Convergent liquid phase syntheses of oligonucleotides
The convergent liquid-phase process for synthesizing oligonucleotides addresses the limitations of solid-phase synthesizers by producing high-purity oligonucleotides on a large scale, suitable for therapeutic applications.
Patent Information
- Application Number
- JP2025113743
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-05-08
- Filing Date
- 2025-07-04
- Publication Date
- 2025-09-25
AI Technical Summary
Existing methods for synthesizing oligonucleotides, such as solid-phase synthesizers, are limited to small scales and require excessive reagents, making them unsuitable for large-scale production and clinical development of oligonucleotide drugs.
A convergent liquid-phase process for synthesizing oligonucleotides by coupling oligonucleotide fragments, which eliminates the need for chromatographic purification and achieves high purity without deamination side reactions, allowing for large-scale production.
The process produces highly pure oligonucleotides suitable for therapeutic applications, overcoming the limitations of traditional methods by enabling efficient and cost-effective large-scale synthesis.
Smart Images

Figure 2025138846000426 
Figure 2025138846000427 
Figure 2025138846000428
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims the benefit of the filing date under U.S. Patent Law of U.S. Provisional Patent Application No. 62 / 856,160, filed May 8, 2019, the entire contents of which are incorporated herein by reference. [Background technology]
[0002] Oligonucleotides are short DNA or RNA oligomers that can be chemically synthesized for a wide range of applications. Recent developments in the use of synthetic oligonucleotides as therapeutic agents have led to an increasing demand for synthesis methods that can produce large amounts of oligonucleotides with high efficiency and purity.
[0003] Traditionally, oligonucleotides have been synthesized by automated solid-phase synthesizers using phosphoramidite chemistry, which is limited to scales of less than two moles. Therefore, solid-phase synthesis is insufficient for producing the materials necessary for the clinical development and commercialization of oligonucleotide drugs in large-scale indications. Furthermore, solid-phase synthesis often requires the use of excess reagents, resulting in increased costs associated with the production of target oligonucleotides.
[0004] Therefore, there is a need for a robust method for synthesizing oligonucleotides that is amenable to large-scale manufacturing processes with high efficiency and purity. Summary of the Invention [Means for solving the problem]
[0005] The present disclosure describes a convergent solution-phase process for producing oligonucleotides by coupling two or more (e.g., three, four, five, six, etc.) oligonucleotide fragments, each having two or more (e.g., three, four, five, six, etc.) nucleotides. Surprisingly, it has been discovered that the convergent solution-phase process of the present disclosure can be used to synthesize protected oligonucleotides with high purity without the need for purification by chromatography (e.g., column chromatography), making the process suitable for use as a large-scale manufacturing process. After deprotection and standard downstream purification, highly pure ASO oligonucleotides suitable for therapeutic applications may be obtained. Also provided by the present disclosure are the reaction steps involved in the convergent solution-phase process. [Brief explanation of the drawings]
[0006] [Figure 1] 1 shows reverse-phase HPLC and MS of compound 1-7-a obtained after ammonolysis of product compounds 1-7. [Figure 2] HPLC and MS of the product compound 2-9 obtained after precipitation are shown. [Figure 3] HPLC and MS of the product compound 3-5 obtained after precipitation are shown. [Figure 4] HPLC and MS of the product compound 4-9 obtained after precipitation are shown. [Figure 5] HPLC and MS of compound 5-2-a obtained after ammonolysis of product compound 5-2 are shown. [Figure 6] HPLC and MS of compound 5-3-a obtained after ammonolysis of product compound 5-3 are shown. [Figure 7] HPLC and MS of compound 5-5-a obtained after ammonolysis of product compound 5-5 are shown. [Figure 8] HPLC and MS of compound 5-6-a obtained after ammonolysis of product compound 5-6 are shown. [Figure 9]HPLC and MS of compound 1-a obtained after ammonolysis of product compound 1 are shown. [Figure 10] 1 shows an HPLC comparison of the deaminated products obtained during the UCC trimer detritylation reaction. [Figure 11] Figure 1 shows an HPLC comparison of the deaminated products obtained during the CC dimer detritylation reaction. [Figure 12] HPLC-MS of product ASO 9 is shown. [Figure 13] MS of the hexamer DMT-dG-dT-dT-dG-dT-dT-OTBDPS is shown. [Figure 14] MS of the 10-mer DMT-Moe G-Moe U-Moe U-Moe U-Moe U-dT-dT-dG-dT-dT-OTBDPS is shown. [Figure 15] MS of compounds 1-3A-H is shown. [Figure 16] MS of compounds 4-3A-H is shown. [Figure 17] MS of compounds 5-3A-H is shown. [Figure 18] HPLC and MS of the 15-mer 5'-ACoAGATATTTTTGTT-3'-OTBDPS are shown. [Figure 19] HPLC and MS of product ASO 8 are shown. [Figure 20] MS of 5'-DMT-GUUUUUGCAA-NO2-benzoyl is shown. [Figure 21] HPLC and MS of LHPG-deprotected compound 7-a are shown. [Figure 22] HPLC and MS of LHPG-deprotected compound 7-b are shown. [Figure 23] HPLC and MS of LHPG-deprotected compound 7-c are shown. [Figure 24] HPLC and MS of LHPG-deprotected compound 7-d are shown. [Figure 25] HPLC and MS of ASO-9-1 are shown. [Figure 26] HPLC and MS of LHPG-deprotected compound 7-e are shown. [Figure 27] HPLC and MS of ASO-9-2 are shown. [Figure 28] 8 shows the chiral SFC-MS of compound 8.4. [Figure 29] 1 shows SFC-MS of the racemic mixture of compound 8.4. [Figure 30] HPLC and MS of compound 8A are shown. [Figure 31] HPLC and MS of compound 8.2.12 are shown. [Figure 32] HPLC and MS of compound 8B are shown. [Figure 33] HPLC and MS of compound 8C are shown. DETAILED DESCRIPTION OF THE INVENTION
[0007] The inventors of the present disclosure have developed the first convergent liquid-phase process for preparing target oligonucleotides. Surprisingly, the convergent liquid-phase process can produce protected target oligonucleotides with high purity and on a large scale without the need for chromatographic purification from the assembly of oligonucleotide fragments. The convergent liquid-phase process can produce target oligonucleotides by extension from the 3' end to the 5' end (i.e., 3'-5' extension) or from the 5' end to the 3' end (i.e., 5'-3' extension). The present disclosure also provides a method for selective deprotection of the 3'-hydroxyl protecting group without affecting other sensitive groups to minimize the generation of by-products. The inventors of the present disclosure discovered that the presence of water in the detritylation reaction can result in deamination side reactions (e.g., deamination of cytosine or 5-methylcytosine or their derivatives, which are commonly used in oligonucleotide synthesis). To reduce or prevent the formation of deamination by-product(s), reaction conditions have been developed to control and minimize the level of water, minimizing deamination during the detritylation step. Furthermore, it has been discovered that the use of a cation scavenger (e.g., RSH) in the detritylation reaction facilitates completion of the detritylation reaction (i.e., the reaction proceeds to completion more easily). The presence of a cation scavenger also makes the reaction less susceptible to reverse detritylation (i.e., the DMT protecting group is re-added to the deprotected 5'-OH group). It has also been demonstrated that phosphitylation of the 3'-hydroxyl group can be performed in solution phase without chromatographic purification. Using the method of the present disclosure, oligonucleotide fragments containing four or five nucleotides were successfully synthesized in solution phase and coupled to fully protected target oligonucleotides. In general, the solution-phase process described in this disclosure can be used to synthesize large quantities of the desired protected nucleotide or oligonucleotide product without chromatographic purification. After deprotection and standard downstream purification, highly pure ASO oligonucleotides suitable for therapeutic applications are obtained.
[0008] definition The term "nucleobase" refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or modified. In certain embodiments, nucleobases may include any atom or group of atoms capable of hydrogen bonding to a nucleobase of another nucleic acid. In particular, nucleobases are heterocyclic bases, typically purines and pyrimidines. In addition to "unmodified" or "natural" nucleobases, such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are suitable for incorporation into compounds synthesized by the methods described herein. In certain embodiments, modified nucleobases are nucleobases that are structurally quite similar to the parent nucleobase, such as, for example, 7-deazapurine, 5-methylcytosine, or G-clamp. In certain embodiments, nucleobase mimics include more complex structures, such as, for example, tricyclic phenoxazine nucleobase mimics. Methods for preparing the above-mentioned modified nucleobases are well known to those skilled in the art.
[0009] The term "nucleoside" refers to a compound containing a heterocyclic base moiety and a sugar moiety, which may be modified at the 2' terminus.
[0010] The term "nucleotide" means a nucleoside that contains a phosphate or thiophosphate or dithiophosphate linking group.
[0011] The term "oligonucleotide" refers to a compound comprising multiple linked nucleosides. In certain embodiments, one or more of the multiple nucleosides are modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).
[0012] As used herein, "target oligonucleotide" refers to an oligonucleotide product that can be prepared by the convergent liquid-phase process of the present disclosure. In certain embodiments, the target oligonucleotide contains at least 10 or at least 15 nucleotides. In certain embodiments, the target oligonucleotide has 10 to 500, 15 to 500, 15 to 200, 15 to 100, 15 to 50, 15 to 40, 15 to 30, or 16 to 30 nucleotides.
[0013] As used herein, "convergent synthesis" refers to a synthetic process for making a target oligonucleotide, in which two or more oligonucleotide fragments are assembled from either the 5'-3' or 3'-5' direction.
[0014] As used herein, "oligonucleotide fragment" refers to a short oligonucleotide that is assembled to create a target oligonucleotide. In certain embodiments, an oligonucleotide fragment has 3-10, 3-8, 3-6, or 4-6 nucleotides. In certain embodiments, an oligonucleotide fragment has 4 or 5 nucleotides.
[0015] The term "internucleoside linkage" means the covalent bond between adjacent nucleosides in an oligonucleotide.
[0016] The term "gapmer" refers to a chimeric antisense compound in which an internal region having multiple nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, and these nucleosides comprising the internal region are chemically distinct from the nucleoside(s) comprising the external regions.
[0017] As used herein, the term "alkyl" refers to a fully saturated branched or unbranched hydrocarbon moiety. Preferably, alkyl contains 1 to 20 carbon atoms, more preferably 1 to 16 carbon atoms, 1 to 10 carbon atoms, 1 to 6 carbon atoms, or 1 to 4 carbon atoms. In some embodiments, alkyl contains 6 to 20 carbon atoms. Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, or n-decyl.
[0018] The term "aryl" refers to monocyclic, bicyclic, or tricyclic aromatic hydrocarbon groups having 6 to 14 carbon atoms in the ring portion. In one embodiment, the term aryl refers to monocyclic and bicyclic aromatic hydrocarbon groups having 6 to 10 carbon atoms. Representative examples of aryl groups include phenyl, naphthyl, fluorenyl, and anthracenyl.
[0019] The term "aryl" also refers to a bicyclic or tricyclic group in which at least one ring is aromatic and is fused to one or two non-aromatic hydrocarbon ring(s). Non-limiting examples include tetrahydronaphthalene, dihydronaphthalenyl, and indanyl.
[0020] The optional substituents on both the alkyl and aryl groups are, for each occurrence, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, 3- to 7-membered carbocyclyl, 3- to 7-membered heterocyclyl, halo, -CN, -C(O)R a , -C(O)2R a , -C(O)N(R a )2, -OR a , -N(R a )2, -N(R a )C(O)R a , -N(Ra )N(R a )2, -NO2, -N(R a )C(O)2R a , -N(R a )C(O)N(R a )2, -N(R a )S(O)2R a , -SR a , -S(O)R a , -S(O)2R a , -S(O)N(R a )2, and -S(O)2N(R a ) independently selected from
[0021] For each entity R a is H, C 1~6 It is independently selected from alkyl, 3- to 6-membered monocyclic carbocyclyl, and 3- to 6-membered monocyclic heterocyclyl.
[0022] As used herein, the term "carbocyclyl" refers to a saturated or unsaturated monocyclic or bicyclic hydrocarbon group of 3 to 7 carbon atoms, 3 to 6 carbon atoms, or 5 to 7 carbon atoms. The term "carbocyclyl" encompasses cycloalkyl groups and aromatic groups. The term "cycloalkyl" refers to a fully saturated monocyclic or bicyclic hydrocarbon group of 3 to 7 carbon atoms, 3 to 6 carbon atoms, or 5 to 7 carbon atoms. Exemplary monocyclic carbocyclyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopropenyl, cyclobutenyl, cyclopenentyl, cyclohexenyl, cycloheptenyl, cyclobutadienyl, cyclopentadienyl, cyclohexadienyl, cycloheptadienyl, phenyl, and cycloheptatrienyl. Exemplary bicyclic carbocyclyl groups include bicyclo[2.1.1]hexyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.1]heptenyl, tricyclo[2.2.1.0]heptenyl, and tricyclo[2.2.1.0]heptenyl. 2,6]heptanyl, 6,6-dimethylbicyclo[3.1.1]heptyl, or 2,6,6-trimethylbicyclo[3.1.1]heptyl, spiro[2.2]pentanyl, and spiro[3.3]heptanyl.
[0023] As used herein, the term "bridged ring system" refers to a ring system having a carbocyclyl or heterocyclyl ring in which two non-adjacent atoms of the ring are joined (bridged) by one or more (preferably 1 to 3) atoms selected from C, N, O, or S. The bridged ring system can have 6 to 7 ring members.
[0024] As used herein, the term "spiro ring system" refers to a ring system having two rings, each ring independently selected from carbocyclyl or heterocyclyl, where the two ring structures share one ring atom. Spiro ring systems have 5 to 7 ring members.
[0025] As used herein, the term "heterocyclyl" refers to a saturated or unsaturated, monocyclic or bicyclic (e.g., bridged or spiro) ring system having 3 to 7 ring members, or particularly 3 to 6 or 5 to 7 ring members, at least one of which is a heteroatom, and up to four of which (e.g., 1, 2, 3, or 4) may be heteroatoms, independently selected from O, S, and N, where C may be oxidized (e.g., C(O)), N may be oxidized (e.g., N(O)) or quaternized, and S may optionally be oxidized to sulfoxide and / or sulfone. Unsaturated heterocycles include heteroaryl rings. As used herein, the term "heteroaryl" refers to an aromatic 5- or 6-membered monocyclic ring system having 1 to 4 heteroatoms independently selected from O, S, and N, where N can be oxidized (e.g., N(O)) or quaternized, and S can be optionally oxidized to sulfoxide and sulfone. In one embodiment, the heterocyclyl is a 3- to 7-membered saturated monocyclic ring, or a 3- to 6-membered saturated monocyclic ring, or a 5- to 7-membered saturated monocyclic ring. In one embodiment, the heterocyclyl is a 3- to 7-membered monocyclic ring, or a 3- to 6-membered monocyclic ring, or a 5- to 7-membered monocyclic ring. In another embodiment, the heterocyclyl is a 6- to 7-membered bicyclic ring. The heterocyclyl group can be attached at a heteroatom or a carbon atom.Examples of heterocyclyl include aziridinyl, oxiranyl, thiiranyl, oxaziridinyl, dioxiranyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, tetrahydrofuranyl, thiolanyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolanyl, dithiolanyl, oxathiolanyl, piperidinyl, tetrahydropyranyl, thianyl, piperazinyl, morpholinyl, thiomorpholinyl, dioxanyl, dithianyl, trioxanyl, trithianyl, azepanyl, oxepanyl, thiepanyl, dihydrofuranyl, imidazolinyl, dihydropyranyl, and heteroaza. Examples of aryl rings include azirinyl, oxirenyl, thiirenyl, diazirinyl, azetyl, oxetyl, thietyl, pyrrolyl, furanyl, thiophenyl (or thienyl), imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, furazanyl, oxadiazolyl, thiadiazolyl, dithiazolyl, triazolyl, tetrazolyl, pyridinyl, pyranyl, thiopyranyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxazinyl, thiazinyl, dioxinyl, dithiinyl, oxathianyl, triazinyl, tetrazinyl, azepinyl, oxepinyl, thiepinyl, diazepinyl, and thiazepinyl. Examples of bicyclic heterocyclic ring systems include 3-azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.1.1]heptanyl, 2-azaspiro[3.3]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, and 5-azaspiro[2.3]hexanyl.
[0026] "Halogen" or "halo" can be fluoro, chloro, bromo or iodo.
[0027] As used herein, the term "substantially anhydrous" refers to a water content of about 1000 parts per million (ppm) or less, preferably 500 ppm or less, and more preferably 100 ppm or less. The water content may be 500-1000 ppm, 100-500 ppm, 50-100 ppm, or less than 50 ppm. Organic solutions or solvents are made substantially anhydrous by using drying agents or by azeotropic removal of water (azeotropic distillation).
[0028] As used herein, the term "desiccant" refers to a chemical reagent used to remove water from an organic solvent or compound, or a solution of an organic compound. Any suitable desiccant may be used. Exemplary desiccants include, but are not limited to, calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, or molecular sieves. In some embodiments, the molecular sieve is 3 Å or 4 Å.
[0029] As used herein, "hydroxyl protecting group" refers to a group suitable for protecting a hydroxyl group, -OH, from reaction with other reagents. Examples of hydroxyl protecting groups can be found in Greene, TW et al., Protective Groups in Organic Synthesis, 4th Ed., John Wiley and Sons (2007).
[0030] In certain embodiments, the hydroxyl protecting group can be selected from, for example, acetyl (Ac); benzoyl (Bz); benzyl (Bn); β-methoxyethoxymethyl ether (MEM); methoxymethyl ether (MOM); methoxytrityl [(4-methoxyphenyl)diphenylmethyl, MMT]; p-methoxybenzyl ether (PMB); methylthiomethyl ether; pivaloyl (Piv); tetrahydropyranyl (THP); tetrahydrofuran (THF); silyl ethers (including, but not limited to, trimethylsilyl (TMS), tert-butyldiphenylsilyl (TBDPS), tert-butyldimethylsilyl (TBDMS), tri-isopropylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers); methyl ether, and ethoxyethyl ether (EE).
[0031] In certain embodiments, the hydroxyl protecting group protects the 3'-hydroxyl of a nucleoside (referred to as a 3'-hydroxyl protecting group). In certain embodiments, the 3'-hydroxyl protecting group includes silyl hydroxyl protecting groups such as trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethylisopropylsilyl, diethylisopropylsilyl, dimethylhexylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, di-t-butylmethylsilyltri(trimethylsilyl)silyl, t-butylmethoxyphenylsilyl, and t-butoxydiphenylsilyl. In certain embodiments, the 3'-hydroxyl protecting group is TBDPS. In certain embodiments, the 3'-hydroxyl protecting group is a large hydrophobic protecting group (LHPG), such as those described herein.
[0032] In certain embodiments, the hydroxyl protecting group protects the 5'-hydroxyl of the nucleoside (referred to as a 5'-hydroxyl protecting group). Exemplary 5'-hydroxyl groups include, but are not limited to, those described herein (e.g., R 15In certain embodiments, the 5'-hydroxyl protecting group is the acid-labile 4,4'-dimethoxytrityl (or bis-(4-methoxyphenyl)phenylmethyl) (DMT or DMTr) protecting group. In certain embodiments, the 5'-hydroxyl protecting group is a large hydrophobic protecting group (LHPG), such as those described herein.
[0033] As used herein, the term "azeotropic distillation" refers to the removal of water from an organic solution or solvent by distillation using a material separating agent, including, but not limited to, benzene, toluene.
[0034] As used herein, "selective precipitation" refers to a purification method in which a desired product is separated from one or more impurities in a solution by adding the solution to a solvent to precipitate the product (while leaving the one or more impurities in the solution). Alternatively, the solvent may be added to a solution containing the crude product and one or more impurities to precipitate the product. In certain embodiments, a desired compound or oligonucleotide of the present disclosure contains a hydrophobic group (e.g., a hydrophobic 3'-hydroxyl protecting group or a hydrophobic 5'-hydroxyl protecting group (e.g., an LHPG group as described herein)), and a polar solvent (e.g., CH3CN) is added to a solution containing the compound or oligonucleotide and one or more impurities to precipitate the desired oligonucleotide. In certain embodiments, the desired compound or oligonucleotide of the present disclosure is dissolved in a co-solvent or solvent mixture (e.g., heptane, tert-butyl methyl ether (TBME or MBTE), a heptane / MBTE mixture (e.g., a heptane / MBTE mixture having a volume ratio of heptane to MBTE ranging from 20:1 to 1:20, 9:1 to 1:9, or 4:1 to 1:4, or a heptane / MBTE mixture having a volume ratio of heptane to MBTE of 9:1, 4:1, 2:1, 1:1, 2:5, 1:2, 1:4, or 1:9). The crude product may be purified by adding the crude product (e.g., dichloromethane (DCM) or ethyl acetate (EtOAc)) to a solution containing the crude product and one or more impurities in an organic solvent (e.g., dichloromethane (DCM) or ethyl acetate (EtOAc)) to precipitate the product. Alternatively, the solution containing the crude product and one or more impurities may be added to a non-polar or less polar solvent or solvent mixture to precipitate the product. An appropriate co-solvent may be determined based on the hydrophobicity of the product. In certain embodiments, the co-solvent is less polar than the organic solvent in which the product is dissolved.
[0035] As used herein, "extraction" refers to a purification method in which a desired product is separated from one or more impurities in a solution by contacting the solution with a solvent in which the product is soluble (wherein the one or more impurities remain insoluble). Alternatively, a solution containing the product and one or more impurities may be contacted with a solvent in which the one or more impurities are soluble (wherein the product remains insoluble). In certain embodiments, a solution containing the product and one or more impurities in an organic solvent (e.g., DCM, EtOAc, or THF) or organic solvent mixture (e.g., a reaction mixture or crude product solution) may be contacted (extracted or washed) with water or an aqueous solution (e.g., a NaHCO3 / H2O solution or a NaCl / H2O solution) to remove hydrophilic impurities.
[0036] As used herein, the term "strong acid" refers to an acid that completely dissociates in solution, as shown below. HA+S ⇔ SH + +A - S represents a solvent molecule. Exemplary strong acids include, but are not limited to, HCl, HBr, HI, triflic acid, perchloric acid, CCCOOH, CHClCOOH, and CHClCOOH. In certain embodiments, the strong acid is a strong organic acid, such as CFCOOH, CHClCOOH, and CHClCOOH.
[0037] As used herein, the term "base" refers to a base that forms hydroxide ions (OH) in aqueous solution. - ) or a substance that can donate a pair of non-bonding electrons. Exemplary bases include, but are not limited to, alkali hydroxides, alkaline earth hydroxides, alkylamines (e.g., tert-butylamine, sec-butylamine, trimethylamine, triethylamine, diisopropylethylamine, 2-methylpropan-2-amine), 8-diazabicyclo[5.4.0]undec-7-ene (DBU), imidazole, N-methylimidazole, pyridine, and 3-picoline.
[0038] As used herein, the term "salt" refers to an organic or inorganic salt of a compound, nucleotide, or oligonucleotide described herein. In certain embodiments, the salt is a pharmaceutically acceptable salt thereof. The phrase "pharmaceutically acceptable" indicates that a substance or composition must be chemically and / or toxicologically compatible with other ingredients contained in the formulation and / or the mammal being treated therewith. In certain embodiments, the salt of a compound, nucleotide, or oligonucleotide described herein is a sodium salt, potassium salt, or ammonium salt. In certain embodiments, the salt is a sodium salt or ammonium salt.
[0039] Methods of the present disclosure I. Fragment Synthesis: The process described herein involves the stepwise addition of nucleotides in a liquid (solution) phase to form a desired oligonucleotide fragment. In certain embodiments, each nucleotide addition involves at least three reactions (coupling, sulfurization or oxidation, and deprotection) to add the nucleotide to the growing oligonucleotide. First, the 5'-end of the first nucleoside is coupled to the 3'-end of the second nucleotide to form a dimer. The dimer is then sulfurized or oxidized to form a phosphothioate (i.e., a P=S bond) or a phosphodiester (i.e., a P=O bond). The 5'-hydroxyl group of the second nucleotide is then deprotected, and the process is repeated to add the next nucleoside.
[0040] a. 5'-deprotection reaction: In a first aspect, the present disclosure provides a deprotection method for removing a 5'-hydroxyl protecting group on a nucleotide, nucleoside, or oligonucleotide. In one embodiment, the deprotection method is a detritylation method for removing a 5'-trityl group. It has been discovered that a significant reduction in side reactions (e.g., deamination of the nucleobases cytosine or 5-methylcytosine or their derivatives commonly used in oligonucleotide synthesis) can be achieved when the detritylation reaction is performed under anhydrous or substantially anhydrous conditions (see Example 3). The detritylation method of the present invention also includes the addition of a cation scavenger to facilitate completion of the reaction. As a result, a highly pure product can be obtained without the need for chromatography (e.g., column chromatography). The water level in the detritylation reaction can be controlled by using a drying agent (e.g., molecular sieves), azeotropic distillation, or other suitable methods known in the art. Alternatively, the solvent, acid, and other reagents used in the detritylation reaction, the substrate subjected to the detritylation reaction, and the reaction vessel can be dried to reduce the residual water level before use in the detritylation reaction.
[0041] A first embodiment of the first aspect is a compound of formula (AI a ) compounds: [ka] or a salt thereof, comprising the formula (AII) a ) compounds: [ka] or a salt thereof, wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group. R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; Z is 0 or an integer from 1 to 200, X, for each occurrence, is independently O or S; W is H, Y, or Z; Y is a hydrophobic hydroxyl protecting group containing an alkyl chain; and Z is a hydroxyl protecting group.
[0042] A first embodiment of the first aspect also includes a compound of formula (AI): [ka] or a salt thereof, which process comprises a liquid phase process for preparing a compound of formula (AII): [ka] or a salt thereof, wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and the variable is a compound of formula (AI) a ) and (AII a ) as defined above.
[0043] Also in the first embodiment, there is provided a compound of formula (AI'): [ka] or a salt thereof, which process comprises a liquid phase process for preparing a compound of formula (AII'): [ka] or a salt thereof, wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, where W is H or Z; Z is a silyl hydroxyl protecting group; and the remaining variables are represented by the formula (AI a ) and (AII a ) as defined above.
[0044] In certain embodiments, R 16 is one of the following: [ka] See Nat Biotechnol. 2017 Sep;35(9):845-851; J. Org. Chem. 1999, 64, 7515-7522; Biopolymers (Peptide Science), 2001, 60, 3 (each of which is incorporated herein by reference).
[0045] In a second embodiment, the deprotection reaction is carried out in the presence of a desiccant. Any suitable desiccant may be used in the deprotection reaction. In some embodiments, the desiccant is selected from calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, and molecular sieves.
[0046] In a third embodiment, the desiccant used in the second embodiment is a molecular sieve.
[0047] In a fourth embodiment, the size of the molecular sieve of the third embodiment is 3 Å or 4 Å. In a preferred embodiment, the size of the molecular sieve is 3 Å.
[0048] In a fifth embodiment, an anhydrous or substantially anhydrous solution for the deprotection reaction is obtained by removing water using azeotropic distillation prior to the deprotection reaction.
[0049] Alternatively, the solvent, acid or acid solution, and other reagents or solutions, including reagents used in the detritylation reaction, the substrate or substrate solution to be subjected to the detritylation reaction, and the reaction vessel may be dried individually or in combination prior to the detritylation reaction.
[0050] In a sixth embodiment, the deprotection reaction is carried out in the presence of a scavenger selected from a cation scavenger containing an -SH group, a silane scavenger (such as HSiPh3, HSiBu3, triisopropylsilane), a siloxane, a polystyrene, a furan, a pyrrole, and an indole.
[0051] In certain embodiments, the deprotection reaction is carried out in the presence of a scavenger selected from 1-dodecanethiol, cyclohexanethiol, 1-octanethiol, triisopropylsilane, indole, 2,3-dimethylfuran, diphenylsilane, 2-mercaptoimidazole, diphenylmethylsilane, phenylsilane, 5-methoxyindole, methylphenylsilane, chlorodimethylsilane, 1,1,3,3-tetramethyldisiloxane, 1-thioglycerol, triphenylsilane, tert-butyldimethylsilane, butylsilane, methyldiethoxysilane, 1,1,3,3,5,5-hexamethyltrisiloxane, hexylsilane, (mercaptomethyl)polystyrene, or dimethylphenylsilane.
[0052] In a seventh embodiment, the cation scavenger of the sixth embodiment is a compound of formula RSH, where R is an alkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl group, each of which is optionally substituted.
[0053] In an eighth embodiment, the RSH group of the seventh embodiment is CH3(CH2)5SH, CH3(CH2) 11SH, cyclohexanethiol (CySH), or CH3CH2OC(=O)CH2CH2SH.
[0054] A ninth embodiment of the present disclosure is R 15 The process as described in any one of the first to eighth embodiments, wherein is a 4,4'-dimethoxytrityl (DMT) group.
[0055] In a tenth embodiment, the deprotection reaction is carried out by reacting the compound of formula (AII) with a detritylation reagent. Any suitable detritylation reagent may be used.
[0056] In an eleventh embodiment, the detritylation reagent of the tenth embodiment is a strong organic acid.
[0057] In a twelfth embodiment, the detritylation reagent is selected from CF3COOH, CC13COOH, CHCl2COOH, CH2ClCOOH, H3PO4, methanesulfonic acid (MSA), benzenesulfonic acid (BSA), CClF2COOH, CHF2COOH, PhSO2H (phenylsulfinic acid), and the like. In a preferred embodiment, the detritylation reagent is CH2ClCOOH. In another particular embodiment, the detritylation reagent is CF3COOH. In yet another particular embodiment, the detritylation reagent is CHCl2COOH.
[0058] In certain embodiments, the detritylation reagent is citric acid. In certain embodiments, the detritylation reagent is a saturated citric acid solution.
[0059] A thirteenth embodiment of the first aspect is the process described in any one of the above disclosed embodiments, wherein W is Z.
[0060] In a fourteenth embodiment, the Z group is a silyl hydroxyl protecting group. Exemplary silyl protecting groups include, but are not limited to, trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethylisopropylsilyl, diethylisopropylsilyl, dimethylthexylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, di-t-butylmethylsilyltri(trimethylsilyl)silyl, t-butylmethoxyphenylsilyl, and t-butoxydiphenylsilyl.
[0061] In a fifteenth embodiment, the silyl hydroxyl protecting group of the fourteenth embodiment is selected from the group consisting of TBDPS, TBoDPS, and TBDAS. [ka] is selected from wherein R5, R6 and R7 are each independently H, C 1-30 Alkyl, or C 1-30 It is an alkoxy.
[0062] In a sixteenth embodiment, the silyl protecting group of the fourteenth embodiment is: [ka] and Here, s is an integer from 1 to 30.
[0063] In a seventeenth embodiment, the Z group of the fourteenth embodiment is TBDPS.
[0064] An eighteenth embodiment discloses the process described in any one of the first to twelfth embodiments, wherein W is represented by the following formula: [ka] Y is represented by where X0 is C 1-10alkyl, wherein one or more CH groups are independently replaced by C(O), C(O)NH, cycloalkyl, or heterocyclyl groups; 1-25 Alkyl or C 1-25 In certain embodiments, Y is represented by the formula: [ka] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remainder of the variables are as described above. In a more specific embodiment, Het is piperazine.
[0065] In the 19th embodiment, Y in the 18th embodiment is expressed by the following formula. [ka]
[0066] A twentieth embodiment discloses the process according to any one of the first to nineteenth embodiments, wherein the compound of formula (AI) or (AI') or a salt thereof is not purified by chromatography (e.g., column chromatography).
[0067] The 21st embodiment discloses the process described in the 1st to 20th embodiments, wherein the compound of formula (AI) or (AI'), or a salt thereof, is purified by selective precipitation and / or extraction. In certain embodiments, the compound of formula (AI) or a salt thereof is purified by selective precipitation. In certain embodiments, selective precipitation of the compound of formula (AI) or a salt thereof can be achieved by adding acetonitrile to a solution of the crude product in DCM. Alternatively, a solution of the crude product can be added to acetonitrile to precipitate the desired product.
[0068] In certain embodiments, the compound of Formula (AI') or its salt is purified by selective precipitation. In certain embodiments, in addition to selective precipitation, the compound of Formula (AI') or its salt is purified by extracting a solution containing the compound of Formula (AI') or its salt in an organic solvent (MBTE, EtOAc, a heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO3 / H2O or NaCl / H2O). In certain embodiments, the extraction is performed before the selective precipitation. Alternatively, the extraction is performed after the selective precipitation. In certain embodiments, the selective precipitation of the compound of Formula (AI') or its salt can be achieved by adding heptane or a heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, a solution of the crude product can be added to heptane or a heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture having an appropriate volume ratio (e.g., a volume ratio described herein) can be used.
[0069] In some embodiments, for the process of the first aspect or any embodiment described therein (e.g., a process described in any one of the first through twenty-first embodiments), z is 1 to 150, 1 to 100, 1 to 50, 1 to 20, 1 to 10, or 1 to 5.
[0070] In some embodiments, for the process of the first aspect or any embodiment described therein (e.g., a process described in any one of the first through twenty-first embodiments), R 16 For each occurrence, independently, C 1~6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO, or a halogen; or R 16 teeth, [ka] In certain embodiments, R 16 is one of the following: [ka]
[0071] In some embodiments, for the process of the first aspect or any embodiment described therein (e.g., a process described in any one of the first through twenty-first embodiments): Each R 2 are independently H, halogen, or C 1-4 Alkoxy (optionally C 1-4 substituted with alkoxy; R 4 is H; and R 16 is -CH2CH2CN.
[0072] In certain embodiments, R 2 is -OCH2CH2OMe.
[0073] b. 3'-deprotection reaction: In a second aspect, the present disclosure describes a liquid-phase deprotection method for removing 3'-hydroxyl protecting groups on oligonucleotides. In one embodiment, the deprotection method is a desilylation process. It has been discovered that the desilylation process of the present disclosure can selectively remove the silyl protecting group of the 3'-hydroxyl group without affecting other sensitive groups on the oligonucleotide, such as the 5'-trityl group, various protecting groups of nucleobases (e.g., benzoyl or isobutyryl groups), cyanoethyl, and -OCHCHOMe (also known as methoxyethyl (MOE)) groups.
[0074] In a twenty-second embodiment, the second aspect of the disclosure relates to a compound of formula (BI): [ka] or a salt thereof, the process comprising the step of: [ka] or a salt thereof to form a compound of formula (BI), or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is H or a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; q is an integer from 1 to 200; X, for each occurrence, is independently O or S; and Z is a hydroxyl protecting group (eg, a silyl hydroxyl protecting group).
[0075] In a twenty-third embodiment, the second aspect of the disclosure relates to a compound of formula (B2I): [ka] or a salt thereof, the process comprising the step of: [ka] or a salt thereof to form a compound of formula (BI), or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; q is an integer from 1 to 200; X, for each occurrence, is independently O or S; Y is a hydrophobic hydroxyl protecting group comprising an alkyl chain; and Z is a hydroxyl protecting group.
[0076] In a twenty-fourth embodiment, Y of the twenty-third embodiment is represented by the following formula: [ka] where X a is C 1-10 alkyl, and one or more CH groups are independently C(O), C(O)NH, cycloalkyl, or C 1-6 substituted with a heterocyclyl group; X1 is C 1-25 Alkyl, or C 1-25In certain embodiments, Y is represented by the formula: [ka] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remainder of the variables are as described above. In a more specific embodiment, Het is piperazine.
[0077] In a twenty-fifth embodiment, Y of the twenty-third embodiment is represented by the following formula: [ka]
[0078] In a twenty-sixth embodiment, the deprotection reaction is carried out by reacting a compound of formula (BII) or (B2II) or a salt thereof with HF in the presence of a base.
[0079] In a twenty-seventh embodiment, the base in the twenty-sixth embodiment is imidazole or pyridine, wherein the imidazole or pyridine is optionally substituted.
[0080] The 28th embodiment discloses the process according to any one of the 22nd to 27th embodiments, wherein an excess of base relative to HF is used.
[0081] In a twenty-ninth embodiment, the deprotection reaction is carried out by reacting a compound of formula (BII) or (B2II) or a salt thereof with HF in the presence of pyridine and imidazole.
[0082] In a 30th embodiment, the molar ratio of imidazole to HF of the 29th embodiment ranges from 1.1:1 to 5:1. In some embodiments, the molar ratio of imidazole to HF ranges from 1.1:1 to 3:1, 1.5:1 to 3:1, or 1.5:1 to 2.5:1.
[0083] In a thirty-first embodiment, the molar ratio of imidazole to HF in the thirty embodiment is 2:1.
[0084] In a thirty-second embodiment, for the process described in any of the twenty-ninth through thirty-first embodiments, the molar ratio of pyridine to HF ranges from 1.1:1 to 20:1. In some embodiments, the molar ratio of pyridine to HF ranges from 5:1 to 20:1 or from 5:1 to 15:1. In particular embodiments, the molar ratio of pyridine to HF is 10:1.
[0085] The 33rd embodiment discloses the process of any one of the 22nd to 32nd embodiments, wherein Z is a silyl hydroxyl protecting group. In certain embodiments, silyl protecting groups include, but are not limited to, those described above in the 14th embodiment.
[0086] In a thirty-fourth embodiment, the silyl hydroxyl protecting group is TBDPS, ToBDPS, or TBDAS, as described in the fifteenth, sixteenth, or seventeenth embodiments. In certain embodiments, the silyl hydroxyl protecting group is TBDPS.
[0087] In certain embodiments, the above deprotection reaction (eg, in any one of the 23rd to 34th embodiments) is carried out in a suitable organic solvent, such as THF.
[0088] The 35th embodiment discloses the process according to any one of the 22nd to 34th embodiments, wherein the compound of formula (BI) or (B2I) or a salt thereof is not purified by chromatography (e.g., column chromatography).
[0089] In a thirty-sixth embodiment, the compound of Formula (BI) or (BI) or a salt thereof is purified by selective precipitation and / or extraction. In certain embodiments, the compound of Formula (BI) or a salt thereof is purified by selective precipitation. In certain embodiments, selective precipitation of the compound of Formula (BI) or a salt thereof can be achieved by adding acetonitrile to a solution of the crude product in DCM. Alternatively, a solution of the crude product can be added to acetonitrile to precipitate the desired product.
[0090] In certain embodiments, the compound of Formula (BI) or its salt is purified by selective precipitation. In certain embodiments, in addition to selective precipitation, the compound of Formula (BI) or its salt is purified by extracting a solution containing the compound of Formula (BI) or its salt in an organic solvent (MBTE, EtOAc, a heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO3 / HO or NaCl / HO). In certain embodiments, the extraction is performed before selective precipitation. Alternatively, the extraction is performed after selective precipitation. In certain embodiments, selective precipitation of the compound of Formula (BI) or its salt can be achieved by adding heptane or a heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, a solution of the crude product can be added to heptane or a heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture having an appropriate volume ratio (e.g., a volume ratio described herein) can be used.
[0091] In some embodiments, in the process described in the second aspect or any embodiment therein (e.g., the 22nd, 26th to 36th embodiments), R 15 is the 4,4'-dimethoxytrityl (DMT) group.
[0092] In some embodiments, for the process described in the second aspect or any embodiment described therein (e.g., embodiments 22-36), each R 2 is H or C 1-4 independently selected from alkoxy, C 1-4optionally substituted with alkoxy; R 4 is H; and R 16 is -CH2CH2CN.
[0093] In some embodiments, for the process described in the second aspect or any embodiment described therein (e.g., the 22nd, 26th to 36th embodiments), each R 2 is H, halo or C 1-4 independently selected from alkoxy, C 1-4 optionally substituted with alkoxy; R 4 is H;R 15 is 4,4'-dimethoxytrityl; and R 16 is —CHCHCN. In certain embodiments, R 2 is MOE.
[0094] In some embodiments, for the process described in the second aspect or any embodiment described therein (e.g., embodiments 22-36), each R 2 is H, halo (e.g., F), or C 1-4 independently selected from alkoxy, C 1-4 optionally substituted with alkoxy; R 4 is H; and R 16 is —CHCHCN. In certain embodiments, R 2 is -OCH2CH2OCH3(MOE).
[0095] c. Phosphitylation reaction A third aspect of the present disclosure provides a solution-phase phosphitylation method for oligonucleotides, as described herein. The method involves reacting the 3'-OH group with a phosphorodiamidite or H-phosphonate (HO)P(O)H. The phosphitylation method of the present disclosure can be used to synthesize oligonucleotide fragments having three or more nucleotides with high purity without chromatographic purification.
[0096] A thirty-seventh embodiment is a compound of formula (CI) or (CI'): [ka] or a salt thereof, which comprises a compound of formula (CII): [ka] or a salt thereof, 16 O)P(NR 17a R 17b )2 or H-phosphonate (HO)P(O)H to form a compound of formula (CI) or (CI'), respectively, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally halogen or C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth, [ka] and; R 17a and R 17b is independently C 1-6 It is an alkyl q1 is an integer from 2 to 200; X, for each occurrence, is independently O or S; and Z is a silyl hydroxyl protecting group.
[0097] A thirty-eighth embodiment is a compound of formula (C2I): [ka] or a salt thereof, which comprises reacting a compound of formula (C2II): [ka] or a salt thereof and a phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to form a compound of formula (CI), or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally halogen or C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 It is an alkyl q1 is an integer from 2 to 200; X, for each occurrence, is independently O or S; and Z is a silyl hydroxyl protecting group.
[0098] In some embodiments, in the process of embodiment 38, each R 2 is H, F, or C 1-4 independently selected from alkoxy, C 1-4 optionally substituted with alkoxy; R 4 is H;R 16 is -CH2CH2CN; R 17a and R 17b is independently C 1-6 and Z is a silyl hydroxyl protecting group as described herein. In some embodiments, Z is selected from TBDPS, TBoDPS, and TBDAS. In certain embodiments, R 2 is H and R 4 is H;R 16 is -CH2CH2CN; R 17a and R 17b are both -CH(CH3)2; and Z is TBDPS. In another particular embodiment, R 2 is MOE and R 4 is H;R 16 is -CH2CH2CN; R 17a and R17b are both -CH(CH3)2; Z is TBDPS.
[0099] The 39th embodiment discloses the process described in the third aspect, or any embodiment described herein (e.g., the 37th or 38th embodiment), wherein the reaction is carried out in the presence of an activator. As used herein, an activator is a chemical reagent that promotes the reaction between a phosphorodiamidite or H-phosphonate and a 3'-hydroxyl group of an oligonucleotide (e.g., a compound of formula (CII) or (C2II)). Exemplary activators include, but are not limited to, the following reagents: [ka]
[0100] In a fortieth embodiment, the present disclosure provides a process as described in the thirty-ninth embodiment, wherein the activator is pyridine trifluoroacetate (Py●TFA) or N-methylimidazolium triflate.
[0101] The 41st embodiment discloses the process according to any one of the 34th to 36th embodiments, wherein the compound of formula (CI), (CI') or (CI) is not purified by chromatography (e.g., column chromatography).
[0102] A forty-second embodiment discloses the process of any one of the thirty-fourth to thirty-sixth embodiments, wherein the compound of formula (CI), (CI'), or (CI), or a salt thereof, is purified by selective precipitation and / or extraction. In certain embodiments, the compound of formula (CI), (CI'), or (CI), or a salt thereof, is purified by selective precipitation. In certain embodiments, the compound of formula (CI), (CI'), or (CI), or a salt thereof, is purified by extracting a solution containing the compound of formula (CI), (CI'), or (CI), or a salt thereof, in an organic solvent (MBTE, EtOAc, heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO3 / HO or NaCl / HO) in addition to selective precipitation. In certain embodiments, extraction is performed before selective precipitation. Alternatively, extraction is performed after selective precipitation. In certain embodiments, selective precipitation of a compound of formula (CI), (CI'), or (CI) or a salt thereof can be achieved by adding heptane or a heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, a solution of the crude product can be added to heptane or a heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture having an appropriate volume ratio (e.g., a volume ratio described herein) can be used.
[0103] In some embodiments, for the process described in the third aspect or any embodiment described therein (e.g., the 37th embodiment), the variables of formula (CI), (CI'), or (CII) are defined below. Each R 2 is H, F, or C 1-4 independently selected from alkoxy, and optionally C 1-4 substituted with alkoxy; R 4 is H; R 15 is 4,4'-dimethoxytrityl; R 16 is -CH2CH2CN; and R 17a and R 17b is independently C 1-6 It is alkyl.
[0104] In certain embodiments, R 2 is MOE. In another particular embodiment, R 2 is H;R 4 is H;R 16 is -CHCHCN; and R 17a and R 17b are both -CH(CH). In another particular embodiment, R 2 is MOE and R 4 is H;R 16 is -CHCHCN; and R 17a and R 17b are both -CH(CH3)2.
[0105] A forty-third embodiment is a compound of formula (CI'): [ka] or a salt thereof, This process consists of the following steps: 1) A compound of formula (CI'A): [ka] or a salt thereof, Compounds of formula (A1): [ka] or a salt thereof to form a compound of formula (CI'B): [ka] or forming a salt thereof; 3) sulfurizing or oxidizing the compound of formula (CI'B) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (CI'C): [ka] or forming a salt thereof; 4) deprotecting the compound of formula (CI'C) or a salt thereof to obtain a compound of formula (CI'D): [ka] or forming a salt thereof; 5) starting with a compound of formula (CI'D), repeating steps 1), 2), 3), and 4) q1-3 times, followed by repeating steps 1), 2), and 3) to produce a fragment of formula (CI'), or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group (e.g., a DMT group); R 16 For each occurrence, independently, C1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; q1 is an integer from 2 to 200; and X, for each occurrence, is independently O or S.
[0106] A forty-fourth embodiment is a compound of formula (CI c ) oligonucleotides: [ka] or a salt thereof, This process is represented by the formula (CI a ) oligonucleotide fragment: [ka] or a salt thereof, Formula (CI b ) oligonucleotide fragment: [ka] or a salt thereof to form a compound of the formula (CI c ), or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; q1a is an integer from 2 to 20; q1b is an integer of 2 to 20; X, for each occurrence, is independently O or S; and Z is a hydroxyl protecting group.
[0107] In certain embodiments, the coupling reaction of the 44th embodiment is carried out in the presence of an acyl chloride. a ) and an oligonucleotide of formula (CI b ) is carried out in the presence of pivaloyl chloride. In another particular embodiment, the coupling reaction is carried out in the presence of pivaloyl chloride and a base (e.g., pyridine).
[0108] In certain embodiments, in the process described in the 43rd or 44th embodiment, chromatography is not used to purify the reaction product of any one of the reaction steps described therein. In certain embodiments, the reaction product of any one of the reaction steps described therein is purified by selective precipitation and / or extraction as described herein (e.g., as described in the 21st, 35th, or 42nd embodiment).
[0109] d. Synthesis of 3'-oligonucleotide fragments In a fourth aspect, the present disclosure describes a solution-phase process for preparing oligonucleotide fragments having a hydrophobic hydroxyl protecting group at their 3' termini (referred to herein as "3' fragments"). Surprisingly, it has been discovered that using the disclosed methods for synthesizing 3' fragments, oligonucleotide fragments having 3-20 (e.g., 3-10, 3-8, 3-5, or 4-5) nucleotides can be prepared with high purity without chromatographic purification. In some embodiments, a hydrophobic 3'-hydroxyl protecting group is used, which facilitates isolation of the oligonucleotide fragment products by selective precipitation. In some embodiments, the solution-phase process includes (1) a 5'-OH deprotection step, (2) a coupling step, and (3) an oxidation or sulfurization step, where steps (1), (2), and (3) are repeated until the desired number of nucleotides have been linked together to form the 3'-oligonucleotide fragment.
[0110] A forty-fifth embodiment is an oligonucleotide fragment of formula (I): [ka] or a salt thereof, the process comprising: 1) A compound of formula (I'A): [ka] or a salt thereof, to give a compound of formula (IA): [ka] or forming a salt thereof; 2) reacting a compound of formula (IA) or a salt thereof with a compound of formula (A1): [ka] or a salt thereof to give a compound of formula (IB): [ka] or forming a salt thereof; 3) sulfurizing or oxidizing the compound of formula (IB) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (IC): [ka] or forming a salt thereof; 4) deprotecting the compound of formula (IC) or a salt thereof to obtain a compound of formula (ID): [ka] or forming a salt thereof; 5) starting from a compound of formula (ID), repeating steps 2), 3) and 4) n-2 times to produce a fragment of formula (I) or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; n is an integer from 2 to 20; X, for each occurrence, is independently O or S; Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.
[0111] The 46th embodiment discloses the process according to the 45th embodiment, wherein the fragment of formula (I) is not purified by chromatography (eg, column chromatography).
[0112] A 47th embodiment discloses the process according to the 45th or 46th embodiment, wherein the fragment of formula (I) is purified by selective precipitation and / or extraction. In certain embodiments, the fragment of formula (I) is purified by selective precipitation. In certain embodiments, the fragment of formula (I) is purified by adding CH3CN to the reaction mixture containing the crude product, followed by filtration to isolate the fragment product.
[0113] A 48th embodiment discloses the process described in the 45th, 46th, or 47th embodiments, wherein chromatography (e.g., column chromatography) is not used to purify the reaction product of any one of steps 1), 2), 3), and 4).
[0114] The 49th embodiment discloses the process described in any one of the 45th to 48th embodiments, wherein the reaction product of any one of steps 1), 2), 3), and 4) is purified by selective precipitation (e.g., as described in the 21st, 35th, or 42nd embodiment).
[0115] In a 50th embodiment, for the process described in any one of the 45th to 49th embodiments, Y is represented by the following formula: [ka] where X0 is C 1-10 alkyl, wherein one or more CH groups are independently replaced by C(O), C(O)NH, cycloalkyl, or heterocyclyl groups; 1-25 Alkyl or C 1-25 In certain embodiments, Y is represented by the formula: [ka] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remainder of the variables are as described above. In a more specific embodiment, Het is piperazine.
[0116] The 51st embodiment discloses the process according to any one of the 45th to 49th embodiments, wherein Y is: [ka]
[0117] In certain embodiments, for the process described in the fourth aspect or any embodiment described therein (e.g., the 45th to 51st embodiments), the deprotection reaction of step 1) and / or step 4) is carried out as described in the first aspect or any embodiment described therein (e.g., the 2nd to 12th embodiments).
[0118] In certain embodiments, for the process described in the fourth aspect or any embodiment described therein (e.g., the 45th to 51st embodiments), the coupling reaction of step 2) can be carried out in the presence of an activator described herein (e.g., an activator described in the 39th embodiment). In certain embodiments, the activator is 4,5-dicyanoimidazole (DCI) or 5-ethylthio-1H-tetrazole (ETT).
[0119] In certain embodiments, for the process described in the fourth aspect or any embodiment described therein (e.g., embodiments 45-51), the sulfurization reaction in step 3) is carried out using a sulfurization agent such as 3-amino-1,2,4-dithiazole-5-thione (xanthan hydride or ADTT), 3-(N,N-dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent), or phenyl-3H-1,2,4-dithiazol-3-one (POS). In certain embodiments, the sulfurization agent is DDTT. In certain embodiments, the sulfurization agent is xanthan hydride. In certain embodiments, the sulfurization reaction is carried out in the presence of a base, as described herein. In certain embodiments, the base is pyridine or imidazole. In certain embodiments, the sulfurization reaction of step 3) is carried out in the presence of DDTT and 4,5-dicyanoimidazole (DCI).
[0120] In certain embodiments, for the process described in the fourth aspect or any embodiment described therein (e.g., embodiments 45-51), the oxidation reaction of step 3) is carried out by using a standard oxidizing agent known in the literature. Exemplary oxidizing agents include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I2, and iodine-pyridine-hydroxide solution. In certain embodiments, the oxidizing agent is t-BuOOH.
[0121] e. Synthesis of 5'-oligonucleotide fragments In a fifth aspect, the present disclosure describes a solution-phase process for preparing oligonucleotide fragments (5' fragments) bearing phosphoramidite groups that can be coupled to the 3' fragments described above. Surprisingly, it has been discovered that using the disclosed methods for preparing 5' fragments, oligonucleotide fragments having 3 to 20 (e.g., 3 to 10, 3 to 8, 3 to 5, or 4 to 5) nucleotides can be synthesized with high purity without chromatographic purification. In some embodiments, the method includes selective deprotection of the 3'-hydroxyl protecting group. In some embodiments, the solution-phase process includes (1) a 5'-OH deprotection step, (2) a coupling step, and (3) an oxidation or sulfurization step, and these steps (1), (2), and (3) are repeated until the desired number of nucleotides have been linked together to form the 5'-oligonucleotide fragment.
[0122] A 52nd embodiment is an oligonucleotide fragment of formula (II): [ka] or a salt thereof, the process comprising: 1') Compound of formula (IIA'): [ka] or a salt thereof, to give a compound of formula (IIA): [ka] or forming a salt thereof; 2') reacting a compound of formula (IIA) or a salt thereof with a compound of formula (A2): [ka] or a salt thereof to form a compound of formula (IIB): [ka] or forming a salt thereof; 3') sulfurizing or oxidizing the compound of formula (IIB) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (IIC): [ka] or forming a salt thereof; 4') Deprotecting the compound of formula (IIC) or a salt thereof to obtain a compound of formula (IID): [ka] or forming a salt thereof; 5') when m is 3, starting from a compound of formula (IID) or a salt thereof, repeating step 2') and step 3') to form a compound of formula (IIE) or a salt thereof; or If m is greater than 3, starting from a compound of formula (IID) or a salt thereof, steps 2'), 3') and 4') are repeated m-3 times, followed by step 2') and step 3') to obtain a compound of formula (IIE): [ka] or forming a salt thereof; 6') Deprotecting the compound of formula (IIE) or a salt thereof to obtain a compound of formula (IIF): [ka] or forming a salt thereof; 7') The compound of formula (IIF) or a salt thereof is reacted with a phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to produce a fragment of formula (II) or a salt thereof: During the ceremony, R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 independently selected from alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth, [ka] and R 17a and R 17b is independently C 1-6 is alkyl; m is an integer from 2 to 20; X, for each occurrence, is independently O or S; and Z is a hydroxylsilyl protecting group.
[0123] In a fifty-third embodiment, in the process described in the fifty-second embodiment, the fragment of formula (II) is not purified by chromatography (eg, column chromatography).
[0124] A 54th embodiment discloses the process described in the 52nd or 53rd embodiment, wherein the fragment of formula (II) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, or 42nd embodiments).
[0125] The 55th embodiment discloses the process described in the 52nd to 54th embodiments, wherein no chromatography is used to purify the reaction product of any one of steps 1'), 2'), 3'), 4'), 5'), 6'), and 7').
[0126] The 56th embodiment discloses the process described in the 52nd to 55th embodiments, wherein the reaction product of any one of steps 1'), 2'), 3'), 4'), 5'), 6'), and 7') is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, or 42nd embodiment).
[0127] In some embodiments, the deprotection reactions of step 1') and step 4') are carried out as described in the first aspect or any embodiment described therein (e.g., any one of the second through twelfth embodiments).
[0128] In some embodiments, the coupling reaction of step 2') is carried out as described in the fourth aspect. In certain embodiments, the coupling reaction is carried out in the presence of an activator described herein (e.g., an activator described in the 39th embodiment). In certain embodiments, the activator is 4,5-dicyanoimidazole (DCI) or 5-ethylthio-1H-tetrazole (ETT).
[0129] In some embodiments, the sulfurization or oxidation reaction of step 3') is carried out as described in the fourth aspect.
[0130] In some embodiments, the deprotection reaction of step 6') is carried out as described in the second aspect or any embodiment described therein (e.g., any one of embodiments 26 to 34).
[0131] In some embodiments, the phosphitylation reaction of step 7') is carried out as described in the third aspect or any embodiment described therein (e.g., any one of embodiments 39-42).
[0132] II. Synthesis of target oligonucleotides i) 3'-5' extension: In a sixth aspect, the present disclosure describes a solution-phase convergent synthesis of target oligonucleotides, in which the target oligonucleotides are assembled in the direction from the 3' end to the 5' end (3'-5' direction).The convergent solution-phase process of the present disclosure has been demonstrated to be successfully used to synthesize target oligonucleotides in large quantities.Furthermore, high-purity protected target oligonucleotides can be obtained by the method of the present disclosure without chromatographic purification.
[0133] In certain embodiments, the convergent solution-phase process described herein involves the stepwise addition of oligonucleotide fragments to a solution phase to synthesize a target oligonucleotide. For example, a 5-mer and a 4-mer fragment are first coupled to synthesize a 9-mer fragment, which is then reacted with another 5-mer fragment to synthesize a 14-mer oligonucleotide. The 14-mer oligonucleotide can be further coupled with another fragment until the desired length of the target oligonucleotide is obtained. In certain embodiments, a 5-mer fragment having a 3'-hydrophobic hydroxyl protecting group (3'-LHPG) (3'-terminal fragment) is first coupled with a 5-mer fragment to form a 10-mer fragment having a 3'-LHPG group, which is then reacted with another 4-mer fragment to form a 14-mer fragment, which is then coupled with another 4-mer fragment to form a target 18-mer oligonucleotide. In certain embodiments, a 3'-terminal fragment having n nucleotides (e.g., a 5-mer fragment) is synthesized by coupling a single nucleotide having a 3'-LHPG group with a fragment having n-1 nucleotides (e.g., a 4-mer fragment).
[0134] A fifty-seventh embodiment discloses a convergent liquid phase process for preparing target oligonucleotides, which comprises the following steps: a) an oligonucleotide fragment of formula (I): [ka] or a salt thereof, Oligonucleotide fragment of formula (II): [ka] or a salt thereof, Coupling in solution to give an oligonucleotide of formula (III): [ka] or forming a salt thereof; b) sulfurizing or oxidizing an oligonucleotide of formula (III) or a salt thereof to obtain an oligonucleotide of formula (IV): [ka] or a salt thereof, During the ceremony, R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth, [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; n is an integer from 2 to 200; m is an integer from 2 to 20; X, for each occurrence, is independently O or S; Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.
[0135] The fifty-seventh embodiment also discloses a convergent liquid phase process for preparing target oligonucleotides, which comprises the following steps: a) an oligonucleotide fragment of formula (I): [ka] or a salt thereof, Formula (II a ) oligonucleotide fragment: [ka] or a salt thereof, Coupling in solution to give a compound of formula (III a ) oligonucleotides: [ka] or a salt thereof; wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth, [ka] and; n is an integer from 2 to 200; m is an integer from 2 to 20; X, for each occurrence, is independently O or S; Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.
[0136] A 58th embodiment discloses the process according to the 57th embodiment, wherein the fragment of formula (I) is a nucleotide of formula (Ia1): [ka] or a salt thereof, Oligonucleotide fragment of formula (Ia2): [ka] or a salt thereof, The oligonucleotide fragments may be synthesized by coupling in solution to form the oligonucleotide fragment of formula (I) or a salt thereof.
[0137] In certain embodiments, for the process described in the 58th embodiment, n is an integer from 3 to 20. In certain embodiments, n is from 3 to 6. In another particular embodiment, n is 5.
[0138] In certain embodiments, in the process described in embodiment 58, fragment (I) is not purified by chromatography. In other embodiments, fragment (I) is purified by selective precipitation and / or extraction (e.g., as described in embodiments 46 and 47).
[0139] A 59th embodiment discloses the process according to the 57th or 58th embodiment, which comprises deprotecting an oligonucleotide of formula (IV) or a salt thereof to obtain an oligonucleotide of formula (V): [ka] or a salt thereof.
[0140] In a fifty-ninth embodiment, there is also provided a process according to the fifty-seventh or fifty-eighth embodiment, wherein the process comprises reacting a compound of formula (III a ) or a salt thereof to obtain an oligonucleotide of the formula (V a ) oligonucleotides: [ka] or a salt thereof.
[0141] A sixtieth embodiment discloses the process described in the fifty-ninth embodiment, which further comprises: d) reacting an oligonucleotide of formula (V) or a salt thereof with an oligonucleotide fragment of formula (II'): [ka] or a salt thereof, Oligonucleotides of formula (VI) [ka] or forming a salt thereof; e) sulfurizing or oxidizing an oligonucleotide of formula (VI) to form an oligonucleotide of formula (VII): [ka] or forming a salt thereof; f) deprotecting the oligonucleotide of formula (VII) or a salt thereof to obtain an oligonucleotide of formula (VIII): [ka] or a salt thereof; and g) Repeating steps d), e) and f) r-1 times, followed by repeating steps d) and e) to obtain an oligonucleotide of formula (IX): [ka] or a salt thereof, During the ceremony: r is an integer from 1 to 50; p i is, for each occurrence, independently an integer from 2 to 20, inclusive; i is an integer from 1 to r; and [ka] is.
[0142] A 61st embodiment discloses the process according to the 60th embodiment, wherein r is 2 and the oligonucleotide of formula (IX) is represented by formula (X): [ka] wherein p1 and p2 are each independently an integer from 2 to 20. In certain embodiments, m, n, p1, and p2 are each independently an integer from 3 to 10, 3 to 6, or 4 to 6. In certain embodiments, m, n, p1, and p2 are each independently 4 or 5. In certain embodiments, m and n are both 5; and p1 and p2 are both 4.
[0143] The 62nd embodiment discloses the process described in the 57th to 61st embodiments, wherein chromatography (e.g., column chromatography) is not used to purify the reaction product of any one of steps a), b), c), d), e), f), and g).
[0144] The 63rd embodiment discloses the process described in the 57th to 62nd embodiments, wherein the reaction product of any one of steps a), b), c), d), e), f), and g) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, 42nd, 46th, and 47th embodiments).
[0145] In certain embodiments, the process described in the 60th to 63rd embodiments comprises the following steps: h1) deprotecting oligonucleotide (IX) or (X) to give oligonucleotides of formula (IXA) or (XA): [ka] or a salt thereof.
[0146] In certain embodiments, the process described in the 60th to 63rd embodiments comprises the following steps: h1) deprotecting oligonucleotide (IX) or (X) or a salt thereof to obtain an oligonucleotide of formula (IXA) or (XA): [ka] or forming a salt thereof; h2) deprotecting the oligonucleotide (IXA) or (XA) or a salt thereof to obtain an oligonucleotide of formula (IXB) or (XB): [ka] or forming a salt thereof.
[0147] In certain embodiments, for step h1) above, an oligonucleotide of formula (IXA) or (XA) is obtained by reacting an oligonucleotide of formula (IX) or (X) with NH4OH. In certain embodiments, treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobases (e.g., NH2 protecting groups on the nucleobases). In certain embodiments, treatment with NH4OH results in an oligonucleotide of formula (IXA) or (XA), or a salt thereof, wherein R 1 is, for each occurrence, independently a nucleobase, and the NH2 of the nucleobase, if present, is unprotected.
[0148] In the 64th embodiment, in the process described in the 60th to 63rd embodiments, R 16 is —CH2CH2CN, deprotection of oligonucleotide (IX) or (X) or a salt thereof gives an oligonucleotide of formula (IXAb) or (XAb): [ka] or a salt thereof is formed. In certain embodiments, the deprotection reaction is carried out by reacting oligonucleotide (IX) or (X) or a salt thereof with NH4OH to form an oligonucleotide of formula (IXAb) or (XAb). In certain embodiments, treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobases (e.g., NH2-protecting groups on nucleobases). In certain embodiments, treatment with NH4OH results in an oligonucleotide of formula (IXAb) or (XAb) or a salt thereof, wherein R1 is independently a nucleobase for each occurrence, and the NH2 of the nucleobase, if present, is unprotected.
[0149] In certain embodiments, in the process described in embodiment 64, the process comprises the following steps: The oligonucleotide (IXAb) or (XAb) or a salt thereof is deprotected to give an oligonucleotide of formula (IXBa) or (XBa): [ka] or a salt thereof. In certain embodiments, oligonucleotide (IXA) or (XA) is reacted with citric acid to form an oligonucleotide of formula (IXBa) or (XBa).
[0150] In a sixty-fifth embodiment, R 16 In the process according to any of the sixtieth to sixty-third embodiments, wherein is -CH2CH2CN, the process further comprises the steps of: h1) deprotecting oligonucleotide (IX) or (X) to obtain an oligonucleotide of formula (IXAa) or (XAa): [ka] or a salt thereof.
[0151] In certain embodiments, in the process of the 65th embodiment, the deprotection reaction is carried out by reacting oligonucleotide (IX) or (X), or a salt thereof, with a base. In certain embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine), and other suitable organic bases.
[0152] A 66th embodiment discloses the process described in the 65th embodiment, which method comprises deprotecting oligonucleotide (IXAa) or (XAa) or a salt thereof to form an oligonucleotide of formula (IXAb) or (XAb): [ka] or a salt thereof.
[0153] In certain embodiments, in the process described in the 66th embodiment, deprotection of oligonucleotide (IXAa) or (XAa), or a salt thereof, is carried out by reacting oligonucleotide (IXAa) or (XAa), or a salt thereof, with NH4OH. In certain embodiments, treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobases (e.g., NH2 protecting groups on the nucleobases). In certain embodiments, treatment with NH4OH provides an oligonucleotide of formula (IXAb) or (XAb), or a salt thereof, wherein R 1 is, for each occurrence, independently a nucleobase, and the NH2 of the nucleobase, if present, is unprotected.
[0154] In certain embodiments, oligonucleotide (IXAb) or (XAb) or a salt thereof may be further reacted with a deprotecting reagent (e.g., a detritylation reagent) to form an oligonucleotide of formula (IXBa) or (XBa) or a salt thereof.
[0155] In one embodiment, for the process described in the sixth aspect or any embodiment described therein (e.g., embodiments 57 to 66), Y is: [ka] is.
[0156] In certain embodiments, the oligonucleotide of formula (IXA) or (XA) or the oligonucleotide of formula (IXAb) or (XAb) obtained from step h1) is purified by depth filtration. In one embodiment, the reaction mixture of step h1) is diluted with ammonium sulfate solution before being subjected to depth filtration. Dilution with ammonium sulfate can prevent the oligonucleotide from adhering to the filter.
[0157] In certain embodiments, the concentration of the ammonium sulfate solution is between 100 mM and 5 M, between 500 mM and 2 M, between 500 mM and 1500 mM, or between 1000 mM and 1200 mM.
[0158] Any suitable depth filter can be used for depth filtration. As used herein, the term "depth filter" refers to a filter that uses a porous filtration medium to retain particles throughout the medium, not just on its surface. These filters are typically used when the fluid to be filtered contains a large amount of particles, as they can retain a larger amount of particles before clogging compared to other types of filters. Surprisingly, it has been found that depth filtration can effectively remove the by-product LHPG-OH (e.g., Y-OH) from the reaction mixture before subjecting the mixture to HIC purification.
[0159] In certain embodiments, the depth filter comprises filter aids such as diatomaceous earth, cellulose, polyacrylic fiber and silica, and activated carbon.
[0160] In certain embodiments, the oligonucleotide of formula (IXA), (IXAb), (XA) or (XAb) obtained from step h1) is purified by depth filtration followed by hydrophobic interaction chromatography (HIC).
[0161] In certain embodiments, for step h2) above, an oligonucleotide of formula (IXA), (IXAa), (IXAb), (XA), (XAa) or (XAb) is reacted with a detritylation reagent described herein to form an oligonucleotide of formula (IXB), (IXBa), (XB) or (XBa). In one embodiment, the detritylation reagent is an organic acid. In one embodiment, the organic acid is acetic acid or citric acid. In certain embodiments, the detritylation reagent is citric acid. In one embodiment, R of formula (IXA), (IXAa), (IXAb), (XA), (XAa) or (XAb) is 15 is a 4,4'-dimethoxytrityl group. In certain embodiments, the detritylation reaction of step h2) is carried out in aqueous solution.
[0162] In certain embodiments, the oligonucleotide of formula (IXB), (IXBa), (XB) or (XBa) obtained from step h2) is purified by anion exchange chromatography.
[0163] The 67th embodiment discloses the process according to the 57th to 66th embodiments, wherein the fragment (I) is: 1) A compound of formula (I'A): [ka] or a salt thereof, to give a compound of formula (IA): [ka] or forming a salt thereof; 2) reacting a compound of formula (IA) or a salt thereof with a compound of formula (A1): [ka] or a salt thereof to give a compound of formula (IB): [ka] or forming a salt thereof; 3) sulfurizing or oxidizing the compound of formula (IB) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (IC): [ka] or forming a salt thereof; 4) deprotecting the compound of formula (IC) or a salt thereof to obtain a compound of formula (ID): [ka] or forming a salt thereof; 5) starting from a compound of formula (ID), steps 2), 3) and 4) are repeated n-2 times to produce a fragment of formula (I) or a salt thereof.
[0164] The 68th embodiment discloses the process described in the 67th embodiment, wherein chromatography (e.g., column chromatography) is not used to purify the reaction product of any one of steps 1), 2), 3), 4), and 5).
[0165] The 69th embodiment discloses the process described in the 67th or 68th embodiment, wherein the reaction product of any one of steps 1), 2), 3), 4) and 5) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, 42nd, 46th or 47th embodiment).
[0166] The seventieth embodiment discloses the process described in the fifty-seventh to sixty-ninth embodiments, where Y is represented by the following formula: [ka] where X0 is C 1-10 alkyl, wherein one or more CH groups are independently replaced by C(O), C(O)NH, cycloalkyl, or heterocyclyl groups; 1-25 Alkyl or C 1-25 In certain embodiments, Y is represented by the formula: [ka] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remainder of the variables are as defined above. In a more specific embodiment, Het is piperazine.
[0167] The 71st embodiment discloses the process described in the 57th to 69th embodiments, wherein Y is: [ka] is.
[0168] The 72nd embodiment discloses the process according to the 57th to 71st embodiments, wherein the fragment of formula (II) is: 1') Compound of formula (IIA'): [ka] or a salt thereof, to give a compound of formula (IIA): [ka] or forming a salt thereof; 2') reacting a compound of formula (IIA) or a salt thereof with a compound of formula (A2): [ka] or a salt thereof to form a compound of formula (IIB): [ka] or forming a salt thereof; 3') sulfurizing or oxidizing the compound of formula (IIB) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (IIC): [ka] or forming a salt thereof; 4') Deprotecting the compound of formula (IIC) or a salt thereof to obtain a compound of formula (IID): [ka] or forming a salt thereof; 5') when m is 3, starting from a compound of formula (IID) or a salt thereof, repeating step 2') and step 3') to form a compound of formula (IIE) or a salt thereof; or If m is greater than 3, starting from a compound of formula (IID) or a salt thereof, steps 2'), 3') and 4') are repeated m-3 times, followed by step 2') and step 3') to obtain a compound of formula (IIE): [ka] or forming a salt thereof; 6') Deprotecting the compound of formula (IIE) or a salt thereof to obtain a compound of formula (IIF): [ka] or forming a salt thereof; 7') The compound of formula (IIF) or a salt thereof is reacted with a phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to produce a fragment of formula (II) or a salt thereof, where Z is a hydroxyl protecting group.
[0169] The 73rd embodiment discloses the process according to the 72nd embodiment, wherein the fragment of formula (II) is not purified by chromatography before reacting with the fragment of formula (I).
[0170] A 74th embodiment discloses the process described in the 72nd or 73rd embodiment, wherein the reaction product of any one of steps 1'), 2'), 3'), 4'), 5'), 6'), and 7') is purified by extraction and / or selective precipitation (e.g., as described in the 21st, 35th, 42nd, 46th, or 47th embodiment).
[0171] The 75th embodiment discloses the process according to the 59th to 74th embodiments, wherein the fragment of formula (II') is: 1″) a compound of formula (II′A′), [ka] or a salt thereof, to give a compound of formula (II'A): [ka] or forming a salt thereof; 2″) A compound of formula (II′A) or a salt thereof is reacted with a compound of formula (A2): [ka] or a salt thereof to produce a compound of formula (II'B): [ka] or forming a salt thereof; 3″) Sulfurizing or oxidizing the compound of formula (II′B) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (II′C): [ka] or forming a salt thereof; 4″) Deprotecting the compound of formula (II′C) or a salt thereof to obtain a compound of formula (II′D): [ka] or forming a salt thereof; 5'') Starting from a compound of formula (II'D) or a salt thereof, steps 1'), 2') and 3') are carried out i - twice, followed by step 1') and step 2') to obtain a compound of formula (II'E): [ka] or forming a salt thereof; 6″) Deprotecting the compound of formula (II′E) or a salt thereof to obtain a compound of formula (II′F): [ka] or forming a salt thereof; 7″) The compound of formula (II′F) or a salt thereof is reacted with a phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to produce a fragment of formula (II') or a salt thereof, wherein Z is a hydroxyl protecting group.
[0172] The 76th embodiment discloses the process according to the 75th embodiment, wherein the fragment of formula (II') is not purified by chromatography (column chromatography) before reacting with the oligonucleotide of formula (V).
[0173] The 77th embodiment discloses the process described in the 75th or 76th embodiment, wherein the reaction product of any one of steps 1″), 2″), 3″), 4″), 5″), 6″), and 7″) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, 42nd, 46th, or 47th embodiment).
[0174] A 78th embodiment discloses the process of any one of the 57th to 77th embodiments, wherein n is 3, 4, 5, or 6.
[0175] A 79th embodiment discloses the process of any one of the 57th to 78th embodiments, wherein m is 3, 4, 5, or 6.
[0176] The 80th embodiment is p i is, for each occurrence, independently 3, 4, 5, or 6.
[0177] An 81st embodiment discloses the process of any one of the 60th to 79th embodiments, wherein p1 and p2 are each independently 3, 4, 5, or 6.
[0178] An 82nd embodiment discloses the process of any one of the 60th to 81st embodiments, wherein r is 1, 2, 3, 4, 5, or 6.
[0179] In some embodiments, the deprotection or detritylation reactions of steps c), f), 1), 4), 1′), 4′), 1″ and 4″ are carried out as described in the first aspect or any embodiment described therein (e.g., the second through twelfth embodiments).
[0180] In some embodiments, the coupling reactions of steps a), d), 2), 2′) and 2″) can be carried out by adding an activating agent to an organic solution containing the 3′-OH protected nucleotide fragment and the 5′-OH protected phosphamidite or phosphonate fragment.
[0181] In some embodiments, the sulfurization reaction of steps b), e), 3), 3′), and 3″ can be carried out by using a sulfurizing agent (e.g., 3-amino-1,2,4-dithiazole-5-thione (XH or ADTT), 3-(N,N-dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent), or phenyl-3H-1,2,4-dithiazol-3-one (POS). In certain embodiments, the sulfurizing agent is DDTT. In certain embodiments, the base is pyridine or imidazole.
[0182] In certain embodiments, the oxidation reactions of steps b), e), 3), 3′), and 3″) can be carried out by using standard oxidizing agents known in the literature. Exemplary oxidizing agents include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I, and iodine-pyridine-hydroxide solution. In certain embodiments, the oxidizing agent is t-BuOOH.
[0183] In some embodiments, the deprotection reaction of step 6') or 6'') is as described in the second aspect or any one of the embodiments described therein (e.g., the 23rd to 31st embodiments).
[0184] In some embodiments, the phosphitylation reaction of step 7') or 7'') is as described in the third aspect or any embodiment described therein (e.g., embodiments 35-38).
[0185] ii) 5'-3' extension: In a seventh aspect, the present disclosure describes a solution-phase convergent synthesis of a target oligonucleotide, wherein the target oligonucleotide is assembled from the 5' end to the 3' end (5'-3' direction). The convergent solution-phase process of the present disclosure has been successfully demonstrated to synthesize a target oligonucleotide in the 5'-3' direction. Furthermore, highly pure protected target oligonucleotides can be obtained by the method of the present disclosure without chromatographic purification.
[0186] In certain embodiments, the convergent solution-phase process described herein involves the stepwise addition of oligonucleotide fragments to a solution phase to synthesize a target oligonucleotide. For example, a 5-mer fragment (5'-terminal fragment) having a 5'-hydrophobic hydroxyl protecting group (5'-LHPG) is first coupled to a 5-mer fragment to form a 10-mer fragment having a 5'-LHPG group, which is then further reacted with another 5-mer fragment to form a 15-mer oligonucleotide. In certain embodiments, a 5'-terminal fragment having n nucleotides (e.g., a 5-mer fragment) is synthesized by coupling a single nucleotide having a 5'-LHPG group to a fragment having n-1 nucleotides (e.g., a 4-mer fragment).
[0187] An 83rd embodiment discloses a convergent liquid phase process for preparing target oligonucleotides, which comprises the following steps: a) an oligonucleotide fragment of formula (II2): [ka] or a salt thereof, Oligonucleotide fragment of formula (I2): [ka] or a salt thereof, Coupling in solution to give an oligonucleotide of formula (III2): [ka] or forming a salt thereof; b) sulfurizing or oxidizing an oligonucleotide of formula (III2) or a salt thereof to obtain an oligonucleotide of formula (IV2): [ka] or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; n1 is an integer from 2 to 20; m1 is an integer from 2 to 200; X, for each occurrence, is independently O or S; Y is a hydrophobic hydroxyl protecting group containing an alkyl chain; Z is a silyl hydroxyl protecting group.
[0188] An 84th embodiment discloses the process according to the 83rd embodiment, wherein fragment (II2) is: ia) a nucleotide of formula (II2a1): [ka] or a salt thereof, Oligonucleotide fragment of formula (II2a2): [ka] or a salt thereof, Coupling in solution to give an oligonucleotide of formula (II2a3): [ka] or forming a salt thereof; iia) sulfurizing or oxidizing an oligonucleotide of formula (II2a3) or a salt thereof to obtain an oligonucleotide of formula (II2a4): [ka] or a salt thereof; and iia) deprotecting an oligonucleotide of formula (II2a4), or a salt thereof, to form an oligonucleotide of formula (II2), or a salt thereof.
[0189] An 85th embodiment discloses the process according to the 84th embodiment, wherein fragment (II2a2) is an oligonucleotide of formula (II2a5): [ka] or a salt thereof, Phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to form compound (II2a2).
[0190] An 86th embodiment discloses the process described in the 85th embodiment, wherein the oligonucleotide of formula (II2a3) is: iA) A compound of formula (II2A'): [ka] or a salt thereof, to give a compound of formula (II2A): [ka] or forming a salt thereof; iiA) A compound of formula (II2A) or a salt thereof with a compound of formula (A12): [ka] or a salt thereof to form a compound of formula (II2B): [ka] or forming a salt thereof; iiiA) sulfurizing or oxidizing a compound of formula (II2B) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (II2C): [ka] or a salt thereof; and ivA) Deprotecting a compound of formula (II2C) or a salt thereof to obtain a compound of formula (IID): [ka] or forming a salt thereof; vA) When m1 is greater than 3, starting from a compound of formula (IID), steps ii), iii), and iv) are repeated m1-3 times to form a compound of formula (II2a3) or a salt thereof.
[0191] In certain embodiments, the process disclosed in any of embodiments 84 to 86, m1 is an integer from 3 to 20. In certain embodiments, m1 is 3 to 6. In another particular embodiment, m1 is 4. In yet another particular embodiment, m1 is 5.
[0192] An 87th embodiment discloses a process according to the seventh aspect or any of the 83rd to 86th embodiments, wherein fragment (I2) is an oligonucleotide of formula (I2a1): [ka] or a salt thereof, Phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to form the fragment of formula (I2).
[0193] An 88th embodiment discloses the process according to the 87th embodiment, wherein the oligonucleotide of formula (I2a1) is i') A compound of formula (I2A'): [ka] or a salt thereof, to give a compound of formula (I2A): [ka] or forming a salt thereof; ii') a compound of formula (I2A) or a salt thereof with a compound of formula (A11): [ka] or a salt thereof to produce a compound of formula (I2B): [ka] or forming a salt thereof; iii') sulfurizing or oxidizing the compound of formula (I2B) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (I2C): [ka] or a salt thereof; and iv') deprotecting the compound of formula (I2C) or a salt thereof to obtain a compound of formula (I2D): [ka] or forming a salt thereof; v') when n1 is greater than 2, starting from a compound of formula (I2D), and repeating steps ii'), iiiI'), and iv') n1-2 times to form a compound of formula (I2a1) or a salt thereof.
[0194] An eighty-ninth embodiment is a method for preparing an oligonucleotide of formula (IV2) or a salt thereof by deprotecting the oligonucleotide of formula (V2): [ka] or a salt thereof.
[0195] A 90th embodiment discloses the process described in the 89th embodiment, further comprising: d) reacting an oligonucleotide of formula (V2) or a salt thereof with an oligonucleotide fragment of formula (II2'): [ka] or a salt thereof, Oligonucleotide of formula (VI2): [ka] or a salt thereof; and e) sulfurizing or oxidizing an oligonucleotide of formula (VI2) to obtain an oligonucleotide of formula (VII2): [ka] or a salt thereof and f) deprotecting the oligonucleotide of formula (VII2) or a salt thereof to obtain an oligonucleotide of formula (VIII2): [ka] or a salt thereof; and g) Repeating steps d), e) and f) r1-1 times, followed by repeating steps d) and e) to obtain an oligonucleotide of formula (IX2): [ka] or a salt thereof, where: r1 is an integer from 1 to 50; s i is, for each occurrence, independently an integer from 2 to 20, inclusive; i is an integer between 1 and r1; and [ka] is.
[0196] A 91st embodiment discloses the process according to the 90th embodiment, wherein r1 is 2 and the oligonucleotide of formula (IX2) is of formula (X2): [ka] or a salt thereof, wherein s1 and s2 are each independently an integer from 2 to 20.
[0197] A 92nd embodiment discloses the process described in the 90th embodiment, wherein r1 is 1 and the oligonucleotide of formula (IX2) is of formula (X2'): [ka] or a salt thereof, wherein s1 is an integer from 2 to 20.
[0198] In certain embodiments, for the process of the 91st or 92nd embodiment, s1, s2, m1, and n1 are each independently an integer from 3 to 10, 3 to 6, or 4 to 6. In certain embodiments, s1, s2, m1, and n1 are each independently 4 or 5.
[0199] A 93rd embodiment discloses the process according to the 90th, 91st, or 92nd embodiment, wherein the oligonucleotide fragment of formula (II2′) is an oligonucleotide of formula (II2a1′): [ka] or a salt thereof, Phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 to form a fragment of formula (II2') or a salt thereof.
[0200] A 94th embodiment discloses the process described in the 93rd embodiment, wherein the oligonucleotide of formula (II2a1′) is: i'') Compounds of formula (II'2A'): [ka] or a salt thereof, to give a compound of formula (II'2A): [ka] or forming a salt thereof; ii'') a compound of formula (II'2A) or a salt thereof with a compound of formula (A12'): [ka] or a salt thereof to obtain a compound of formula (II'2B): [ka] or forming a salt thereof; iii'') sulfurizing or oxidizing the compound of formula (II'2B) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (II'2C): [ka] or a salt thereof; and iv″) deprotecting the compound of formula (II′2C) or a salt thereof to obtain a compound of formula (II′2D): [ka] or forming a salt thereof; v'')s i If is greater than 2, start with the compound (II'2D) and carry out steps ii'', iii'', and iv'') as follows: i - twice to form a compound of formula (II2a1') or a salt thereof.
[0201] The 95th embodiment discloses the process described in the 83rd to 94th embodiments, wherein chromatography is not used to purify the reaction product of any one of steps a), b), c), d), e), f), and g).
[0202] The 96th embodiment discloses the process described in the 83rd to 94th embodiments, wherein the reaction product of any one of steps a), b), c), d), e), f), and g) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the 21st, 35th, 42nd, 46th, and 47th embodiments).
[0203] A 97th embodiment discloses the process described in any of the 90th to 96th embodiments, wherein the method further comprises deprotecting the oligonucleotide of formula (IX2), (X2) or (X2′), or a salt thereof, to form an oligonucleotide of formula (IX2A), (X2A) or (X2A′), or a salt thereof: [ka]
[0204] In certain embodiments, Z is a group of formula (IX2), and (X2) or (X2') is selected from TBDPS, ToBDPS, and TBDAS. In certain embodiments, the deprotection reaction is carried out as described in the second aspect or any embodiment described therein (e.g., embodiments 26 to 32).
[0205] The 98th embodiment discloses the process according to any one of the 83rd to 97th embodiments, 16 is -CH2CH2CN, the process may further comprise the steps of: h1) deprotecting the oligonucleotide (IX2A), (X2A) or (X2A′) or a salt thereof to obtain an oligonucleotide of formula (IX2Aa), (X2Aa) or (X2Aa′): [ka] or forming a salt thereof.
[0206] The 99th embodiment discloses the process according to the 98th embodiment, wherein the deprotection reaction is carried out by reacting oligonucleotide (IX2A), (X2A), or (X2A'), or a salt thereof, with a base. In some embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine), and other suitable organic bases.
[0207] A 100th embodiment discloses the process according to the 98th or 99th embodiment, which comprises deprotecting oligonucleotide (IX2Aa), (X2Aa) or (X2Aa') or a salt thereof to obtain an oligonucleotide of formula (IX2B), (X2B) or (X2B'): [ka] or forming a salt thereof.
[0208] The 101st embodiment discloses the process described in the 100th embodiment, wherein deprotection is carried out by reacting the oligonucleotide (IX2Aa) or (X2Aa), or a salt thereof, with NH4OH. In certain embodiments, treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobases (e.g., NH2 protecting groups on the nucleobases). In certain embodiments, treatment with NH4OH provides an oligonucleotide of formula (IX2B), (X2B), or (X2B'), or a salt thereof, wherein R 1 is, for each occurrence, independently a nucleobase, and the NH2 of the nucleobase, if present, is unprotected.
[0209] The 102nd embodiment discloses the process according to any one of the 83rd to 101st embodiments, wherein n1 is 3, 4, 5, or 6.
[0210] The 103rd embodiment discloses a process as described in any one of the 90th to 101st embodiments, wherein s i is independently 3, 4, 5, or 6 for each occurrence.
[0211] The 104th embodiment discloses the process according to any one of the 91st to 101st embodiments, wherein s1 and s2 are each independently 3, 4, 5, or 6.
[0212] The 105th embodiment discloses the process according to any one of the 83rd to 101st embodiments, wherein r1 is 1, 2, 3, 4, 5, or 6.
[0213] The 106th embodiment discloses the process according to any one of the 1 to 105th embodiments, wherein all P=X groups in the compound or oligonucleotide are P=S.
[0214] The 107th embodiment discloses the process according to any one of the 1 to 105th embodiments, wherein all P=X groups in the compound or oligonucleotide are P=O.
[0215] The 108th embodiment discloses the process of any one of the 1 to 105 embodiments, wherein more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the P=X groups in the compound or oligonucleotide are P=S.
[0216] The 109th embodiment discloses the process of any one of the 1 to 105th embodiments, wherein 10-90%, 20-80%, 30-70%, or 40-60% of the P=X groups in the compound or oligonucleotide are P=S.
[0217] The 110th embodiment discloses the process of any one of the 1 to 105 embodiments, wherein 10-90%, 20-80%, 30-70%, or 40-60% of the P=X groups in the compound or oligonucleotide are P=O.
[0218] In some embodiments, the deprotection reactions of steps iia), c) and f) of any of the 84th to 90th embodiments and the 96th embodiment may be carried out as described in the first aspect or any embodiment described therein (e.g., the 26th to 34th embodiments).
[0219] In some embodiments, the deprotection steps of iA), ivA), i'), iv'), i''), and iv") of the seventh aspect may be carried out as described in the first aspect or any embodiment described therein (e.g., the second through twelfth embodiments).
[0220] In some embodiments, the coupling reactions of steps a), ia), ii), iiA), ii'), d), and ii") can be carried out by adding an activating agent to an organic solution containing the 3'-OH protected nucleotide fragment and the 5'-OH protected phosphamidite or phosphonate fragment.
[0221] In some embodiments, the sulfurization reaction of steps b), iii), iiiA), iii′)e), and iii”) can be carried out by using a sulfurizing agent (e.g., 3-amino-1,2,4-dithiazole-5-thione (XH or ADTT), 3-(N,N-dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent), or phenyl-3H-1,2,4-dithiazol-3-one (POS). In certain embodiments, the sulfurizing agent is DDTT. In certain embodiments, the base is pyridine or imidazole.
[0222] In certain embodiments, the oxidation reactions of steps b), iii), iiiA), iii′)e), and iii”) can be carried out by using standard oxidizing agents known in the literature. Exemplary oxidizing agents include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I, and iodine-pyridine-hydroxide solution. In certain embodiments, the oxidizing agent is t-BuOOH.
[0223] In some embodiments, the phosphitylation reactions of the 85th, 87th, and 92nd embodiments can be carried out as described in the third aspect or any embodiment described therein (e.g., the 39th through 42nd embodiments).
[0224] In one embodiment, Y is: [ka] is.
[0225] In certain embodiments, the oligonucleotide of formula (IX2B), (X2B) or (X2B') obtained from the deprotection reaction is purified by depth filtration.In one embodiment, the reaction mixture of the deprotection reaction is diluted with ammonium sulfate solution before being subjected to depth filtration.Diluting with ammonium sulfate can prevent the oligonucleotide from adhering to the filter.
[0226] In certain embodiments, the concentration of the ammonium sulfate solution is between 100 mM and 5 M, between 500 mM and 2 M, between 500 mM and 1500 mM, or between 1000 mM and 1200 mM.
[0227] Any suitable depth filter may be used for depth filtration, such as the suitable depth filters described herein.
[0228] In certain embodiments, the oligonucleotide of formula (IX2A), (IX2Aa), (IX2Aa'), (X2A), (X2A'), (X2Aa), (X2Aa'), (X2B) or (X2B') may be purified by depth filtration followed by hydrophobic interaction chromatography (HIC).
[0229] In certain embodiments, any of the reactions described in the first through eighth aspects or any embodiment described therein (e.g., the first through 135th embodiments) can be carried out in a suitable solvent or mixture of suitable solvents. In certain embodiments, the reactions can be carried out in a suitable organic solvent or mixture of suitable organic solvents. Exemplary organic solvents that can be used in the present disclosure include, but are not limited to, dichloromethane (DCM), acetonitrile (ACN), tetrahydrofuran (THF), acetone, 2-methyltetrahydrofuran, methyl tert-butyl ether, ethyl acetate, and the like.
[0230] In certain embodiments, any reaction described in the first through eighth aspects or any embodiment described therein (e.g., embodiments 1 through 135) can be carried out at a suitable temperature. In certain embodiments, the reaction is carried out at room temperature. In certain embodiments, the reaction is carried out at a temperature of 20°C to 30°C. In certain embodiments, the reaction is carried out at a temperature of -10°C to 10°C, or at a temperature of -5°C to 5°C. In certain embodiments, the reaction is carried out at 25°C ± 2°C. In one embodiment, the reaction is carried out at 0°C ± 2°C.
[0231] A 111th embodiment discloses the process of any one of the embodiments described herein (e.g., the 1st to 135th embodiments), wherein the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethylcytosine, and the NH group of the nucleobase, if present, is protected by PhCO—, CHCO—, iPrCO—, MeN—CH═, or MeN—CMe═.
[0232] The 112th embodiment discloses the process of any one of the embodiments described herein (e.g., the 1st to 135th embodiments), wherein R 1is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, and 5-methylcytosine, wherein the NH group of the nucleobase, if present, is protected by PhCO—, CHCO—, iPrCO—, MeN—CH=, or MeN—CMe=.
[0233] The 113th embodiment discloses a process according to any one of the embodiments described herein (e.g., any one of the 1st to 135th embodiments), Each R 2 H, F, and C 1-4 alkoxy, and optionally C 1-4 substituted with alkoxy; Each R 4 are independently H or R 2 and an alkoxy group of the formula (I), wherein the ring is formed from 1 to 3 C 1-4 is a 5- or 6-membered ring optionally substituted with alkyl groups; R 16 is -CH2CH2CN; and R 17a and R 17b is independently C 1-4 It is alkyl.
[0234] In certain embodiments, the process is the process described in embodiment 113, wherein: Each R 2 are independently H or -OCH2CH2OMe; Each R 4 is H; R 16 is -CH2CH2CN; and R 17a and R 17b are both -CH(CH3)2.
[0235] The 114th embodiment discloses the process according to any one of the 51st to 135th embodiments, wherein the target oligonucleotide is an antisense oligonucleotide comprising 16 to 30 nucleotides.
[0236] The 115th embodiment discloses the process described in the 114th embodiment, wherein the antisense oligonucleotides comprise only modified RNA.
[0237] The 116th embodiment discloses the process according to the 114th embodiment, wherein the antisense oligonucleotides include DNA and modified RNA.
[0238] The 117th embodiment discloses the process according to the 114th embodiment, wherein the antisense oligonucleotide is a gapmer.
[0239] The 118th embodiment discloses the process described in the 114th embodiment, wherein the antisense oligonucleotides comprise only DNA.
[0240] In certain embodiments, the 5′-DMT group (R 15 The target oligonucleotides described herein, having a 5'-DMT group represented by:
[0241] III. Synthesis of Oligonucleotides with Chiral Phosphorothioate Linkages In an eighth aspect, the present disclosure describes a solution-phase process for synthesizing stereospecific oligonucleotides using P(V)-PSI reagents (KW Knouse, JN de Gruyter, MASchmidt, et al. Science, Vol. 361, Issue 6408, pp. 1234-1238 (2018)). Linearly synthesized oligonucleotide fragments may be combined using the solution-phase convergent synthesis method described herein to generate stereoselective targeted oligonucleotides (e.g., antisense oligonucleotides (ASOs)).
[0242] A 119th embodiment is an oligonucleotide of formula (PI1) or (PI2): [ka] or a salt thereof, wherein: 1) A compound of formula (PIB): [ka] or a salt thereof, Compounds of formula (PI1A) or (PI2A): [ka] or a salt thereof, Compounds of formula (PI1C) or (PI2C): [ka] or forming a salt thereof; 2) deprotecting the compound of formula (PI1C) or (PI2C), or a salt thereof, to obtain a compound of formula (PI1D) or (PI2D): [ka] or forming a salt thereof; 3) starting from a compound of formula (PI1D) or (PI2D) or a salt thereof, repeating steps 1) and 2) t-3 times, followed by step 1) to produce a compound of formula (PI') or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15is a hydroxyl protecting group; t is an integer from 3 to 20; and Z is a silyl hydroxyl protecting group.
[0243] In a 120th embodiment, for the process described in the 119th embodiment, the compound of formula (PI1A) is a compound of formula (PIA1): [ka] or a salt thereof, Compounds of formula (1): [ka] React with prepared by forming a compound of formula (PI1A) or a salt thereof; and The compound of formula (PI2A) can be prepared by reacting a compound of formula (PIA1) or a salt thereof with a compound of formula (2): [ka] React with It is prepared by forming a compound of formula (PI2A) or a salt thereof:
[0244] A 121st embodiment discloses a process as described in the process of the 119th or 120th embodiment, wherein the fragment of formula (PIB) is a compound of formula (PIB1): [ka] or a salt thereof by deprotection.
[0245] The 122nd embodiment discloses the process according to the 119th, 120th, or 121st embodiment, wherein the coupling reaction of step 1) is carried out in the presence of a base. In certain embodiments, the base is selected from 8-diazabicyclo[5.4.0]undec-7-ene (DBU), alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, 2-methylpropan-2-amine, etc.), and other suitable organic bases. In certain embodiments, the base is DBU.
[0246] In certain embodiments, the coupling reaction of step 1) is carried out in an anhydrous or substantially anhydrous solution in the presence of a base. In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the reaction. In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by adding a drying agent.
[0247] A 123rd embodiment discloses a process as described in the process of the 122nd embodiment, wherein the coupling reaction is carried out in the presence of a base and a desiccant. Any suitable desiccant may be used. In some embodiments, the desiccant is selected from calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, and molecular sieves. In certain embodiments, the desiccant is a molecular sieve.
[0248] In certain embodiments, the base is DBU and the drying agent is a molecular sieve. In certain embodiments, the molecular sieve has a size of 3 Å.
[0249] A 124th embodiment discloses the process of any one of the 119th to 121st embodiments, wherein the deprotection reaction is carried out by reacting the compound with a detritylation reagent. In certain embodiments, the detritylation reagent is an organic acid. In certain embodiments, the detritylation reagent is CF3COOH, CCl3COOH, CHCl2COOH, CHCl2ClCOOH, citric acid, methanesulfonic acid, benzenesulfonic acid, CClF2COOH, CHF2COOH, or PhSO2H. In certain embodiments, the detritylation reagent is CHCl2COOH. In another preferred embodiment, the detritylation reagent is citric acid.
[0250] The 125th embodiment is R 15 is a 4,4'-dimethoxytrityl group.
[0251] The 126th embodiment discloses the process according to any one of the 120th to 125th embodiments, wherein the reaction between the compound of formula (PIA1) and the compound of formula (1) or (2) is carried out in the presence of a base in an anhydrous or substantially anhydrous solution.
[0252] In certain embodiments, an anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the reaction, hi certain embodiments, an anhydrous or substantially anhydrous solution is obtained by the addition of a drying agent.
[0253] In certain embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, etc.), and other suitable organic bases. In certain embodiments, the base is DBU.
[0254] A 127th embodiment discloses the process according to any one of the 119th to 126th embodiments, further comprising deprotecting the oligonucleotide of formula (PI1) or (PI2), or a salt thereof, to obtain an oligonucleotide of formula (PI1′) or (PI2′): [ka] or forming a salt thereof.
[0255] A 128th embodiment is a silyl protecting group selected from the group consisting of TBDPS, TBoDPS and TBDAS. [ka] 127. The process of claim 127, wherein the process is selected from wherein R5, R6 and R7 are each independently H, C 1-30 Alkyl, or C 1-30 In certain embodiments, Z is alkoxy.
[0256] A 129th embodiment discloses the process described in the 128th embodiment, wherein the deprotection reaction is carried out by reacting an oligonucleotide of formula (PI1) or (PI2), or a salt thereof, with a desilylation reagent (e.g., as described in the second aspect described herein or any embodiment described therein). In certain embodiments, the desilylation reagent is tetra-n-butylammonium fluoride (TEAF).
[0257] A 130th embodiment discloses the process according to any one of the 119th to 129th embodiments, wherein: each R 2 are independently H, F, or C 1-4 alkoxy, and optionally C 1-4 substituted with alkoxy; and R 4 is H. In certain embodiments, R 2 is H. In another particular embodiment, R 2 is -OCH2CH2OCH3.
[0258] The 131st embodiment discloses the process according to any one of paragraphs 119 to 130, wherein the compounds of formula (PI1A), (PI2A), (PIB), (PI1C), (PI2C), (PI1D), (PI2D), (PI1), (PI2), (PI1′) and / or (PI2′) are purified by column chromatography.
[0259] The present disclosure also provides a convergent solution phase process for preparing oligonucleotides, wherein at least a portion of the phosphorothiolate linkages in the oligonucleotides are diastereospecific phosphorothioates.
[0260] A 132 embodiment discloses a convergent liquid phase process for preparing oligonucleotides, which comprises preparing an oligonucleotide fragment of formula (P1F1) or (P2F2): [ka] or a salt thereof, with an oligonucleotide of formula (P1F2) or (P2F2) [ka] or a salt thereof, to form an oligonucleotide of formula (PIII1) or (PIII2) [ka] or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; X, for each occurrence, is independently O or S; t1 is an integer between 3 and 20; x1 is an integer between 3 and 20; and Z is a silyl hydroxyl protecting group.
[0261] Specifically, the oligonucleotide of formula (PIII1) or its salt is formed by a coupling reaction between the oligonucleotide fragment of formula (P1F1) or its salt and the oligonucleotide of formula (P1F2) or its salt. Similarly, the oligonucleotide of formula (PIII2) or its salt is formed by a coupling reaction between the oligonucleotide fragment of formula (P2F1) or its salt and the oligonucleotide of formula (P2F2) or its salt.
[0262] In certain embodiments, the oligonucleotide of formula (PIII1) or (PIII2) or a salt thereof is purified by chromatography.
[0263] A 133rd embodiment discloses a convergent liquid phase process for preparing oligonucleotides, which comprises preparing an oligonucleotide fragment of formula (P1F3) or (P2F3): [ka] or a salt thereof, Oligonucleotide fragment of formula (PF4): [ka] or a salt thereof, Oligonucleotides of formula (PIV1) or (PIV2): [ka] or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, the NH2 of which, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forms a ring with the alkoxy group; R 15 is a hydroxyl protecting group; X, for each occurrence, is independently O or S; t2 is an integer between 3 and 20; x2 is an integer between 3 and 20; and Z is a silyl hydroxyl protecting group.
[0264] Specifically, the oligonucleotide of formula (PIV1) or a salt thereof is formed by a coupling reaction between an oligonucleotide fragment of formula (P1F3) or a salt thereof and an oligonucleotide fragment of formula (PF4) or a salt thereof. Similarly, the oligonucleotide of formula (PIV2) or a salt thereof is formed by a coupling reaction between an oligonucleotide fragment of formula (P2F3) or a salt thereof and an oligonucleotide fragment of formula (PF4) or a salt thereof.
[0265] In certain embodiments, the oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof is purified by chromatography.
[0266] A 134th embodiment discloses the process according to the 133rd embodiment, further comprising the steps of: a) deprotecting an oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof to obtain an oligonucleotide of formula (PIV1′) or (PIV2′): [ka] or a salt thereof; b) combining an oligonucleotide of formula (PIV1') or (PIV2') or a salt thereof with an oligonucleotide fragment of formula (P1F5) or (P2F5): [ka] or a salt thereof, Oligonucleotides of formula (PV1) or (PV2): [ka] [ka] or a salt thereof, wherein y1 is an integer from 3 to 20.
[0267] Specifically, the oligonucleotide of formula (PV1) or its salt is formed by a coupling reaction between the oligonucleotide of formula (PIV1') or its salt and the oligonucleotide fragment of formula (P1F5) or its salt. Similarly, the oligonucleotide of formula (PV2) or its salt is formed by a coupling reaction between the oligonucleotide of formula (PIV2') or its salt and the oligonucleotide fragment of formula (P2F5) or its salt.
[0268] In certain embodiments, the oligonucleotide of formula (PIV1') or (PIV2') or a salt thereof and / or the oligonucleotide of formula (PV1) or (PV2) or a salt thereof is purified by chromatography.
[0269] In certain embodiments, the oligonucleotide fragment of formula (P1F5) or (P2F5) or a salt thereof is an oligonucleotide fragment of formula (PF5a): [ka] or a salt thereof with a PSI reagent (ie, a compound of formula (1) or (2) or a salt thereof).
[0270] In certain embodiments, the oligonucleotide of formula (PF5a) or a salt thereof is an oligonucleotide of formula (PF5b): [ka] or a salt thereof with a base, wherein R 16 is -CH2CH2CN. In certain embodiments, the base is selected from DBU, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, 2-methylpropan-2-amine, etc.), and other suitable organic bases. In certain embodiments, the base is triethylamine or 2-methylpropan-2-amine. In another particular embodiment, the base is triethylamine.
[0271] A 135th embodiment discloses the process according to the 133rd embodiment, further comprising the steps of: a) deprotecting an oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof to obtain an oligonucleotide of formula (PIV1′) or (PIV2′): [ka] or forming a salt thereof; b) combining an oligonucleotide of formula (PIV1') or (PIV2') or a salt thereof with an oligonucleotide fragment of formula (P1F6) or (P2F6): [ka] or a salt thereof, Oligonucleotides of formula (PVI1) or (PVI2): [ka] or forming a salt thereof; c) deprotecting the oligonucleotide of formula (PVI1) or (PIV2) or a salt thereof to obtain an oligonucleotide of formula (PVI1′) or (PVI2′): [ka] or a salt thereof; and c) reacting an oligonucleotide of formula (PVI1') or (PVI2') or a salt thereof with an oligonucleotide fragment of formula (P1F5) or (P2F5): [ka] or a salt thereof, Oligonucleotides of formula (PVII1) or (PVII2): [ka] or a salt thereof, wherein y1 is an integer from 3 to 20; and z1 is an integer from 3 to 20.
[0272] Specifically, the oligonucleotide of formula (PVI1) or its salt is formed by coupling the oligonucleotide of formula (PIV1') or its salt with the oligonucleotide fragment of formula (P1F6) or its salt, and the oligonucleotide of formula (PVII1) or its salt is formed by coupling the oligonucleotide of formula (PVI1') or its salt with the oligonucleotide fragment of formula (P1F5) or its salt. Similarly, the oligonucleotide of formula (PVI2) or its salt is formed by coupling the oligonucleotide of formula (PIV2') or its salt with the oligonucleotide fragment of formula (P2F6) or its salt, and the oligonucleotide of formula (PVII2) or its salt is formed by coupling the oligonucleotide of formula (PVI2') or its salt with the oligonucleotide fragment of formula (P2F5) or its salt.
[0273] In certain embodiments, any one of the oligonucleotides of formula (PIV1'), (PIV2'), (PVI1), (PVI2), (PVI1'), (PVI2'), (PVII1) and (PVII2) or salts thereof is purified by chromatography.
[0274] In certain embodiments, the coupling reaction described in any one of embodiments 132-135 is carried out as described in embodiment 122 or 123. In certain embodiments, the coupling reaction is carried out in the presence of a base. In another particular embodiment, the coupling reaction is carried out in the presence of a base and a drying agent. In yet another particular embodiment, the coupling reaction is carried out in the presence of DBU and molecular sieves.
[0275] In certain embodiments, the deprotection reaction described in any one of the 132nd to 135th embodiments is carried out as described in the 124th embodiment.
[0276] In certain embodiments, the processes disclosed herein include the preparation of the following oligonucleotides: 1. ASO 1 (BIIB 058) (SEQ ID NO: 1), an 18-mer phosphorothioate oligonucleotide (each ribooligonucleotide contains a methoxyethyl (MoE) at the 2' position). 2. ASO 2 (BIIB 067) (SEQ ID NO: 2), a 5-10-5 gapmer phosphothioester and phosphodiester mixed backbone oligonucleotide. The central block of the gapmer is 10 deoxyribonucleotides, flanked by blocks of 2'-MoE ribonucleotides. 3. Phosphorothioate oligonucleotides A, B, C, D, and E, as shown in Table 2 below. 4. ASO 8 (SEQ ID NO: 8), a 4-8-6 gapmer phosphothioester and phosphodiester mixed backbone oligonucleotide. The central block of the gapmer is eight deoxyribonucleotides, flanked by blocks of 2'-MoE ribonucleotides. [ka] (SEQ ID NO: 8) 5. ASO 9 (SEQ ID NO: 9), a 5-8-5 gapmer phosphothioester and phosphodiester mixed backbone oligonucleotide. The central block of the gapmer is eight deoxyribonucleotides, flanked by blocks of 2'-MoE ribonucleotides. [ka] Here, underlined: MOE ribonucleotide P=O: phosphodiester Other: Phosphothioester [Table 1]
[0277] In certain embodiments, the targeted antisense oligonucleotide has the following sequence (5' to 3'): TCACTTTCATAATGCTGG (SEQ ID NO: 1), is a phosphorothioate oligonucleotide having the formula: wherein each internucleoside bond of the oligonucleotide is a phosphorothioate bond, each nucleoside of the oligonucleotide is a 2'-O-methoxyethyl (MOE) nucleoside, and each cytosine is a 5-methylcytosine. SEQ ID NO: 1 is also known as BIIB058 and is described in WO2007 / 002390, WO2010 / 148249, and U.S. Patent No. 8,980,853, the teachings of each of which are incorporated herein by reference.
[0278] In certain embodiments, the sequence of the antisense oligonucleotide is the following sequence (5' to 3'): CAGGATACATTTCTACAGCT (SEQ ID NO: 2) a 5-10-5 MOE gapmer having the formula: wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 6-15 is a 2'-deoxynucleoside, the internucleoside linkages of nucleosides 2-3, 4-5, 16-17, and 18-19 are phosphodiester bonds, and the internucleoside linkages of nucleosides 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 17-18, and 19-20 are phosphorothioate bonds, and each cytosine is a 5'-methylcytosine. SEQ ID NO: 2 has the following chemical notation: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; where, A = adenine, mC=5'-methylcytosine; G = guanine, T = thymine, e=2'-O-methoxyethyl ribose modified sugar; d=2'-deoxyribose sugar; s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage. SEQ ID NO: 2 is known as BIIB067 or ISIS 666853 and is described in WO2015153800, the teachings of which are incorporated herein by reference.
[0279] In certain embodiments, the process is as described in any of the above embodiments or any of its aspects, wherein the antisense oligonucleotide is a 4-8-6 gapmer and has the following sequence (5' to 3'): GUUUUCATCAATATCUGCAA (SEQ ID NO: 8), wherein each of nucleosides 1-4 and 13-18 is a 2'-O-methoxyethyl ribose modified nucleoside, each of nucleosides 5-12 is a 2'-deoxynucleotide, the internucleoside linkages of nucleosides 2-3, 3-4, 13-14, 14-15, and 15-16 are phosphodiester bonds, and the internucleoside linkages of nucleosides 1-2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 16-17, and 17-18 are phosphorothioate bonds, each cytosine is 5-methylcytosine, and wherein uracil is 5-methyluracil. SEQ ID NO: 8 is represented by the following chemical notation: [ka] Underlined = MoE ribonucleotides G = guanine Me C=5-methylcytosine T = thymine A = adenine Me U = 5-methyluracil (also known as thymine) P=O=phosphodiester internucleoside linkage Any other internucleoside linkage is a phosphothioester bond.
[0280] In certain embodiments, the process is as described in any of the above embodiments or any of its aspects, wherein the antisense oligonucleotide is a 5-8-5 gapmer (ASO 9) and has the following sequence (5' to 3'): CCGUUTTCTTACCACCCU (SEQ ID NO: 9), wherein each of nucleosides 1 to 5 and 14 to 18 is a 2'-O-methoxyethyl ribose-modified nucleoside, each of nucleosides 6 to 13 is a 2'-deoxynucleotide, the internucleoside linkage of nucleosides 3 to 4 and 16 to 17 is a phosphodiester bond, and the internucleoside linkage of nucleosides 1 to 2, 2 to 3, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, and 17 to 18 is a phosphorothioate bond, each cytosine is a 5-methylcytosine, and wherein uracil is 5-methyluracil. SEQ ID NO: 9 is described by the following chemical notation: [ka] (SEQ ID NO: 9) Underlined = MoE ribonucleotides G = guanine, Me C=5-methylcytosine T = thymine, A = adenine, Me U = 5-methyluracil (also known as thymine) P=O=phosphodiester internucleoside linkage
[0281] In a specific embodiment, ASO 9 was prepared using the convergent solution phase process of oligonucleotide synthesis of the present disclosure as follows.
[0282] In certain embodiments, ASO 9 was prepared using the convergent solution-phase process of oligonucleotide synthesis of the present disclosure. In certain embodiments, the process s T s A s C s C s -OH, which involves the addition of a phosphoramidite at the 3'-hydroxyl of the fragment DMTrO-T s T s A s C s C s -OP fragment is generated. s T s A s C s C s -OP is HO-A s C o C s C s Coupling with U-LHPG followed by sulfurization yielded DMTrO-T s T s A s C s C s A s C o C s C s This DMT-protected fragment undergoes 5'-hydroxyl deprotection (detritylation) to give HO-T s T s A s C s C s A s C o C s C s U-LHPG was generated and further synthesized using the phosphoramidite fragment DMTrO-U s T s T s C-OP (DMTrO-T s T s A s C s C s -OP synthesis) and subsequently sulfurized to DMTrO-U s T s T s Cs T s T s A s C s C s A s C o C s C s This DMT-protected fragment undergoes 5'-hydroxyl deprotection (detritylation) to give HO-U s T s T s C s T s T s A s C s C s A s C o C s C s U-LHPG is generated and DMTrO-C s C o G s U-OP (DMTrO-T discussed above) s T s A s C s C s DMTrO-C was synthesized in a similar manner to the DMTrO-OP synthesis) and subsequently sulfurized to DMTrO-C. s C o G s UsU s T s T s C s T s T s A s C s C s A s C o C s C s U-LHPG (fully protected ASO 9) is obtained. In certain embodiments, the fragment HO-A s C o C s C s U-LHPG is a DMTrOA s C o C sThe fragment DMTrOA can be prepared by coupling with CP followed by sulfurization and 5'-hydroxyl deprotection (detritylation). s C o C s CP is the fragment DMTrOA s C o C s It can be prepared by adding a phosphoramidite to the 3' hydroxyl of C-OH. As used herein, O is a phosphodiester bond and s is a phosphothiolate bond. [Example]
[0283] Abbreviation ACN = acetonitrile DBU = 8-diazabicyclo[5.4.0]undec-7-ene DCA = CHCl2COOH or dichloroacetic acid DCM = dichloromethane DDTT = 3-(N,N-dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole DCI = 4,5-dicyanoimidazole DI = DIPEA = N,N-diisopropylethylamine DMT or DMTr = 4,4'-dimethoxytrityl or bis-(4-methoxyphenyl)phenylmethyl DMSO = dimethyl sulfoxide EtOAc or EA = ethyl acetate ETT = 5-ethylthio-1H-tetrazole h or hr = hours HBTU = 3-[bis(dimethylamino)methyliumyl]-3H-benzotriazole-1-oxide hexafluorophosphate HOBt = hydroxybenzotriazole imid = imidazole iPrOH = isopropyl alcohol MOE = methoxyethyl MS=molecular sieve MTBE or TBME = methyl tert-butyl ether Py = pyridine RT=retention time TBAF = tetra-n-butylammonium fluoride TBuAA = tributylamine acetate TBDPSCl = tert-butyl(chloro)diphenylsilane TCA = trichloroacetic acid TEA = triethylamine TEAB = tetraethylammonium bromide TFA = trifluoroacetic acid THF = tetrahydrofuran
[0284] Example 1. Synthesis of ASO 9 A. Preparation of 3' fragment: 1. Synthesis of 5'-OH-ACCCU-LHPG fragment (fragment 1) General procedure for the preparation of compounds 1-2 [ka]
[0285] To a solution of compound 1-1 (176 g, 103 mmol, 1.00 equiv.) in DCM (1800 mL) was added DCA (66.8 g, 518 mmol, 42.6 mL, 5.00 equiv.) and CySH (24.1 g, 207 mmol, 25.3 mL, 2.00 equiv.) at 0° C. The mixture was stirred at 0° C. for 1 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.43) showed that compound 1-1 was completely consumed and one new spot was formed. The reaction was clean by TLC. The reaction mixture was purified by NaHCO 3 3( The reaction mixture was quenched by adding 200 mL of 2.50% ethanol (2000 mL), and the dichloromethane (DCM) layer was collected. Anhydrous acetonitrile (ACN) (5000 mL, 30.0 V) was added slowly at 25 °C to precipitate the product. Compound 1-2 (144 g, 103 mmol, 99.5% yield) was obtained as a white solid.
[0286] General procedure for the preparation of compounds 1-3 [ka]
[0287] Compound 1-2 (125 g, 89.6 mmol, 1.00 equiv.) and 5′-DMT-MOE C-3′-P amidite (124 g, 134 mmol, 1.50 equiv.) were coevaporated with ACN (300 mL) and DCM (700 mL). To a solution of compound 1-2 (125 g, 89.6 mmol, 1.00 equiv.) and 5'-DMT-MOE C-3'-P amidite (124 g, 134 mmol, 1.50 equiv.) in DCM / ACN (3:1, 1800 mL) was added molecular sieves 3A (54.0 g). The mixture was stirred at 25 °C for 1 h. To the mixture was added DCI (21.1 g, 179 mmol, 2.00 equiv.). The mixture was stirred at 25 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.55) showed that compound 1-2 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0288] To the mixture was added DDTT (36.7 g, 178 mmol, 2.00 equiv.) and propan-2-ol (3.22 g, 53.6 mmol, 4.11 mL, 0.600 equiv.). The mixture was stirred at 25 °C for 0.5 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.55) showed the formation of one new spot. The reaction was clean by TLC.
[0289] To the mixture was added CySH (20.6 g, 178 mmol, 21.7 mL, 2.00 equiv) and TFA (101 g, 890 mmol, 65.9 mL, 10.0 equiv) at 0° C. The mixture was stirred at 0° C. for 2 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.51) showed the formation of one new spot. The reaction was clean by TLC.
[0290] Pyridine (Py) (84.4 g, 1.07 mol, 86.2 mL, 12.0 equiv.) was added to this mixture. The molecular sieves were removed by filtration, and the solid cake was washed with DCM (500 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO3 solution (1000 mL). The combined organic layers were dried over Mg2SO4, filtered, and concentrated. The crude product was redissolved in DCM (450 mL) and added dropwise to ACN (4000 mL, 30.0 V) with vigorous stirring. The desired product precipitated. Compound 1-3 (173 g, 88.9 mmol, 99.9% yield) was obtained as a white solid.
[0291] General procedure for the preparation of compounds 1-4 [ka]
[0292] Compound 1-3 (123 g, 63.2 mmol, 1 equiv.) and 5′-DMT-MOE C-3′-P amidite (87.4 g, 94.8 mmol, 1.50 equiv.) were coevaporated with ACN (500 mL) and DCM (1500 mL). To a solution of compound 1-3 (123 g, 63.2 mmol, 1.00 equiv.) and 5'-DMT-MOE C-3'-P amidite (87.4 g, 94.8 mmol, 1.50 equiv.) in DCM / ACN (3:1, 1600 mL) was added molecular sieves 3A (48.0 g). The mixture was stirred at 25 °C for 1 h. To the mixture was added DCI (14.9 g, 126 mmol, 2.00 equiv.). The mixture was stirred at 25 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.64) showed that compound 1-3 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0293] To the mixture was added DDTT (25.9 g, 126 mmol, 2.00 equiv). The mixture was stirred at 25 °C for 0.5 h. To the mixture was added propan-2-ol (2.28 g, 37.95 mmol, 2.91 mL, 0.6 equiv) at 25 °C. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.68) showed the formation of one new spot. The reaction was clean by TLC.
[0294] To this mixture, trifluoroacetic acid (TFA) (86.5 g, 758 mmol, 56.1 mL, 12.0 equiv.) and CySH (14.7 g, 126 mmol, 15.4 mL, 2.0 equiv.) were added at 0° C. The mixture was stirred at 0° C. for 1 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.56) showed the formation of one new spot. The reaction was clean by TLC.
[0295] Py (70.03 g, 885.31 mmol, 71.46 mL, 14 equiv.) was added to this mixture. The molecular sieves were removed by filtration, and the solid cake was washed with DCM (1000 mL). The pH value of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO3 solution (2000 mL). The combined organic layers were dried over Mg2SO4. The crude product was redissolved in DCM (600 mL) and added dropwise to ACN (5000 mL, 30 V) with vigorous stirring. The desired product precipitated. Compound 1-4 (143 g, 57.31 mmol, 90.63% yield) was obtained as a white solid.
[0296] General procedure for the preparation of compounds 1-5 [ka]
[0297] Compound 1-4 (290 g, 116 mmol, 1.00 equivalents) and 5'-DMT-MOE C-3'-P amidite (160 g, 174 mmol, 1.50 equiv.) was coevaporated with ACN (500 mL) and DCM (1500 mL). To a solution of compound 1-4 (290 g, 116.23 mmol, 1 equiv.) and 5'-DMT-MOE C-3'-P amidite (160 g, 174 mmol, 1.50 equiv.) in DCM / ACN = 3:1 (2300 mL) was added molecular sieves 3 Å (69.0 g). The mixture was stirred at 25 °C for 1 h. DCI (34.3 g, 290 mmol, 2.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.70) showed that compound 1-4 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0298] To the mixture was added t-BuOOH (HO, 31.8 mL, 70.0% purity, 2.00 equiv.), and the resulting mixture was stirred at 25 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.72) showed the formation of one new spot. The reaction was clean by TLC. The molecular sieves were removed by filtration, and the solid cake was washed with DCM (1000 mL). With vigorous stirring, the crude product was added dropwise to ACN (9000 mL, 30.0 V). The desired product precipitated. Compound 1-5 (386 g, 116 mmol, 99.8% yield) was obtained as a white solid.
[0299] General procedure for the preparation of compounds 1-6 [ka]
[0300] To a solution of compound 1-5 (386 g, 115 mmol, 1.00 equiv.) in DCM (5700 mL) was added CySH (40.3 g, 347 mmol, 42.5 mL, 3.00 equiv.) and dichloroacetic acid (DCA) (298 g, 2.32 mol, 190 mL, 20.0 equiv.) at 0 °C. The mixture was stirred at 0 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.46) showed that compound 1-5 was completely consumed and one new spot was formed. The reaction was clean by TLC. Py (201 g, 2.55 mol, 205 mL, 22.0 equiv.) was added to the mixture. The molecular sieves were removed by filtration, and the solid cake was washed with DCM (800 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO3 (4000 mL). The combined organic layers were dried over Mg2SO4. The crude product was redissolved in DCM (500 mL) and added dropwise to ACN (12000 mL, 30 V) with vigorous stirring. The desired product precipitated. Compound 1-6 (310 g, 102 mmol, 88.3% yield) was obtained as a white solid.
[0301] General procedure for the preparation of compounds 1-7 (5'-OH-ACCCU-LHPG) [ka]
[0302] Compound 1-6 (154 g, 50.8 mmol, 1.00 equiv.) and 5′-DMT-MOE A-3′-P amidite (71.0 g, 76.2 mmol, 1.50 equiv.) were coevaporated with ACN (500 mL) and DCM (1500 mL).
[0303] To a solution of compound 1-6 (154 g, 50.8 mmol, 1.00 equiv.) and 5'-DMT-MOE A-3'-P amidite (71.0 g, 76.2 mmol, 1.50 equiv.) in DCM / ACN (3:1, 1200 mL) was added molecular sieves 3A (36.0 g). The mixture was stirred at 25 °C for 1 h. To the mixture was added DCI (15.0 g, 127 mmol, 2.50 equiv.). The mixture was stirred at 25 °C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.57) showed that compound 1-6 was completely consumed and one new spot was formed. The reaction was clean by TLC. To the mixture was added DDTT (17.7 g, 86.3 mmol, 1.70 equiv.) and propan-2-ol (iPrOH) (1.83 g, 30.4 mmol, 2.33 mL, 0.600 equiv.). The mixture was stirred at 25 °C for 0.5 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.59) showed the formation of one new spot. The reaction was clean by TLC.
[0304] To the mixture was added TFA (75.2 g, 659 mmol, 48.8 mL, 13.0 equiv) and CySH (11.7 g, 101 mmol, 12.4 mL, 2.00 equiv) at 0° C. The mixture was stirred at 0° C. for 1 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.47) showed the formation of one new spot. The reaction was clean by TLC.
[0305] Py (58.5 g, 739 mmol, 59.7 mL, 15.0 equiv.) was added to this mixture. The molecular sieves were removed by filtration, and the solid cake was washed with DCM (300 mL). The pH value of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO3 solution (2000 mL). The combined organic layers were dried over Mg2SO4. The crude product was redissolved in DCM (400 mL) and added dropwise to ACN (4500 mL, 30.0 V) with vigorous stirring. The desired product precipitated. Compound 1-7 (5'-OH-ACCCU-LHPG) (169 g, 47.0 mmol, 92.7% yield) was obtained as a white solid. HPLC and LC-MS analysis of compound 1-7 was performed using an ammonolysis (NH3 / HO) procedure similar to that used for the ammonolysis of compound 1 disclosed below to give 1-7-a (5'-OH-ACCCU-OH). The HPLC and LC-MS of compound 1-7-a are shown in Figure 1. [ka]
[0306] The HPLC-MS method for compound 1-7-a is described below: ● Column - ACQUITY UPLC BEH shielded RP18 column, 130Å, 1.7μm, 2.1mm x 150mm; ●Column temperature: 65℃; ● Mass spectrometry scan range: 300~2000m / z; ●MS polarity: negative Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH3CN, 1 μM EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA ●Slope: [Table 2]
[0307] 2. Alternative synthesis of the 5'-OH-ACCCU-LHPG fragment (fragment 1) Preparation of 5'-DMT-ACCC-3'OH [ka]
[0308] 5'-DMT-ACCC-3'-OH (1-8) was prepared based on the above scheme using a procedure similar to that described above for compound 1-3. General procedure for the preparation of 5'-DMT-ACCC-3'-P amidite (1-8a) [ka]
[0309] 5'-DMT-ACCC-3'-OH (280.0 g, 1.0 equiv.) was charged to a reactor (R1) under N2 protection. DCM (1000 mL 3.57 V) was charged to a flask under N2 protection. The compound was coevaporated with DCM under vacuum at 25-30 °C. Coevaporation with DCM was repeated three times until the residual water level was below 0.01%. THF (1400 mL 5 V) was charged to R1 under N2 protection. Samples were collected for analysis. The temperature of R1 was adjusted between -5 °C and 5 °C. P reagent (106.7 g, 2.992 equiv.) was charged to R1 under N2 protection. (Pyridine; 2,2,2-trifluoroacetic acid 45.7 g, 2.001 equiv.) was added to R1 under N2 protection, and the reaction mixture was stirred at -5 °C to 5 °C for 1 h.
[0310] Methyl tert-butyl ether (MTBE) (10080 mL, 36 V) was charged to another flask (R2) under N2 protection. Py (70 mL, 0.25 V) was charged to R2 under N2 protection. Heptane (3920 mL, 14 V) was charged to R1 under N2 protection. R2 was purged with N2 at -5°C to 5°C for 30 minutes. The solution from R1 was slowly charged to the solution in R2 under N2 protection. R2 was stirred at -5°C to 5°C for 1 hour. The reaction mixture was filtered. The cake was washed twice with a solution of MTBE:heptane (5:2, 700 mL). A sample of the filtrate was collected for analysis. The cake was dried at 25°C to 30°C for 24 hours to obtain 5'-DMT-ACCC-3'-P amidite 1-8a (292.3 g, yield: 96.25%, purity: 98%).
[0311] General procedure for preparation of 5'-DMT-ACCCU-3'-LHPG(1-9) [ka]
[0312] 5'-HO-U-3'-LHPG (120.0 g) was charged to a reactor, followed by molecular sieves (3 Å) (300.0 g), 5'-DMT-ACCC-P-amidite (280.68 g, 1.27 equiv.), and DCM (3000 mL, 25 V). The reaction mixture was stirred at 20°C to 30°C for 1 h. DCI (20.33 g, 2.00 equiv.) was charged to the reaction mixture, and the mixture was stirred at 20°C to 30°C for 30 min. A sample was collected for analysis. DDTT (35.35 g, 2.0 equiv.) was charged to the reaction mixture. A sample was collected for analysis. The reaction mixture was filtered, concentrated, and dissolved in DCM (720 mL, 6 V). The DCM solution was added dropwise to a solution of ACN (9000 mL, 75 V), followed by rotary evaporation to remove most of the DCM. The mixture was filtered, and the filter cake was washed twice with ACN (600 mL, 10 V). The wet cake was dried at 20-30 °C for 16 h to give 5'-DMT-ACCCU-3'-LHPG (287.15 g, 85.7% yield).
[0313] General procedure for the preparation of 5'-OH-ACCCU-3'-LHPG (1-7) [ka]
[0314] 5'-DMT-ACCCC-3'-LHPG (285.54 g), molecular sieves (3A) (142.77 g), and DCM (2855 mL, 10V) were charged to a reactor. The reaction mixture was stirred at 20°C to 30°C for 1 hour, and the reaction temperature was adjusted to -5°C to 5°C. Dodecane-1-thiol (51.97 g, 3.5 equiv.) was charged to the reactor, followed by TFA (58.55 g, 7.0 equiv.), and the reaction mixture was stirred at -5°C to 5°C for 1 hour. 1-Methylimidazole (NMI) (54.21 g, 9.0 equiv.) was charged to the reactor, and the reaction mixture was stirred at 20°C to 30°C for 5 minutes. The reaction mixture was filtered, and the solution was concentrated to remove DCM. The crude product was dissolved in DCM (427.5 mL, 1.5 V), and this solution was added dropwise to a solution of ACN (8566 mL, 30 V). The resulting mixture was concentrated by rotary evaporation to remove most of the DCM and filtered. The cake was washed twice with ACN (571 mL, 4 V) and dried at 20-30 °C to give compound 1-7 (239.92 g; 91.1% yield).
[0315] B. General Procedure for Preparation of 5' Fragments 1. Synthesis of deoxy-TTACC pentamer fragment (fragment 2) General procedure for the preparation of compound 2-2 [ka]
[0316] To a solution of compound 2-1 (300 g, 463 mmol, 1.00 equiv) in DCM (2300 mL) was added imidazole (94.6 g, 1.39 mol, 3.00 equiv) at 25 °C. The mixture was a pale yellow homogeneous solution. TBDPSCl (tert-butyl(chloro)diphenylsilane) (166 g, 602 mmol, 155 mL, 1.30 equiv) was added at 25 °C. The mixture was stirred at 25 °C for 12 h. Note: The temperature rose 5 °C during the addition of TBDPSCl. HPLC showed complete consumption of the reactant. Propan-2-ol (27.8 g, 463 mmol, 35.5 mL, 1.00 equiv) was added, and the mixture was stirred at 25 °C for 0.5 h.
[0317] To the above solution was added cyclohexanethiol (70.0 g, 602 mmol, 73.7 mL, 1.30 equiv) at 0° C. The mixture was stirred at 0° C. for 15 min. TFA (264.06 g, 2.32 mol, 171.47 mL, 5 equiv) was added dropwise over 45 min at 0° C. The mixture was stirred at 0° C. for 1 h. The color of the solution changed from pale yellow to deep red, and a white solid was observed during the addition of TFA. HPLC showed the reaction was complete.
[0318] The reaction mixture was poured into Na2CO3 solution (245 g Na2CO3 in 1.5 L of water), diluted with methyl tert-butyl ether (TBME or MTBE) (1.5 L), and the two layers were separated. The organic layer was washed with brine (750 mL × 2), dried over anhydrous MgSO4 (232 g), filtered through Celite, and concentrated. Note that some white solid was observed during the addition of the aqueous Na2CO3 solution, and no product precipitated during the concentration process until the product evaporated to dryness, yielding the crude product as a yellow foamy solid.
[0319] The crude product was dissolved in DCM (300 mL) and loaded into a 1000 mL separatory funnel. The crude product solution was slowly added dropwise to a heptane / TBME solvent mixture (v / v 9:1, 3.0 L) to carry out the precipitation process. This process took approximately 30 minutes. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a heptane solvent mixture (100 mL × 2) and concentrated to dryness. Compound 2-2 (235 g, 395 mmol, 85.2% yield, 98.0% purity) was obtained as a white solid.
[0320] General procedure for the preparation of compounds 2-4 [ka]
[0321] Compound 2-2 (10.0 g, 17.1 mmol, 1.00 equiv.) and compound monomer 2-3 (17.4 g, 20.6 mmol, 1.20 equiv.) were coevaporated with CHCN (20 mL × 2) under Ar in a 250 mL single-neck round bottle.
[0322] Compound 2-2 (10.0 g, 17.1 mmol, 1.00 equiv.) and compound monomer 2-3 (17.4 g, 20.6 mmol, 1.20 equiv.) were dissolved in ACN (80 mL) and DCM (80 mL) (CHCN / DCM = 1 / 1) at 25 °C. ETT (3.34 g, 25.7 mmol, 1.50 equiv.) was added, and the mixture was stirred at 25 °C for 30 min under Ar. It is important to note that the acetonitrile used in the reaction was 99.9% pure and further dried over molecular sieves to a water content of less than 50 ppm. Anhydrous DCM was also used. The mixture changed from a pale yellow homogeneous solution to a pale yellow cloudy solution. HPLC showed that compound 2-2 was completely consumed.
[0323] To the above solution was added xanthan hydride (2.83 g, 18.8 mmol, 1.10 equiv) at 25° C. The mixture was stirred at 25° C. for 0.5 h. Note: The mixture changed from a pale yellow homogeneous solution to a yellow cloudy solution. HPLC showed the reaction was complete.
[0324] The above solution was cooled to 0° C. in an ice-water bath for 30 minutes. TFA (13.7 g, 120 mmol, 8.88 mL, 7.00 equiv.) was added to the reaction mixture at 0° C. The mixture was stirred at 0° C. for 2.5 hours. The color of the mixture changed from yellow cloudy to red. HPLC showed the reaction was complete.
[0325] A Na2CO3 solution (12.7 g Na2CO3 in 83 mL water) was slowly added to the reaction mixture (the rate of CO2 evolution was monitored to avoid bumping of the reaction solution). The naturalization process was carried out for about 12 hours, and then all the solvent in the reaction mixture was removed by rotavapor to obtain a milky white suspension of the crude product in water.
[0326] The crude product was dissolved in a mixed solvent of EtOAc / TBME (v / v 1:3, 800 mL), and the two layers were separated. The organic layer was washed with water (400 mL) and brine (2×400 mL), dried over anhydrous MgSO (ca. 42.0 g), filtered through Celite, and concentrated.
[0327] The crude product was dissolved in DCM (55 mL) and loaded into a 100 mL separatory funnel. The crude product solution was slowly added to a solvent mixture of heptane / TBME (v / v 9, 1600 mL) through the funnel to carry out the precipitation process. This process took approximately 60 minutes. The time of the quenching step was extended by 1 hour.
[0328] The pure product was collected as a white solid on a Buchner funnel. The product cake was washed with a solvent mixture of heptane (50 mL × 2) and concentrated to dryness. Compound dimer 2-4 (25.5 g, 16.6 mmol, 96.6% yield, 68.2% purity) was obtained as a pale yellow solid.
[0329] General procedure for the preparation of compounds 2-6 [ka]
[0330] Compound dimer 2-4 (10.0 g, 9.43 mmol, 1.00 equiv.) and compound monomer 2-5 (8.90 g, 10.4 mmol, 1.10 equiv.) were coevaporated with ACN (100 mL × 3) in a 500 mL single-neck round bottle, then dissolved in ACN (30 mL) and DCM (30 mL) (CHCN / DCM = 1 / 1) at 25 °C. 5-Ethylsulfanyl-2H-tetrazole (1.84 g, 14.2 mmol, 1.5 equiv.) was added at 25 °C, and the mixture was stirred at 25 °C for 30 min. HPLC showed that reactant dimer 2-4 was completely consumed.
[0331] To the above solution was added 5-amino-1,2,4-dithiazole-3-thione (1.56 g, 10.4 mmol, 1.10 equiv.) at 25° C. The mixture was stirred at 25° C. for 0.5 h. The mixture changed from a pale yellow homogeneous solution to a yellow cloudy solution. HPLC showed the reaction was complete.
[0332] The above solution was cooled to 0°C. TFA (6.45 g, 56.6 mmol, 4.20 mL, 6.00 equiv) was added dropwise at 0°C. The mixture was stirred at 0-25°C for 3 h. The color of the mixture changed from yellow turbidity to an orange-yellow suspension. HPLC showed the reaction was complete.
[0333] A Na2CO3 solution (6.00 g Na2CO3 in 46.6 mL water) was slowly added to the reaction mixture (the rate of CO2 evolution was monitored to avoid bumping of the reaction solution). The acclimation process was carried out for about 1 hour, and then all the solvent in the reaction mixture was removed by rotavapor to obtain a milky white suspension of the crude product in water. The crude product was dissolved in a mixed solvent of EtOAc / TBME (v / v 3:1, 622 mL) and the two layers were separated. The organic layer was washed with water (155 mL), brine (2 × 155 mL), dried over anhydrous MgSO (approximately 15.5 g), filtered, and concentrated under reduced pressure. Note that a yellow gel solid did not precipitate in this process. The crude product was dissolved in DCM (70 mL) and loaded into a 100 mL separatory funnel.
[0334] The crude product solution from the funnel was slowly added to TBME solvent (1.24 L) for the precipitation process. This process took approximately 1.5 hours. The pure product was collected as a white solid on a Buchner funnel, and the product cake was washed with a heptane solvent mixture (50 mL × 2) and concentrated to dryness. Compound trimer 2-6 (11.4 g, 6.63 mmol, 70.3% yield, 90.0% purity) was obtained as a pale yellow solid.
[0335] General procedure for the preparation of compounds 2-8 [ka]
[0336] To a solution of compound trimer 2-6 (4.20 g, 2.72 mmol, 1.00 equiv.) in CH3CN (10 mL), monomer 2-7 (3.03 g, 4.07 mmol, 1.50 equiv.) was added, and the solution was coevaporated with CH3CN (10 mL × 2) under Ar2 in a 100 mL single-neck round bottle.
[0337] Compound trimer 2-6 (4.20 g, 2.72 mmol, 1.00 equiv.) and monomer 2-7 (3.03 g, 4.07 mmol, 1.50 equiv.) were dissolved in CHCN (12 mL) and DCM (12 mL) (CHCN / DCM = 1 / 1) at 25 °C. 3Å molecular sieves (4.00 g, 1.00 equiv.) were added, and the mixture was stirred at 25 °C for 1 h under Ar. 5-Ethylsulfanyl-2H-tetrazole (530 mg, 4.07 mmol, 1.50 equiv.) was added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. The mixture changed from a pale yellow homogeneous solution to a pale yellow cloudy solution. The reaction mixture was filtered to remove the 3Å molecular sieves.
[0338] It is important to note that both the acetonitrile and DCM were freshly redistilled. HPLC showed that the trimer was completely consumed.
[0339] To the above solution was added 5-amino-1,2,4-dithiazole-3-thione (449 mg, 2.99 mmol, 1.10 equiv) at 25° C. The mixture was stirred at 25° C. for 0.5 h. The mixture changed from a pale yellow homogeneous solution to a yellow cloudy solution. HPLC showed the reaction was complete.
[0340] To the above mixture was added TFA (2.48 g, 21.7 mmol, 1.61 mL, 8.00 equiv) dropwise at 0° C. The mixture was stirred at 0° C. for 4.5 h. The mixture changed from a yellow cloudy color to an orange-yellow suspension. HPLC showed the reaction was complete.
[0341] A Na2CO3 solution (2.88 g Na2CO3 in 20 mL water) was slowly added to the reaction mixture (the rate of CO2 evolution was monitored to avoid bumping of the reaction solution). The acclimation process was carried out for about 1 hour, and then all the solvent in the reaction mixture was removed by rotavapor to obtain a milky white suspension of the crude product in water.
[0342] The crude product was dissolved in a mixed solvent of EtOAc / TBME (v / v 3:1, 260 mL) and the two layers were separated. The organic layer was washed with water (64 mL), brine (2 × 64 mL), dried over anhydrous MgSO (approximately 6.44 g), filtered through Celite, and concentrated.
[0343] The crude product was dissolved in DCM (28 mL) and loaded into a 100 mL separatory funnel. The solution of the crude product was slowly added dropwise from the funnel to the solvent TBME (518 mL) to carry out the precipitation process. This process took about 30 minutes.
[0344] The pure product was collected as a white solid on a Buchner funnel. The product cake was washed with a solvent mixture of heptane (20 mL × 2) and concentrated to dryness. Compound tetramer 2-8 (4.37 g, 2.07 mmol, 76.2% yield, 91.0% purity) was obtained as a pale yellow solid.
[0345] General procedure for the preparation of compounds 2-9 (deoxy-TTACC pentamers) [ka]
[0346] Tetramer 2-8 (120 g, 62.5 mmol, 1.00 equiv.) was coevaporated with ACN (500 mL × 2), followed by addition of monomer 2-7 (51.2 g, 68.8 mmol, 1.10 equiv.), and the solution was coevaporated with ACN (500 mL × 2) under Ar in a 3 L single-neck round.
[0347] To a mixed solution of tetramer 2-8 (120 g, 62.5 mmol, 1.00 equiv.) and monomer 2-7 (51.2 g, 68.8 mmol, 1.10 equiv.) in ACN (485 mL) was added molecular sieves 3A (36 g) at 25 °C. The mixture was stirred at 25 °C for 1 h. PyTFA (1 M, 93.8 mL, 1.50 equiv.) was added at 25 °C. The resulting mixture was stirred at 25 °C for 30 min. It is important to note that the acetonitrile was freshly redistilled. HPLC showed that tetramer 2-8 was completely consumed.
[0348] To the above mixture was added DDTT (14.1 g, 68.8 mmol, 1.10 equiv) at 25° C. The mixture was stirred at 25° C. for 0.5 h. After the sulfurization was complete, the above mixture was diluted with redistilled MeCN (480 mL) and then cooled to 0° C. Py (49.4 g, 625 mmol, 50.5 mL, 10.0 equiv) was added at 0° C.
[0349] Simultaneously, a 1 L three-necked round-bottom flask was charged with imidazole (85.1 g, 1.25 mol, 20.0 equiv.) and anhydrous THF (240 mL) and placed in an ice bath for 30 min. HF (17.9 g, 625 mmol, 16.3 mL, 70% purity, 10.0 equiv.) was slowly added, followed by stirring for an additional 15 min (homogeneity was achieved at this step). The solution was added to the above suspension at 0 °C via a syringe pump (drop rate of 2 mL / min). The mixture was stirred at 0 °C for 3 h. HPLC showed the reaction was complete.
[0350] The reaction mixture was dissolved in EtOAc (2.8 L). The organic layer was washed with saturated aqueous NaHCO3 (1.4 L x 2), water (1.4 L x 3), brine (1.4 L), dried over anhydrous MgSO4 (approximately 208 g), filtered, and concentrated in vacuo. No yellow gel solid precipitated in this process.
[0351] The crude product was dissolved in DCM (840 mL) and ACN (240 mL) and loaded into a 1 L separatory funnel. The crude product solution was slowly added to TBME (8.5 L) through the funnel to carry out the precipitation process. This process took approximately 3 hours. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a TBME solvent mixture (1 L x 2) and concentrated to dryness. Deoxy-TTACC pentamer (145.5 g, 57.8 mmol, 92.4% yield, 93.6% purity) was obtained as a white solid. HPLC-MS of deoxy-TTACC pentamer (2-9) at RT = 7.174 min is shown in Figure 2.
[0352] HPLC-MS method for compounds 2-9: ● Column: ACQUITY UPLC BEH Shield RP18 Column, 130Å, 1.7μm, 2.1mm × 150mm; ●Column temperature: 60℃; • MS analysis was performed on a Thermo Orbitrap Fusion with a resolution of 60,000 and a mass range of 700–2,000. ●MS polarity: positive Mobile phase A: 20 mM ammonium acetate in ACN:water = 25:75; Mobile phase B: acetonitrile; ●Slope: [Table 3]
[0353] 2. Synthesis of UTTC tetramer (fragment 3) General procedure for the preparation of compound 3-2 [ka]
[0354] To a solution of compound 3-1 (500 g, 772 mmol, 1.00 equiv.) in DCM (3800 mL) was added imidazole (158 g, 2.32 mol, 3.0 equiv.). TBDPSCl (276 g, 1.00 mol, 258 mL, 1.30 equiv.) was added. The mixture was stirred at 25 °C for 16 h. TLC (petroleum ether / ethyl acetate = 5 / 1, product: Rf = 0.40) showed that compound 3-1 was completely consumed. Propan-2-ol (46.4 g, 59.1 mL, 1.00 equiv.) was added, and the mixture was stirred for 30 min.
[0355] To the above solution was added CySH (117 g, 1.00 mol, 123 mL, 1.30 equiv) at 0° C. The mixture was stirred at 0° C. for 15 min. TFA (440 g, 3.86 mol, 286 mL, 5.00 equiv) was added dropwise over 30 min at 0° C. The mixture was stirred at 0° C. for 1 h. HPLC showed the reaction was complete. Note that the color of the solution changed from pale yellow to deep red during the addition of TFA.
[0356] The reaction mixture was diluted with NaCO solution (410 g NaCO in 2.5 L water) 3) The mixture was poured into a broth, diluted with TBME (2.5 L), and the two layers were separated. The organic layer was washed with brine (1.3 L x 2), dried over anhydrous MgSO4 (321 g), filtered through Celite, and concentrated.
[0357] The crude product was dissolved in DCM (600 mL) and loaded into a 1000 mL separatory funnel. The crude product solution was slowly added to a heptane / TBME solvent mixture (v / v 9:1, 5.0 L) through the funnel to carry out the precipitation process. This process took approximately 30 minutes. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a heptane solvent mixture (500 mL × 2) and concentrated to dryness. Compound 3-2 (390 g, 660 mmol, 85.5% yield, 98.8% purity) was obtained as a white solid.
[0358] General procedure for the preparation of compound 3-3 [ka]
[0359] Compound 3-2 (110 g, 188 mmol, 1.00 equiv.) and dT amidite (168 g, 226 mmol, 1.20 equiv.) were coevaporated with CHCN (1.0 L × 3). The mixture was dissolved in CHCN (500 mL) and DCM (500 mL) at 25 °C. 5-(Ethylthio)-1H-tetrazole (ETT) (1.67 g, 12.8 mmol, 1.50 equiv.) was added with stirring, and the mixture was stirred at 25 °C for 30 min under an Ar atmosphere. Note that both acetonitrile and DCM were freshly redistilled. HPLC showed that compound 3-2 was completely consumed. Note that the dT amidite is the following DMT-2'-deoxythymidine phosphoramidite: [ka]
[0360] To the above solution was added xanthan hydride (31.1 g, 207 mmol, 1.10 equiv) at 25° C. The mixture was stirred for 0.5 h at 25° C. HPLC showed the reaction was complete.
[0361] The above solution was cooled to 0° C. in ice water. CySH (24.1 g, 207 mmol, 25.4 mL, 1.10 equiv.) was added to the reaction mixture at 0° C. TFA (215 g, 1.88 mol, 140 mL, 10.0 equiv.) was added to the reaction mixture at 0° C. The mixture was stirred at 25° C. for 2 hours. HPLC showed that the reaction was complete. The color of the mixture changed from yellow turbid to red.
[0362] A Na2CO3 solution (254 g, Na2CO3 in 3.4 L of water) was slowly added to the reaction mixture (the rate of CO2 evolution was monitored to avoid bumping of the reaction solution). The acclimation process took about 1 hour, and then all the solvent in the reaction mixture was removed by rotavapor to obtain a milky white suspension of the crude product in water.
[0363] The two reactions were then combined, and the resulting aqueous crude product was diluted with 7.5 L of MeCN (addition of MeCN may dissolve the crude product cake) and extracted three times with TBME / heptane (3 x 3.4 L, v / v, 1:4) to remove non-polar impurities (e.g., CySH and DMTrSCy). The aqueous fractions were collected in a 3.0 L round-bottom flask and the entire MeCN was removed under reduced pressure in a rotavapor, again yielding an aqueous solution containing the crude yellow gel cake.
[0364] The aqueous solution of the crude product was diluted with a mixed solvent of EtOAc / TBME (v / v = 1:3, 5.1 L) (ensuring that no gel solid remained in the solution), and the two layers were separated. The organic layer was washed three times with DI water (3 × 2.5 L), brine (2.5 L), dried over anhydrous MgSO (ca. 500 g), and concentrated to dryness to give the crude yellow foam, which was used directly in the next step without further treatment. Compound 3-3 (420 g, 330 mmol, 88.5% yield, 76.0% purity) was obtained as a pale yellow solid.
[0365] General procedure for the preparation of compounds 3-4 [ka]
[0366] Compound 3-3 (200 g, 208 mmol, 1.00 equiv.) and dT amidite (186 g, 250 mmol, 1.20 equiv.) were coevaporated with ACN (1.0 L x 3) in a 3 L single-necked tube under Ar. To the above solution in ACN (525 mL) and DCM (525 mL) was added molecular sieves 3A (52.0 g) at 25 °C. The mixture was stirred at 25 °C for 1 h. ETT (40.8 g, 313 mmol, 1.50 equiv.) was added at 25 °C. The resulting mixture was stirred at 25 °C for 30 min. Note that both acetonitrile and DCM were freshly redistilled. HPLC showed that compound 3-3 was completely consumed.
[0367] To the above solution was added xanthan hydride (34.5 g, 229 mmol, 1.10 equiv) at 25° C. The mixture was stirred for 0.5 h at 25° C. HPLC showed the reaction was complete.
[0368] The above solution was cooled to 0°C in ice water. CySH (26.7g, 229mmol, 28.1mL, 1.10eq) was added to the reaction mixture at 0°C for 10 minutes. TFA (238g, 2.09mol, 154mL, 10.0eq) was added to the reaction mixture at 0°C. The mixture was stirred at 25°C for 2 hours. HPLC showed the reaction was complete. Note that the color of the mixture changed from yellow cloudy to red.
[0369] A Na2CO3 solution (156 g, Na2CO3 in 2100 mL of water) was slowly added to the reaction mixture (the rate of CO2 evolution was monitored to avoid bumping of the reaction solution). The acclimation process was carried out for about 1 hour, and then all the solvent in the reaction mixture was removed by rotavap to obtain a milky white suspension of the crude product in water. The crude product was dissolved in a mixed solvent of EtOAc / TBME (v / v 1:2, 6400 mL) and the two layers were separated. The organic layer was washed with water (3×3200 mL), brine (3200 mL), dried over anhydrous MgSO (approximately 520 g), filtered and concentrated under reduced pressure.
[0370] The two reactions were combined, and the crude product was dissolved in DCM (1.0 L x 2) and loaded into a 1000 mL separatory funnel. The crude product solution was slowly added to a TBME / heptane (v / v = 9:1, 21 L) solvent through the funnel to carry out the precipitation process. This process took approximately 3 hours. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a heptane solvent mixture (800 mL x 2) and concentrated to dryness. Compound 3-4 (301 g, 216 mmol, 51.8% yield, 95.8% purity) was obtained as a pale yellow solid. HPLC showed compound 2-4: RT = 6.778 min.
[0371] General procedure for preparation of 3-5 (UTTC tetramer) [ka]
[0372] Compound 3-4 (200 g, 150 mmol, 1.00 equiv.) and MOE U amidite (129 g, 157.85 mmol, 1.05 equiv.) were coevaporated with CHCN (500 mL × 3). To a solution of compound 3-4 (200 g, 150 mmol, 1.00 equiv.) and MOE U amidite (129 g, 157 mmol, 1.05 equiv.) in anhydrous CHCN (800 mL), molecular sieves (MS) 3Å (40.0 g, 150 mmol, 1.00 equiv.) were added. The mixture was stirred at 25 °C for 1 h. Next, Py-TFA (1.00 M, 225 mL, 1.50 equiv.) was added to the reaction mixture at 25 °C. The resulting mixture was stirred at 25 °C for 30 min. Note that both acetonitrile and DCM were freshly redistilled. HPLC showed that compound 2-4 was completely consumed. MOE Note that the U amidite is: [ka]
[0373] To the above solution was added DDTT (33.9 g, 165 mmol, 1.10 equiv) at 25° C. The mixture was stirred at 25° C. for 0.5 h. The mixture was then cooled to 0° C. in an ice bath for 30 min. HPLC showed the reaction was complete. Note that the mixture changed from a yellow cloudy color to a yellow homogeneous solution.
[0374] Simultaneously, a 1 L three-necked round-bottom flask was charged with imidazole (204 g, 3.01 mol, 20.0 equiv.) and anhydrous THF (400 mL) and placed in an ice bath for 30 min. HF (43.0 g, 1.50 mol, 39.1 mL, 70.0% purity, 10.0 equiv.) was slowly added, followed by stirring for an additional 15 min. The mixture was added to the above suspension at 0 °C for 1 h. The mixture was stirred at 0 °C for 1 h. HPLC showed the reaction was complete.
[0375] The reaction mixture was dissolved in EtOAc (5.2 L). The organic layer was washed with saturated aqueous NaHCO (3.6 × 2), water (2.6 L × 3), brine (2.6 L), dried over anhydrous MgSO (approximately 440 g), filtered, and concentrated in vacuo. Note that a yellow gel solid did not precipitate in this process.
[0376] The crude product was dissolved in DCM (2.0 L) and loaded into a 1 L separatory funnel. The crude product solution was slowly added to a solvent mixture of TBME (17.6 L) through the funnel to carry out the precipitation process. This process took approximately 30 minutes. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a solvent mixture of TBME (500 mL × 2) and concentrated to dryness. Compound 3-5 (UTTC tetramer) (258 g, 134 mmol, 89.0% yield, 95.6% purity) was obtained as a pale yellow solid. The HPLC-MS of compound UTTC tetramer (3-5) is shown in Figure 3.
[0377] HPLC-MS method for compounds 3-5: ● Column: ACQUITY UPLC BEH Shield RP18 column, 130 Å, 1.7 μm, 2.1 mm × 150 mm; Column temperature: 60℃ • MS analysis was performed on a Thermo Orbitrap Fusion with a resolving power of 60,000 and a mass range of 300–2,000. ● MS polarity: positive; Mobile phase A: 20 mM ammonium acetate in ACN:water = 25:75; Mobile phase B: acetonitrile; ●Slope: [Table 4]
[0378] 3. Synthesis of 5'DMT-MOE CCGU-OH (Fragment 4) General procedure for the preparation of compound 4-2 [ka]
[0379] To a solution of compound 4-1 (200 g, 323 mmol) in DCM (1600 mL) was added imidazole (66.0 g, 969 mmol) and TBDPSCl (115 g, 420 mmol, 107 mL) at 25° C. The mixture was stirred at 25° C. for 12 hours. TLC (petroleum ether / ethyl acetate=1 / 1, R f =0.63 min) showed compound 4-1 along with one major new spot of less polarity. Propan-2-ol (19.4 g, 323 mmol, 24.7 mL) was added to the mixture and stirred at 25 °C for 0.5 h.
[0380] To the solution from the last step, CySH (48.8 g, 420 mmol) and TFA (184 g, 1.62 mol) were added dropwise at 0 °C. The mixture was stirred at 0 °C for 1 h. TLC (petroleum ether / ethyl acetate = 1 / 1, Rf = 0.50) showed the reaction was complete. The reaction mixture was quenched at 25 °C by adding Na2CO3 solution (185 g, 1600 mL DI H2O) and then diluted with TBME (500 mL), and the two layers were separated. The combined organic layers were washed with brine (500 mL), dried over MgSO4, filtered, and concentrated under reduced pressure to give a residue. The crude product compound 4-2 was dissolved in ACN (2000 mL) and DI H2O (300 mL) and extracted with heptane / TBME (4 / 1, 8 L, 1.6 L × 5). The ACN layer was diluted with DCM (3.2 L), the water was separated, dried over MgSO, filtered, and concentrated under reduced pressure to give a residue, which gave compound 4-2 (176 g, 98.1% yield, 95.8% purity) as a white foam. 1 H NMR: 400 MHz DMSO:11.30(s,1H),7.69(m,J=6.4Hz,3H),7.61(dd,J=7.73,1.47Hz,2H),7.44 (m,6H),5.97(d,J=5.87Hz,1H),5.12(t,J=4.89,4.89Hz,1H),4.31(m,1H),3.9( q,J=2.8,2.8,2.8Hz,1H),3.76(t,J=5.38,5.38Hz,1H),3.46(m,2H),3.28(m,2 H),3.21(ddd,J=12.23,4.4,3.13Hz,1H),3.14(s,3H),1.73(s,3H),1.05(s,9H)
[0381] General procedure for the preparation of compound 4-4 [ka]
[0382] Compound 4-3 (164 g, 179 mmol) and compound 4-2 (90.5 g, 163 mmol) were coevaporated with ACN (450 mL × 3) in a 3000 mL single-neck round bottle under Ar. 3 Å molecular sieves (10.0 g) were added to the single-neck bottle, and ACN (1000 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (28.9 g, 244 mmol) was added to the mixture. The mixture was stirred at 25 °C for 0.5 h. HPLC showed that the starting material was completely consumed.
[0383] After completion of the coupling reaction, DDTT (37.7 g, 183 mmol) was added to the mixture. The reaction mixture was stirred at 25° C. for 0.5 h, then DI HO (0.12 mL), PPh (4.38 g, 16.7 mmol) were added to the mixture, and the mixture was stirred at 25° C. for 0.5 h. HPLC showed that the starting material was completely consumed.
[0384] The majority of the ACN was removed on a rotavapor, and the reaction was then diluted with tBuOMe / EtOAc (3 / 1, 1500 mL). A yellow solid precipitated. The filtrate was filtered and washed with DI The organic layer was dried and concentrated to dryness. Compound 4-4 (233.8 g, crude, 80.1% purity) was obtained as a pale yellow solid and used in the next step without further purification.
[0385] General procedure for the preparation of compounds 4-5 [ka]
[0386] Compound 4-4 (234 g, 167 mmol) was dissolved in anhydrous DCM (1600 mL), and then TCA (81.8 g, 501 mmol) and CySH (29.1 g, 250 mmol) were added at 0° C. The mixture was stirred at 0° C. for 0.5 h. HPLC showed that the starting material was completely consumed.
[0387] The reaction was quenched by the slow addition of NaHCO3 / HO (84.0 g of NaHCO3 in 1200 mL of DI HO). The mixture was stirred vigorously for 10 min, and the two layers were separated. The HO layer was extracted with DCM (600 mL), and the combined organic layers were dried and concentrated to dryness. The mixture was redissolved in CH3CN / DI HO (2 / 1, 1200 mL), and the CH3CN / HO layer was washed with heptane / tBuOMe (4 / 1, 1000 mL × 5). Most of the CH3CN was removed in a rotavapor, and then the mixture was diluted with tBuOMe / EtOAc (2 / 1, 1500 mL), and the mixture was washed with NaHCO3 / HO (1000 mL × 2, to remove DCI), brine (600 mL × 2). The organic layer was dried over MgSO4, filtered, and concentrated to dryness. The crude product was used in the next step without further purification. The crude product compound 4-5 (180 g, 98.2% yield, 94.6% purity) was obtained as a pale yellow solid and used in the next step without further purification.
[0388] General procedure for the preparation of compounds 4-7 [ka] Compound 4-5 (115 g, 104 mmol) and compound 4-6 (106 g, 115 mmol) were coevaporated with ACN (500 mL × 3) under Ar in a 2000 mL single-neck round bottle, and 3 Å molecular sieves (45.0 g) were added to the single-neck bottle, followed by ACN (1050 mL) under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (18.6 g, 157 mmol) was added to the mixture. HPLC showed that the starting material was completely consumed.
[0389] After the coupling reaction was completed, tBuOOH (5.5 M, 38.1 mL) and HO (10 mL) were added to the reaction mixture. The reaction mixture was stirred at 25° C. for 30 minutes. HPLC showed that the starting material was completely consumed.
[0390] After the oxidation was complete, the reaction mixture was cooled to 0° C. in an ice-water bath for 5 min, and a commercially available grade I2 oxidation solution (628.87 mL of 0.05 M in pyridine / HO, v / v 9:1) was added to the mixture over 20 min. The reaction mixture was stirred at 0° C. for an additional 5 min. HPLC showed that the starting material was completely consumed.
[0391] The reaction mixture was slowly poured into a NaSO / H2O solution (33.1 g of NaSO in 2300 mL of H2O) and the solution was stirred vigorously for 10 min. The mixture was then diluted with 3000 mL of a 1 / 3 EtOAc / tBuOMe mixture. The organic layer was separated and washed with 2000 mL of NaHCO3 / H2O, 1000 mL of brine. The organic layer was dried and concentrated to dryness. The crude product was redissolved in 460 mL of DCM / tBuOMe (1 / 1). The crude solvent was replaced with heptane / t The desired product precipitated. After filtration, the product was collected as a pale yellow solid and the solid cake was diluted with heptane / t Washing with BuOMe (1 / 1, 230 mL x 2) gave compound 7 (217 g, crude, 87.6% purity) as a pale yellow solid, which was used in the next step without further purification.
[0392] General procedure for the preparation of compounds 4-8 [ka]
[0393] Compound 4-7 (204 g, 104 mmol) was dissolved in anhydrous DCM (2000 mL), and then DCA (67.5 g, 524 mmol) and CySH (18.2 g, 157 mmol) were added at 0° C. The mixture was warmed to 25° C. and stirred for 2 h. HPLC showed that the starting material was completely consumed.
[0394] The reaction was quenched by the slow addition of Na2CO3 / HO (77.4 g Na2CO3 in 1200 mL DI HO). The mixture was stirred vigorously for 10 min, and the two layers were separated. The HO layer was extracted with DCM (600 mL), and the combined organic layers were dried and concentrated to dryness. The mixture was redissolved in CH3CN / HO (2 / 1, 900 mL), and the CH3CN / HO layer was washed with heptane / tBuOMe (4 / 1, 800 mL × 5). Most of the CH3CN was removed using a rotavapor, and then the mixture was diluted with tBuOMe / EtOAc (1 / 3, 1800 mL), and the mixture was washed with NaHCO3 / HO (900 mL × 2) and brine (600 mL). The organic layer was dried and concentrated to dryness. The crude product was used in the next step without further purification. Compound 4-8 (130 g, 75.3% yield, 92.4% purity) was obtained as a pale yellow solid and used in the next step without further purification.
[0395] General procedure for preparation of 5'DMT-MOE CCGU-OH [ka]
[0396] Compound 4-8 (153 g, 92.8 mmol) and compound 4-6 (89.9 g, 97.5 mmol) were coevaporated with ACN (400 mL × 3) in a 3000 mL single-neck round bottle under Ar. 3A molecular sieves (45.0 g) were added to the single-neck bottle, and ACN (928 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then Py-TFA (1 M, 139 mL) was added to the mixture. HPLC showed that the starting material was completely consumed.
[0397] After the coupling reaction was completed, DDTT (20.0 g, 97.5 mmol) was added to the mixture, and the reaction mixture was stirred at 25° C. for 0.5 hours, after which the yellow turbid solution changed to a yellow homogeneous solution, indicating the completion of the reaction, and then cooled to 0° C. in an ice bath for 30 minutes.
[0398] Simultaneously, a 500 mL round-bottom flask was charged with imidazole (127 g, 1.87 mol) and anhydrous THF (232 mL) and placed in an ice bath for 30 min. HF-Py (24.3 mL, 70.0% purity) was slowly added and stirred for an additional 15 min (a homogeneous solution was obtained at this step). The solution from the last step was slowly added to the reaction mixture from the last step using a peristaltic pump (dropwise addition rate of 1 mL / 5 min) and stirred at 0 °C for 1–2 h. The reaction completion could be monitored by HPLC. HPLC showed complete consumption of the starting material. The mixture was diluted with EA (4500 mL) and slowly neutralized with NaHCO3 / H2O (2500 mL) at 0 °C. The organic layer was separated and washed with NaHCO3 / H2O (2500 mL) and brine (2000 mL). The organic layer was dried and concentrated to dryness. The crude product was redissolved in DCM (600 mL). The crude solvent was slowly added dropwise to a solution of tBuOMe (6000 mL). The desired product precipitated. After filtration, the product was collected as a pale yellow solid, and the solid cake was washed with tBuOMe (600 mL × 2). 4-9 (5'DMT-MOE CCGU-OH) (190 g, 90.5% yield, 94.8% purity) was obtained as a pale yellow solid. HPLC-MS of the MOE-CCGU tetramer (4-9) is shown in Figure 4.
[0399] HPLC-MS method for compounds 4-9: ● Column: ACQUITY UPLC BEH Shield RP18 Column, 130Å, 1.7μm, 2.1mm × 150mm; Column temperature: 60℃ • MS analysis was performed on a Thermo Orbitrap Fusion with a resolution of 60,000 and a mass range of 400–2,000. ●MS polarity: positive Mobile phase A: 20 mM ammonium acetate in ACN:water = 25:75; Mobile phase B: acetonitrile; ●Slope: [Table 5]
[0400] C. Convergent Synthesis of Targeted Oligonucleotides General procedure for the preparation of compound 5-1 [ka]
[0401] To a solution of the amidite reagent (63.9 g, 212 mmol, 67.3 mL, 5.0 equiv) and compound 2-9 (100 g, 42.4 mmol, 1.0 equiv) in THF (400 mL) was added Py-TFA (24.5 g, 127 mmol, 15.9 mL, 3.0 equiv) at 0° C. The mixture was stirred at 0° C. for 1 h. HPLC showed that compound 2-9 was completely consumed.
[0402] The reaction mixture was transferred to a 500 mL separatory funnel (approximately 20 mL after combining with the DCM wash volume). The crude product solution was slowly added dropwise from the funnel to the solvent TBME / Py (v / v 100:0.7, 15 L) to carry out the precipitation process. This process took approximately 90 minutes. The pure product was collected as an off-white solid from the previous step. The product cake was washed with pure TBME (1.0 L × 3) and dried under vacuum. Compound 5-1 (106 g, 90.8% yield, 93% purity) was obtained as a white solid. Note that anhydrous THF was used. Compound 2-9 and Py-TFA were coevaporated with THF three times. Pyridine was added to maintain a basic environment to minimize hydrolysis of the amidite product.
[0403] General procedure for the preparation of compound 5-2 [ka]
[0404] Compound 5-1 (122 g, 48.0 mmol, 1.5 equiv.), 3 Å molecular sieves (45.0 g), and compound 1-7 (115 g, 32.0 mmol, 1.0 equiv.) were dissolved in DCM / ACN (2 / 1) (900 mL) and DCI (9.46 g, 80.08 mmol, 2.5 equiv.) was added. The mixture was stirred at 10 °C for 1 h.
[0405] The reaction was monitored by TLC (complete conversion in 60 min). After the coupling reaction was complete, DDTT (9.87 g, 48.05 mmol, 1.5 equiv.) was added to the mixture. The reaction mixture was stirred at 10 °C for 30 min. The reaction mixture was filtered, and the filtrate was concentrated to 1 / 2 volume. The remaining solution was added to ACN (5.0 L). The product precipitated. Filtration was performed to collect the filter cake. The filter cake was washed with ACN (1 L) and dried under vacuum. Compound 5-2 (194 g, 99.6% yield) was obtained as a pale yellow solid. Note that both acetonitrile and DCM were freshly redistilled. Compound 5-1 and compound 1-7 were coevaporated with DCM / ACN three times.
[0406] HPLC and LC-MS analysis of compound 5-2 was performed using an ammonolysis (NH3 / HO) procedure similar to that used for the ammonolysis of compound 1 disclosed below to obtain 5-2-a (DMTrO-TsTsAsCsCsAsCoCsCsU-OH). The HPLC and LC-MS of compound 5-2-a are shown in Figure 5.
[0407] General procedure for the preparation of compound 5-3 [ka] Compound 5-2 (194 g, 31.9 mmol, 1.0 equiv.) and 3 Å molecular sieves (65.0 g) were added to a round-bottom flask, and anhydrous DCM (1.3 L) was added under Ar pressure. The mixture was stirred at 15 °C for 1 h, and then CySH (7.42 g, 63.8 mmol, 7.81 mL, 2.0 equiv.) and TCA (52.1 g, 319 mmol, 32.1 mL, 10.0 equiv.) were added to the mixture at 0 °C.
[0408] The reaction was stirred at 0 °C for 90 min (TLC confirmed the reaction), and then Py (30.2 g, 382 mmol, 30.9 mL, 12.0 equiv.) was added to the mixture. The mixture was stirred at 15 °C for 5 min. The 3A molecular sieves were removed by filtration. The DCM solvent was slowly added to CH3CN (7.0 L), causing the precipitation of a pale yellow solid. Most of the DCM was removed using a rotavap, and the white precipitate was collected and washed with CH3CN (500 mL × 3). Compound 5-3 (180 g, 97.6% yield) was obtained as a pale yellow solid. Note that the DCM was freshly redistilled. Compound 5-2 was coevaporated with DCM three times. The product is highly soluble in DCM, and it is important to remove most of the DCM before filtration. HPLC and LC-MS analysis of compound 5-3 was performed using an ammonolysis (NH3 / HO) procedure similar to that used for the ammonolysis of compound 1 disclosed below to obtain 5-3-a (HO-TsTsAsCsCsAsCoCsCsU-OH). The HPLC and LC-MS of compound 5-3-a are shown in Figure 6.
[0409] HPLC-MS method for 5-3-a ● Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm × 50 mm; Column temperature: 50℃ ●Ionization mode: API-ES; ●Mass range of 1350 to 2300 ●MS polarity: negative; • Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μm EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μm EDTA; ●Slope [Table 6]
[0410] General procedure for the preparation of compound 5-4 [ka]
[0411] Compound 3-5 (102 g, 55.3 mmol, 1.0 equiv.) was coevaporated with THF (300 mL × 3). Py-TFA (32.0 g, 166 mmol, 3.0 equiv.) was coevaporated with THF (300 mL × 3). Compound 3-5 (102 g, 55.3 mmol, 1.0 equiv.) and AMidite reagent (83.4 g, 276 mmol, 87.9 mL, 5.0 equiv.) were added to a 2000 mL round-bottom flask in anhydrous THF (400 mL) and cooled to 0 °C in an ice bath for 30 min. Activator Py-TFA (32.0 g, 166 mmol, 3.0 equiv.) was added, and the reaction mixture was stirred at 0 °C for 1 h. HPLC showed that the starting material was completely consumed.
[0412] The crude product solution was slowly added dropwise from the funnel to the solvent TBME / heptane / Py (95 / 5 / 1, 15.8 L) to carry out the precipitation process. This process took approximately 30 minutes. The pure product from the previous step was collected as an off-white solid, and the product cake was washed with pure TBME (500 mL x 3) and dried under high vacuum for 3 hours.
[0413] Compound 5-4 (107 g, 52.4 mmol, 94.6% yield) was obtained as a white solid. Note that THF was anhydrous and compound 3-5 and Py-TFA were co-evaporated with anhydrous THF three times.
[0414] General procedure for the preparation of compound 5-5 [ka]
[0415] Compound 5-3 (177 g, 30.6 mmol, 1.0 equiv.), compound 5-4 (106 g, 52.0 mmol, 1.7 equiv.), and 3 Å molecular sieves (60 g) were added to a round flask, and ACN (425 mL, HO<50 ppm) was added in anhydrous DCM (850 mL, HO<50 ppm) under Ar pressure. The mixture was stirred at 15 °C for 1 h, and then DCI (9.05 g, 76.6 mmol, 2.5 equiv.) was added to the mixture. The mixture was stirred at 15 °C for 0.67 h. TLC (DCM:MeOH=10:1) showed that compound 5-3 was completely consumed.
[0416] After the coupling reaction was completed, DDTT (10.7 g, 52.0 mmol, 1.7 equiv.) was added to the mixture, and the reaction mixture was stirred at 15° C. for 10 min.
[0417] The 3Å molecular sieves were removed by filtration, and the reaction mixture was diluted with 6000 ml of CH3CN (a white solid precipitated). The DCM was removed using a rotavapor, and the white solid was collected and washed with CH3CN (500 mL x 3). The pale yellow solid was used directly in the next step without purification. Compound 5-5 (237 g, 99.6% yield) was obtained as a pale yellow solid.
[0418] HPLC and LC-MS analysis of compound 5-5 was performed using an ammonolysis (NH3 / HO) procedure similar to that used for the ammonolysis of compound 1 disclosed below to obtain 5-5-a (DMTrO-UsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). The HPLC and LC-MS of compound 5-5-a are shown in Figure 7.
[0419] HPLC-MS method for 5-5-a ● Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm × 50 mm; ●Column temperature: 50℃; ●Ionization mode: API-ES; ● Mass range of 1350-2300; ●MS polarity: negative; • Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μm EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μm EDTA; ●Slope: [Table 7]
[0420] General procedure for the preparation of compounds 5-6 [ka]
[0421] Compound 5-5 (234 g, 30.2 mmol, 1.0 equiv.) and 3 Å molecular sieves (12.5 g) were added to a round-bottom flask, and anhydrous DCM (1500 mL, HO <50 ppm) was added under Ar pressure. The mixture was stirred at 15 °C for 1 h, and then CySH (10.5 g, 90.5 mmol, 11.1 mL, 3.0 equiv.) and TCA (59.2 g, 362 mmol, 12.0 equiv.) were added to the mixture.
[0422] The reaction was stirred at 0° C. for 60 minutes (reaction monitored by TLC), and then Py (35.8 g, 452 mmol, 36.5 mL, 15.0 equiv.) was added to the mixture, and the mixture was stirred at 15° C. for 5 minutes.
[0423] The 3Å molecular sieves were removed by filtration. DCM solvent was slowly added to 10 L of CH3CN, causing a pale yellow solid to precipitate. Most of the DCM was removed using a rotavapor, and the white precipitate was collected and washed with CH3CN (500 mL x 3). Compound 5-6 (210 g, 93.3% yield) was obtained as a pale yellow solid.
[0424] HPLC and LC-MS analysis of compound 5-6 was performed using an ammonolysis (NH3 / HO) procedure similar to that used for the ammonolysis of compound 1 disclosed below to obtain 5-6-a (HO-UsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). The HPLC and LC-MS of compound 5-6-a are shown in Figure 8.
[0425] HPLC-MS method for 5-6-a ● Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm × 50 mm; ●Column temperature: 50℃; ●Ionization mode: API-ES; ● Mass range of 1350-2300; ●MS polarity: negative; • Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μm EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μm EDTA; ●Slope: [Table 8]
[0426] General procedure for the preparation of compounds 5-7 [ka]
[0427] Compound 4-9 (130 g, 57.8 mmol, 1.0 equiv) and Amidite reagent (87.2 g, 289 mmol, 91.9 mL, 5.0 equiv) were added to anhydrous THF (520 mL) in a 2000 mL round-bottom flask and cooled to 0 °C in an ice bath for 30 min. Activator Py-TFA (33.5 g, 173 mmol, 34.2 mL, 3.0 equiv) was added, and the reaction mixture was stirred at 0 °C for 1 h. HPLC showed that the starting material was completely consumed.
[0428] The precipitation process was carried out by slowly dropping the crude product solution into the solvent TBME / heptane / Py (95 / 5 / 1, 15850 mL) through a funnel. This process took approximately 30 minutes. The pure product from the previous step was collected as an off-white solid, and the product cake was washed with pure TBME (500 mL x 3) and dried using high vacuum for 3 hours.
[0429] Compound 5-7 (133 g, 93.9% yield) was obtained as a white solid.
[0430] General procedure for the preparation of compound 1, fully protected ASO 9 [ka]
[0431] To compound 5-6 (242 g, 32.5 mmol, 1.0 equiv.), compound 5-7 (135 g, 55.2 mmol, 1.7 equiv.), and 3 Å molecular sieves (80.0 g) in a round flask, anhydrous DCM (1200 mL, HO < 50 ppm) and ACN (600 mL, HO < 50 ppm) were added under Ar pressure. The mixture was stirred at 15 °C for 1 h, and then DCI (9.60 g, 81.2 mmol, 2.5 equiv.) was added to the mixture. The mixture was stirred at 15 °C for 1 h. The completion of the reaction was confirmed by TLC.
[0432] After the coupling reaction was complete, DDTT (11.3 g, 55.2 mmol, 1.7 equiv.) was added to the mixture. The reaction mixture was stirred at 15 °C for 10 min. The 3 Å molecular sieves were removed by filtration, and the reaction was diluted with 10 L of CH3CN (a pale yellow solid precipitated). The DCM was removed by rotovap, and the pale yellow solid was collected and washed with CH3CN (500 mL × 3). Compound 1 (264 g, 82.8% yield) was obtained as a pale yellow solid.
[0433] For HPLC and LC-MS analysis of compound 1, it was deprotected using the ammonolysis (NH3 / HO) procedure described below to obtain 1-a (DMTrO-CsCoGsUsUsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). The HPLC and LC-MS of compound 1-a are shown in Figure 9.
[0434] HPLC-MS method for 1-a ● Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm × 50 mm; ●Column temperature: 50℃; ●Ionization mode: API-ES; ●Mass range of 1350 to 2300 ●MS polarity: negative; • Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μm EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μm EDTA; ●Slope: [Table 9] Deprotection and ammonolysis of compound 1 to give fully protected ASO 9 [ka]
[0435] A 1 L flask was charged with compound 1 (64 g) and CHCN:EtN (640 ml, v / v). The mixture was stirred at 25° C. for 2 hours, and then the solvent was removed by rotovap. 500 ml of NHOH (approximately 30 wt%) was added to the flask, and the mixture was stirred at 25° C. for approximately 30 minutes. The resulting solution was transferred to a 1 L glass pressure flask, and the mixture was heated to 65° C. for 5 hours. The mixture was cooled to ambient temperature for downstream purification.
[0436] ASO 9 Purification Process: The DMT-on ASO 9 from ammonolysis (2 L) was diluted with 1111 mM ammonium sulfate solution (18 L) to a final ammonium sulfate concentration of approximately 1000 mM. The suspension was then filtered through a depth filter, which was wetted, rinsed, and equilibrated with 3 bed volumes of solution (1000 mM ammonium sulfate, 50 mM Tris, pH 8.5).
[0437] For the hydrophobic interaction chromatography (HIC) step, a 20 cm bed height (BH) × 14 cm internal diameter (ID) HIC column was equilibrated with 4 column volumes (CV) of equilibration buffer (1000 mM ammonium sulfate, 50 mM Tris, pH 8.5). The filtrate from the depth filter was loaded onto the column. The column was chased with 4 CV of buffer (1000 mM ammonium sulfate, 50 mM Tris, pH 8.5) and washed with buffer (800 mM ammonium sulfate, 50 mM Tris, pH 8.5) at 100 cm / hr until the UV gate (2 mm flow cell) hit 0.5 AU. Once the UV gate reached 0.5 AU, the column was washed with two more CVs of the same buffer (800 mM ammonium sulfate, 50 mM Tris, pH 8.5). The flow rate for the wash step was 100 cm / hr. The column was eluted with 8 CV of buffer (50 mM ammonium sulfate, 50 mM Tris, pH 8.5) to give DMT-on ASO 9. The column was stripped with 4 CV of deionized water. The column was sanitized with 3 CV of 1 N sodium hydroxide and stored in 0.1 N sodium hydroxide. The HIC process was carried out at 200 cm / hr, except for the wash, which was carried out at 100 cm / hr.
[0438] The HIC eluate (approximately 9 L) containing DMT-on ASO 9 was cooled to 10°C, and a solution of 25% (w / w) citric acid (0.9 L) was added to adjust the pH of the mixture to 2.7. The mixture was stirred at 10°C for 4.5 hours, and 5 N sodium hydroxide (0.8 L) was added to adjust the pH to 8.5. The mixture was then filtered to remove the DMT-OH byproduct using a 0.22 μm sterile filter. The filtrate was then purified by anion exchange chromatography.
[0439] For anion exchange chromatography (AEX), 15 cm BH x 14 cm ID The AEX column was loaded with 2 CV of high-salt buffer (2000 mM sodium chloride, 250 mM Tris, pH 8.5) and equilibrated with 4 CV of equilibration buffer (100 mM sodium chloride, 50 mM Tris, pH 8.5). The filtrate from the detritylation step was diluted with water to a conductivity of approximately 20 mS and loaded onto the column. The column was washed with buffer solution (300 mM sodium chloride, 50 mM Tris, pH 8.5) until the UV gate (2 mm flow cell) reached 0.4 AU. The column was subsequently washed with four more CVs of the same buffer (300 mM sodium chloride, 50 mM Tris, pH 8.5). The column was eluted with 7 CV of buffer (525 mM sodium chloride, 50 mM Tris, pH 8.5) to provide the ASO 9 solution. The column was stripped with 4 CV of buffer (2000 mM sodium chloride, 250 mM Tris, pH 8.5), then sanitized with 3 CV of 1 N sodium hydroxide and stored in 0.1 N sodium hydroxide. The AEX process was carried out at 200 cm / hr. The HPLC-MS of ASO 9 is shown in Figure 12.
[0440] Example 2. Synthesis of ASO (10-mer) using 5' to 3' extension strategy. 1. General synthesis of 5' P amidite fragment (5-mer) [ka]
[0441] Starting from 1-2A and the phosphoramidite, compound 2-2A was obtained in >98% yield using a procedure similar to that described above for the synthesis of compound 1-8a. 2. Synthesis of ASO hexamer [ka]
[0442] Compound 4-2A was coupled with compound 3-2A using a procedure similar to that described above for the synthesis of fragment 1-9, followed by the desilylation procedure described in step 3 of the 4-9 synthesis, to give the hexamer (compound 5-2A) in >98% yield. The mass spectrum of the ASO hexamer before desilylation is shown in Figure 13.
[0443] 3. Synthesis of ASO 10mer [ka]
[0444] ASO pentamer 6-2A was coupled with pentamer fragment 2-2A to produce the ASO decamer in >98% yield using a procedure similar to that described above for the synthesis of fragments 1 to 9. The mass spectrum of the ASO decamer is shown in Figure 14.
[0445] 4. Convergent synthesis of the ASO 15mer 5'-ACoAGATATTTTTGTT-3'-OH [ka]
[0446] The ASO 15-mer was synthesized based on the convergent synthesis method shown in the scheme above using the same procedure as above. The three fragments used in the convergent synthesis were: 5'-LHPG-ACoAGA-3'-OH (fragment 1), 5'-P-TATTT-3'-OTBDPS (fragment 2), and 5'-P-TTGTT-3'-OTBDPS (fragment 3). 1) Synthesis of Fragment 1: 5'-LHPG-ACoAGA-3'-OH (1-3A) [ka]
[0447] Fragment 1 (compounds 1-3A) was synthesized using the same procedure as above, as shown in the scheme above. The mass spectra of deprotected fragment 1 (compounds 1-3A-H) are shown in Figure 15. [ka] 2) Synthesis of Fragment 2: 5'-P-TATTT-3'-OTBDPS (Compound 2-3A) Fragment 2 was synthesized using a procedure similar to that described above for the synthesis of 2-2A. 3) Synthesis of Fragment 3: 5'-P-TTGTT-3'-OTBDPS (Compound 3-3A) Fragment 3 was also synthesized using a procedure similar to that described above for the synthesis of 2-2A. 4) Convergent synthesis of ASO 15mer: The ASO 15-mer was synthesized using the solution-phase convergent synthesis method described herein. Fragment 1 and fragment 2 were coupled, followed by sulfurization, to form compound 4-3A. Compound 4-3A was desilylated to remove the 3'-TBDPS group to generate compound 5-3A, which was then coupled with fragment 3 and then sulfurized to generate ASO 15-mer 6-3A. The formation of 4-3A and 5-3A was confirmed by LC-MS analysis of the corresponding deprotected products 4-3A-H and 5-3A-H, formed by treating compounds 4-3A or 5-3A with NH3 / HO. The mass spectra of compounds 4-3A-H and 5-3A-H are shown in Figures 16 and 17, respectively. The ammonolysis reactions of compounds 4-3A and 5-3A are shown below: [ka] [ka] 5) Deprotection and ammonolysis of ASO 15-mer 6-3A [ka] Using a deprotection and ammonolysis procedure similar to that described above for the DMT-on ASO 9 synthesis, ASO 15-mer 6-3A was treated with NH4OH to give a mixture of 6a and 6b, demonstrating complete removal of the 5'-LHPG protecting group and partial removal of the TBDPS group at the 3' end (see Figure 18).
[0448] Example 3: Deamination studies during 5'OH deprotection: Detritylation studies of UCC trimers and CC dimers 1. UCC trimer deamination study:
[0449] The detritylation of UCC trimer was studied under a variety of reaction conditions to find the best conditions and reagents necessary to minimize the deamination side reaction. Table 1 shows a comparison of the various reaction conditions and the amount of unwanted deamination product produced under those conditions. As can be seen in Figure 9, the use of 3 Å molecular sieves and quenching the reaction with pyridine resulted in less than 0.5% deamination, compared to 7% deamination without sieves and 10% deamination without sieves and pyridine quenching. [ka] [Table 10]
[0450] 2. CC dimer deamination studies: Similar to the above study performed on the UCC trimer, detritylation was performed on the CC dimer using various reagents and conditions to minimize or avoid deamination reactions. As seen in Table 2 and Figure 11, when DCA, thiol, and 3 Å molecular sieves were used, no deaminated product was detected after 14 hours at room temperature, even with the addition of water. In contrast, without the addition of molecular sieves or water, 4.46% deaminated product was obtained, and after 14 hours of stirring at room temperature, 49% deaminated product was obtained without molecular sieves but with water. [ka] [Table 11]
[0451] 3. Results of detritylation and deamination studies from fragment synthesis Pentameric MOE DMTO-AC o CCU-OH (from DMTO-ACCCU-OLHPG) contained approximately 10% deaminated impurities (total of Ia, Ib, and Ic, proportions not determined) (Scheme A). Scheme A. High levels of deaminated impurities in DMTO-ACCCU-OLHPG [ka] The synthesis of its analog, HO-CCC-OTBDPS, was then completed using the same procedure, and the trimeric product was found to contain at least 10% total deaminated impurities (Scheme B). Scheme B: High levels of deaminated impurities in HO-CCC-OTBDPS [ka]
[0452] MOE fragment-LHPG(I): As a result of the above, pentameric MOE DMTO-AC o CCU-OH was repeated with a modified detritylation procedure. In this synthesis, the solution was dried over 3 Å molecular sieves before adding acid to each detritylation reaction. The deamination by-product was completely suppressed (Table 3). [ka] [Table 12]
[0453] Example 4. Synthesis of ASO 8 Fully protected ASO 8, bearing a DMT group at the 5' end and an LHPS group at the 3' end, was prepared using a similar procedure as described in Example 1 for ASO 9. The oligonucleotide fragments used in the synthesis are shown in the following scheme. 1. Synthesis of ASO 8 via 5+6+(4+5) coupling [ka] 2. Synthesis of ASO 8 via 5+6+4+5 coupling [ka]
[0454] DMT-on ASO 8 was detritylated and purified using a procedure similar to that described in Example 1 for ASO 9. The HPLC-MS of ASO 8 is shown in Figure 19.
[0455] HPLC-MS method for ASO 8: ● Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm × 50 mm; ●Column temperature: 50℃; ●Ionization mode: API-ES; ● Mass range of 1350-2300; ●MS polarity: negative; • Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μm EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μm EDTA; ●Slope: [Table 13]
[0456] Example 5. Desilylation studies To minimize the formation of impurities, we developed a novel, facile, mild, and clean deprotection method for 3'-OTBDPS. It was discovered that the presence of imidazole significantly accelerated the deprotection of TBDPS and minimized the generation of impurities. Comparative studies, described below, demonstrate that desilylation using known conditions led to the formation of various byproducts, including N-2 and diol byproducts. In contrast, the new desilylation method results in a significant reduction of these byproducts. a. Desilylation of CCGU tetramer using known desilylation conditions: [ka]
[0457] 250 mg of CCGU tetramer was treated with 20 equivalents of HF and 30 equivalents of pyridine at 0 °C for 7 h. N-2 and diol by-products were observed. Desilylation reactions with other known methods, such as TBAF or CsF, resulted in complex mixtures.
[0458] The presence of N-2 and diol by-products can significantly affect the purity of the final target oligonucleotide. b. Desilylation of CCGU tetramer under HF / imidazole desilylation conditions: [ka]
[0459] In contrast to the desilylation reaction carried out under the known conditions described above, the desilylation with HF / imidazole led to completion of the desilylation reaction in 2 h, with less than 0.5% of the diol and N-2 byproducts observed. Furthermore, only 5 equivalents of HF were required to achieve complete conversion of the starting material, compared to the 20 equivalents required under the known desilylation conditions.
[0460] Example 6. Synthesis of 5'-DMT-GUUUUUGCAA-NO2-benzoyl via H phosphonate chemistry [ka] SM1 (3.78 g) and SM2 (2.64 g) were dissolved in 20 ml of CHCN. At 0 °C, 2.4 ml of pyridine and 0.62 ml of pivaloyl chloride were slowly added to the mixture. After stirring at 0 °C for 40 minutes, I2 / py (40 ml of 0.05 M) was added to the mixture. After stirring at 0 °C for 30 minutes, the reaction was quenched with Na2SO3 / HO solution to obtain 5'-DMT-GUUUUUGCAA-NO2-benzoyl as a pale yellow solid. The structure of 5'-DMT-GUUUUUGCAA-NO2-benzoyl was confirmed by MS (see Figure 20).
[0461] Example 7. Evaluation of the feasibility of convergent solution-phase synthesis of ASO 9 analogs with various PO / PS linkages HPLC method (A). Column: Xbridge Shield RP18 5 μm, 2.1 mm × 50 mm column. Column temperature: 40°C; Mobile phase: Solution A: 10mM NH4HCO3 aqueous solution Solution B: 100% acetonitrile gradient: [Table 14]
[0462] HPLC method (B). Column: Xbridge C18 3.5 μm, 4.6 mm × 150 mm column. Column temperature: 40℃ Mobile phase: Solution A: 10mM NH4HCO3 aqueous solution Solution B: 100% acetonitrile gradient: [Table 15]
[0463] HPLC method (C). Column: Xbridge Shield RP18 5 μm, 2.1 mm × 50 mm column. Column temperature: 40℃ Mobile phase: Solution A: 10mM NH4HCO3 aqueous solution Solution B: 100% acetonitrile gradient: [Table 16]
[0464] HPLC-MS method (D). Column: Xbridge Shield RP18 5 μm, 2.1 mm × 50 mm column. Column temperature: 40°C; Mass range of 100-1000; MS polarity: negative; Mobile phase: Solution A: 10mM NH4HCO3 aqueous solution Solution B: 100% acetonitrile gradient: [Table 17]
[0465] HPLC-MS method (E). Column: Luna C18 3.0 μm, 2.0 mm × 30 mm column. Column temperature: 40°C; Mass range of 100-2000; MS polarity: positive Mobile phase: Solution A: 0.037% TFA (v / v) aqueous solution Solution B: 0.018% TFA (v / v) in acetonitrile. gradient: [Table 18]
[0466] HPLC-MS method (F). Column: Xbridge Shield RP18 5 μm, 2.1 mm × 50 mm column. Column temperature: 40°C; Mass range of 100-1000; MS polarity: positive Mobile phase: Solution A: 10mM NH4HCO3 aqueous solution Solution B: 100% acetonitrile gradient: [Table 19]
[0467] HPLC-MS method for amidite compounds 7-1-6a, 7-3-10a and 7-4-8a (G). Column: ACQUITY UPLC BEH C18 1.7 μm, 2.1 mm x 50 mm. Column temperature: 50°C; Mass range of 500-2200; MS polarity: negative; Mobile phase: Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH3CN, 1 μM EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA gradient: [Table 20]
[0468] ASO 9 analogs with different numbers of P=O / S bonds were synthesized. [ka]
[0469] A. Preparation of 5' Fragment 1. Preparation of 5'-DMTr-CCGU-OH or 5'-OH-CCGU-TBDPS tetramer (fragment 4) Synthesis of compound 7-1-2 [ka]
[0470] To a solution of compound 7-1-1 (8.50 g, 13.7 mmol, 1.00 equiv.) and imidazole (4.68 g, 68.7 mmol, 5.00 equiv.) in DCM (85 mL) was added TBDPSCl (4.15 g, 15.1 mmol, 3.88 mL, 1.10 equiv.). The mixture was stirred at 25° C. for 16 hours. TLC (petroleum ether:ethyl acetate=1:2, product: R f =0.55) indicated that compound 7-1-1 was completely consumed and one new spot was formed. The reaction was clean by TLC. Propan-2-ol (825 mg, 13.7 mmol, 1.00 equiv) was added and the mixture was stirred at 25 °C for 0.5 h.
[0471] To the above solution was added dodecane-1-thiol (7.23 g, 35.7 mmol, 8.56 mL, 1.30 equiv.) cooled to 0° C., and then TFA (25.0 g, 219 mmol, 16.2 mL, 8.00 equiv.) was added to the reaction mixture at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (petroleum ether:ethyl acetate=1:2, product: R f =0.28) indicated complete consumption of the starting material and the formation of one new spot. The reaction was clean by TLC.
[0472] The reaction mixture was quenched by adding NaHCO (500 mL), then diluted with DCM (100 mL) and extracted with NaHCO (200 mL). The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over MgSO, filtered, and concentrated under reduced pressure to give a residue. The crude product was dissolved in DCM (600 mL) and loaded into a 1000 mL separatory funnel.
[0473] The crude product was dissolved in 100 mL of ACN and 50 mL of DI water, and the mixture was extracted with heptane:TBME = 4:1 (120 mL × 4). (TLC showed the product was clean in ACN and DI water.) The product was in ACN and water. The mixture was extracted with TBME (100 mL), and the organic layer was dried and concentrated to dryness as a white solid. Compound 7-2 (14.0 g, 23.4 mmol, 85.1% yield, 92.7% purity) was obtained as a white foam. HPLC (Method A): RT=3.446 min; LCMS (Method F): RT=1.371 min; m / z:[M+H] + = 555.3 (for compound 7-1-2).
[0474] Synthesis of compound 7-1-3 [ka]
[0475] Compound 7-1-2 (12.0 g, 21.6 mmol, 1.00 equiv.) and MOE G amidite (21.7 g, 23.8 mmol, 1.10 equiv.) were coevaporated with ACN (10 mL x 3) in a 250 mL single-neck round bottle under argon, and 3 Å molecular sieves (3.00 g) and ACN (60 mL) were added to the single-neck bottle under argon pressure. The mixture was stirred at 25 °C for 1 hour, and then DCI (3.83 g, 32.4 mmol, 1.50 equiv.) was added to the mixture. The reaction mixture was stirred at 25 °C for 1 hour. TLC (dichloromethane:methanol = 15:1, product: R f =0.39) showed that compound 7-1-2 was completely consumed and one new spot was formed. The reaction was clean by TLC. HPLC (product: RT = 7.199 min; starting material: RT = 5.194 min) showed that compound 2 was completely consumed.
[0476] To the above solution was added BuOOH (3.90 g, 43.2 mmol, 4.15 mL, 2.00 equiv.). The mixture was stirred at 25 °C for 0.5 h. HPLC (7-1-3, product: RT = 6.869 min; starting material: RT = 7.199 min) showed the reaction was complete. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 400 mL of DI water), and the mixture was then diluted with DCM (100 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (200 mL), dried, filtered, and concentrated. Compound 7-1-3 (32.0 g, 18.9 mmol, 87.6% yield, 82.0% purity) was obtained as a pale yellow foam. HPLC (Method A): RT=6.868 min; LCMS (Method F): RT=1.501, 1.520 min; m / z:[M+H] + =1383.5 (for compound 7-1-3).
[0477] General procedure for the preparation of compound 7-1-3a [ka]
[0478] To compound 7-1-3 (25.0 g, 18.0 mmol, 1.00 equiv.) in DCM (120 mL) was added dodecane-1-thiol (4.75 g, 23.4 mmol, 5.63 mL, 1.30 equiv.) at 0° C., and then TFA (16.4 g, 144 mmol, 10.7 mL, 8.00 equiv.) was added to the reaction mixture at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (dichloromethane:methanol=10:1, product: R f =0.24) indicated that compound 7-1-3 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0479] The reaction mixture was poured into a NaHCO3 solution (10.0 equiv. NaHCO3 in 300 mL of DI water), then the mixture was diluted with DCM (100 mL), the two layers were separated, and the organic layer was washed with NaHCO3 (100 mL), brine (100 mL), dried, filtered, and concentrated.
[0480] The mixture was redissolved in CHCN:HO (2:1, 70 mL), and the CHCN / HO layer was washed with heptane:MTBE = 4:1 (100 mL × 4). The CHCN and HO layer was then diluted with EtOAc (100 mL), and the organic layer was washed with brine (100 mL), dried, filtered, and concentrated to give compound 7-1-3a (17.0 g, 15.0 mmol, 83.3% yield, 95.8% purity) as a pale yellow foam. HPLC (Method A): RT=6.778 min; LCMS (Method F): RT=1.322 min; m / z:[M+H] + = 1081.4 (for compound 7-1-3a).
[0481] Synthesis of compound 7-1-4 [ka]
[0482] Compound 7-1-3a (17.0 g, 15.7 mmol, 1.00 equiv.) and MOE C amidite (15.9 g, 17.2 mmol, 1.10 equiv.) were coevaporated with ACN (50 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (4.00 g) were added to the single-neck bottle, and ACN (85 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (2.78, 23.5 mmol, 1.50 equiv.) was added to the mixture. The reaction mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.932, 8.001 min; starting material: RT = 5.111, 5.169 min) showed complete consumption of the starting material.
[0483] To the above solution was added BuOOH (4.05 g, 31.4 mmol, 4.31 mL, 70.0% purity, 2.00 equiv.). The mixture was stirred at 25° C. for 0.5 h. HPLC (7-1-4, product: RT = 7.746, 7.832, 7.916 min; starting material: RT = 7.932, 8.001 min) showed that the starting material was completely consumed.
[0484] The reaction mixture was poured into a solution of NaHCO and NaSO (10.0 equiv. NaHCO and 5.00 equiv. NaSO in 400 mL of DI water), and the mixture was then diluted with EtOAc (100 mL). The two layers were separated, and the organic layer was washed with NaHCO (200 mL), brine (200 mL), dried, filtered, and concentrated to give compound 7-1-4 (33.4 g, 12.7 mmol, 81.3% yield, 73.5% purity) as a white solid. HPLC (Method A): RT=7.746, 7.832, 7.916 min; LCMS (Method F): RT=1.603 min; m / z:[M+H] + =1917.7 (for compound 7-1-4).
[0485] Synthesis of compound 7-1-4a [ka]
[0486] To compound 7-1-4 (23.0 g, 11.9 mmol, 1.00 equiv.) in ACN (120 mL) was added dodecane-1-thiol (3.15 g, 15.5 mmol, 3.73 mL, 1.30 equiv.) at 0° C., and then TFA (10.9 g, 95.8 mmol, 7.10 mL, 8.00 equiv.) was added to the reaction mixture at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (dichloromethane:methanol=7:1, product: R f =0.40) indicated that compound 7-1-4 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0487] The reaction mixture was poured into NaHCO3 solution (10.0 equivalents of NaHCO3 in 400 mL of DI water), and then the mixture was diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with aqueous NaHCO3 solution (150 mL), brine (150 mL), dried, filtered, and concentrated. The crude product was redissolved in DCM (50 mL). The crude solvent was slowly added dropwise to a solution of isopropyl ether (500 mL). The desired product precipitated. After filtration, the product was collected as a pale yellow solid, and the solid cake was washed with isopropyl ether (50 mL × 2). Compound 7-1-4a (22.0 g, 11.1 mmol, 93.0% yield, 81.9% purity) was obtained as a pale yellow solid. Compound 7-1-4a (13.0 g, 8.04 mmol, 86.9% yield, 98.3% purity) was obtained as a white foam after HPLC purification. HPLC (Method A): RT = 6.127, 6.193, 6.277 min, and LCMS (Method F): RT = 1.431 min; m / z: [M+H] + =1615.5.
[0488] Preparation of CCGU tetramer [ka]
[0489] Compound 7-1-4a (13.0 g, 8.04 mmol, 1.00 equiv.) and MOE C amidite (8.17 g, 8.84 mmol, 1.10 equiv.) were coevaporated with ACN (30 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (3.50 g) were added to the single-neck bottle, and ACN (65 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (1.42 g, 12.0 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT=8.547 min; starting material: RT=6.127, 6.193, 6.277 min) showed complete consumption of the starting material.
[0490] To the above solution was added BuOOH (2.07 g, 16.0 mmol, 2.20 mL, 70.0% purity, 2.00 equiv) at 25° C. The mixture was stirred at 25° C. for 0.5 h. HPLC (7-5, product: RT = 8.400 min; starting material: RT = 8.547 min) showed that the starting material was completely consumed.
[0491] The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 equivalents of NaHCO3 and 5.00 equivalents of Na2SO3 in 500 mL of DI water), and then the mixture was diluted with EtOAc (300 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (200 mL), dried, filtered, and concentrated. The crude product was redissolved in DCM (50 mL). The crude solvent was slowly added dropwise to a solution of isopropyl ether (600 mL). The desired product precipitated. After filtration, the product was collected as a pale yellow solid, and the solid cake was washed with isopropyl ether (50 mL × 2). Compound 7-1-5 (CCGU) (15.0 g, 5.94 mmol, 73.9% yield, 97.3% purity) was obtained as a yellow solid after HPLC purification. HPLC (Method B): RT=8.400 min, and LCMS (Method F): RT=1.665 min; m / z:[M+2H] 2+ / 2=1226.4
[0492] Preparation of DMTr-CCGU-OH(7-1-6) [ka] To a solution of 7-1-5 (6.00 g, 2.44 mmol, 1.00 equiv) in ACN (35 mL), and then to a solution of pyridine; hydrofluoric acid (698 mg, 24.4 mmol, 634 μL, 70.0% purity, 10.0 equiv) and imidazole (3.33 g, 48.8 mmol, 20.0 equiv) in THF (8 mL) was added dropwise at 0° C. The mixture was stirred at 0° C. for 3 h. TLC (dichloromethane:methanol=10:1, product: R f=10:1) showed that compound 7-1-5 was completely consumed and one new spot was formed. The reaction was messy by TLC.
[0493] The reaction mixture was dissolved in EtOAc (20 mL). The organic layer was washed with saturated aqueous NaHCO3 (20 mL x 2), brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was redissolved in DCM (5 mL). The crude solvent was slowly added dropwise to a solution of MTBE (50 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-1-6 (4.90 g, 2.07 mmol, 84.5% yield, 93.5% purity) was obtained as a white solid. HPLC (Method B): RT = 10.986, 11.182, 11.264 min, and LCMS (Method F): RT = 1.502 min; m / z: [M+2H] 2+ / 2=1107.4.
[0494] Preparation of DMTr-CCGU-OH (7-1-6a) [ka] 7-1-6a was synthesized from 7-1-6 using a procedure similar to that described above for the phosphoramidite synthesis. HPLC-MS (Method G): RT = 9.740, 9.843, 9.949 min; m / z: [M-2H] 2- / 2 = 1205.8 (for compound 7-1-6a).
[0495] Preparation of HO-CCGU-OTBDPS (7-1-7) [ka] To a solution of 7-1-5 (6.20 g, 2.52 mmol, 1.00 equiv) in ACN (30 mL) was added dodecane-1-thiol (766 mg, 3.79 mmol, 906 uL, 1.50 equiv) at 0 °C, followed by dropwise addition of TFA (2.30 g, 20.1 mmol, 1.49 mL, 8.00 equiv) at 0 °C. The mixture was stirred at 0 °C for 1 h. TLC (DCM:MeOH = 10:1, product: R f =0.35) indicated that compound 7-1-5 was completely consumed and two new spots were formed. The reaction was messy by TLC.
[0496] The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 100 mL of DI water), then diluted with 50 mL of EtOAc and extracted with 100 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (300 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2).
[0497] Compound 7-1-7 (4.86 g, 2.18 mmol, 86.4% yield, 96.6% purity) was obtained as a white solid by HPLC purification. HPLC (Method B): RT = 0.664, 10.794, 10.917 min, and LCMS (Method F): RT = 1.431 min; m / z: [M+2H] 2+ / 2=1075.9.
[0498] B. Preparation of 3' Fragment 1. General procedure for preparation of 5'-OH-ACCCU-LHPG pentamer (fragment 1) General procedure for the preparation of compound 7-2-1 [ka]
[0499] Compound 7-2-a was coevaporated with toluene (60.0 mL × 3). To a solution of compound 7-2-a (10.0 g, 16.1 mmol, 1.00 equiv.) in DCM (100 mL) was added N,N-diethylethanamine (8.18 g, 80.8 mmol, 11.2 mL, 5.00 equiv.) and tetrahydrofuran-2,5-dione (3.24 g, 32.3 mmol, 2.00 equiv.). The mixture was stirred at 25 °C for 4 h. HPLC showed that compound 7-2-a was completely consumed. The reaction mixture was washed with TEAB (0.5 M, 300 mL), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure to give a residue. Compound 7-2-1 (11.0 g, 15.3 mmol, 94.6% yield) was obtained as a brown solid.
[0500] HPLC (Method A): RT=2.405 minutes
[0501] General procedure for the preparation of compound 7-2-2 [ka] To a solution of compound 7-2-1a (10.1 g, 10.2 mmol, 1.00 equiv.) in DCM (300 mL) was added compound 7-2-2 (11.0 g, 14.5 mmol, 1.43 equiv., HCl), HBTU (13.1 g, 34.6 mmol, 3.40 equiv.), HOBt (4.69 g, 34.6 mmol, 3.40 equiv.), and DIEA (4.48 g, 34.6 mmol, 6.04 mL, 3.40 equiv.). The mixture was stirred at 25° C. for 0.5 h. TLC (starting material, R f =0.38, product, R f =0.42), indicating that compound 7-2-1a was completely consumed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The crude product was triturated with ACN (700 ml) at 25 °C for 15 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-2 (16.0 g, 9.43 mmol, 92.4% yield) was obtained as a brown solid.
[0502] General procedure for the preparation of compound 7-2-3 [ka]
[0503] To a solution of compound 7-2-2 (16.0 g, 9.43 mmol, 1.00 equiv.) in DCM (160 mL), dodecane-1-thiol (5.73 g, 28.3 mmol, 6.78 mL, 3.00 equiv.) and TFA (10.7 g, 94.3 mmol, 6.98 mL, 10.0 equiv.) were added. The mixture was stirred at 0° C. for 1 h. TLC (DCM:MeOH=10:1, starting material, R f =0.50, product, R f =0.43), indicating that compound 7-2-2 was completely consumed. The reaction mixture was washed with saturated aqueous NaHCO3 until pH > 7, extracted with dichloromethane (300 mL), washed with brine (200 ml), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. The crude product was triturated with ACN (800 ml) at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-3 (11.7 g, 8.39 mmol, 88.9% yield) was obtained as a white solid.
[0504] General procedure for the preparation of compound 7-2-4 [ka]
[0505] Compound 7-2-3 and MOE C amidite were coevaporated with (ACN 60.0 mL × 3) and (DCM 20.0 mL × 3). To a solution of compound 7-2-3 (11.7 g, 8.39 mmol, 1.00 equiv.) and MOE C amidite (15.4 g, 16.7 mmol, 2.00 equiv.), DCM (120 mL) and ACN (20 mL) were added, followed by 3A MS. The mixture was stirred for 1 hour, DCI (2.98 g, 20.98 mmol, 2.50 equiv.) was added to the mixture, the mixture was stirred for 0.5 hours, and 2-hydroperoxy-2-methyl-propane (3.24 g, 25.1 mmol, 5.04 mL, 5 M, 3.00 equiv.) was added to the mixture, and the mixture was stirred at 25 ° C. for 0.5 hours. TLC (DCM:MeOH=20:1, starting material, R f =0.43, product, R f =0.48), indicating that compound 7-2-3 was completely consumed. The reaction mixture was washed with aqueous NaHCO3 and Na2SO3 (200 ml), washed with brine (200 ml), filtered, and concentrated under reduced pressure to give a residue. The crude product was triturated with ACN (350 ml) at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-4 (17.1 g, 7.33 mmol, 87.2% yield) was obtained as a white solid.
[0506] General procedure for the preparation of compound 7-2-5 [ka] To a solution of compound 7-2-4 (17.1 g, 7.33 mmol, 1.00 equiv.) in DCM (170 mL) was added dodecane-1-thiol (4.45 g, 21.9 mmol, 5.26 mL, 3.00 equiv.) and TFA (8.35 g, 73.2 mmol, 5.42 mL, 10.0 equiv.). The mixture was stirred at 0° C. for 1 h. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f=0.48) indicated that compound 7-2-4 was completely consumed. The reaction mixture was washed with saturated aqueous NaHCO3 until pH > 7, extracted with dichloromethane (300 mL), washed with brine (200 ml), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. The crude product was triturated with ACN at 0 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-5 (13.7 g, 6.74 mmol, 92.0% yield) was obtained as a white solid.
[0507] General procedure for the preparation of compound 7-2-6 [ka]
[0508] Compound 5 and MOE C amidite were co-evaporated with (ACN 80.0 mL × 3) and (DCM 30.0 mL × 3). To a solution of compound 7-2-5 (13.7 g, 6.74 mmol, 1.00 equiv.) and MOE C amidite (12.4 g, 13.4 mmol, 2.00 equiv.), DCM (80.0 mL) and ACN (20.0 mL) were added, followed by 3 Å molecular sieves. The mixture was stirred for 1 hour, DCI (2.39 g, 16.8 mmol, 2.50 equiv.) was added to the mixture, the mixture was stirred for 0.5 hours, and 2-hydroperoxy-2-methyl-propane (5 M, 4.05 mL, 3.00 equiv.) was added to the mixture, and the mixture was stirred at 25 °C for 0.5 hours. TLC (DCM:MeOH = 15:1, starting material, R f =0.43, product, R f =0.50), indicated that compound 7-2-5 was completely consumed. The reaction mixture was filtered. The filtrate was triturated with ACN at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-6 (17.0 g, 6.15 mmol, 91.1% yield) was obtained as a white solid.
[0509] General procedure for the preparation of compound 7-2-7 [ka]
[0510] To a solution of compound 7-2-6 (17.0 g, 6.15 mmol, 1.00 equiv.) in DCM (190 mL) was added dodecane-1-thiol (3.73 g, 18.4 mmol, 4.42 mL, 3.00 equiv.) and TFA (7.01 g, 61.4 mmol, 4.55 mL, 10.0 equiv.). The mixture was stirred at 0° C. for 1 h. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f =0.38), indicating that compound 7-2-6 was completely consumed. The reaction mixture was washed with saturated aqueous NaHCO3 until pH > 7, extracted with dichloromethane (300 mL), washed with brine (200 ml), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. The crude product was triturated with ACN at 0 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-7 (14.7 g, 5.97 mmol, 97.0% yield) was obtained as a white solid.
[0511] General procedure for the preparation of compounds 7-2-8 [ka]
[0512] Compound 7-2-7 and MOE C amidite were co-evaporated with (ACN 60.0 mL × 3) and (DCM 20.0 mL × 3). To a solution of compound 7-2-7 (13.0 g, 5.31 mmol, 1.00 equiv.) and MOE C amidite (9.80 g, 10.6 mmol, 2.00 equiv.), DCM (60.0 mL) and ACN (20.0 mL) were added, followed by 3 Å molecular sieves (MS). The mixture was stirred for 1 hour, DCI (1.89 g, 13.2 mmol, 2.50 equiv.) was added to the mixture, the mixture was stirred for 0.5 hours, and 2-hydroperoxy-2-methyl-propane (5 M, 3.195 mL, 3.00 equiv.) was added to the mixture, and the mixture was stirred at 25 ° C. for 0.5 hours. TLC (DCM:MeOH=15:1, starting material, R f =0.43, product, R f =0.48), indicating that compound 7-2-7 was completely consumed. The reaction mixture was filtered. The filtrate was triturated with ACN (800 ml) at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-8 (14.4 g, 4.36 mmol, 82.1% yield) was obtained as a white solid.
[0513] General procedure for the preparation of compound 7-2-9 [ka]
[0514] To a solution of compound 7-2-8 (14.47 g, 4.39 mmol, 1.00 equiv.) in DCM (70.0 mL), dodecane-1-thiol (2.66 g, 13.1 mmol, 3.15 mL, 3.00 equiv.) and TFA (5.00 g, 43.8 mmol, 3.25 mL, 10.0 equiv.) were added. The mixture was stirred at 0° C. for 1 hour. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f=0.38), which indicated that compound 7-2-8 was completely consumed. The reaction mixture was washed with saturated aqueous NaHCO3 until pH > 7, extracted with dichloromethane (300 mL), washed with brine (200 ml), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The crude product was triturated with ACN (800 ml) at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-9 (11.6 g, 3.88 mmol, 88.5% yield) was obtained as a white solid.
[0515] General procedure for the preparation of compounds 7-2-10 [ka]
[0516] Compound 7-2-9 and MOE A amidite were dissolved in (ACN 60 ml × 3) and (DCM The mixture was co-evaporated with 20 ml x 3. To a solution of compound 7-2-9 (11.6 g, 3.87 mmol, 1.00 eq) and MOE A amidite (7.21 g, 7.74 mmol, 2.00 eq), DCM (60.0 mL) and ACN (20.0 mL) were added, followed by 3 Å MS, and the mixture was stirred for 1 hour. Then DCI (1.37 g, 9.67 mmol, 2.50 eq) was added to the mixture, and the mixture was stirred for 0.5 hours. Then 2-hydroperoxy-2-methyl-propane (5 M, 2.32 mL, 3.00 eq) was added to the mixture, and the mixture was stirred at 25 °C for 0.5 hours. TLC (DCM:MeOH = 15:1, starting material, R f =0.43, product, R f =0.47), indicating that compound 7-2-9 was completely consumed. The reaction mixture was filtered. The filtrate was triturated with ACN (800 ml) at 25 °C for 30 minutes. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-10 (14.0 g, 3.64 mmol, 94.1% yield) was obtained as a white solid.
[0517] General procedure for preparation of fragment 1 [ka]
[0518] To a solution of compound 7-2-10 (14.0 g, 3.64 mmol, 1.00 equiv.) in DCM (70.0 mL) was added dodecane-1-thiol (2.21 g, 10.9 mmol, 2.62 mL, 3.00 equiv.). The mixture was stirred at 0° C. for 1 h. TLC (DCM:MeOH=15:1, starting material, R f =0.43, product, R f =0.39), indicating that compound 7-2-10 was completely consumed. The reaction mixture was washed with saturated aqueous NaHCO3 until pH >7, extracted with dichloromethane (300 mL), washed with brine (200 ml), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a residue. The crude product was triturated with ACN (800 ml) at 25 °C for 30 min. It was then filtered and washed with ACN (100 mL × 2). Compound 7-2-10 (Fragment 1) (10.0 g, 2.82 mmol, 77.5% yield) was obtained as a white solid. 7-2-10 (Fragment 1) was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis. HPLC (Method C): RT = 2.11 min and LCMS (Method D): RT = 0.219 min; m / z: [M-2H] 2- / 2=916.6.
[0519] 2. General procedure for preparation of 5'-deoxy-TTACC pentamer or 5'-DMTr-TTACC-OH or 5'-OH-TTACC-TBDPS pentamer (fragment 2) General procedure for the preparation of compound 7-3-2 [ka]
[0520] To a solution of compound 7-3-1 (40.0 g, 61.7 mmol, 1.00 equiv.) in DCM (200 mL) was added imidazole (21.0 g, 308 mmol, 5.00 equiv.). The mixture was a pale yellow homogeneous solution. TBDPSCl (22.0 g, 80.2 mmol, 20.6 mL, 1.30 equiv.) was added. The mixture was stirred at 25 °C for 16 h. TLC (petroleum ether:ethyl acetate=2:1, product: R f =0.46) indicated that compound 7-3-1 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0521] Propanol-2-ol (4.73 mL, 1.00 equiv.) was added and the mixture was stirred for 0.5 h. The above mixture was cooled to 0° C. in an ice-water bath. Dodecane-1-thiol (16.2 g, 80.2 mmol, 19.2 mL, 1.30 equiv.) was added and the mixture was stirred at 0° C. for 15 min. TFA (56.3 g, 494 mmol, 36.5 mL, 8.00 equiv.) was added dropwise at 0° C. The mixture was stirred at 0° C. for 1 h. TLC (petroleum ether:ethyl acetate=2:1, R f =0.24) indicated complete consumption of the starting material and the formation of one new spot. The reaction was clean by TLC. The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 500 mL of DI water), then diluted with 100 mL of DCM and extracted with 200 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0522] The crude product was dissolved in 100 mL of DCM and the crude product solution was slowly added dropwise through a funnel to a solvent mixture of heptane / TBME (v / v 9:1, 1200 mL) to carry out the precipitation process. This process took approximately 30 minutes. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a solvent mixture of heptane (100 mL x 2) and concentrated to dryness. Compound 7-3-2 (34.8 g, 56.1 mmol, 91.0% yield, 94.2% purity) was obtained as a white solid. HPLC (Method A): RT=7.136 min, and LCMS (Method F): RT=1.570 min; m / z:[M+H] + =584.2.
[0523] General procedure for the preparation of compound 7-3-3 [ka]
[0524] A solution of compound 7-3-2 (13.0 g, 22.2 mmol, 1.00 equiv.) and dC amidite (20.7 g, 24.5 mmol, 1.10 equiv.) was coevaporated with ACN (100 mL x 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (3.00 g) were added to the single-neck bottle, and ACN / DCM = 1:1 (100 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (3.94 g, 33.4 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 6.207 min; starting material: RT = 7.136 min) showed complete consumption of the starting material.
[0525] After the coupling reaction was completed, BuOOH (5.73 g, 44.5 mmol, 6.10 mL, 70.0% purity, 2.00 equiv.) was added to the above solution at 25 °C. The mixture was stirred at 25 °C for 1 h. HPLC (7-3-3, product: RT = 9.028 min; starting material: RT = 6.027 min) showed that the starting material was completely consumed. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 400 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated. Compound 7-3-3 (33.0 g, 22.0 mmol, 98.7% yield, 89.7% purity) was obtained as a white foam. HPLC (Method A): RT = 5.518 min, and LCMS (Method D): RT = 1.787 min; m / z: [M−H] - =1344.6.
[0526] General procedure for the preparation of compound 7-3-4 [ka]
[0527] To compound 7-3-3 (24.0 g, 17.8 mmol, 1.00 equiv.) in ACN (120 mL) was added dodecane-1-thiol (4.69 g, 23.1 mmol, 5.55 mL, 1.30 equiv.) at 0° C., followed by dropwise addition of TFA (16.2 g, 142 mmol, 10.5 mL, 8.00 equiv.) at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (dichloromethane:methanol=10:1, product: R f =0.55) indicated that compound 7-3-3 was completely consumed and one new spot was formed. The reaction was messy by TLC. The reaction mixture was poured into NaHCO (10.0 equivalents of NaHCO in 300 mL of DI water), then diluted with 100 mL of EtOAc and extracted with 100 mL of aqueous NaHCO. The combined organic layers were washed with brine (100 mL × 2), dried over NaSO, filtered, and concentrated under reduced pressure to give a residue. The mixture was redissolved in CHCN:HO (2:1, 100 mL). The CHCN / HO layer was washed with heptane:tBuOMe = 4:1 (200 mL × 4). The CHCN and HO layer was then diluted with EtOAc / MTBE (1 / 3, 120 mL). The organic layer was washed with DI water (100 mL), brine (100 mL), dried over NaSO, filtered, and concentrated under reduced pressure to give a residue. Compound 7-3-4 (16.4 g, 14.3 mmol, 80.4% yield, 91.2% purity) was obtained as a white solid. The crude product was purified by reverse-phase HPLC (pH = 7). Compound 7-3-4 (14.7 g, 13.4 mmol, 87.4% yield, 95.2% purity) was obtained as a white foam. HPLC (Method A): RT=7.344 min, and LCMS (Method E): RT=1.451 min; m / z: [M+H] + =1044.7.
[0528] General procedure for the preparation of compound 7-3-5 [ka]
[0529] Compound 7-3-4 (14.7 g, 14.0 mmol, 1.00 equiv.) and dA amidite (13.2 g, 15.4 mmol, 1.10 equiv.) were coevaporated with ACN (100 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (4.00 g) were added to the single-neck bottle, and ACN (75 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (2.49 g, 21.1 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.344 min; starting material: RT = 8.501 min) showed complete consumption of the starting material.
[0530] After the coupling reaction was completed, BuOOH (3.62 g, 28.1 mmol, 3.86 mL, 70.0% purity, 2.00 equiv.) was added to the above solution at 25 °C. The mixture was stirred at 25 °C for 0.5 h. HPLC (7-3-5, product: RT = 8.232 min; starting material: RT = 8.501 min) showed that the starting material was completely consumed. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 500 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.
[0531] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (1000 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL × 2). Compound 7-3-5 (30.0 g, 13.4 mmol, 95.7% yield, 81.6% purity) was obtained as a white solid. The crude product was purified by reverse-phase HPLC (pH = 7 condition). Compound 7-3-5 (24.0 g, 13.0 mmol, 96.9% yield, 98.8% purity) was obtained as a white solid. HPLC (Method A): RT=8.233 min; LCMS (Method D): RT=1.622 min; m / z:[M-2H] 2- / 2=906.8.
[0532] General procedure for the preparation of compound 7-3-6 [ka]
[0533] To a solution of compound 7-3-5 (18.3 g, 10.0 mmol, 1.00 equiv) in ACN (90 mL) was added dodecane-1-thiol (2.65 g, 13.0 mmol, 3.14 mL, 1.30 equiv) at 0 °C, and then TFA (9.19 g, 80.5 mmol, 5.97 mL, 8.00 equiv) was added dropwise at 0 °C. The mixture was stirred at 0 °C for 1 hour. TLC (DCM:MeOH = 10:1, product: R f =0.43) indicated that compound 7-3-5 was completely consumed and two new spots were formed. The reaction was messy by TLC.
[0534] The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 300 mL of DI water), then diluted with 100 mL of EtOAc and extracted with 100 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (1000 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether heptane (50 mL x 2). Compound 7-3-6 (14.3 g, 9.34 mmol, 92.7% yield, 98.8% purity) was obtained as a white solid. HPLC (Method A): RT=7.008 min; LCMS (Method E): RT=1.444 min; m / z:[M+H] + =1514.8.
[0535] General procedure for the preparation of compound 7-3-7 [ka]
[0536] Compound 7-3-6 (14.3 g, 9.44 mmol, 1.00 equiv.) and dT amidite (7.73 g, 10.3 mmol, 1.10 equiv.) were coevaporated with ACN (50 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (4.00 g) were added to the single-neck bottle, and ACN (75 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (1.67 g, 14.1 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 8.061 min; starting material: RT = 7.008 min) showed complete consumption of the starting material.
[0537] After the coupling reaction was completed, BuOOH (2.43 g, 18.8 mmol, 2.59 mL, 70.0% purity, 2.00 equiv.) was added to the above solution at 25 °C. The mixture was stirred at 25 °C for 1 h. HPLC (7-3-7, product: RT = 7.856 min; starting material: RT = 8.061 min) showed that the starting material was completely consumed. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 400 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.
[0538] Compound 7-3-7 (21.9 g, 8.78 mmol, 93.0% yield, 87.1% purity) was obtained as a white solid. The crude product was purified by reverse-phase HPLC (pH = 7). Compound 7-3-7 (19.0 g, 8.57 mmol, 97.6% yield, 98.0% purity) was obtained as a white foam. HPLC (Method A): RT=7.848 min; LCMS (Method D): RT=1.569 min; m / z:[M-2H] 2- / 2=1085.5.
[0539] General procedure for the preparation of compounds 7-3-8 [ka]
[0540] To a solution of compound 7-3-7 (14.0 g, 6.44 mmol, 1.00 equiv.) in ACN (70 mL) was added dodecane-1-thiol (1.69 g, 8.37 mmol, 2.01 mL, 1.30 equiv.) at 0° C., followed by dropwise addition of TFA (5.87 g, 51.5 mmol, 3.81 mL, 8.00 equiv.) at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (methanol:dichloromethane=10:1, product: R f =0.41) indicated that compound 7-3-7 was completely consumed and two new spots were formed. The reaction was messy by TLC. The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 300 mL of deionized (DI) water) and then diluted with EtOAc. The mixture was diluted with 100 mL of water and extracted with 100 mL of aqueous NaHCO3 solution. The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0541] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (1000 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-3-8 (11.5 g, 6.00 mmol, 93.1% yield, 97.6% purity) was obtained as a white solid. HPLC (Method A): RT=6.705 min.
[0542] General procedure for preparation of deoxy-TTACC pentamer 7-3-9 [ka]
[0543] A solution of compound 7-3-8 (11.5 g, 6.14 mmol, 1.00 equiv.) and dT amidite (5.03 g, 6.76 mmol, 1.10 equiv.) was coevaporated with ACN (50 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (4.00 g) were added to the single-neck bottle, and ACN (75 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (1.67 g, 14.1 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.730 min; starting material: RT = 6.705 min) showed complete consumption of the starting material.
[0544] After the coupling reaction was complete, BuOOH (1.58 g, 12.2 mmol, 1.68 mL, 70.0% purity, 2.00 equiv.) was added to the above solution. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.517 min; starting material: RT = 7.730 min) showed complete consumption of the starting material. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 500 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.
[0545] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (800 mL). The desired product precipitated. After filtration, the product was collected as a white solid and the solid cake was washed with isopropyl ether MTBE (50 mL x 2). LCMS: Product: RT = 1.443 min. The crude product was purified by reverse phase HPLC (pH=7). 7-3-9 (deoxy-TTACC pentamer) (14.3 g, 5.47 mmol, 89.3% yield, 96.8% purity) was obtained as a pale yellow solid. HPLC (Method B): RT=11.993, 12.120, 12.240 min; LCMS (Method D): RT=1.443 min; m / z:[M-2H] 2- / 2=1263.7.
[0546] General procedure for the preparation of DMTr-TTACC-OH7-3-10 [ka]
[0547] To a solution of compound 7-3-9 (7.20 g, 2.84 mmol, 1.00 equiv.) in ACN (35 mL), and then to a solution of pyridine; hydrofluoric acid (813 mg, 28.4 mmol, 739 μL, 70.0% purity, 10.0 equiv.) and imidazole (3.87 g, 56.8 mmol, 20.0 equiv.) in THF (12 mL) was added dropwise at 0° C. The mixture was stirred at 0° C. for 3 hours. TLC (dichloromethane:methanol=10:1, purity: R f =0.30) indicated that compound 7-3-9 was completely consumed and two new spots were formed. The reaction was messy by TLC.
[0548] The reaction mixture was dissolved in EtOAc (50 mL), and the organic layer was washed with saturated aqueous NaHCO (100 mL x 2), brine (100 mL), and dried over anhydrous NaSO, filtered, and concentrated in vacuo. The crude product was redissolved in DCM (5 mL). The crude solvent was slowly added dropwise to a solution of MTBE (300 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-3-10DMTr-TTACC-OH (6.00 g, 2.33 mmol, 82.0% yield, 89.1% purity) was obtained as a white solid. HPLC (Method B): RT=6.449, 6.591 min; LCMS (Method F): RT=1.312 min; m / z:[M+2H] 2+ / 2=1147.4.
[0549] Preparation of Compound 7-3-10a [ka]
[0550] Compound 7-3-10a was synthesized from 7-3-10 using a procedure similar to that described above for the phosphoramidite synthesis. HPLC-MS (Method G): RT = 8.174, 8.251, 8.420, 8.494 min; m / z: [M-2H] 2- / 2 = 1245.4 (for compound 7-3-10a).
[0551] Preparation of HO-TTACC-OTBDPS7-3-11 [ka]
[0552] To a solution of compound 7-3-9 (6.60 g, 2.61 mmol, 1.00 equiv) in ACN (35 mL) was added dodecane-1-thiol (791 mg, 3.91 mmol, 936 uL, 1.50 equiv) at 0 °C, followed by dropwise addition of TFA (2.38 g, 20.8 mmol, 1.54 mL, 8.00 equiv) at 0 °C. The mixture was stirred at 0 °C for 1 hour. TLC (DCM:MeOH = 10:1, product: R f =0.35) indicated that compound 7-3-9 was completely consumed and two new spots were formed. The reaction was messy by TLC. The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 100 mL of DI water), then diluted with 50 mL of EtOAc and extracted with 100 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0553] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (300 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL × 2). Compound 7-3-11 (HO-TTACC-OTBDPS) (5.35 g, 2.37 mmol, 90.7% yield, 98.6% purity) was obtained as a white solid. HPLC (Method B): RT=9.508, 9.650 min; LCMS (Method D): RT=1.444 min; m / z:[M-2H] 2- / 2=1113.3.
[0554] 3. General procedure for preparation of 5'-UTTC tetramer or 5'-DMTr-UTTC-OH or 5'-OH-UTTC-TBDPS tetramer (fragment 3) General procedure for the preparation of compound 7-4-2 [ka]
[0555] To a solution of compound 7-4-1 (40.0 g, 61.7 mmol, 1.00 equiv.) in DCM (200 mL) was added imidazole (21.0 g, 308 mmol, 5.00 equiv.). The mixture was a pale yellow homogeneous solution. TBDPSCl (22.0 g, 80.2 mmol, 20.6 mL, 1.30 equiv.) was added. The mixture was stirred at 25 °C for 16 h. TLC (petroleum ether:ethyl acetate=2:1, product: R f =0.46) indicated that compound 7-4-1 was completely consumed and one new spot was formed. The reaction was clean by TLC.
[0556] Propanol-2-ol (4.73 mL, 1.00 equiv.) was added and the mixture was stirred for 0.5 h. The above mixture was cooled to 0° C. in an ice-water bath. Dodecane-1-thiol (16.2 g, 80.2 mmol, 19.2 mL, 1.30 equiv.) was added and the mixture was stirred at 0° C. for 15 min. TFA (56.3 g, 494 mmol, 36.5 mL, 8.00 equiv.) was added dropwise at 0° C. The mixture was stirred at 0° C. for 1 h. TLC (petroleum ether:ethyl acetate=2:1, R f =0.24) indicated complete consumption of the starting mixture and the formation of one new spot. The reaction was clean by TLC. The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 500 mL of DI water), then diluted with 100 mL of DCM and extracted with 200 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0557] The crude product was dissolved in 100 mL of DCM and slowly added dropwise to a solvent mixture of heptane / TBME (v / v 9:1, 1200 mL) via a funnel to carry out the precipitation process. This process took approximately 0.5 h. The pure product was collected as a white solid on a Buchner funnel, and the product cake was washed with a solvent mixture of heptane (100 mL × 2) and concentrated to dryness. Compound 7-4-2 (34.8 g, 56.1 mmol, 91.0% yield, 94.2% purity) was obtained as a white solid. HPLC (Method A): RT=7.136 min, and LCMS (Method F): RT=1.570 min; m / z:[M+H] + =584.2
[0558] General procedure for the preparation of compound 7-4-3 [ka]
[0559] Compound 7-4-2 (15.0 g, 25.7 mmol, 1.00 equiv.) and dT amidite (21.0 g, 28.2 mmol, 1.10 equiv.) were coevaporated with ACN / DCM (1 / 1, 100 mL x 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (6.50 g) were added to the single-neck bottle under Ar pressure, and ACN (60 mL) and DCM (60 mL) were added. The mixture was stirred at 25 °C for 1 h, and then DCI (4.55 g, 38.5 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 8.233 min) showed that compound 7-4-2 was completely consumed.
[0560] After the coupling reaction was complete, BuOOH (6.62 g, 51.3 mmol, 7.04 mL, 70.0% purity, 2.00 equiv.) was added to the above solution at 25 °C. The mixture was stirred at 25 °C for 0.5 h. HPLC (product: RT = 7.764, 7.826 min) showed the reaction was complete. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.0 equiv. Na2SO3 in 400 mL of DI water), and the mixture was then diluted with DCM (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.
[0561] Compound 7-4-3 (36.0 g, 24.9 mmol, 97.1% yield, 86.2% purity) was obtained as a white solid. HPLC: Product: RT = 7.764, 7.826 min; LCMS: Compound 7-4-3, RT = 1.602 min. Crude compound 3 was used in the next step.
[0562] Compound 7-4-3 (10.0 g, 6.93 mmol, 86.2% purity) was purified by reverse-phase MPLC (MeCN / water, pH 7). Compound 7-4-3 (8.00 g, 6.19 mmol, 89.2% yield, 96.1% purity) was obtained as a white foam. HPLC (Method A): RT = 7.792, 7.845 min, and LCMS (Method F): RT = 1.602 min; m / z: [M+H]+ =1243.4.
[0563] General procedure for the preparation of compound 7-4-4 [ka]
[0564] To a solution of compound 7-4-3 (26.0 g, 20.9 mmol, 1.00 equiv.) in ACN (120 mL) was added dodecane-1-thiol (5.50 g, 27.18 mmol, 6.51 mL, 1.30 equiv.) cooled to 0° C., followed by dropwise addition of TFA (19.0 g, 167 mmol, 12.3 mL, 8.00 equiv.) at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (dichloromethane:methanol=10:1, product: R f =0.46), which indicated that compound 7-4-3 was completely consumed and one new spot was formed. The reaction was clean by TLC. The reaction mixture was poured into NaHCO3 solution (10.0 equivalents of NaHCO3 in 400 mL of DI water), and then the mixture was diluted with EtOAc (300 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (200 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0565] The mixture was redissolved in CHCN:HO (2:1, 100 mL), and the CHCN / HO layer was washed with heptane:tBuOMe = 4:1 (200 mL × 4), and then the CHCN and HO layer was diluted with EtOAc / MTBE (1 / 3, 120 mL). The organic layer was washed with DI water (100 mL), and the organic layer was washed with brine (100 mL), dried over NaSO, filtered, and concentrated under reduced pressure to give a residue. Compound 7-4-4 (17.0 g, 16.7 mmol, 80.0% yield, 92.6% purity) was obtained as a white foam. HPLC (Method A): RT=5.977 min, and LCMS (Method E): RT=1.241 min; m / z: [M+H] + =941.5.
[0566] General procedure for the preparation of compound 7-4-5 [ka]
[0567] Compound 7-4-4 (17.0 g, 18.0 mmol, 1.00 equiv.) and dT amidite (14.8 g, 19.8 mmol, 1.10 equiv.) were coevaporated with ACN (100 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (4.50 g) were added to the single-neck bottle, and ACN (85 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (3.20 g, 27.1 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.451 min; starting material: RT = 5.977 min) showed complete consumption of the starting material.
[0568] After the coupling reaction was complete, BuOOH (4.65 g, 36.1 mmol, 4.95 mL, 70.0% purity, 2.00 equiv.) was added to the above solution. The mixture was stirred at 25 °C for 0.5 h. HPLC (product: RT = 7.810 min; starting material: RT = 7.451 min) showed complete consumption of the starting material. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 400 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated. Compound 7-4-5 (34.0 g, 17.2 mmol, 95.2% yield, 81.0% purity) was obtained as a white foam.
[0569] Compound 7-4-5 (24.0 g, 15.0 mmol, purity 81.0%) was purified by reverse-phase HPLC (pH = 7 condition; MeCN / water). Compound 7-4-5 (17.8 g, 11.1 mmol, yield 89.7%, purity 98.2%) was obtained as a white foam. HPLC (Method A): RT=7.179 min, and LCMS (Method D): RT=1.530 min; m / z: [M−H] - =1599.6.
[0570] General procedure for the preparation of compound 7-4-6 [ka]
[0571] To a solution of compound 7-4-5 (12.6 g, 7.87 mmol, 1.00 equiv.) in ACN (65 mL) was added dodecane-1-thiol (2.07 g, 10.2 mmol, 2.45 mL, 1.30 equiv.) at 0° C., followed by dropwise addition of TFA (7.18 g, 62.9 mmol, 4.66 mL, 8.00 equiv.) at 0° C. The mixture was stirred at 0° C. for 1 hour. TLC (dichloromethane:methanol=10:1, product: R f =0.36) indicated that compound 7-4-5 was completely consumed and one new spot was formed. The reaction was clean by TLC. The reaction mixture was poured into NaHCO3 (10.0 equivalents of NaHCO3 in 200 mL of DI water), then diluted with 100 mL of EtOAc and extracted with 100 mL of aqueous NaHCO3. The combined organic layers were washed with 200 mL of brine (100 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to give a residue.
[0572] The crude product was dissolved in 100 mL of DCM and the crude product solution was slowly added dropwise through a funnel to a solvent mixture of heptane / TBME (v / v 9:1, 500 mL) to carry out the precipitation process. This process took approximately 0.5 h. The pure product was collected as a white solid in a Buchner funnel, and the product cake was washed with a solvent mixture of heptane (100 mL x 2) and concentrated to dryness. Compound 7-4-6 (11.0 g, 7.75 mmol, 98.4% yield, 91.4% purity) was obtained as a white solid. HPLC (Method A): RT=5.661 min, and LCMS (Method F): RT=1.365 min; m / z:[M+H] + =1298.4.
[0573] General procedure for the preparation of UTTC tetramer 7-4-7 [ka]
[0574] Compound 7-4-6 (11.0 g, 8.47 mmol, 1.00 equiv.) and MOE T amidite (7.63 g, 9.32 mmol, 1.10 equiv.) were coevaporated with ACN (100 mL × 3) in a 250 mL single-neck round bottle under Ar. 3 Å molecular sieves (3.00 g) were added to the single-neck bottle, and ACN (55 mL) was added under Ar pressure. The mixture was stirred at 25 °C for 1 h, and then DCI (1.50 g, 12.7 mmol, 1.50 equiv.) was added to the mixture. The mixture was stirred at 25 °C for 1 h. HPLC (product: RT = 7.056, 7.180 min; starting material: RT = 5.661 min) showed complete consumption of the starting material.
[0575] After the coupling reaction was complete, BuOOH (2.18 g, 16.9 mmol, 2.32 mL, 70.0% purity, 2.00 equiv.) was added to the above solution. The mixture was stirred at 25 °C for 0.5 h. HPLC (product: RT = 6.897, 6.961 min; starting material: RT = 7.056, 7.180 min) showed complete consumption of the starting material. The reaction mixture was poured into a NaHCO3 and Na2SO3 solution (10.0 equiv. NaHCO3 and 5.00 equiv. Na2SO3 in 500 mL of DI water), and the mixture was then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (200 mL), dried, filtered, and concentrated.
[0576] The crude product was redissolved in DCM (50 mL). The crude solvent was slowly added dropwise to a solution of MTBE (600 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2). The crude solid was purified by reverse-phase HPLC (pH = 7 condition; MeCN / water). Compound 7-4-7 (UTTC tetramer) (14.5 g, 7.06 mmol, 83.3% yield, 98.9% purity) was obtained as a white solid. HPLC (Method B): RT=10.638, 10.822 min, and LCMS (Method D): RT=1.396 min; m / z:[MH] - =1014.3.
[0577] General procedure for the preparation of 7-4-8 (DMTr-UTTC-OH) [ka]
[0578] To a solution of 7-4-7 (6.60 g, 3.25 mmol, 1.00 equiv) in ACN (35 mL) and then pyridine; hydrofluoric acid (928 mg, 32.4 mmol, 844 μL, 70.0% purity, 10.0 equiv) and imidazole (4.42 g, 64.9 mmol, 20.0 equiv) in THF (8 mL) were added dropwise at 0° C. The mixture was stirred at 0° C. for 3 h. TLC (dichloromethane:methanol=10:1, product: R f =0.33) indicated that compound 7-4-7 was completely consumed and two new spots were formed. The reaction was messy by TLC.
[0579] The reaction mixture was dissolved in EtOAc (20 mL). The organic layer was washed with saturated aqueous NaHCO3 (50 mL x 2), brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated in vacuo. The crude product was redissolved in DCM (5 mL). The crude solvent was slowly added dropwise to a solution of MTBE (300 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL x 2).
[0580] Compound 7-4-8 (DMTr-UTTC-OH) (5.57 g, 2.90 mmol, 89.3% yield, 93.4% purity) was obtained as a white solid. HPLC (Method B): RT=4.461, 4.761 min and LCMS (Method D): RT=1.237 min; m / z:[MH] - =1791.5.
[0581] General procedure for the preparation of 7-4-8a (fragment 3) [ka]
[0582] Compound 7-4-8a was synthesized from 7-4-8 using a procedure similar to that described above for the phosphoramidite synthesis. HPLC-MS (Method G): RT = 7.335, 7.446, 7.583, 7.637 min; m / z: [M−H] - =1991.6 (for compound 7-4-8a).
[0583] General procedure for the preparation of 7-4-9 (HO-UTTC-OTBDPS) [ka]
[0584] To a solution of 7-4-7 (6.00 g, 2.95 mmol, 1.00 equiv) in ACN (30 mL) was added dodecane-1-thiol (896 mg, 4.43 mmol, 1.06 mL, 1.50 equiv) followed by TFA (2.69 g, 23.6 mmol, 1.75 mL, 8.00 equiv) dropwise at 0 °C. The mixture was stirred at 0 °C for 1 h. TLC (DCM:MeOH = 10:1, product: R f = 0.35) showed complete consumption of 7-4-7 and the formation of two new spots. The reaction was messy by TLC.
[0585] The reaction mixture was poured into NaHCO (10.0 equivalents of NaHCO in 100 mL of DI water), then diluted with 50 mL of EtOAc and extracted with 100 mL of aqueous NaHCO The combined organic layers were washed with 200 mL of brine (100 mL x 2), dried over NaSO, filtered, and concentrated under reduced pressure to give a residue.
[0586] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (300 mL). The desired product precipitated. After filtration, the product was collected as a white solid, and the solid cake was washed with isopropyl ether MTBE (50 mL × 2). Compound 7-4-9 (HO-UTTC-OTBDPS) (4.97 g, 2.86 mmol, 96.6% yield, and 99.3% purity) was obtained as a white solid. HPLC (Method B): RT=6.895 min; LCMS (Method F): RT=1.323 min; m / z:[M+H] + =1729.6.
[0587] C. Convergent Synthesis of Targeted Oligonucleotide ASO 9-1
[0588] HPLC-MS method for the synthesis of ASOs 9-1 and 9-2 and their intermediates 7a-e. Column: ACQUITY UPLC Oligonucleotide BEH C18 Column, 130 Å, 1.7 μm, 2.1 mm × 150 mm; Column temperature: 35℃ Mass range of 200-2300; MS polarity: negative; Mobile phase: Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH3CN, 1 μM EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA gradient: [Table 21]
[0589] ASO 9-1 was synthesized using a convergent synthetic procedure similar to the method disclosed above for the synthesis of ASO 9.
[0590] General procedure for the preparation of compound 7-a [ka]
[0591] Fragments 1 and 2 were coupled to synthesize 7-a using a procedure similar to that disclosed above. 7-a was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis. HPLC-MS: RT=7.247 min and m / z=1831.5 (see Figure 21).
[0592] General procedure for the preparation of compound 7-b [ka]
[0593] Compound 7-b was synthesized from 7-a using the detritylation method disclosed above. 7-b was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis. HPLC-MS: RT = 6.250 min and m / z = 1680.4 (see Figure 22).
[0594] General procedure for the preparation of compound 7-c [ka]
[0595] Fragments 3 and 7-b were coupled to synthesize 7-c using a procedure similar to that disclosed above. 7-c was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis. HPLC-MS: RT=7.627 min and m / z=1650.6 (see Figure 23).
[0596] General procedure for the preparation of compound 7-d [ka]
[0597] Compound 7-d was synthesized from 7-c using the detritylation method disclosed above. 7-d was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis; HPLC-MS: RT = 7.801 min and m / z = 1549.9 (see Figure 24).
[0598] General procedure for the preparation of compound ASO-9-1 [ka]
[0599] ASO-9-1 was synthesized by coupling fragment 7-d and fragment 4 using a procedure similar to that described for the synthesis of ASO 9. ASO-9-1 was confirmed by HPLC-MS: RT = 10.224 min and m / z: = 2168.0 (see Figure 25).
[0600] D. Convergent Synthesis of Targeted Oligonucleotide ASO-9-2 [ka]
[0601] ASO 9-2 was synthesized using a convergent synthetic procedure similar to that disclosed above for the synthesis of ASO 9 and ASO-9-1. [ka]
[0602] Compound 7-e was synthesized by coupling fragment 5-4 and fragment 7-b using the coupling procedure disclosed above, followed by the detritylation method disclosed above. 7-e was characterized by HPLC and mass spectrometry after deprotection of the LHPG group using ammonolysis; HPLC-MS: RT = 7.773 min and m / z = 1570.9 (see Figure 26).
[0603] General procedure for the preparation of compound ASO-9-2 [ka] ASO-9-2 was synthesized by coupling fragment 7-e and fragment 4 using a procedure similar to that described for the synthesis of ASO 9 and ASO-9-1. ASO-9-2 was confirmed by HPLC-MS: RT = 9.917 min and m / z: = 2189.4 (see Figure 27).
[0604] Example 8. Synthesis of stereospecific oligonucleotides using PSI chemistry For the Prep-HPLC method described below, mobile phase solvents are written in the format [AB], where A refers to mobile phase A and B refers to mobile phase B. For example, mobile phase [TEAB(10 mM)-ACN] means that 10 mM TEAB was used as mobile phase A and HPLC-grade acetonitrile was used as mobile phase B.
[0605] The following analytical methods were used in the synthesis of the compounds and oligonucleotides described in Example 8.
[0606] HPLC method: [Table 22]
[0607] LC-MC method: [Table 23]
[0608] 1.1 Linear synthesis of dTdAdCdC fragment [ka] Preparation of Compound 8.2 Compound dC (10 g, 15.44 mmol, 1 equiv.) was azeotroped with ACN (10 mL × 2). To a solution of compound dC (10 g, 15.44 mmol, 1 equiv.) and PSI reagent, compound 8.1 (8.96 g, 20.07 mmol, 1.3 equiv.) in ACN (60 mL) was added DBU (3.06 g, 20.07 mmol, 3.03 mL, 1.3 equiv.) under N at 0 °C. The mixture was stirred at 25 °C for 0.5 h. TLC (petroleum ether / ethyl acetate = 2:1, Rf = 0.54) showed that compound dC was completely consumed. The mixture was filtered through a short pad of silica gel, and the silica gel was washed with EA (60 mL × 2). The organic phase was washed with saturated KH2PO4 (30 mL), saturated NaHCO3 (30 mL), brine (30 mL x 2), dried over anhydrous Na2SO4, filtered, and the solvent was removed in vacuo. The crude product was purified by chromatography (SiO2, petroleum ether / ethyl acetate = 50 / 1 to 1 / 1). Compound 8.2 (7.3 g, 8.00 mmol, 51.83% yield, 98% purity) was obtained as a white solid. IPC (in process control): TLC (petroleum ether / ethyl acetate = 2:1, product (R f )=0.54) HPLC shows RT=8.666.
[0609] Preparation of Compound 8.4 Compound 8.3 (4 g, 6.85 mmol, 1 equiv.) was azeotroped with ACN (10 mL × 2). Compound 8.3 (3.5 g, 6.00 mmol, 1 equiv.) in ACN (24 mL) was added to molecular sieves 3A (1 g, 1.00 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Then, compound 8.2 (5.90 g, 6.60 mmol, 1.1 equiv.) and DBU (2.74 g, 17.99 mmol, 2.71 mL, 3 equiv.) were added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS (product: RT = 1.469 min) showed that compound 8.2 was completely consumed. The mixture was diluted with ethyl acetate (10 mL) and 20% citric acid (10 mL). The organic phase was washed with HO (10 mL), saturated NaHCO (10 mL), brine (10 mL), dried over anhydrous NaSO, filtered, and the solvent was removed in vacuo. The crude product was used without further purification. Compound 8.4 [(m / z H + )=1307.6, 9.48 g, crude] as a yellow solid.
[0610] The stereoselectivity of compound 8.4 was tested by superfluid flow chromatography (SFC) (described below). Compound 8.4 showed a single peak at RT=2.30 min (see Figure 28). No other peaks were detected. The stereoselectivity is >99.5%. SFC method: Equipment: CAS-TJ-ANA-SFC-1(Waters SFC-MS) Column: Chiralcel OD-3, 4.6*100mm, 3um Mobile phase: A for SFC CO2, B for EtOH (0.05% IPAm) Gradient: B is 40% in 10 minutes Flow rate: 4.0mL / min Column temperature: 35℃ Detection wavelength: 220 nm System back pressure: 100 bar
[0611] For comparison, a racemic sample was synthesized by amidite chemistry as a standard with two retention times of 2.79 and 4.33 min (see Figure 29). [ka]
[0612] Preparation of Compound 8.5 To a solution of compound 8.4 (7.85 g, 5.99 mmol, 1 equiv.) in DCM (55 mL) was added 2,2-dichloroacetic acid (5.18 g, 40.18 mmol, 3.3 mL, 6.70 equiv.) at 25 °C under N2. The mixture was stirred at 25 °C for 1 h. LCMS (product: RT = 1.352 min) showed that compound 8.4 was completely consumed. The mixture was diluted with TEAB (10 mL) and DCM (10 mL). The organic phase was washed with HO (10 mL), saturated aqueous NaHCO3 (10 mL), brine (10 mL × 2), dried over anhydrous Na2SO4, filtered, and the solvent was removed in vacuo. The residue was purified by preparative HPLC (neutral conditions) (column: YMC-Triart Prep C18 250*50mm*10um; mobile phase: [TEAB (10mM)-ACN]; B%: 45%-65%, 22 min). Compound 8.5 (3.8g, 3.70mmol, 61.68% yield, 98% purity) was obtained as a white solid. MS (mH + ) / z=1005.4,
[0613] Preparation of Compound 8.7 Compound 8.5 (3.5 g, 3.48 mmol, 1 equiv) was azeotroped with ACN (10 mL x 2). Compound 8.5 (3.5 g, 3.48 mmol, 1 equiv) in ACN (25 mL) was added to molecular sieves 3Å (0.5 g, 3.48 mmol, 1.00 equiv) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Then, compound 8.6 (4.71 g, 5.21 mmol, 1.5 equiv) and DBU (1.59 g, 10.43 mmol, 1.57 mL, 3 equiv) were added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS (product: RT = 1.314 min, mH +) / z=1740.4) indicated that compound 8.5 was completely consumed. The mixture was diluted with DCM (10 mL), 20% citric acid (10 mL x 2). The organic phase was diluted with HO (10 mL), NaHCO 3( The crude product was purified by preparative HPLC (instrument: Shimadzu 20AP; column: YMC-Actus The mixture was purified by Triart C18 150*30mm*5um; mobile phase: [TEAB (10mM)-ACN]; B%: 20%-60%, 12 min. Compound 8.7 (2.7g, 53.79% yield, 97% purity) was obtained as a yellow solid.
[0614] Preparation of Compound 8.9 Compound 8.7 (1 g, 694.20 μmol, 1 equiv.) was azeotroped with ACN (5 mL × 2). To compound 8.7 (1 g, 694.20 μmol, 1 equiv.) in ACN (7 mL) was added molecular sieves 3 Å (0.5 g, 208.26 μmol, 1.00 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Then, compound 8.8 (1.10 g, 1.39 mmol, 2 equiv.) and DBU (317.06 mg, 2.08 mmol, 313.92 μL, 3 equiv.) were added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS (product: RT = 1.254 min) showed that compound 8.7 was completely consumed. The mixture was diluted with DCM (30 mL), pH = 3 citric acid (20 mL). The organic phase was washed with HO (20 mL), TEAB (20 mL), brine (20 mL), dried over anhydrous NaSO, filtered, and the solvent was removed in vacuo. The crude product was used without further purification. Compound 8.9 was obtained as a yellow solid (MS (m-2H)). + ) / z=807.3, 2.1 g, 75.49% LCMS purity).
[0615] Preparation of Compound 8A To a solution of compound 8.9 (1.43 g, 693.12 umol, 1 equiv) in DCM (12 mL) was added 2,2-dichloroacetic acid (1.13 g, 8.77 mmol, 720.00 uL, 12.65 equiv) under N at 25 °C. The mixture was stirred at 25 °C for 1 h. LCMS (product: RT = 1.168 min) showed complete consumption of the starting material. The mixture was diluted with TEAB (15 mL), DCM (25 mL). The organic phase was washed with HO (20 mL), brine (20 mL), dried over anhydrous NaSO, filtered, and the solvent was removed in vacuo. The crude product was purified by preparative HPLC (neutral conditions) (column: YMC-Actus Triart C18 150*30mm*5um; mobile phase: [TEAB(10mM)-ACN]; B%: 10%-40%, 10 min. Compound 8A[(m-2H + ) / z=879.6, 522 mg, 41.0% yield over two steps, 97.6% purity) was obtained as a white solid and characterized by HPLC and MS (see Figure 30).
[0616] 1.1.1 Coupling conditions during TACC tetramer synthesis: Based on the IPC after the coupling reaction, the conversion of the coupling step was complete. A summary of the coupling step conditions and HPLC purity at various stages is as follows: [Table 24]
[0617] In conclusion, tetrameric oligonucleotides were synthesized using a solution-phase linear extension method with the PSI reagent. Detritylation with DCA resulted in deprunination of adenosines. Detritylation of the trimers was achieved by an acidic workup step using 20% citric acid. As the oligonucleotide lengthened, coupling efficiency decreased. At later coupling stages, additional equivalents of PSI-amidite and DBU were required. The presence of benzyl and isobutyryl protecting groups was not hindered under coupling conditions, particularly with DBU.
[0618] 1.2 Linear elongation of the MOE fragment DMTO-AGUCU-OH using PSI chemistry The synthesis of MOE oligos using PSI reagents has not been reported. We applied PSI chemistry to the coupling reaction of 2'MOE nucleosides and developed a solution-phase synthesis process for the elongation of 2'MOE oligo 8B. [ka]
[0619] Synthesis of Compound 8.2.2 To a solution of compound 8.2.1 (5.00 g, 6.93 mmol, 1 equiv.) and PSI reagent (4.02 g, 9.01 mmol, 1.3 equiv.) in ACN (35 mL) was added DBU (1.37 g, 9.01 mmol, 1.36 mL, 1.3 equiv.) at 0 °C. The mixture was stirred at 25 °C for 0.5 h. TLC (petroleum ether:ethyl acetate = 0:1, Rf = 0.82) showed complete consumption of reactant 8.2.1. The mixture was filtered through a short pad of silica gel, and the silica gel was then washed with EA (80 mL × 2). The filtrate was washed with saturated KH2PO4 (100 mL), saturated NaHCO3 (100 mL), brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by chromatography (SiO2, petroleum ether / ethyl acetate = 30 / 1 to 0 / 1). Compound 8.2.2 [(mH + ) / z=966.4, 5.5 g, 5.51 mmol, 79.55% yield, 97% purity] as a white solid.
[0620] Synthesis of Compound 8.2.4 Compound 8.2.2 (5.00 g, 9.01 mmol, 1 equiv) was azeotroped with ACN (40 mL × 2), and compound 8.2.3 (9.60 g, 9.92 mmol, 1.1 equiv) was coevaporated with ACN (40 mL × 2). To a solution of compound 8.2.2 (5 g, 9.01 mmol, 1 equiv) and compound 8.2.3 (9.60 g, 9.92 mmol, 1.1 equiv) in ACN (35 mL) was added DBU (4.12 g, 27.04 mmol, 4.08 mL, 3 equiv) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS showed that compound 8.2.2 was completely consumed. The mixture was diluted with EA (150 mL) and 20% citric acid (80 mL). The organic layer was washed with saturated NaHCO3 (150 mL), HO (150 mL), brine (150 mL x 2), dried over anhydrous Na2SO4, filtered, and the solvent was removed in vacuo. The crude product was used in the next step without further purification. Compound 8.2.4 [(mH + ) / z=1353.6, 12.21 g, crude] as a yellow solid.
[0621] Synthesis of Compound 8.2.5 To a solution of compound 8.2.4 (12.21 g, 9.01 mmol, 1 equiv) in DCM (85 mL) at 25 °C was added 2,2-dichloroacetic acid (8.01 g, 62.10 mmol, 5.1 mL, 6.89 equiv). The mixture was stirred at 25 °C for 1 h. LCMS showed that compound 8.2.4 was completely consumed. TEAB (150 mL) was slowly added to the mixture and extracted with DCM (150 mL). The organic phase was then washed with saturated aqueous NaHCO (150 mL), HO (150 mL), brine (150 mL), dried over anhydrous NaSO, filtered, and the solvent was removed in vacuo. The crude product was purified by preparative HPLC: Column: Agela DuraShell C18 250*50mm*10um; Mobile phase: [TEAB (10mM)-ACN]; B%: 30%-53%, 22 min. Compound 8.2.5 [(mH + ) / z=1050.5, 6.9 g, 6.36 mmol, 70.57% yield, 97% purity] as a white solid.
[0622] Synthesis of Compound 8.2.7 Compound 8.2.5 (4.50 g, 4.28 mmol, 1 equiv.) was azeotroped with ACN (40 mL × 2), and compound 8.2.6 (5.55 g, 6.42 mmol, 1.5 equiv.) was coevaporated with ACN (40 mL × 2). To a solution of compound 8.2.5 (4.5 g, 4.28 mmol, 1 equiv.) in ACN (30 mL) was added molecular sieves 3A (2.40 g, 4.28 mmol, 1.00 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 hours. Compound 8.2.6 (5.55 g, 6.42 mmol, 1.5 equiv.) was then added at 25 °C. DBU (1.95 g, 12.83 mmol, 1.93 mL, 3 equiv.) was slowly added at 25 °C. The mixture was stirred at 25° C. for 0.5 h. LCMS showed that compound 8.2.5 was completely consumed. The mixture was diluted with DCM (200 mL), pH ∼3 citric acid (150 mL). The organic phase was washed with NaHCO (200 mL), H O (200 mL), brine (200 mL), dried over anhydrous Na SO , filtered, and the solvent was removed in vacuo. The crude product was used in the next step without further purification. Compound 8.2.7 (9.3 g, crude) was obtained as a yellow solid.
[0623] Synthesis of Compound 8.2.8 To a solution of compound 8.2.7 (7.48 g, 4.28 mmol, 1 equiv) in DCM (60 mL) at 25 °C was added 2,2-dichloroacetic acid (7.85 g, 60.88 mmol, 5 mL, 14.23 equiv). The mixture was stirred at 25 °C for 1 h. LCMS showed that compound 8.2.7 was completely consumed. The mixture was diluted with DCM (150 mL) and quenched with TEAB (150 mL). The organic phase was washed with NaHCO (150 mL), HO (150 mL), brine (150 mL), dried over anhydrous NaSO, filtered, and the solvent was removed in vacuo. The crude product was triturated with TBME (250 mL), then filtered, and the solid was washed with TEAB. The crude product was purified by preparative HPLC: Column: YMC-Triart Prep C18 250*50mm*10um; Mobile phase: [TEAB(10mM)-ACN]; B%: 25%-48%, 22 min. Compound 8.2.8 [(mH + ) / z=1444.5, 3.3 g, 2.21 mmol, 51.74% yield, 97% purity] as a yellow solid.
[0624] Synthesis of Compound 8.2.10 Compound 2.18 (3.3 g, 2.28 mmol, 1 equiv.) was azeotroped with ACN (20 mL × 2), and compound 8.2.9 (3.29 g, 3.42 mmol, 1.5 equiv.) was coevaporated with ACN (20 mL × 2). To a solution of compound 8.2.8 (3.3 g, 2.28 mmol, 1 equiv.) in ACN (20 mL) was added molecular sieves 3A (1.6 g, 2.28 mmol, 1 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Then, compound 8.2.9 (3.29 g, 3.42 mmol, 1.5 equiv.) and DBU (1.74 g, 11.41 mmol, 1.72 mL, 5 equiv.) were added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS showed that compound 8.2.8 was completely consumed. The mixture was diluted with DCM (50 mL), 20% citric acid (50 mL). The organic phase was washed with TEAB (50 mL), dried over anhydrous Na2SO4, filtered, and the solvent was removed in vacuo. The crude product was purified by preparative HPLC: Column: Agela DuraShell C18 250*50 mm*10 um; Mobile phase: [TEAB (10 mM)-ACN]; B%: 15%-45%, 22 min. Compound 8.2.10 [(m-2H + ) / z=967.1, 3.1 g, 1.54 mmol, 67.38% yield, 96% purity) as a white solid.
[0625] Synthesis of Compound 8.2.12 Compound 8.2.10 (2.1 g, 1.08 mmol, 1 equiv.) was azeotroped with ACN (20 mL x 2), and compound 8.2.11 (2.12 g, 2.17 mmol, 2 equiv.) was coevaporated with ACN (20 mL x 2). To a solution of compound 8.2.10 (2.1 g, 1.08 mmol, 1 equiv.) in ACN (14 mL) was added molecular sieves 3 Å (1.2 g, 1.08 mmol, 1 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Next, compound 8.2.11 (2.12 g, 2.17 mmol, 2 equiv.) and DBU (495.42 mg, 3.25 mmol, 490.51 uL, 3 equiv.) were added at 25 °C. The mixture was stirred at 25 °C for 0.5 h. LCMS showed that compound 8.2.10 was completely consumed. The mixture was filtered through 3A MS and the filter cake was washed with ACN (5 mL). The crude product was purified by preparative HPLC (Column: YMC-Triart Prep C18 250*50 mm*10 um; Mobile phase: [TEAB (10 mM)-ACN]; B%: 18%-50%, 22 min. Compound 8.2.12 [(m-2H + ) / z=1371.8, 1.92 g, 678.28 umol, 62.53% yield, 97% purity] was obtained as a white solid and characterized by HPLC and LCMS (see Figure 31).
[0626] Synthesis of compound 8B To a solution of compound 8.2.12 (0.18 g, 65.56 umol, 1 eq) in THF (2 mL) was added TBAF (1 M, 196.67 uL, 3 eq) at 25 °C. The mixture was stirred at 25 °C for 24 h. LCMS showed that compound 8.2.12 was completely consumed. The mixture was washed with TEAB (10 mL), diluted with DCM (10 mL), dried over anhydrous NaSO, then filtered and concentrated. The crude product was purified by preparative HPLC (column: YMC-Actus Triart C18 150*30 mm*5 um; mobile phase: [TEAB (10 mM)-ACN]; B%: 30%-60%, 12 min). Compound 8B [(m-3H +) / z=834.8, 0.124 g, 47.48 umol, 72.42% yield, 96% purity) was obtained as a white solid and characterized by HPLC and LCMS (see Figure 32).
[0627] 1.2.1 MOE fragment coupling conditions Based on the IPC after the coupling reaction, the conversion of the coupling step was complete. A summary of the coupling step conditions and HPLC purity at various stages is listed below. [Table 25]
[0628] In conclusion, pentameric oligonucleotides were synthesized using solution-phase linear elongation of 2'-MOE amidites with the PSI reagent. Detritylation with DCA resulted in deprunination of adenosines. Detritylation of the trimers was achieved by an acidic workup step using 20% citric acid. As with deoxyoligonucleotide elongation, coupling efficiency decreases as the oligonucleotide grows longer. The later coupling steps require the addition of equivalents of PSI-amidite and DBU.
[0629] 1.3 Convergent synthesis of fragments. [ka]
[0630] Fragment 8C was synthesized by combining fragments 8A and 8B-2. Fragment 8B-2 was synthesized from 8B-1, the synthesis of which was described above. [ka]
[0631] Synthesis of UdTdTdC fragment 8B-2 The formation of the UdTdTdC fragment was achieved by treating the amine of the tetramer fragment obtained from the amidite chemistry during the synthesis of ASO 9 to cleave the cyanoethyl group, followed by coupling with PSI reagent (10 equiv.) in ACN at 0 °C. Product 8B-2 is highly sensitive to water; if the workup is exposed to air, the product will be hydrolyzed by moisture. [ka]
[0632] Two amines, 2-methylpropan-2-amine and TEA, were screened for cleavage of the cyanoethyl group, and the results are listed in the table below. [Table 26]
[0633] Convergent synthesis of ASO 8C [ka] Compound 8A (0.05 g, 28.40 μmol, 1 equiv.) was azeotroped with ACN (2 mL * 2). Compound 8B-2 (164.32 mg, 85.19 μmol, 3 equiv.) was azeotroped with ACN (2 mL * 2). To compound 8B-2 in ACN (0.1 mL) was added molecular sieves 3 Å (0.015 g, 1.00 equiv.) at 25 °C. The mixture was stirred at 25 °C for 0.5 h. Compound 8A (0.05 g, 28.40 μmol, 1 equiv) was premixed with DBU (30.26 mg, 198.78 μmol, 29.96 μL, 7 equiv) in ACN (0.2 mL) to form a mixture, and then the above mixture was added dropwise to compound 8B-2 (164.32 mg, 85.19 μmol, 3 equiv) in ACN (0.1 mL) at 25 °C under Ar. The mixture was stirred at 25 °C for 0.5 h. LCMS and HPLC showed that the starting material was consumed by more than 90%. The reaction mixture was filtered. The mixture was purified by preparative HPLC (neutral condition, column: Phenomenex Gemini-NX 80*30 mm*3 μm; mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 25%-55%, 7 min). Compound 8C [(m-4H + ) / z=879.4, 40.0 mg, 9.77 umol, 34.4% yield, 86% purity] was obtained as a white solid and characterized by HPLC and LCMS (see Figure 33).
[0634] In conclusion, PSI chemistry was successfully applied to the solution-phase synthesis of deoxy tetramers and 2'-MOE pentamers, as well as the convergent solution-phase synthesis of stereocontrolled ASOs. Convergent coupling reactions are highly sensitive to moisture. To ensure high conversion rates, pre-azeotroping HO with ACN is necessary. Furthermore, the concentration of DBU is critical for the conversion yield, with 0.64 M (10% by volume of DBU to ACN), as recommended for high conversion.
[0635] Example 9. Deprotection of full-length ASO products [ka]
[0636] First, the cyanoethyl group was deprotected by dissolving 64 grams of protected ASO 9 in 640 ml of a 1:1 CH3CN:Et3N solution. After stirring the mixture at 25 °C for 2 hours, the solvent was removed using a rotovap. The crude product was carried on to the next step for deprotection of the LHPG and amine protecting groups. 500 ml of concentrated NH3 / HO was added to the crude mixture, and the reaction mixture was stirred at 25 °C until the solid was completely dissolved (approximately 20–30 min). After dissolving the solid in NH3 / HO, the mixture was transferred to a 1 L glass pressure flask and then heated at 65 °C for 5 hours. The reaction mixture was cooled to room temperature, and the deprotected ASO 9 was ready for downstream purification. This procedure deprotected all protecting groups on ASO 9 (except 5'-DMTr). The DMTr group was removed after downstream HIC purification. The present invention provides, for example, the following items. (Item 1) Compounds of formula (AI): [ka] 1. A liquid phase process for preparing a compound of formula (AII): [ka] or a salt thereof, wherein said deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, wherein: R 1 is, for each occurrence, independently a nucleobase, wherein the NH of said nucleobase, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 independently selected from the group consisting of alkoxy, C 1-6 optionally substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2forming a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; Z is 0 or an integer from 1 to 200, X, for each occurrence, is independently O or S; and the solution phase process wherein Y is a hydrophobic hydroxyl protecting group comprising an alkyl chain. (Item 2) R 15 Item 2. The process according to item 1, wherein is a 4,4'-dimethoxytrityl group. (Item 3) 3. The method according to item 1 or 2, wherein the deprotection reaction is carried out in the presence of a drying agent. (Item 4) 4. The method of claim 3, wherein the desiccant is a molecular sieve. (Item 5) 5. The process of claim 4, wherein the molecular sieve has a size of 3 Å. (Item 6) 3. The process according to item 1 or 2, wherein the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation before the deprotection reaction. (Item 7) 7. The process according to any one of items 1 to 6, wherein the deprotection reaction is carried out in the presence of a cation scavenger comprising an -SH group, a silane group, a siloxane group, a polystyrene group, a furan, a pyrrole, or an indole. (Item 8) 8. The process of claim 7, wherein the cation scavenger is a compound of the formula RSH, where R is an alkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl group, each of which is optionally substituted. (Item 9) RSH is CH3(CH2)5SH, CH3(CH2) 11 Item 9. The process according to item 8, wherein methyl is methyl SH, cyclohexanethiol, CH3CH2OC(=O)CH2CH2SH. (Item 10) 10. The process according to any one of items 1 to 9, wherein the deprotection reaction is carried out by reacting the compound of formula (AII) with a detritylation reagent. (Item 11) 11. The process of claim 10, wherein the detritylation reagent is a strong organic acid. (Item 12) Item 13. The process of item 10, wherein the detritylation reagent is CF3COOH, CCl3COOH, CHCl2COOH, CH2ClCOOH, H3PO4, methanesulfonic acid, benzenesulfonic acid, CClF2COOH, CHF2COOH, or PhSO2H. Item 12. The process of item 11, wherein the detritylation reagent is CH2ClCOOH. (Item 14) Item 11. The process according to item 10, wherein the detritylation reagent is CF3COOH or CHCl2COOH. (Item 15) 15. The process according to any one of items 1 to 14, wherein Y is a compound of the formula: [ka] is expressed as In the formula, X is C 1-10 alkyl, where one or more CH groups are independently C(O), C(O)NH, cycloalkyl, or C 1-6 heterocyclyl group; and X1 is C 1-25 Alkyl or C 1-25The process wherein the alkoxy group is alkoxy. (Item 16) Item 16. The process according to item 15, wherein Y is represented by the following formula: [ka] (Item 17) 17. The process according to any one of items 1 to 16, Each R 2 are independently mj, k, H, F or C 1-4 Alkoxy, optionally C 1-4 substituted with alkoxy; R 4 is H; and R 16 is —CH 2 CH 2 CN. (Item 18) 18. The process according to any one of items 1 to 17, wherein the compound of formula (AI) is not purified by chromatography. (Item 19) 18. The process according to any one of items 1 to 17, wherein the compound of formula (AI) is purified by selective precipitation and / or extraction. (Item 20) an oligonucleotide fragment of formula (I), [ka] 1. A liquid phase process for preparing a compound selected from the group consisting of: 1) A compound of formula (I'A): [ka] or a salt thereof, to give a compound of formula (IA): [ka] or forming a salt thereof; 2) reacting the compound of formula (IA) or a salt thereof with a compound of formula (A1): [ka] or a salt thereof to give a compound of formula (IB): [ka] or forming a salt thereof; 3) sulfurizing or oxidizing the compound of formula (IB) or a salt thereof with a sulfurizing agent or an oxidizing agent to obtain a compound of formula (IC): [ka] or forming a salt thereof; 4) deprotecting the compound of formula (IC) or salt thereof to obtain a compound of formula (ID): [ka] or forming a salt thereof; 5) starting from said compound of formula (ID), repeating steps 2), 3) and 4) n-2 times to produce said fragment of formula (I) or a salt thereof, wherein: R 1 is, for each occurrence, independently a nucleobase, wherein the NH of said nucleobase, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forming a ring with the alkoxy group; R 15is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; n is an integer from 2 to 20; X, for each occurrence, is independently O or S; The liquid phase process wherein Y is a hydrophobic hydroxyl protecting group comprising an alkyl chain. (Item 21) 21. The process according to item 20, wherein the fragment of formula (I) is not purified by chromatography. (Item 22) 22. The process according to item 21, wherein the fragment of formula (I) is purified by selective precipitation and / or extraction. (Item 23) 23. The process of any one of items 20 to 22, wherein chromatography is not used to purify the reaction product of any one of steps 1), 2), 3) and 4). (Item 24) 24. The process according to any one of items 20 to 23, wherein the reaction product of any one of steps 1), 2), 3) and 4) is purified by selective precipitation. (Item 25) 25. The process according to any one of items 20 to 24, wherein Y is [ka] The process wherein (Item 26) 26. The process according to any one of items 20 to 25, wherein any one of the deprotection reactions of step 1) and step 4) is carried out as defined in items 2 to 14. (Item 27) 1. A convergent liquid phase process for preparing target oligonucleotides, comprising the steps of: a) an oligonucleotide fragment of formula (I): [ka] or a salt thereof, Oligonucleotide fragment of formula (II): [ka] or a salt thereof, Coupling in solution to give an oligonucleotide of formula (III): [ka] or forming a salt thereof; b) sulfurizing or oxidizing the oligonucleotide of formula (III) or a salt thereof to obtain an oligonucleotide of formula (IV): [ka] or a salt thereof, During the ceremony: R 1 is, for each occurrence, independently a nucleobase, wherein the NH of said nucleobase, if present, is protected by an amine protecting group; R 2 For each occurrence of H, halo, and C 1-6 alkoxy, and optionally C 1-6 substituted with alkoxy; R 4 is, for each occurrence, independently H or R 2 forming a ring with the alkoxy group; R 15 is a hydroxyl protecting group; R 16 For each occurrence, independently, C 1-6 Alkyl group, C 2-6 an alkenyl group, a phenyl group, or a benzyl group, each of which is optionally substituted with —CN, —NO2, or a halogen; or R 16 teeth [ka] and; R 17a and R 17b is independently C 1-6 is alkyl; n is an integer from 2 to 200; m is an integer from 2 to 20; X, for each occurrence, is independently O or S; the convergent liquid phase process wherein Y is a hydrophobic hydroxyl protecting group comprising an alkyl chain. (Item 28) Item 27, the process according to item 27, comprising the step of: [ka] or a salt thereof, Oligonucleotide fragment of formula (Ia2): [ka] or a salt thereof in solution to form said oligonucleotide fragment of formula (I) or a salt thereof. (Item 29) 29. The process according to item 27 or 28, wherein n is an integer from 3 to 20. (Item 30) 29. The process according to item 27 or 28, wherein n is 3 to 6. (Item 31) 29. The process according to item 27 or 28, wherein n is 5. (Item 32) The process according to any one of items 27 to 31, further comprising deprotecting the oligonucleotide of formula (IV) or a salt thereof to obtain an oligonucleotide of formula (V): [ka] or a salt thereof. (Item 33) Item 33. The process according to item 32, further comprising: d) reacting said oligonucleotide of formula (V), or a salt thereof, with an oligonucleotide fragment of formula (II'): [ka] or a salt thereof, Oligonucleotide of formula (VI): [ka] or a salt thereof; and e) sulfurizing or oxidizing said oligonucleotide of formula (VI) to form an oligonucleotide of formula (VII): [ka] or a salt thereof; and f) deprotecting the oligonucleotide of formula (VII) or a salt thereof to obtain an oligonucleotide of formula (VIII): [ka] or a salt thereof; and g) Repeating steps d), e) and f) r-1 times, followed by repeating steps d) and e) to obtain an oligonucleotide of formula (IX): [ka] or a salt thereof, During the ceremony, r is an integer from 1 to 50; p i is, for each occurrence, independently an integer from 2 to 20; i is an integer from 1 to r; and [ka] The process wherein (Item 34) Item 34. The process according to item 33, wherein r is 2 and the oligonucleotide of formula (IX) is represented by formula (X): [ka] wherein p1 and p2 are each independently an integer from 2 to 20. (Item 35) 35. The process of any one of items 27 to 34, wherein chromatography is not used to purify the reaction product of any one of steps a), b), c), d), e), f) and g). (Item 36) 36. The process of any one of items 27 to 35, wherein the reaction product of any one of steps a), b), c), d), e), f) and g) is purified by extraction or selective precipitation. (Item 37) 37. The process according to any one of items 33 to 36, further comprising the steps of: h1) deprotecting said oligonucleotide (IX) or (X) or a salt thereof to obtain an oligonucleotide of formula (IXA) or (XA): [ka] or a salt thereof. (Item 38) Item 38. The process according to item 37, wherein the method comprises the following steps: h2) deprotecting said oligonucleotide (IXA) or (XA) to obtain an oligonucleotide of formula (IXB) or (XB): [ka] or a salt thereof, optionally reacting said oligonucleotide (IXA) or (XA) with citric acid to form said oligonucleotide of formula (IXB) or (XB). (Item 39) Item 37. The process according to item 37, wherein R 16 is —CHCHCN, deprotection of the oligonucleotide (IX) or (X) or a salt thereof provides an oligonucleotide of formula (IXAb) or (XAb): [ka] or a salt thereof is formed. (Item 40) Item 39. The process according to item 39, wherein the method comprises the following steps: The oligonucleotide (IXAb) or (XAb) or a salt thereof is deprotected to obtain an oligonucleotide of formula (IXBa) or (XBa): [ka] or a salt thereof, optionally reactin...
Claims
[Claim 1] The invention described in this specification.
Citation Information
Patent Citations
Hydrophobic group-linked nucleoside, hydrophobic group-linked nucleoside solution and method of synthesizing hydrophobic group-linked oligonucleotide
JP2010275254A
Method for synthesizing oligonucleotide using highly dispersible liquid phase support
JP2012111728A
Method for preparing oligonucleotides
WO2004013154A1
Method for producing oligonucleotide
WO2012157723A1
Oligonucleotide synthesis method using highly dispersible liquid-phase support
WO2013179412A1