Anti-aging oral composition

Abstract

To provide an oral composition that is confirmed as a general food component, has high safety, and further exhibits high capability for anti-aging.SOLUTION: An anti-aging oral composition characterized by comprising nicotinamide mononucleotide, reduced CoQ10, and a polyamine.SELECTED DRAWING: Figure 1A

Description

[Technical Field]

[0001] The present invention relates to an improved oral anti-aging composition, particularly an oral anti-aging composition that exerts anti-aging activity by activating mitochondria. [Background technology]

[0002] It is said that the human body is made up of approximately 37 trillion cells, and human aging can be described as the aging of these cells. The causes of cellular aging are thought to be largely due to the "decline in intracellular mitochondrial function due to aging" and the "decline in intracellular metabolism (autophagy)." In other words, when mitochondrial function declines, energy (ATP) production declines, making people more susceptible to fatigue and making it harder to recover, leading to various diseases such as a decline in brain function and muscle strength, and further to overall aging, including an aged appearance. One of the reasons for the decline in mitochondrial function is the age-related decrease in the coenzyme NAD, which is necessary for maintaining mitochondrial function. This is thought to be due to the age-related decrease in NAD synthesizing enzymes (decreased synthesis), the consumption of NAD by enzymes responsible for repairing damaged genes (increased consumption), and the increase in NAD degrading enzymes (increased degradation). In addition, with age, the redox balance within mitochondria is disrupted, causing oxidative stress, which damages mitochondria and leads to a decline in function. Damaged mitochondria are broken down by autophagy, and SIRT then rebuilds them into new mitochondria, but these functions also decline with age. Thus, mitochondria perform extremely important functions in living organisms, and techniques such as those shown in Patent Documents 1 to 3 have been developed to activate mitochondria. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Special Table 2023-545721 [Patent Document 2] Special Table 2023-541403 [Patent Document 3] Special Table 2023-539925 Summary of the Invention [Problem to be solved by the invention]

[0004] However, when improving mitochondrial status for anti-aging purposes, continuous oral intake is preferred. The present invention has been made in view of the above-mentioned prior art, and an object of the present invention is to provide an oral composition that has been confirmed as a common food ingredient, is highly safe, and has a high anti-aging effect. [Means for solving the problem]

[0005] In order to solve the above problems, the anti-aging oral composition of the present invention contains nicotinamide mononucleotide, reduced CoQ10, and a polyamine. In the present invention, it is preferable that the polyamine contains spermidine as a main component. In the present invention, it is preferable that the nicotinamide mononucleotide is administered in an amount of 10 to 1000 mg / day, the reduced CoQ10 is administered in an amount of 10 to 500 mg / day, and the polyamine is administered in an amount of 0.00008 mg or more / day. Furthermore, in the present invention, it is preferable that the content ratio of nicotinamide mononucleotide to reduced CoQ10 is 1:100 to 100:1, and the content of polyamine is 1 / 250,000 or more of the total content of nicotinamide mononucleotide and reduced CoQ10. Furthermore, the present invention preferably includes a hard capsule containing nicotinamide mononucleotide, polyamine, and other solid components, and a soft capsule containing reduced CoQ10 and other oily components. In the composition of the present invention, each component may be extracted from a natural product or synthesized. [Effects of the Invention]

[0006] The anti-aging oral composition of the present invention can be taken over a long period of time and exhibits excellent anti-aging effects due to the synergistic effects of nicotinamide mononucleotide, reduced CoQ10, and polyamines. [Brief explanation of the drawings]

[0007] [Figure 1A] FIG. 1 is an explanatory diagram of the increase in intracellular mitochondrial activity due to the addition of nicotinamide mononucleotide, reduced coenzyme Q10, and spermidine. [Figure 1B] FIG. 1 is an explanatory diagram of the increase in intracellular mitochondrial activity due to the addition of nicotinamide mononucleotide, reduced coenzyme Q10, and spermidine. [Figure 1C] FIG. 1 is an explanatory diagram of the increase in intracellular mitochondrial activity due to the addition of nicotinamide mononucleotide, reduced coenzyme Q10, and spermidine. [Figure 2A] FIG. 2 is an explanatory diagram showing the increase in intracellular expression of the skin-related gene Col1a1 due to the addition of nicotinamide mononucleotide, reduced coenzyme Q10, and spermidine. [Figure 2B] FIG. 2 is an explanatory diagram showing the increase in intracellular expression of the skin-related gene Col1a1 due to the addition of nicotinamide mononucleotide, reduced coenzyme Q10, and spermidine. [Figure 3] FIG. 3 shows a time schedule for examining the effects of taking the anti-aging oral composition of the present invention. [Figure 4] FIG. 4 is an explanatory diagram showing the increase in mitochondrial amount before and after ingestion of the anti-aging oral composition of the present invention. [Figure 5A] FIG. 5 is an explanatory diagram of changes in muscle mass and muscle quality associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 5B] FIG. 5 is an explanatory diagram of changes in muscle mass and muscle quality associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 6]FIG. 6 is an explanatory diagram of the improvement in sleep state associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7A] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7B] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7C] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7D] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7E] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7F] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 7G] FIG. 7 is an explanatory diagram of the improvement in skin condition associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8A] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8B] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8C] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8D] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8E] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8F] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8G] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8H]FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8I] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8J] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8K] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8L] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8M] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. [Figure 8N] FIG. 8 is an explanatory diagram of the improvement in physical and mental conditions associated with the ingestion of the anti-aging oral composition of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0008] Preferred embodiments of the present invention will now be described. Nicotinamide mononucleotide (NMN), the first essential ingredient in the present invention, is a precursor of the coenzyme NAD, which is essential for maintaining mitochondrial function. NAD decreases with age, but if ingested directly, it is broken down and not absorbed; therefore, it is administered in the form of its precursor, nicotinamide mononucleotide. Furthermore, it has been reported that nicotinamide mononucleotide activates the longevity gene sirtuin (seven types in total). In the present invention, the intake amount of nicotinamide mononucleotide is preferably 10 to 1,000 mg / day in adult equivalent. At doses less than 10 mg / day, the effect may not be fully exerted, and at doses exceeding 1,000 mg / day, no enhanced effect may be observed.

[0009] Reduced CoQ10, the second essential component of the present invention, is a powerful antioxidant present in the mitochondria of cells throughout the body, and is found in large amounts in the heart, which requires the most oxygen. However, this content decreases with age, and the ability to convert to reduced CoQ10 also decreases. Therefore, supplementing with reduced CoQ10 can protect mitochondria from oxidative stress and enable them to function normally. In the present invention, the intake amount of reduced CoQ10 is preferably 10 to 500 mg / day in adult equivalent. If the intake is less than 10 mg / day, the effect may not be fully exerted, and even if the intake exceeds 500 mg / day, the effect may not be enhanced.

[0010] Furthermore, polyamines, particularly spermidine, the third essential component of the present invention, have been reported to promote autophagy and enhance mitochondrial function. Spermidine is a type of polyamine synthesized from arginine and ornithine, but its synthetic ability declines with age. Therefore, direct supplementation with spermidine can promote mitochondrial metabolism. In the present invention, the polyamine intake is preferably at least 0.00008 mg / day, based on an adult's intake, more preferably 0.00008 to 100 mg / day, and even more preferably 0.00008 to 50 mg / day. Amounts less than 0.00008 mg / day may not be effective enough.

[0011] Furthermore, in the present invention, the content ratio of nicotinamide mononucleotide to reduced CoQ10 is preferably 1:100 to 100:1, and the ratio of the total content of nicotinamide mononucleotide and reduced CoQ10 to the content of polyamine is preferably 250,000:1 to 14.5:1, and more preferably 25,000:1 to 14.5:1.

[0012] In the present invention, the total daily intake of nicotinamide mononucleotide, reduced CoQ10, and polyamines is preferably 20 to 1500 mg. The above total intake amount is an amount that is thought to be sufficient to provide anti-aging effects when nicotinamide mononucleotide, reduced CoQ10, and polyamines are orally administered in combination, and is also within a range that can be manufactured into common oral dosage forms such as tablets and capsules, and is a realistic dosage range in terms of intake and dosage form design.

[0013] In addition to the essential ingredients, examples of hydrophilic bioactive ingredients that can be added to the oral composition of the present invention include hydrogen, PQQ (pyrroloquinoline quinone), 5-aminolevulinic acid (5-ALA), ferulic acid, zinc, vitamin C, B vitamins, L-cysteine, L-carnitine, citrulline, collagen (collagen peptide), hyaluronic acid, elastin (elastin peptide), proteoglycan, glucosamine, chondroitin, placenta, GABA, glycine, BCAA, glutamine, etc. These are water-soluble or water-solubilizable ingredients and can be coexisted with the nicotinamide mononucleotide. Furthermore, examples of oil-soluble physiologically active ingredients that can be added to the oral composition of the present invention in addition to the essential ingredients include quercetin, resveratrol, ellagic acid, urolithin, α-lipoic acid, ceramide, vitamin E, exosomes, astaxanthin, krill oil, and vitamin D.

[0014] The oral composition of the present invention can be in various forms, such as liquid, tablet, or capsule, but it is particularly preferred to hard-encapsulate nicotinamide mononucleotide, polyamine, and other hydrophilic bioactive ingredients, and soft-encapsulate reduced CoQ10 and other lipophilic bioactive ingredients together with a base oil, since reduced CoQ10 is easily oxidized and may be denatured by coexistence with hydrophilic ingredients. Furthermore, any one or more of nicotinamide mononucleotide, reduced CoQ10, and polyamine may be liposomalized and incorporated into the composition. When preparing hard capsules, capsule materials include gelatin, pullulan, HPMC, etc., and bulking agents include starch, starch hydrolysates, etc. Furthermore, capsule materials used in producing soft capsules include gelatin, starch, carrageenan, etc., and base oils include edible oils and fats, olive oil, linseed oil, soybean oil, corn oil, safflower oil, sunflower oil, rapeseed oil, cottonseed oil, sesame oil, perilla oil, beeswax, fish oil, and medium-chain fatty acid triglycerides.

[0015] The inventors used mouse fibroblasts to test intracellular mitochondrial activity and the expression levels of skin-related genes.

[0016] (cell culture) NIH3T3 cells were purchased from ATCC and cultured in DMEM (FUJIFILM WAKO) containing 10% fetal bovine serum, 100 units / mL penicillin, and 100 μg / mL streptomycin (Thermo Fischer) at 37°C in a humidified incubator with a 5% CO2 concentration. NIH3T3 cells were cultured at a density of 1x10 5 The cells / mL were adjusted and seeded in 100 μL of a 96-well plate (for CCK-8 assay) or 500 μL of a 24-well plate (for qRT-PCR). The next day, the medium was replaced with serum-free medium. 24 hours later, the medium was replaced with serum-free medium supplemented with the indicated concentrations of nicotinamide mononucleotide (NMN; Merck), coenzyme Q10 (CoQ10; Kaneka), and spermidine (Merck). 48 hours later, the medium was subjected to the CCK-8 assay and qRT-PCR.

[0017] (Mitochondrial activity measurement (CCK-8 assay)) After 48 hours of treatment, the medium of NIH3T3 cells was removed and washed with PBS. 100 μL of serum-containing medium plus 10 μL of cell counting kit-8 (CCK-8; Dojindo Laboratories) was added to each well. After incubation in an incubator for 1 hour, the absorbance at 450 nM (reference wavelength: 650 nM) was measured using a SpectraMax Mini (Molecular Devices). The absorbance was then measured using a lysis buffer (1% NP-40, 50 mM Tris pH 8.0, 150 mM NaCl) at 450 nM. The absorbance was then determined as the mitochondrial dehydrogenase activity. After centrifugation, the medium was removed and washed with PBS. The protein content of the supernatant was measured using Bradford Protein Assay reagent (Bio-Rad). The CCK-8 assay result was divided by the cellular protein content to obtain a normalized value.

[0018] The results are shown in Figure 1. As is clear from Figures 1A and 1B, it was found that the combination of nicotinamide mononucleotide, reduced CoQ10, and spermidine significantly increased mitochondrial activity. As can be seen from Figure 1A, the combined use of nicotinamide mononucleotide (30 μg / mL), reduced CoQ10 (20 μg / mL), and spermidine (0.01 μg / mL or higher) showed a clear increase in mitochondrial activity. Furthermore, as shown in Figure 1B, a significant increase in mitochondrial activity was also confirmed when nicotinamide mononucleotide 100 μM (33.4 μg / mL, molecular weight 334.2), reduced CoQ10 10 μM (8.6 μg / mL, molecular weight 863.4), and spermidine 20 μM (2.9 μg / mL, molecular weight 145.2) were used in combination. Furthermore, as shown in Figure 1C, an increase in mitochondrial activity was confirmed by adding a small amount of spermidine to a fixed amount of nicotinamide mononucleotide and reduced CoQ10. When spermidine was added at 0.2 ng / mL in addition to a certain amount of nicotinamide mononucleotide and reduced CoQ10, a tendency for mitochondrial activity to increase was observed, with a further increase observed at 2 ng / mL and a significant increase observed at 5 ng / mL or more. For this reason, in the present invention, the ratio of the total content of nicotinamide mononucleotide and reduced CoQ10 to the content of polyamine is preferably 250000:1 to 14.5:1, and more preferably 25000:1 to 14.5:1. The intake amount of nicotinamide mononucleotide is preferably 10 to 1000 mg / day in terms of an adult, and the intake amount of reduced CoQ10 is preferably 10 to 500 mg / day in terms of an adult. The results in Figures 1A to 1C show that even trace amounts of spermidine contribute to an increase in mitochondrial activity. For this reason, the polyamine intake amount in the present invention is preferably 0.00008 mg or more per day, more preferably 0.00008 to 100 mg per day, and even more preferably 0.00008 to 50 mg per day, calculated as an adult.

[0019] (Measurement of the expression level of the skin-related gene Col1a1) Col1a1 is a gene involved in the synthesis of type I collagen α1. Type I collagen is an essential component in maintaining youthful skin tone, elasticity, and moisture, particularly in skin tissue, and changes in its quantity and structure are closely related to skin aging and inflammation. It is known that aging and external stimuli cause a decrease in collagen production and increased degradation, resulting in skin aging symptoms such as wrinkles, sagging, loss of elasticity, and roughness of the skin. Furthermore, decreased collagen production is also believed to be a contributing factor in age-related diseases such as osteoporosis, and is thought to be one of the factors that cause bone fragility. Furthermore, in the treatment of damaged biological tissue, it is known that collagen production is enhanced and functions as a scaffold that supports the adhesion, migration, and proliferation of fibroblasts, thereby promoting tissue repair. Therefore, promoting the production of type I collagen is thought to be extremely useful not only for preventing and improving skin aging symptoms, but also for preventing and treating osteoporosis and promoting wound healing.

[0020] To evaluate the expression level of the skin-related gene Col1a1, quantitative reverse transcription PCR (qRT-PCR) was performed using the following method. After 48 hours of treatment, the NIH3T3 cells were washed with PBS and total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen). Reverse transcription was then performed using ReverTra Ace qPCR RT Master Mix (Toyobo). PCR was performed on the reverse-transcribed samples using KOD SYBR qPCR Mix (Toyobo) and primer sets specific for mouse Col1a1 (mCol1a1) and mouse β-actin (mActb) genes on an ABI7300 Real-time PCR System (ABI). Expression levels of each gene were calculated using the ΔΔCT method, and normalized by dividing the Col1a1 gene expression level by the β-actin gene expression level. The primer sequences used for PCR are as follows: (mCol1a1) forward: ACTGCAACATGGAGACAGGTCAGA; reverse: ATCGGTCATGCTCTCTCCAAACCA. (mActb) forward: CACTGTCGAGTCGCGTCCA; reverse: CACTGTCGAGTCGCGTCCA.

[0021] The results are shown in Figure 2. As shown in Figure 2A, when nicotinamide mononucleotide (33.4 μg / mL), reduced CoQ10 (8.6 μg / mL), and spermidine (2.9 μg / mL) were administered in combination, the expression of type I collagen mRNA was significantly increased. Furthermore, as shown in Figure 2B, it was found that adding a small amount of spermidine to a certain amount of nicotinamide mononucleotide and reduced CoQ10 increased the expression of type I collagen mRNA. Furthermore, an increasing trend was observed at nicotinamide mononucleotide 30 μg / mL, reduced CoQ10 20 μg / mL, and spermidine 2 ng / mL or higher, with a significant increase observed at 5 ng / mL or higher. The results in Figure 2 show that adding spermidine is also useful from the perspective of promoting the production of type I collagen, and a synergistic effect is expected, particularly when combined with nicotinamide mononucleotide and reduced CoQ10. From this perspective, in the present invention, the ratio of the total content of nicotinamide mononucleotide and reduced CoQ10 to the content of polyamine is preferably 250000:1 to 14.5:1, more preferably 25000:1 to 14.5:1. The intake amount of nicotinamide mononucleotide is preferably 10 to 1000 mg / day in terms of an adult, and the intake amount of reduced CoQ10 is preferably 10 to 500 mg / day in terms of an adult. The results in Figures 2A and 2B show that even trace amounts of spermidine contribute to promoting the production of type I collagen. For this reason, the polyamine intake amount in the present invention is preferably 0.00008 mg or more per day, more preferably 0.00008 to 100 mg per day, and even more preferably 0.00008 to 50 mg per day, calculated as an adult dose.

[0022] Next, a test for confirming the effect of the oral composition of the present invention will be described. First, the inventors prepared the following test oral compositions and had three subjects take them according to the test schedule shown in Figure 3, during which time they measured mitochondrial content, body composition, and completed a questionnaire regarding subjective symptoms. Mitochondrial mass was measured using the MiRMes mitochondrial mass measurement kit, and body composition was measured using a Tanita Inner Scan Dual body composition analyzer. [Test composition (daily intake)] Nicotinamide Mononucleotide 300mg Reduced CoQ10 300mg Spermidine (polyamine) 1mg Unless otherwise specified, the results are shown as the average value for the subjects.

[0023] First, the results of measuring mitochondrial amounts are shown in FIG. As is clear from the figure, a significant increase in mitochondria was observed after 4 weeks of intake compared to before intake.

[0024] Next, Figure 5 shows the changes in muscle mass and muscle quality measured by a body composition analyzer. The "muscle quality score" is measured using the Tanita InnerScan Dual body composition monitor and evaluates muscle quality on a scale of 0 to 100. This evaluation method, developed by Tanita using electrical measurement technology, focuses not only on muscle mass but also on qualitative changes such as an increase in tissue other than muscle fibers. The muscle mass and muscle quality scores were both set at 0 before ingestion of the test oral composition, and the amount of change compared to before ingestion was calculated. As is clear from the figure, improvements in both muscle mass and muscle quality were observed with the ingestion of the test composition.

[0025] In addition, based on the questionnaire, participants self-evaluated their insomnia using the Athens Insomnia Scale. The Athens Insomnia Scale is a globally accepted method for assessing insomnia created by the World Health Organization's (WHO) Global Project on Sleep and Health. The results are shown in Figure 6. As shown in the figure, improvement of insomnia was observed by taking the test composition.

[0026] In addition, participants were asked to self-evaluate the beauty effects based on a questionnaire. The cosmetic effects were evaluated by the participants themselves based on the following evaluation criteria. Not at all applicable: 5 points Slightly applicable: 4 points; Somewhat applicable: 3 points; Very true: 2 points; Very well: 1 point; For the evaluation score of each item, the relative value (rate of change) was calculated, with the score before ingestion of the test oral composition being set at 1, and the results were graphed. The results are shown in Figure 7. As shown in the figure, improvement in skin condition was observed by taking the test composition.

[0027] In addition, participants were asked to self-assess their physical and mental condition based on a questionnaire. Subjects self-evaluated their physical and mental conditions based on the following evaluation criteria. Not at all applicable: 5 points Slightly applicable: 4 points; Somewhat applicable: 3 points; Very true: 2 points; Very well: 1 point; For the evaluation score of each item, the relative value (rate of change) was calculated, with the score before ingestion of the test oral composition being set at 1, and the results were graphed. The results are shown in Figure 8. As shown in the figure, improvements in mental and physical conditions were observed after taking the test composition.

[0028] Specific embodiments of the present invention will be described below. Hard capsules (3 tablets per day) β-Nicotinamide Mononucleotide 450mg Thiamine hydrochloride (vitamin B1) 1.8mg Pyridoxine hydrochloride (vitamin B6) 2.4mg Wheat germ extract (containing 1% polyamine) 150mg Soft capsules (3 tablets per day) Reduced CoQ10 300mg Vitamin D3 1.35mg

Claims

1. An anti-aging oral composition comprising nicotinamide mononucleotide, reduced CoQ10, and a polyamine.

2. 2. The anti-aging oral composition according to claim 1, wherein the polyamine is mainly composed of spermidine.

3. The anti-aging oral composition according to claim 1, wherein the nicotinamide mononucleotide is 10 to 1000 mg / day, the reduced CoQ10 is 10 to 500 mg / day, and the polyamine is 0.00008 mg or more / day.

4. 2. The anti-aging oral composition according to claim 1, wherein the content ratio of nicotinamide mononucleotide to reduced CoQ10 is 1:100 to 100:1, and the content of polyamine is 1 / 250,000 or more of the total content of nicotinamide mononucleotide and reduced CoQ10.

5. 2. The anti-aging oral composition according to claim 1, characterized in that it comprises a hard capsule containing nicotinamide mononucleotide, polyamines and other solid components, and a soft capsule containing reduced CoQ10 and other oily components.

Images