer selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and a primer for amplifying a nucleic acid comprising a nucleotide sequence that has 90% or more sequence identity to the nucleotide sequence shown in SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10. The kit according to the third aspect of the present disclosure can be used, for example, in the diagnostic adjunct method of the first aspect and the therapeutic method of the second aspect. The antibody or antigen-binding fragment thereof and the primer can be obtained, designed, and obtained according to methods commonly used by those skilled in the art.

[0054] In the present disclosure, an antigen-binding fragment refers to a portion of an antibody that recognizes an antigen and includes the variable domain of the antibody or at least the antigen-binding region. For example, antigen-binding fragments include Fab, F(ab') 2 , Fab', scFv or V HH It may be a region fragment.

[0055] In one embodiment, the kit of the third aspect may further include a package insert describing use in one embodiment of the diagnostic aid method of the first aspect or the therapeutic method of the second aspect. The package insert may be electronic. [Example]

[0056] The present invention will be specifically explained below by showing examples, but the present invention is not limited to these examples.

[0057] [Preparation of scRNA-seq sequencing libraries] Peripheral blood mononuclear cells (PBMCs) were collected from four patients with myasthenia gravis and six healthy individuals. All four patients were Caucasian, clinically diagnosed with myasthenia gravis, and had detectable anti-AChR antibodies. As shown in Table 1, the age at onset of these four patients was under 50 years, so their myasthenia gravis was classified as early-onset. In Table 1, "Age (sample collection)" indicates the patient's age at the time of PBMC collection. In Table 1, "Age at diagnosis" indicates the patient's age at the time of diagnosis. All four patients had the following HLA alleles associated with early-onset myasthenia gravis: <MHC class I> HLA-B*08:01:01 HLA-A*01:01:01:01 HLA-C*07:01:01 <MHC class II> HLA-DRB1*03:01:01 HLA-DRB3*01:01:02 HLA-DQA1*05:01:01:02 HLA-DQB1*02:01:01

[0058] [Table 1]

[0059] Frozen PBMCs were quickly thawed in a 37°C water bath and washed three times with Mg- and Ca-free Dulbecco's PBS (DPBS, Thermo Fisher Scientific Inc., #14190144) containing 0.1% BSA (DPBS / 0.1% BSA). After resuspending in DPBS / 0.1% BSA, residual particles were removed using a 40 μm mesh cell strainer. After confirming cell count and viability, scRNA-seq sequencing libraries were prepared and analyzed according to the following procedure.

[0060] Approximately 10,000 cells were confirmed to have a viability of 80-90%. Gel beads-in-emulsion (GEMs) were generated by incorporating individual cells into a single oil emulsion using the Chromium Controller (10x Genomics). Using the above kit, 65% of the cells were typically incorporated into GEMs. The GEMs were then subjected to reverse transcription to label cDNA with a tag unique to each single-cell emulsion (labeled cDNA). Using the Chromium Next GEM Single Cell 5' Reagent Kits v2 (10x Genomics), the following procedures were followed: reverse transcription to prepare labeled cDNA; amplification of the labeled cDNA; construction of a 5' Gene Expression (GEX) library for single-cell gene expression; and construction of a V(D)J library.

[0061] The resulting libraries were quantified using Qubit dsDNA Assay (ThermoFisher Scientific) and TapeStation D1000 ScreenTape (Agilent Technologies). They were then analyzed on a HiSeq platform (Illumina) with a 150-bp paired-end configuration, generating approximately 350 million paired-end reads per sample. These sequence reads were further trimmed to 26 bp for Read 1 and 90 bp for Read 2, and NGS data were generated.

[0062] For each sample, the obtained NGS data was processed using Cell Ranger (version 6.1.2, 10x Genomics) to obtain the TCR amino acid sequence (reads) and expression information profile.

[0063] [Obtaining cell type annotation information] (Obtaining expression information profiles) We mapped the reads to the human reference genome (GRCh 38) and associated UMIs (Unique Molecular Identifiers, short nucleotide sequence tags unique to each molecule in the library) with gene and cell barcodes to obtain expression profile matrices. These expression profile matrices were then analyzed using Seurat (version 4.1.1), a package for single-cell RNA sequencing data analysis in the statistical software R (version 4.1.3).

[0064] (annotation) Prior to clustering, cells with low data quality were removed. Cells with fewer than 200 detected genes or mitochondrial gene expression levels exceeding 10% of the total were removed. T cell receptor genes, which were not important for the analysis, were also removed from the expression profile matrix. For the selected cells, UMI counts were normalized using the SCTransform function in Seurat, and genes with high variability were selected. To correct for batch differences between samples, the expression profile matrix was processed using the FindIntegrationAnchors and IntegrateData functions in Seurat. Furthermore, principal component analysis was performed using the RunPCA function in Seurat. Considering the contribution rate of principal components, we retained the first 30 principal components for subsequent analysis. Cell clustering was performed using the FindCluster function in Seurat. Cell type annotation was performed to determine which clusters belonged to which cell type by comparing the expression levels of genes commonly known as cell type markers between clusters.

[0065] To visualize the results of clustering and annotation, the expression profiles were reduced in dimension using Uniform Manifold Approximation and Projection (UMAP), a method for reducing dimension, and plotted as shown in Figure 1. As shown in Figure 1, three populations of CD8-positive T cells were observed.

[0066] Figure 2 shows the expression levels of the marker genes used for cell type annotation by cluster. The color of the circles in Figure 2 represents the logarithm of the average expression level, with the color closer to blue indicating a higher level. The size of the circle also indicates the proportion of cells in which the gene is expressed, with larger circles indicating a greater number of cells in which the gene is expressed.

[0067] According to the results in Figure 2, the three populations of CD8+ T cells seen in Figure 1 showed increased expression of the cytotoxic markers GZMA (granzyme A), GZMH (granzyme H), NKG7 (natural killer cell group 7), CTSW (cathepsin W), PRF1 (perforin, perforin-1), and GZMK (granzyme K). The p-values ​​(probability of significance) and avg log2FC (log2 of the expression variation ratio (MG / HC)) of these cytotoxic markers are shown in Tables 2 to 4 below. The results in Figure 2 and Tables 2 to 4 reveal that these cytotoxic markers are significantly increased in myasthenia gravis patients, i.e., CD8+ T cells are activated.

[0068] [Table 2]

[0069] [Table 3]

[0070] [Table 4]

[0071] [Obtaining TCR sequence information] Using Cell Ranger, contigs were constructed from the V(D)J library and aligned to a BCR (B cell receptor) or TCR (T cell receptor) reference to determine each V(D)J segment. After that, the CDR3 region was determined by identifying conserved sequences before and after the CDR3 region for each contig, and TCR sequence information was obtained.

[0072] [Integration of TCR sequence information and cell type annotation information] Using the cell barcodes and unique IDs assigned to each sample from the four patients and six healthy individuals, we linked cell type annotation information to the TCR sequences. This allows us to determine which subtype of T cell the TCR sequence is derived from (e.g., CD8 + cells or CD4 + TCR cells, etc.).

[0073] [Repertoire analysis] (Chronotype identification) To analyze the combined data of TCR sequence information and cell type annotation information and identify clonotypes, we used Scrirpy (provided by the scverse project, https: / / scverse.org / ), a package for TCR or BCR repertoire analysis. First, we used the pp.ir_dist function in Scirpy to calculate the amino acid sequence distance between the sequences of the CDR3 region of the TCR α chain and the CDR3 sequence of the TCR β chain for all cells. BLOSUM62 matrices were used to align the CDR3 sequences and calculate the amino acid sequence distance. Next, we defined the same clonotype as one with matching VJ and VDJ sequences using the tl.define_clonotype_clusters function in Scirpy.

[0074] (Clone size narrowing) When performing clustering, the clonotypes to be clustered were narrowed down by clone size. This is because, in MG patients, clonotypes that react with internal autoantigens, such as AchR-derived peptides, are likely to have undergone clonal expansion. Whether clonal expansion has occurred can be determined by setting a threshold for clone size. The clone size threshold for determining whether clonal expansion has occurred is not particularly limited as long as it is 2 or greater. In this example, clustering was performed by narrowing down only to clonotypes with a clone size of 10 or greater.

[0075] (Clustering) Clustering was performed using TCRdist3, a Python package for analyzing TCRs. TCRdist3 is software developed by Blackwell et al. and published on bioRxiv in 2020 to calculate the distance between TCR sequences. The TCRRep function of TCRdist3 calculated pairwise distances between the amino acid sequences of the TCR α and β chains, and hierarchical clustering was performed using the TCRtree function of TCRdist3 based on these distances. The clustering results are shown in Figure 3.

[0076] (Identification of common clones) As a result of clustering, clonotypes with similar CDR3 regions of the TCRα chain (TCRα) or TCRβ chain (TCRβ) were found in two of the four myasthenia gravis samples, as shown by the circles in Figure 3. These clonotypes had two types of TCR sequences. One had a TCRα CDR3 region containing the amino acid sequence shown in SEQ ID NO: 1 and a TCRβ CDR3 region containing the amino acid sequence shown in SEQ ID NO: 3. Sequence number 1: CAAYQTGANNLFF Sequence number 3: CAIRTGTDNEQFF The other had a TCRα CDR3 region containing the amino acid sequence shown in SEQ ID NO:2 and a TCRβ CDR3 region containing the amino acid sequence shown in SEQ ID NO:4. Sequence number 2: CASYQTGANNLFF Sequence number 4: CAIRTGSDNEQFF The amino acid sequence shown in SEQ ID NO: 1 was encoded by the nucleic acid shown in SEQ ID NO: 5 or SEQ ID NO: 6. The amino acid sequence shown in SEQ ID NO: 2 was encoded by the nucleic acid shown in SEQ ID NO: 7. The amino acid sequence shown in SEQ ID NO: 3 was encoded by the nucleic acid shown in SEQ ID NO: 8 or SEQ ID NO: 9. The amino acid sequence shown in SEQ ID NO: 4 was encoded by the nucleic acid shown in SEQ ID NO: 10. SEQ ID NO: 5: TTGCTGCCTATCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 6: TGTGCTGCCTACCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 7: TGTGCGTCCTATCAAACTGGGGCAAACAACCTCTTCTTT SEQ ID NO: 8: TGTGCCATCAGGACTGGGACGGACAATGAGCAGTTCTTC SEQ ID NO: 9: TGTGCCATCAGGACCGGGACAGACAATGAGCAGTTCTTC SEQ ID NO: 10: TGTGCCATCAGAACAGGGTCGGACAATGAGCAGTTCTTC Clonotypes with these TCR sequences, TCRα, and TCRβ sequences, were not detected in six healthy control samples and were found only in myasthenia gravis patients. These findings suggest that the TCRs of myasthenia gravis patients have, in their CDR3 regions, either the amino acid sequence CAAYQTGANNLFF (SEQ ID NO: 1) or CASYQTGANNLFF (SEQ ID NO: 2) for TCRα, or the amino acid sequence CAIRTGTDNEQFF (SEQ ID NO: 3) or CAIRTGSDNEQFF (SEQ ID NO: 4) for TCRβ. Therefore, peptides consisting of these amino acid sequences may be biomarkers for the diagnosis, prediction of onset, and therapeutic efficacy of myasthenia gravis.

Claims

1. A method for assisting in the diagnosis of myasthenia gravis, comprising measuring, in a sample derived from a subject, (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:

10.

2. A method for obtaining data for diagnosing myasthenia gravis, comprising measuring, in a sample derived from a subject, (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO:

10.

3. A method for treating myasthenia gravis, comprising measuring (a) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or (b) at least one selected from the group consisting of a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 and a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, in a sample derived from a subject; and administering a therapeutic drug for myasthenia gravis to the subject from whom the sample in which (a) and / or (b) was detected was derived.

4. The method of claim 1 or 2, wherein detection of (a) and / or (b) in the sample indicates that the subject is likely to be suffering from myasthenia gravis.

5. The method of claim 1 or 2, wherein detection of (a) and (b) in the sample indicates that the subject is likely to be suffering from myasthenia gravis.

6. The method according to any one of claims 1 to 3, wherein the protein in (a) is TCRα, and the nucleic acid in (a) is a nucleic acid encoding TCRα.

7. The method according to any one of claims 1 to 3, wherein the protein in (b) is TCRβ, and the nucleic acid in (b) is a nucleic acid encoding TCRβ.

8. The method according to any one of claims 1 to 3, wherein measuring (a) and / or (b) comprises measuring both (a) and (b) on a cell-by-cell basis.

9. The method according to any one of claims 1 to 3, wherein measuring (a) and / or (b) comprises determining whether one protein complex has both (a) and (b).

10. The method of claim 9, wherein the one protein complex is one TCR.

11. The method according to any one of claims 1 to 3, wherein (a) and (b) are expressed in CD8-positive T cells.

12. The method according to any one of claims 1 to 3, wherein the myasthenia gravis is early-onset myasthenia gravis.

13. The method according to any one of claims 1 to 3, wherein the myasthenia gravis is anti-acetylcholine receptor antibody positive.

14. The method of any one of claims 1 to 3, wherein the subject is a Caucasian subject.

15. 4. The method of any one of claims 1 to 3, wherein the subject has at least one HLA allele selected from the group consisting of HLA-B*08:01, HLA-A*01:01, HLA-C*07:01, HLA-DRB1*03:01, HLA-DRB3*01:01, HLA-DQA1*05:01, and HLA-DQB1*02:

01.

16. The method of any one of claims 1 to 3, wherein the subject has the HLA allele of HLA-B*08:

01.

17. The method according to any one of claims 1 to 3, wherein the myasthenia gravis is myasthenia gravis accompanied by activation of cellular immunity.

18. A diagnostic kit for myasthenia gravis comprising: (a') at least one selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2, and a primer for amplifying a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7; and / or (b') at least one selected from the group consisting of an antibody or antigen-binding fragment thereof that binds to a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and a primer for amplifying a nucleic acid comprising a base sequence that has 90% or more sequence identity to the base sequence shown in SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:

10.

19. The kit according to claim 18, further comprising an attached document describing use in the method according to any one of claims 1 to 3.