Oligonucleotide for detecting sclerotium cepivorum and detection method using the same

The development of oligonucleotides and primer sets targeting conserved regions of G3PDH, HSP60, and CaM genes in Sclerotium cepivorum enables efficient detection of both group A and group B strains of black rot fungus, overcoming false negatives and soil interference, using the LAMP method for accurate onion disease diagnosis.

JP2025170425AActive Publication Date: 2025-11-18NAT AGRI & FOOD RES ORG +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025146613
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-02-22
Filing Date
2025-09-04
Publication Date
2025-11-18
Estimated Expiration
2042-02-22

AI Technical Summary

Technical Problem

Existing PCR primer sets for detecting black rot fungus of onions are unable to consistently detect both group A and group B strains, leading to false negatives, and soil disinfection methods are costly and labor-intensive, necessitating a more efficient detection method for early-stage infestation.

Method used

Development of oligonucleotides and primer sets targeting conserved regions of the G3PDH, HSP60, and CaM genes in Sclerotium cepivorum, capable of detecting both group A and group B strains, and employing LAMP method for sensitive and accurate detection.

Benefits of technology

The method allows for rapid, sensitive, and accurate detection of black rot fungus in onions, distinguishing between group A and group B strains, and is not inhibited by soil-derived substances, with visual or fluorescent confirmation of results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025170425000001_ABST
    Figure 2025170425000001_ABST
Patent Text Reader

Abstract

To provide an oligonucleotide enabling accurate grasp of the initial onset of Welsh onion white rot and a method for detecting both group A and group B strains of Sclerotium cepivorum.SOLUTION: The detection method according to the present invention uses an oligonucleotide of 15-30 base-length that is capable of annealing to any one region, or a complementary region thereof, selected from gene regions of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat shock protein 60 (HSP60), and calmodulin (CaM) of plant-pathogenic Ascomycota, the region being conserved in both group A and group B strains of Sclerotium cepivorum and exhibiting polymorphisms in Botrytis, Dumontinia, Macrophomina, Sclerotinia, and Sclerotium., Sclerotinia, and Sclerotium.SELECTED DRAWING: Figure 7
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the detection of pathogens of agricultural crops by PCR. [Background technology]

[0002] Welsh onions are cultivated throughout Japan. The main production areas are Saitama, Chiba, Ibaraki, and Gunma prefectures. White onions (long onions and deep-rooted onions) are typically cultivated as "autumn / winter onions" or "spring harvest onions" and shipped from autumn to spring. In recent years, the damage caused by black rot of onions has been increasing. This disease infects the roots from sclerotia of the pathogenic fungus remaining in the soil, then spreads to the stalk and leaf sheath (the edible part of the white onion), and then spreads to neighboring plants. Early onset of the disease causes root rot, resulting in stunted growth and tsubo wilting. Even if the onion survives until harvest, soil mulching (which involves burying the soil up to the bifurcation of the leaf blade to maintain a soft, white leaf sheath) can cause the leaf sheath and stalk to rot and brown. Soil disinfection to inactivate sclerotia in the soil is considered an effective method of controlling black rot of onions.

[0003] The causal agent of this disease is a filamentous fungus (Sclerotium cepivorum, the black rot fungus of leeks) that prefers low temperatures (soil temperatures below 20°C). Therefore, in the case of "autumn-winter leeks" cultivation, infection and disease progress in the soil during the autumn and winter when hilling is performed, making timely control extremely difficult. Furthermore, sclerotia remaining in the soil after harvest can become a source of infection for the next crop, resulting in rapid damage throughout the field within two to three years of the initial outbreak.

[0004] Traditionally, diagnosis and identification of black rot disease in onion involves visual inspection, whereby stunted or dead plants are removed from the field and the condition of the roots and symptoms (black discoloration, presence or absence of sclerotia) are observed. Subsequently, sclerotia formed on infected plants (mainly in the leaf sheaths) are cultured for 2 to 4 weeks, and a definitive diagnosis is made based on cultural characteristics (hyphal growth rate, color and shape of the mycelium) and the appearance of sclerotial formation on the medium. Haq et al. designed PCR primers to amplify the 5.8S rRNA gene and a portion of the nearby ITS region from Sclerotium cepivorum, the causative agent of black rot disease in onion, and provided this as a method for confirming the presence of this bacterium in onions at the early stage of infection (Non-Patent Document 1). Woodhall et al. developed real-time PCR primers targeting the ITS region to detect sclerotia from large amounts of soil (Non-Patent Document 2) and stated that this method is suitable for quantifying the level of Sclerotium cepivorum in soil samples. developed nested PCR primers for highly sensitive detection of domestic outbreak strains (Shizuoka Prefecture) (Non-Patent Document 3). Amselem et al. sequenced the genomes of one strain of Sclerotinia sclerotiorum, a closely related ascomycete fungus to the black rot fungus of leeks, and two strains of Botrytis cinerea, the cause of gray mold, and constructed a phylogenetic tree of five gene loci, including glyceraldehyde-3-phosphate (G3PDH) and heat shock protein 60 (HSP60) (Non-Patent Document 4).

[0005] Regarding the sclerotia of Sclerotium cepivorum, Morikawa et al. reported that there are two types of sclerotial formation on culture media (Non-Patent Document 5). Furthermore, the present inventors performed molecular phylogenetic analysis of HSP60, G3PDH, and calmodulin for Sclerotium cepivorum strains classified into two groups, A and B, based on morphological characteristics, and reported that the results of the molecular phylogenetic analysis were consistent with those of the morphologically classified groups, A and B (Non-Patent Document 6). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Haq MA, Collin HA, Tomsett AB, Jones, MG (2003) Detection of Sclerotium cepivorum within onion plants using PCR primers. Physiological and Molecular Plant Pathology, 62(3), 185-189. [Non-patent document 2] Woodhall JW, Webb KM, Giltrap PM, Adams IP, Peters JC, Budge GE, Boonham N (2012) A new large scale soil DNA extraction procedure and real-time PCR assay for the detection of Sclerotium cepivorum in soil. European Journal of Plant Pathology, 134(3), 467-473. [Non-patent document 3] Iyozumi, H. and Kawabe, M. (2019) Detection of Sclerotium cepivorum Berkeley, the cause of black rot of onion, by nested PCR of the ribosomal DNA-ITS region. Kansai Society of Disease and Insect Research Bulletin, 61: 133-136 [Non-patent document 4] Amselem J et al (2011) Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLos Genetics, 7(8): e1002230. [Non-patent document 5] Morikawa, T., Teranaka, S., Okuda, S., & Natsuaki, T. (1987). Formation of sclerotia and microconidia of Sclerotium cepivorum on culture medium. Bulletin of the Phytopathological Society of Japan, 53(1), Abstracts of the Autumn Meeting of the Kanto Division, 118 [Non-patent document 6] Kataoka, Y., Miyata, S., Kim, Ok-kyung, H. Negishi, and K. Shinohara (2018) New mycelial compatibility groups and molecular phylogenetic analysis of black rot fungi of onion in Japan. Bulletin of the Phytopathological Society of Japan, 84(3), Abstracts of the Annual Meeting of the Phytopathological Society of Japan, 257 Summary of the Invention [Problem to be solved by the invention]

[0007] Inactivation of black rot sclerotinia sclerotia on onion by soil disinfection is difficult to achieve consistently in fields with moderate to high infestations, and soil disinfection treatment, which requires complete coverage, is costly and labor-intensive. For these reasons, a growing-season control system is being established in fields where the disease occurs, in which effective chemicals are irrigated or sprayed during the onion growth period (at planting or during soil mulching), making it possible to reduce damage. In order to utilize this control system more efficiently, it is important to accurately grasp the early stages of infestation.

[0008] Furthermore, it was not clear whether PCR primer sets designed to detect black rot sclerotinia sclerotioides of onion could detect all strains occurring in various regions. According to the inventors' studies, existing primer sets (Non-Patent Documents 1 and 2 cited above) can detect group B of black rot sclerotinia sclerotioides of onion, but gave false negative results for group A. A method that can detect both groups A and B is desired. [Means for solving the problem]

[0009] The present invention provides the following: [1] Any one selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and An oligonucleotide of 15-30 bases in length capable of binding to a region that exhibits polymorphism in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [2] The oligonucleotide of 1, Conserved in the sequences of SEQ ID NOs: 25-30, and an oligonucleotide capable of binding to a region in which a polymorphism is found in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof; Conserved in the sequences of SEQ ID NOs: 51-56, and an oligonucleotide capable of associating with a polymorphic region in a sequence of SEQ ID NO: 31-50, or a complementary region thereof; or Conserved in the sequences of SEQ ID NOs: 77-82, and An oligonucleotide capable of binding to a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof. [3] A primer set capable of amplifying any one selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and A primer set consisting of nucleotides each 15-30 bases long that can associate with regions that exhibit polymorphism in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii. [4] The primer set according to 3, A region of the G3PDH gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 25-30; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 5-24 or a complementary region thereof; A region of the HSP60 gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 51-56; and A primer set capable of associating with a region in which a polymorphism is found in the sequence of SEQ ID NO: 31-50, or a complementary region thereof; or capable of amplifying a region of the CaM gene, conserved in the sequences of SEQ ID NOs: 77-82; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof. [5] The primer set according to 3 or 4, It is capable of amplifying the G3PDH gene region, one primer is capable of binding to a region comprising positions 79 and 82 of the sequence of SEQ ID NO: 27, or a complementary region thereof; A primer set, wherein the other primer is capable of binding to a region including positions 329, 335 and 338 of the sequence of SEQ ID NO: 27, or a complementary region thereof. [6] A primer set described in any one of 3 to 5, wherein one primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence, and the other primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 2 or its complementary sequence. [7] A primer set according to any one of items 3 to 6, for diagnosing black rot of onion. [8] extracting DNA from the sample; performing PCR using the extracted DNA as a template and the primer set according to any one of claims 3 to 7; A step of detecting the PCR amplification product and determining that the pathogen is present in the sample when an amplification product is detected. [9] The method according to 8, wherein the sample is soil, or a plant body or part thereof.

[10] The method according to 8 or 9, further comprising the step of cleaving the PCR amplification product with a restriction enzyme.

[11] The method described in 10, wherein the primer set described in any one of 3 to 7 is used and the restriction enzyme is MspI.

[0010]

[12] The oligonucleotide according to 1 or 2, or the primer set according to any one of 3 to 7, used in the LAMP method.

[13] A kit for diagnosing black rot disease on onion, comprising the oligonucleotide according to 1 or 2, or the primer set according to any one of 3 to 7.

[14] A LAMP primer set for diagnosing black rot disease on onion, comprising the following oligonucleotides (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 or its complementary sequence (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 or its complementary sequence (g) an F3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 85 or its complementary sequence; (h) B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence [Effects of the Invention]

[0011] According to the present invention, group A and group B strains of the black rot fungus of Welsh onion can be detected. According to the present invention, it is possible to specifically detect the black rot fungus of Allium lecithin, distinguishing it from other closely related species. According to the present invention, highly sensitive detection of black rot fungus of leek can be performed. According to the present invention, the onion black rot fungus can be detected in a plant body or a part thereof. According to the present invention, group A and group B strains of the black rot fungus of Welsh onion can be detected separately. According to the present invention, PCR can be used to specifically and sensitively detect all Sc strains occurring in Japan, enabling rapid and highly accurate detection and diagnosis of black rot fungus of onion in onion production fields.

[0012] The method for detecting group A and group B strains of black rot fungus of onion according to the present invention employs the LAMP method using loop primers, and has the following advantages. -Detection results can be confirmed visually by turbidity or fluorescence. -Lower detection limit compared to conventional PCR. Even when diseased tissue with soil attached is used as a sample, detection is possible without being inhibited by soil-derived substances. -It is easy to distinguish whether it is a false positive or not. [Brief explanation of the drawings]

[0013] [Figure 1]Phylogenetic analysis of strains occurring in Japan. A molecular phylogenetic tree is shown using multiple regions of the genome (Hsp60 gene, G3PDH gene, Cal gene). Sclerotium cepivorum (Sc), the fungus that causes black rot of onion, occurring in Japan, is broadly divided into two groups. The characteristics of groups A and B differ in the mycelium colony on artificial media, mycelial compatibility, and sclerotium size. [Figure 2] Alignment of the base sequences of the G3PDH gene region. The underlined region indicates the Sc-specific region (including potential regions). The box indicates the TaqMan sequence. [Figure 3] Alignment of the base sequences of the HSP60 gene region. The underlined regions are specific to Sc (including potential regions). [Figure 4] Alignment of the base sequences of the CaM gene region. The underlined regions are specific to Sc (including potential regions). The boxed regions are specific to group A. [Figure 5] Detection of Sc using previously reported primers. Conventional PCR was performed using the primers of Haq et al. (2003) and total DNA as a template for Sc strains and Sc-related species. Top: PCR was performed on domestic Sc ​​isolates of groups A and B, but group A strains could not be detected. No PCR amplification products were detected in Sc-related species. [Figure 6] Detection of Sc using previously reported primers. Quantitative PCR was performed using the primers described by Woodhall et al. (2012) on total DNA of Sc strains and related species. Sc group B strains were detected, but not group A strains. [Figure 7] Detection of Sc using the primer set of the present example. PCR was newly performed using the total DNA of Sc strains (groups A and B) and related species (strains stored in gene banks) as templates. No related species were detected, but Sc group A and B strains were detected. [Figure 8] The sensitivity of Sc-specific detection using the primer set ScG3F / ScG3R. Total DNA (approximately 10 ng / μl) extracted from sclerotia (10 seeds) of Sc strains (groups A and B) by the CTAB method was detectable even when diluted to 1 / 100. [Figure 9]Specific detection of Sc using the primer set ScG3F / ScG3R. Quantitative PCR was performed using the total DNA of Sc strains (groups A and B) and related species as templates. Two Sc strains (groups A and B) were detected at a cycle value (Ct value) of approximately 23. [Figure 10] Detection was performed using a primer set designed based on Hsp60. PCR was performed using total DNA from Sc strains (groups A and B) and related species as templates. Two Sc strains (groups A and B) were detected. Amplification was also observed in samples from Dumontinia tuberosa and Sclerotinia minor. [Figure 11] Distinguishing between two Sc groups by restriction enzyme digestion after PCR. After PCR was performed using the primer set ScG3F / ScG3R, restriction enzyme (MspI) digestion allowed differentiation of group A and group B strains by agarose gel electrophoresis. [Figure 12] Detection from plants: Sampling of diseased plants. The severity of black rot disease on leek was classified into three stages (mild, medium, and severe), and sampling was carried out according to the distance from the roots, which are the site of pathogen invasion. [Figure 13] Detection from plants: Example of PCR detection. Total DNA (plant + pathogen) was extracted from diseased plants and detected using the ScG3F / ScG3R primer set. Differences in detection efficiency depending on the DNA extraction method were also compared. Top: Extraction by the CTAB method, bottom: Extraction using the Qiagen DNeasy Plant mini kit. [Figure 14] Sequence of a new LAMP primer set for Sc-specific detection (G3PDH). The sequences of the primer set ScG3F / ScG3R were used for F3 and B3 in the LAMP primer design. The primer positions for the FIP and BIP sequences were designed to reveal single-base polymorphisms with closely related species. [Figure 15] Sample preparation of Sc-infected welsh onion plants (DNA sample preparation for Sc detection) [Figure 16] Specific detection of Sclerotium cepivorum (Sc) by loop-mediated isothermal amplification (LAMP) using sclerotial DNA from Sc and related species [Figure 17]Specific detection of Sc by cPCR in Sc-infected onion plants. Conventional PCR (cPCR, regular PCR) allows accurate detection by washing the sample with water, but detection sensitivity decreases when soil is present due to the presence of inhibitors. Medium 1-3: Another sample with moderate symptoms; Light 1-3: Another sample with mild symptoms; None: Healthy onion with no symptoms (negative control); sai02: Sclerotial DNA of the sai02 strain (positive control) [Figure 18] Specific detection of Sc from Sc-infected leek plants: Comparison of cPCR and LAMP. Conventional PCR (cPCR, regular PCR) and LAMP yielded nearly identical results, with LAMP showing higher detection sensitivity for some sample DNA. DETAILED DESCRIPTION OF THE INVENTION

[0014] [Oligonucleotides, primers, probes] The present invention relates to oligonucleotides for PCR that can detect plant pathogenic fungi. The oligonucleotides for PCR include primers, primer sets, and probes. The oligonucleotides, primers, and probes of the present invention are particularly suitable for detecting Sclerotium cepivorum, the fungus that causes black rot of onion.

[0015] The oligonucleotide of the present invention is capable of binding to any one selected from the group consisting of the glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, the heat shock protein 60 (HSP60) gene region, and the calmodulin (CaM) gene region of ascomycetes. The oligonucleotide of the present invention is also capable of binding to a region that is conserved in both group A and group B strains of Sclerotium cepivorum (Sc) and that exhibits polymorphism in closely related species of Sc.

[0016] In the present invention, unless otherwise specified, the term "related species of Sc" refers to any species selected from the group consisting of Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii.

[0017] Analysis of Sc based on sclerotial shape, cultural properties, hyphae, and molecular phylogeny is underway, and it can be roughly divided into Group A (which forms large sclerotia) and Group B (which forms small sclerotia) in terms of MCG (mycelial anastomosis group) and molecular phylogeny (Non-Patent Document 6 cited above). Clear differences in cultural properties are observed between Group A and Group B, so if they can be distinguished and detected, it is expected that analysis of their influence on disease onset will progress in the future.

[0018] The sequence listing shows the sequences of the G3PDH gene region of related species as SEQ ID NOs: 5-24, the sequence of the G3PDH gene region of Sc as SEQ ID NOs: 25-30, the sequence of the HSP60 gene region of related species as SEQ ID NOs: 31-50, the sequence of the HSP60 gene region of Sc as SEQ ID NOs: 51-56, the sequence of the CaM gene region of related species as SEQ ID NOs: 57-76, and the sequence of the CaM gene region of Sc as SEQ ID NOs: 77-82.

[0019] In a preferred embodiment, the oligonucleotides are primers, and the primers may be a paired primer set. In a particularly preferred embodiment, the primer set is capable of amplifying a region of the G3PDH gene, and is capable of associating with a region conserved in the sequences of SEQ ID NOs: 25-30 and polymorphic in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof.

[0020] A more specific example of such a primer set is one capable of amplifying a G3PDH gene region, in which one primer can bind to a region including positions 79 and 82 of the sequence of SEQ ID NO: 27, or a complementary region thereof, and the other primer can bind to a region including positions 329, 335, and 338 of the sequence of SEQ ID NO: 27, or a complementary region thereof.

[0021] Specifically, one of the primers is any of the following oligonucleotides: (a) an oligonucleotide consisting of a continuous portion of the sequence of at least 15-30 bases, preferably 18-25 bases, including positions 79 and 82 of SEQ ID NO: 27, or a complementary sequence thereof; (b) An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (a).

[0022] The other primer is any one of the following oligonucleotides: (c) an oligonucleotide consisting of a continuous portion of the sequence of at least 15-30 bases, preferably 18-25 bases, including positions 329, 335, and 338 of SEQ ID NO: 27, or a complementary sequence thereof; (d) An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (c).

[0023] A more specific example of one primer is any of the following oligonucleotides: (a') an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence; (b') An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (a').

[0024] A more specific example of the other primer is any of the following oligonucleotides: (c') an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence; (d') An oligonucleotide having a sequence in which 1 to 3 bases are substituted in the sequence of the oligonucleotide (c').

[0025] In another preferred embodiment, the primer set is capable of amplifying an HSP60 gene region, and is capable of associating with a region that is conserved in the sequences of SEQ ID NOs: 51-56 and polymorphic in the sequences of SEQ ID NOs: 31-50, or a complementary region thereof.

[0026] In another preferred embodiment, the primer set is capable of amplifying a region of the CaM gene that is conserved in the sequences of SEQ ID NOs: 77-82 and polymorphic in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.

[0027] In general, primers for PCR are designed with four considerations in mind: Tm value, terminal stability of each primer region, GC content, and secondary structure. Furthermore, primers are designed so that their 3' ends are not complementary to each other to prevent the formation of primer dimers. The same applies to the primers of the present invention.

[0028] The distance between the primers can be designed so that the amplification product is 120-400 bases long, for example, 200-300 bases long.

[0029] Each primer can be independently 15-30 bases long, preferably 18-25 bases long, and when the primer is a BIP or FIP primer in the LAMP method described below, each primer can be independently 30-60 bases long, preferably 36-50 bases long.

[0030] In another preferred embodiment, the oligonucleotide is a probe for detecting a specific sequence in a PCR amplification product, and the probe is capable of associating with a region related to the G3PDH gene that is conserved in the sequences of SEQ ID NOs: 25-30 and polymorphic in the sequences of SEQ ID NOs: 5-24, or a complementary region thereof.

[0031] A more specific example of such a probe is one that can associate with a region including any one selected from the group consisting of positions 79, 82, 329, 335 and 338 of the sequence of SEQ ID NO:27, or a complementary region thereof.

[0032] In another preferred embodiment, the probe is capable of associating with a region related to the HSP60 gene region that is conserved in the sequences of SEQ ID NOs: 51-56 and polymorphic in the sequences of SEQ ID NOs: 31-50, or a complementary region thereof.

[0033] In another preferred embodiment, the probe is capable of associating with a region related to the CaM gene region that is conserved in the sequences of SEQ ID NOs: 77-82 and polymorphic in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.

[0034] The probe should be designed to associate with the target polymorphism approximately in the center, specifically in a region five bases above and five bases below the center of the nucleotide chain. The probe should be 15-30 bases long, preferably 18-25 bases, because this length is effective for specific association with the intended complementary sequence.

[0035] The probe may be modified with a fluorescent molecule, such as N-(3-Fluoranthyl)maleimide (FAM), fluorescein, dansyl, Cascade Yellow, fluorescamine, Oregon Green, pyrene, Texas Red, Pacific Blue, Marine Blue, Alexa, Lucifer Yellow, BODIPY, coumarin, PyMPO, TET, JOE, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, HEX, TAMRA, SYBR Green, or NBD. Methods for binding fluorescent molecules to oligonucleotides and detecting fluorescence are well known in the art.

[0036] The present invention also provides a kit for diagnosing black rot disease on onion, which includes a predetermined oligonucleotide and primer set. The kit may also include a container such as a microtube, a solution for extracting DNA from a sample, a diluent, a positive control, a manual, etc.

[0037] [Detection method] The present invention also provides a method for detecting pathogens using the above-mentioned primer set. The detection method of the present invention comprises the following steps: extracting DNA from the sample; performing PCR using the extracted DNA as a template and the above-mentioned primer set; A process for detecting PCR amplification products.

[0038] The present invention also provides a method for detecting pathogens using the above-mentioned probe. The detection method of the present invention comprises the following steps: extracting DNA from the sample; performing PCR using the extracted DNA as a template and an appropriate primer set; A step of detecting the PCR amplification product using the above-mentioned probe.

[0039] Furthermore, when an amplification product is detected, the detection method of the present invention can determine that a pathogen, more specifically, Sclerotium cepivorum (Sc), the fungus causing black rot of onion, is present in the sample.

[0040] Examples of plants in which Sc can be detected by the detection method of the present invention include plants of the genus Allium. Examples of Allium plants include green onion (Allium fistulosum L.), onion (A. cepa L.), leek (A. porrum L.), garlic (A. sativum L.), shallot (A. chinensis G. Don), wild onion (A. victorialis L.), Chinese chive (A. tuberosum Rottl.), Japanese chive (A. monanthum Maxim.), Chinese chive (A. togashii Hara), Japanese leek (A. virgunculae F. Maek. et Kitam.), mountain shallot (A. splendens Willden.), wild shallot (A. macrostemon Bunge), mountain shallot (A. thunbergii G. Don), and chives (A. schoenoprasum L.). The detection method of the present invention is suitable for detecting Sc in green onions, onions, garlic, leeks, shallots, and chives, and is particularly suitable for detecting Sc in green onions.

[0041] When the analytical method of the present invention is applied to leeks, there are no particular limitations on the variety, line, or crop type of the leeks to be analyzed. According to the present invention, analysis can be suitably carried out on white leeks (also called long leeks or deep-rooted leeks) that are susceptible to widespread damage caused by black rot of leeks and that are produced using the crop types of "autumn / winter leeks" and "spring harvest leeks." Examples of welsh onion varieties to which the analytical method of the present invention can be applied include TA-4, MSN-TAM-1, Suzuwarabe, MSS-TA-4, TAM-3, Koiwarabe, Yumewarabe, TAM-1, MSK-TA-2, TA-2, welsh onion intermediate parent No. 1, Fuyuwarabe, Hikawa, Nagaetsu, Iwai, late-season Shiobara, Benizome, Motoharu late-season, Big Fellow, Futoko, Harukawa Okuta, Daikokuho, Frost-resistant, Furuno Midori, Yoshiharu, Nishikizo, Shuntou, Harumi, Kiyomidori, Natsufujin, Satsukihime, Yawaragi, T Nakajima Shironaga, Saga Yutaka, BL Manganbo, Ashi Nagabijin, Shonan Ippon, Hitachi Benikko, Tom One, Etchu Natsu Komachi, Etchu Fuyu Komachi, Natsu Genki, YSG1, NR Shizuku 1, Tokyo Komachi, Early-season Kaminari, Akita Harukko, YSG2, Hyogo These include N-1, Natsu Moeka, Ryusho, Ryu Hikari 1, Ryu Hikari 2, Ryuuki, and Ryumi.

[0042] The sample to be detected can be fungal bodies (sclerotia), soil, or a plant body or part thereof. Examples of plant body parts include roots and stem discs to which Sc sclerotia are attached.

[0043] An extraction solution is used to extract DNA from a sample. The extraction solution can be prepared as a buffer containing a surfactant. The base buffer is selected from Tris buffer, phosphate buffer, Tricine buffer, HEPES buffer, MOPS buffer, carbonate buffer, citrate buffer, borate buffer, MES buffer, and PIPES buffer. It contains 100-700 mM, preferably 500 mM, NaCl, and has a pH of 6-10, preferably 7.4. Known surfactants can be used, including nonionic surfactants such as Triton X-100, NP-40, and Tween; zwitterionic surfactants such as 7BzO, SB3-10, SB3-14, CHAPS, and amidosulfobetaine-14 (ASB14); and ionic surfactants such as cetyltrimethylammonium bromide (CTAB) and sodium dodecyl sulfate (SDS). Zwitterionic surfactants and ionic surfactants are preferred, with ionic surfactants being even more preferred. Preferably, SDS or CTAB is used, more preferably CTAB. The concentration of the surfactant in the extraction solution is 0.5-1.5% by weight, preferably 1% by weight.

[0044] The extraction liquid can be added in a ratio of 0.1 to 30 ml, preferably 0.5 to 10 ml, more preferably 0.75 to 3 ml per 1 g of sample.

[0045] Extraction can be performed by known techniques, in which an extracting solution is added to the pulverized sample and the mixture is heated (e.g., at 60°C) for a few minutes to an hour, preferably 5 to 20 minutes. If necessary, the extraction process may be repeated multiple times, preferably twice.

[0046] The detection method of the present invention may further include a step of cleaving the PCR amplification product with a restriction enzyme. A preferred example of the restriction enzyme is MspI, as this allows for the distinction between group A and group B strains of Sc. MspI is a restriction enzyme derived from the MspI gene isolated from bacteria of the genus Moraxella, and recognizes and cleaves the following sequence:

[0047] [ka]

[0048] Other restriction enzymes with the same activity can be used, such as HpaII.

[0049] [Detection method using LAMP] The detection method of the present invention can be carried out as a LAMP (Loop-Mediated Isothermal Amplification) method. LAMP is a method of amplification using a strand displacement reaction with four primers that combine six regions selected from the sequence of a target gene. LAMP primers are designed using six regions, namely, F3 region, F2 region, F1 region, B1 region, B2 region, and B3 region, from the 5' end, in the region to be amplified (sometimes referred to as the "template (nucleotide, DNA)"). The regions complementary to these six regions are called F3c region, F2c region, F1c region, B1c region, B2c region, and B3c region, respectively. The basic LAMP method uses four primers, more specifically, two inner primers, namely, FIP and BIP, and two outer primers, namely, F3 primer and B3 primer.

[0050] In detail, FIP is designed to have an F2 region at its 3'-end, which is a sequence complementary to the F2c region, and a sequence identical to the F1c region at its 5'-end, F3 Primer is designed to have an F3 region at its 3'-end, which is a sequence complementary to the F3c region, BIP is designed to have a B2 region at its 3'-end, which is a sequence complementary to the B2c region, and a sequence identical to the B1c region at its 5'-end, and B3 Primer is designed to have a B3 region at its B3c region. When designing primers for the LAMP method for detection of the present invention, it is advisable to design any one of FIP, BIP, F3 primer, and B3 primer to associate with the position of the polymorphism.

[0051] Loop primers can be used in the LAMP method. Loop primers are usually designed to have a sequence complementary to the single-stranded portion of the loop at the 5' end of the dumbbell structure of the LAMP amplification product (between the B1 and B2 regions, or between the F1 and F2 regions). They are called loop primer B (LB) and loop primer F (LF), respectively. The use of loop primers can increase the number of origins of DNA synthesis. In amplification products that typically have six loops in the LAMP method, four loops are not utilized in the original method using four primers, but by using loop primers, all loops can be utilized. Loop primers LB and LF may also be used in the LAMP method for detection of the present invention.

[0052] In relation to the present invention, when referring to the F3 region, F2 region, F1 region, B1 region, B2 region, B3 region, FIP, F3 primer, BIP, B3 primer, loop primer B (LB), and loop primer F (LF) in relation to the LAMP method, they are used in the same sense as those in the general LAMP method (see below), unless otherwise specified.

[0053] [Table 1]

[0054] In general, the LAMP method is characterized by the fact that it does not require a denaturation reaction from single strands to double strands, and the reaction proceeds at a constant temperature of 60-65°C, eliminating the need for equipment such as a thermal cycler. Furthermore, the amplification rate is fast and the specificity is high.

[0055] In a particularly preferred embodiment, the LAMP method of the present invention uses the following primer sets (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 or its complementary sequence (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 or its complementary sequence (g) an F3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 85 or its complementary sequence; (h) B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence

[0056] The LAMP method of the present invention may use an oligonucleotide probe. Furthermore, the primers and probes used in the LAMP method may be modified with a fluorescent molecule or a quencher molecule. Examples of fluorescent molecules are as described above. Examples of quencher molecules include non-fluorescent substances (known as dark quenchers), such as 4-dimethylaminoazobenzene-4'-carboxylic acid (Dabcyl), QSY-7, QSY-21, QSY-35, BHQ-0, BHQ-1, BHQ-2, BHQ-3, and Eclipse. Alternatively, fluorescent substances with absorption bands in the wavelength ranges emitted by the above-mentioned fluorescent molecules may be used as quencher molecules. Methods for attaching fluorescent molecules and quencher molecules to oligonucleotides and for detecting changes in fluorescence intensity are well known in the art. [Example]

[0057] Development of PCR primers for detecting I.Sc 1. Method [DNA extraction] Eight Sclerotium cepivorum (Sc) isolates isolated between 2015 and 2018 were cultured on PDA plates at 20°C in the dark, and approximately 10 sclerotia were collected. DNA from each strain was extracted using the CTAB method. In addition, 13 strains of closely related species of Sclerotinia (Botrytis cinerea MAFF 615004, Botrytis squamosa MAFF 241966, Dumontinia tuberosa MAFF 241471, Macrophomina phaseolina MAFF 238567, Sclerotinia homoeocarpa MAFF 235856, Sclerotinia kitajimana MAFF 410428, Sclerotinia minor MAFF 238173, Sclerotinia nivalis MAFF 241342, Sclerotinia sclerotiorum MAFF 306236, Sclerotinia trifoliorum MAFF 305210, Sclerotium fumigatum MAFF 237402) and 11 strains of Sclerotium rolfsii MAFF 242770 and Sclerotium DNA from each of the two strains (B. rolfsii var. delphinii MAFF 328254) was extracted using the CTAB method from a single sclerotium or mycelium cultured on a PDA plate. The extracted DNA concentration was measured using a Nanodrop (Thermo Fisher) and adjusted to 10-30 ng / μl. Each DNA sample was stored in a -25°C freezer until use.

[0058] [CTAB method] Extraction Buffer CTAB extraction solution (2% hexadecyltrimethylammonium bromide, 0.1M Tris-HCl pH 8.0, 20mM EDTA, 0.4M NaCl) Phenol-chloroform solution (v / v=1:1)

[0059] <method> 1. Place the sclerotia or mycelia of each strain into a 1.5 ml microtube and crush the cells using a pestle or a 2 mm stainless steel ball. 2. Add 500 μL of CTAB extraction solution and incubate at 60°C for 10 minutes. 3. Add 200 μL of phenol chloroform solution, mix well, and let stand for 10 minutes. 4. Centrifuge at 15,000 rpm for 10 minutes 5. Transfer 200 μL of the upper layer to a new tube, add 200 μL of isopropanol, and mix by inverting. 6. Centrifuge at 15,000 rpm for 10 minutes 7. Remove the supernatant and add 500 μL of 70% ethanol. 8. Centrifuge at 15,000 rpm for 10 minutes. 9. Remove the supernatant and dry the pellet 10. After drying, add 20 μL of TE Buffer and measure the concentration using a Nanodrop (Thermo Fisher) to adjust it to 10-30 ng / μl.

[0060] [Determination of base sequence] Conventional PCR was performed targeting the three regions reported by Andrews et al. (2012) (glyceraldehyde-3-phosphate dehydrogenase; G3PDH, heat shock protein 60; HSP60, and calmodulin; CaM). PCR of the G3PDH, HSP60, and CaM regions was performed using Takara EX taq. The reaction volume was 10x EX taq Buffer (Mg 2+The total volume was 25 μL, containing 10 mM ATP (Protein Plus), 0.25 mM dNTP Mixture, 0.2 μM each primer, and 0.2 U of EX taq. The reaction conditions were as described by Andrews et al. (2012). After a 2-minute denaturation at 95°C, the reaction was denatured at 95°C for 30 seconds, annealed at different temperatures for each primer (58°C for G3PDH, 53°C for HSP60, and 50°C for CaM), and then extended at 72°C for 1 minute for 35 cycles. The PCR products were electrophoresed on 1.5% agarose gel (Agarose LE, Analytical Grade) and analyzed using a 100-bp DNA Ladder (Nippon Genetics Co., Ltd.) as a size marker. The PCR products were purified using the FastGene Gel / PCR Extraction Kit (Nippon Genetics Co., Ltd.) to obtain purified products for sequencing. The purified products were subjected to a capillary sequencer to obtain each base sequence data, which was then subjected to a BLAST search at NCBI.

[0061] [Primer design] Based on the report by Andrews et al. (2012), the nucleotide sequence information for each gene region of 13 Sc-related species (3 species of Botrytis, 4 species of Botryotinia, 4 species of Sclerotinia, and 2 species of Myriosclerotinia) was obtained from the DDBJ / EMBL / GenBank databases. The alignments were performed using the software Clustal W and compared using MEGA ver. 7. Based on the nucleotide sequence of each gene region, species-specific nucleotide sequence information was designed to be specific for either the upstream or downstream region, or both. Primers were designed: 3 primer sets for G3PDH, 10 primer sets for HSP60, and 4 primer sets for CaM.

[0062] In addition, Figure 2, 3, and 4 show the alignments of the nucleotide sequences of G3PDH, HSP60, and CaM derived from representative Sc A-group strains and B-group strains, as well as Sc-related species, respectively.

[0063] [Confirmation of Primer Specificity] PCR was performed on a total of 15 strains, including 2 strains of S.cepivorum (A-group strain MAFF239143 and B-group strain Sai01) and 13 strains of related species.

[0064] [PCR Reaction Conditions] Using Promega's Go taq Greenmaster mix, the test was conducted in a reaction system with a total volume of 25 μl according to the manual. After a preliminary reaction at 94°C for 2 minutes, 30 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds were performed using TaKaRa PCR Thermal Cycler Dice (registered trademark) TP600 or TP650. The PCR reaction products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and 100bp DNA Ladder (Nippon Genetics Co., Ltd.) was used as the marker for judgment.

[0065] [Processing of PCR Reaction Products] For the determination of bacterial groups using restriction enzyme treatment, MspI (Takara) was used, and the cleavage enzyme treatment was performed according to Takara's manual. The restriction enzyme treatment reaction was incubated at 37°C for 15 minutes and then the enzyme was inactivated at 94°C for 10 minutes. The confirmation of the restriction enzyme treatment products after treatment was carried out in the same manner as the PCR reaction test.

[0066] [Quantitative PCR] Using Nippon Gene's GeneAce SYBR qPCR Mixα, this was carried out according to the manual. After a preliminary reaction at 94°C for 10 minutes, 45 cycles of 94°C for 15 seconds, 62°C for 15 seconds, and 72°C for 15 seconds were performed using Takara's Tehermal Cycler Dice TP700.

[0067] [PCR Using Previously Reported Primers] PCR was performed using the Sc-specific primers (SCAF / ITS2SCR) from Haq et al. (2003) (Non-Patent Document 1) on 37 strains of Sc-related species and 71 strains of S. cepivorum. PCR reactions were performed in a 25-μl reaction system according to the Promega Go taq Greenmaster mix manual. PCR reaction conditions were as described by Haq et al. The PCR products were electrophoresed using 1.5% agarose (Agarose, LE, Analytical Grade), and the marker was read using a 100-bp DNA ladder (Nippon Genetics Co., Ltd.).

[0068] Quantitative PCR was performed on six Sc-related species using the Sc-specific primers (Z996-340F / Z996-450R:Z996-382T) from Woodhall et al. (2012). PCR reactions were performed according to the Nippon Gene GeneAce Probe qPCR Mix II manual, and the PCR reaction conditions were as described by Woodhall et al. (2012).

[0069] 2. Results [Detection using previously reported primers] The results are shown in Figures 5 and 6. Conventional PCR was performed using the primers from Haq et al. (2003) and the total DNA of Sc and related species as templates. Group B strains were detected, but not group A strains. No amplification products were obtained from 37 closely related species. Furthermore, PCR was performed using the primers from Woodhall et al. (2012) and the total DNA of Sc and related species as templates. Group B strains were detected, but not group A strains (Figure 6).

[0070] [Detection using ScG3F / ScG3R primer set] Using the designed primer sets and the total DNA of Sc strains (groups A and B) and related species as templates, we were able to perform PCR using one of the primer sets based on the GAPDH sequence to specifically detect Sc group A and B strains but not related species. The results are shown in Figure 7.

[0071] The sequences of the ScG3F primer and the ScG3R primer are shown below. ScG3F:5'-CAAGGGCGATATCAAGGTCCTT-3'(SEQ ID NO:1) ScG3R:5'-GGAGATGACATCTGCTTCACCA-3'(SEQ ID NO:2)

[0072] [Sensitivity of Sc-specific detection using the ScG3F / ScG3R primer set] PCR was performed using total DNA (approximately 10 ng / μl) extracted from sclerotia (10 seeds) of Sc strains (groups A and B) using the CTAB method described above, which was serially diluted to 1 / 100.

[0073] The results are shown in Figure 8. Amplification products were detected from diluted samples of both group A and group B strains.

[0074] [Quantitative PCR] The results of PCR using the ScG3F / ScG3R primer set are shown in Figure 9. Only two Sc strains (groups A and B) had cycle values ​​(Ct values) of approximately 23, allowing them to be detected and distinguished from closely related Sc species.

[0075] [Design of PCR primers based on Hsp60] PCR was performed using PCR primers designed based on Hsp60 and the total DNA of Sc strains (groups A and B) and related species as templates. The results are shown in Figure 10. Two Sc strains (groups A and B) were detected. Other amplified DNA was also detected from Dumontinia tuberosa and Sclerotinia minor.

[0076] The primer sequences are shown below. F:5'- ACTGTTGGTGAACAGATGGTG -3'(SEQ ID NO:3) R:5'- GCGACTTGTGCGATTTCCTCGCTG -3'(SEQ ID NO:4)

[0077] [Discrimination of the two groups using the ScG3F / ScG3R primer set] The MAFF239143, Chi01, and Chi07 strains were used in group A, and the Sai01 and Shi01 strains were used in group B. PCR was performed using the ScG3F / ScG3R primer set, followed by treatment with a restriction enzyme (MspI) at 37°C for 15 or 60 minutes, followed by agarose gel electrophoresis. The results are shown in Figure 11. Group A and B could be distinguished by agarose gel electrophoresis of the enzyme-treated products. In Figure 11, the molecular weight markers are shown on the left side for a 15-minute reaction time and on the right side for a 60-minute reaction time, and both were detectable.

[0078] [Detection of pathogens from plants] Total DNA (plant + pathogen) was extracted from infected plants and detected using the ScG3F / ScG3R primer set. The detection efficiency of different DNA extraction methods was also compared.

[0079] Specifically, the severity of black rot disease on onion was classified into three stages (mild, moderate, and severe), and samples were collected according to the distance from the roots, the site of pathogen invasion (Figure 12). Total DNA was extracted from diseased plants using the CTAB method described above or the Qiagen DNeasy Plant mini kit, following the instructions provided with the kit. PCR was performed under the same conditions as described above.

[0080] The results are shown in Figure 13. When extracted using the CTAB method, the bacteria were detected in the stem disc where symptoms were "moderate," and in the roots, stem discs, and areas 10 cm away from the roots where symptoms were "severe."

[0081] II. Development of the LAMP method 1. Method [Primer set development] LAMP primers for the specific detection of Sc were designed using PrimerExplorer V5, a LAMP primer design support software from Eiken Chemical Co., Ltd. LAMP primer F3 utilized the sequence of primer ScG3F designed in I, but was two bases shorter than it in consideration of the Tm value. In addition, the polymorphic position in ScG3R was incorporated into BIP. The primer position of FIP was designed to reveal a single-base polymorphism compared to closely related species (see Figure 14).

[0082] The sequences of the designed LAMP primer set are shown in the table below.

[0083] [Table 2]

[0084] [Sample preparation] Samples were prepared from leek plants infected with Sc and with different degrees of disease (see Figure 15 and the table below), and total DNA was extracted from each sample (infected leek plants or sclerotia) using the CTAB method described in "I. Development of PCR primers for Sc detection."

[0085] [Table 3]

[0086] Specifically, samples were prepared from the welsh onion plants as follows. 1. Cut the diseased tissue of a diseased plant (approximately 1cm square: red frame) in half. 2. Total DNA was extracted from the "soil-attached" specimens using the CTAB method. 3. "Water washing" involved rinsing with tap water, wiping off the moisture thoroughly, and extracting total DNA.

[0087] [LAMP and cPCR methods] LAMP method: Reagents from a LAMP kit (Loopamp® DNA Amplification Reagent Kit D (Eiken Chemical Co., Ltd.) or Isothermal Master Mix (Nippon Gene Co., Ltd.)), total DNA (approximately 1 μl), and the designed primers were added to a 0.2 ml Eppendorf tube, and amplification reaction was carried out according to the manual provided with the kit. The apparatus used was a Takara Real Time PCR48 (Takara Bio Inc.).

[0088] Conventional PCR (cPDR) method: This was performed according to the method described in "Development of PCR primers for detecting I.Sc."

[0089] 2. Results [Specific detection of Sc by LAMP using sclerotial DNA] The results are shown in Figure 16. DNA amplification was confirmed by the cloudiness of the reaction solution. Amplified products were detected by the LAMP method for both group A and group B strains.

[0090] [Specific detection of Sc by cPCR using plant tissues] The results are shown in Figure 17. In conventional PCR (cPCR, normal PCR), accurate detection is possible by washing the sample with water, but detection sensitivity decreases when soil is present due to the inclusion of inhibitors and other contaminants.

[0091] [Specific detection of Sc from plants: comparison of cPCR and LAMP methods] The results are shown in Figure 18. The results of conventional PCR (cPCR, normal PCR) and the LAMP method were almost identical, and the LAMP method had higher detection sensitivity for some sample DNA. [Industrial Applicability]

[0092] The present invention makes it possible to diagnose black rot disease of leeks at the initial stage of occurrence, and therefore can be used at leeks production sites, prefectural extension and guidance centers and public testing stations that receive consultations from production sites, and the seed and seedling industry.

[0093] According to the present invention, the density of sclerotia in soil can be measured to diagnose the degree of contamination, and therefore the present invention can also be used to diagnose soil pests.

[0094] The orthodox method for extracting DNA from plants, sclerotia, and fungi (CTAB method) has good detection sensitivity, and no special conditions are required for PCR, so it is thought that there are few technical limitations to its practical application. [Sequence List Free Text]

[0095] SEQ ID NO:1 ScG3F primer SEQ ID NO:2 ScG3R primer SEQ ID NO:3 primer SEQ ID NO:4 primer SEQ ID NOs:5-24 Related species G3PDH SEQ ID NOs:25-30 Sc G3PDH SEQ ID NOs:31-50 Related species HSP60 SEQ ID NOs:51-56 Sc HSP60 SEQ ID NOs:57-76 Related species CaM SEQ ID NOs:77-82 ScCaM SEQ ID NO:83 FIP SEQ ID NO:84 BIP SEQ ID NO:85 F3 primer SEQ ID NO:86 B3 primer SEQ ID NO:87 LF SEQ ID NO:88 LB

[0096] SEQUENCE LISTING <110> National Agriculture and Food Research Organization, The Yokohama Nursery Co., Ltd. <120> Oligonucleotides and methods for detecting Sclerotium cepivorum <130> 211906K <150> JP 2021-026543 <151> 2021-02-22 <160> 88 <170> PatentIn version 3.5 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer, ScG3F <400> 1 caagggcgat atcaaggtcc tt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer, ScG3R <400> 2 ggagatgaca tctgcttcac ca 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 3 actgttggtg aacagatggt g 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 4 gcgacttgtg cgatttcctc gctg 24 <210> 5 <211> 756 <212> DNA <213> Botryotinia calthae strain LMK750 <400> 5 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccact ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgcgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgttatca 660 agaaggctgc tgatggtcct ctcaagggta agctactcca ttactctttc tttggctcta 720 atttactaat cgtaacacag gcatattggc ttacac 756 <210> 6 <211> 756 <212> DNA <213> Botryotinia convoluta strain LMK755 <400> 6 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaat gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttgctaat cgtaacacag gcatattggc ttacac 756 <210> 7 <211> 756 <212> DNA <213> Botryotinia fuckeliana strain B05.10 <400> 7 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttgctaat cgtaacacag gcatattggc ttacac 756 <210> 8 <211> 756 <212> DNA <213> Botryotinia porri strain LMK19 <400> 8 aggcatacat gttgaagtat gattccaccc acggtcaatt caagggtgat atcaaggtcc 60 tttccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccat tcctacaccg 420 ccacccaaaa gaccgtcgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcta ttaatctttc ttccattcta 720 atttactaat cgtaatatag gcatattggc ttacac 756 <210> 9 <211> 901 <212> DNA <213> Botrytis cinerea DAOM:166439 <400> 9 aatatgccgt aagttccgc tatcggacct cccgcagatt gcaaggaccc gagctaatct 60 atcttatgta caggcataca tgttgaagta tgattccacc cacggtcaat tcaagggtga 120 tatcaaggtc ctttccgatg gattggaggt caatggcaag aaggtcaagt tctacactga 180 gagagaccca gccaacatcc catgggctga gtctgaggca tactacgttg tcgagtccac 240 cggtgttttc accaccaccg agaaggccaa ggcacatttg aagggtggtg ccaagaaggt 300 tgtatctct gctccttctg ccgatgcccc aatgtacgtt atgggtgtca acaacgagac 360 ctacaagggt gatgttgatg ttatctccaa cgcctcttgc acaaccaact gcttggctcc 420 tctcgccaag gtcatcaacg atgagttcac catcattgag ggtttgatga ccaccatcca 480 ctcctacacc gccacccaaa agaccgtcga tggtccatcc gctaaggatt ggcgtggagg 540 acgtaccgct gctcaaaaca tcatcccatc gagcaccggt gctgccaagg ccgtcggaaa 600 ggtcatccca gagcttaacg gcaaactcac cggaatgtcc atgcgtgttc caactgccaa 660 cgtctcagtt gttgacttga ctgtccgcat tgagaagggt gcttcttatg atgagatcaa 720 ggccgtcatc aagaaggctg ctgatggtcc tctcaagggt aagttactct attaatctct 780 ttttcatttc aatttactaa tcgtaatata ggcatattgg cttacactga ggacgacgtt 840 gtctccactg acatgaacgg tgacaaccac tcctccatct tcgatgctaa ggccggtatc 900 t 901 <210> 10 <211> 756 <212> DNA <213> Botrytis paeoniae strain LMK439 <400> 10 aggcatacat gttgaagtat gattccacccc acggtcaatt caagggtgac atcaaggtcc 60 ttgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgtcgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gttatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacaccg 420 ctacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc tgtcggaaag gtcatcccag 540 tccttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttacga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggta agttactcca ttactctttc ttcggctcta 720 atttactaat cgtaacacag gcatattggc ttacac 756 <210> 11 <211> 756 <212> DNA <213> Botrytis tulipae strain LMK76 <400> 11 aggcatacat gttgaagtat gattccacccc acggtcaatt caagggtgat atcaaggtcc 60 tttccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tccgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 cgccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgaattcacc atcattgaag gtttgatgac caccattcac tcctacaccg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caaactcacc ggaatgtcca tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaagggtg cttcttatga tgagatcaag gccgtcatca 660 agaaggctgc tgatggtcct ctcaagggtg agttactctc tcaacccttc ttccgttcta 720 atttactaat cataatacag gcatattggc ttacac 756 <210> 12 <211> 760 <212> DNA <213> Ciboria acerina strain LMK476 <400> 12 aggcatacat gttgaagtat gactccacccc acggtcaatt caagggtgat atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga agatcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag actgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gctcacttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 acgttgatgt tctctctaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatccacga tgagttcacc atcattgagg gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatgtcca tgcgtgttcc aactgccaac gtttccgttg 600 ttgacttgac ctgccgcatt gagaagggtg cttcttacga ccaaatcaag gccgtcatca 660 agaaggccgc tgatggacct ctcaagggta agacctctat aaattttcaa cattcttatt 720 cataatacta acagtgatat ataggcatat tggcttacac 760 <210> 13 <211> 761 <212> DNA <213> Dumontinia tuberosa strain LMK749 <400> 13 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgaa atcaaggtcc 60 tttccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc tgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaacggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgaattcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaatgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct ctcaagggta agatacttca caaatattta ttacttttca 720 atttactaat aataacgatg tataggcata ttggcttaca c 761 <210> 14 <211> 758 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 14 aggcatacat gttgaagtac gactccaccc acggtcaatt caagggtgac atcaaggtcc 60 tccccgacgg attggaggtc aatggcaaga aggtcaaatt ctacaccgag agagatcccg 120 ccaacatccc atgggctgag tccgacgcat actacgttgt tgagtccact ggtgtcttca 180 ccaccaccga gaaggccaag gcccatctta agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc tgacgctcct atgtatgtca tgggtgtcaa caacgagacc tacaagtccg 300 atgttgatgt tatctccaac gcctcctgca caaccaactg cttggctcct ctcgccaagg 360 tcatccacga tgagttcacc atcatcgagg gtctcatgac caccattcac tcctacactg 420 ccacccaaaa gactgttgac ggtccatccg ccaaggactg gcgtggagga cgtaccgctg 480 ctcaaaacat cattcctagc agcactggtg ccgccaaggc cgtcggaaag gtcatcccag 540 acctcaacgg caagctcacc ggaatgtcca tgcgtgtgcc aacctccaac gtctccgttg 600 ttgacttgac tgtccgcatc gagaagggag cttcctacga tgagatcaag gctgtcatca 660 agaaggctgc tgatggtcct cttaagggta tgttgtgcgt tcacatatgc acggtggtca 720 gattacttac attgaatatt aggcatactc gcttacac 758 <210> 15 <211> 758 <212> DNA <213> Monilinia aucupariae strain LMK733 <400> 15 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacaccgag agagacccag 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgaagctacc ggtgttttca 180 ccaccaccga caaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacaccg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcactggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 600 tcgacttgac ctgccgcatt gagaagggtg ctacttatga tgagatcaag gctgtcatca 660 agaaggctgc tgatggtcct cttaagggta agagctttcg tcaatctttt gtacttctcg 720 gcttactaat gatgatgtat aggcatattg gcttacac 758 <210> 16 <211> 757 <212> DNA <213> Monilinia fructicola strain LMK125 <400> 16 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgat atcaaggtcc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag actgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagagc tacaagggtg 300 acgtcgacgt tatctccaac gcttcttgca caaccaactg cttggctcct cttgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac cactatccac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatgtcca tgcgtgtccc aactgccaac gtctccgttg 600 ttgacttgac ctgccgcatt gagaagggtg ctacttatga tgagatcaag gctgtcgtca 660 agaaggctgc cgagggtcct cttaagggta agagctttga tgatctttga tgttttccag 720 attactaatt atgataaaca ggcatattgg gttacac 757 <210> 17 <211> 761 <212> DNA <213> Monoline megalospora strain LMK415 <400> 17 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggttc 60 tcgccgatgg attggaggtc aacggcaaga aggtcaagtt ctacaccgag agagaccctg 120 ccagcatccc atgggctgag tccgaggcat actacgttgt cgaggccacc ggtgttttca 180 ccaccaccga gaaggccaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacacgggtg 300. atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 420. tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacactg 480. cccccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 660. tcgacttgac ctgccgcatt gagaagggtg ctacttatga cgagatcaag gctgtcatca agaaggctgc tgagggtcct cttaagggta agagcattca tagtcttt gcgctttcca 720 gcttactaat gatgatgata tataggcata ttgggttaca c <210> 18 <211> 762 <212> DNA <213> Monilinia urnula strain LMK413 <400> 18 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaggttc 60 tcgccgatgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccagcatccc atgggctgag tccgaggcat actacgttgt cgaggccacc ggtgttttca 180 ccaccaccga taaggccaag gcacatttga agggtggtgc caagaaggtt gtcatttctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcctcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgagg gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgac ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat catcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg caagctcacc ggaatggcta tgcgtgtccc aactgccaac gtctccgttg 600 660. tcgacttgac ctgccgcatt gagaagggtg ctacttatga cgagatcaag gctgtcgtca agaaggctgc tgagggccct cttaagggta agagcattca tagtctttt gcgctttcca 720 gcttactaat gatgatatat atataggcat attgggttac ac <210> 19 <211> 759 <212> DNA <213> Myriosclerotinia curreyana strain LMK736 <400> 19 aggcatacat gttgaagtat gattccaccc acggccaatt caagggtgat attaaggtcc tccccgatgg attggaggtc aacggcaaga aggtcaagtt ctacacagag agagaccctg ccaacatccc atgggctgag tctaaggcat actacgttgt cgagtccacc ggtgttttca 180 240. ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa taacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg ttatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg gaaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat tatcccatcg agcaccggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agctcaacgg aaagctcacc ggaatgtcta tgcgtgtccc aactgccaac gtttctgttg 600 ttgatttgac ttgccgcatt gagaagggtg ctacttatga tgagatcaag gccgtcatca 660 agaaggctgc tgagggtccc cttaagggta agtgttttca ctcatcttga taattttcta 720 aaatactaac tggtgacata taggcatatt gggttacac 759 <210> 20 <211> 759 <212> DNA <213> Myriosclerotinia scirpicola strain LMK735 <400> 20 aggcatacat gttgaagtat gactccaccc acggccaatt caagggtgat attaaggtcc 60 tctccgacgg attggaggtc aacggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ctaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttctgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaagggtg 300 atgttgatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg gaaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcactggtg ctgccaaggc cgtcggaaag gtcatcccag 540 agcttaacgg aaagcttacc ggaatgtcta tgcgtgtccc aactgccaac gtttcagttg 600 ttgatttgac ttgccgcatt gagaagggtg ctacttatga tgagatcaag gccgtcatca 660 agaaggctgc tgagggtcct ctcaagggta cgtgtttttc atcaatcttt atcattttat 720 aatactaa tggtgatata taggcatatt gggttacac 759 <210> 21 <211> 758 <212> DNA <213> Sclerotinia glacialis strain LMK74 <400> 21 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgat atcaaggtcc 60 ttcccgacgg attggaggtt aatggcaaga aagtcaagtt ctacaccgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc tgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacactggtg 300 aagctgatgt tatctccaac gcttcttgca caaccaactg cttggcccct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaatgg caagcttacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatc gagaagcctg cttcttatga cgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttca tcaatattta ttacgtttca 720 attgactate aacgatgcat aggcatattg gcttacac 758 <210> 22 <211> 758 <212> DNA <213> Sclerotinia minor strain W10 <400> 22 aggcatacat gttgaagtat gactccactc acggtcaatt caagggtgac atcaaagtcc 60 tctccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ctaccaccga gaaggctaag gcacacttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtca tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttacga tgagatcaag gaggtcatca 660 agaaggctgc caatggtcct cttaagggta agcaacctgt caaatattca ttactcttca 720 atttactaat aacgctgtat aggcatattg gcttacac 758 <210> 23 <211> 757 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 23 aggcatacat gttgaaatat gactccactc acggtcaatt caagggtgat atcaaagtcc 60 tctccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtca tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg ctaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctctgttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggccgc caatggtcct ctcaagggta agaaatttgt caatattcat tacttttcaa 720 tttactaaca acaatgtata ggcatattgg cttacac 757 <210> 24 <211> 758 <212> DNA <213> Sclerotinia trifoliorum strain LMK47 <400> 24 aggcatacat gttgaagtat gactctactc acggtcaatt caagggtgac atcaaagtcc 60 tccccgacgg attggaggtt aatggcaaga aagtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt tatctccaac gcttcttgca caaccaactg cttggctcct cttgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccatccac tcctacactg 420 ccacccagaa gaccgttgat ggtccatccg caaaggattg gcgcggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcactggtg ccgctaaggc cgtcggaaaa gtcattccag 540 agcttaacgg caagctcacc ggaatgcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgtccgcatt gagaaggctg cttcttatga tgagatcaag gaggccatca 660 agaaggctgc caatggtcct cttaagggta agcaacctat caaatattca ttactcgtca 720 attactaac aacaatggat aggcatattg gcttacac 758 <210> 25 <211> 758 <212> DNA <213> Sclerotium cepivorum strain LMK1 <400> 25 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgat atcaaggtcc 60 ttccgacgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt catctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgttcgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttta caaatactta ttgcttttca 720 gtttactaat aacgatgttt aggcatattg gcttacac 758 <210> 26 <211> 758 <212> DNA <213> Sclerotium cepivorum strain LMK71 <400> 26 aggcatacat gttgaagtat gactccactc acggtcaatt caagggcgat atcaaggtcc 60 tttccgacgg attggaggtc aatggcaaga aggtcaagtt ctacactgag agagaccctg 120 ccaacatccc atgggctgag tctgaggcat actacgttgt cgagtccacc ggtgttttca 180 ccaccaccga gaaggctaag gcacatttga agggtggtgc caagaaggtt gtcatctctg 240 ctccttccgc cgatgcccca atgtacgtta tgggtgtcaa caacgagacc tacaatggtg 300 aagcagatgt catctccaac gcttcttgca caaccaactg cttggctcct ctcgccaagg 360 tcatcaacga tgagttcacc atcattgaag gtttgatgac caccattcac tcctacactg 420 ccacccaaaa gaccgttgat ggtccatccg caaaggattg gcgtggagga cgtaccgctg 480 ctcaaaacat cattccatcg agcaccggtg ccgccaaggc cgtcggaaag gtcattccag 540 agcttaacgg caagctcacc ggaatgtcta tgcgtgttcc aactgccaac gtctcagttg 600 ttgacttgac tgttcgcatt gagaaggctg cttcttatga tgagatcaag gaggtcatca 660 agaaggctgc taatggtcct cttaagggta agatacttta caaatactta ttgcttttca 720 gtttactaat aacgatgttt aggcatattg gcttacac 758 <210> 27 <211> 871 <212> DNA <213> MAFF239143(A) <400> 27 ccggacctcc caaaaacacc aaggacccga gctaatattc attgtttaca ggcatacatg 60 ttgaagtatg actccactca cggtcaattc aagggcgata tcaaggtcct tcccgacgga 120 ttggaggtca atggcaagaa ggtcaagttc tacactgaga gagaccctgc caacatccca 180 tgggctgagt ctgaggcata ctacgttgtc gagtccactg gtgttttcac caccaccgag 240 aaggctaagg cacatttgaa gggtggtgcc aagaaggttg tcatctctgc tccttccgcc 300 gatgccccaa tgtacgttat gggtgtcaac aacgagacat acaatggtga agcagatgtc 360 atctccaacg cttcttgcac aaccaactgc ttggctcctc tcgccaaggt catcaacgat 420 gagttcacca tcattgaagg tttgatgacc accattcact cctacactgc cactcaaaag 480 accgttgatg gtccatccgc aaaggattgg cgtggaggac gtaccgctgc tcaaaacatc 540 attccatcga gcaccggtgc cgccaaggcc gtcggaaagg tcattccaga gcttaacggc 600 aagctcaccg gaatgtctat gcgtgttcca actgccaacg tctcagttgt tgacttgact 660 gtccgcattg agaagggtgc ttcttatgat gagatcaaag gaggtcatca agaaggctgc 720 taatggtcct cttaagggta agatacttca caaatattta ttgcttttca atttactaat 780 aacgatgtac aggcatattg gcttacaccg aggacgatgt tgttccact gacatgaacg 840 gtgacaacca ctcctccatc tcgatgccaa g 871 <210> 28 <211> 839 <212> DNA <213> chi01(A) <400> 28 caccaaggac ccgagctaat attcattgtt tacaggcata catgttgaag tatgactcca 60 ctcacggtca attcaagggc gatatcaagg tccttcccga cggattggag gtcaatggca 120 agaaggtcaa gttctacact gagagagacc ctgccaacat cccatgggct gagtctgagg 180 catactacgt tgtcgagtcc actggtgttt tcaccaccac cgagaaggct aaggcacatt 240 tgaagggtgg tgccaagaag gttgtcatct ctgctccttc cgccgatgcc ccaatgtacg 300 ttatgggtgt caacaacgag acatacaatg gtgaagcaga tgtcatctcc aacgcttctt 360 gcacaaccaa ctgcttggct cctctcgcca aggtcatcaa cgatgagttc accatcattg 420 aaggtttgat gaccaccatt cactcctaca ctgccactca aaagaccgtt gatggtccat 480 ccgcaaagga ttggcgtgga ggacgtaccg ctgctcaaaa catcattcca tcgagcaccg 540 gtgccgccaa ggccgtcgga aaggtcattc cagagcttaa cggcaagctc accggaatgt 600 ctatgcgtgt tccaactgcc aacgtctcag ttgttgactt gactgtccgc attgagaagg 660 gtgcttctta tgatgagatc aaggaggtca tcaagaaggc tgctaatggt cctcttaagg 720 gtaagatact tcaacaatat ttattgcttt tcaatttact aataacgatg tacaggcata 780 ttggcttaca ccgaggacga tgttgtttcc actgacatga acggtgacaa ccactcctc 839 <210> 29 <211> 937 <212> DNA <213> sai01(B) <400> 29 cttcatcgag actgaatatg ccgtaagtcg ccgctaccgg acctcccaaa gacaccatgg 60 acccgagcta attttcattg tttgcaggca tacatgttga agtatgactc cactcacggt 120 caattcaagg gcgatatcaa ggtcctttcc gacggattgg aggtcaatgg caagaaggtc 180 aagttctaca ctgagagaga ccctgccaac atcccatggg ctgagtctga ggcatactac 240 gttgtcgagt ccaccggtgt tttcaccacc accgagaagg ctaaggcaca tttgaagggt 300 ggtgccaaga aggttgtcat ctctgctcct tccgccgatg ccccaatgta cgttatgggt 360 gtcaacaacg agacctacaa tggtgaagca gatgtcatct ccaacgcttc ttgcacaacc 420 aactgcttgg ctcctctcgc caaggtcatc aacgatgagt tcaccatcat tgaaggtttg 480 atgaccacca ttcactccta cactgccacc caaaagaccg ttgatggtcc atccgcaaag 540 gattggcgtg gaggacgtac cgctgctcaa aacatcattc catcgagcac cggtgccgcc 600 aaggccgtcg gaaaggtcat tccagagctt aacggcaagc tcaccggaat gtctatgcgt 660 gttccaactg ccaacgtctc agttgttgac ttgactgttc gcattgagaa ggctgcttct 720 tatgatgaga tcaaggaggt catcaagaag gctgctaatg gtcctcttaa gggtaagata 780 ctttacaaat acttattgct tttcagttta ctaataacga tgtttaggca tattggctta 840 caccgaggac gatgttgtct ctactgacat gaacggtgac aaccactcct ccatcttcga 900 tgccaaggcc tggtatctcc ctcaacaaga acttctc 937 <210> 30 <211> 879 <212> DNA <213> shi01(B) <400> 30 cgctaccgga cctcccaaag acaccatgga cccgaagcta attttcattg tttgcaggca 60 tacatgttga agtatgactc cactcacggt caattcaagg gcgatatcaa ggtcctttcc 120 gacggattgg aggtcaatgg caagaaggtc aagttctaca ctgagagaga ccctgccaac 180 atcccatggg ctgagtctga ggcatactac gttgtcgagt ccaccggtgt tttcaccacc 240 accgagaagg ctaaggcaca tttgaagggt ggtgccaaga aggttgtcat ctctgctcct 300 tccgccgatg ccccaatgta cgttatgggt gtcaacaacg agacctacaa tggtgaagca 360 gatgtcatct ccaacgcttc ttgcacaacc aactgcttgg ctcctctcgc caaggtcatc 420 aacgatgagt tcaccatcat tgaaggtttg atgaccacca ttcactccta cactgccacc 480 caaaagaccg ttgatggtcc atccgcaaag gattggcgtg gaggacgtac cgctgctcaa 540 aacatcattc catcgagcac cggtgccgcc aaggccgtcg gaaaggtcat tccagagctt 600 aacggcaagc tcaccggaat gtctatgcgt gttccaactg ccaacgtctc agttgttgac 660 ttgactgttc gcattgagaa ggctgcttct tatgatgaga tcaaggaggt catcaagaaa 720 gctgctaatg gtcctcttaa gggtaagata ctttacaaat acttattgct tttcagttta 780 ctaataacga tgtttaggca tattggctta caccgaggac gatgttgtct ctactgacat 840 gaacggtgac aaccactcct ccatcttcga tgccaaggc 879 <210> 31 <211> 899 <212> DNA <213> Botryotinia calthae strain LMK750 <400> 31 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc gaaactcccg gctacctagt ttcaaaattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctg ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagccg ccgtggaggc 420 tgttgttgaa tttttgcaaa agaacaagcg tgatatcaca accagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgtcatcac agtcaaggaa ggaaaaacca tggaggatga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat actttatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgccgtcc 780 tttggtcatc attgctgaag atattgatgg agaagctctc gctgtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg acaaccgaa 899 <210> 32 <211> 899 <212> DNA <213> Botryotinia convoluta strain LMK755 <400> 32 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag tttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggtttcggtg ataaccgag 899 <210> 33 <211> 899 <212> DNA <213> Botryotinia fuckeliana strain B05.10 <400> 33 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag ttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg ataaccgaa 899 <210> 34 <211> 899 <212> DNA <213> Botryotinia porri strain LMK19 <400> 34 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt cgccacaacc ttaggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaccccctg gctaccaagt tgtaaaattc 180 taattgttgg tgaatagatg gtgtaactgt tgccagagct atttccctca aggacaaatt 240 cgagaatctc ggtgctagac tcatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggtacc acaaccgcta ctgtccttgc caaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagccg ccgtggaggc 420 cgtcgttgag tttttgcaaa agaacaagcg tgatatcaca accagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggagaaggtt ggaaaggaag gtgtcatcac agtcaaggag ggaaagacca tggaggatga 600 actcgatatc accgagggaa tgagatttga ccgcggttat gtctccccat acttcatcac 660 cgataccaag tcgcaaaagg ttgaattcga gaaaccattg attctcctct ctgagaagaa 720 gatctcaaac gtccaagata ttatcccagc acttgaggca tctacccaac ttcgccgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gctgtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggtttcggcg acaaccgaa 899 <210> 35 <211> 936 <212> DNA <213> Botrytis cinerea DAOM:166439 <400> 35 tcaagttcgg tgttgagggc agagcagctc ttcttgctgg tgttgagact ttggcaaaag 60 ctgttgccac aaccctaggt ccaaaaggcc gaaatgttct tattgagtca gcatatggct 120 ccccaaagat cactaaaggt tcgtgaaatc cctcggttac ctagttataa aattctaatg 180 tttgtgaata gatggtgtaa ctgttgccag agctatttcc ctcaaggaca aattcgagaa 240 tctcggtgct agactcatcc aagatgttgc ctcgaaaacc aacgagaccg ctggtgatgg 300 aaccacaacc gctactgtcc ttgctaagtc tatcttctcc gagactgtaa agaacgtcgc 360 cgcaggatgc aacccaatgg atttgcgcag aggtacccag gccgccgtgg aggccgtcgt 420 tgagttttg caaaagaaca agcgtgatat cacaaccagc gaggaaattg cacaagttgc 480 gactatcagt gcaaacggtg atacccacat cggaaagttg attgcaaacg ctatggagaa 540 ggttggaaag gaaggtgtca tcacagtcaa ggagggaaag accatggagg atgaactcga 600 tattaccgag ggaatgagat ttgaccgcgg ttgtctct catacttca tcaccgatac 660 caagtcgcaa aaagtggaat tcgagaagcc attgattctc ctctccgaga agaagatctc 720 aaacgtccaa gatatcatcc cagcacttga ggcatccact caacttcgcc gtcctttggt 780 catcattgct gaagatatcg atggagaggc cctcgctgta tgcatcctta acaagctccg 840 tggtcaactc caagttgccg ctgtcaaggc ccccggtttc ggtgataacc gaaagtccat 900 tctcggcgat ctcggtatct tgaccaatgc tactgt 936 <210> 36 <211> 899 <212> DNA <213> Botrytis paeoniae strain LMK439 <400> 36 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt tgctacaacc ttgggtccca aaggccgaaa tgttcttatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaaactcccg gctacctagt ttcaagattc 180 taattattgg tgaatagatg gtgtaaccgt tgccagagct atttccctca aggacaaatt 240 cgagaacctc ggtgctagac ttatccaaga tgttgcctcg aaaaccaacg agaccgctgg 300 tgatggaacc acaaccgcta ctgtccttgc taaatctatt ttctccgaga ccgtaaagaa 360 cgtcgccgca ggatgcaacc caatggactt gcgcagaggt acccaagctg ccgtggaggc 420 cgttgttgag tttttgcaaa agaacaagcg tgatatcaca acaagcgagg aaatcgcaca 480 agttgcgact atcagtgcaa acggtgatac ccacatcgga aaattgattg ccaacgctat 540 ggaaaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaggacga 600 actcgatatt accgagggaa tgagatttga ccgcggttat gtttccccat acttcatcac 660 cgataccaag tcgcaaaagg tggaattcga gaagccattg attctccttt ctgagaagaa 720 gatttcaaac gtccaagata ttatcccagc acttgaggcg tctactcaac ttcgtcgtcc 780 tttggtcatc attgctgaag atatcgatgg agaagctctc gcagtatgca ttcttaacaa 840 gctccgtggt caactccaag ttgccgctgt caaggccccc ggttcggtg ataaccgaa 899 <210> 37 <211> 900 <212> DNA <213> Botrytis tulipae strain LMK76 <400> 37 aggagctcaa attcggtgtt gagggcagag cagctcttct tgctggtgtt gagactttgg 60 caaaagctgt cgccacaacc ctaggtccaa aaggccgaaa tgttcttatt gagtcagcat 120 acggctcccc gaagatcact aaaggtttgt gaaatcccccc ggccacctag ttgcaaaatt 180 ctaattgttg gtgaatagat ggtgtaactg ttgccagagc tatttccctc aaggacaaat 240 300. tcgagaatct cggtgctaga ctcatccaag atgttgcctc gaaaaccaac gagaccgctg gtgatggaac cacaaccgct actgtccttg ctaaatctat tttctccgag accgtaaaga atgtcgccgc aggatgcaac ccaatggact tgcgcagagg tacccaggcc gccgtggagg 420 ccgtcgttga gttttgcaa aaaaacaagc gtgatatcac aaccagcgag gaaatcgcac aagttgcgac tatcagtgca aacggtgata cccacatcgg aaaattgatt gccaacgcta tggagaaggt tggaagga ggtgtcatca cagtcaagga gggcaagacc atggaggatg aactcgatat taccgaggga atgagatttg accgcggtta tgtctcccca tacttcatca ccgataccaa gtcgcaaaaa gtggaattcg agaagccact gatcctcctc tccgagaaaa agatctcaaa cgtccaagat atcatcccag cacttgaggc atctactcaa cttcgccgtc ctttggtcat cattgctgaa gatatcgatg gagaggctct cgctgtatgc attctcaaca agctccgtgg tcaactccaa gttgctgctg tcaaggcccc cggttcggt gacaaccgaa 900 <210> 38 <211> 899 <212> DNA <213> Ciboria acerina strain LMK476 <400> 38 aggaactcaa gttcggtgtc gaaggcagag ctgccctcct cgctggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccta agggccgaaa tgttctcatt gagtcggcat 120 atggctctcc aaagattacc aaaggtttgc aaaatctcta gctatttatg tttaccattc 180 taattattgg taaccagatg gtgtaactgt cgcaagagcc atttccctca aagacaaatt 240 cgagaacctt ggtgcaagac ttattcaaga tgttgcctcg aaaaccaacg agactgccgg 300 tgacggaacc accagtgcaa ctgtccttgc taaatctatc ttctccgaga ccgtcaagaa 360 cgtcgctgct ggatgcaacc caatggactt acgtagaggt acccaagctg ctgtcgaagc 420 tgttgtcgac ttttgcaaa agaacaagcg cgatatcaca accagcgagg agatcgctca 480 agtcgcaacc atcagtgcaa acggtgacac tcacatcgga aaactgatcg caatgctat 540 ggagaaggtt ggaaaggaag gtgtgatcac agtcaaggaa ggaaagacca tggaggatga 600 actcgacatc accgagggaa tgagattcga ccgcggctac gtctctccat acttcatcac 660 tgacaccaag tctggaaagg ttgaattcga gaagccattg atcctcctct ccgagaagaa 720 gatctccaac gtccaagata tcatcccagc tcttgaggca tccacccagc tccgtcgtcc 780 tttggtcatc attgctgagg atatcgacgg tgaggctctc gctgtctgca ttcttaacaa 840 gctccgtggt caactccaag ttgcagctgt caaggcacca ggcttcggtg acaatcgaa 899 <210> 39 <211> 898 <212> DNA <213> Dumontinia tuberosa strain LMK749 <400> 39 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggttcgc aaactcttgg ctactttaat gcaaaattct 180 aactgttggt gaacagatgg tgtgacggtt gccagagcga ttactctcaa ggacaaattc 240 gagaatctcg gcgctagact aattcaagat gttgcctcaa aaactaacga gacagccggt 300 gatggaacca caaccgcaac tgtcctcgcc aaatctatct tctccgagac tgtaaagaac 360 gttgctgcag gatgcaaccc aatggacttg cgcaggggta cacaggctgc cgtggaagct 420 gttgttgagt ttttgcaaaa aaacaagcgt gatatcacaa ccagcgagga aatcgcacaa 480 gtcgcaacta tcagtgcaaa cggtgatacc catattggaa aattgattgc caacgccatg 540 gagaaggtgg gaaaggaggg tgtaatcaca gttaaggaag gaaagaccat ggaagatgaa 600 ctcgatatta ccgagggaat gagatttgac cgcggttatg tctcgccata cttcattact 660 gataccaagt cgcaaaaagt ggagttcgag aagccattga ttctcctctc cgagaagaag 720 atctcaaacg ttcaagacat tatcccagca ctcgaggcat ctacccaact tcgccgtcct 780 ttggttatca ttgctgaaga tattgacgga gaagctctcg cggtgtgcat tctcaataag 840 ctccgcggtc aactccaagt tgcagctgtc aaggcacccg gcttcggcga caaccgaa 898 <210> 40 <211> 902 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 40 aggaactcaa gtttggcgtt gaaggtagag cagctcttttt ggctggtgtt gaaactttgg 60 caaaggctgt cgccacaact ttgggaccga agggccgaaa cgttttgatc gagtctgcct 120 atggctcacc taagattacc aagggttgc ccacctaccc caattgttct tggtagctct 180 ctgacttgtg tgttgtgtag atggtgtcac tgtggccaaa gccattaccc tccaagacaa 240 attcgaaaac ctcggtgctc gcctcatcca agatgtcgcc tcgaaaacaa acgagactgc 300 tggtgatgga accactaccg ctactgtgct tgcaaaatcc atcttctccg agactgtgaa gaatgttgcc gcaggatgca acccaatgga tctgcgaaga ggtacacaag ctgccgttga agcagttgtt gaatttttac aaaagaacaa gcgtgatatc actaccagcg aggaaattgc gcaagttgcc accatcagtg caaatggtga cacccacatt ggtaattga ttgccagcgc aatggagaaa gttggaaagg agggtgtcat cacagtcaag gaggaaga ctatggaaga tgagctagat gtcaccgaag gaatgagatt cgaccgaggt tatgtctcac catatttcat cacagacacc aaatcgcaga aagttgagtt tgagaagcca ttgatccttc tttctgagaa gaagatctct agcgttcaag atatcattcc cgcacttgaa gcttccacac aacttcgtcg tcctttggtt atcattgcag aggatatcga tggagaagct ctcgccgtgt gcatcctgaa 840 caagcttcgt ggtcaactcc aagtcgctgc tgtcaaggct cctggatttg gtgataaccg aa 902 <210> 41 <211> 900 <212> DNA <213> Monilinia aucupariae strain LMK733 <400> 41 aggagctcaa attcggtgtt gatgccagag cctctcttct cgtcggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccta agggccgtaa tgttctcatc gagtcagcat 120 atggctcccc aaagattacc aaaggtttgg caaaacttct agatatttat ggtcacaatt 180 ctaattcttc gtaaacagat ggtgtaactg ttgccagagc cattactctc aaggacaaat 240 ttgagaatct tggtgccaga cttattcaag atgttgcctc gaaaactaac gagactgctg 300 gtgatggaac tacaaccgca actgtccttg ccaaatctat cttctccgaa accgtaaaaa 360 atgttgctgc gggatgcaac ccaatggatt tgcgtagagg tacacaagct gctgtggaag 420 ctgttgtcga gttcttgcag aagaacaagc gcgatatcac aactagcgag gagatcgcac 480 aagttgcaac tattagtgca aatggtgata cccacgtcgg aaagttgatt gccaatgcta 540 tggaaagggt tggaaaggaa ggtgtgatca cagttaagga aggaaagacc atggaagatg 600 aactcgatat cactgaggga atgcgatttg accgcggtta tgtctcccca tacttcatca 660 ccgataccaa gtcgcagaag gtagaattcg agaagccgtt gatcctcctc tctgagaaga 720 agatctcgaa cgttcaagac attatcccag ctcttgaggc atccactcaa ctccgccgcc 780 cattggtcat tattgctgag gatattgatg gagaagctct cgctgtatgc atccttaaca 840 agcttcgtgg ccaacttcaa gttgctgctg tcaaggcccc cggcttcggc gacaaccgaa 900 <210> 42 <211> 899 <212> DNA <213> Monilinia fructicola strain LMK125 <400> 42 aggagctcaa attcggtgtt gaaggcagag cagctctcct cgccggtgtt gagactttgg 60 ccaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat 120 atggctctcc aaaaattacc aaaggtttgg aaacccgttc gacatctatg attacaactc 180 taattgttcg taaacagatg gtgtaacagt tgccagagct attactctta aagataaatt 240 cgagaatctt ggtgcaagac taattcaaga tgttgcctcc aaaaccaacg agactgccgg 300 tgatggaact acaaccgcaa ctgtccttgc aaaatccatc ttctccgaga ctgtaaagaa 360 tgttgccgca ggatgcaacc caatggactt gcgcagaggt acacaagctg ccgtggaagc 420 tgtcgttgag tttttgcaga agaacaagcg cgatatcaca actagcgaag aaatcgctca 480 agttgcaact atcagtgcaa atggtgatac ccatatcgga aagttgattg ccaatgctat 540 ggaaaaggtt ggtaaagaag gtgtgattac agttaaggaa ggaaagacca tggagagatga 600 acttgacatc accgagggta tgagatttga ccgcggttat gtatccccat acttcatcac 660 cgataccaag tcgcaaaag tagaattcga gaaaccattg atcctcctct ctgagaagaa 720 780. gatctcgac gtccaagaca ttattccagc tcttgaggca tctactcaac tccgtcgtcc attagtcatt attgctgaag acattgatgg agaagccctt gctgtatgca ttcttaacaa actccgtggt caactccaag ttgctgctgt caaagctccc ggctttggcg acaaccgaa <210> 43 <211> 899 <212> DNA <213> Monilinia megalospore strain LMK415 <400> 43 aggagctgaa attcggtgtt gaaggcagag ccgctctcct cgccggtgtt gagactttgg 120. caaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat atggctcccc aaagattact aaaggtttga aaaacttcta gatatttt gttacaattc tattgttcg taaacagatg gtgtaactgt tgccagagcc attactctca aggataatt tgagaatctt ggtgccagac ttattcaaga tgttgcctcg aaaaccaacg agactgctgg tgatggaact acaaccgcaa ctgtccttgc caaatccatc ttctccgaaa ctgtaaaaaa tgttgccgcg ggatgcaacc caatggattt gcgcagaggt acacaagctg ctgtggaagc 420 tgttgtcgag ttcttgcaga agagcaagcg cgatatcaca actagcgagg agatcgcaca 480 agttgcaact atcagtgcaa atggtgatac ccacgtcgga aaattgattg ccaatgctat 540 ggagagggt ggaaaggaag gtgtgatcac agttaaggaa ggaaagacca tggaagatga 600 actcgatgtc actgagggaa tgagatttga ccgcggttat gtctccccat acttcatcac 660 cgataccaag tcgcagaagg tagaattcga gaagccattg atcctcctct ctgagaagaa 720 gatctcgaac gtccaagaca ttatcccagc tcttgaggca tccactcaac tccgccgtcc 780 attggtcatt attgctgagg atattgatgg agaagctctc gctgtatgca tccttaacaa 840 gctccgtggt caactccaag ttgctgctgt caaggccccc ggctcggcg acaaccgaa 899 <210> 44 <211> 898 <212> DNA <213> Monoline urnula strain LMK413 <400> 44 aggagctcaa attcggtgtt gaaggcagag ccgctctcct cgccggcgtt gagactttgg 60 cgaaggctgt tgccacaact ttgggaccta aaggccgtaa tgttctcatt gagtcagcat 120 atggctcccc aaagattact aaaggtttgg aaaacttcta gatctttact gttacaactc 180 taattgtcgt aaacagatgg tgtaactgtt gccagagcca ttactctcaa ggacaaattt 240 gagaatcttg gtgccagact tattcaagat gttgcctcga aaaccaacga gactgctggt 300 gatggaacta caaccgcaac tgtccttgcc aaatctatct tctccgaaac cgtaaaaaat 360 gttgccgcgg gatgcaaccc aatggatttg cgcagaggta cacaagctgc tgtggaagct 420 gttgtcgagt tcttgcagaa aaataagcgc gatatcacaa ctagcgagga gatcgcacaa 480 gttgcaacta tcagtgcaaa tggtgatacc cacgtcggaa agttgatagc caatgctatg 540 gagagggttg gaaaggaagg tgtgatcaca gtcaaggaag gaaagaccat ggaagatgaa 600 ctcgacgtca ctgagggaat gagatttgac cgcggttatg tctccccata cttcatcacc 660 gataccaagt ctcagaaggt agaattcgag aagccattga ttctcctctc tgagaagaag 720 atctcgaacg ttcaagacat tatcccagct cttgaggcat ccactcaact ccgccgtcca 780 ttggtaatta ttgctgagga tattgatgga gaagctctcg ctgtatgcat ccttaacaag 840 ctccgtggtc aactccaagt tgctgctgtc aaggcccccg gcttcggcga caaccgaa 898 <210> 45 <211> 896 <212> DNA <213> Myriosclerotinia curreyana strain LMK736 <400> 45 aggaactcaa atttggtgtt gaaggcagag cagctctact tgctggtgtt gagactttgg 60 caaaggctgt tgccacaact ttgggaccaa aaggccgcaa tgttcttatt gagtcagcat 120 acggctcccc aaagatcacc aaaggtttgc aaacttcccc aattatgtgt acaattctaa 180 tcgttggtga ccagatggtg taactgttgc cagagccatt actctcaagg acaaattcga 240 gaatctcggt gctagactta ttcaagatgt cgcctcgaag accaacgaga ctgccggtga 300 tggaacca accgcaaccg tccttgccaa atctatcttc tccgagactg taagaacgt 360 tgctgcagga tgcaacccaa tggatttgcg cagaggtaca caagctgctg tggaggccgt 420 480 tgcaaccatc agtgcaaacg gcgacaccca catcggaaag ttaattgcca atgctatgga 540 gaaggttgga aaaggtg tgatcacagt caaggaagga aaaaccatgg aagacgaact 600 cgatattacc gaggaatga gatttgaccg cggttatgtc tctccatact tcatcactga 660 taccaagtcg caaaaggttg aattcgagaa accattgatc ctcctttctg agaagagat 720 ttcaaacgtt cagatatca tcccagcact tgaggcatcc actcaactcc gtcgtccttt 780 ggtcatcatt gctgagata tcgatggaga ggctctcgct gtgtgcattc ttaacaagct 840 ccgtggtcaa ctccaagttg cggctgttaa ggcaccagga tttggtgaca accgaa <210> 46 <211> 900 <212> DNA <213> Myriosclerotinia scirpicola strain LMK735 <400> 46 aggagctcaa attcggtgtt gaaggcagag cagctctcct tgctggtgtt gagactttgg 120. caaaagctgt tgccactact ttgggaccta aaggccgcaa tgttcttatt gagtcagcat atggctcccc aaaaatcacc aaaggtttgc aaaccttcct aattattggt gtgcgcaatt 180 ctaatcgatg gtgactagat ggtgtaactg ttgccagagc tattactctc aaggacaaat tcgagaatct cggtgctaga cttattcaag atgtcgcctc caagaccac gagactgccg gtgatggaac tacaaccgca accgtccttg ccaaatctat cttctccgag actgtaaaga atgttgctgc aggatgcaac ccaatggact tgcgcagagg tacacaagct gctgtggagg ccgttgttga gtttttgcaa aagaacaagc gtgatattac aactagtgag gaaatcgcac aagttgcaac tatcagtgca aacggcgaca cccacatcgg aaaattgatt gccaatgcca 540 tggagaaggt tggaaaggaa ggtgtgatca cagtcaagga aggaaagact atggaggatg 600 aacttgatat caccgaggga atgagatttg accgtggtta tgtctctcca tacttcatca 660 ctgatacaaa gtcgcaaaag gttgaattcg agaagccact gatcctcctc tctgagaaga 720 agatctcaaa cgttcaagat attatcccag cacttgaagc atccactcaa ctccgtcgtc 780 ctttggtcat cattgctgaa gatatcgatg gagaggctct cgctgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcggctg tcaaggcacc aggatttggc gacaaccgaa 900 <210> 47 <211> 899 <212> DNA <213> Sclerotinia glacialis strain LMK74 <400> 47 aggagctcaa attcggtgtt gaaggcagag cagctctcct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgc aaacccttga ctacttttaa tgcaaaaatc 180 taactgttgc tgaacagatg gtgtgactgt tgccagagcg attactctca aggacaaatt 240 cgagaatctc ggtgctagac ttatccaaga tgttgcctca aaaaccaacg agacagctgg 300 tgatggaacc acaactgcaa ctgtccttgc caaatctatc ttctctgaga ctgtaaagaa 360 cgttgctgca ggatgcaacc caatggactt gcgcaggggt acacaggctg ccgtggaagc 420 tgttgttgag tttttacaaa agaacaagcg tgatatcacg accagcgagg aaatcgcaca 480 agtcgcaact atcagtgcaa acggtgatac ccacattgga agattgattg ccaacgccat 540 ggagaaggtt ggaaaggaag gtgttatcac agttaaggaa ggaaagacca tggaagatga 600 actcgatatt accgagggaa tgagatttga ccgtggttat gtctcgccat acttcatcac 660 tgataccaag tcgcaaaaag tggagttcga gaagccattg attctcctct ccgagaagaa 720 gatctcaaac gttcaagaca ttatcccagc acttgaggca tctactcaac ttcgccgtcc 780 tttggtcatc attgctgaag atattgacgg agaagctctc gctgtgtgca ttctcaacaa 840 gctccgtggt caactccaag ttgcagctgt caaggcaccc ggctcggcg acaaccgaa 899 <210> 48 <211> 897 <212> DNA <213> Sclerotinia minor strain W10 <400> 48 aggagctcaa atttggtgtc gaaggcagag cagctcttttt ggctggtgtt gagactcttg 60 caaaggctgt tgctacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggttcccc aaagatcacc aaaggtttgc aaattcctgg ccactttgaa tgcggaattc 180 taacttggta aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg 240 agaaccttgg tgctagactt attcaagatg tggcctcaaa aaccaacgag acagctggtg 300 atggaccac aaccgcaact gtgcttgcca aatctatctt ctccgagacc gtaaagaacg 360 ttgctgcagg atgcaaccca atggatctgc gcagaggtac acaagctgcc gtagaagctg 420 ttgttgagtt tttgcaaaag aacaagcgtg atatcacgac cagcgaggaa atcgcacaag 480 tcgcgaccat cagtgcaaat ggcgataccc acatcggaaa attgattgcg aacgccatgg 540 agaaggttgg aaaggaaggt gtaatcacag ttaaggaagg aaagaccatg gaagatgaac 600 tcgatattac cgaggggatg agatttgacc gcggttacgt ctcgccatac ttcatcaccg 660 acaccaagtc gcaaaaagtg gagttcgaga agccattgat tctcctctct gagaagaaga 720 tctcaaacgt tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt 780 tggtcatcat tgctgaagat attgacggtg aagcactcgc tgtgtgcatt ctcaacaagc 840 tccgtggtca gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgag 897 <210> 49 <211> 904 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 49 aggagctcaa attcggtgtt gaaggcagag cagctctttt ggctggtgtg gagactttag 60 caaaggctgt tgccacaacc ctaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcact aaaggtttgc aaattcttca aaaggcttct ttgaatgcac 180 aattctaact gttggtgaac agatggtgta actgttgcta gagcgattac tctcaaggat 240 aaattcgaga atctcggtgc tagacttatt caagatgttg cctcaaaaac caacgagaca 300 gctggtgatg gaaccacaac cgcaactgtc cttgccaaat ctatcttctc cgagactgta 360 aagaacgttg ctgcaggatg caacccaatg gacttgcgca ggggtacaca ggctgctgta 420 gaagctgttg ttgagttttt gcaaaagaac aaacgtgata tcacgaccag cgaggaaatt 480 gcacaagtcg caactatcag tgcaaatggc gatacccaca ttggaaaatt gattgccaac 540 gccatggaga aggttggaaa ggaaggtgta atcacagtta aggaaggaaa gaccatggaa 600 gatgaactcg acattaccga gggaatgaga tttgaccgcg gttacgtctc gccatacttc 660 atcaccgaca ccaagtcgca aaaagtggag ttcgagaagc cattgattct cctctctgag 720 aagaagatct caaacgttca agacattatc ccagcacttg aggcatctac tcaacttcgt 780 cgtcctttgg tcatcattgc tgaggatatt gatggagagg cactcgctgt gtgcattctc 840 aacaagctcc gtggtcaact ccaagttgca gctgtcaagg cacccggctt cggcgacaac 900 cgaa 904 <210> 50 <211> 897 <212> DNA <213> Sclerotinia trifoliorum strain LMK47 <400> 50 aggagctcaa attcggtgtt gaagccagag cagctcttttt ggctggtgtt gagactctag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgc aaattcttgg ctagtttgaa tgcaaaattc 180 taacttggtg aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg 240 agaatctcgg tgctagactt attcaagatg tggcctcaaa aaccaacgag acagctggtg 300 atggaaccac aaccgcaact gtccttgcca aatccatctt ctccgagacc gtaaagaacg 360 ttgctgcagg atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg 420 ttgttgagtt tttgcaaaag aacaagcgtg atatcacgac cagcgaggaa atcgcacaag 480 tcgcaaccat cagtgcaaat ggcgataccc acatcggaaa attgattgcc aacgccatgg 540 agaaggttgg aaaggaaggt gtaatcacag ttaaggaagg aaagaccatg gaagatgaac 600 tcgatattac cgaaggaatg agatttgacc gcggttacgt ctcgccatac ttcatcaccg 660 acaccaagtc actaaaagtg gagtttgaga agccattgat tctcctctct gagaagaaga 720 tctcaaacgt tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt 780 tggtcatcat tgctgaagat attgacggtg aagcactcgc tgtggcatc ctcaataagc 840 tccgtggtca actccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaa 897 <210> 51 <211> 900 <212> DNA <213> Sclerotium cepivorum strain LMK1 <400> 51 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttttgatt gagtcagcat 120 atggctcccc aaagatcacc aaaggtttgt gaaactcttg gttactttaa atgcaaaatt 180 ctaactgttg gtgaacagat ggtgtgactg ttgccagagc gattactctc aaggacaaat 240 tcgagaatct cggtgctaga cttattcaag atgttgcctc gaaaaccaac gagacagctg 300 gtgatggaac cacaaccgca actgtccttg ccaaatctat cttctccgag actgtaaaaa 360 atgttgctgc aggatgcaac ccaatggact tgcgcagggg tacacaggct gccgtggaag 420 ctgttgttga gttttgcaa aagaacaagc gtgatatcac aaccagcgag gaaatcgcac 480 aagtcgcaac tatcagtgca aacggtgata cccacattgg aaaattgatt gccaacgcca 540 tggagaaggt tggaaaggaa ggtgtgatca cagttaagga aggaaagacc atggaggatg 600 aactcgatat taccgaggga atgagatttg accgcggtta tgtctcgcca tacttcatca 660 ctgataccaa gtcgcaaaag gtggagtttg agaagccatt gattctcctc tccgagaaga 720 agatctcaaa cgttcaagac attatcccag cacttgaggc atctactcaa cttcgccgtc 780 ctttggtcat cattgctgaa gatattgacg gagaagctct cgccgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcagctg tcaaggcacc cggcttcggc gacaaccgaa 900 <210> 52 <211> 900 <212> DNA <213> Sclerotium cepivorum strain LMK71 <400> 52 aggagctcaa attcggtgtt gaaggcagag cagctcttct ggctggtgtt gagactttag 60 caaaggctgt tgccacaacc ttaggaccca aaggacgaaa tgttgatt gagtcagcat 120 atggctcccc aagatcacc aaagtttgt gaactcttg gttactttaa atgcaaatt 180 ctaactgttg gtgaacagat ggtgtgactg ttgccagagc gattactctc aaggacaaat 240 tcgagaatct cggtgctaga cttattcaag atgttgccctc gaaaaccaac gagacagctg 300 gtgatggaac cacaccgca actgtccttg ccaatctat cttctccgag actgtaaaaa 360 atgttgctgc aggatgcac ccaatggact tgcgcagggg tacacaggct gccgtggaag 420 ctgttgttga gttttgcaa aagaacaagc gtgatatcac aaccagcgag gaatcgcac 480 aagtcgcaac tatcagtgca aacggtgata cccacattgg aaaattgatt gccaacgcca 540 height height gtgtgatca height height heightcc height 600 aactcgatat taccgaggga atgagatttg accgcggtta tgtctcgcca tacttcatca 660 ctgataccaa gtcgcaaaag gtggagtttg agaagccatt gattctcctc tccgagaaga 720 agatctcaaa cgttcaagac attatcccag cacttgaggc atctactcaa cttcgccgtc 780 ctttggtcat cattgctgaa gatattgacg gagaagctct cgccgtgtgc attctcaaca 840 agctccgtgg tcaactccaa gttgcagctg tcaaggcacc cggcttcggc gacaaccgaa 900 <210> 53 <211> 1004 <212> DNA <213> MAFF239143(A) <400> 53 atagatttgt ttaattgttt aaatttatgc taatcatttt gtcatttagg agctcaaatt 60 cggtgttgaa gccagagcag ccttctggc tggtgttgag actttagcaa aggctgttgc 120 cacaacctta ggacccaaag gacgaaatgt tttgattgag tcagcatatg gctccccaaa 180 gatcaccaaa ggtttgcaaa actcttggtt actttaaatg caaaatccta actgttggtg 240 aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg agaatctcgg 300 tgctagactt attcaagatg ttgcctcgaa aaccaacgag acagctggtg atggaaccac 360 aaccgcaact gtccttgcca aatctatctt ctccgagact gtaaaaaacg ttgctgcagg 420 atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg ttgttgagtt 480 tttgcaaaag aacaagcgtg atatcacaac cagcgaggaa atcgcacaag tcgcaactat 540 cagtgcaaac ggtgataccc acattggaaa attgatagcc aacgccatgg agaaggttgg 600 aaaggaaggt gtgatcacag ttaaggaagg aaagaccatg gaggatgaac ttgatattac 660 cgagggaatg agatttgacc gcggttatgt ctcgccatac ttcatcactg ataccaagtc 720 gcaaaaggtg gagttcgaga agccattgat tctcctctcc gagaagaaga tctcaaacgt 780 tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt tggtcatcat 840 tgctgaagat attgacggag aagctctcgc tgtgtgcatt ctcaacaagc tccgtggtca 900 gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaaagt ccattcttgg 960 cgatctcggt atcttaacca atgccaccgt cttactgat gagc 1004 <210> 54 <211> 1004 <212> DNA <213> chi01(A) <400> 54 atagatttgt ttaattgttt aaatttatgc taatcatttt gtcatttagg agctcaaatt 60 cggtgttgaa gccagagcag ccttctggc tggtgttgag actttagcaa aggctgttgc 120 cacaacctta ggacccaaag gacgaaatgt tttgattgag tcagcatatg gctccccaaa 180 gatcaccaaa ggtttgcaaa actcttggtt actttaaatg caaaatccta actgttggtg 240 aacagatggt gtgactgttg ccagagcgat tactctcaag gacaaattcg agaatctcgg 300 tgctagactt attcaagatg ttgcctcgaa aaccaacgag acagctggtg atggaaccac 360 aaccgcaact gtccttgcca aatctatctt ctccgagact gtaaaaaacg ttgctgcagg 420 atgcaaccca atggacttgc gcaggggtac acaggctgcc gtggaagctg ttgttgagtt 480 tttgcaaaag aacaagcgtg atatcacaac cagcgaggaa atcgcacaag tcgcaactat 540 cagtgcaaac ggtgataccc acattggaaa attgatagcc aacgccatgg agaaggttgg 600 aaaggaaggt gtgatcacag ttaaggaagg aaagaccatg gaggatgaac ttgatattac 660 cgagggaatg agatttgacc gcggttatgt ctcgccatac ttcatcactg ataccaagtc 720 gcaaaaggtg gagttcgaga agccattgat tctcctctcc gagaagaaga tctcaaacgt 780 tcaagacatt atcccagcac ttgaggcatc tactcaactt cgccgtcctt tggtcatcat 840 tgctgaagat attgacggag aagctctcgc tgtgtgcatt ctcaacaagc tccgtggtca 900 gctccaagtt gcagctgtca aggcacccgg cttcggcgac aaccgaaagt ccattcttgg 960 cgatctcggt atcttaacca atgccaccgt ctttactgat gagc 1004 <210> 55 <211> 1001 <212> DNA <213> sai01(B) <400> 55 gatttacttg attgttcaat tttatgctaa tcttttgtc atttaggagc tcaaattcgg 60 tgttgaaggc agagcagctc ttctggctgg tgttgagact ttagcaaagg ctgttgccac 120 aaccttagga cccaaaggac gaaatgtttt gattgagtca gcatatggct cccaaagat 180 caccaaaggt ttgtgaaact cttggttact ttaaatgcaa aattctaact gttggtgaac 240 agatggtgtg actgttgcca gagcgattac tctcaaggac aaattcgaga atctcggtgc 300 tagacttatt caagatgttg cctcgaaaac caacgagaca gctggtgatg gaaccacaac 360 cgcaactgtc cttgccaaat ctatcttctc cgagactgta aaaaacgttg ctgcaggatg 420 caacccaatg gacttgcgca ggggtacaca gggctccgtg gaagctgttg ttgagttttt 480 gcaaaagaac aagcgtgata tcacaaccag cgaggaaatc gcacaagtcg caactatcag 540 tgcaaacggt gatacccaca ttggaaaatt gattgccaac gccatggaga aggttggaaa 600 ggaaggtgtg atcacagtta aggaaggaaa gaccatggag gatgaactcg atattaccga 660 gggaatgaga tttgaccgcg gttatgtctc gccatacttc atcactgata ccaagtcgca 720 aaaggtggag tttgagaagc cattgattct cctctccgag aagaagatct caaacgttca 780 agacattatc ccagcacttg aggcatctac tcaacttcgc cgtcctttgg tcatcattgc 840 tgaagatatt gacggagaag ctctcgccgt gtgcattctc aacaagctcc gtggtcaact 900 ccaagttgca gctgtcaagg caccggctt cggcgacaac cgaaagtcca ttcttggcga 960 tctcggtatc ttgaccaatg ccaccgtctt tactgatgag c 1001 <210> 56 <211> 1011 <212> DNA <213> shi01(B) <400> 56 cataaacata gatttacttg attgttcaat tttatgctaa tcttttgtc atttaggagc 60 tcaaattcgg tgttgaaggc agagcagctc ttctggctgg tgttgagact ttagcaaagg 120 ctgttgccac aaccttagga cccaaaggac gaaatgtttt gattgagtca gcatatggct 180 ccccaaagat caccaaaggt ttgtgaaact cttggttact ttaaatgcaa aattctaact 240 gttggtgaac agatggtgtg actgttgcca gagcgattac tctcaaggac aaattcgaga 300 atctcggtgc tagacttatt caagatgttg cctcgaaaac caacgagaca gctggtgatg 360 gaaccacaac cgcaactgtc cttgccaaat ctatcttctc cgagactgta aaaaatgttg 420 ctgcaggatg caacccaatg gacttgcgca ggggtacaca ggctgccgtg gaagctggttg 480 ttgagttttt gcaaaagaac aagcgtgata tcacaaccag cgaggaaatc gcacaagtcg 540 caactatcag tgcaaacggt gatacccaca ttggaaaatt gattgccaac gccatggaga 600 aggttggaaa ggaaggtgtg atcacagtta aggaaggaaa gaccatggag gatgaactcg 660 atattaccga gggaatgaga tttgaccgcg gttatgtctc gccatacttc atcactgata 720 ccaagtcgca aaaggtggag tttgagaagc cattgattct cctctccgag aagaagatct 780 caaacgttca agacattatc ccagcacttg aggcatctac tcaacttcgc cgtcctttgg 840 tcatcattgc tgaagatatt gacggagaag ctctcgccgt gtgcattctc aacaagctcc 900 gtggtcaact ccaagttgca gctgtcaagg cacccggctt cggcgacaac cgaaagtcca 960 ttcttggcga tctcggtatc ttgaccaatg ccaccgtctt tactgatgag c 1011 <210> 57 <211> 425 <212> DNA <213> Botryotinia calthae strain LMK75 <400> 57 ttctccctct tcgtacgtta atattcccaa cttgatactc tcagccctat ggacacttgg 60 cagggcatgt ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac atccatatta ttcctttggc attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc acccagccc ctatctcaa caatgtacc ataatgggg 240 acagcgacac aaatgggcag aacaacgtag agagacagca ctgatatatg gatctatagg 300 acaaatcact agcaggagt tgggcaccgt tatgcgatcc cttggtcaaa acccttccga 360 gtccgagttg caacatga tcaacgaggt cgatgctgac aacaacggta ccattgattt 420 pp. 425 <210> 58 <211> 424 <212> DNA <213> Botryotinia convoluted strain LMK755 <400> 58 ttctccctct ttgtacgtta atattcccta cttgatactc tcagccctt ggacacttgg 60 caggcatat tgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttccttgaca ttgcagatct cgaatatcct cctgtgttta 180 cacacttgcc ctctcgaccg ccccagcccc tatcccgaac aatcgtacca ataatgggga 240 caacgacgca aattggcaga acaatgtaga gaggcagcac tgatatatgg atttatagga 300 caaatcacta gcaaggagtt gggtaccgtc atgcgatccc ttggtcaaaa cccttccgag 360 tccgagttgc aagacatgat caacgaggtc gatgctgaca acaacggtac cattgatttc 420 ccag 424 <210> 59 <211> 425 <212> DNA <213> Botryotinia fuckeliana strain B05.1 <400> 59 ttctccctct ttgtacgttg atattcccta cttgatactc tcagccctat ggacacttgg 60 cagggcatat ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttcctttgaa attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc gcccagccc ctatctcgaa caattgtacc aataatgggg 240 acagcgacgc aaatcggcag aacaatgtag agagacagca ctgatatatg gatctatagg 300 acaaatcact agcaaggagt tgggaaccgt catgcgatcc cttggtcaaa acccttccga 360 gtccgagttg caagacatga tcaacgaggt cgatgctgac aacaacggta ccattgattt 420 cccag 425 <210> 60 <211> 395 <212> DNA <213> Botryotinia porri strain LMK1 <400> 60 ggatactctc agccctatgg acacttggca gggcatgttt gaagttttga aggctaataa 60 gctgtgactt tacaggacaa gaatggcgat ggttcgtact tccaaatttt tcctttgaca 120 ttgcagatct cgagaatccc ccctgtgttc acatacttgc cctctcgacc aacccagccc 180 ctatgtcgaa caatagtacc ggcaatgggg acaacgacac agattggcca aacaatatag 240 aaggacaaca ctgatatatg gatctacagg acaaatcact agcaaggaat tgggaaccgt 300 catgcgatcc cttggtcaaa acccttccga gtccgagttg caagacatga tcaacgaggt 360 cgatgctgac aacaacggta ccattgattt cccag 395 <210> 61 <211> 499 <212> DNA <213> Botrytis cinerea DAOM:16643 <400> 61 gaggccttct ccctctttgt atgttcatat tcccacctcg acactctcag ccctatggac 60 acttggcagg gcatactga agatttgaaa acttaataac tgtgacttta taggacaaga 120 atggtgatgg ttcgtacttc catgttgttc ctttgacatt gcagatctcg aagattcccc 180 tgtgttcata tacttgccct ctcgaccaag gcagccccta tctcaaacaa ttgtgacaac 240 aatggggac aaccacacaa tttggcataa caatacagga cagcactgat atatggatct 300 acaggacaaa tcactagcaa ggagttgggc actgttatgc gatccctcgg acagaaccct 360 tccgagtccg agttgcaaga catgatcaac gaggtcgatg ctgacaacaa cggcaccatt 420 gatttcccag gtatggcgca acacattgag gttcctgtct caaaatgctg acgcgattag 480 aatttcttac catgatggc 499 <210> 62 <211> 426 <212> DNA <213> Botrytis paeoniae strain LMK43 <400> 62 ttctccctct ttgtacgttg atattcccta cttgatactc tcagccctat ggacacttgg 60 cagggcatat ttgaagattt gaaagctaat agctgtgact ctacaggaca agaatggtga 120 tggttcgtac ttccatatta ttcctttgaa attgcagatc tcgaatatcc tcctgtgttt 180 acacacttgc cctctcgacc gcccccagcc cctatctcga acaattgtac caataatggg 240 gacaacgacg caaatcggca gaacaatgta gagagacagc actgatatat ggatctatag 300 gacaaatcac tagcaaggag ttgggcaccg tcatgcgatc ccttggtcaa aacccttccg 360 agtccgagtt gcaagacatg atcaacgagg tcgatgctga caacaacggt accattgatt 420 tcccag 426 <210> 63 <211> 422 <212> DNA <213> Botrytis tulipae strain LMK7 <400> 63 ttctccctat ttgtatgttc acaaacccac ctcgatactc tcagccctat ggacacttg 60 cagggcataa ttgaagattt gaaagctaat aagctgtgac tttgtaggac aagaatggcg 120 atggttcgta cttctataat attcctttga tattccagat ctcgaaaatc cccctgtggt 180 cacatacttg ccctctcgat cagcccctat ctcaaacaat cgtaaccaca atgggggaca 240 accacacaaa ttggcagaac aataaagaag gtcagcactg atatatggat ctacaggaca 300 aatcactagc aaggagttgg ggaccgttat gcgatccctt ggtcaaaatc cttccgagtc 360 cgagttgcaa gacatgatca acgaggtcga tgctgacaac aacggtacca ttgatttccc 420 of 422 <210> 64 <211> 428 <212> DNA <213> Ciboria acerina strain LMK476 <400> 64 ttctccctct ttgtaagtta tttatccaa ctttgcaact accatctcag ccctatggac 60 acttggcagg gcatattgga agatttggaa gctaataagt tgctacttct caggacaaaa 120 atggtgatgg ttagtactct cagcttggat actcgatggc atgaatccgc tatcttctcc 180 ttcattcacc tacttctgat ttcggtccaa ccctatatc gaacaactgt accaacaagg 240 atgacaacat tactatcaag catgacaatg catgagggct tggctgatat gcgatttcat 300 aggacaaatc actagcaagg agttgggcac cgttatgcga tcacttggac aaaacccttc 360 cgagtccgag ttgcaagaca tgatcaacga ggtcgatgcc gacaacaacg gtaccatcga 420 ttttccag 428 <210> 65 <211> 424 <212> DNA <213> Dumontinia tuberosa strain LMK74 <400> 65 ttctccctct tcgtaagttc atctttctaa cttttacaat ctcagctcta tggacacttg 60 gcagggtata tttgaagatt ggatagctaa taatttatga ctttatagga caaatggt 120 gatggttagt aatttcagat tatactttcc atatcctaga tcactctcc tcctttatct 180 acatgctaga catcctgacc gandacggccc ctatctcgaa cagttgtatt aacaaggggg 240 gcaatacac gattaagcat gatacag aggacagcgc tgatatatga attcatagga 300 caaatcacta gcaggagtt gggtaccgtt atgcgatccc ttgggcaaa cccttccgag 360 tctgagttgc aagacatgat taatgaggtc gacgccgata acaatggtac cattgatttc 420 page 424 <210> 66 <211> 412 <212> DNA <213> Lambertella subrenispora strain LMK5 <400> 66 ttctccctct ttgtaagtta tttagcacaa ccccatctc agccctatgg atacttggcg 60 accgaccgac atctgagac tggaagcta attatatgcg cttcaacagg acaaaaatgg 120 cgatggttgg tgcctacac tctaaaccac tatattgcat gcatgctgtc ttgggaaata 180 ctttctttcc tgctcgatat acccattc ccagcatact ccagcgacga gacggcatcg 240 aggcaaacgc gcaagttgtg gatgacac tgacatatat ttcaggaca attackagc 300 aaagagctgg gtaccgtcat gcgatccctc ggccaaacc catcagagtc tgaactccaa 360 gatatgatca acgaagtcga tgctgacac aacggcacta tcgactttcc ag 412 <210> 67 <211> 420 <212> DNA <213> Monilinia aucupariae strain LMK73 <400> 67 ttctccctct ttgtaagttc atcttgtata gcttcacag ctcatctc agggcatatc 60 tcaagcctgg gaagctata acttacgacc ttacaggaca agaatggtga tggttcgtac 120 tttcaatta tccttcaat gtcgcagatc aaccatctc ttcatccat ccatctacat 180 gcttcctatt ccggtccagc ccctatctcg aaaactgtc caacatcta ggaccacatt 240 accatcaaac atgacaacac atgagaagaa ctaagctgat atgcgagttc ataggacaaa 300 ttactagcaa ggagttgggt accgtcatgc gatcccttgg acaaaatcct tccgagtccg 360 agttacaaga tatgatcaac gaggtcgacg ctgacaacaa cggtaccatt gatttcccag 420 <210> 68 <211> 407 <212> DNA <213> Monilinia fructicola strain LMK12 <400> 68 ttctccctct ttgtaagttc atcttatata actctacatt ctcagcccta tggacacttg 60 gcagggcata tctgaagact tggaagctaa caattcatgg ctatatagga caagaatggt 120 gatggttcgt actttcaaac tatactttcg atgtcgcaga tagagctatc tacttctcat 180 ctagcccagc ccctatctcg aacattcgtg caaacaatta cgacaacatt actatccaac 240 ttaacaacac ttgagaacaa agctgatatg cgaatctata ggacaaatca ctagcaaaga 300 gttgggtacc gttatgcgat cccttggaca aaacccttcc gagtctgagc tgcaagatat 360 gatcaacgag gtcgacgccg ataacaacgg taccattgat ttcccag 407 <210> 69 <211> 418 <212> DNA <213> Monilinia megalospora strain LMK41 <400> 69 ttctcccttt ttgtaagttc catcttgtat aactttacaa gctcagctct cagggcgtat 60 ctgaagactt ggaagctaat aatttatgac tttacaggac aagaatggtg atggttcgta 120 ctttcaactt atacttttca tgtcgcagat caaatatctt cttctatcta tctgcgtgct 180 tcctatttcg gtccagcccc tatctcgaac aactgtgcaa aacatctagg acaacattac 240 cataaaatat gacaacacat gaggggaact aagctgatgt gcgagtccat aggacaaatt 300 actagcaagg agttgggcac cgtcatgcga tcccttggac aaaacccttc cgagtccgag 360 ttacaagata tgatcaacga ggtcgacgcc gacaacaacg gtaccattga tttcccag 418 <210> 70 <211> 392 <212> DNA <213> Monoline urnula strain LMK413 <400> 70 ttctccctct ttgtaagttc catcttgtat aactttacaa gctcagctct cagggcgtat 60 ctgaagactt ggaagctaat cattgatgac tttacaggac aagaatggtg atggttcgta 120 cttccaactt atgctttcga tgtcgcagat caactatctt cttctatcta tctacatgct 180 tcctatttcg gtccagcccc tatctcgaac aactgtgcaa acatggcaac acatgaggag 240 aactaagctg atgtgcgagt ccatagggca aattactagc aaggagttgg gcaccgtcat 300 gcgatccctt ggacaaaacc cttccgagtc cgagttacaa gatatgatca acgaggtcga 360 cgccgacaac aacggtacca ttgatttccc cg 392 <210> 71 <211> 432 <212> DNA <213> Myriosclerotinia curreyana strain LMK73 <400> 71 ttctccctct ttgtaagttc aaatttcccg actttatagc ttcagcccta tgaacacttg 60 gaagagcata tttaaagaca tgaaagctaa taatttatta ctttacagga caagaatggt 120 gatggttcgt tcttccaatt catattttca gttcgcaga tcggccgact attcccccct 180 tcatctgcat gttgctgtc tcgatccagt ccagccccta tctcgagtca tctcatcaat 240 aaggaggaca acaatactat tagacataac aatacatcag gacagcgctg atatatgaat 300 tcataggaca aattactagc aaggagttgg gcaccgttat gcgatccctt ggtcaaaatc 360 catccgagtc tgagttacaa gatatgatca atgaggttga tgccgataac aacggtacca 420 tcgatttcc ag 432 <210> 72 <211> 428 <212> DNA <213> Myriosclerotinia scirpicola strain LMK73 <400> 72 ttctccctct ttgtaagttc acatttccca actttattgc ttcagcccta tggacacttg 60 gcaagggcata ttcaaaggca tgaaagctaa taatttatga ctttacagga caagaatggt 120 gatggttcgt acttccaatt tatatcttca gtgtcgcaga tcgaccgact atcccccttc 180 atctgcatgt ttgctgtctc ggcccagccc agccctatc gaatagtctt atcaatcagg 240 aggacaacaa tcctattggg cataacaata cataagggca acgctgatat atgaatccat 300 aggacaaatt actagcaagg agttgggcac cgttatgcga tcccttggtc aaaacccttc 360 cgagtctgag ttgcaggata tgatcaatga ggttgatgcc gacaacaacg gtaccatcga 420 tttccctg 428 <210> 73 <211> 431 <212> DNA <213> Sclerotinia glacialis strain LMK7 <400> 73 ttctccctct ttgtaagttc atctttctac ctttcacaat ctcagcccta tggacacttg 60 gcagggtaca ttggatgata tggtagctaa cagttcatta ctttaaagga caagaatggt 120 gatggttagt aatttcagat tataatttcc atgtccagga tcgaatcctc ctttatctac 180 atgctagaca tcttgaccga cactgcccct atctcgaaca acggtaccaa caaaaggggc 240 aataacacaa taacacgatt gagcatgatt gagcagaacg acagcgctga tgtataaaat 300 catagggcaa atcactagca aggagttggg taccgttatg cgatcccttg gacaaaaccc 360 ttccgagtct gagttgcaag acatgatcaa tgaggtcgac gccgataaca acggtaccat 420 tgattcccca g 431 <210> 74 <211> 441 <212> DNA <213> Sclerotinia minor strain W1 <400> 74 gtaagttcat ctccctgact tttataatct cagccctatg gacacttggc agggtatatt 60 tggagatttg gtagctaata atgtatgact ctacaggaca agaatggcga tggttagtaa 120 tttcaggtta tactttccat gtcccagatc gactctcctc tttatgtag atgctagaca 180 tcttgaccga caccgcccct atctcgagca attgtaccga caaagggggg agcaacacga 240 ttgagcatga tgacacagga cagggctgat gtataaatcc ataggacaaa ttactagcaa 300 ggagttgggt accgttatgc gatcccttgg acaaaacccc tccgagtctg agttgcaaga 360 catgatcaat gaggttgatg ccgataacaa cggtaccatt gatttcccag gtacggctaa 420 gcatgacata gtttatgact c 441 <210> 75 <211> 422 <212> DNA <213> Sclerotinia sclerotiorum strain 1980 <400> 75 ttctccctct ttgtaagttc atctctctaa cttttacaat ctcagcccta tggacacttg 60 gcagggtata tttgaagatt tggtagctaa taatttataa ctttacagga caagaatggt 120 gatggttagt aatttcagat tatactttcc atgtcccagt tcgactctcc tcttttatct 180 acgtgctaga catcttgacc gacaccgccc ctatctcgaa caattgtacc aaaaagggg 240 gcaataacac gattgagcat gatacag gtcagggttg atatataat tcataggaca 300 attackagc aaggagctgg gtaccgtcat gcgatccctt ggacaaaacc cttccgagtc 360 tgagttgcaa gatagatca atgaggtcga tgccgataac aacggtacca ttgatttccc 420 Page 422 <210> 76 <211> 440 <212> DNA <213> Sclerotinia trifoliorum strain LMK4 <400> 76 gtgagttcat ctccctact tttacaatct cagccctatg vakacttggc agggtatatt 60 tgaagatatg gtagctgata atttatgact tttaggaca agaatggtga tggttagtaa 120 tttcagatta tactttccat gtcctagatc gactctcctc ctttatctac atgctagaca 180 tcttgaccga caccgcccct atctcgagca attgttcca aaggaggca atacacgat 240 tgagcatgat aacacaggac agggctgata tataaattca taggaxaat taccacac 300 gagtgggta ccgttatgcg atcccttgga caaaaccctt ccgagtctga gttgcaagac 360 atgatcaatg aggtcgatgc cgataacaac ggaaccattg atttcccagg tacggcgaag 420 cataatatag tttatgactc 440 <210> 77 <211> 422 <212> DNA <213> Sclerotium cepivorum strain LMK <400> 77 ttctccctct ttgtaagttc atctttccaa cttacaatt cagccctatg gacacttggc 60 agggtatatt tgaagatttg ggagctaata attatgact ttacaggaca agaatggtga 120 tggttagtac tttcggatta tactttccat gtcctagatc gactatcctc ctttatctac 180 atgctagaca tcttgaccga cacggcccct atctcgaaca attgtgccaa caaggggggc 240 atatacgat taagcatggt atacggaag gagagcgcta atatataaaa tcataggaca 300 aatcactagc aaggagctgg gtactgttat gcgatccctt gggcaaaatc cttccgagtc 360 tgagttgcaa gacatgatca atgaggtcga cgccgataac aacggtacca ttgatttccc 420 of 422 <210> 78 <211> 422 <212> DNA <213> Sclerotium cepivorum strain LMK7 <400> 78 ttctccctct ttgtaagttc atctttccaa cttacaatt cagccctatg gacacttggc 60 agggtatatt tgaagatttg ggagctaata attatgact ttacaggaca agaatggtga 120 tggttagtac tttcggatta tactttccat gtcctagatc gactatcctc ctttatctac 180 atgctagaca tcttgaccga cacggcccct atctcgaaca attgtgccaa caaggggggc 240 atatacgat taagcatggt atacggaag gagagcgcta atatataaaa tcataggaca 300 aatcactagc aaggagctgg gtactgttat gcgatccctt gggcaaaatc cttccgagtc 360 tgagttgcaa gacatgatca atgaggtcga cgccgataac aacggtacca ttgatttccc 420 of 422 <210> 79 <211> 477 <212> DNA <213> MAFF239143(A) <400> 79 ttacatctca gccagcccta tggacacttg gcaggtata ttgagat tgggactta 60 taatttatga ctttacagga caagaatggt gatggttagt acttcagat tatactttcc 120 atgtaccaga tcgactatcc tcctttacct atatgctgga catcttgacc gatagccc 180 ctatttcgaa cattgtgcc aacaaggggg gcaatacac gattaagcat gatacag 240 aaggagagcg ctgatatatata aattcgtagg acaaatcact agcaggagt tggtaccgt 300 tatgcgatcc cttgggcaaa acccttccga gtctgagttg cacacatga tcaatgaggt 360 cgatgccgat aacaacggta ccattgattt cccaggtacg gcaagtata atatagttta 420 tgactcacaa gttaaccga attagaattc ctcaccatga tggcatcaa gatgata 477 <210> 80 <211> 465 <212> DNA <213> chi01(A) <400> 80 height height height height height ataatttatg actttacagg acagaatgg tgatgttag tacttcaga tatatactttc 120 catgtaccag atcgactatc ctcctttacc tatatgctgg acatcttgac cgacatagcc 180 cctatttcga acaattgtgc siaaagggg ggcaataca cgattaagca tgatataca 240 gaaggagagc gctgatatat aaattcgtag gaaatcac tagcaggag tgggtaccg 300 ttatgcgatc ccttgggcaa aacccttccg agtctgagtt gcaagacatg atcaatgagg 360 tcgatgccga taacaacggt accattgat tcccaggtac ggcaaagtat atatagttt 420 atgactcaca aggttaaccg aattagaatt cctcaccatg atggc 465 <210> 81 <211> 470 <212> DNA <213> blood01(B) <400> 81 tttacattca gccctatgga cacttggcag ggtatattg aagatttggg agctaataat 60 tttgacttt acaggacaag aatggtgatg gttagtactt tcggattata ctttccatgt 120 cctagatcga ctatcctcct ttatctacat gctagacatc ttgaccgaca cggcccctat 180 ctcgaacaat tgtgccaaca aggggggcaa tatacgatta agcatggtaa tacggaagga 240 gagcgctaat atataaaatc ataggacaaa tcactagcaa ggagctgggt actgttatgc 300 gatcccttgg gcaaaatcct tccgagtctg agttgcaaga catgatcaat gaggtcgacg 360 ccgataacaa cggtaccatt gatttcccag gtacggcaca gcataatata gtttatgact 420 ctcaaggctg accggattag aattcctcac catgatggcc agaaagatga 470 <210> 82 <211> 470 <212> DNA <213> shi01(B) <400> 82 tttacattca gccctatgga cacttggcag ggtatatttg aagatttggg agctaataat 60 tttgacttt acaggacaag aatggtgatg gttagtactt tcggattata ctttccatgt 120 cctagatcga ctatcctcct ttatctacat gctagacatc ttgaccgaca cggcccctat 180 ctcgaacaat tgtgccaaca aggggggcaa tatacgatta agcatggtaa tacggaagga 240 gagcgctaat atataaaatc ataggacaaa tcactagcaa ggagctgggt actgttatgc 300 gatcccttgg gcaaaatcct tccgagtctg agttgcaaga catgatcaat gaggtcgacg 360 ccgataacaa cggtaccatt gatttcccag gtacggcaca gcataatata gtttatgact 420 ctcaaggctg accggattag aattcctcac catgatggca gaaaagatga 470 <210> 83 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 83 tcagcccatg ggatgttggc agggtcgacg gattggattg gaggtcaatg 50 <210> 84 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 84 ccgccgatgc cccaatgtac gttaagaagc gttggagatg ac 42 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 85 caagggcgat atcaaggtcc 20 <210> 86 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 86 gagccaagca gttggttgtg c 21 <210> 87 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 87 ctctcagtgt agaacttgac c 21 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthesized sequence <400> 88 atgggtgtca acaacgagac 20

Claims

1. Any one selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and An oligonucleotide of 15-30 bases in length that can bind to a region that exhibits polymorphism in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii, or a complementary region thereof.

2. 2. The oligonucleotide of claim 1 : Conserved in the sequences of SEQ ID NOs: 25-30, and an oligonucleotide capable of binding to a region in which a polymorphism is found in the sequence of SEQ ID NO: 5-24, or a complementary region thereof; Conserved in the sequences of SEQ ID NOs: 51-56, and an oligonucleotide capable of associating with a polymorphic region in a sequence of SEQ ID NO: 31-50, or a complementary region thereof; or Conserved in the sequences of SEQ ID NOs: 77-82, and An oligonucleotide capable of binding to a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.

3. A primer set capable of amplifying any one gene selected from the group consisting of a glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene region, a heat shock protein 60 (HSP60) gene region, and a calmodulin (CaM) gene region of a plant pathogenic fungus, conserved in both group A and group B strains of Sclerotium cepivorum, and A primer set consisting of nucleotides each of 15 to 30 bases in length that can bind to a region where polymorphism is found in Botrytis cinerea, Botrytis squamosa, Dumontinia tuberosa, Macrophomina phaseolina, Sclerotinia homoeocarpa, Sclerotinia kitajimana, Sclerotinia minor, Sclerotinia nivalis, Sclerotinia sclerotiorum, Sclerotinia trifoliorum, Sclerotium fumigatum, and Sclerotium rolfsii, or a complementary region thereof.

4. 4. The primer set of claim 3, comprising: A region of the G3PDH gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 25-30; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 5-24 or a complementary region thereof; A region of the HSP60 gene that can be amplified and is conserved in the sequences of SEQ ID NOs: 51-56; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 31-50, or a complementary region thereof; or capable of amplifying a region of the CaM gene, conserved in the sequences of SEQ ID NOs: 77-82; and A primer set capable of associating with a region in which a polymorphism is found in the sequences of SEQ ID NOs: 57-76, or a complementary region thereof.

5. 5. The primer set according to claim 3 or 4, comprising: It is capable of amplifying the G3PDH gene region, one primer is capable of binding to a region comprising positions 79 and 82 of the sequence of SEQ ID NO: 27, or a complementary region thereof; A primer set, wherein the other primer is capable of binding to a region including positions 329, 335 and 338 of the sequence of SEQ ID NO: 27, or a complementary region thereof.

6. 6. The primer set according to claim 3, wherein one primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 1 or its complementary sequence, and the other primer is an oligonucleotide consisting of the sequence of SEQ ID NO: 2 or its complementary sequence.

7. The primer set according to any one of claims 3 to 6, for diagnosing black rot of onion.

8. extracting DNA from the sample; A step of performing PCR using the extracted DNA as a template and the primer set according to any one of claims 3 to 7; A step of detecting the PCR amplification product and determining that the pathogen is present in the sample when an amplification product is detected.

9. The method according to claim 8, wherein the sample is soil, or a plant body or part thereof.

10. The method according to claim 8 or 9, further comprising the step of cleaving the PCR amplification product with a restriction enzyme.

11. The method according to claim 10, wherein the primer set according to any one of claims 3 to 7 is used and the restriction enzyme is MspI.

12. The oligonucleotide according to claim 1 or 2, or the primer set according to any one of claims 3 to 7, used in the LAMP method.

13. A kit for diagnosing black rot disease of onion, comprising the oligonucleotide according to claim 1 or 2, or the primer set according to any one of claims 3 to 7.

14. A LAMP primer set for diagnosing black rot disease on onion, comprising the following oligonucleotides (e)-(j): (e) FIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 83 or its complementary sequence (f) BIP, an oligonucleotide consisting of the sequence of SEQ ID NO: 84 or its complementary sequence (g) an F3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 85 or its complementary sequence; (h) B3 primer, which is an oligonucleotide consisting of the sequence of SEQ ID NO: 86 or its complementary sequence. (i) LF, an oligonucleotide consisting of the sequence of SEQ ID NO: 87 or its complementary sequence (j) LB, an oligonucleotide consisting of the sequence of SEQ ID NO: 88 or its complementary sequence