RNAi AGENTS FOR INHIBITING EXPRESSION OF ALPHA-ENaC AND METHODS OF USE
Patent Information
- Application Number
- JP2025166543
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-06-01
- Filing Date
- 2025-10-02
- Publication Date
- 2026-01-30
AI Technical Summary
There is a need for novel RNA interference (RNAi) agents that can selectively and efficiently inhibit the expression of the alpha-ENaC gene, particularly for the treatment of diseases associated with enhanced ENaC activity, such as cystic fibrosis and other respiratory and ocular disorders, as existing small molecule inhibitors have limitations in duration of action and toxicity.
Development of alpha-ENaC-specific RNAi agents comprising a sense and antisense strand, optionally conjugated with integrin targeting ligands, for targeted delivery to epithelial cells, administered via inhalation or other methods, to reduce ENaC expression and activity.
The alpha-ENaC RNAi agents effectively inhibit ENaC expression, providing therapeutic benefits for respiratory and ocular disorders by reducing ENaC activity, with potential for prophylactic treatment and improved safety profile compared to small molecule inhibitors.
Smart Images

Figure 00000103_0000 
Figure 00000103_0001 
Figure 00000103_0002
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 679,549, filed June 1, 2018, U.S. Provisional Patent Application No. 62 / 631,683, filed February 17, 2018, and U.S. Provisional Patent Application No. 62 / 529,132, filed July 6, 2017, the entire contents of each of which are incorporated herein by reference.
[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy is entitled 30656_SequenceListing and is 74kb in size.
[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference (RNAi) agents, eg, double-stranded RNAi agents, compositions comprising alpha-ENaC RNAi agents, and methods of use thereof, for the inhibition of alpha-ENaC gene expression. [Background technology]
[0004] The vertebrate amiloride-sensitive epithelial sodium channel ("ENaC" or "amiloride-sensitive sodium channel") is a member of the degenerin / ENaC channel superfamily, characterized by two transmembrane domains, intracellular N- and C-termini, and a large extracellular loop that is a substrate for furin proteases. The channel is a heterotrimeric complex composed of three homologous subunits (alpha (α), beta (β), and gamma (γ)) encoded by three separate genes: SCNN1A (alpha), SCNN1B (beta), and SCNN1G (gamma). All three subunits are required for full channel activity. The fourth subunit (delta (δ)), encoded by SCNN1D, is expressed in the testis and ovary and may be able to functionally substitute for the alpha (α) subunit in these tissues.
[0005] ENaC is expressed on the apical membrane of epithelial cells, particularly in the lung, distal convoluted tubule, gastrointestinal (GI) tract, reproductive tract, and ocular surface epithelium of the eye. In these epithelia, ENaC channels mediate the influx of extracellular sodium ions, which are subsequently actively transported out of the cell by the basolateral sodium / potassium ATPase, establishing an osmotic gradient and allowing water in the epithelial lumen to be absorbed into the interstitium. In the kidney, ENaC mediates electrolyte balance and blood pressure and is the target of systemic small-molecule diuretics such as amiloride. In the lung, airway epithelial ENaC plays an important role in regulating lung hydration and mucociliary clearance.
[0006] Patients with type 1 pseudohypoaldosteronism (PHA) who harbor loss-of-function mutations in SCNN1A, SCNN1B, or SCNN1G produce excess airway surface liquid and have significantly higher mucociliary clearance rates. Conversely, airway epithelial ENaC activity is significantly elevated in patients with cystic fibrosis (CF) of all genotypes. Enhanced ENaC activity, along with reduced cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel activity, is a major pathogenic mechanism underlying airway dehydration and mucociliary stasis in patients with CF lung disease.
[0007] Inhaled small molecule ENaC inhibitors initially showed promise in the treatment of CF, but their clinical development has been limited by their short duration of action in the lung and on-target toxicity (hyperkalemia) associated with inhibition of renal ENaC (see, e.g., O'Riordan et al., Vol. 27 J. Aerosol Med. & Pulmonary Drug Dev., pp. 200-208 (2014)).
[0008] For example, certain RNAi agents have been previously identified that can inhibit the expression of alpha-ENaC gene (that is, SCNN1A), such as those disclosed in United States Patent No. 7,718,632.However, the sequence and modification of the alpha-ENaC RNAi agent disclosed herein are different from those previously disclosed or known in the art.The alpha-ENaC RNAi agent disclosed herein provides highly potent and effective inhibition of the expression of alpha-ENaC gene. [Prior art documents] [Patent documents]
[0009] [Patent Document 1] U.S. Patent No. 7,718,632 [Non-patent literature]
[0010] [Non-Patent Document 1] O'Riordan et al., J. Aerosol Med. & Pulmonary Drug Dev. (2014) 27, 200-208 Summary of the Invention [Means for solving the problem]
[0011] There is a need for novel RNA interference (RNAi) agents (also called RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, that can selectively and efficiently inhibit the expression of the alpha-ENaC gene (i.e., SCNN1A). Furthermore, there is a need for novel alpha-ENaC-specific RNAi agent compositions for the treatment of diseases associated with enhanced ENaC activity.
[0012] Generally, the present disclosure provides an alpha-ENaC gene-specific RNAi agent, alpha-ENaC The present invention features compositions comprising RNAi agents, and methods for inhibiting the expression of the alpha-ENaC gene in vitro and / or in vivo using alpha-ENaC RNAi agents and compositions comprising the alpha-ENaC RNAi agents described herein. The alpha-ENaC RNAi agents described herein can selectively and efficiently reduce the expression of the alpha-ENaC gene, thereby reducing ENaC levels in a subject, reducing ENaC activity in a subject, or reducing both ENaC levels and ENaC activity in a subject, for example, a human or animal subject.
[0013] The described alpha-ENaC RNAi agent can be used in the method for therapeutic treatment (including preventive or prophylactic treatment) of the symptoms and diseases associated with the enhancement or elevation of ENaC activity level, including but not limited to various respiratory diseases such as cystic fibrosis, chronic bronchitis, chronic obstructive pulmonary disease (COPD), asthma, airway infection, primary ciliary dyskinesia and lung cancer.For example, it is known that in subjects suffering from cystic fibrosis (CF), the increase in ENaC activity contributes to the drying of mucus in the airway and the reduced ability of the lungs to eliminate toxins and infectious agents.In addition, it is also known that CF subjects who inherit a poorly functioning ENaC gene show milder lung disease, which provides further evidence that inhibiting ENaC level can be beneficial for certain patient populations. The alpha-ENaC RNAi agent described can also be used for the therapeutic treatment (including preventive or preventive treatment) of the symptoms and diseases associated with the enhancement or elevation of ENaC activity level in ocular surface epithelium (for example, conjunctival epithelium), including for example, for the treatment of eye diseases and disorders such as dry eye syndrome.The alpha-ENaC RNAi agent disclosed herein can selectively reduce alpha-ENaC expression, resulting in the reduction of ENaC activity.The method disclosed herein includes administering one or more alpha-ENaC RNAi agents to subjects, for example, human or animal subjects, by any suitable means known in the art, such as aerosol inhalation or dry powder inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
[0014] In one aspect, the present disclosure features an RNAi agent for inhibiting the expression of alpha-ENaC gene, the RNAi agent comprising a sense strand and an antisense strand.Also described herein is a composition comprising or consisting of an RNAi agent that can inhibit the expression of alpha-ENaC gene, wherein the RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.
[0015] In another aspect, the present disclosure features compositions comprising one or more of the disclosed alpha-ENaC RNAi agents that can selectively and efficiently reduce the expression of the alpha-ENaC gene. Compositions comprising one or more of the alpha-ENaC RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with enhanced or elevated ENaC activity (also referred to herein as enhanced ENaC channel activity levels or elevated ENaC channel activity levels).
[0016] Each alpha-ENaC RNAi agent disclosed herein comprises a sense strand and an antisense strand. The sense strand and antisense strand may be partially, substantially, or fully complementary to one another. The sense and antisense strands of the RNAi agents described herein may each be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, both the sense and antisense strands are 21 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein inhibit the expression of one or more alpha-ENaC genes in vivo or in vitro upon delivery to cells expressing alpha-ENaC.
[0017] The alpha-ENaC RNAi agent described herein comprises at least 16 consecutive nucleotides with at least 85% identity to the core stretch sequence (also referred to herein as "core stretch" or "core sequence") of the same number of nucleotides in alpha-ENaC mRNA. In some embodiments, this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length.
[0018] The antisense strand of the alpha-ENaC RNAi agent described herein comprises at least 16 consecutive nucleotides with the core stretch of the same number of nucleotides in alpha-ENaC mRNA and the corresponding sense strand, and has at least 85% complementarity.In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides in length.
[0019] In some embodiments, an alpha-ENaC RNAi agent disclosed herein targets a portion of the alpha-ENaC gene having the sequence of any of the sequences disclosed in Table 1.
[0020] Examples of alpha-ENaC RNAi agent sense and antisense strands that can be used in alpha-ENaC RNAi agents are provided in Tables 3 and 4. Examples of alpha-ENaC RNAi agent duplexes are provided in Table 5. Examples of 19-nucleotide core stretch sequences that may consist of or be included within the sense and antisense strands of certain alpha-ENaC RNAi agents disclosed herein are provided in Table 2.
[0021] In another aspect, the present disclosure features a method for delivering an alpha-ENaC RNAi agent to epithelial cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods. In some embodiments, disclosed herein is a method for delivering an alpha-ENaC RNAi agent to lung epithelial cells of a subject in vivo. In some embodiments, disclosed herein is a method for delivering an alpha-ENaC RNAi agent to lung epithelial cells of a human subject in vivo. One or more alpha-ENaC RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, liposomal encapsulation, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugate™ (DPC) (see, e.g., WO2000 / 053722, WO2008 / 022309, WO2011 / 104169, and WO2012 / 083185, each of which is incorporated herein by reference).
[0022] In some embodiments, the alpha-ENaC RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that facilitate adhesion of extracellular matrix (ECM). In particular, integrin alpha-v-beta-6 (αvβ6) is an epithelial-specific integrin known to be a receptor for ECM proteins and TGF-beta latency-associated peptide (LAP), and is expressed in various cells and tissues. Integrin αvβ6 is known to be highly upregulated in injured lung epithelium. In some embodiments, the alpha-ENaC RNAi agent described herein is linked to an integrin targeting ligand that has affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound that has affinity for integrin αvβ6 and can be used as a ligand to facilitate targeting and delivery of an RNAi agent that binds to a desired cell and / or tissue (i.e., a cell that expresses integrin αvβ6). In some embodiments, multiple αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are linked to an alpha-ENaC RNAi agent. In some embodiments, the alpha-ENaC RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells by receptor-mediated endocytosis or other means.
[0023] Examples of targeting groups useful for delivering alpha-ENaC RNAi agents, including αβ integrin targeting ligands, are disclosed, for example, in International Patent Application Publication No. WO2018 / 085415 and U.S. Provisional Patent Applications Nos. 62 / 580,398 and 62 / 646,739, the contents of each of which are incorporated herein by reference in their entirety.
[0024] The targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of the alpha-ENaC RNAi agent.In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand.In some embodiments, the targeting group is linked to the 5' end of the sense strand.In some embodiments, the targeting group is linked internally to the nucleotide on the sense strand and / or antisense strand of the RNAi agent.In some embodiments, the targeting group is linked to the RNAi agent via a linker.
[0025] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4.
[0026] In another aspect, the disclosure features a composition that includes one or more alpha-ENaC RNAi agents having a double-stranded structure disclosed in Table 5.
[0027] In some embodiments, the present invention provides a composition comprising at least two alpha-ENaC RNAi agent combinations or cocktails with different sequences.In some embodiments, two or more alpha-ENaC RNAi agents are each separately and independently linked to targeting group.In some embodiments, two or more alpha-ENaC RNAi agents are each linked to targeting group that comprises or consists of integrin targeting ligand.In some embodiments, two or more alpha-ENaC RNAi agents are each linked to targeting group that comprises or consists of αββ integrin targeting ligand.
[0028] In another aspect, the present disclosure features a method for inhibiting alpha-ENaC gene expression in a subject, the method comprising administering to the subject an amount of an alpha-ENaC RNAi agent capable of inhibiting alpha-ENaC gene expression, wherein the alpha-ENaC RNAi agent comprises a sense strand and an antisense strand. Also described herein are compositions for use in such methods.
[0029] In a further aspect, the disclosure features a method of treating (including prophylactic or preventative treatment) a disease or condition caused by enhanced or elevated ENaC activity, the method comprising administering to a subject in need thereof an alpha-ENaC RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3. Also described herein are compositions for use in such methods.
[0030] In some embodiments, the described alpha-ENaC RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another alpha-ENaC RNAi agent (e.g., an alpha-ENaC RNAi agent that targets a different sequence within the alpha-ENaC gene). The additional therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The alpha-ENaC RNAi agent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.
[0031] In some embodiments, a composition for delivering an alpha-ENaC RNAi agent to epithelial cells in vivo is described. In some embodiments, the alpha-ENaC RNAi agent is delivered without being conjugated to a targeting ligand or a pharmacokinetic (PK) modulator (referred to as "naked" or "naked RNAi agent"). In some embodiments, the alpha-ENaC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group. In some embodiments, the alpha-ENaC RNAi agent is conjugated to a targeting group comprising an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αββ integrin targeting ligand. In some embodiments, the targeting group comprises one or more αββ integrin targeting ligands.
[0032] In some embodiments, the alpha-ENaC RNAi agent is linked to one or more linking groups or other non-nucleotide groups or compounds such as pharmacokinetic modulators. In some embodiments, the alpha-ENaC RNAi agent is conjugated to a hydrophobic group having 12 or more carbon atoms, such as a polyethylene glycol (PEG) moiety, or a cholesterol or palmitoyl group. In some embodiments, the alpha-ENaC RNAi agent is linked to one or more pharmacokinetic modulators selected from cholesterol or cholesteryl derivatives, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, or aralkynyl groups, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the binding position for these moieties is at the 5' or 3' end of the sense strand, the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or is linked to the phosphate or phosphorothioate backbone at any position of the sense strand.
[0033] In some embodiments, one or more of the described alpha-ENaC RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
[0034] The use of alpha-ENaC RNAi agents provides a method for therapeutic (including preventive) treatment of diseases or disorders associated with enhanced or elevated ENaC activity. The described alpha-ENaC RNAi agents can inhibit (e.g., inhibit) the expression of alpha-ENaC. The alpha-ENaC RNAi agents can also be used to treat various respiratory diseases, such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, airway infections, primary ciliary dyskinesia, and lung cancer cystic fibrosis. The alpha-ENaC RNAi agents can also be used to treat various eye diseases and disorders, such as dry eye. Such treatment methods include administering the alpha-ENaC RNAi agent to humans or animals with elevated or enhanced ENaC activity levels. Described herein is a composition for delivering the alpha-ENaC RNAi agent to lung epithelial cells. Additionally, compositions for in vivo delivery of alpha-ENaC RNAi agents to cells such as renal epithelial cells and / or epithelial cells in the GI or reproductive tract and / or ocular surface epithelial cells of the eye are generally described herein.
[0035] The pharmaceutical composition comprising one or more alpha-ENaC RNAi agents can be administered in several ways, depending on whether local or systemic treatment is desired.Administration can be, but is not limited to, for example, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (for example, by implanted device), and intraparenchymal administration.In some embodiments, the pharmaceutical composition described herein is administered by inhalation (such as dry powder or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
[0036] The described alpha-ENaC RNAi agents and / or compositions comprising the alpha-ENaC RNAi agents can be used in methods for therapeutic treatment of diseases or conditions caused by enhanced or elevated ENaC activity levels. Such methods include administering the alpha-ENaC RNAi agents described herein to a subject, for example, a human or animal subject. This involves administering an RNAi agent.
[0037] In another aspect, the present disclosure provides a method for the treatment (including prophylactic treatment) of a pathological condition (such as a condition or disease) mediated at least in part by alpha-ENaC expression, comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3.
[0038] Disclosed herein, in some embodiments, is a method for inhibiting expression of the alpha-ENaC gene, the method comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or Table 3.
[0039] Disclosed herein, in some embodiments, is a method for the treatment (including prophylactic treatment) of a pathological condition mediated at least in part by alpha-ENaC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or Table 4.
[0040] In some embodiments, disclosed herein is a method for inhibiting expression of the alpha-ENaC gene, the method comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or Table 4.
[0041] Disclosed herein in some embodiments is a method for the treatment (including prophylactic treatment) of a pathological condition mediated at least in part by alpha-ENaC expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.
[0042] In some embodiments, disclosed herein is a method for inhibiting expression of the alpha-ENaC gene, the method comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.
[0043] Disclosed herein in some embodiments are methods for inhibiting expression of the alpha-ENaC gene, comprising administering to a subject an alpha-ENaC RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4 and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3. Disclosed herein in other embodiments are methods for inhibiting expression of the alpha-ENaC gene, comprising administering to a subject an alpha-ENaC RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4 and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3.
[0044] In some embodiments, disclosed herein are methods for inhibiting expression of the alpha-ENaC gene in a cell, the method comprising administering one or more alpha-ENaC RNAi agents having a duplex structure of one of the duplexes described in Table 5.
[0045] The alpha-ENaC RNAi agent disclosed herein is designed to target specific position on the alpha-ENaC gene (SEQ ID NO: 1).As defined herein, the antisense strand sequence is designed to target the alpha-ENaC gene at a given position on the gene when the 5'-end nucleobase of antisense strand is aligned with the position that is 19 nucleotides downstream (towards the 3' end) from the position on the gene when base-pairing with the gene.For example, as illustrated in Tables 1 and 2 herein, the antisense strand sequence that is designed to target the alpha-ENaC gene at position 972 needs to be aligned with the 990th position of the alpha-ENaC gene when base-pairing with the gene when the 5'-end nucleobase of antisense strand is aligned with the position on the gene.
[0046] As provided herein, alpha-ENaC RNAi agents do not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for an alpha-ENaC RNAi agent disclosed herein that is designed to target position 972 of the alpha-ENaC gene, the 5'-terminal nucleobase of the antisense strand of the alpha-ENaC RNAi agent must align with position 990 of the gene; however, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 990 of the alpha-ENaC gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as demonstrated by the various examples disclosed herein, the specific binding site of the gene by the antisense strand of the alpha-ENaC RNAi agent (e.g., whether the alpha-ENaC RNAi agent is designed to target the alpha-ENaC gene at position 972, 1291, 1000, or elsewhere) is an important factor in the level of inhibition achieved by the alpha-ENaC RNAi agent.
[0047] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3), wherein SEQ ID NO: 3 is located at positions 1-21 (5'→3') of the antisense strand.
[0048] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) (where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand. As one of ordinary skill in the art will clearly understand, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 12A-12G, which show all internucleoside linkages).
[0049] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.
[0050] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5), wherein SEQ ID NO: 5 is located at positions 1-21 (5'→3') of the antisense strand.
[0051] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, the alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and the antisense strand is at least substantially complementary to the sense strand. In some embodiments, one or more inverted abasic residues are added to the 5' end of the sense strand, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 4. In some embodiments, a targeting ligand, such as an αvβ6 integrin targeting ligand, can be covalently linked to the 5' end of the sense strand, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand of SEQ ID NO:4.
[0052] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5), where all or substantially all of the nucleotides are modified nucleotides.
[0053] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), wherein the sense strand further comprises an inverted abasic residue at the 3' end and an αvβ6 integrin-targeting ligand covalently linked to the 5' end.
[0054] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7), wherein SEQ ID NO:7 is located at positions 1-21 (5'→3') of the antisense strand.
[0055] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and wherein the sense strand is at least substantially complementary to the antisense strand.
[0056] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9), wherein SEQ ID NO:9 is located at positions 1-21 (5'→3') of the antisense strand.
[0057] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage), and the antisense strand is at least substantially complementary to the sense strand. In some embodiments, one or more inverted abasic residues can be added to the 5' end of the sense strand, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand of SEQ ID NO: 8. In some embodiments, a targeting ligand, such as an αvβ6 integrin targeting ligand, can be covalently linked to the 5' end of the sense strand of SEQ ID NO:8, the 3' end of the sense strand, or both the 5' and 3' ends of the sense strand.
[0058] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by 0 or 1 nucleobase from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7), where all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9), where all or substantially all of the nucleotides are modified nucleotides.
[0059] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8), wherein the sense strand further comprises an inverted abasic residue at the 3' end and an αvβ6 integrin targeting ligand covalently linked to the 5' end.
[0060] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine) (see Table 6), and wherein the sense strand is at least substantially complementary to the antisense strand.
[0061] In some embodiments, the alpha-ENaC RNAi agents disclosed herein comprise an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), and an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4). In some embodiments, the alpha-ENaC disclosed herein comprises a sense strand consisting essentially of or comprising: a, c, g, and u, respectively, represent 2'-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf, respectively, represent 2'-fluoroadenosine, cytidine, guanosine, or uridine; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine (see Table 6). The RNAi agent comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4), wherein the sense strand further comprises an inverted abasic residue at the 3' end and an αvβ6 integrin targeting ligand covalently linked to the 5' end.
[0062] In some embodiments, the alpha-ENaC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254); and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of:
[0063] In some embodiments, the alpha-ENaC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254); wherein the alpha-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; the sense strand comprises an inverted abasic residue at its 3' end; and an αvβ6 integrin targeting ligand is linked to the 5' end of the sense strand.
[0064] In some embodiments, the alpha-ENaC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254); wherein the alpha-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; the sense strand comprises an inverted abasic residue at the 3' end; an αvβ6 integrin targeting ligand is linked to the 5' end of the sense strand; and each antisense strand sequence is located at positions 1-21 of the antisense strand.
[0065] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO: 259); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO: 289); wherein all or substantially all of the nucleotides on both the antisense and sense strands are modified nucleotides.
[0066] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO: 259); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO: 289); wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides; the sense strand comprises an inverted abasic residue at its 3'-end; and an αvβ6 integrin targeting ligand is linked to the 5'-end of the sense strand.
[0067] In some embodiments, the alpha-ENaC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152); (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine) (see Table 6), wherein the alpha-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
[0068] In some embodiments, the alpha-ENaC RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152); wherein the alpha-ENaC RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides on the sense strand are modified nucleotides; the sense strand comprises an inverted abasic residue at its 3' end; and an αvβ6 integrin targeting ligand is linked to the 5' end of the sense strand.
[0069] In some embodiments, the alpha-ENaC RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO: 293); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO: 294); (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine) (see Table 6), comprising an antisense strand and a sense strand that consist of, consist essentially of, or comprise modified nucleotide sequences that differ by zero or one nucleotide from one of the following:
[0070] In some embodiments, the alpha-ENaC RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO: 293); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO: 294); (wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine) (see Table 6), wherein the sense strand comprises an inverted abasic residue at the 3' end; and an αβ integrin targeting ligand is linked to the 5' end of the sense strand.
[0071] In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21). In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein comprises an antisense strand comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UAUUUGUUCUGGUUGCACA (SEQ ID NO: 21), wherein SEQ ID NO: 21 is located at positions 1-19 (5'→3') of the antisense strand.
[0072] As used herein, the terms "oligonucleotide" and "polynucleotide" each refer to a polymer of linked nucleosides, which may or may not be independently modified.
[0073] As used herein, "RNAi agent" (also referred to as "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can operate by the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) or by any alternative mechanism or pathway. Although RNAi agents, as that term is used herein, are considered to operate primarily by the RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to any particular pathway or mechanism of action. The RNAi agent disclosed herein comprises a sense strand and an antisense strand, including but not limited to short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrate.The antisense strand of the RNAi agent described herein is at least partially complementary to the mRNA to be targeted (i.e., alpha-ENaC mRNA).The RNAi agent may comprise one or more modified nucleotides and / or one or more non-phosphodiester linkages.
[0074] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA, in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is decreased when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that is not so treated.
[0075] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides written with a sequence of letters using standard nomenclature.
[0076] As used herein, "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. (ed.), Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.
[0077] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence to form a double-stranded or double-helical structure under certain standard conditions. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, as defined herein, a and Af are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.
[0078] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.
[0079] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.
[0080] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.
[0081] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of alpha-ENaC mRNA.
[0082] As used herein, the term "substantially identical" or "substantial identity" applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher, for example, at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase is present in both sequences, obtaining the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.
[0083] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief from or a reduction in the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include preventative treatment, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0084] As used herein, the phrase "introducing into a cell" when referring to an RNAi agent means functionally delivering the RNAi agent into a cell.The phrase "functionally delivering" means delivering the RNAi agent into a cell in a manner that allows the RNAi agent to have the expected biological activity, for example, sequence-specific inhibition of gene expression.
[0085] Unless otherwise stated, symbols used herein [ka] The use of means that any group or groups can be attached thereto in accordance with the scope of the invention described herein.
[0086] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."
[0087] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including its optically pure and racemic forms. For example, a structure disclosed herein is intended to encompass mixtures of diastereomers as well as single stereoisomers.
[0088] As used in the claims of this specification, the phrase "consisting of The phrase "consisting essentially of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.
[0089] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art.
[0090] As used herein, the term "linked" or "conjugated," when referring to a connection between two compounds or molecules, means that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated," as used herein, may refer to a connection between a first compound and a second compound with or without any intervening atom or group of atoms.
[0091] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly dictates otherwise.
[0092] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art.Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and suitable methods and materials are described below.All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.In addition, materials, methods, and examples are merely illustrative and are not intended to be limiting.
[0093] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]
[0094] [Figure 1] FIG. 1 is a histogram showing the relative expression of mouse whole lung alpha-ENaC expression following administration of various alpha-ENaC RNAi agents compared to vehicle control. [Figure 2]FIG. 2 is a histogram showing the relative expression of mouse whole lung alpha-ENaC expression following administration of alpha-ENaC RNAi agents AD04025 and AD04858 compared to vehicle control. [Figure 3] FIG. 3 is a graph showing the relative expression of rat whole lung alpha-ENaC expression for the alpha-ENaC RNAi agent AD04025 and an AD04025 conjugate (i.e., AD04025 conjugated to a peptide-based αvβ6 epithelial cell targeting ligand). [Figure 4] FIG. 4 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM2. [Figure 5] FIG. 5 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM1. [Figure 6] FIG. 6 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM6.1. [Figure 7] FIG. 7 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM9. [Figure 8] FIG. 8 is a chemical structural representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM6. [Figure 9] FIG. 9 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM8. [Figure 10] FIG. 10 is a chemical structural representation of the tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM10. [Figure 11] FIG. 11 is a chemical structural representation of a tridentate αvβ6 epithelial cell targeting ligand, referred to herein as Tri-SM11. [Figure 12-1]Figure 12A is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05453 (see Tables 3-5), shown with an amino group on the 5'-end of the sense strand to facilitate linkage to a targeting ligand. In Figures 12A-12G, the following abbreviations are used: a, c, g, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue; cPrp is a 5'-terminal cyclopropylphosphonate group (see Table 6); NH2-C6 is a C6 amino group (see Table 6); and TriAlk14 is a tri-alkyne linker (see Table 6) having the structure shown herein. Figure 12B is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05924 (see Tables 3-5), shown functionalized with a tri-alkyne group on the 5' end of the sense strand to facilitate linkage to a targeting ligand. As described herein, AD05453 and AD05924 have the same modified nucleotide sequence and represent alternative approaches for synthesizing the alpha ENaC-RNAi agent conjugates disclosed herein. Figure 12C is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05625 (see Tables 3-5), shown functionalized with an amino group on the 5' end of the sense strand to facilitate linkage to a targeting ligand. [Figure 12-2]Figure 12D is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05347 (see Tables 3-5), shown functionalized with an amino group on the 5' end of the sense strand to facilitate linkage to a targeting ligand. Figure 12E is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05831 (see Tables 3-5), shown functionalized with an amino group on the 5' end of the sense strand to facilitate linkage to a targeting ligand. Figure 12F is a schematic diagram of modified sense and antisense strands of alpha-ENaC RNAi agent AD05833 (see Tables 3-5), shown functionalized with an amino group on the 5' end of the sense strand to facilitate linkage to a targeting ligand. [Figure 12-3] Figure 12G is a schematic diagram of modified sense and antisense strands of both alpha-ENaC RNAi agent AD05453 and alpha-ENaC RNAi agent AD05924 (see Tables 3-5), where X represents a tridentate αvβ6 integrin-targeting ligand (including any linker). Figure 12H is a schematic diagram of an example of a tridentate αvβ6 integrin-targeting ligand-RNAi agent conjugate described herein, in which the tridentate αvβ6 integrin-targeting ligand is conjugated to the 5' end of the sense strand. As shown therein, each αvβ6 represents an αvβ6 integrin-targeting compound. [Figure 13A] 13A-13D are chemical structural representations of alpha-ENaC RNAi agent AD05453, which contains an NH2-C6 terminal amino group, shown as the sodium salt. [Figure 13B] 13A-13D are chemical structural representations of alpha-ENaC RNAi agent AD05453, which contains an NH2-C6 terminal amino group, shown as the sodium salt. [Figure 13C] 13A-13D are chemical structural representations of alpha-ENaC RNAi agent AD05453, which contains an NH2-C6 terminal amino group, shown as the sodium salt. [Figure 13D]13A-13D are chemical structural representations of alpha-ENaC RNAi agent AD05453, which contains an NH2-C6 terminal amino group, shown as the sodium salt. [Figure 14A] 14A-14D are chemical structural representations of the alpha-ENaC RNAi agent AD05924, which contains a tri-alkyne functionalized linker group (TriAlk14), shown as the sodium salt. [Figure 14B] 14A-14D are chemical structural representations of the alpha-ENaC RNAi agent AD05924, which contains a tri-alkyne functionalized linker group (TriAlk14), shown as the sodium salt. [Figure 14C] 14A-14D are chemical structural representations of the alpha-ENaC RNAi agent AD05924, which contains a tri-alkyne functionalized linker group (TriAlk14), shown as the sodium salt. [Figure 14D] 14A-14D are chemical structural representations of the alpha-ENaC RNAi agent AD05924, which contains a tri-alkyne functionalized linker group (TriAlk14), shown as the sodium salt. [Figure 15A] 15A-15E are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the sodium salt and conjugated to Tri-SM6.1. As discussed herein, the same chemical structure can be synthesized using a tri-alkyne-functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described in the modified sense strand nucleotide sequence of alpha-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4). [Figure 15B]15A-15E are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the sodium salt and conjugated to Tri-SM6.1. As discussed herein, the same chemical structure can be synthesized using a tri-alkyne-functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described in the modified sense strand nucleotide sequence of alpha-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4). [Figure 15C] 15A-15E are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the sodium salt and conjugated to Tri-SM6.1. As discussed herein, the same chemical structure can be synthesized using a tri-alkyne-functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described in the modified sense strand nucleotide sequence of alpha-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4). [Figure 15D] 15A-15E are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the sodium salt and conjugated to Tri-SM6.1. As discussed herein, the same chemical structure can be synthesized using a tri-alkyne-functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described in the modified sense strand nucleotide sequence of alpha-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4). [Figure 15E]15A-15E are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the sodium salt and conjugated to Tri-SM6.1. As discussed herein, the same chemical structure can be synthesized using a tri-alkyne-functionalized linker group (TriAlk14), which can be added by phosphoramidite synthesis, as described in the modified sense strand nucleotide sequence of alpha-ENaC RNAi agent AD05924 (i.e., AM07807-SS in Table 4). [Figure 16A] 16A-16D are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the free acid, containing an NH2-C6 terminal functionalized amino group. [Figure 16B] 16A-16D are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the free acid, containing an NH2-C6 terminal functionalized amino group. [Figure 16C] 16A-16D are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the free acid, containing an NH2-C6 terminal functionalized amino group. [Figure 16D] 16A-16D are chemical structural representations of alpha-ENaC RNAi agent AD05453, shown as the free acid, containing an NH2-C6 terminal functionalized amino group. DETAILED DESCRIPTION OF THE INVENTION
[0095] RNAi agents Described herein are RNAi agents (herein referred to as alpha-ENaC RNAi agents or alpha-ENaC RNAi triggers) for inhibiting expression of the alpha-ENaC (i.e., SCNN1A) gene. Each alpha-ENaC RNAi agent includes a sense strand and an antisense strand. The sense strand and antisense strand may each be 16-30 nucleotides in length. In some embodiments, the sense and antisense strands are each 17-26 nucleotides in length. The sense and antisense strands may be the same length or different lengths. In some embodiments, the sense and antisense strands are each independently 17-26 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, while the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides long, while the antisense strand is about 23 nucleotides long.In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides long.In some embodiments, the sense strand and the antisense strand of the RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long.In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0096] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense and antisense strands is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfect, substantial, or partial complementarity).
[0097] The sense strand and antisense strand each contain a core stretch (also referred to herein as a "core sequence" or "core stretch sequence") that is 16 to 23 nucleotides in length. The antisense strand core stretch is 100% (perfectly) complementary or at least 85% (substantially) complementary to a nucleotide sequence present in the alpha-ENaC target (e.g., sometimes referred to as a target sequence). The sense strand core stretch is 100% (perfectly) complementary or at least 85% (substantially) complementary to a core stretch in the antisense strand. Thus, the sense strand core stretch is typically perfectly identical or at least 85% identical to a nucleotide sequence (target sequence) present in the alpha-ENaC mRNA target. The sense strand core stretch may be the same length as the corresponding antisense core stretch, or may be a different length. In some embodiments, the antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0098] Examples of nucleotide sequences used in forming alpha-ENaC RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes comprising the sense and antisense strand nucleotide sequences in Tables 2, 3, and 4 are shown in Table 5.
[0099] The sense and antisense strands of alpha-ENaC RNAi agent are annealed to form a double strand.The sense and antisense strands of alpha-ENaC RNAi agent can be partially, substantially, or completely complementary to each other.In the complementary double-stranded region, the core stretch sequence of the sense strand is at least 85% complementary, or 100% complementary to the core stretch sequence of the antisense strand. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an alpha-ENaC RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).
[0100] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. The sense strand of the RNAi agent differs from any of the sense strand sequences in Table 2 or Table 4 by 0, 1, 2, or 3 nucleotides.
[0101] The sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the core stretch sequence. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding sequence in alpha-ENaC mRNA. If present, the additional nucleotides of the sense strand may or may not be identical to the corresponding sequence in alpha-ENaC mRNA. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding additional nucleotides of the sense strand.
[0102] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to any of the nucleotides in the core stretch sequence or the extended nucleotides in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may or may not be complementary to any of the nucleotides in the core stretch sequence or the extended nucleotides in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more of the 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, alpha-ENaC RNAi agent has antisense strand with 3' extension and sense strand with 5' extension.In some embodiments, the extended nucleotide is not paired and forms overhang.As used herein, " overhang " refers to the stretch of one or more unpaired nucleotides located at the end of sense strand or antisense strand, which do not form part of hybridized or double-stranded part of the RNAi agent disclosed herein.
[0103] In some embodiments, the alpha-ENaC RNAi agent comprises an antisense strand with a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length.In other embodiments, the alpha-ENaC RNAi agent comprises an antisense strand with a 3' extension of 1, 2, or 3 nucleotides in length.In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to corresponding alpha-ENaC mRNA sequence.
[0104] In some embodiments, the 3'-end of the antisense strand may contain an additional abasic residue (Ab). An "abasic residue" or "abasic site" is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety (see, e.g., U.S. Pat. No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3'-end of the antisense strand. In some embodiments, the abasic residue can be added as an inverted abasic residue (invAb) (see Table 6) (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16).
[0105] In some embodiments, a sense strand or an antisense strand, as used herein, may include an "end cap," which is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of the strand of an RNAi agent disclosed herein, and in some instances can provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. End caps are generally known in the art and include an inverted abasic residue and a terminal C3, C6, or C7 residue. 12 In some embodiments, the terminal cap is present at the 5'-end, the 3'-end, or both the 5'- and 3'-ends of the sense strand.
[0106] In some embodiments, the alpha-ENaC RNAi agent comprises a sense strand with a 3' extension of 1, 2, 3, 4 or 5 nucleotides in length.In some embodiments, one or more of the sense strand extension nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to the nucleotides in the alpha-ENaC mRNA sequence.In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (listed from 5' to 3', respectively).
[0107] In some embodiments, the 3' end of the sense strand may include an additional abasic residue. In some embodiments, a UUAb, UAb, or Ab is added to the 3' end of the sense strand.
[0108] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the end or ends of the sense strand of the RNAi agent can enhance the activity or other desirable properties of the RNAi agent.
[0109] In some embodiments, the alpha-ENaC RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides corresponding to the nucleotides in the alpha-ENaC mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (listed from 5' to 3', respectively). The sense strand may have a 3' extension and / or a 5' extension.
[0110] In some embodiments, the 5' end of the sense strand may contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of an RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the end or ends of the sense strand of an RNAi agent can enable enhanced activity or other desirable properties of the RNAi agent. In some embodiments, abasic (deoxyribose) residues can be replaced with ribitol (abasic ribose) residues.
[0111] In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may comprise an inverted abasic residue (invAb (see Table 6)).
[0112] Examples of sequences used in forming an alpha-ENaC RNAi agent are provided in Tables 2, 3, and 4. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the sequence of any of the sequences in Table 2 or 3. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises the sequence of any of the sequences in Table 2 or 4. In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises a sequence of nucleotides (from the 5' end to the 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any of the sequences in Table 2 or 4. In certain embodiments, the sense strand of an alpha-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
[0113] In some embodiments, the sense and antisense strands of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of an RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).
[0114] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand to create a 3' or 5' overhang. In some embodiments, the RNAi agent contains a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.
[0115] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can retain the activity of these compounds while simultaneously increasing the serum stability of the compounds in cells, and can also minimize the potential for activating interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.
[0116] In some embodiments, alpha-ENaC RNAi agent is prepared or provided as salt, mixed salt or free acid.In some embodiments, alpha-ENaC RNAi agent is prepared as sodium salt.These forms that are well known in the art are within the scope of the invention disclosed herein.
[0117] Modified nucleotides In some embodiments, an alpha-ENaC RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (referred to herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (referred to herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogs, referred to herein as N UNA or NUNA), locked nucleotides (referred to herein as N LNA or NLNA), 3'-O-methoxy (2' internucleoside linkage) nucleotides (referred to herein as 3'-OMen), 2'-F-arabinonucleotides (referred to herein as NfANA or Nf ANAnucleotides (represented herein as 5Me-Nf), 5'-Me, 2'-fluoro nucleotides (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate-containing nucleotides, and cyclopropyl phosphonate-containing nucleotides (cPrpN). 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as a lowercase "n" in nucleotide sequences), 2'-deoxy-2'-fluoro nucleotides (also referred to herein as 2'-fluoro nucleotides and represented herein as Nf), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to herein as 2'-MOE and represented herein as NM), 2'-amino nucleotides, and 2'-alkyl nucleotides. All positions in a given compound do not need to be uniformly modified.On the contrary, more than one modification can be incorporated into a single alpha-ENaC RNAi agent, or even into its single nucleotide.The sense strand and antisense strand of alpha-ENaC RNAi agent can be synthesized and / or modified by methods known in the art.The modification at one nucleotide is independent of the modification at another nucleotide.
[0118] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 2-methyl- ... These include synthetic and natural nucleobases such as uracil, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.
[0119] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides.As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has 4 or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand that are ribonucleotides (i.e., unmodified).As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has 2 or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides.As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has 2 or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides.In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.
[0120] Modified internucleoside linkages In some embodiments, one or more nucleotides of an alpha-ENaC RNAi agent are linked by a non-canonical linkage or backbone (ie, a modified internucleoside linkage or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphophates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 moieties.
[0121] In some embodiments, the sense strand of an alpha-ENaC RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an alpha-ENaC RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an alpha-ENaC RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an alpha-ENaC RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate linkages.
[0122] In some embodiments, the sense strand of an alpha-ENaC RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, at least two phosphorothioate internucleoside linkages are between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, at least two phosphorothioate internucleoside linkages are between nucleotides 1 to 3, 2 to 4, 3 to 5, 4 to 6, 4 to 5, or 6 to 8 from the 5' end of the sense strand. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, the alpha-ENaC RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.
[0123] In some embodiments, the alpha-ENaC RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with a modified internucleoside linkage.
[0124] Alpha-ENaC RNAi Agents In some embodiments, an alpha-ENaC RNAi agent disclosed herein targets the alpha-ENaC gene at or near the location of an alpha-ENaC sequence shown in Table 1. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to the sequence of a target alpha-ENaC 19-mer disclosed in Table 1. [Table 1]
[0125] In some embodiments, an alpha-EnaC RNAi agent comprises an antisense strand in which position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an alpha-EnaC agent comprises an antisense strand in which position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
[0126] In some embodiments, an alpha-EnaC agent comprises an antisense strand in which position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an alpha-EnaC agent comprises an antisense strand in which positions 2 through 18 of the antisense strand (5'→3') can base pair with each of the complementary bases located from positions 18 through 2 of a 19-mer target sequence disclosed in Table 1.
[0127] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3'-end) can be perfectly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3'-end) forms an A:U or U:A base pair with the sense strand.
[0128] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the sequence of 2-18 or 2-19 nucleotides (from the 5' end to the 3' end) of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises the sequence of 1-17, 1-18, or 2-18 nucleotides (from the 5' end to the 3' end) of any of the sense strand sequences in Table 2 or Table 4.
[0129] In some embodiments, an alpha-ENaC RNAi agent consists of (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (from the 5' end to the 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (from the 5' end to the 3' end) of any of the sense strand sequences in Table 2 or Table 4.
[0130] In some embodiments, the alpha-ENaC RNAi agent comprises a 19-mer core nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2]
[0131] The sense and antisense strands of an alpha-ENaC RNAi agent comprising or consisting of a nucleotide sequence in Table 2 may be modified or unmodified nucleotides. In some embodiments, an alpha-ENaC RNAi agent having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences in Table 2 is entirely or substantially entirely modified nucleotides.
[0132] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
[0133] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase from the N nucleotide at the corresponding position on the other strand.
[0134] The sense and antisense strands of certain modified alpha-ENaC RNAi agents are provided in Tables 3 and 4. The antisense strands of modified alpha-ENaC RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. The sense strands of modified alpha-ENaC RNAi agents, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming alpha-ENaC RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, and Table 2 above, may be a modified nucleotide.
[0135] The alpha-ENaC RNAi agent described herein is formed by annealing antisense strand and sense strand.Under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides, the sense strand that contains the sequence listed in Table 2 or Table 4 can be hybridized with any antisense strand that contains the sequence listed in Table 2 or Table 3.
[0136] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.
[0137] In some embodiments, an alpha-ENaC RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, or Table 4.
[0138] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.
[0139] As used in Tables 3 and 4, the following notations are used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine 3'-phosphate C=cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorocytidine-3'-phosphorothioate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N UNA = 2',3'-seco nucleotide mimic (unlocked nucleobase analog)-3'-phosphate N UNA s=2',3'-seco nucleotide mimic (unlocked nucleobase analog)-3'-phosphorothioate A UNA 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA 2',3'-seco-cytidine-3'-phosphate C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate G UNA 2',3'-seco-guanosine-3'-phosphate G UNA s=2',3'-seco-guanosine-3'-phosphorothioate U UNA 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N=See Table 7 a_2Ns = See Table 7 pu_2N = See Table 7 pu_2Ns = See Table 7 D2us = See Table 7 Npu = See Table 7 Nus = See Table 7 N LNA = locked nucleotide Nf ANA = 2'-F-arabinonucleotide NM = 2'-O-(2-methoxyethyl) nucleotide AM = 2'-O-(2-methoxyethyl) adenosine-3'-phosphate AMs = 2'-O-(2-methoxyethyl)adenosine-3'-phosphorothioate TM = 2'-O-(2-methoxyethyl)thymidine-3'-phosphate TMs = 2'-O-(2-methoxyethyl)thymidine-3'-phosphorothioate R=Ribitol (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphate, see Table 7 (invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 7 (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate linkage vpdN = vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me,2'-fluoronucleotide cPrp = cyclopropylphosphonate, see Table 7 epTcPr = see Table 7 epTM = see Table 7 spus = See Table 7 (Chol-TEG) = See Table 7 (TEG-Biotin) = See Table 7 (PEG-C3-SS) = See Table 7 (Alk-SS-C6) = See Table 7 (C6-SS-Alk) = See Table 7 (C6-SS-C6) = See Table 7 (6-SS-6) = See Table 7 (C6-SS-Alk-Me) = See Table 7 (NH2-C6) = See Table 7 (TriAlk#) = See Table 7 (TriAlk#)s = See Table 7
[0140] Those skilled in the art will readily understand that, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), when present in an oligonucleotide, nucleotide monomers are linked to one another by a 5'-3'-phosphodiester bond. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each of the given monomers in place of a phosphate moiety ex vivo. Furthermore, as those skilled in the art will readily understand and appreciate, while the phosphorothioate chemical structures shown herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers and / or diastereomers (e.g., when the sulfur atom has a double bond and the anion is an oxygen atom). Unless otherwise expressly indicated herein, such understanding by those skilled in the art will be understood by those skilled in the art as being consistent with the alpha-ENaC disclosed herein. Used when describing RNAi agents and compositions of alpha-ENaC RNAi agents.
[0141] Certain examples of targeting groups and linking groups for use with the alpha-ENaC RNAi agents disclosed herein are included in the chemical structures provided below in Table 6. Each sense and / or antisense strand may have any of the targeting or linking groups listed herein, as well as other targeting or linking groups conjugated to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4]
[0142] The alpha-ENaC RNAi agent disclosed herein is formed by annealing antisense strand and sense strand.Under the condition that the two sequences have at least 85% complementary region over the sequence of 16, 17, 18, 19, 20 or 21 consecutive nucleotides, the sense strand that contains the sequence listed in Table 2 or Table 4 can be hybridized with any antisense strand that contains the sequence listed in Table 2 or Table 3.
[0143] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.
[0144] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
[0145] In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises the sequence of nucleotides (from the 5' end to the 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2 or Table 4. In certain embodiments, the sense strand of the alpha-ENaC RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
[0146] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) can be perfectly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) is U, A, or dT (or a modified version of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) forms an A:U or U:A base pair with the sense strand.
[0147] In some embodiments, the antisense strand of an alpha-ENaC RNAi agent comprises the sequence of nucleotides 2-18 or 2-19 (from the 5' end to the 3' end) of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent comprises the sequence of nucleotides 1-17 or 1-18 (from the 5' end to the 3' end) of any of the sense strand sequences in Table 2 or Table 4.
[0148] In some embodiments, an alpha-ENaC RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (from the 5' end to the 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (from the 5' end to the 3' end) of any of the sense strand sequences in Table 2 or Table 4.
[0149] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, an alpha-ENaC RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Table 5.
[0150] In some embodiments, the alpha-ENaC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, the alpha-ENaC RNAi agent consists of any of the duplex ID numbers presented herein. In some embodiments, the alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequence of any of the duplex ID numbers presented herein. In some embodiments, the alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequence of any of the duplex ID numbers presented herein and a targeting group, a linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the alpha-ENaC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequence of any of the duplex ID numbers presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.
[0151] In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands.
[0152] In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises a targeting group that is an integrin targeting ligand. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).
[0153] In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 5.
[0154] In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 5, and further comprises an integrin-targeting ligand.
[0155] In some embodiments, the alpha-ENaC RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 5. [Table 5-1] [Table 5-2]
[0156] In some embodiments, the alpha-ENaC RNAi agents are formulated or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knock down expression of one or more alpha-ENaC genes in vivo and / or in vitro upon delivery to cells expressing the alpha-ENaC genes.
[0157] Targeting Groups, Linking Groups, Pharmacokinetic (PK) Modulators, and Delivery Vehicles In some embodiments, the alpha-ENaC RNAi agent contains or is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a pharmacokinetic (PK) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance the targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group may be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the alpha-ENaC RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the alpha-ENaC RNAi agent. The non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0158] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.
[0159] A targeting group or targeting moiety enhances the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which it is attached, improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or higher with respect to the target to which it is directed. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker, or in some cases, one, two, or three abasic and / or ribitol (abasic ribose) residues, which can serve as a linker. In some embodiments, the targeting group comprises an integrin targeting ligand.
[0160] The alpha-ENaC RNAi agents described herein can be synthesized with a reactive group, such as an amino group (also referred to herein as an amine), at the 5'-end and / or 3'-end. The reactive group can then be used to attach a targeting moiety using methods typical in the art.
[0161] For example, in some embodiments, the alpha-ENaC RNAi agent disclosed herein is synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent.Then, the terminal amino group can be reacted to form a conjugate with a group that includes, for example, αββ integrin targeting ligand.In some embodiments, the alpha-ENaC RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent.Then, the terminal alkyne group can be reacted to form a conjugate with a group that includes, for example, αββ integrin targeting ligand.
[0162] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells that have αvβ6 on their respective surfaces, and the binding of the integrin targeting ligand can facilitate the entry of a therapeutic agent, such as an RNAi agent, to which it is linked into cells, such as epithelial cells, including lung epithelial cells and kidney epithelial cells. The integrin targeting ligand may be monomeric or monovalent (e.g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. The preparation of targeting groups such as αβ integrin targeting ligands is described, for example, in International Patent Application Publication No. WO2018 / 085415 and U.S. Provisional Patent Applications Nos. 62 / 580,398 and 62 / 646,739, the contents of each of which are incorporated herein in their entirety.
[0163] The present disclosure also provides a pharmaceutical composition for delivering an alpha-ENaC RNAi agent to lung epithelial cells in vivo. Such a pharmaceutical composition may comprise, for example, an alpha-ENaC RNAi agent conjugated to a targeting group comprising an integrin targeting ligand. In some embodiments, the integrin targeting ligand comprises an αββ integrin ligand.
[0164] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, reactive groups such as Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, primary amines and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and / or PEG groups.
[0165] A linker or linking group is a connection between two atoms that connects one chemical group or segment of interest (such as an RNAi agent) to another chemical group or segment of interest (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) via one or more covalent bonds. A labile linkage contains a labile bond. The linkage may optionally include a spacer that increases the distance between the two connected atoms. The spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the description.
[0166] In some embodiments, targeting group is connected to alpha-ENaC RNAi agent without using additional linker.In some embodiments, targeting group is designed with linker that exists easily, so that it can be easily connected to alpha-ENaC RNAi agent.In some embodiments, when two or more RNAi agents are contained in composition, two or more RNAi agents can be connected to their respective targeting group using the same linker.In some embodiments, when two or more RNAi agents are contained in composition, two or more RNAi agents are connected to their respective targeting group using different linker.
[0167] Any of the alpha-ENaC RNAi agent nucleotide sequences listed in Tables 2, 3, and 4, whether modified or unmodified, may contain a 3' and / or 5' targeting group, linking group, and / or pharmacokinetic modulator. Any of the alpha-ENaC RNAi agent sequences listed in Tables 3 and 4 or otherwise described herein that contain a 3' or 5' targeting group, linking group, or pharmacokinetic modulator may alternatively contain no 3' or 5' targeting group, linking group, or pharmacokinetic modulator, or may contain a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator, including, but not limited to, those shown in Table 6. Any of the alpha-ENaC RNAi agent duplexes listed in Table 5, whether modified or unmodified, may further comprise a targeting group or linking group, including but not limited to those shown in Table 6, which can be attached to the 3' or 5' end of either the sense or antisense strand of the alpha-ENaC RNAi agent duplex.
[0168] Examples of certain targeting groups and linking groups are provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] [Table 6-14]
[0169] Alternatively, other linking groups known in the art can be used.
[0170] In some embodiments, RNAi agents can be delivered to cells or tissues using delivery vehicles.Delivery vehicles are compounds that improve the delivery of RNAi agents to cells or tissues.Delivery vehicles can include or consist of polymers such as, but not limited to, amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.
[0171] In some embodiments, RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery system available in the art.RNAi agent can also be chemically conjugated with targeting group, lipid (including but not limited to cholesterol and cholesteryl derivative), nanoparticle, polymer, liposome, micelle, DPC (see for example WO2000 / 053722, WO2008 / 022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference) or other delivery system available in the art.
[0172] Pharmaceutical Compositions and Formulations The alpha-ENaC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical compositions comprise at least one alpha-ENaC RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting alpha-ENaC mRNA expression in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects with diseases, disorders, or conditions that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease or disorder that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, a method comprises administering to a subject to be treated an alpha-ENaC RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an alpha-ENaC RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0173] The pharmaceutical compositions and methods disclosed herein comprising an alpha-ENaC RNAi agent reduce the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, an organ, or a subject, including by inhibiting the expression of alpha-ENaC mRNA in the subject by administering to the subject a therapeutically effective amount of an alpha-ENaC RNAi agent described herein. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder mediated at least in part by ENaC expression. In some embodiments, the subject has previously been identified or diagnosed with increased ENaC activity in one or more cells or tissues. In some embodiments, the subject has previously been diagnosed with one or more respiratory diseases, such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, airway infection, primary ciliary dyskinesia, and lung cancer cystic fibrosis. In some embodiments, the subject has previously been diagnosed with one or more ophthalmic diseases, such as dry eye. In some embodiments, the subject has suffered from one or more respiratory disease-related symptoms associated with or caused by enhanced ENaC activity.
[0174] In some embodiments, the pharmaceutical compositions described, comprising alpha-ENaC RNAi agents, are used to treat or manage clinical symptoms in subjects who benefit from inhibiting the expression of ENaC. In some embodiments, a therapeutically or prophylactically effective amount of one or more of the pharmaceutical compositions is administered to a subject who needs such treatment. In some embodiments, the administration of any of the disclosed alpha-ENaC RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.
[0175] The pharmaceutical compositions described comprising alpha-ENaC RNAi agents can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting the expression of alpha-ENaC mRNA.In some embodiments, the symptoms are treated by administering to the subject a therapeutically effective amount of one or more pharmaceutical compositions comprising alpha-ENaC RNAi agents.In other embodiments, the symptoms are prevented or inhibited by administering to the subject a prophylactically effective amount of one or more alpha-ENaC RNAi agents.
[0176] The administration route is the route by which the alpha-ENaC RNAi agent comes into contact with the body. Generally, the methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The alpha-ENaC RNAi agent disclosed herein can be administered by any suitable route in a preparation that is appropriately adjusted for a specific route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical composition can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally, or topically.
[0177] Pharmaceutical compositions comprising the alpha-ENaC RNAi agent described herein can be delivered to cells, cell groups, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable method (in vitro or in vivo) recognized in the art for delivering nucleic acid molecules can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the composition is administered by inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration. For example, in some embodiments, it is desirable for the alpha-ENaC RNAi agents described herein to inhibit expression of the alpha-ENaC gene in the pulmonary epithelium, making administration by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) particularly suitable and advantageous.
[0178] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0179] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., alpha-ENaC RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can a) aid in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in product identification, and / or d) act to enhance any other attribute of the overall safety or effectiveness of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
[0180] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffering agents, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.
[0181] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0182] Sterile injection solution can be prepared by incorporating the active compound in the required amount in suitable solvent with one or combination of the above-listed components as needed, and then sterilizing and filtering.Generally, dispersion is prepared by incorporating the active compound into a sterile vehicle that contains basic dispersion medium and other necessary components from the above-listed components.For the preparation of sterile powder for sterile injection solution, the preparation method includes vacuum drying and freeze-drying, which produces the powder of active ingredient and any other desired components from its previously sterile-filtered solution.
[0183] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ophthalmic administration.
[0184] The preparation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound in suitable solvent, and then sterilizing and filtering.Generally, the preparation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5cP).Salt can be added to the preparation to balance tonicity.In some cases, surfactant or cosolvent can be added to increase the solubility of active compound and improve aerosol properties.In some cases, excipient can be added to control viscosity and ensure the size and distribution of atomized droplets.
[0185] Active compounds can be prepared with carriers that protect the compound from rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.Methods for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.They can be prepared according to the method known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0186] Alpha-ENaC RNAi agent can be formulated into compositions in unit dosage form for ease of administration and uniform dosage.Unit dosage form refers to a physically separate unit that is suitable as a single dosage for the subject to be treated; each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect associated with required pharmaceutical carrier.The specification for unit dosage form of the present disclosure is determined by and directly depends on the unique characteristics of active compound and the therapeutic effect that it wants to achieve, and the inherent limitation in the field of compounding this active compound for individual treatment.
[0187] Pharmaceutical compositions may contain other additional components that are commonly found in pharmaceutical compositions.Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (for example, antihistamines, diphenhydramine, etc.).It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as "pharmaceutical compositions".As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces pharmacological, therapeutic, or preventive results.
[0188] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another alpha-ENaC RNAi agent (e.g., an alpha-ENaC RNAi agent that targets a different sequence within the alpha-ENaC target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.
[0189] Generally, an effective amount of an alpha-ENaC RNAi agent disclosed herein ranges from about 0.0001 to about 20 mg / kg body weight / day, e.g., from about 0.001 to about 3 mg / kg body weight / day. In some embodiments, an effective amount of an alpha-ENaC RNAi agent ranges from about 0.001 to about 0.500 mg / kg body weight / dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent ranges from about 0.001 to about 0.100 mg / kg body weight / dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent ranges from about 0.001 to about 0.050 mg / kg body weight / dose. The amount administered may also depend on variables such as the patient's overall health, the relative biological potency of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Also, the initial dosage administered may be increased above the upper upper level in order to rapidly achieve the desired blood or tissue levels, or the initial dosage may be less than the optimum dosage.
[0190] For the treatment of a disease or to form a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising an alpha-ENaC RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.
[0191] When added to pharmaceutically acceptable excipient or adjuvant, the alpha-ENaC RNAi agent described can be packaged in kit, container, pack or dispenser.The pharmaceutical compositions described herein can be packaged in dry powder or aerosol inhaler, other metered dose inhaler, nebulizer, pre-filled syringe or vial.
[0192] Methods of Treatment and Inhibition of Expression The alpha-ENaC RNAi agent disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that benefit from the administration of an RNAi agent.In some embodiments, the RNAi agent disclosed herein can be used to treat subjects (e.g., humans) that benefit from the reduction and / or inhibition of the expression of alpha-ENaC mRNA.
[0193] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) with a disease or disorder that would benefit from reduced ENaC channel activity, including, but not limited to, cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, and / or lung cancer, cystic fibrosis, and / or dry eye. Treatment of a subject may include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more alpha-ENaC RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein may be to a human or an animal.
[0194] Increased ENaC activity is known to promote the drying of airway surface liquid and impair mucociliary clearance. In some embodiments, the described alpha-ENaC RNAi agents are used to treat at least one symptom in a subject that is at least partially mediated by ENaC activity levels. The subject is administered a therapeutically effective amount of any one or more of the described alpha-ENaC RNAi agents. In some embodiments, the subject is treated by preventing or inhibiting at least one symptom by administering a prophylactically effective amount of any one or more of the described RNAi agents to the subject.
[0195] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by alpha-ENaC gene expression in a patient in need thereof, comprising administering to the patient any of the alpha-ENaC RNAi agents described herein.
[0196] In some embodiments, alpha-ENaC RNAi agents are used to treat or manage clinical conditions or pathological conditions in subjects, wherein the clinical conditions or pathological conditions are at least partially mediated by ENaC expression.The subject is administered a therapeutically effective amount of one or more of the alpha-ENaC RNAi agents described herein or compositions containing alpha-ENaC RNAi agents.In one embodiment, the method comprises administering a composition comprising the alpha-ENaC RNAi agent described herein to the subject to be treated.
[0197] In some embodiments, the gene expression level and / or mRNA level of the alpha-ENaC gene in certain epithelial cells of a subject to which a described alpha-ENaC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the alpha-ENaC RNAi agent or a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the ENaC level or ENaC channel activity level in certain epithelial cells of a subject administered with the described alpha-ENaC RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the alpha-ENaC RNAi agent or the subject who has not received the alpha-ENaC RNAi agent. The gene expression level, protein level, and / or mRNA level in a subject can be reduced in the subject's cells, cell groups, and / or tissues. In some embodiments, alpha-ENaC mRNA levels in certain epithelial cells of a subject administered a described alpha-ENaC RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the alpha-ENaC RNAi agent or compared to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the level of ENaC heterotrimeric protein complexes in certain epithelial cells of a subject administered a described alpha-ENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the alpha-ENaC RNAi agent or compared to a subject not receiving the alpha-ENaC RNAi agent.The ENaC level in a subject can be reduced in the cells, cell groups, tissues, blood, and / or other bodily fluids of the subject.For example, in some embodiments, the level of alpha-ENaC mRNA and / or ENaC heterotrimeric protein complex in the lung epithelial cells of the subject administered with the described alpha-ENaC RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% compared with the subject before the alpha-ENaC RNAi agent is administered or the subject who has not received the alpha-ENaC RNAi agent. In some embodiments, the levels of alpha-ENaC mRNA and / or ENaC heterotrimeric protein complex and / or ENaC channel activity in a subset of lung epithelial cells, such as airway epithelial cells, of a subject administered a described alpha-ENaC RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the alpha-ENaC RNAi agent or a subject not receiving the alpha-ENaC RNAi agent.
[0198] The reduction of gene expression, mRNA and protein level can be evaluated by any method known in the art.The reduction or decrease of alpha-ENaC mRNA level, ENaC channel activity level, and / or ENaC heterotrimeric protein complex level is collectively referred to herein as the reduction or decrease of alpha-ENaC or the inhibition or decrease of the expression of alpha-ENaC gene.The examples described herein illustrate the known method for evaluating the inhibition of alpha-ENaC gene expression.
[0199] Cells, tissues, organs, and non-human organisms Contemplated herein is the cell, tissue, organ and non-human organism that comprises at least one of the alpha-ENaC RNAi agents described herein.Cell, tissue, organ or non-human organism is produced by delivering RNAi agent to cell, tissue, organ or non-human organism.
[0200] The embodiments and clauses provided above will now be illustrated with the following non-limiting examples. [Example]
[0201] Example 1 Synthesis of alpha-ENaC RNAi agent The alpha-ENaC RNAi agent duplexes shown in Table 5 were synthesized as follows.
[0202] A. Synthesis. The sense and antisense strands of the alpha-ENaC RNAi agent were synthesized on a solid phase according to the phosphoramidite technique used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) was used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used were the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-O-dimethoxytrityl-N 2The protective groups included 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidite carried the same protecting groups as the 2'-O-methyl-RNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2' 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. TFA amino-linked phosphoramidites were also purchased commercially (ThermoFisher).
[0203] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0204] Alternatively, tri-alkyne moieties were introduced post-synthetically (see Section E below). For this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA-amino-linked phosphoramidites were dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0205] B. Cleavage and deprotection of the support-bound oligomer. After finalization of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine and 28%-31% ammonium hydroxide solution (Aldrich) in water at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).
[0206] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW, 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then run on a size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine, using a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system by tangential flow filtration.
[0207] D. Annealing. RNAi agents were formed by combining the complementary strands of RNA (sense and antisense) in equimolar concentrations in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x PBS on a UV-Vis spectrophotometer. The absorbance of the solution at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. Unless otherwise stated, the conversion factor used was 0.037 mg / (mL·cm).
[0208] E. Conjugation of Tri-Alkyne Linkers. Before or after annealing, the 5' or 3' amine-functionalized sense strand is conjugated to a tri-alkyne linker. Examples of tri-alkyne linker structures that can be used in forming the constructs disclosed herein are as follows: [ka] The following describes the conjugation of the tri-alkyne linker to the annealed duplex. The amine-functionalized duplex was dissolved at approximately 50-70 mg / mL in 90% DMSO / 10% HO. 40 equivalents of triethylamine were added, followed by 3 equivalents of tri-alkyne-PNP. Once complete, the conjugate was precipitated twice in a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.
[0209] F. Conjugation of the Targeting Ligand. A 5' or 3' tridentate alkyne-functionalized sense strand is conjugated to the targeting ligand before or after annealing. The following example describes the conjugation of a targeting ligand to an annealed duplex. Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M Cu(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and a 2 M solution of sodium ascorbate were prepared in deionized water. A 75 mg / mL solution of the targeting ligand in DMSO was made. To a 1.5 mL centrifuge tube containing the tri-alkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol), 25 μL of 1 M Hepes pH 8.5 buffer was added. After vortexing, 35 μL of DMSO was added and the solution was vortexed. The targeting ligand was added to the reaction (6 equiv. / duplex, 2 equiv. / alkyne, approximately 15 μL) and the solution was vortexed. Using pH paper, the pH was checked and confirmed to be approximately 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equiv., 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately thereafter, 2 M ascorbate (5 μL, 50 equiv. / duplex, 16.7 / alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically in 0.5-1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography.
[0210] Example 2 In vivo intratracheal administration of alpha-ENaC RNAi agents in mice To assess the activity of alpha-ENaC RNAi agents in vivo, male ICR mice were administered 50 microliters on days 1 and 2 of the study via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration of either an isotonic saline vehicle for use as a control, or one of the following alpha-ENaC RNAi agents formulated in isotonic saline at 5 mg / kg without a conjugated ligand (i.e., "naked RNAi agents"): AD04019, AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, or AD04026 (see, e.g., Tables 3-6 for chemical structure information regarding the chemically modified duplexes used in this example).
[0211] Four or five mice were administered per group. Mice were sacrificed (sac) on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0212] Figure 1 shows the relative expression of the identified alpha-ENaC RNAi agent compositions (AD04019, AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, and AD04026), with each RNAi agent showing a significant reduction in pulmonary alpha-ENaC expression compared to the vehicle control.
[0213] Example 3 In vivo intratracheal administration of alpha-ENaC RNAi agents in mice On study days 1 and 2, male ICR mice were administered 50 microliters of either isotonic saline vehicle (used as a control) or 3 mg / kg of alpha-ENaC RNAi agent (i.e., AD04025 or AD04858 (see Tables 3-6 for chemical structure information on the chemically modified duplexes used in this example)) formulated in isotonic saline via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. Four or five mice were administered per group. Mice were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0214] FIG. 2 shows the relative expression of alpha-ENaC RNAi agents AD04025 and AD04858, with both RNAi agents showing a significant reduction in lung alpha-ENaC expression compared to controls.
[0215] Example 4 In vivo intratracheal administration of alpha-ENaC RNAi agents conjugated and unconjugated to epithelial cell-targeting ligands in rats On study days 1 and 2, male Sprague-Dawley rats received 200 microliters of either 0.5 mg / kg, 1.5 mg / kg, or 5 mg / kg alpha-ENaC RNAi agent formulated in isotonic saline via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration. Five rats were administered per group. Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0216] Figure 3 shows the relative expression of the alpha-ENaC RNAi agent AD04025 and the AD04025-conjugate. The AD04025-conjugate was synthesized by post-synthetically linking a peptide-based integrin-targeting ligand with affinity for αβ integrin to an amino group added to the 5' end of the sense strand of the RNAi agent via a masked poly-L-lysine (PLL) scaffold (see, e.g., Tables 3-6 for chemical structure information regarding the chemically modified duplex used in this example). While both the naked RNAi agent and the RNAi agent-conjugate showed a substantial reduction in lung alpha-ENaC expression compared to baseline measurements, the AD04025-conjugate showed numerically improved levels of knockdown across each of the three dose levels measured (0.5 mg / kg, 1.5 mg / kg, and 5 mg / kg), with a particularly striking improvement at the 1.5 mg / kg dose (78% knockdown with ligand vs. 47% knockdown without ligand).
[0217] Example 5 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 7: [Table 7] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0218] In groups 2-7, the tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM2, has the structure shown in Figure 4 and was conjugated to the RNAi agent via the terminal amine on the 5' end of the sense strand (i.e., by forming a covalent bond with the terminal NH2-C6 group).
[0219] Five rats were administered per group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 8]
[0220] As shown in Table 8 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to controls. For example, AD05347, which contains a cyclopropyl-phosphonate group located at the 5' end of the antisense strand, had an average reduction in mRNA of about 59% (0.411) compared to the control group. Furthermore, each of the other alpha-ENaC RNAi agents showed a reduction in rENaC mRNA of at least about 27% compared to controls.
[0221] Example 6 In vivo intratracheal administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration of either an isotonic saline vehicle for use as a control, or one of the following alpha-ENaC RNAi agents according to the following dosing groups listed in Table 9: [Table 9] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0222] In groups 2, 5, and 6, the tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM1, had the structure shown in Figure 5 and was conjugated to the RNAi agent via the terminal amine on the 5' end of the sense strand (i.e., by forming a covalent bond with the terminal NH2-C6 group). For groups 3 and 4, the tridentate small molecule ligand in groups 3 and 4 replaced the glutaric linker shown in Figure 5 with a linker containing a cysteine-PEG2 linkage shown below. [ka]
[0223] Five rats were administered each in groups 1, 2, 3, 4, 5, and 7 (n=5), and four rats were administered in group 6. Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 10]
[0224] As shown in Table 10 above, each of the alpha-ENaC RNAi agents demonstrated reduced mRNA expression in rats compared to controls. Furthermore, the use of a tridentate small molecule αvβ6 epithelial cell targeting ligand demonstrates comparable reductions in mRNA expression when compared to a peptide-based αvβ6 epithelial cell targeting ligand that further comprises a 20 kDa PEG PK modifier.
[0225] Example 7 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 11: [Table 11] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0226] In each of Groups 2-6 and 8-10, a tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM2, had the structure shown in Figure 4 and was conjugated to the RNAi agent via the terminal amine on the 5' end of the sense strand (i.e., by forming a covalent bond with the terminal NH2-C6 group). The ligand in Group 7 contained a cysteine linking group (see, e.g., Example 6).
[0227] In groups 1, 2, 3, 4, 5, 6, 7, and 9, four rats were administered (n=4), and in groups 8 and 10, three rats were administered (n=3). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 12]
[0228] As shown in Table 12 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to controls. For example, AD05347 showed an approximately 54% reduction (0.457) in mean rENaC mRNA expression compared to controls.
[0229] Example 8 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 13: [Table 13] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0230] The tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM2 in groups 2 and 4 has the structure shown in Figure 4; the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM6.1 in groups 3 and 8 has the structure shown in Figure 6; the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM9 in group 5 has the structure shown in Figure 7; the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM6 in group 6 has the structure shown in Figure 8; the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM8 in group 7 has the structure shown in Figure 9; the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM10 in group 9 has the structure shown in Figure 10; and the tridentate small molecule αvβ6 epithelial cell targeting ligand designated Tri-SM11 in group 10 has the structure shown in Figure 11. Each of the respective tridentate small molecule αvβ6 epithelial cell targeting ligands was attached by conjugation via the amino group on the 5' end of the respective alpha-ENaC RNAi agent.
[0231] Four rats were administered in each group (n = 4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 14]
[0232] As shown in Table 14 above, each alpha-ENaC RNAi agent showed a reduction in mRNA expression in rats compared to the control. For example, AD05347-Tri-SM6.1 (Group 3) showed an approximately 64% reduction in average rENaC mRNA expression (0.358) compared to the control, and AD05453-Tri-SM6.1 (Group 8) showed an approximately 55% reduction in average rENaC mRNA expression (0.454) compared to the control. Furthermore, Groups 8 and 9 achieved an approximately 55% reduction in average rENaC mRNA expression (0.454) without using a 5'-terminal cyclopropyl-phosphonate modification on the antisense strand, demonstrating an inhibitory effect comparable to Group 2, with an approximately 53% reduction in average rENaC mRNA expression (0.469) using a 5'-antisense cyclopropyl-phosphonate modification. Furthermore, as observed in Groups 4, 6, 8, 9, and 10, tridentate small molecule αvβ6 epithelial cell targeting ligands were comparable to, or in some cases numerically superior to, Group 11, which uses αvβ6 epithelial cell targeting ligands based on tridentate peptides known to have affinity for integrin αvβ6 (e.g., Groups 8 and 9, including Tri-SM6.1 and Tri-SM10) (see Figure 11 of International Patent Application Publication No. WO2018 / 085415 for chemical structure information).
[0233] Example 9 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette containing the following dose groups listed in Table 15: [Table 15] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0234] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 3 and 5-8, has the structure shown in FIG.
[0235] Four rats were administered in each group (n = 4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 16]
[0236] As shown in Table 16 above, each of the alpha-ENaC RNAi agents demonstrated a reduction in mRNA expression in rats compared to controls. Furthermore, when administered naked, AD05453 demonstrated only approximately 29% inhibition (0.713), but when conjugated with the Tri-SM6.1 integrin-targeting ligand, it demonstrated a 44% reduction in mean rENaC mRNA expression (0.562).
[0237] Example 10 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette containing the following dose groups listed in Table 17: [Table 17] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0238] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-10, has the structure shown in FIG.
[0239] Four rats were administered in each group (n = 4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 18]
[0240] As shown in Table 18 above, each of the alpha-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.
[0241] Example 11 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette containing the following dose groups listed in Table 19: [Table 19] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0242] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-7, has the structure shown in FIG.
[0243] Five rats were administered in each group (n = 5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 20]
[0244] As shown in Table 20 above, each of the alpha-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.
[0245] Example 12 In vivo oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 21: [Table 21] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0246] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-13, has the structure shown in FIG.
[0247] Four rats were administered in each group (n = 4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 22]
[0248] As shown in Table 22 above, each of the alpha-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.
[0249] Example 13 A dose-ranging study of oropharyngeal aspiration administration of an alpha-ENaC RNAi agent conjugated to an epithelial cell-targeting ligand in rats On study day 1, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 23: [Table 23] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0250] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-8, has the structure shown in FIG.
[0251] Six rats (n = 5) were administered in each of groups 1, 2, 3, 4, 7, and 8. Four rats (n = 4) were administered in groups 5 and 6. Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 24] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0252] As shown in Table 24 above, the alpha-ENaC RNAi agent AD05453 demonstrated reduced mRNA expression in rats compared to controls at each of the administered dosage levels.
[0253] Example 14 In vivo intratracheal administration of alpha-ENaC RNAi agents in mice On study days 1 and 2, male ICR mice were sprayed with 50 microliters of either an isotonic saline vehicle for use as a control, or one of the following alpha-ENaC RNAi agents formulated in isotonic saline at 5 mg / kg without a conjugated ligand (i.e., "naked RNAi agent"): AD04025, AD04526, AD04527, AD04528, AD04529, AD04530, AD04531, AD04536, or AD04537 using a microspray device (Penn The treatment was administered via a 500 mg / kg / day (Century, Philadelphia, PA) IV infusion. Four mice per group (n=4) were administered. Mice were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 25] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0254] As shown in Table 25 above, each of the alpha-ENaC RNAi agents showed a decrease in mRNA expression in rats compared to controls.
[0255] Example 15 In vivo intratracheal administration of alpha-ENaC RNAi agents in mice On study days 1 and 2, male ICR mice were administered 50 microliters via a microspray device (Penn Century, Philadelphia, PA) of either an isotonic saline vehicle for use as a control, or 5 mg / kg of one of the following alpha-ENaC RNAi agents (i.e., "naked RNAi agents") formulated in isotonic saline without a conjugated ligand: AD04025, AD04538, AD04539, AD04532, AD04533, AD04534, AD04535, or AD04540 (see, e.g., Tables 3-6 for chemical structure information regarding the chemically modified duplexes used in this example).
[0256] Four mice per group (n=4) were administered. Mice were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 26] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0257] As shown in Table 26 above, the underlying sequence of each alpha-ENaC RNAi agent affects the level of ENaC gene inhibition achieved. For example, alpha-ENaC RNAi agent AD04025 contains an antisense strand sequence designed to target position 972 of the alpha-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to positions 972-990 of the alpha-ENaC gene (SEQ ID NO: 1)). AD04525 achieved the highest level of inhibition of the RNAi agents tested in this example, exhibiting approximately 55% knockdown of gene expression (0.448) compared to the control. The remaining alpha-ENaC RNAi agents were designed to target different positions on the gene, including alpha-ENaC RNAi agents AD04538 (targeting gene position 973), AD04539 (targeting gene position 999), AD04532 (targeting gene position 1000), AD04533 (also targeting gene position 973), AD04534 (also targeting gene position 999), AD04535 (targeting gene position 1291), and AD04540 (targeting gene position 763). As shown above, alpha-ENaC RNAi agents designed to target genes at different positions may have different inhibitory activities (e.g., compare the alpha-ENaC mRNA knockdown levels of AD04025 (position 972) with those of AD04538 (position 973) and AD04533 (position 973)). Furthermore, when comparing alpha-ENaC RNAi agents at the same position (e.g., AD04539 and AD04534), even though both sequences have an underlying nucleobase designed to inhibit a gene at the same position (e.g., gene position 999), slight modifications of the underlying base sequence and / or the inclusion of different modified nucleotides may result in at least numerically different inhibitory activity.
[0258] Example 16 In vivo intratracheal administration of alpha-ENaC RNAi agents in rats On study days 1 and 2, male Sprague Dawley rats were administered 200 microliters via a microspray device (Penn Century, Philadelphia, PA) of either an isotonic saline vehicle for use as a control, or approximately 3 mg / kg of one of the following alpha-ENaC RNAi agents (i.e., "naked RNAi agents") formulated in isotonic saline without a conjugated ligand: AD04835, AD04022, AD05116, AD05117, AD05118, or AD05119 (see, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example).
[0259] Five rats were administered per group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 27] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0260] Table 27 above provides further data showing that the underlying sequence of each alpha-ENaC RNAi agent influences the level of inhibition of the ENaC gene achieved.For example, alpha-ENaC RNAi agents AD04025 and AD04835 each comprise an antisense strand sequence designed to target position 972 of the alpha-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to positions 972-990 of the alpha-ENaC gene (SEQ ID NO: 1)).Among the alpha-ENaC RNAi agents tested in this example, these two RNAi agents show the highest level of knockdown, greater than 70%. The remaining alpha-ENaC RNAi agents were designed to target different locations on the gene, including alpha-ENaC RNAi agents AD05116 (targeting gene position 944), AD05117 (targeting gene position 945), AD05118 (targeting gene position 1289), and AD05119 (targeting gene position 1579).
[0261] Example 17 A multiple-dose dose-ranging study of an alpha-ENaC RNAi agent conjugated to an epithelial cell-targeting ligand administered by oropharyngeal aspiration in rats On Study Day 1, Study Day 2, and Study Day 3, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette according to the following dosing groups listed in Table 28: [Table 28] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.) As noted herein, the same RNAi agent-tridentate small molecule αvβ6 epithelial cell targeting ligand conjugate structure in this example (i.e., Tri-SM6.1-AD05453) can alternatively be synthesized by using a tri-alkyne functionalized linker (TriAlk14) as shown in AD05924, instead of post-synthetic addition to the terminal amino group as shown in AD05453 (see also Example 1).
[0262] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-7, has the structure shown in FIG.
[0263] Seven rats were administered in each of groups 1, 2, 3, 4, 5, and 6 (n = 7), and six rats were administered in group 7 (n = 6). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 29]
[0264] As shown in Table 29 above, the alpha-ENaC RNAi agent AD05453 showed reduced mRNA expression in rats compared to controls at each administered dosage level. Furthermore, administration of multiple OP doses showed signs of further knockdown of rENaC mRNA expression compared to a single dose when using the same alpha-ENaC RNAi agent (e.g., compare Group 7 in Example 17 with Group 5 in Example 13).
[0265] Example 18 In vivo intratracheal administration of alpha-ENaC RNAi agents to assess sputum stability in mice and humans in COPD To assess the activity and stability of known prior art duplexes and compare them to the RNAi agents disclosed herein, duplexes with the following modified structures, as disclosed in International Patent Application Publication No. WO 2008 / 152131 to Novartis et al. (see Table 1C, ND-9201 therein), were synthesized: Antisense strand sequence (5'→3'): GAUUUGUUCUGGUUGcAcAdTsdT (SEQ ID NO: 291) Sense strand sequence (5'→3'): uGuGcAAccAGAAcAAAucdTsdT (SEQ ID NO: 292) (Hereinafter referred to as ND-9201). According to WO2008 / 152131, ND-9201 showed equally potent in vitro inhibition of alpha-ENaC gene expression.
[0266] First, we conducted a study to evaluate alpha-ENaC inhibitory activity in vivo. On days 1 and 2, male ICR mice were administered either an isotonic glucose (D5W) vehicle (used as a control) or approximately 10 mg / kg of ND-9201 formulated in D5W via a microspray device (Penn Century, Philadelphia, PA). Mice were sacrificed on day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group. For comparison, on days 1 and 2 of the study, male ICR mice were administered either D5W vehicle for use as a control or approximately 5 mg / kg of the RNAi agent AD04025 disclosed herein formulated in D5W via a microspray device (Penn Century, Philadelphia, PA) (see Tables 3-6 for chemical structure information regarding the chemically modified duplex of AD04025). Mice were similarly sacrificed on day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group.
[0267] ND-9201 at 10 mg / kg on days 1 and 2 significantly inhibited mENaC Approximately 25% inhibition of mRNA expression was achieved in vivo in mice.
[0268] For AD04025, approximately 65% inhibition of mENaC mRNA expression was achieved in vivo in mice with only a 5 mg / kg dose on days 1 and 2, thus demonstrating a substantial improvement in inhibitory activity compared to the known prior art double-chain ND-9201.
[0269] Further stability studies were performed with ND-9201 and AD04858 in human sputum collected from patients diagnosed with COPD (see Tables 3-6 for chemical structure information for the chemically modified duplex of AD04858). A solution containing 50 μL of sputum and 350 μL of lysis buffer was vortexed, and 12.5 μL of ND-9201 or AD04858 was added, followed by brief vortexing every hour. LCMS was performed on the samples to determine the remaining full-length product over time for both the sense and antisense strands of each molecule. After 6 hours, AD04858 demonstrated improved stability, as it had approximately 20-30% more full-length product present for both the sense and antisense strands.
[0270] Example 19 In vivo study of oropharyngeal aspiration administration of alpha-ENaC RNAi agents conjugated to epithelial cell-targeting ligands in rats On Study Day 1 and Study Day 2, male Sprague Dawley rats were administered 200 microliters by oropharyngeal ("OP") aspiration using a pipette containing the following dose groups listed in Table 30: [Table 30] (See, e.g., Tables 3-6 for chemical structure information for the chemically modified duplexes used in this example.)
[0271] The tridentate small molecule αvβ6 epithelial cell targeting ligand, designated Tri-SM6.1 in groups 2-7, has the structure shown in FIG.
[0272] Four rats were administered in each group (n = 7). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs after collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval). [Table 31]
[0273] In Table 31 above, alpha-ENaC RNAi agents AD05625 and AD05453 each contained an antisense strand designed to target the alpha-ENaC gene starting at position 972 (see SEQ ID NO: 1); AD05829 contained an antisense strand designed to target the alpha-ENaC gene starting at position 944; AD05831 contained an antisense strand designed to target the alpha-ENaC gene starting at position 973; and AD01289 contained an antisense strand designed to target the alpha-ENaC gene starting at position 1289. Each of the alpha-ENaC RNAi agents exhibited inhibition of gene expression, with RNAi agent AD05453 exhibiting relatively strong inhibition of alpha-ENaC.
[0274] Example 20 In vivo local ophthalmic administration of alpha-ENaC RNAi agents in mice To evaluate the ability of alpha-ENaC RNAi agents to inhibit alpha-ENaC mRNA expression in the ocular surface epithelium, CB57Bl / 6 mice (n = 3 per group) were administered topical drops of saline vehicle or 400 micrograms of AD04858 (in a 2-microliter volume) twice daily in both eyes for 5 days (see Tables 3-6 for chemical structure information on the chemically modified duplex of AD04858). On study day 5, mice were sacrificed, conjunctival epithelial samples were collected, and total RNA was isolated from tissue homogenates. Alpha-ENaC (SCNN1A) mRNA expression was quantified by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as a percentage of the vehicle control group.
[0275] After 5 days of twice-daily topical dosing with AD04858, conjunctival samples from treated mice expressed significantly less (approximately 24%) alpha-ENaC mRNA than samples from vehicle-treated controls.
[0276] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. In certain embodiments, for example, the following items are provided: (Item 1) An RNAi agent for inhibiting the expression of the alpha-ENaC gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand an RNAi agent comprising: (Item 2) 2. The RNAi agent of item 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences provided in Table 2 or Table 3. (Item 3) 3. The RNAi agent of claim 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 4, and the sense strand has a region of at least 85% complementarity over 17 contiguous nucleotides with the antisense strand. (Item 4) 4. The RNAi agent of any one of paragraphs 1 to 3, wherein at least one nucleotide of the alpha-ENaC RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. (Item 5) 4. The RNAi agent of any one of items 1 to 3, wherein all or substantially all of the nucleotides are modified nucleotides. (Item 6) 6. The RNAi agent of item 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, and 3'-O-methyl nucleotides. (Item 7) 6. The RNAi agent of item 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides or 2'-fluoro nucleotides. (Item 8) 8. The RNAi agent of any one of items 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3. (Item 9) 9. The RNAi agent of any one of items 1 to 8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. (Item 10) 2. The RNAi agent of item 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. (Item 11) 11. The RNAi agent of any one of items 1 to 10, which is linked to a targeting ligand. (Item 12) 12. The RNAi agent of claim 11, wherein the targeting ligand comprises an integrin targeting ligand. (Item 13) 13. The RNAi agent of item 12, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand. (Item 14) 14. The RNAi agent of item 13, wherein the αvβ6 integrin targeting ligand has a structure represented by any one of the structures in Figures 4 to 11. (Item 15) 15. The RNAi agent of any one of items 11 to 14, wherein the targeting ligand is conjugated to the sense strand. (Item 16) 16. The RNAi agent of item 15, wherein the targeting ligand is conjugated to the 5' end of the sense strand. (Item 17) 17. The RNAi agent according to any one of items 1 to 16, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. (Item 18) 18. The RNAi agent according to item 17, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. (Item 19) 19. The RNAi agent according to item 18, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. (Item 20) 20. The RNAi agent of item 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length. (Item 21) 21. The RNAi agent of item 20, having two blunt ends. (Item 22) 22. The RNAi agent of any one of items 1 to 21, wherein the sense strand comprises one or two end caps. (Item 23) 23. The RNAi agent of any one of items 1 to 22, wherein the sense strand comprises one or two inverted abasic residues. (Item 24) The RNAi agent of item 1, which is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5. (Item 25) The RNAi agent is composed of a sense strand and an antisense strand, and the antisense strand has the following nucleotide sequence (5'→3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO: 6); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152); wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine, and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. (Item 26) 27. The RNAi agent according to claim 25, wherein the sense strand further comprises an abasic residue at the 3' end. 2. The RNAi agent of item 1, wherein the RNAi agent comprises an antisense strand and a sense strand, and the antisense strand and the sense strand comprise a pair of nucleotide sequences selected from the group consisting of SEQ ID NOs: 2 and 4; SEQ ID NOs: 3 and 5; SEQ ID NOs: 6 and 8; SEQ ID NOs: 7 and 9; and SEQ ID NOs: 10 and 4. (Item 28) 2. The RNAi agent of item 1, having a double-stranded structure selected from the group consisting of AD05453, AD05625, AD05347, AD05831, AD05833, AD04835, and AD05924. (Item 29) the RNAi agent comprises an antisense strand and a sense strand, the antisense strand and the sense strand having the following nucleotide sequence (5'→3') pair: UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO: 9); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO: 230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO: 259); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO: 254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO: 289) 2. The RNAi agent according to item 1, wherein the RNAi agent consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of (Item 30) 30. The RNAi agent of item 29, wherein all or substantially all of the nucleotides are modified nucleotides. (Item 31) 31. The RNAi agent of any one of paragraphs 24 to 30, wherein the sense strand of the RNAi agent is linked to a targeting ligand. (Item 32) 32. The RNAi agent of claim 31, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells. (Item 33) 33. The RNAi agent of item 31 or 32, wherein the targeting ligand is an αvβ6 integrin targeting ligand. (Item 34) 34. A composition comprising the RNAi agent of any one of items 1 to 33, comprising a pharmaceutically acceptable excipient. (Item 35) 35. The composition of item 34, further comprising a second RNAi agent for inhibiting expression of alpha-ENaC. (Item 36) The composition according to item 34 or 35, further comprising one or more additional therapeutic agents. 37. The composition of item 36, formulated for administration by inhalation. (Item 38) 38. The composition of item 37, delivered by a metered dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler. (Item 39) 39. A method for inhibiting expression of the alpha-ENaC gene in a cell, the method comprising introducing into the cell an effective amount of the RNAi agent of any one of items 1 to 33 or the composition of any one of items 34 to 38. (Item 40) 40. The method of claim 39, wherein the cell is in a subject. (Item 41) 41. The method of claim 40, wherein the subject is a human subject. (Item 42) 42. The method of any one of items 39 to 41, wherein the expression of the alpha-ENaC gene is inhibited by at least about 30%. (Item 43) 39. A method for treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of items 34 to 38. (Item 44) Item 44. The method of item 43, wherein the disease is a respiratory disease. (Item 45) 45. The method of claim 44, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, a respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis. (Item 46) Item 44. The method of item 43, wherein the disease is an eye disease such as dry eye syndrome. (Item 47) 47. The method of any one of items 43 to 46, wherein the RNAi agent is administered at a dose of about 0.001 mg / kg body weight to about 0.500 mg / kg body weight. (Item 48) 48. The method of any one of paragraphs 39 to 47, wherein the RNAi agent is administered in two or more doses. (Item 49) 34. Use of the RNAi agent of any one of items 1 to 33 for the treatment of a disease, disorder, or condition mediated at least in part by ENaC activity and / or alpha-ENaC gene expression. (Item 50) 39. Use of the composition of any one of items 34 to 38 for the treatment of a disease, disorder, or condition mediated at least in part by ENaC activity and / or alpha-ENaC gene expression. (Item 51) 39. Use of a composition according to any one of items 34 to 38 for the manufacture of a medicament for the treatment of a disease, disorder or condition mediated at least in part by ENaC activity and / or alpha-ENaC gene expression. (Item 52) 52. The use according to any one of items 49 to 51, wherein the disease is cystic fibrosis.
Claims
1. 1. An RNAi agent for inhibiting expression of the alpha-ENaC gene, comprising: Nucleotide sequence (5'→3') UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and an antisense strand comprising: a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; wherein all or substantially all of said nucleotides in said sense strand and said antisense strand are modified nucleotides.
2. 2. The RNAi agent of claim 1, wherein the antisense strand, the sense strand, or both the antisense and sense strands comprise at least one modified internucleoside linkage.
3. 3. The RNAi agent of any one of claims 1 to 2, wherein the modified nucleotides are each independently selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.
4. 4. The RNAi agent of any one of claims 1 to 3, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.
5. The RNAi agent of claim 1 , wherein the sense strand comprises the nucleotide sequence (5′→3′) CCUGUGCAACCAGAACAAAUA (SEQ ID NO: 5).
6. The antisense strand has the following nucleotide sequence (5' to 3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2); or cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine.
7. The sense strand has the following nucleotide sequence (5' to 3'): cscugugcaAfCfCfagaacaaaua (SEQ ID NO: 4) wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.
8. The RNAi agent of any one of claims 1 to 7, wherein the RNAi agent is linked to a targeting ligand.
9. 9. The RNAi agent of any one of claims 1 to 8, wherein the sense strand of the RNAi agent is linked to a targeting ligand.
10. The RNAi agent of any one of claims 8 to 9, wherein the targeting ligand comprises an integrin targeting ligand.
11. The RNAi agent of any one of claims 8 to 9, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
12. The RNAi agent of any one of claims 8 to 9, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells.
13. 13. The RNAi agent of any one of claims 1 to 12, wherein the targeting ligand is conjugated to the sense strand.
14. The RNAi agent of claim 13, wherein the targeting ligand is conjugated to the 5' end of the sense strand.
15. The RNAi agent of any one of claims 1 to 14, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.
16. The RNAi agent of claim 15, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.
17. 17. The RNAi agent of claim 16, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
18. 18. The RNAi agent of claim 17, wherein the RNAi agent has two blunt ends.
19. 19. The RNAi agent of any one of claims 1 to 18, wherein the sense strand comprises a terminal cap.
20. 20. The RNAi agent of any one of claims 1 to 19, wherein the sense strand comprises one or two inverted abasic residues.
21. 2. The RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence cscugugcaAfCfCfagaacaaauas(invAb) (SEQ ID NO: 178), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and (invAb) represents an inverted abasic residue.
22. the antisense strand comprises the nucleotide sequence (5'→3') usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 2), and the sense strand comprises the nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaauas(invAb) (SEQ ID NO: 178); 2. The RNAi agent of claim 1, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and (invAb) represents an inverted abasic residue.
23. the antisense strand comprises the nucleotide sequence (5'→3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), and the sense strand comprises the nucleotide sequence (5'→3') cscugugcaAfCfCfagaacaaauas(invAb) (SEQ ID NO: 178); 2. The RNAi agent of claim 1, wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and (invAb) represents an inverted abasic residue.
24. 24. The RNAi agent of any one of claims 21 to 23, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
25. 25. The RNAi agent of any one of claims 21 to 24, wherein the sense strand of the RNAi agent is linked to an αvβ6 integrin targeting ligand.
26. 26. A composition comprising the RNAi agent of any one of claims 1 to 25, wherein the composition comprises a pharmaceutically acceptable excipient.
27. 27. The composition of claim 26, further comprising a second RNAi agent for inhibiting expression of Alpha-ENaC.
28. 28. The composition of any one of claims 26 to 27, further comprising one or more additional therapeutic agents.
29. 29. The composition of any one of claims 26 to 28, wherein the composition is formulated for administration by inhalation.
30. 30. The composition of any one of claims 26 to 29, wherein the composition is delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.
31. 31. A composition comprising the RNAi agent of any one of claims 1 to 25, or the composition of any one of claims 26 to 30, for use in inhibiting expression of the Alpha-ENaC gene in a cell, said use comprising introducing into a cell an effective amount of the RNAi agent of any one of claims 1 to 25 or the composition of any one of claims 26 to 30.
32. The composition of claim 31 , wherein the cell is in a subject.
33. 33. The composition of claim 32, wherein the subject is a human subject.
34. 34. The composition of any one of claims 31 to 33, wherein expression of the Alpha-ENaC gene is inhibited by at least about 30%.
35. 31. A composition according to any one of claims 26 to 30 for use in treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels, said use comprising administering to a human subject in need thereof a therapeutically effective amount of a composition according to any one of claims 26 to 30.
36. 36. The composition of claim 35, wherein the disease is a respiratory disease.
37. 37. The composition of claim 36, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, a respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.
38. 36. The composition of claim 35, wherein the disease is an ocular disease such as dry eye syndrome.
39. 39. The composition of any one of claims 35-38, wherein the RNAi agent is administered at a dose of about 0.001 mg / kg body weight to about 0.500 mg / kg body weight.