Method for evaluating senescence cascade state of cell

By using miR-570-3p as an indicator, the method evaluates and screens for substances that regulate cellular senescence, addressing the lack of knowledge on senescence chain states and promoting or inhibiting cellular aging effectively.

JP2025181744APending Publication Date: 2025-12-11KOSE CORPORATION
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2025087867
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-30
Filing Date
2025-05-27
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

There is insufficient knowledge about the senescence chain state caused by senescent cells and the evaluation of substances that regulate this state, hindering effective interventions for cellular aging.

Method used

The method utilizes MicroRNA-570-3p (miR-570-3p) as an indicator to evaluate the senescence-linked state of cells and screen for substances that modulate this state, using miR-570-3p mimics to induce or suppress senescence, and incorporates Atractylodes chinensis extract to inhibit cellular senescence.

Benefits of technology

Enables the evaluation of cellular senescence potential and the identification of substances that can inhibit or promote the senescence chain, thereby maintaining tissue health and functionality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025181744000007
    Figure 2025181744000007
  • Figure 2025181744000008
    Figure 2025181744000008
  • Figure 2025181744000009
    Figure 2025181744000009
Patent Text Reader

Abstract

To provide a technique enabling evaluation of a novel senescence cascade state and screening of a substance that modulates a novel senescence cascade state.SOLUTION: The present invention provides a method for evaluating a senescence cascade state of a cell using Micro RNA-570-3p (miR-570-3p) as an indicator. The present invention also provides a method for screening a substance that modulates a senescence cascade state of a cell using miR-570-3p as an indicator.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for evaluating the senescence-linked state of cells, a method for screening for substances that regulate the senescence-linked state of cells, an inhibitor of miR-570-3p expression, a composition for inhibiting the senescence-linked state of cells, and the like. [Background technology]

[0002] Cellular senescence is a state in which the cell cycle is stably arrested. Senescent cells are characterized by morphological changes, metabolic changes, chromatin reorganization, and changes in gene expression. The number of senescent cells is known to increase with age.

[0003] In the fields of cosmetics and topical skin preparations, there has long been research and development into products and merchandise that address consumer needs, such as those related to aging, and research into cellular aging of the skin and aging associated with skin aging is also underway.

[0004] Skin is composed of the epidermis and dermis, and more specifically, of epidermal cells, fibroblasts, and extracellular matrices (e.g., collagen, hyaluronic acid, elastin, etc.). Various symptoms arise in skin due to cellular aging in skin tissues caused by external and internal factors such as ultraviolet light, dryness, stress (oxidative stress), and aging. For example, it is believed that symptoms such as sagging, wrinkles, and age spots occur when the function of the extracellular matrix or fibroblasts is reduced due to one or more of these external and internal factors. Therefore, there has long been a need for substances (e.g., compounds, materials, extracts, etc.) that can prevent, improve, or treat symptoms caused by aging in such skin tissues or the cells that constitute them.

[0005] Patent Document 1 discloses a method for promoting sirtuin 1 expression, which is characterized by applying waves of the Schumann resonance frequency to cells. Furthermore, Patent Document 2 discloses a method for evaluating the quality of cells using miRNA as an indicator. Furthermore, Patent Document 3 discloses the identification and use of compounds that inhibit the expression or activity of microRNAs to prevent and / or slow aging and / or moisturize the skin. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Publication No. 2022-100202 [Patent Document 2] Japanese Patent Application Publication No. 2019-154320 [Patent Document 3] Special Publication No. 2013-529091 [Patent Document 4] WO2007 / 069666 [Patent Document 5] Japanese Patent Application Publication No. 2024-061647 [Patent Document 6] Japanese Patent Publication No. 2022-102858 [Patent Document 7] Japanese Patent Publication No. 2021-169532 [Non-patent literature]

[0007] [Non-Patent Document 1] R. Baker et al., The FASEB Journal, Vol. 33 February 2019, p1605-1616. [Non-patent document 2] Taiyue Li et al., Frontiers in Pharmacology, Original Research, 01 September 2022,p1-15. [Non-patent document 3] Weiwei Tang et al., AGING 2022, Vol. 14, No. 21, P8688-8699. [Non-patent document 4] G. A. McFarland, R. Holliday, Experimental Cell Research, Volume 212, Issue 2, June 1994, Pages 167-175. [Non-Patent Document 5] Jae-Hong Jeong et al., Food Sci Biotechnol (2018) 27(2):555-564. [Non-patent document 6] Alanna N Roff et al., Am J Clin Exp Immunol. 2014; 3(2): 68-83. [Non-Patent Document 7] Eriko Itai et al., Exp Dermatol. 2023 Nov;32(11):1982-1995. Summary of the Invention [Problem to be solved by the invention]

[0008] However, there is insufficient knowledge about the state in which senescent cells cause the senescence of surrounding cells (senescence chain state). As a result, there is insufficient knowledge about the evaluation of the senescence chain state and the screening of substances that regulate the senescence chain state. Therefore, a main object of the present invention is to provide a technique for evaluating a new aging-linked state and screening for a substance that modulates the new aging-linked state. [Means for solving the problem]

[0009] As a result of extensive research, the present inventors have newly discovered that MicroRNA-570-3p (hereinafter also referred to as "miR-570-3p") is a type of miRNA contained in exosomes and that it is an aging-linked factor that causes the aging of surrounding cells, and have completed the present invention.

[0010] The present invention can provide a method for evaluating the senescence-linked state of cells using miR-570-3p as an indicator. The present invention can provide a screening method for substances that regulate the senescence-linked state of cells, using miR-570-3p as an indicator. Furthermore, the present invention can provide an agent for suppressing miR-570-3p expression, which contains an extract of Atractylodes chinensis as an active ingredient. Furthermore, the present invention can provide a composition for inhibiting cellular senescence, comprising an agent for modulating (promoting or suppressing) miR-570-3p expression. Furthermore, the present invention can provide a cosmetic, topical skin preparation, pharmaceutical, or food product for inhibiting the cellular aging chain, which contains an agent for regulating (promoting or inhibiting) miR-570-3p expression.

[0011] The cells may be fibroblasts or epidermal keratinocytes. The screening method may include selecting the test substance as a substance that promotes the cellular senescence chain if the amount of miR-570-3p after contacting the test substance with the subject cells is higher than the amount of miR-570-3p in a control, or selecting the test substance as a substance that suppresses the cellular senescence chain if the amount is lower. [Effects of the Invention]

[0012] The present invention can provide a technique for evaluating a new aging-linked state and screening for a substance that regulates a new aging-linked state. [Brief explanation of the drawings]

[0013] [Figure 1] FIG. 1 shows the results of particle size confirmation of isolated exosomes using a nanoparticle analyzer. [Figure 2] FIG. 1 shows the results of confirming the shape and particle size of isolated exosomes using a transmission electron microscope. [Figure 3] FIG. 1 shows the confirmation of the expression of marker proteins in isolated exosomes by Western blotting. [Figure 4] 1 shows changes in the number of fibroblast cells due to the addition of miR-570-3p mimic. The numbers indicate the rate of increase when the number of cells seeded is set at 100. [Figure 5] FIG. 1 shows changes in particle size of fibroblasts due to addition of miR-570-3p mimic. [Figure 6] 1 shows confirmation of SA-β-gal in fibroblasts after addition of miR-570-3p mimic. The left image shows the control, and the right image shows the cells after addition of miR-570-3p mimic. [Figure 7] 1 shows changes in SIRT1 expression in fibroblasts due to the addition of miR-570-3p mimic, with the left panel showing gene expression levels and the right panel showing protein expression levels. [Figure 8] 1 shows changes in the number of epidermal keratinocytes due to the addition of miR-570-3p mimic. The numbers indicate the rate of increase when the seeding number is set at 100. [Figure 9] 1 shows confirmation of SA-β-gal in epidermal keratinocytes after addition of miR-570-3p mimic. The left image shows a control, and the right image shows cells after addition of miR-570-3p mimic. [Figure 10] 1 shows changes in SIRT1 expression in epidermal keratinocytes due to the addition of miR-570-3p mimic, with the left panel showing gene expression levels and the right panel showing protein expression levels. [Figure 11] This figure shows the changes in miR-570-3p expression caused by each test substance. The test substance in the left panel of Figure 11 is a Radix Atractylodes extract. The test substance in the center panel of Figure 11 is L-carnosine. The test substance in the right panel of Figure 11 is L-ascorbyl magnesium phosphate. [Figure 12] This figure shows changes in miR-570-3p levels due to suppression of EFEMP2 expression in dermal fibroblasts. The left figure shows the amount of miR-570-3p in siCTR cells and in siEFEMP2 cells. The right figure shows the amount of miR-570-3p encapsulated in exosomes released from siCTR cells and in exosomes released from siEFEMP2 cells. [Figure 13]This shows the change in miR-570-3p levels due to replicative senescence in dermal fibroblasts. The left graph shows the amount of miR-570-3p in cells (P=9) and cells (P=24). The right graph shows the amount of miR-570-3p encapsulated in exosomes released from cells (P=9) and cells (P=24). P=9 and P=24 represent 9 and 24 passages, respectively, and repeated passages induce cellular senescence. DETAILED DESCRIPTION OF THE INVENTION

[0014] Preferred embodiments for implementing the present technology will be described below. Note that the embodiment described below shows an example of a typical embodiment of the present technology, and the scope of the present technology will not be interpreted narrowly by this. Note that, in this specification, percentages are expressed by mass unless otherwise specified. Furthermore, the upper limit (or less) and the lower limit (or more) of each numerical range (to) can be arbitrarily combined as desired. Furthermore, in the explanations of "1.", "2.", etc. and each of these items, etc., duplicate explanations of the technical features, configurations, definitions, terms, methods, etc. of miR-570-3p and indicator miR-570-3p, methods for evaluating the cellular senescence-linked state and screening for regulators of the cellular senescence-linked state, regulation of miR-570-3p expression and its components, and their usage and dosage, methods of use, etc., may be omitted as appropriate. The explanations of "1.", "2.", etc. and each of these items, etc. can be applied to any of the technologies or embodiments, etc. of "1.", "2.", etc. and each of these items, etc., and each technical feature, etc. can be adopted as appropriate in each of the technologies or embodiments, etc.

[0015] 1. Overview of the present invention

[0016] In previous studies, the applicant has found that EFEMP2 is a factor that regulates dermal fibroblast senescence, and that inhibition of its expression induces cellular senescence (e.g., Patent Document 5 and Non-Patent Document 7). Furthermore, as a result of various studies on senescent cells in which senescence has been induced by EFEMP2 knockdown, the inventors were inspired to discover that exosomes are secreted from senescence-induced cells in which senescence has been induced by EFEMP2 knockdown, and that microRNAs (hereinafter also referred to as "miRNAs") encapsulated in these exosomes link senescence to other cells. They then developed an experimental system that uses these microRNAs as an indicator to evaluate the senescence linkage potential of cells, and discovered a method for screening agents that regulate this.

[0017] As shown in the Examples below, the present inventors have discovered that miR-570-3p is encapsulated in exosomes, small vesicles involved in signal transduction to other cells, and that miR-570-3p mimics, which mimic the nucleic acid sequence of miR-570-3p, induce senescence in cells by being delivered and incorporated into the cells. The present inventors have also found that miR-570-3p induces senescence in cells of several different types.

[0018] Based on this, the inventors discovered that miR-570-3p, a type of miRNA encapsulated in exosomes, is one of the factors that causes senescent cells to induce senescence in surrounding cells or tissues (senescence chain reaction). The inventors believe that the chain reaction of cellular senescence leads to aging, functional decline, and loss at the tissue level to which the cells belong. They believe that suppressing the expression of miR-570-3p, an senescence chain reaction factor, leads to the suppression of tissue senescence and functional decline (maintenance of homeostasis and a healthy state), while promoting miR-570-3p expression leads to tissue senescence and functional decline. The inventors have found that by detecting or measuring the expression state of this novel marker miR-570-3p using miR-570-3p as an indicator, it is possible to assess the cellular senescence potential and the pharmacological effects of a test substance on the cellular senescence chain. Furthermore, using miR-570-3p as an indicator makes it possible to search for substances that have the effect of inhibiting the senescence chain, which is expected to stop the cellular senescence chain.

[0019] That is, this embodiment is a technology that makes it possible to evaluate the senescence-linked state of cells, based on the discovery of miR-570-3p as a senescence-linked factor.

[0020] Based on the above, the present inventors have been able to provide a method for evaluating the state of the cellular senescence chain using miR-570-3p, a method for screening for a substance that modulates the state of the cellular senescence chain, as well as a substance for modulating miR-570-3p expression that can be found by these methods and a composition for modulating the cellular senescence chain containing the same. Hereinafter, embodiments of the present invention will be described, but the present invention is not limited to the following embodiments and their descriptions.

[0021] 2. Method for evaluating the cellular senescence chain state according to this embodiment

[0022] This embodiment can provide a method for evaluating the senescence-linked state of cells using miR-570-3p as an indicator.

[0023] The present embodiment may also provide miR-570-3p for use as an indicator or a method for using miR-570-3p as an indicator. The present embodiment may also provide an indicator reagent containing miR-570-3p, or an indicator reagent combination that uses or includes the indicator reagent. Furthermore, it is preferable to use miR-570-3p as an indicator substance, indicator, or marker for assessing the state of the cellular senescence chain, or for evaluating or screening substances related to regulating the cellular senescence chain.

[0024] <mir-570-3p> miR-570-3p (SEQ ID NO: 1: GAAAACAGCAATTACCTTTGC) [Homo sapiens (human)] used in this embodiment is disclosed in the National Library of Medicine National (website: https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC4138130 / ; Non-Patent Document 6: Alanna N Roff et al., Am J Clin Exp Immunol. 2014; 3(2): 68-83.), etc.

[0025] Non-Patent Document 1 discloses that miR-570-3p induces cellular senescence in airway epithelial cells. However, Non-Patent Document 1 does not describe that miR-570-3p is encapsulated in exosomes and secreted extracellularly, and therefore does not disclose any technology related to the cascade of cellular senescence. Furthermore, Non-Patent Document 2 discloses that vaccarin suppresses inflammation in vascular endothelial cells via the miR-570-3p / HDAC1 pathway, and Non-Patent Document 3 discloses that zinc carnosine increases PDL-1 expression in human colon cancer cells via miR-570-3p, thereby increasing the anti-tumor activity of colon cancer. However, neither of these documents discloses an evaluation from the perspective of aging or the aging-linked state.

[0026] <Evaluation of the cellular senescence chain state> In this embodiment, the "cascade of cellular aging" refers to a state in which a certain cell initiates aging of surrounding cells, resulting in aging of the surrounding tissues. Previous studies of senescent cells have focused on the expression of senescence factors within cells and the mechanism of senescence within cells. However, the present embodiment provides a technique for evaluating the effect of target cells (originating cells) on the senescence of surrounding cells or tissues. The target cells may be cells undergoing senescence (in the process of senescence) or senescent cells. For example, since cellular senescence can be induced by repeated passaging, cells with different passage numbers may be used, with the more passaged cells being used as senescent cells, and cells with fewer passage numbers being used as young cells or cells not undergoing senescence. For example, cells with passage P = 1, 2, 3, 4, 5, 6, 7, 8, 9, or a predetermined number or less may be used as young cells or control cells. Furthermore, cells with passage P = 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or a predetermined number or more may be used as senescent cells or target cells. Additionally, senescent cells may be used as a control and young cells as target cells.

[0027] In this embodiment, the evaluation of the senescence-linked state of cells is preferably an evaluation that can use miR-570-3p as an indicator. Examples of evaluation in this embodiment include, for example, evaluating the senescence chain state of individual cells or cells derived from individual animals, evaluating the senescence chain state of cells caused by external stimuli, evaluating the senescence chain state of cells caused by a test substance, and screening for senescence chain regulators by evaluating the senescence chain state of cells in the presence of a test substance and / or external stimuli; one or more selected from these may be used. In this case, senescent cells or senescence-induced cells (e.g., EFEMP2 knockdown cells) may be used, and by using these, evaluation can be performed in states where the amount of miR-570-3p is high or where the cellular senescence chain is accelerated or advanced.

[0028] The "external stimulus" in this embodiment is preferably an external stimulus related to aging, and more preferably an external stimulus related to skin aging. Examples of external stimuli include stress (oxidative stress inducers (e.g., active oxygen generating substances such as oxygen peroxide), dryness, light (ultraviolet rays, etc.), allergens, etc., and one or more types selected from these can be used.

[0029] Furthermore, because the addition of miR-570-3p mimic promotes the senescence pathway in cells, the miR-570-3p mimic (specifically, full-length miR-570-3p) may be used to evaluate the state of the senescence pathway in cells. In this case, for example, a test substance may be added together to screen for substances that modulate the senescence pathway, or an external stimulus may be added together to evaluate the state of the senescence pathway in cells.

[0030] Comparison with a control when making an evaluation in this embodiment includes, but is not limited to, a relative comparison such as in a comparative experimental system (e.g., the presence or absence of the addition of a test substance, the presence or absence of an external stimulus, or the difference in the number of cell passages), or a time-course comparison such as a time-series change in the same experimental system (e.g., the magnitude of the slope between two points). This embodiment may also be an evaluation in comparison with data (e.g., standard data) on the state of the cellular senescence chain obtained from publicly available literature or statistical processing. This embodiment may also be a judgment or evaluation based on absolute values ​​obtained by setting a threshold, or a judgment or evaluation based on relative values ​​based on a certain standard. The controls used in this embodiment may be a negative control (NC; no effect on the results, e.g., no addition of the test substance) or a positive control (a control that demonstrates an effect, e.g., the addition of a substance already known to have a positive or negative effect (e.g., the addition of a known cellular senescence chain inhibitor or a known cellular senescence chain accelerator)). However, a control without the addition of the test substance is preferred because it facilitates comparative evaluation or judgment.

[0031] This embodiment preferably involves evaluation by comparison with a control. For example, an evaluation step may include comparing the expression level of miR-570-3p in the target cells with that of control cells, and assessing that a higher level indicates an accelerated cellular senescence pathway, or a lower level indicates an inhibited cellular senescence pathway. This evaluation may also involve judgment, selection, or the like. Note that in this embodiment, the "expression level" of "miR-570-3p expression level" may also refer to "amount." Furthermore, the "cellular miR-570-3p expression level" preferably refers to the expression level of cell-derived miR-570-3p. Examples of cell-derived miR-570-3p include, but are not limited to, the amount of miR-570-3p in the cells, the amount of miR-570-3p secreted extracellularly, and the amount of miR-570-3p encapsulated in exosomes released from the cells. Furthermore, the "cellular senescence pathway" refers to the aging of cells or tissues surrounding the target cells. The cells or tissues evaluated in this embodiment are cells or tissues surrounding the target cells, and may be the same type of cells as the target cells or a different type of cells, or may be the same tissue as the target cells or a different tissue from the target tissue. For example, if the target cells are fibroblasts and / or epidermal keratinocytes, this embodiment can evaluate the fibroblasts and / or epidermal keratinocytes, or skin tissue containing them.

[0032] And in this embodiment, the higher the expression level of miR-570-3p in the target cells is compared with the expression level of miR-570-3p in the control cells, the higher the promotion of the cell senescence cascade is or the lower the suppression is, or the lower it is compared with the control, the lower the promotion of the cell senescence cascade is or the higher the suppression is, and it can be evaluated that the progress of the cell senescence cascade may be fast or slow. The expression level of miR-570-3p may be either or both of the intracellular expression level and / or the extracellularly secreted expression level. However, it is preferable to preferentially use the intracellular expression level because the results can be obtained by a simple detection or measurement method. Also, preferentially using the amount secreted extracellularly is preferable in terms of enhancing the accuracy of evaluation. More preferably, it is to use the amount of miR-570-3p encapsulated in exosomes released extracellularly.

[0033] For example, the state of the cell senescence cascade may be evaluated from the difference in the expression level obtained by subtracting the expression level of miR-570-3p in the control cells from the expression level of miR-570-3p in the target cells, or the expression level of miR-570-3p in the control cells may be set as 100% and evaluated as [expression level of miR-570-3p in target cells / expression level of miR-570-3p in control cells] × 100%.

[0034] <Method for detecting or measuring miR-570-3p> The expression level of miR-570-3p used in this embodiment may be the expression level of miR-570-3p extracted from the target cells. From the perspective of improving the evaluation accuracy, it is preferable to use as an index the amount of miR-570-3p encapsulated extracted from exosomes released from the target cells. Also, from the perspective of ease of operation, it is preferable to use as an index the expression level of miR-570-3p extracted from the target cells. For example, for the expression or expression level of miR-570-3p, the expression level of miR-570-3p may be detected or measured, or the state related to the expression of miR-570-3p may be detected or measured with a microscope or an automatic measuring device. These extractions and expression levels, etc., may use commercially available reagent kits (for example, for extraction, measurement, etc.), or may use a measuring method or measuring device capable of measuring these expression levels and exosomes, etc.

[0035] Methods for detecting or measuring miR-570-3p expression include, but are not limited to, PCR (quantitative PCR, real-time PCR), LAMP, Northern blotting, microarray, RNA sequencing, in situ hybridization (ISH), and the like, and one or more methods may be selected from these. Among these, nucleic acid amplification methods such as PCR and LAMP, which are simple and quantitative, are preferred, with PCR being more preferred. Primers used in nucleic acid amplification methods are not particularly limited, and commercially available products can be used as appropriate. Real-time PCR is even more preferred. The real-time PCR method is not particularly limited, and known methods can be used, such as the intercalation method, the hybridization method, and the LUX method, and one or more methods selected from these can also be used.

[0036] <Cellular senescence markers> In this embodiment, if necessary, a cellular senescence marker may be used to evaluate the senescence state of cells or the state of senescence-linked cells. Examples of cellular senescence markers include, but are not limited to, SA-β-gal (senescence-associated β-galactosidase) staining, cell proliferation, cell particle shape, expression level of senescent cell genes, and DNA damage response (DDR) markers. One or more selected from these may be used. Cellular senescence markers may be obtained using commercially available kits, as appropriate. Among these, SA-β-gal (senescence-associated β-galactosidase) staining is preferred, and the SA-β-galactosidase-positive cell rate (%) can be calculated by multiplying the number of SA-β-galactosidase-positive cells by the total number of cells evaluated by 100.

[0037] <Culture method> The target cells may be cultured as needed, and the senescence state of the cells may be evaluated before, during, or after culture. The method for culturing the target cells is not particularly limited, and known culture methods can be appropriately adopted depending on the cells used. The cell culture medium used is not particularly limited, and commercially available products or media obtained by known production methods may be used depending on the cells used. Furthermore, culture conditions such as the cell culture medium, culture atmosphere, and subculture may be appropriately modified depending on the cells used. For example, fibroblasts can be seeded in a commercially available culture vessel and cultured at 37°C in a 5% CO2 atmosphere using a cell culture medium (e.g., DMEM medium containing 10% fetal bovine serum (FBS)). Furthermore, when fibroblasts are used, commercially available fibroblast media (e.g., medium for normal fibroblasts, 2D-growth medium) may be used, and when epidermal keratinocytes are used, commercially available epidermal keratinocyte media (e.g., medium for normal epidermal keratinocytes, 2D-growth medium) may be used.

[0038] The fibroblast medium may be one or more selected from media obtained by known production methods or commercially available products (e.g., Fibroblast Medium (Takara Bio), HFDM-1 Medium (Cell Science Institute), Fibrolife S2 Medium Complete Kit (Lifeline Cell Technology)). For example, DMEM (Dulbecco's Modified Eagle Medium) may be used. For example, a growth medium for fibroblasts may be used. For example, DMEM medium containing 10% FBS (fetal bovine serum) may be used.

[0039] The medium for epidermal keratinocytes may be one or more selected from media obtained by known production methods or commercially available products (e.g., CnT-PR medium (CnT-Prime, Epithelial Culture Medium, CELLnTEC), Keratinocyte Growth Medium 2 (Promocell), MCDB153 medium (Cosmo Bio Co., Ltd.), HuMedia-KG2 (Kurabo), etc.). For example, a growth medium for epithelial cells may also be used. For example, serum- and BPE (Bovine Pituitary Extract)-free CnT-PR medium may also be used.

[0040] The culture temperature can be any general culture temperature, for example, about 35 to 38°C, and the period of contact with the test substance can also be within this temperature range. The culture period is not particularly limited, but is preferably a period long enough to obtain test results, with suitable lower limits being, for example, 12 or 18 hours or more, preferably 1 day or more, and more preferably 1.5 days or more, and suitable upper limits may be, for example, 14 days, 7 days or less, 3 days, or 2.5 days or less, and may be determined by checking the state of the cells and determining whether to discontinue culture as appropriate. The culture periods before and during contact with the test substance can also be within these ranges, with suitable upper limits being 48 hours or less, 36 hours or less, or 30 hours or less. The density of the cells in the culture is not particularly limited, but may be, for example, 10 3 More than 10 cells / cm is preferred, and more preferably 10 3 ~10 6 cells / cm 2 , more preferably 10 4 ~10 5 cells / cm 2 Examples include:

[0041] The conditions for contacting the test substance with the cells are not particularly limited and can be changed appropriately depending on the purpose. Contacting the test substance with the cells can be, for example, by culturing the cells in a medium containing the test substance, and the order of adding the cells and the test substance to the medium can be any. This embodiment may also include culturing the medium containing the test substance and the cells after contacting them.

[0042] In this embodiment, examples of culture conditions for screening a test substance are described below in (a) to (c), but are not limited thereto. It is desirable to perform the control under the same culture conditions as those for the test substance, except that the test substance is used. (a) Cells are seeded in a container containing a medium and cultured for a certain period of time. After that, the test substance is added to a predetermined concentration and contacted with the cells. For example, the certain period of culture before the addition of the test substance may be appropriately set depending on the cells, and is preferably, for example, 1 to 2 days or 18 to 30 hours. Alternatively, the test substance may be added after the cell number reaches a predetermined number or range, or after the cell has reached confluence. The predetermined concentration (final concentration) of the test substance is not particularly limited, and suitable lower limits include, for example, 0.0001%, 0.005%, or 0.01% or more, and suitable upper limits include, for example, 1% or less, 0.5% or less, or 0.1% or less. However, the concentration may be adjusted appropriately depending on the potency of the test substance. (b) After contact, the cells are cultured in the presence of the test substance for a certain period of time. The test substance may be added to a predetermined concentration each time the medium is changed. The contact period is not particularly limited, and examples include, for example, after contact (starting time 0 hours), 0.5 to 2 days, or 18 to 30 hours. (c) After culturing the cells for a certain period of time after contact with the test substance, the senescence-linked state of the cells (e.g., the expression state of mi-570-3p, changes in cell morphology due to mi-570-3p expression, etc.) is detected or measured. The number of detections or measurements per sample may be one or more times after the end of the period or during the period. The senescence-linked state of the cells (e.g., expression state, changes in morphology) may be detected or measured at regular intervals to observe changes over time. The test substance may also be replaced with an external stimulus (e.g., an oxidative stress substance (e.g., hydrogen peroxide solution), light exposure, etc.) to evaluate the senescence-linked state of the cells.

[0043] <cell> The cells used as target cells in this embodiment are not particularly limited, and may be, for example, autologous cells (e.g., blood, somatic cells, etc.) collected from a target animal such as a human, cultured cells, pluripotent stem cells, or cells obtained by inducing differentiation of autologous cell-derived pluripotent stem cells. The target animal may be any of the target animals described below. Furthermore, by selecting the cells used in this embodiment, it is also possible to select cells or tissues (cells or tissues surrounding the target cells) that can evaluate the cellular senescence-linked state. The cells to be evaluated may be cells of the same or different species as the target cells, and the tissue to be evaluated may be the same or different tissue as the tissue containing the target cells, but is a cell or tissue surrounding the target cells.

[0044] When this embodiment is used in a technique related to the aging-linked state of cells in the skin, it is preferable to use fibroblasts and / or epidermal keratinocytes as target cells (originating cells), and more preferably fibroblasts.

[0045] The somatic cells used in this embodiment refer to any animal cells (preferably mammalian cells including humans) excluding germline cells such as eggs, oocytes, and ES cells, or totipotent cells. Somatic cells include, but are not limited to, fetal (offspring) somatic cells, newborn (offspring) somatic cells, and mature healthy or diseased somatic cells, as well as primary culture cells, subcultured cells, and established cell lines.

[0046] More specific examples of somatic cells include tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells; tissue progenitor cells; and differentiated cells such as lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts, epidermal keratinocytes, hair cells, stem cells, gastric mucosal cells, intestinal cells, spleen cells, pancreatic cells, brain cells, embryonic cells, kidney cells, and adipocytes; and one or more types selected from these can be used.

[0047] The pluripotent stem cells used in this embodiment are stem cells that have pluripotency, meaning they can differentiate into all cells present in a living organism, and also have the ability to proliferate. Examples include, but are not limited to, embryonic stem cells (ES cells), embryonic stem cells derived from cloned embryos by nuclear transfer (ntES cells), spermatogonial stem cells (GS cells), embryonic germ cells (EG cells), induced pluripotent stem cells (iPS cells), and somatic stem cells (e.g., Muse cells and mesenchymal stem cells) derived from cultured fibroblasts or bone marrow stem cells. One or more of these may be used. These cells can be produced by known production methods or obtained commercially or from public institutions. Preferably, the cells are derived from mammalian cells, particularly human cells.

[0048] Embryonic stem cells (ES cells) are stem cells established from the inner cell mass of early mammalian embryos (e.g., blastocysts) such as humans and mice. Spermatogonial stem cells are pluripotent stem cells derived from spermatozoa and are the cells that serve as the source of spermatogenesis. Embryonic germ cells are cells established from primordial germ cells during the fetal stage.

[0049] Induced pluripotent stem cells (iPS cells) are artificial stem cells derived from somatic cells that have properties similar to those of ES cells, such as pluripotency and the ability to proliferate through self-renewal, and can be produced by introducing certain reprogramming factors into somatic cells in the form of DNA, RNA, or protein. They can be produced by referring to known techniques (e.g., Patent Document 4: WO2007 / 069666, etc.).

[0050] The pluripotent stem cells are preferably ES cells and / or iPS cells, more preferably iPS cells. The iPS cells are preferably derived from mammalian (preferably human) cells. Generally, the cells used for producing iPS cells are not particularly limited, and somatic cell-derived iPS cells are preferred.

[0051] When this embodiment is used in a technology related to the linked state of cellular aging in the skin, differentiated cells are suitable as somatic cells to be used for producing iPS cells. The differentiated cells are not particularly limited, but among these, for example, blood system cells and skin system cells are suitable. Furthermore, in this embodiment, autologous cells of the target animal are preferred from the viewpoint of obtaining a customized effect from the test substance, and when iPS cells are used to obtain target cells, for example, iPS cells may be obtained from a sample collected from the target animal (e.g., blood (e.g., red blood cells, white blood cells, platelets, etc.)), and the iPS cells may be induced to differentiate into target cells (e.g., skin cells, etc.).

[0052] <Test substance> The "test substance" used in this embodiment is not particularly limited and may be of natural or artificial origin. More specific examples of origin include, but are not limited to, one or more types selected from the group consisting of animal and plant origin, microbial origin, and mineral resource origin. The test substance may also be a test material. More specific examples of the test substance include, for example, one or more types selected from the group consisting of compounds (single or mixture); animals, plants, microorganisms, artificially synthesized products, and cells thereof; processed products, cultures, culture supernatants, extracts, isolated products, and purified products of animals, plants, microorganisms, and synthesized products; and mixtures and compositions thereof. In this embodiment, the compound may be either an inorganic compound or an organic compound. This embodiment allows for better evaluation or determination of a wide range of substances.

[0053] As an example of the method for producing or extracting a test substance, the test substance can be extracted from a material (e.g., a plant, an animal, etc.) containing the test substance. In the case of a plant, any part may be used for extraction, including, for example, seeds, fruits, leaves, stems, roots, and the whole plant, and one or more selected from these can be used. It is also preferable to perform processing appropriate to the material. For example, materials that have been appropriately subjected to physical processing such as drying, crushing, cutting, or shredding, or enzymatic processing such as enzymatic hydrolysis, can be used, and extraction is preferably performed after such processing.

[0054] The extraction method is not particularly limited. For example, the extraction may be carried out by using an extraction solvent for a predetermined period of time at a constant temperature (low temperature, room temperature, or heated) using a conventional extraction method such as immersion or countercurrent extraction. As a pretreatment, the extraction part may be washed with water to remove foreign matter, and then may be used as is or dried, and further cut or crushed as necessary. The pH during extraction is not particularly limited, but is generally preferably in the range of pH 4 to 9. A suitable example of the extraction method is to extract the material with the extraction solvent at room temperature (e.g., about 1 to 30°C) or at elevated temperature (e.g., about 30 to 100°C) for 5 minutes to 50 days.

[0055] The solvent used for the extraction is not particularly limited, but examples include water and organic solvents, and one or more selected from these can be used. Among these, water-soluble organic solvents are preferred, and alcohols and / or water are also preferred. Examples of the alcohols include lower monohydric alcohols (e.g., methanol, ethanol, etc.); liquid polyhydric alcohols (e.g., 1,3-butylene glycol, propylene glycol, glycerin, etc.). The alcohols are preferably monohydric alcohols and dihydric alcohols, and the number of carbon atoms of the alcohols is preferably about 1 to 5. Among the alcohols, ethanol and 1,3-butylene glycol (1,3-BG) are preferred. One or more selected from these can be used. In the case of an aqueous alcohol solution, the alcohol concentration (V / V) is preferably 0 to 100% by volume, more preferably 20 to 80% by volume, even more preferably 30 to 70% by volume, and even more preferably 40 to 60% by volume.

[0056] The obtained extract may be diluted or concentrated to a desired concentration, and then impurities may be removed by a separation and purification method such as filtration or chromatographic separation. Furthermore, the extract may be dried by a conventional method such as spray drying or freeze drying. The form of the obtained extract is not particularly limited, and examples thereof include liquid, solid, semi-solid, and powder. The extract used in this embodiment may be a commercially available product.

[0057] In addition, in this embodiment, the solvent control for the test substance is not particularly limited and can be determined appropriately taking into consideration the solubility (polar, non-polar, etc.) of the test substance, and examples include water, DMSO, ethanol, etc., and one or more selected from these can be used. In this embodiment, when screening or evaluation is performed, the final concentration of the test substance in the medium, sample, or the like is not particularly limited. Examples of such methods include culturing or reacting fibroblasts in a medium containing the test substance at the final concentration. In this embodiment, for example, when the final concentration of the test substance is adjusted to at least 0.00001% and / or 50% or less, if there is no difference from a control without the test substance, it may be determined that the test substance does not affect the senescence-linked state of cells.

[0058] Examples of "specific examples of candidate test substances" in this embodiment include active lipids (e.g., lysophosphatidylcholine, lecithin, lipopolysaccharide, sphingolipid, etc.); polyphenol compounds (e.g., quercetin, fisetin, resveratrol, flavonoids, and glycosides thereof); carotenoid compounds (e.g., astaxanthin, lycopene, carotene, cryptoxanthin, etc.); vitamins (VC-pMG, niacin, Q1 One or more of the following may be used: vitamin E and derivatives; mucopolysaccharides (hyaluronic acid, chondroitin sulfate, heparin, etc.); amino acid-like compounds (taurine, etc.); nucleic acids (deoxyribonucleic acid, ribonucleic acid, NMN, etc.); peptides (protein hydrolysates, synthetic peptides, etc.); growth factors (FGF, EGF, etc.); culture supernatants (culture supernatants of stem cells, dermal stem cells, adipose stem cells, etc.); alkali metal salts (alkali metal chlorides such as sodium chloride); plant extracts, etc. The term "active lipid" is also referred to as a physiologically active lipid and refers to a lipid that has the activity of directly transmitting a signal via a target protein.

[0059] By using this embodiment, it is possible to better evaluate or determine the regulation of miR-570-3p expression and the state of cell aging, and it is also possible to search for or screen for substances that may have even more pronounced effects from among the test substances.

[0060] 3. Screening method for substances that regulate the cellular aging chain This embodiment can provide a screening method for substances that regulate the senescence-linked state of cells, using miR-570-3p as an indicator. In this embodiment, when evaluating the cellular senescence-linked state of skin, the target cells (originating cells) are preferably fibroblasts and / or epidermal keratinocytes, more preferably fibroblasts, and / or the cells surrounding the target cells or cells contained in the surrounding tissue for which the cellular senescence-linked state is being evaluated may be, for example, one or more types selected from vascular endothelial cells, pigment cells, fibroblasts, and epidermal keratinocytes, more preferably fibroblasts and / or epidermal keratinocytes. The amount (expression level) of miR-570-3p measured in this embodiment may be either intracellular or exosomal, but using the amount of miR-570-3p in exosomes as an indicator allows for more accurate provision of substances that regulate the cellular senescence-linked state.

[0061] This embodiment preferably includes or employs the following steps: (a) comparing the expression level of miR-570-3p in a target cell with that of miR-570-3p in a control cell; and (b) determining that the progression of the cellular senescence chain is inhibited and selecting the test substance as an inhibitor of the cellular senescence chain if the target expression level is high. As mentioned above, "expression level" may also refer to "amount." Furthermore, this embodiment preferably includes comparing the expression level of miR-570-3p after contacting the test substance with the cells with the expression level of miR-570-3p in control cells (e.g., no test substance added), and selecting the test substance as one that promotes the cellular aging chain if it is higher, or selecting the test substance as one that suppresses the cellular aging chain if it is lower.

[0062] In addition, in this embodiment, various detections or measurements related to miR-570-3p may be performed to obtain the cellular senescence-linked state, and various detections or measurements can be used to obtain data or information on the cellular senescence-linked state caused by miR-570-3p.

[0063] Furthermore, in a preferred embodiment of this embodiment, the intracellular miR-570-3p expression state is determined before the test substance is contacted with the cell. Based on the results of the intracellular expression state determination, the strength of the test substance's regulatory effect or ability to regulate the cellular senescence-linked state can be easily determined, selected, or evaluated. The "intracellular miR-570-3p expression state" may be, for example, the expression level of miR-570-3p extracted from the cell. Cell extraction can be performed using known methods or commercially available products (e.g., miRNeasy kits). For example, a monophasic solution of phenol and guanidine thiocyanate can promote tissue lysis and inhibit RNase, and most cellular DNA and proteins can be removed from the lysate by extraction with an organic solvent (e.g., a nonpolar solvent such as phenol or chloroform). The RNA in the aqueous layer can then be amplified using known methods or commercially available reagent kits. Furthermore, the aqueous layer containing the RNA can be isolated and the RNA purified by alcohol precipitation, and the purified RNA can be amplified using known methods or commercially available reagent kits. In addition, in the present embodiment, preferred aspects of this embodiment, and more specific preferred aspects of this embodiment described above or below, the terms "intracellular miR-570-3p expression" and "intracellular miR-570-3p expression level" may be replaced with "amount of miR-570-3p secreted outside the cell (preferably, amount of miR-570-3p in exosomes released into the cell)."

[0064] In a preferred aspect of this embodiment, it is preferable to determine, select, or evaluate the function, action, efficacy, etc. of the test substance (e.g., the strength of the regulating effect or regulating power of the cellular senescence chain state) based on the change in the intracellular miR-570-3p expression level caused by the test substance when the test substance is contacted with the cells.

[0065] For example, if the expression of miR-570-3p in cells contacted with a test substance is compared with the expression of miR-570-3p in cells used as a control (e.g., no test substance added), (1) if it is high, the test substance contacted with the cells can be determined as a substance that promotes the cellular senescence chain and is capable of promoting the cellular senescence chain; or (2) if it is low, the test substance contacted with the cells can be determined as a substance that inhibits the cellular senescence chain and is capable of inhibiting cellular senescence. Note that, in this specification, "determining" (step) may also mean "selecting" or "evaluating." In this case, it is preferable to detect or measure the expression level of miR-570-3p by nucleic acid amplification (e.g., PCR, LAMP, TRC, etc.) from the standpoint of easier operation and objective evaluation. By confirming the expression of miR-570-3p in the cells, the senescence-linked state of the cells exposed to the test substance can be compared with the cellular senescence-linked state of the control cells.

[0066] When the above determinations of (1) high and (2) low are made more precisely, for example, miR-570-3p expression in cells contacted with a test substance can be compared with miR-570-3p expression in cells used as a control (e.g., no test substance added), and it can be determined that (a) if the test substance increases the expression level of miR-570-3p, the test substance is a substance that promotes the cellular senescence chain; or (b) if the test substance does not change the expression level of miR-570-3p (e.g., there is no statistically significant difference), the test substance is a substance that does not affect the cellular senescence chain state; or (c) if the test substance decreases the expression level of miR-570-3p, the test substance is a substance that suppresses the cellular senescence chain state.

[0067] In this embodiment, the amount of miR-570-3p secreted extracellularly from cells contacted with a test substance (e.g., miR-570-3p-encapsulated exosomes) may be obtained to determine the state of the cellular senescence chain. The amount of miR-570-3p secreted extracellularly from cells contacted with a test substance may be compared with the amount of miR-570-3p secreted extracellularly from control cells (e.g., no test substance added), and agents for modulating the cellular senescence chain may be screened using the same method as described above (when high or low). For example, the amount of miR-570-3p secretion may be determined by isolating exosomes from the culture medium and measuring the amount of miR-570-3p in the isolated exosomes. Furthermore, analysis to confirm exosome isolation may involve one or more methods selected from a reagent kit, a nanoparticle analyzer, a transmission microscope, Western blotting, flow cytometry, and the like. The method for analyzing miR-570-3p in exosomes can be appropriately selected from the above-mentioned "methods for detecting or measuring miR-570-3p expression" (e.g., PCR).

[0068] As a more specific preferred aspect of this embodiment, (A) contacting a test substance with cells; and (B) contacting the test substance with the cells and then determining the test substance based on changes in intracellular miR-570-3p expression. The screening may be for a substance that modulates miR-570-3p expression and / or a substance that modulates the senescence-linked state of cells. Cell evaluation may be performed by replacing "test substance" in steps (A) and (B) with "in the presence of an external stimulus." Furthermore, evaluation of the test substance may be performed by adding "in the presence of an external stimulus" to steps (A) and (B). Furthermore, "intracellular miR-570-3p expression (amount)" may be replaced with "amount of miR-570-3p in exosomes."

[0069] Furthermore, in step (B), the senescence-linked state of the cells may be obtained by various measurement methods, measurement devices, or measurement steps. The senescence-linked state of the cells may be, for example, the expression state associated with miR-570-3p expression or a change in cell morphology. The senescence-linked state of the cells may be determined, for example, based on the expression level of miR-570-3p extracted from the cells.

[0070] Furthermore, the step (B) of determining may be a selection or evaluation, and the step (A) of contacting may be omitted and the aging-chain state of the cells themselves may be determined, and the aging-chain state of the cells themselves may be evaluated.

[0071] In step (B), "based on changes in intracellular miR-570-3p expression" may refer to "comparison with a control," and examples of "comparison with a control" include comparing the expression level of miR-570-3p in cells contacted with the test substance with that in control cells (e.g., no test substance added) to determine whether the test substance is a miR-570-3p modulator or a modulator of the cellular senescence chain. Furthermore, examples of "comparison with a control" include comparing the difference between the state of the cellular senescence chain involving miR-570-3p expression before and after the addition of the test substance by observing (observing and / or measuring) changes in the cellular senescence chain involving miR-570-3p expression (changes in the originating cell, surrounding cells, or tissues).

[0072] Furthermore, a pre-culture step of culturing the cells seeded in the medium may be included before the step (A). In this embodiment, the duration of the pre-culture period, contact period, etc. may be appropriately selected from the above-mentioned periods (e.g., a fixed period), for example, 18 to 30 hours.

[0073] Furthermore, in step (A), cells (e.g., EFEMP2 knockdown cells) that regulate (e.g., suppress or promote) miR-570-3p expression may be prepared before contact with the test substance, and such preparation may be used as a pretreatment step for step (A). Furthermore, cells in which miR-570-3p expression is regulated or cells in which senescence has been induced may be used in step (A), and examples of such cells include EFEMP2 knockdown cells.

[0074] Furthermore, as a more specific preferred embodiment of this embodiment, (A) contacting a test substance with cells; (B) The amount of miR-570-3p expression in cells in a medium containing the test substance is used as an index, and compared with the amount of miR-570-3p expression in cells in a control medium without the test substance. If the amount of miR-570-3p expression in cells with the test substance is high, the substance is selected as a substance that promotes the cellular senescence chain state, or A screening method can be provided that includes a selection step in which, if the intracellular miR-570-3p expression level in the presence of the test substance is low, the substance is selected as a substance that inhibits the cellular senescence chain state. The "test substance" in steps (A) and (B) above may be replaced with "in the presence of an external stimulus" to evaluate the cells. Furthermore, the "in the presence of an external stimulus" may be added to steps (A) and (B) above to evaluate the test substance. Furthermore, the "expression level of miR-570-3p in cells" may be replaced with the "amount of miR-570-3p in exosomes."

[0075] 4. Substances for regulating miR-570-3p expression, substances for regulating the cellular aging chain

[0076] Another aspect of this embodiment can be to provide a substance that has the effect of regulating miR-570-3p expression (a substance for regulating miR-570-3p expression) and / or a substance that has the effect of regulating the cellular senescence chain state (a substance for regulating the cellular senescence chain). Note that in this embodiment, either or both of the substance for regulating miR-570-3p expression and the substance for regulating the cellular senescence chain are also referred to as "effective substances." Another aspect of this embodiment can be to provide a composition containing the effective substance (such as an agent for regulating miR-570-3p expression, or a composition for regulating the cellular aging chain).

[0077] Furthermore, this embodiment can provide a technology for searching for or evaluating the effective substance, etc. Specifically, by using the miR-570-3p indicator, the effective substance and a composition containing the effective substance can be provided. The cellular senescence chain state is preferably the senescence chain state of various organs (preferably the skin), or may be the cellular senescence chain state due to aging. Furthermore, in this embodiment, "regulation of the cellular senescence chain" may be "regulation of miR-570-3p expression" or "regulation of the cellular senescence chain state by regulating miR-570-3p expression."

[0078] The cells or tissues linked to senescence are not particularly limited, and the above-mentioned cells, tissues, and origins can be appropriately used. Among these, the cells or tissues linked to senescence are preferably one or more types selected from the group consisting of skin, epidermis, dermis, fibroblasts, and epidermal keratinocytes, and more preferably one or more types selected from the group consisting of skin, dermis, and fibroblasts.

[0079] In this embodiment, a substance selected or chosen by the screening method, evaluation and / or selection method for a substance for regulating miR-570-3p expression and a substance that regulates the cellular senescence chain (hereinafter also referred to as a "selected substance") can be provided as the effective substance. Furthermore, the screening method, evaluation method, and / or selection method for a substance that has the effect of regulating the aging-linked state of a cell may be a device or system for use in screening, evaluation, and / or selection of a substance that has the effect of regulating the aging-linked state of a cell in this embodiment, or may be a method executed or stored in the device or system.

[0080] Examples of the effect of regulating the cellular aging-related state include, but are not limited to, an effect of regulating the cellular aging-related state (e.g., skin), an effect of regulating the cellular aging-related state due to aging, etc. The regulating effect includes a promoting or inducing effect, an inhibiting or suppressing effect, an improving effect, a maintaining effect, etc. One or more of these can be selected. Therefore, the selected substance or substance having the effect of regulating the cellular aging chain state obtained by the method of evaluating and / or selecting for the regulation of the cellular aging chain state of this embodiment (hereinafter referred to as "the effective substance") has the effect of regulating the cellular aging chain state, and therefore can exert effects on anti-aging, aging inhibition, rejuvenation, etc. of cells or skin, such as inhibition of aging of cells or skin due to aging.

[0081] The effective substance used in this embodiment is not particularly limited and may be either naturally or artificially derived, and may be either a single substance or a mixture. The effective substance is preferably one or more substances selected from compounds, microorganisms or their cultures, extracts, mixtures thereof, and compositions. The compound may be either an inorganic compound or an organic compound. The effective substance is preferably one or more substances selected from the "Specific examples of candidate test substances" described in the above-mentioned <Test substance>. In this embodiment, the effective substance may be a commercially available product or may be obtained by a known manufacturing method.

[0082] The manufacturing method or extraction method for the effective substance etc. can be appropriately adopted from the manufacturing method or extraction method (including the site, temperature, solvent, pH, etc.) for the above-mentioned <Test substance>.

[0083] In this embodiment, a substance that suppresses the cellular aging chain state caused by miR-570-3p is suitable for use in preventing, improving, treating, and maintaining rejuvenation of, for example, cellular aging, acceleration of the cellular aging chain, skin aging, and dermal aging, and is even more suitable for use in preventing, improving, and treating one or more specific symptoms selected from, for example, wrinkles, sagging, nasolabial folds, age spots, dullness, etc.; chronic mild inflammation induction, and wound healing failure.

[0084] The rose fruit or an extract thereof used as one of the active substances in this embodiment is preferably an extract obtained by extracting the fruits of Rosa multiflora Thunberg with an alcohol-containing aqueous solution. Rosa multiflora grows in thickets and fields along riverbanks from Hokkaido to Honshu, Shikoku, and Kyushu, and is also found in the Korean Peninsula and China. Rosa multiflora is the fruit of the plant.

[0085] The solvent used to extract the Rhizome extract can be any of the extraction solvents described above for the test substance, but alcohols and / or water are preferred. The alcohols are preferably monohydric and dihydric alcohols, and preferably have approximately 1 to 5 carbon atoms. Among these alcohols, ethanol and 1,3-butylene glycol (1,3-BG) are preferred, with ethanol being even more preferred. One or more selected from these can be used. In the case of an alcohol-containing aqueous alcohol solution, the alcohol concentration (V / V) is preferably 20 to 80% by volume, even more preferably 30 to 70% by volume, and even more preferably 40 to 60% by volume. The temperature during extraction is not particularly limited, but is preferably room temperature to 90°C, more preferably 80 to 90°C. For example, if the extraction temperature is increased, such as by heating and extracting at 80 to 90°C for 2 hours or extracting at room temperature (20 to 30°C) for 24 hours, the extraction time may be shortened to adjust the extraction (Patent Document 6: JP 2022-102858 A, Patent Document 7: JP 2021-169532 A).

[0086] The active substance can be contained as an active ingredient in a composition for regulating the cellular senescence chain, a composition for preventing, ameliorating, or treating a cellular senescence chain state, or the like, or can be used in such a composition, etc. In this embodiment, the composition may be an agent, and the agent may be a composition. Furthermore, the effective substance can be used to manufacture a composition for regulating the cellular aging chain of this embodiment. The present embodiment may also provide the effective substance or use thereof for, for example, regulating the state of the cellular senescence chain. The present embodiment may also provide the effective substance used for, for example, regulating the state of the cellular senescence chain. The regulation of the cellular senescence chain may be one or more selected from prevention, improvement, treatment, and maintenance of rejuvenation of aging, skin aging, dermal aging, etc. The present embodiment can also provide a method for regulating the state of the cellular aging chain, a method for preventing, improving, treating, or rejuvenating aging or the aging chain, etc., using the effective substance, or a method for regulating the state of the cellular aging chain, a method for preventing, improving, treating, or rejuvenating aging or the aging chain, etc., using a composition containing the effective substance.

[0087] The effective substance exhibits the above-mentioned physiological activity and can therefore be used in methods for preventing, ameliorating or treating symptoms or diseases caused by the aging chain or the like. Symptoms or diseases of the skin aging chain (preferably the epidermis or dermis aging chain) are not particularly limited, but include, for example, wrinkles, sagging, nasolabial folds, age spots, dullness, etc.; chronic mild inflammation and impaired wound healing, etc., and one or more of these can be selected from the group consisting of these.

[0088] In this embodiment, "prevention" refers to preventing or delaying the onset of symptoms or disease in a subject, or reducing the risk of developing symptoms or disease in a subject, etc. In this embodiment, "amelioration" refers to improvement or maintenance of the disease, symptom, or condition in a subject; prevention or delay of deterioration; or reversal, prevention, or delay of progression.

[0089] In this embodiment, the active substance can be used in, for example, cosmetics, topical skin preparations, quasi-drugs, food and drink, feed (e.g., pet food), additives thereto, and the like, but is not particularly limited thereto. The "composition for modulating the cellular aging chain" may be used, for example, as a cosmetic, topical skin preparation, quasi-drug, food or drink, feed, etc., but is not particularly limited thereto, and one or more of these may be selected. Among these, cosmetic, topical skin preparation, pharmaceutical, quasi-drug, etc. are preferred. Furthermore, the "composition for modulating the cellular aging chain, etc." may be used as a compounding agent or additive to a composition, and may be, for example, a "composition for modulating the cellular aging chain, etc." used to be compounded or added to compositions such as cosmetics, topical skin preparations, quasi-drugs, foods and beverages, and feeds.

[0090] When the present embodiment is, for example, a cosmetic or topical skin preparation, the active substance or composition for controlling the cellular aging chain may be incorporated into various forms of the cosmetic or topical skin preparation, such as, but not limited to, emulsion, cream, lotion, pack, cleanser, makeup cosmetic, sunscreen, dispersion, ointment, liquid, aerosol, patch, cataplasm, liniment, etc. The present embodiment may select one or more of these.

[0091] When this embodiment is, for example, a pharmaceutical or quasi-drug, the active substance or composition for modulating the cellular aging chain can be incorporated into, but is not limited to, oral preparations such as tablets, capsules, granules, powders, liquids, and suspensions; external preparations such as dermatological preparations, patches, eye drops, nasal drops, oral preparations, and suppositories; and parenteral preparations such as infusions and injections. This embodiment can be administered in one or more of these forms.

[0092] Furthermore, in the case of this embodiment, for example, of a food composition, the active substance or composition for modulating the cellular aging chain can be incorporated into various foods, such as beverages such as soft drinks, tea drinks, coffee drinks, fruit juice drinks, carbonated drinks, jelly drinks, and near-water; foods and beverages such as jellies, wafers, biscuits, bread, noodles, and sausages; and nutritional foods, or as ingredients thereof, but is not limited to these. Furthermore, the food composition may be a supplement in the form of an orally administered formulation such as a tablet, capsule, granule, powder, liquid, or syrup. Furthermore, the food composition may include functional foods, foods for specified health uses, supplements, etc., based on the above-mentioned concept of anti-aging, etc., and labeled as such as necessary. These foods are permitted to make functional claims and can be distinguished from general foods. This embodiment may select one or more of these.

[0093] The effective substance or composition for modulating the cellular aging chain can be produced by using a known production method. The effective substance may be a commercially available product.

[0094] The content of the active substance is not particularly limited, and can be, for example, 0.0001 to 99% by mass, preferably 0.001 to 99% by mass, more preferably 0.005 to 90% by mass, and even more preferably 0.01 to 90% by mass of the active substance in the composition or the total amount of the preparation. The "preparation" in "of the total amount of the preparation" may be the "composition for controlling the cellular senescence chain, etc."

[0095] The effective substance or composition for modulating the cellular aging chain can be applied to humans and non-human animals (e.g., pets, livestock, etc.), etc. Among these, humans and pets are preferred, and humans are more preferred.

[0096] Methods for using the effective substances or compositions for modulating the cellular aging chain include, but are not limited to, administration such as transdermal administration, oral administration, or administration by injection; oral ingestion; and application to the skin. The amount of the active substance used or administered is not particularly limited as long as it is an amount that can obtain the effects of the present invention, and may be adjusted appropriately depending on the dosage form of the preparation, the application site, age, sex, etc.

[0097] The composition for modulating the cellular senescence chain can be produced using known production methods. In addition to the selected substance or effective substance, the composition for modulating the cellular senescence chain can also contain optional components such as various additives, as needed.

[0098] In this embodiment, the optional ingredients may be appropriately blended with ingredients acceptable for cosmetics, topical skin preparations, pharmaceuticals, foods and beverages, feeds, etc. For example, one or more selected from excipients, colorants, thickeners, binders, disintegrants, dispersants, stabilizers, gelling agents, antioxidants, surfactants, preservatives, moisturizers, pH adjusters, etc. may be appropriately used, thereby allowing the desired dosage form to be obtained.

[0099] 5. Other Aspects of the Present Embodiment In another aspect of this embodiment, determination, evaluation, etc. of cells (preferably cells of the target animal) may be carried out, and the cells are preferably fibroblasts and / or epidermal keratinocytes. As a more preferred aspect of this embodiment, a method for evaluating the aging-linked state or anti-aging-linked state of cells of a subject animal using miR-570-3p as an indicator may be provided, and the evaluation method may be a determination method.

[0100] In this embodiment, the target animal is not particularly limited, but is preferably a mammal, and it is preferable to use one or more species selected from, for example, humans, monkeys, pigs, cows, horses, mice, etc., and of these, humans are preferable for cosmetic purposes, etc.

[0101] In this embodiment, it is preferable to use miR-570-3p in a biological sample as an indicator, and the biological sample is, for example, one or more selected from blood, hair, cells, and tissues collected from a subject animal.

[0102] In addition, a preferred aspect of this embodiment includes the steps of: (1) detecting or measuring the expression level of miR-570-3p in cultured cells, and acquiring the senescence-linked state of the cells based on the results; (2) The expression level of miR-570-3p in the cells is compared with the expression level of miR-570-3p in the control. The evaluation method may include a step of determining that (a) if the level is increased, the senescence-linked state of the cell is progressing, or (b) if the level is decreased, the senescence-linked state of the cell is inhibited.

[0103] The control is not particularly limited and may be a control cell, and the control cell is not particularly limited and may be, for example, a fibroblast of the same age or generation, or a fibroblast previously collected from the same subject, or data on the cell state (e.g., expression state (expression level)) previously obtained, or data on the cell state that has been subjected to statistical processing such as averaging.

[0104] In this embodiment, the cultured cells of (1) are preferably obtained by a process of extracting cells from skin containing cells collected from the skin of a target animal, and / or a process of culturing (preferably subculture) the treated cells.

[0105] In the method according to this embodiment (for example, a screening method or an evaluation method), the step of determining or evaluating the state of the cellular senescence chain caused by the test substance may be performed by a computer or an evaluation device.

[0106] The method according to this embodiment can also be realized by a control device or control unit including a CPU or the like in an apparatus or system (for example, a computer, PLC, server, cloud service, etc.) used for screening, evaluation, etc. Furthermore, the method according to this embodiment can also be stored as a program in hardware resources including a recording medium (non-volatile memory (such as a USB memory), an SDD, an HDD, a CD, a DVD, a Blu-ray Disc, etc.) and realized by a control unit. It is also possible to provide a control unit including a system for executing a method such as the screening method, determination or evaluation method of this embodiment, or an apparatus including such a system.

[0107] An apparatus or system for carrying out a method such as the screening method or evaluation method of this embodiment can include an input unit such as a keyboard, a communication unit such as a network, an output unit such as a display, a storage unit such as a HDD, a measurement unit, etc. The apparatus or system preferably includes an input unit, an output unit, and a storage unit, and more preferably includes a communication unit and / or a measurement unit.

[0108] Furthermore, the screening, evaluation, and other related systems according to this embodiment can be implemented by utilizing a program and hardware. One embodiment (not shown) of a computer 1 according to one embodiment of the present invention includes, but is not limited to, at least a CPU as its components, and can further include one or two selected from a RAM, a storage unit, an output unit, an input unit, a communication unit, a ROM, and a measurement unit. Of these, it is preferable for the computer 1 to include a RAM, a storage unit, an output unit, and an input unit, and it is also preferable for the computer 1 to further include at least one of a communication unit, a measurement unit, a ROM, and the like. It is preferable for the respective components to be connected by, for example, a bus as a data transmission path.

[0109] 6. About this technology In addition, the present technology can also adopt the following configurations, but is not limited to the contents described here, and the contents described in "1." above can also be adopted as appropriate. [1] A method for evaluating the senescence-linked state of cells using miR-570-3p as an indicator, or a method for using miR-570-3p as an indicator or miR-570-3p as an indicator, or an indicator reagent containing miR-570-3p or a combination of indicator reagents that use or contain the indicator reagent. [2] A screening method for substances that regulate the cellular aging chain using miR-570-3p as an indicator. [3] The method according to [1] or [2] above, wherein the cells (originating cells or surrounding cells) are fibroblasts and / or epidermal keratinocytes. [4] The method according to any one of [1] to [3] above, which includes or uses the following steps: comparing the amount of miR-570-3p in the target cells with the amount of miR-570-3p in a control; and (a) if the amount is higher, determining that the progression of the cellular senescence chain is promoted or selecting the test substance as a substance that promotes the cellular senescence chain; or (b) if the amount is lower, determining that the progression of the cellular senescence chain is inhibited or selecting the test substance as a substance that inhibits the cellular senescence chain. [5] The method according to [2] or [3], comprising comparing the amount of miR-570-3p after contacting the test substance with the subject cells with the amount of miR-570-3p in a control, and selecting the test substance as a substance that promotes the cellular senescence chain if the amount is higher, or selecting the test substance as a substance that suppresses the cellular senescence chain if the amount is lower.

[0110] [6] A substance capable of regulating miR-570-3p expression, an agent for regulating (inhibiting or promoting) miR-570-3p expression, or a substance used therefor, obtained from a test substance using the method described in any one of [1] to [5] above. The agent may be used for addition or blending, or may be various products or commercial products (e.g., cosmetics, topical skin preparations, pharmaceuticals, and foods) for regulating (inhibiting or promoting) miR-570-3p expression or for inhibiting the cellular aging chain.

[0111] [7] An agent for regulating (inhibiting or promoting) miR-570-3p expression, or a composition for regulating (inhibiting or promoting) the cellular senescence chain, comprising a substance capable of regulating (inhibiting or promoting) miR-570-3p expression. The agent for regulating (inhibiting or promoting) miR-570-3p expression may be an agent used for adding or blending in various products or commercial products (e.g., cosmetics, topical skin preparations, pharmaceuticals, foods, etc.) during production. [8] Use of a substance capable of regulating (inhibiting or promoting) miR-570-3p expression in the manufacture of an agent for regulating (inhibiting or promoting) miR-570-3p expression or a composition for regulating (inhibiting or promoting) the cellular senescence chain. [9] Use of a substance capable of regulating (inhibiting or promoting) miR-570-3p expression for regulating (inhibiting or promoting) miR-570-3p expression or for regulating (inhibiting or promoting) the cellular senescence chain.

[10] A substance capable of regulating (inhibiting or promoting) miR-570-3p expression, for use in regulating (inhibiting or promoting) miR-570-3p expression or regulating (inhibiting or promoting) the cellular senescence chain.

[11] A method for regulating (inhibiting or promoting) miR-570-3p expression, or a method for regulating (inhibiting or promoting) the cellular senescence chain, using a substance capable of regulating (inhibiting or promoting) miR-570-3p expression.

[0112]

[12] The method according to any one of [6] to

[11] above, wherein the substance capable of regulating miR-570-3p expression is a Rhizome extract, and in the case of a Rhizome extract, the regulation of miR-570-3p expression is suppression of miR-570-3p expression, and the regulation of the cellular senescence chain is suppression of the cellular senescence chain.

[13] An inhibitor of miR-570-3p expression containing an extract of A. japonica as an active ingredient.

[14] A composition for inhibiting the cellular aging chain (e.g., cosmetics, topical skin preparations, pharmaceuticals, foods, etc.) comprising the miR-570-3p expression inhibitor according to

[12] above. [Example]

[0113] Hereinafter, the present technology will be described in further detail based on examples, etc. Note that the examples, etc. described below are examples of typical examples, etc. of the present technology, and the scope of the present technology will not be construed as being narrow.

[0114] <Test Example 1: Exosome isolation> <Experimental Method> Using Lipofectamine (Thermo Fisher Scientific) and various siRNAs (siCTR; Thermo Fisher Scientific, siEFEMP2; Bioneer), EFEMP2 (an anti-aging factor) was knocked down in fibroblasts to induce cellular senescence (siCTR was used as a control). Exosomes in the culture medium were analyzed by MagCapture. TM Exosomes were purified using the Exosome Isolation Kit PS Ver.2 (Fujifilm Wako Pure Chemical Industries, Ltd.; exosome isolation / extraction / purification kit), and all microRNAs in the exosomes were analyzed by microarray. The microRNA mi-570-3p (hereinafter referred to as "miR-570-3p") was detected only in EFEMP2 knockdown cells.

[0115] Normal fibroblasts (manufactured by Kurabo Industries, Ltd.) were used as the fibroblasts in Test Examples 1 to 3. Normal epidermal keratinocytes (manufactured by CELLnTEC) were used as the epidermal keratinocytes in Test Examples 1 to 3. 10% FBS-containing DMEM medium was used for the fibroblasts, and serum- and BPE (bovine pituitary extract)-free human epithelial cell medium (CnT-PR medium, CELLnTEC) was used for the epidermal keratinocytes. In addition, in Test Examples 1 to 3, the cells were cultured at 37°C in a 5% CO2 atmosphere.

[0116] It has been confirmed that the EFEMP2 gene is an anti-aging related factor (Patent Document 5; Japanese Patent Application Laid-Open No. 2024-061647, Non-Patent Document 7; Exp Dermatol. 2023 Nov;32(11):1982-1995.), and aging-induced cells that induce cell aging can be obtained by knocking down the expression of the EFEMP2 gene in cells using the siRNA method.

[0117] <Expression suppression by siRNA> Cells were seeded in a 12-well plate (CORNIG), and the following siRNA was introduced by the lipofection method using Lipofectamin reagent (Thermofisher, 13778030) the next day. The medium was changed the next day, and the cell aging index was evaluated as follows at an appropriate timing. <sirna> siEFEMP2 (inhibition of EFEMP2 expression): BIONEER, #30008-1-B siCTR (siRNA control): Ambion, #4390843

[0118] We also confirmed whether exosomes could be isolated from the culture supernatant of the EFEMP2 knockdown cells using the following method. The particle size of the isolated exosomes was confirmed using a nanoparticle analyzer (NanoSight LM10, Malvern Panalytical), and a peak was observed around 150 nm (mean: 141 + / - 3.6 nm, SD: 55 + / - 4.0 nm) (Figure 1). Furthermore, when the isolated exosomes were observed using a transmission electron microscope, membrane vesicles were confirmed (Figure 2). Furthermore, Western blot analysis confirmed the expression of representative exosome marker proteins (Figure 3). These results confirmed that exosomes could be isolated from the culture supernatant.

[0119] <Test Example 2: Functional analysis of miR-570-3p in fibroblasts> <Experimental Method> After introducing the mimic sequence of miR-570-3p (mimic; Thermo Fisher Scientific) (hereinafter also referred to as "miR-570-3p mimic") into fibroblasts and epidermal keratinocytes using Lipofectamine, the cells were cultured for 3 days, and then the cells were collected using trypsin, and the number and particle size of fibroblasts were measured using a Coulter counter (CDA-1000, sysmex). In addition, RNA was extracted from various cells (miRNeasy, QIAGEN), and the expression level was evaluated by performing real-time PCR using SIRT1-specific primers. For SIRT1 expression, it was standardized using GAPDH. For SIRT1 protein, proteins were extracted from the cells (RIPA Lysis and Extraction Buffer, Thermo Scientific), and SIRT1 protein expression was confirmed by performing Western blotting using an SIRT1-specific antibody. For SIRT1 protein expression, it was standardized using β-actin. Furthermore, the aging of cells was evaluated by staining for Senescence-associated beta-galactosidase (SA-β-gal), which is an indicator of senescent cells (Senescent cells IHC kit, cellular β-galactosidase probe, Merck).

[0120] <Test for the increase in the percentage of SA-β-galactosidase positive cells> Three days after siRNA treatment, the cells were re-seeded in another 12-well plate, and on the third day, staining can be performed using the kit (SIGMA, #CS0030-1KT) according to the recommended protocol. Positive cells can be calculated from the cell images randomly taken under a microscope using the following formula. SA-β-galactosidase positive cell ratio (%) = number of SA-β-galactosidase positive cells / total number of cells evaluated x 100

[0121] miRNA mimics are generally chemically modified double-stranded RNAs consisting of a guide strand made of natural RNA and a chemically modified passenger strand. The guide strand exhibits strong RNAi activity, while the passenger strand does not, allowing the activity of the mature miRNA itself to be observed.

[0122] In fibroblasts, addition of miR-570-3p mimic reduced cell number (Figure 4, Table 1) and increased cell size (Figure 5, Table 2). Furthermore, staining for SA-β-gal, an indicator of senescent cells, revealed that addition of miR-570-3p mimic increased the number of SA-β-gal-positive cells (Figure 6). Furthermore, SIRT1 expression, known to decrease with senescence and a known target of miR-570-3p, was confirmed by qPCR and Western blotting (methods described in Experimental Example 2 above). It was revealed that addition of miR-570-3p mimic reduced both gene and protein expression (Figure 7, Table 3).

[0123] These results suggest that miR-570-3p, found in exosomes released by fibroblasts, induces senescence in surrounding fibroblasts and is a factor involved in the senescence chain. Furthermore, a decrease in cell number, an increase in SA-β-gal-positive cells, and a decrease in SIRT1 expression were observed in epidermal keratinocytes (Figures 8-10, Tables 4-5), demonstrating that miR-570-3p induces the senescence chain not only in fibroblasts but also in epidermal keratinocytes.

[0124] [Table 1]

[0125] [Table 2]

[0126] [Table 3]

[0127] [Table 4]

[0128] [Table 5]

[0129] <Test Example 3: Screening of components that regulate miR-570-3p expression> <Experimental Method> 24 hours after seeding the fibroblasts, various test substances (Aster extract, final concentration 0.01%; L-carnosine, final concentration 50 mM; VC-pmg (L-ascorbyl magnesium phosphate), final concentration 1 mg / mL) were added and cultured for 24 hours. After that, miRNA was extracted from the cells (miRNeasy Micro Kit, QIAGEN) and analyzed by using a primer specific to miR-570-3p (TaqMan TM The expression levels of miR-570-3p induced by various test substances were evaluated by real-time PCR (hybridization) using MicroRNA Assay (product number: 4440887, Assay ID: 002347, Thermo Fisher Scientific) (Figure 11).

[0130] <Preparation of Rhizome Extract> Crushed fruit of wild rose (Rosa multiflora Thunberg) was extracted with an aqueous ethanol solution containing 50% ethanol by mass. The extraction was carried out by heating at 80-90°C for 2 hours in a reflux extractor. The extract was filtered to obtain a filtrate, which was then concentrated to dryness in an evaporator. The concentrate was adjusted to a predetermined concentration with water to prepare a rosehip extract.

[0131] The Atractylodes chinensis extract reduced miR-570-3p expression in fibroblasts compared to the control (miR-570-3p expression in fibroblasts without the addition of the test substance), whereas the addition of L-carnosine or VC-pmg did not alter miR-570-3p expression compared to the control (miR-570-3p expression in fibroblasts without the addition of the test substance) (Figure 11, Table 6).

[0132] [Table 6]

[0133] <Test Example 4: Changes in miR-570-3p levels due to suppression of EFEMP2 expression in dermal fibroblasts> EFEMP2 expression was suppressed in dermal fibroblasts, and the amount of miR-570-3p in the cells and in exosomes was analyzed. The results are shown in Figure 12. The experimental method for Test Example 4 was performed in accordance with the experimental method for Test Example 1 described above. The amount of miR-570-3p in the cells was measured using a standard method, and the cells were crushed and miR-570-3p was measured. The results of Test Example 4 showed that suppression of EFEMP2 expression did not change the amount of miR-570-3p in cells, but significantly increased the amount of miR-570-3p encapsulated in exosomes.

[0134] <Test Example 5: Changes in miR-570-3p levels due to replicative senescence in dermal fibroblasts> Cellular senescence was induced in dermal fibroblasts by repeated passage, and the amount of miR-570-3p in cells and exosomes was analyzed. The results are shown in Figure 13. The experimental method for Test Example 5 was the same as that for Test Example 1 described above. Passage was performed using a standard subculture method, and this time, cells from the same cells at P=9 (9th passage) and P=24 (24th passage) were used, with P=24 cells being considered to be cells in advanced senescence. The results of Test Example 5 showed that replicative senescence did not change the amount of intracellular miR-570-3p, but that replicative senescence significantly increased the amount of miR-570-3p in exosomes.

[0135] <Experimental Results of Test Examples 1 to 5> From the results of Test Examples 1 to 5, the present inventors discovered that miR-570-3p, a type of miRNA encapsulated in exosomes, is a factor in senescent cells causing surrounding cells to senesce (senescence chain). The present inventors discovered that miR-570-3p expressed in senescent cells is encapsulated in exosomes and released into the extracellular space; the encapsulated miR-570-3p is transported by these released exosomes into surrounding cells; miR-570-3p transported into other cells causes the senescence chain in surrounding cells; and that miR-570-3p can be used as a novel marker for evaluating the cellular senescence chain. Furthermore, it was found that using the amount of miR-570-3p in exosomes released from a specific cell as an index, rather than using the amount of miR-570-3p in the specific cell, allows for more accurate estimation or evaluation of the degree or progression of aging in the specific cell, or the cells surrounding the specific cell, or the tissue containing the specific cell, based on changes (increases or decreases) in the amount of miR-570-3p; a further outstanding advantage of this invention is that it also allows for more accurate estimation or evaluation of the aging chain state of the cells surrounding the specific cell or the tissue containing the specific cell (cells within the tissue).

[0136] The inventors believed that by evaluating the intracellular expression of this novel marker miR-570-3p by PCR, it was possible to more easily determine the cellular senescence chain potential and the effects of drugs on the cellular senescence chain, and that they had provided a new technology, such as a method for evaluating or screening the state of the cellular senescence chain using the novel marker miR-570-3p for evaluating the cellular senescence chain. Furthermore, using this evaluation system and technology, they were able to identify a drug (Aijiru extract) that can regulate the senescence chain, and it is expected that this technology will provide a technology to stop the senescence chain.

[0137] Furthermore, using a screening method using miR-570-3p as an indicator, we investigated the cellular senescence pathway in various test substances. The inventors showed that the Atractylodes chinensis extract reduced miR-570-3p expression in fibroblasts compared to the control (miR-570-3p expression in fibroblasts without the test substance). On the other hand, the addition of L-carnosine or magnesium ascorbyl phosphate did not change miR-570-3p expression compared to the control (miR-570-3p expression in fibroblasts without the test substance).

[0138] L-carnosine is known to inhibit aging due to its anti-oxidant properties (Non-Patent Document 4: Experimental Cell Research, Volume 212, Issue 2, June 1994, Pages 167-175), and L-ascorbyl magnesium phosphate is known to inhibit the intrinsic aging of fibroblasts (Non-Patent Document 5: Food Sci Biotechnol (2018) 27(2):555-564).

[0139] Even these well-known anti-aging substances failed to inhibit the cellular aging chain when miR-570-3p expression was used as an indicator. Therefore, the inventors believed that providing users hoping to inhibit the cellular aging chain with a product containing an anti-aging substance obtained using a conventional screening method for intracellular aging inhibition would not fully meet their expectations. The inventors therefore believed that adopting a screening method using miR-570-3p as an indicator would fully meet the expectations of users hoping to inhibit the cellular aging chain. The inventors then selected a Rhizome extract using the screening method using miR-570-3p as an indicator, and determined that this Rhizome extract is a substance for regulating miR-570-3p expression and inhibiting the cellular aging chain. They therefore believed that they could provide a new use for the Rhizome extract: inhibiting the aging chain.< / sirna>

Claims

1. A method for evaluating the cellular senescence chain state using microRNA-570-3p as an indicator.

2. The method of claim 1 , wherein the cells are fibroblasts or epidermal keratinocytes.

3. A screening method for substances that regulate the cellular aging chain using microRNA-570-3p as an indicator.

4. The method of claim 3 , wherein the cells are fibroblasts or epidermal keratinocytes.

5. The method according to claim 3 or 4, comprising: determining the amount of microRNA-570-3p after contacting the test substance with the subject cells, and selecting the test substance as a substance that promotes the cellular senescence chain if the amount is higher than the amount of microRNA-570-3p in a control; or selecting the test substance as a substance that inhibits the cellular senescence chain if the amount is lower.

6. Micro RNA-570-3p expression inhibitor containing rhododendron extract as the active ingredient.

7. A composition for inhibiting cellular senescence, comprising the microRNA-570-3p expression inhibitor according to claim 6.

8. The composition according to claim 7, wherein the composition is a cosmetic, a topical skin preparation, a pharmaceutical, or a food product. thing.

Citation Information

Patent Citations

  • MicroRNA inhibitors for use in preventing and / or reducing skin aging and / or moisturizing the skin.

    JP2013529091A

  • Method for evaluating quality of cell, and quality determination kit of cell

    JP2019154320A

  • Transglutaminase production promoter

    JP2021169532A

  • Beauty method for strengthening defense function of skin, method for promoting expression of antibacterial peptide, method for promoting expression of sirtuin 1, apparatus for promoting expression of antibacterial peptides, and apparatus for promoting expression of sirtuin 1

    JP2022100202A

  • Corneum protein carbonylation inhibitor and external skin preparation for inhibiting carbonylation of corneum protein

    JP2022102858A