Kits and methods for detecting cancer-related mutations

Abstract

To provide improved methods and kits for detecting cancer-related mutations in DNA samples, which are cost-effective and characterized by high specificity and sensitivity.SOLUTION: Provided is a method for detecting a cancer-related mutation in a DNA sample, the method comprising: (a) subjecting the DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying from the restriction endonuclease-treated DNA a restriction locus comprising a cancer mutation site and a control locus, thereby generating an amplification product for each locus, (c) calculating a ratio between signal intensities of the amplification products of the restriction locus and the control locus; and (d) detecting the cancer-related mutation in the DNA sample by comparing the ratio calculated in the step (c) to a predefined threshold ratio.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to the detection of cancer-associated mutations in DNA samples using enzymatic restriction and real-time PCR. [Background technology]

[0002] Cancer is associated with alterations in genes encoding various cellular molecules. The range of cancer mutations is diverse in type, number, and functional impact. Examples include single-base changes, deletions, and alternative splicing or translocations. Specific mutations are associated with one or more types of cancer, and mutated gene products are associated with the biology of cancer.

[0003] Mutational profiles of tumor DNA are important for patient management, including diagnosis, prognosis, and treatment decisions. However, detecting cancer-associated mutations in a clinical setting is challenging because clinical samples typically contain only low abundance of mutated tumor genes within a large abundance of normal genes. Detecting cancer-associated mutations is particularly challenging when analyzing circulating tumor DNA (ctDNA) in plasma samples. Therefore, highly sensitive and specific assays are needed.

[0004] Currently, most genetic variant clinical trials are performed using techniques such as allele-specific polymerase chain reaction (PCR), Sanger dideoxy sequencing, pyrosequencing, multiplex ligation-dependent probe amplification (MLPA), and mass spectrometry (MS). New next-generation sequencing (NGS) technologies, also known as massively parallel sequencing, are emerging. NGS allows for the amplification and sequencing of numerous sequences simultaneously. However, this technology is currently expensive and complex for routine clinical trials.

[0005] Jenkins et al. (1999) provide an overview of a methodology, termed the restriction site mutagenesis assay, for detecting mutations at ubiquitous restriction enzyme sites in Mutagenesis, 14(5):439-48. Briefly, DNA mutations at ubiquitous restriction enzyme sites abolish the ability of a restriction enzyme to recognize a specific DNA target sequence. Thus, wild-type DNA is recognized and cleaved by the restriction enzyme, whereas DNA containing a mutation at the restriction enzyme site is not recognized by the enzyme, remains undigested, and serves as a substrate for subsequent PCR amplification. The PCR amplification product is subjected to gel electrophoresis to detect enzyme-resistant bands, i.e., the presence of mutations.

[0006] Jenkins et al. (2002) in Br J Surg. 89(1):8-20 review the use of restriction enzymes to analyze genetic alterations that contribute to cancer progression.

[0007] Ward et al. (1998) reported an enriched PCR strategy in Am J Pathol., 153(2):373-379, in which the BstNI restriction enzyme and Taq polymerase were used simultaneously to amplify mutant K-ras while inhibiting the formation of wild-type products. This restriction endonuclease-mediated selective PCR assay uses three sets of primers in combination with BstNI in a reaction mix, and the amplified products are analyzed by gel electrophoresis.

[0008] Asano et al. (2006) in Clin Cancer Res, 43:12(1), 43-48, report the development of a PCR-based assay for mutations in EGFR exons 19 and 21 and for detecting EGFR mutations in clinical samples, including specimens from biopsies, pleural effusions, and surgically resected tissues of patients with non-small cell lung cancer (NSCLC).

[0009] Zhao et al. (2013) reported in Int. J. Cancer, 132, 2858-2866, that PCR combined with restriction endonuclease digestion (known as real-time digestion PCR, or RTD-PCR) allows for the detection of somatic mutations in a small number of cells in a single reaction tube. The PCR mixture contains a thermostable restriction enzyme that digests wild-type alleles during the PCR program, allowing selective amplification of mutant alleles.

[0010] WO2013 / 181276 discloses compositions and methods for detecting rare nucleic acid mutations in a plurality of nucleic acid molecules, and also discloses a method for determining the size of the nucleic acid molecules using droplet digital PCR.

[0011] Previously described methods suffer from the drawbacks that some are laborious and expensive, others have insufficient sensitivity and / or specificity, and lack quantitative data or require complex processing and calibration to provide quantitative data.

[0012] There is a need for improved methods and kits for detecting cancer-associated mutations in DNA samples that are easy to operate, cost-effective, and characterized by high specificity and sensitivity. Summary of the Invention

[0013] According to some embodiments, the present invention provides a method for detecting cancer-associated mutations in a DNA sample based on selective digestion of wild-type DNA while leaving mutant DNA intact, followed by PCR amplification and analysis of the amplified products. The PCR amplification involves simultaneous amplification of two loci: one that remains intact if a mutation is present, and the other that always remains intact under test conditions and serves as a control. The disclosed method involves calculating the ratio between the signal intensities of the amplified products of these loci and detecting the cancer-associated mutation based on the calculated ratio, resulting in highly accurate mutation detection. The DNA sample may be derived from tumor tissue or a plasma sample. Additionally, a method for determining whether a subject is positive for a cancer-associated mutation is provided.

[0014] In particular, the method disclosed herein detects cancer-associated mutations within restriction enzyme sites. Non-mutated (wild-type) DNA contains a restriction enzyme site and is recognized by the restriction enzyme. Therefore, non-mutated DNA is cleaved upon contact with the restriction enzyme. Mutant DNA alters the restriction enzyme site, preventing the mutant DNA from being recognized by the restriction enzyme. The mutant DNA remains intact upon contact with the restriction enzyme and provides a substrate for subsequent PCR amplification. Subsequent PCR amplification of a locus ("restriction locus") containing the restriction enzyme site containing the mutation position amplifies only the mutant DNA, allowing the presence of the mutation to be determined. To achieve high specificity, only mutation levels above a certain threshold are considered clinically significant. Therefore, it is important to have a quantitative means for determining whether a DNA sample is considered positive for a particular mutation. The present invention advantageously addresses this need by simultaneously amplifying a control locus that does not contain the restriction enzyme recognition sequence and calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus. Different mutation levels result in different signal ratios between the restriction locus and the control locus, with higher signal ratios corresponding to higher mutation levels. According to some embodiments, a threshold signal ratio is determined above which a given DNA sample is identified as positive for a particular cancer-associated mutation.

[0015] Thus, the present invention provides a simple and reliable means for detecting the presence of cancer-associated mutations.

[0016] In some embodiments, the cancer mutation position (mutation site) is naturally found within the recognition sequence of a restriction enzyme (i.e., within natural DNA). In other embodiments, the cancer mutation site is not naturally found within the recognition sequence of a restriction enzyme. According to these embodiments, to detect mutations using the methods disclosed herein, the recognition sequence is artificially introduced by PCR. According to these embodiments, the DNA sample subjected to digestion and further analysis is a PCR product containing the artificially introduced restriction locus. In additional embodiments, the cancer mutation site is naturally found within the recognition sequence of a specific restriction enzyme, but a different restriction enzyme is desirable for use in the methods of the present invention. The recognition sequence of the restriction enzyme of interest can be artificially introduced by PCR, and according to these embodiments, the DNA sample subjected to digestion and further analysis is a PCR product containing the artificially introduced restriction locus.

[0017] In the case of natural DNA and natural restriction loci, suitable loci include those for restriction enzymes that are methylation-insensitive, so that digestion of the DNA is not biased by the presence of methylation.

[0018] Thus, according to one aspect, the present invention provides a method for detecting cancer-associated mutations in a DNA sample, the method comprising: (a) subjecting a DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying a restriction locus containing the cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; (c) calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus; (d) detecting cancer-associated mutations in the DNA sample by comparing the ratio calculated in step (c) with a predefined threshold ratio.

[0019] In some embodiments, a cancer-associated mutation is detected if the calculated ratio exceeds a predefined threshold ratio.

[0020] According to another aspect, the present invention provides a method for identifying a subject as positive for a cancer-associated mutation, the method comprising: (a) subjecting a DNA sample from a subject to digestion with a methylation-insensitive restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying a restriction locus containing the cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; (c) calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus; (d) identifying the subject as positive for the cancer-associated mutation by comparing the ratio calculated in step (c) with a predefined threshold ratio.

[0021] In some embodiments, if the calculated ratio exceeds a predefined threshold ratio, the subject is identified as positive for the cancer-associated mutation.

[0022] In some embodiments, the DNA is derived from tumor tissue.

[0023] In some embodiments, the DNA is derived from plasma.

[0024] In some embodiments, the control locus is a locus that lacks a recognition sequence for the restriction endonuclease.

[0025] In some embodiments, the DNA is naturally occurring DNA, the restriction locus is a naturally occurring restriction locus, and the restriction endonuclease is a methylation-insensitive restriction endonuclease whose recognition sequence comprises the cancer mutation site.

[0026] In some embodiments, the cancer mutation is one whose site is naturally found within a recognition sequence for a methylation-insensitive restriction endonuclease and is selected from the group consisting of an EGFR exon 19 deletion (E747-A750), an EGFR L858 substitution, a P53 H179 substitution, a P53 G154 substitution, a P53 R282 substitution, a P53 R248 substitution, a P53 R249 substitution, and a BRAF V600 substitution, with each possibility representing a separate embodiment of the present invention.

[0027] In some embodiments, the restriction endonuclease is selected from the group consisting of MseI (EGFR exon 19 deletion), MscI (EGFR L858 substitution), FatI (P53 H179 substitution), MspI (P53 G154 substitution, P53 R282 substitution, P53 R248 substitution), HaeIII (P53 R249 substitution), and TspRI (BRAF V600 substitution). Each possibility represents a separate embodiment of the present invention.

[0028] In other embodiments, the cancer mutation site is not naturally found within the recognition sequence of the restriction endonuclease. According to these embodiments, the DNA is a PCR product and the restriction locus is an artificially introduced restriction locus into the DNA by the PCR.

[0029] In some embodiments, the cancer mutation is not naturally found within the recognition sequence of the restriction endonuclease and is selected from the group consisting of a KRAS G12 substitution and an EGFR L858 substitution. In some embodiments, the restriction endonuclease is selected from the group consisting of BstNI (KRAS G12 substitution) and AluI (EGFR L858 substitution).

[0030] In certain embodiments, the cancer mutation is a KRAS G12 substitution, the site of which is not naturally found within the recognition sequence of the restriction endonuclease, and the restriction endonuclease is BstNI. In some embodiments, the control locus is the locus set forth in SEQ ID NO:4.

[0031] In some embodiments, the cancer-associated mutation is selected from the group consisting of a KRAS G12 substitution, an EGFR exon 19 deletion (E747-A750), an EGFR L858 substitution, a P53 H179 substitution, a P53 G154 substitution, a P53 R282 substitution, a P53 R248 substitution, a P53 R249 substitution, and a BRAF V600 substitution. Each possibility represents a separate embodiment of the present invention.

[0032] In some embodiments, step (b) of the method is performed using real-time PCR. In some embodiments, when step (b) is performed using real-time PCR, the method further comprises adding a fluorescent probe to aid in detection of the amplification products of the restriction locus and the control locus.

[0033] In some embodiments, step (b) is performed using real-time PCR, and said calculating the ratio between the signal intensities of the amplification products of said restricted locus and said control locus comprises determining the quantification cycle (Cq) of each locus and calculating 2 (Cq control locus - Cq restricted locus).

[0034] According to a further aspect, the present invention provides a kit for detecting cancer-associated mutations in a DNA sample, the kit comprising: at least one restriction endonuclease for digesting the DNA sample; a plurality of primer pairs for simultaneous amplification of at least one restriction locus containing the cancer mutation site and at least one control locus after digestion with a restriction endonuclease; and a computer-readable medium storing computer software that instructs a computer processor to detect cancer-associated mutations in a DNA sample based on a comparison of the ratio of signal intensities of the restriction locus and the control locus after amplification to a predefined threshold ratio.

[0035] In some embodiments, the computer software instructs the computer processor to perform the steps of determining the signal intensities of the restriction loci and the control loci after amplification thereof, calculating a ratio between the signal intensities of the restriction loci and the control loci, comparing the calculated ratio with a predefined threshold ratio, and outputting whether the DNA sample is positive for a cancer-associated mutation based on the comparison.

[0036] In some embodiments, the kit further comprises a plurality of polynucleotide probes for detecting amplification products of at least one restriction locus and at least one control locus.

[0037] According to a further aspect, the present invention provides a system for detecting cancer-associated mutations in a DNA sample, the system comprising: at least one restriction endonuclease for digesting the DNA sample; a plurality of primer pairs for simultaneous amplification of at least one restriction locus containing the cancer mutation site and at least one control locus after digestion with a restriction endonuclease; and computer software stored on a computer-readable medium that instructs a computer processor to detect cancer-associated mutations in the DNA sample based on a comparison of the ratio of signal intensities of the restriction locus and the control locus after amplification to a predefined threshold ratio.

[0038] In some embodiments, the computer software instructs the computer processor to perform the steps of determining the signal intensities of the restriction loci and the control loci after amplification thereof, calculating a ratio between the signal intensities of the restriction loci and the control loci, comparing the calculated ratio with a predefined threshold ratio, and outputting whether the DNA sample is positive for a cancer-associated mutation based on the comparison.

[0039] These and further aspects and features of the present invention will become apparent from the following detailed description, examples and claims. [Brief explanation of the drawings]

[0040] [Figure 1A] 1A and 1B are exemplary quantitative PCR plots of the BstNI restriction locus containing the KRAS G12 mutation site, and the control locus, showing DNA samples from cancerous lung tissue with G12V mutation (FIG. 1A), G12A mutation (FIG. 1B), or no G12 mutation (FIG. 1C), and DNA samples from normal lung tissue (no G12 mutation) (FIG. 1D). [Figure 1B] 1A and 1B are exemplary quantitative PCR plots of the BstNI restriction locus containing the KRAS G12 mutation site, and the control locus, showing DNA samples from cancerous lung tissue with G12V mutation (FIG. 1A), G12A mutation (FIG. 1B), or no G12 mutation (FIG. 1C), and DNA samples from normal lung tissue (no G12 mutation) (FIG. 1D). [Figure 1C] 1A and 1B are exemplary quantitative PCR plots of the BstNI restriction locus containing the KRAS G12 mutation site, and the control locus, showing DNA samples from cancerous lung tissue with G12V mutation (FIG. 1A), G12A mutation (FIG. 1B), or no G12 mutation (FIG. 1C), and DNA samples from normal lung tissue (no G12 mutation) (FIG. 1D). [Figure 1D] 1A and 1B are exemplary quantitative PCR plots of the BstNI restriction locus containing the KRAS G12 mutation site, and the control locus, showing DNA samples from cancerous lung tissue with G12V mutation (FIG. 1A), G12A mutation (FIG. 1B), or no G12 mutation (FIG. 1C), and DNA samples from normal lung tissue (no G12 mutation) (FIG. 1D). DETAILED DESCRIPTION OF THE INVENTION

[0041] The present invention relates to the detection of mutations, particularly cancer-associated mutations, in DNA samples using enzymatic restriction and real-time PCR.The present invention involves calculating the signal intensity ratio between the restriction locus containing the mutation site (for example, cancer mutation site) and the control locus co-amplified from the tested DNA sample after digesting DNA with a restriction enzyme.Based on the signal intensity ratio, the tested sample is identified as positive or negative for mutations (for example, cancer-associated mutations).

[0042] Ratios of signal intensities are calculated between loci amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions), making the methods disclosed herein insensitive to various "noise" factors such as variations in template DNA concentration, PCR conditions, and the presence of inhibitors.

[0043] Advantageously, according to some embodiments, the method of the present invention is carried out without separating and / or sequencing PCR products. The method of the present invention detects mutations easily with high specificity and sensitivity.

[0044] Furthermore, the present invention provides a simple means for identifying cancer-associated mutations, which can be easily integrated into existing methods for cancer diagnosis, simultaneously providing disease diagnosis and information, such as information that can assist in selecting appropriate treatments and determining disease prognosis. More specifically, the methods of the present invention may be integrated into cancer diagnostic methods, such as those described in the applicant's co-pending application for lung cancer diagnosis and the co-pending application for bladder cancer diagnosis. The methods disclosed herein involve identifying cancer based on changes in DNA methylation at selected genomic loci. These methods include digesting a DNA sample from a tested subject using a methylation-sensitive restriction endonuclease, co-amplifying at least one differentially methylated restriction locus and a control locus between cancer and normal DNA, and calculating a ratio of the signal intensities of the restriction and control loci. Cancer is identified by comparing the calculated ratio with a reference ratio. Advantageously, the method of the present invention is based on the same steps of DNA digestion followed by amplification, signal intensity determination, and ratio calculation, and can be easily performed in parallel with these diagnostic methods to provide diagnosis and information regarding mutation status. For example, the detection of lung cancer-associated mutations according to the present invention can be performed in parallel with the aforementioned method for diagnosing lung cancer, and can provide information on whether the tested subject has lung cancer and whether the subject has one or more mutations that make the subject more susceptible to a particular treatment and / or affect the subject's prognosis.

[0045] In some embodiments, provided herein are methods for detecting cancer-associated mutations in a DNA sample, the methods including: (a) subjecting a DNA sample to digestion with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying a restriction locus containing a cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; (c) calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus; and (d) determining whether the calculated ratio is above or below a predefined threshold ratio, thereby detecting a cancer-associated mutation in the DNA sample.

[0046] In some embodiments, the present invention provides a method for generating a mutation profile in a DNA sample, the method comprising: (a) digesting a DNA sample with a restriction endonuclease to obtain restriction endonuclease-treated DNA; (b) co-amplifying a restriction locus containing a cancer mutation site and a control locus from the restriction endonuclease-treated DNA, thereby generating an amplification product for each locus; and (c) calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus. In some embodiments, the method further comprises determining whether the calculated ratio is above or below a predetermined threshold ratio, thereby generating a mutation profile in the DNA sample.

[0047] In some embodiments, the method comprises detecting a mutation based on the ratio between the signal intensities of the amplification products of the restriction locus and the control locus.

[0048] In some embodiments, the method comprises detecting whether a mutation is present by calculating a ratio between the signal intensities of the amplification products of the restriction locus and the control locus, and detecting a signal ratio above a predefined threshold ratio.

[0049] Biological sample collection and processing The analyzed DNA may be derived from tumor tissue (solid tumors). The analyzed DNA may be derived from a plasma sample.

[0050] Terms such as "DNA from," "DNA derived from," or "DNA originating from" refer to DNA obtained from a biological sample, such as a tumor sample or a blood (plasma) sample. These terms also encompass naturally occurring DNA, i.e., DNA found in a biological sample, and PCR products generated from naturally occurring DNA, such as PCR products containing artificially introduced restriction loci.

[0051] Tumor and / or plasma samples can be collected from the subject using conventional methods.

[0052] As used herein, the term "subject" is interchangeable with "individual" and typically refers to a human subject. The subject may be a cancer patient or suspected of having a cancer associated with a particular mutation. In some embodiments, the subject may be at risk for developing a cancer associated with a particular mutation, for example, based on family history.

[0053] DNA may be extracted from the biological sample according to methods known in the art.

[0054] In some embodiments, when cancer-associated mutations are naturally found within the restriction loci of methylation-insensitive restriction enzymes, native DNA obtained from biological samples can be used for analysis of mutation status.

[0055] In another embodiment, when an artificial restriction locus is introduced, the natural DNA obtained from the biological sample is subjected to PCR to introduce the restriction locus before analyzing the mutation status. In particular, PCR amplification of the locus containing the cancer mutation site using mismatched primers is performed to introduce the artificial restriction locus. An exemplary procedure is illustrated below.

[0056] DNA digestion According to the method of the present invention, DNA from a biological sample or a PCR product generated from DNA from a biological sample is subjected to digestion with a restriction endonuclease.

[0057] In some embodiments, the whole DNA extracted from a biological sample or generated by PCR is used in the digestion step. In some embodiments, the DNA is not quantified before being subjected to digestion. In other embodiments, the DNA is quantified before being digested.

[0058] "Restriction endonucleases," used interchangeably herein with "restriction enzymes," refer to enzymes that cut DNA at or near specific recognition nucleotide sequences known as restriction sites.

[0059] A "methylation-insensitive" or "methylation-independent" restriction endonuclease is a restriction endonuclease whose activity is not affected by or independent of the presence of methylation. In other words, a methylation-insensitive restriction endonuclease cleaves a restriction site regardless of its methylation state.

[0060] The selection of the restriction endonuclease used by the method of the present invention depends on the nucleotide sequence at or near the position of the cancer-associated mutation to be detected.In some embodiments, if the mutation position is naturally found within the recognition sequence of the methylation-insensitive restriction endonuclease, this methylation-insensitive restriction endonuclease can be used.Digestion can be performed on natural DNA from biological samples.

[0061] In other embodiments, for example, if the mutation position is not within the recognition sequence of a methylation-insensitive restriction endonuclease, the restriction endonuclease can be selected based on technical criteria, such as its ability to function at high temperatures, and an appropriate recognition sequence can be introduced by PCR using mismatch primers. Preferably, the restriction enzyme is other than a methylation-dependent restriction enzyme. Digestion is performed on the PCR product containing the artificially introduced recognition sequence.

[0062] Amplification of genomic loci As used herein, the terms "genomic locus" or "locus" are interchangeable and refer to a DNA sequence located at a specific location on a chromosome. A specific location can be identified by the location of the molecule, that is, the number of base pairs at the start and end on the chromosome. A variant of a DNA sequence at a specific genomic location is called an allele. Alleles of a locus are located at the same site on homologous chromosomes. A locus includes gene sequences as well as other genetic elements (e.g., intergenic sequences).

[0063] "Restriction locus" is used herein to describe a locus that contains a recognition sequence for a restriction enzyme used in the present methods.

[0064] A "restriction locus containing a cancer mutation site" refers to a restriction locus that contains a position known to be prone to mutation in a particular type of cancer. The cancer mutation site is located within the recognition sequence of the restriction enzyme used in the method. DNA mutations result in the production of mutant proteins, such as proteins in which specific amino acids are substituted with other amino acids or proteins in which one or more amino acids are deleted.

[0065] The term "cancer-associated mutation" refers to a DNA mutation that results in a mutant protein associated with one or more types of cancer. Mutations are typically indicated by the name of the protein, the changed amino acid, and its position (amino acid number) within the protein chain. Substitutions are also typically indicated by the substituted amino acid. Examples of cancer-associated mutations include: KRAS G12 substitutions: for example, G12A, G12C, G12D, G12R, G12S and G12V are associated with cancers such as lung cancer, pancreatic cancer, bladder cancer, colorectal cancer, etc. (reviewed, e.g., in Prior et al. 2012, Cancer Res., 72(10):2457-2467). EGFR exon 19 deletion (E747-A750 deletion): associated with lung cancer, primarily non-small cell lung cancer (NSCLC) (e.g., Lovly et al. 2015, EGFR Exon 19 Deletion in Non-Small Cell Lung Cancer. My Cancer Genome (Updated October 15, 2015)). EGFR L858 substitution: for example, L858R is associated with cancers such as lung cancer, primarily non-small cell lung cancer (NSCLC) (e.g., reviewed in Lovly et al. 2015, EGFR c.2573T>G(L858R) Mutation in Non-Small Cell Lung Cancer. My Cancer Genome (Updated October 15, 2015)). - P53 H179 substitutions: for example, H179R, H179L and H179Y are associated with cancers such as breast cancer, ovarian cancer, and lung cancer (e.g., COSMIC - the Catalogue of Somatic Mutations in Cancer (cancer.sanger.ac.uk) (reviewed in Forbes et al. 2016, Nucleic Acids Research, 45(D1):D777-D783)). - P53 G154 substitutions: for example, G154V and G154S are associated with cancers such as lung cancer, esophageal cancer, liver cancer, etc. (COSMIC ibid.). - P53 R282 substitutions: for example, R282W and R282G are associated with cancers such as intestinal, esophageal, and breast cancer (COSMIC ibid.). - P53 R248 substitution: for example, R248Q is associated with cancers such as colorectal cancer, breast cancer, esophageal cancer, CNS cancer, and lymphoma (COSMIC ibid.). -P53 R249 substitution: for example, R249S is associated with cancers such as liver cancer, lung cancer, and breast cancer (COSMIC ibid.). -BRAF V600 substitutions: for example, V600E is associated with cancers such as thyroid cancer and skin cancer (COSMIC ibid.).

[0066] As used herein, the terms "non-mutated DNA" and "wild-type DNA" refer to the identity of the nucleotide at the cancer mutation site, with "non-mutated" and "wild-type" indicating the presence of a nucleotide that results in translation of the appropriate wild-type protein in vivo.

[0067] The term "mutated DNA" refers to the identity of the nucleotide at the cancer mutation site and indicates that it contains a non-wild-type nucleotide associated with cancer.

[0068] "Control locus" and "internal reference locus" are used interchangeably herein to describe a locus whose digestion by the restriction enzyme applied in the digestion step is independent of the presence or absence of a mutation. Typically, a control locus is a locus that lacks a recognition sequence for the restriction enzyme applied in the digestion step. Advantageously, a control locus is an internal locus, i.e., a locus within the analyzed DNA sample, thus eliminating the need for an external / additional control sample.

[0069] In tissues positive for mutations, more cells contain mutations at this position than in tissues negative for mutations. Restriction enzymes only cleave their recognition sequences in non-mutated DNA if the recognition sequence contains the mutation site. Therefore, DNA samples with a higher proportion of DNA molecules containing mutations will be digested to a lower extent than DNA samples with a higher proportion of non-mutated DNA. Differences in digestion efficiency result in different amplification patterns in the subsequent amplification and quantification steps, making it possible to distinguish between mutation-positive and mutation-negative DNA.

[0070] As used herein, "amplification" refers to an increase in the copy number of one or more specific nucleic acid targets of interest. Amplification is typically carried out by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture known in the art, which may include a DNA template, a polymerase (usually Taq polymerase), dNTPs, primers, and a suitable buffer supplemented with a probe (if necessary).

[0071] As used herein, the term "polynucleotide" includes a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. The term "oligonucleotide" is also used herein and includes a polymeric form of nucleotides, typically up to 100 bases in length.

[0072] "Amplification products" refers collectively to nucleic acid molecules of a specific target sequence that are produced and accumulated in an amplification reaction. This term generally refers to nucleic acid molecules produced by PCR using a predetermined set of amplification primers.

[0073] As used herein, "primer" defines an oligonucleotide that can anneal (hybridize) to a target sequence, thereby generating a double-stranded region that can serve as a starting point for DNA synthesis under suitable conditions.The term "primer pair" refers to a pair of oligonucleotides that are selected to be used together in amplifying a selected nucleic acid sequence by one of several types of amplification processes, preferably PCR.As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0074] As used herein, a "mismatch primer" defines a primer that partially hybridizes to its corresponding target polynucleotide. A mismatch primer includes a complementary portion and a non-complementary portion. The non-complementary portion of a mismatch primer is located at its 3' end and cannot hybridize to the target nucleotide present in the target polynucleotide, and is typically one nucleotide long. Typically, the complementary portion of a mismatch primer is completely complementary to the target polynucleotide. The complementary portion can be of any suitable length. In some embodiments, the complementary portion is at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 15, at least 16, at least 17, at least 18, at least 19, or more than 20 nucleotides long.

[0075] Primers can be any suitable length depending on the specific assay format and specific needs. In some embodiments, primers can be at least 15 nucleotides long, preferably 19 to 25 nucleotides long. Primers can be adapted to be particularly suitable for a selected nucleic acid amplification system. As is generally known in the art, oligonucleotide primers can be designed by considering the melting temperature of their hybridization with their target sequence.

[0076] In some embodiments, restriction and control loci can be amplified from the same DNA sample (digested sample) using pairs of reverse and forward primers designed as known in the art to specifically amplify each locus.

[0077] In some embodiments, primers may be designed to generate amplification products between 75 and 225 bases in length.

[0078] The methods disclosed herein involve the simultaneous amplification of multiple target sequences (restriction and control loci) in the same reaction mixture (a process known as multiplex amplification or coamplification). This process requires the simultaneous use of two primer pairs. As is known in the art, primers can be designed to function at the same annealing temperature during amplification. In some embodiments, primers with similar melting temperatures (Tm) are used in the methods disclosed herein. For primers used in pools, a Tm variation of approximately 3-5°C is considered acceptable.

[0079] In some embodiments, amplification of genomic loci may be performed using real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), which simultaneously amplifies and detects the amplification product.

[0080] In some embodiments, detection of amplification products in RT-PCR can be achieved using polynucleotide probes, typically fluorescently labeled polynucleotide probes.

[0081] As used herein, the terms "polynucleotide probe" and "oligonucleotide probe" refer interchangeably to a labeled polynucleotide that is complementary to a specific subsequence within the nucleic acid sequence of a locus of interest, e.g., within the sequence of a restriction locus or a control locus. In some embodiments, detection is achieved by using a TaqMan assay (Roche Molecular Systems Inc.), which is based on the combination of a reporter molecule and a quencher molecule. In such assays, polynucleotide probes have a fluorescent moiety (fluorophore) attached to their 5' end and a quencher attached to their 3' end. During PCR amplification, polynucleotide probes selectively hybridize to their target sequence on the template, and as the polymerase replicates the template, the 5'-nuclease activity of the polymerase also cleaves the polynucleotide probe. When the polynucleotide probe is intact, the quencher and fluorescent moiety are in close proximity, typically resulting in low background fluorescence levels. When the polynucleotide probe is cleaved, the quencher is separated from the fluorescent moiety, resulting in an increase in fluorescence intensity. The fluorescent signal correlates with the amount of amplification product, ie, the signal increases as amplification product accumulates.

[0082] As used herein, "selectively hybridize" (as well as "selective hybridization," "specifically hybridize," and "specific hybridization") refers to a nucleic acid molecule (such as a primer or probe) preferentially binding, duplexing, or hybridizing to a specific complementary nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions under which a nucleic acid molecule will hybridize preferentially to its target sequence and hybridize to a lesser extent or not at all to other non-target sequences. "Stringent hybridization," in the context of nucleic acid hybridization, is sequence-dependent and will vary under different conditions, as is known in the art.

[0083] Polynucleotide probes may vary in length. In some embodiments, polynucleotide probes may comprise 15-30 bases. In additional embodiments, polynucleotide probes may comprise 25-30 bases. In some embodiments, polynucleotide probes may comprise 20-30 bases, e.g., 20 bases, 21 bases, 22 bases, 23 bases, 24 bases, 25 bases, 26 bases, 27 bases, 28 bases, 29 bases, or 30 bases. Each possibility represents a separate embodiment of the present invention.

[0084] Polynucleotide probe can be designed to bind to either strand of template.Additional considerations include the Tm of polynucleotide probe, and it is preferable that it is compatible with that of primer.Computer software can be used to design primer and probe.

[0085] As mentioned above, the methods disclosed herein involve the simultaneous amplification of multiple target sequences in the same reaction mixture. Polynucleotide probes labeled with different fluorescent colors may be used to distinguish between the multiple target sequences being amplified in parallel.

[0086] In some embodiments, the polynucleotide probes form a fluorophore / quencher pair, as known in the art, examples of which include FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0087] In some embodiments, the dye combination may be compatible with the RT-PCR thermocycler of choice.

[0088] In some embodiments, fluorescence may be monitored during each PCR cycle, providing an amplification plot showing the change in fluorescent signal from the probe as a function of cycle number.

[0089] In the context of RT-PCR, the following terms are used: "Quantification cycle" ("Cq") refers to the cycle number at which fluorescence increases above a threshold set automatically by the software or manually by the user. In some embodiments, the threshold may be constant for all loci or may be set in advance prior to amplification and detection. In other embodiments, the threshold may be defined separately for each locus after a run based on the maximum fluorescence level detected for that locus during an amplification cycle.

[0090] "Threshold" refers to the value of fluorescence used for Cq determination. In some embodiments, the threshold may be a value above baseline fluorescence and / or above background noise, and may be within the exponential growth phase of an amplification plot.

[0091] "Baseline" refers to the early cycles of PCR where there is little or no change in fluorescence.

[0092] Computer software can be used to analyze the amplification plots and determine the baseline, threshold, and Cq.

[0093] After digestion with the restriction enzyme, the DNA molecules are protected from digestion, resulting in high-efficiency amplification of loci mutated by cancer mutation sites. Detectable amplification products are obtained after a relatively small number of amplification cycles, resulting in relatively low Cq values. Conversely, loci not mutated by cancer mutation sites are more severely cleaved during the digestion step, resulting in higher Cq values ​​(i.e., amplification products that become detectable after a relatively large number of amplification cycles) during the amplification and quantification steps.

[0094] In alternative embodiments, amplification and detection of the amplified products can be performed by conventional PCR using fluorescently labeled primers, followed by capillary electrophoresis of the amplified products. In some embodiments, after amplification, the amplified products are separated by capillary electrophoresis, and the fluorescent signal is quantified. In some embodiments, an electropherogram can be generated that plots the change in fluorescent signal as a function of size (bp) or time since injection, with each peak in the electropherogram corresponding to the amplified product of a single locus. The peak height (e.g., given using "relative fluorescence units," rFU) can represent the intensity of the signal from the amplified locus. Computer software can be used to detect the peaks and calculate the fluorescent intensity (peak height) of the set of loci whose amplified products were run on the capillary electrophoresis device, followed by calculating the ratio between the signal intensities.

[0095] DNA samples digested with a restriction enzyme in which the cancer mutation site is mutated will produce a relatively strong signal (higher peak) on the electropherogram, whereas loci in which the cancer mutation site is not mutated will produce a relatively weak signal (lower peak) on the electropherogram.

[0096] In some embodiments, the fluorescent label of the primer comprises any one of fluorescein, FAM, Lissamine, phycoerythrin, rhodamine, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX, JOE, HEX, NED, VIC, and ROX.

[0097] Signal Ratio The term "ratio" or "signal ratio" as used herein refers to the ratio between the intensities of signals obtained from the co-amplification of a pair of genomic loci in a single DNA sample (in the same reaction mixture), in particular the co-amplification of a restriction locus and a control locus.

[0098] As used herein, the term "signal intensity" refers to a measure reflecting the amount of locus-specific amplification product corresponding to the initial amount of intact copies of the locus. However, signal intensity may not indicate the actual amount of amplification product / intact locus, and may not involve any calculation of the absolute amount of amplification product / intact locus. Therefore, when calculating the ratio of amplification product signals, there is no need to calculate the actual DNA concentration itself, and therefore no standard curve or reference DNA is required.

[0099] In some exemplary embodiments, amplification and detection of the amplification products are performed by RT-PCR, and the signal intensity of a particular locus is represented by the Cq calculated for that locus. The signal ratio in this case is represented by the following calculation: 2 (Cq of the control locus - Cq of the limiting locus).

[0100] In some embodiments, when there is no amplification or very little amplification, Cq is determined to be "infinity." In some embodiments, in such cases, the numerical value of the formula (Cq of the control locus - Cq of the restricted locus) is set to (-14), and the signal ratio is set to 1:16384. In additional embodiments, in such cases, the signal ratio is set to 1:16000.

[0101] In additional exemplary embodiments, detection of amplification products is performed by capillary electrophoresis, and the signal intensity of a particular locus is the number of relative fluorescence units (rfu) of its corresponding peak. The signal ratio is calculated by dividing the peak height of the restriction locus by the peak height of the control locus.

[0102] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus in the DNA sample comprises (i) determining the signal intensity of the amplification product of the restriction locus, (ii) determining the signal intensity of the amplification product of the control locus, and (iii) calculating the ratio between the two signal intensities.

[0103] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restricted locus and the control locus in the DNA sample comprises determining the Cq of each locus and calculating the difference between the Cq of the control locus and the Cq of the restricted locus. In some embodiments, the calculation further comprises applying the following formula: 2^(Cq of the control locus - Cq of the restricted locus).

[0104] In some embodiments, computer software can be used to calculate the ratio between the signal intensities of the amplification products.

[0105] Determining mutation status The methods disclosed herein are based on evaluating the signal ratio calculated for a given DNA sample to determine its mutational status, i.e., whether it is positive or negative for a particular cancer-associated mutation.

[0106] In some embodiments, the ratio calculated in the tested sample is compared with reference ratio.In some embodiments, the ratio calculated is compared with threshold ratio.In some embodiments, when the signal ratio calculated is greater than or less than predefined threshold ratio, indicates that DNA is positive for mutation.

[0107] A "threshold ratio" or "cutoff ratio" refers to a signal ratio that distinguishes a population of mutation-negative samples from a population of mutation-positive samples.

[0108] In some embodiments, the lower ratio below the threshold is from a non-mutated sample, e.g., a sample from a normal individual (healthy, i.e., not suffering from cancer), while the higher ratio above the threshold is from a mutated sample, e.g., a cancer patient who is positive for the mutation.

[0109] In some embodiments, determining the threshold ratio involves measuring the signal ratio between a particular pair of restriction and control loci in a large population of subjects (or biological samples) with known mutation status, either mutation-positive or mutation-negative, as determined by other methods. After analyzing the signal ratios in this large sample set, a threshold is set to minimize false positive cases and achieve a desired level of specificity. Preferably, the threshold is set to achieve a specificity of greater than 95%.

[0110] As mentioned above, the signal ratio can be determined by a variety of methods, including, for example, measuring peaks after capillary electrophoresis or calculating Cq after RT-PCR.

[0111] In some embodiments, the methods of the present invention include providing a threshold ratio.

[0112] In some embodiments, the threshold is a statistically significant value. Often, statistical significance is determined by comparing two or more populations and determining a confidence interval (CI) and / or p-value. In some embodiments, a statistically significant value refers to a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while a preferred p-value is less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001 or 0.0001. Each possibility represents a separate embodiment of the present invention. According to some embodiments, the threshold p-value is at most 0.05.

[0113] As used herein, the term "about," when referring to a measurable value, encompasses a variation of + / - 10%, more preferably + / - 5%, even more preferably + / - 1%, and even more preferably + / - 0.1% from the specified value.

[0114] In some embodiments, the sensitivity of the methods disclosed herein may be at least about 75%. In some embodiments, the sensitivity of the methods may be at least about 80%. In some embodiments, the sensitivity of the methods may be at least about 85%. In some embodiments, the sensitivity of the methods may be at least about 90%.

[0115] In some embodiments, the "sensitivity" of a diagnostic assay as used herein refers to the proportion of mutant samples that test positive (the "true positive" rate). Mutant individuals not detected by the assay are therefore "false negatives." Samples that are not mutated and test negative in the assay are referred to as "true negatives." The "specificity" of a diagnostic assay is 1 minus the false positive rate, where the "false positive" rate is defined as the proportion of those that test positive without a mutation. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it is sufficient if the method provides a positive indication that aids in diagnosis.

[0116] In some embodiments, the specificity of the methods disclosed herein may be at least about 65%. In some embodiments, the specificity of the methods may be at least about 70%. In some embodiments, the specificity of the methods may be at least about 75%. In some embodiments, the specificity of the methods may be at least about 80%.

[0117] Kits and Systems In some embodiments, a kit for detecting cancer-associated mutations in a DNA sample is provided. In some embodiments, a system for detecting cancer-associated mutations in a DNA sample is provided.

[0118] In some embodiments, the kits and systems are for detecting cancer-associated mutations according to the methods of the present invention.

[0119] In some embodiments, the kit comprises at least one restriction endonuclease for digesting a DNA sample, and a plurality of primer pairs for simultaneous amplification of at least one restriction locus comprising a cancer mutation site and at least one control locus following digestion with the restriction endonuclease.

[0120] In some embodiments, the kit further comprises a computer-readable medium storing computer software that instructs the computer processor to detect cancer-associated mutations in the DNA sample based on a comparison of the ratio of signal intensities of the restricted loci and the control loci after amplification to a predefined threshold ratio.

[0121] In some embodiments, the system includes at least one restriction endonuclease for digesting a DNA sample; a plurality of primer pairs for simultaneous amplification of at least one restriction locus comprising a cancer mutation site and at least one control locus after digestion with the restriction endonuclease; and computer software stored on a computer-readable medium that instructs a computer processor to detect a cancer-associated mutation in the DNA sample based on a comparison of a ratio of signal intensities of the restriction locus and the control locus after amplification to a predefined threshold ratio.

[0122] In some embodiments, the computer software instructs a computer processor to perform the following steps: determine the signal intensity of each restriction locus and each control locus after their simultaneous amplification; calculate the ratio between the signal intensity of each restriction locus and its corresponding control locus; compare the calculated ratio with a predefined threshold ratio; and output whether the DNA sample is positive for a cancer-associated mutation based on the comparison. In some embodiments, the kit or system includes primers for amplifying a single pair of restriction and control loci to detect the presence of a single cancer-associated mutation. In other embodiments, the kit or system includes primers for amplifying multiple restriction loci and corresponding control loci to detect the presence of multiple cancer-associated mutations.

[0123] In some embodiments, the computer software receives as input parameters or raw data of the real-time PCR run, hi some embodiments, the computer software instructs the computer processor to analyze the real-time PCR run to determine signal intensities and signal ratios.

[0124] Computer software includes processor-executable instructions stored on a non-transitory computer-readable medium. Computer software may also include stored data. The computer-readable medium is a tangible computer-readable medium, such as a compact disc (CD), a magnetic storage device, an optical storage device, a random access memory (RAM), a read-only memory (ROM), or any other tangible medium.

[0125] In some embodiments, the kit comprises a restriction enzyme, a pair of primers for amplifying the restriction locus and the control locus, a means for detecting the amplification products of the restriction locus and the control locus, and instructions for performing the determination of cancer-associated mutations. In some embodiments, the instructions may be electronic instructions.

[0126] In some embodiments, the instructions may provide a threshold signal ratio above which the sample is determined to be mutation positive, hi other embodiments, the instructions may provide a threshold signal ratio below which the sample is determined to be mutation positive.

[0127] In some embodiments, the instructions may include directions for carrying out the method steps described above.

[0128] In some embodiments, the instructions may include directions directing the correlation between signal ratio and mutation status.

[0129] In some embodiments, the instructions may provide directions for calculating the signal ratio.

[0130] In some embodiments, the kit comprises a methylation-insensitive endonuclease.

[0131] In some embodiments, the kit may further comprise computer software, hi some embodiments, the computer software may be computer software that calculates at least one of a signal intensity and a signal ratio.

[0132] In some embodiments, the kit includes fluorescent polynucleotide probes complementary to the restriction locus and the control locus.

[0133] In some embodiments, the kits include primer pairs complementary to the restriction loci and control loci described herein, and fluorescent polynucleotide probes complementary to subsequences within the restriction loci and control loci.

[0134] In some embodiments, the kit includes mismatch primers for introducing artificial restriction loci into the DNA sample.

[0135] In some embodiments, the kit comprises one or more containers filled with at least one nucleotide primer pair, wherein each nucleotide primer pair included in the kits of the invention may comprise a primer complementary to a subsequence within a restriction locus or a control locus, and each nucleotide primer pair is designed to selectively amplify a fragment of the genome that includes the restriction or control locus.

[0136] In some embodiments, the kit may include primer pairs for selectively amplifying combinations of loci described above.

[0137] In some embodiments, the kit may further include oligonucleotide probes for detecting amplification products of loci amplified using the primers in the kit. Each oligonucleotide probe may be complementary to and capable of hybridizing to a subsequence within the locus. In some embodiments, the oligonucleotide probes may be fluorescently labeled.

[0138] In some embodiments, the kit may further include at least one additional component required for DNA digestion, locus amplification, and detection of the amplification product, such as a DNA polymerase and a nucleotide mixture.

[0139] In some embodiments, the kit may further include suitable reaction buffers for digestion and amplification, as well as a written protocol for performing mutation detection. The written protocol may include instructions for performing any of the steps disclosed herein, including, but not limited to, DNA digestion parameters, PCR cycling parameters, signal ratio analysis, and signal ratio thresholds.

[0140] In some embodiments, the kit further comprises materials for DNA extraction from tissue or plasma.

[0141] The following examples are presented to more fully illustrate certain embodiments of the present invention. However, they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art can readily devise numerous variations and modifications of the principles disclosed herein without departing from the scope of the invention. [Example]

[0142] Example 1 - Mutation detection in DNA from solid tissue Lung cancer tumor tissue samples (n=72, including adenocarcinoma, squamous cell carcinoma, and small cell carcinoma) and normal lung tissue samples (n=25) were tested for KRAS G12 mutations by Sanger sequencing and by enzymatic restriction combined with real-time (RT)-PCR according to the present invention.

[0143] DNA was extracted from tissue samples using a QIAamp® DNA Mini Kit. Because the native DNA sequence of KRAS around the G12 codon does not contain a restriction site, 10 cycles of pre-analytical PCR were performed to introduce a BstNI restriction site and modify the sequence using the following primers: Forward 5'-GGATCATATTCGTCCACAAAATG (SEQ ID NO: 1) Reverse 5'-TATAAACTTGTGGTAGTTGGACCT (SEQ ID NO: 2) The amount of DNA for pre-analysis PCR was 4 ng.

[0144] The sequence around the G12 codon before and after introduction of the BstNI restriction site is as follows (nucleotides changed to introduce the restriction site are shown in bold and the introduced restriction site is underlined): TIFF2025157489000001.tif8162TIFF2025157489000002.tif7162

[0145] The modified sequence is expected to be recognized by BstNI and cleaved extensively upon contact with the enzyme. If a mutation is present that changes one or more of the nucleotides G marked in italics, the locus will no longer be recognized or cleaved by BstNI.

[0146] After the introduction of BstNI sites, each DNA sample was subjected to BstNI digestion. The digestion reaction (total volume 50 microliters) contained 40 microliters of PCR product diluted (1:100) in digestion buffer and BstNI. Digestion was carried out at 60°C for 2 hours.

[0147] The digested DNA was subjected to quantitative RT-PCR to amplify the restriction locus containing the G12 codon and a control locus that does not contain the recognition sequence for BstNI and remains intact when the DNA sample is digested with this enzyme.

[0148] Sequence of the restriction locus (G12 codon shown in bold): TIFF2025157489000003.tif15151

[0149] The restriction locus corresponds to positions 25289485 to 25289577 on chromosome 12.

[0150] Control locus sequence: AGCAAGGTGAAGACTAACTTTTCTCTTGTACAGAATCATCAGGCTAAAT TTTTGGCATT ATTTCAGTCC TTGGAGAC (SEQ ID NO: 4).

[0151] The control locus corresponds to positions 121380844 to 121380921 on chromosome 7.

[0152] The amplification reaction (total volume 25 microliters) contained 10 microliters of digested DNA, 0.2 μM primers, dNTPs, and reaction buffer. To allow detection of amplification products during amplification, fluorescently labeled polynucleotide probes were added to the reaction for each locus (FAM and JOE labels for restriction and control loci, respectively). RT-PCR reactions were performed on an ABI 7500 FastDx instrument using the following PCR program: 95°C, 10 min → 45X (95°C, 15 s → 60°C, 1 min).

[0153] Figures 1A-1D show exemplary quantitative PCR plots, showing the change in fluorescent signal from the probe as a function of cycle number. These figures show PCR plots of restriction and control loci in DNA samples derived from cancerous lung tissue with a G12V mutation (Figure 1A), a G12A mutation (Figure 1B), or no G12 mutation (Figure 1C), and in a DNA sample derived from normal lung tissue (no G12 mutation) (Figure 1D).

[0154] In samples containing mutations, the restriction locus was no longer recognized by BstIN and therefore remained largely intact upon digestion with the enzyme, resulting in a highly efficient amplification of the restriction locus, rising at approximately the same cycle as the control locus (which was not cut at all) or 1–3 cycles later.

[0155] In samples without mutations in G12 (cancerous or normal), the restriction locus was significantly cleaved by BstNI, and little amplification was observed (Figure 1C and Figure 1D).

[0156] For each sample, the ratio between the signal intensity of the restriction locus and the signal intensity of the control locus was calculated as follows: The quantification cycle (Cq) was determined for the restriction locus and the control locus. The Cq value was used in the following formula: 2 (Cq of control locus - Cq of restriction locus)

[0157] The number obtained from this calculation represents the signal ratio between the restriction locus and the control locus.

[0158] In Figure 1A, the Cq of the control locus is 28.3 and the Cq of the restricted locus is 27.8, resulting in a signal ratio of 1:0.7, which is significantly higher than the established threshold (1:500, described in more detail below), indicating the presence of a KRAS G12 mutation in the sample.

[0159] In Figure 1B, the Cq of the control locus is 28.5 and the Cq of the restricted locus is 31.3, resulting in a signal ratio of 1:6.9, which is also significantly higher than the threshold, indicating the presence of a KRAS G12 mutation in the sample.

[0160] Figure 1C - The Cq of the control locus is 27.7. Because the restricted locus does not exceed the minimum fluorescence threshold, the Cq cannot be calculated and is determined to be "infinity." In such a case, the signal ratio is set to 1:16,000, significantly lower than the threshold (1:500). Figure 1D shows a similar case, where the Cq of the control locus is 28 and the Cq of the restricted locus is "infinity." Therefore, the signal ratio is 1:16,000. Both samples are determined to be negative for the KRAS G12 mutation.

[0161] result: Sanger sequencing: No KRAS G12 mutations were identified in normal lung tissue samples. 19% of lung cancer tumor tissue samples were found to have KRAS G12 mutations.

[0162] Enzymatic restriction and RT-PCR assay: A signal ratio threshold of 1:500 was set so that a signal ratio between the restriction locus and the control locus higher than 1:500 (e.g., 1:200) indicated the presence of a G12 mutation. To achieve a specificity of over 95%, the signal ratio threshold was set at 1:500 after analyzing a primary set of normal lung and lung tumor tissues. Based on the signal ratio data calculated for each sample, all lung cancer tumor tissue samples found to have a KRAS G12 mutation by sequencing were also identified as having a G12 mutation. No KRAS G12 mutations were identified in normal lung tissue.

[0163] Example 2 - Mutation detection in plasma-derived DNA 105 plasma samples from control patients (without lung cancer) and 99 plasma samples from lung cancer patients were tested for KRAS G12 mutations as described in Example 1 above.

[0164] The signal ratio threshold for plasma-derived DNA was set at 1:1000, such that a signal ratio between the restriction locus and the control locus greater than 1:1000 (e.g., 1:200) indicated the presence of the G12 mutation.

[0165] After testing a primary set of plasma samples from healthy (without lung cancer) and lung cancer patients, a signal ratio threshold of 1:1000 was used to minimize false-positive cases (to obtain a specificity of >95%), assuming that DNA from plasma samples from healthy individuals does not contain the KRAS G12 mutation.

[0166] Six percent of lung cancer plasma samples were identified as G12 mutation-positive.

[0167] 1% of control plasmas were identified as positive for the G12 mutation, indicating that 1% of cases are false positives.

[0168] The foregoing description of specific embodiments fully reveals the general nature of the present invention, so that others, by applying their current knowledge, can easily modify and / or adapt such specific embodiments to various uses without undue experimentation and without departing from the general concept; therefore, such adaptations and modifications should be understood and are intended to be within the meaning and range of equivalents of the disclosed embodiments. It should be understood that the phraseology or terminology used herein is for purposes of description and not limitation. The means, materials, and steps for carrying out the various disclosed chemical structures and functions may take a variety of alternative forms without departing from the invention.

Claims

[Claim 1] The invention described in the specification.

Images