A platform for using iPSC-derived cardiomyocytes carrying gene variants as models of cardiac disease and drug response

JP2025500011A5Pending Publication Date: 2025-11-18SRI INTERNATIONAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024527343
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-11-09
Filing Date
2022-11-09
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Current drug development processes lack suitable model systems to account for interindividual genetic diversity in cardiotoxicity testing, leading to increased costs and withdrawal of drugs due to undesirable side effects, particularly affecting hERG channels.

Method used

Development of a platform using iPSC-derived cardiomyocytes harboring specific genetic variants to study drug toxicity, incorporating prime editing to introduce targeted genetic mutations in genes like KCNH2 (hERG) and other relevant channels, enabling comprehensive cardiotoxicity assays.

Benefits of technology

This approach provides a robust model for predicting drug-induced cardiotoxicity across diverse populations by simulating individual genetic variations, reducing the risk of adverse drug reactions and enhancing drug development efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure is in the field of cardiac disease.For example, the present disclosure provides a new platform that includes iPSC and cardiomyocyte carrying one or more gene mutations, and a model for studying the effect of those gene mutations on cardiomyocyte and on drug toxicity.This platform is herein identified as PREDICT PLATFORM.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present disclosure is in the field of cardiac disease.For example, the present disclosure provides a new platform that includes iPSC and cardiomyocyte carrying one or more gene mutations, and a model for studying the effect of those gene mutations on cardiomyocyte and on drug toxicity.This platform is herein identified as PREDICT PLATFORM. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 277,272, filed November 9, 2021, the contents of which are incorporated by reference herein in their entirety. Reference to Electronically Submitted Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy (November 8, 2022) is SRI 210040 202210-20_SL.xls and is 5,495 kilobytes in size. [Background technology]

[0002] Recent advances in sequencing technologies and genome-wide association studies (GWAS) have identified a wide range of genetic variants as determinants of an individual's response to drug treatment. However, translating these computational findings into clinical applications remains a major hurdle for personalized medicine. Testing for cardiotoxicity is one of the key components of the drug development process. Cardiotoxicity is the leading cause of withdrawal of approved drugs from the market, and the FDA mandates cardiotoxicity assessment in preclinical trials, which significantly increases the cost of drug development. For example, several therapeutic drugs have been withdrawn from the market due to undesirable side effects on the hERG channel that can cause fatal arrhythmias. Although several hERG channel mutations have been identified in clinical settings, the lack of suitable model systems has hindered detailed studies of their role in adverse drug reactions. The KCNH2 gene (hERG) encodes potassium voltage-gated channel subfamily H member 2, a rapid delayed rectifier potassium channel involved in cardiotoxic events (i.e., long QT 2 syndrome). Human variations in KCNH2 are directly linked to long QT syndrome and may explain some individual differences in cardiotoxic responses to drugs. Current hERG assays use monogenic (i.e., derived from one individual) cell lines, a uniform approach that ignores the contribution of inter-individual responses to drugs. Therefore, hERG testing that introduces genetic diversity is needed to better predict the effects of drugs on diverse human populations.

[0003] Comprehensive testing of the impact of genetic variation across populations on adverse drug effects has not been reported to date. Genotype-phenotype maps linking pharmacologically relevant genetic variants to adverse drug reaction phenotypes are needed. These maps can provide an essential framework for prospective preclinical evaluation of drug toxicity and, when combined with companion diagnostics, provide actionable intelligence for physicians to prescribe the most effective medicines while avoiding adverse drug reactions. Summary of the Invention

[0004] In one embodiment, the present disclosure provides a platform comprising a panel of cell lines containing established clinically relevant genetic diversity (and variants of unknown significance) to study the functionality of these cell lines with different drugs. Specifically, cardiotoxicity assays using the disclosed cell lines and platform can detect adverse drug effects due to genetic differences between individuals.

[0005] The cell lines, related methods, and assays provided by the present disclosure include cardiomyocytes derived from genome-edited human induced pluripotent stem cells (iPSCs) carrying specific genetic variations of KCNH2 (hERG) alleles to test potential cardiotoxicity (and other functional effects) for various compounds. Specifically, the methods test whether cardiomyocytes with specific KCNH2 alleles exhibit differential or disease-mimicking functionality compared to common (wild-type) alleles, and whether any of the compounds tested have cardiotoxic or other functionality-altering effects.

[0006] In addition to KCNH2, several genes, such as KCNQ1, SCNA5, KCNE1, and KCNE2, have been shown to be associated with drug-induced cardiotoxicity. The cell lines, methods, and assays disclosed herein can also be applied to these genes. This disclosure provides a method to characterize all polymorphisms in a gene of interest and their potential relationship with cardiac disease and drug-induced cardiotoxicity. The experimental data disclosed establishes proof of concept here for KCNH2 alleles due to their high clinical relevance and the presence of polymorphisms.

[0007] The following embodiments of the present disclosure are merely illustrative: 1. A prime editing guide RNA (pegRNA) designed for prime editing of a target gene hypothesized to have an association with arrhythmia and / or drug-induced toxicity to cardiomyocytes, preferably wherein the cardiomyocytes are derived from induced pluripotent stem cells (iPSCs), and preferably wherein the pegRNA is barcoded. 2. A pegRNA as described in embodiment 1, comprising a spacer sequence and a DNA synthesis template, wherein the spacer sequence comprises a region complementary to a target strand of a double-stranded target gene DNA sequence to be edited, and the DNA synthesis template comprises a region complementary to a non-target strand of the double-stranded target gene DNA sequence and one or more nucleotide edits compared to the target strand double-stranded target gene DNA sequence. 3. A guide RNA (gRNA) core and an extension arm comprising a DNA synthesis template and a primer binding site (PBS), wherein the gRNA core is associated with a nucleic acid programmable DNA binding protein (napDNAbp) fused to a domain comprising a polymerase (preferably an RNA-dependent DNA polymerase) activity; 3. The pegRNA of any one of embodiments 1 and 2, wherein the primer binding site comprises a region of complementarity to the non-target strand of the double-stranded target gene DNA sequence. 4. A pegRNA described in any one of embodiments 1 to 3, wherein the DNA synthesis template is designed to edit a target gene at at least one site. 5. The pegRNA of embodiment 4, wherein the DNA synthesis template introduces random edits into the target gene. 6. The pegRNA of embodiment 4, wherein the DNA synthesis template introduces a preselected edit into the target gene. 7. A pegRNA described in any one of embodiments 1 to 7, wherein the target gene is selected from genes encoding potassium channels or potassium channel-related genes, sodium channels or sodium channel-related genes, calcium channels and calcium channel-related genes, and cardiomyocyte structural genes. 8. The target gene is a potassium channel / related gene selected from human ether-a-go-go related gene (hERG) / KCNH2, hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium (Kir) channel; inward rectifier potassium channel; G protein-coupled, inward rectifier potassium channel; ATP-sensitive potassium channel; a sodium channel / related gene selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; CACNA1C, CACNB2, CACNA2 D1, RYR2, CASQ2, TRDN, CALM1-3; and KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta.4 genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta involved in drug transport.4 The pegRNA according to embodiment 7, selected from other genes selected from ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases involved in drug metabolism (e.g., CBR3), hyaluronan synthase 3 involved in oxidative stress response (e.g., HAS3), hereditary hemochromatosis proteins involved in iron metabolism (e.g., HFE), retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport. 9. The pegRNA of any one of embodiments 1 to 8, wherein the prime editing introduces one or more genetic variations into a gene, and the genetic variations have been previously identified as benign, benign-like, pathogenic, or pathogenic-like with respect to cardiac function. 10. A pegRNA described in any one of embodiments 1 to 6, wherein the drug has not been previously identified as a drug capable of inducing myocardial cell toxicity. 11. The pegRNA of any one of embodiments 1-6, wherein the drug is selected from the list of black box labeled drugs (drugs currently on the market that contain a label indicating that patients with QT prolongation should avoid the use of this drug; including Table 2); ii) drugs that have been withdrawn from the US market due to cardiotoxicity events; iii) drugs that have failed clinical trials due to cardiotoxicity events - (some may be on the market in other countries); iv) drugs associated with cardiotoxicity to specific SNPs described in the literature (e.g., ClinVar; class i and iii antiarrhythmics; cisapride, amiodarone, dofetilide, clarithromycin, hydroxyzine, quinidine and disopyramide); and v) TdP associated drugs (including Table 3). 12. A pegRNA according to any one of embodiments 1 to 11, designed to introduce a mutation into the human KCNH2 gene, wherein the mutation is selected from a SNP, preferably the SNP is selected from the SNPs identified in Table 1 and / or SEQ ID NOs: 2 to 1054. 13. The pegRNA of embodiment 12, wherein the SNP causes a V476I mutation in the KCNH2 protein, as in SEQ ID NO: 105. 14. A pegRNA described in any one of embodiments 1 to 13, encoded by a DNA sequence of any one of SEQ ID NOs: 1100 to 1113. 15. gRNAs designed for regulating expression of target genes by CRISPR interference, wherein the target genes are tested for their role in cardiomyocyte function, proliferation, viability, survival, morphology, expression of markers and receptors, and in vitro "heart beat" (which may model arrhythmias), preferably the target genes are selected from human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channels; transient outward potassium current channels; slowly activating delayed rectifier potassium current channels; rapidly activating delayed rectifier potassium current channels; inward rectifier potassium (Kir) channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; ATP-sensitive potassium channels; sodium channels / related genes selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; Calcium channel / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; and KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta.4 genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta involved in drug transport.4 ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and other genes selected from chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport. 16. The gRNA described in embodiment 15, wherein the gRNA target sequence is selected from SEQ ID NOs: 1116 to 1155 and is described in Table 4. 17. A composition comprising the pegRNA nucleic acid of any one of embodiments 1-14, and optionally comprising a prime editor comprising a nucleic acid programmable DNA binding protein (napDNAbp) fused or linked to a domain comprising polymerase (preferably RNA-dependent DNA polymerase) activity, an sgRNA, an iPSC, and a cardiomyocyte. 18. A composition comprising a library of two or more pegRNA nucleic acids according to any one of embodiments 1-11, wherein all of the pegRNA nucleic acids are designed for prime editing of one or more (cardiomyocyte) genes at one or more multiple sites, and optionally comprising a prime editor comprising a nucleic acid programmable DNA binding protein (napDNAbp) fused or linked to a domain comprising polymerase (preferably RNA-dependent DNA polymerase) activity, sgRNA, iPSCs, and cardiomyocytes. 19. The composition of embodiment 12, wherein each of the pegRNA nucleic acids is designed for prime editing of a single (cardiomyocyte) gene. 20. The composition of any one of embodiments 12 and 13, further comprising one or more negative controls, each comprising a pegRNA that does not introduce any editing into the one or more genes. 21. A composition comprising the gRNA described in embodiment 15, and optionally comprising a nuclease. 22. A cell modified by CRISPR interference with a DNA polynucleotide encoding a gRNA described in embodiment 15. 23. Cells genetically engineered to carry one or more specific mutations in one or more target genes, which are tested for their role in cardiomyocyte function, proliferation, viability, survival, morphology, marker and receptor expression, and in vitro "heart beat" (which may model arrhythmias), preferably iPSCs or cardiomyocytes derived from iPSCs. 24. A cell described in embodiment 23, which is genetically engineered using CRISPR, base editing, or prime editing, preferably prime editing, more preferably a pegRNA described in any one of embodiments 1 to 14. 25. The target gene is a sodium channel / related gene selected from KCNH2 / hERG, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, and Nav.beta.4 genes; other channel-encoding genes, SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, and SCN10A; human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium current channel; Potassium channel / related genes selected from: Kir channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; ATP-sensitive potassium channels; calcium channel / related genes selected from: CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta involved in drug transport.4 The cell according to any one of embodiments 23 and 24, wherein the other genes are selected from ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomeric genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport. 26. The cell of embodiment 25, wherein the mutation replicates one or more SNPs listed in Table 1, SEQ ID NO: 2 to 1054, preferably SEQ ID NO: 105. 27. A cell described in any one of embodiments 23 to 26, carrying a V476I mutation in the KCNH2 gene. 28. A cell described in any one of embodiments 23 to 27, wherein the mutation is known to be associated with heart disease or is being tested to be associated with heart disease. 29. The cells of embodiment 28, wherein the cardiac disease is arrhythmia, hypertrophic cardiomyopathy, sudden death of unknown cause, obesity-related cardiac disease, primary dilated cardiomyopathy, primary familial hypertrophic cardiomyopathy, or stroke, preferably arrhythmia selected from long QT syndrome (including congenital long QT syndrome, long QT syndrome type 2, and bradycardia-induced long QT syndrome), Brugada syndrome, short QT syndrome type 1, sudden infant death syndrome, acquired long QT syndrome, ventricular tachycardia, Wolff-Parkinson-White pattern arrhythmia, arrhythmogenic right ventricular cardiomyopathy, atrial fibrillation, catecholaminergic polymorphic ventricular tachycardia type 1, prolonged QT interval, paroxysmal familial ventricular fibrillation type 1, sudden cardiac arrest / death, and torsades de pointes. 30. A cell described in any one of embodiments 23 to 29, which expresses an mRNA having a sequence comprising SEQ ID NO: 2 to 1054 in Table 1, preferably SEQ ID NO: 105. 31. A composition comprising a library of two or more iPS cells and / or cardiomyocytes, wherein each iPS cell / cardiomyocyte has been modified to contain one or more pegRNA molecules described in any one of embodiments 1-11, or is a cell described in any one of embodiments 23-30. 32. The composition of embodiment 31, further comprising iPS cells and / or cardiomyocytes that have not been exposed to pegRNA, and / or iPS cells that have been exposed to one or more pegRNAs that do not edit one or more genes. 33. A method for identifying a target gene or gene mutation associated with or causing cardiotoxicity, comprising: (i) obtaining one or more iPSC-derived cardiomyocytes carrying one or more (e.g., libraries) of wild-type and targeted gene editing mutations in one or more (cardiomyocyte) genes; or Obtaining one or more iPSC-derived cardiomyocytes having altered expression of one or more target genes; and (ii) identifying the target gene or gene mutation and / or altered gene expression level as associated with or causing cardiotoxicity if the mutation and / or gene expression level has a negative effect on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, or "heart beat" in vitro (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells. 34. A method for identifying a target gene mutation as a mutation associated with drug-induced cardiotoxicity, comprising: (i) obtaining one or more iPSC-derived cardiomyocytes carrying one or more (e.g., a library) wild-type and targeted gene editing mutations in one or more (cardiomyocyte) genes; or Obtaining one or more iPSC-derived cardiomyocytes having altered expression of one or more genes; and (ii) exposing cardiomyocytes to a drug; (ii) A method comprising exposing cardiomyocytes harboring the mutation and / or altered gene expression levels to a drug, and identifying a target gene or gene mutation as associated with drug-induced cardiotoxicity if the target gene or gene mutation has a negative effect on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, or in vitro "heart rate" (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells exposed to the drug and cells not exposed to the drug. 35. A method for assessing whether a drug is cardiotoxic in a wild-type subject, comprising: (i) obtaining wild-type cardiomyocytes derived from one or more iPSCs; (ii) exposing the cardiomyocytes to a drug; and (ii) A method comprising exposing wild-type cardiomyocytes to a drug and identifying the drug as being cardiotoxic to the wild-type subject if the drug has a negative effect on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, or in vitro "heart beat" (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cardiomyocytes not exposed to the drug. 36. A method for identifying a drug as causing cardiotoxicity in a subject due to the presence of a target gene mutation and / or due to altered expression of the gene, comprising: (i) obtaining one or more iPSC-derived cardiomyocytes carrying one or more (e.g., a library) of wild-type and targeted gene editing mutations in a target gene; or Obtaining one or more iPSC-derived cardiomyocytes having altered expression of one or more target genes; and (ii) exposing cardiomyocytes to a drug; (iii) identifying the drug as causing cardiotoxicity due to the presence of the target gene mutation and / or due to altered target gene expression, when cardiomyocytes harboring the mutation or altered target gene expression show signs of cardiotoxicity in response to exposure to the drug in a cardiotoxicity assay, but not wild-type cardiomyocytes; signs of cardiotoxicity include negative effects on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, or in vitro "heart beat" (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells not exposed to the drug, and wherein sequencing of the gene or portion of the gene to determine the identity of the mutation is performed before or after the cardiotoxicity assay. 37. The method of any one of embodiments 33 to 36, wherein the mutation is introduced into the target gene by gene editing (including CRISPR, base editing, and prime editing). 38. The method of embodiment 37, wherein a mutation is introduced into the target gene by prime editing, preferably using any one of the pegRNAs described in any one of embodiments 1 to 14, and / or target gene expression is altered by CRISPR interference, preferably using a gRNA described in any one of embodiments 15 and 16. 39. At least one of the target genes to be edited or whose expression is altered is selected from KCNH2 / hERG, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, and Nav.beta.4 genes; other channel-encoding genes, sodium channel / related genes selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channels; inward rectifier potassium (Kir) channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; potassium channels / related genes selected from ATP-sensitive potassium channels; calcium channels / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta involved in drug transport.4 The method according to any one of embodiments 33 to 38, wherein the other genes are selected from ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport. 40. The method of embodiment 39, wherein the target gene is the KCNH2 / hERG gene. 41. The method of embodiment 40, wherein the mutation is selected from the SNPs of Table 1 and SEQ ID NOs: 2 to 1054, preferably V476I, preferably SEQ ID NO: 105. 42. A method for identifying a subject in need of treatment with a drug as being susceptible to said drug-induced cardiotoxicity, comprising testing a DNA sample from the subject (e.g., taken from a tissue containing cardiomyocytes and / or from cardiomyocytes derived from iPSCs isolated from the subject) for the presence of one or more target gene mutations or alterations in expression levels identified as being associated with said drug-induced cardiotoxicity by the method described in any one of embodiments 33 to 41, and optionally comprising selecting a drug for treating the subject that is different from the drug that induces cardiotoxicity. 43. The method of embodiment 42, wherein the subject is identified as suffering from or susceptible to arrhythmias selected from arrhythmias, hypertrophic cardiomyopathy, sudden death of unknown cause, obesity-related cardiac disease, primary dilated cardiomyopathy, primary familial hypertrophic cardiomyopathy, or stroke, preferably Long QT syndrome (including congenital long QT syndrome, long QT syndrome type 2, and bradycardia-induced long QT syndrome), Brugada syndrome, short QT syndrome type 1, sudden infant death syndrome, acquired long QT syndrome, ventricular tachycardia, Wolff-Parkinson-White pattern arrhythmias, arrhythmogenic right ventricular cardiomyopathy, atrial fibrillation, catecholaminergic polymorphic ventricular tachycardia type 1, prolonged QT interval, paroxysmal familial ventricular fibrillation type 1, sudden cardiac arrest / death, and torsades de pointes, if the subject carries one or more genetic mutations. 44. The cell according to any one of embodiments 22 to 30 or the method according to any one of embodiments 33 to 41, wherein the iPSCs are prepared from any somatic cell, including skin-derived fibroblasts and peripheral blood mononuclear cells, and are reprogrammed by any integrative (i.e. lentivirus) or episomal (i.e. plasmid, Sendai virus) vector, or by direct regulation of gene expression via RNAi or CRISPRi / a, including transcription factors including OCT4, SOX2, KLF4 and MYC, or any combination of transcription factors delivered via RNA (mRNA or miRNA), or combinations of small molecules and growth factors. 45. The method of any one of embodiments 33 to 41, wherein cardiomyocytes are derived from iPSCs by in vitro differentiation using a combination of small molecules and / or growth factors, and a combination of nucleic acids (including RNA, miRNA, siRNA), including modulation of the Wnt pathway to select for a highly purified population of cardiomyocytes, followed by glucose starvation. 46. ​​The method of any one of embodiments 33 to 41, wherein the signs of cardiotoxicity include changes in cardiomyocyte function, cell viability, survival, morphology, expression of specific markers and receptors, and heart rate in vitro, and these signs are preferably measured using model arrhythmias, patch clamp techniques, external recording techniques, voltage-sensitive dyes, or intracellular ion-sensitive dyes. 47. A method of prime editing an iPS cell or an iPSC-derived cardiomyocyte, comprising contacting double-stranded target DNA of the cell with a pegRNA designed to edit a target gene (e.g., a cardiomyocyte), preferably a pegRNA described in any one of embodiments 1-14, and a prime editor, optionally an sgRNA, preferably wherein the prime editor comprises a nucleic acid programmable DNA binding protein (napDNAbp) fused to a domain comprising polymerase (preferably RNA-dependent DNA polymerase) activity, and wherein the prime contact edits the cell by installing one or more nucleotide edits in the double-stranded target DNA, thereby editing the double-stranded target DNA. 48. The method of embodiment 47, wherein a nucleic acid encoding a napDNAbp fused to a domain containing pegRNA and / or RNA-dependent DNA polymerase activity is introduced into iPSC or IPSC-derived cardiomyocytes by transfection, viral transduction (lentivirus, AAV, etc.), nanoparticles, or nucleofection. 49. The method of any one of embodiments 47 and 48, wherein napDNAbp is selected from the group consisting of Casl9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, Casl2b2, Casl3a, Casl2c, Casl2d, Casl2e, Casl2h, Casl2i, Casl2g, Casl2f (Casl4), Casl2fl, Casl2j (Casi), and Argonaute, and may have nickase activity. 50. The method of any one of embodiments 47 to 49, wherein napDNAbp is a nuclease-active Cas9 domain, a nuclease-inactive Cas9 domain, or a Cas9 nickase domain or a variant thereof. 51. The method of any one of embodiments 47 to 50, wherein the RNA-dependent DNA polymerase is a reverse transcriptase, preferably selected from Moloney murine leukemia virus reverse transcriptase (MMLV-RT), and MMLV-RT may contain one or more amino acid substitutions selected from D200N, T306K, W313F, T330P, and L603W compared to wild-type MMLV-RT. 52. The method of any one of embodiments 29 to 46, wherein the pegRNA and / or gRNA are designed by PrimeDesign or other commercially or publicly available methods known to those skilled in the art. 53. A polynucleotide comprising a DNA sequence encoding a pegRNA described in any one of embodiments 1 to 14, or a gRNA described in any one of embodiments 15 and 16, preferably a sequence of SEQ ID NOs: 1116 to 1134, or a DNA sequence encoding a pegRNA encoded thereby. 54. A vector comprising the polynucleotide described in embodiment 53, wherein expression of the pegRNA or gRNA may be under the control of a promoter. 55. The method according to any one of embodiments 33 to 52, wherein iPSCs or iPSC-derived cardiomyocytes are cultured and / or tested in multi-well (e.g. 96-well) plates. 56. The method of embodiment 55, wherein each well contains one cell or its progeny. 57. The method of any one of embodiments 55 or 56, wherein each cell contains only one type of pegRNA or a nucleic acid encoding a pegRNA, and preferably the cells are sorted through a barcode in each pegRNA and / or the pegRNA is sorted into each well prior to introduction into the cells. 58. The method of any one of embodiments 33 to 41, 45, and 46, wherein the drug is a drug hypothesized to cause arrhythmia. 59. The method of any one of embodiments 33-41, 45, 46, 55-58, wherein the drug is selected from the list of black box labeled drugs (currently marketed drugs that contain a label indicating that patients with QT prolongation should avoid the use of this drug; including Table 2), ii) drugs that have been withdrawn from the US market due to a cardiotoxicity event, iii) drugs that have failed clinical trials due to a cardiotoxicity event - (some may be marketed in other countries), iv) drugs associated with cardiotoxicity for specific SNPs described in the literature (e.g., ClinVar; antiarrhythmic drugs, classes i and iii; cisapride, amiodarone, dofetilide, clarithromycin, hydroxyzine, quinidine, and disopyramide), and v) TdP associated drugs (including Table 3). 60. A method of treating arrhythmia in a subject and / or preventing arrhythmia in a subject, wherein the subject is identified by the method of embodiment 42 or 43 as carrying a variant mutation, and the treatment comprises genome editing of at least a portion of the genome of the subject's cardiomyocytes to edit the variant mutation and / or alter expression of a target gene. 61. An array of cell culture wells or vessels each comprising at least one iPSC or iPSC-derived cardiomyocyte and at least one component of a gene editing system and / or gene expression modification system, wherein the gene editing system is designed to introduce one or more gene edits per iPSC / cardiomyocyte into at least one target gene, and the gene expression modification system is designed to modify expression of at least one target gene, and wherein the target gene edits and / or altered expression levels are hypothesized to cause cardiotoxicity or drug-induced cardiotoxicity when introduced or present in the genome of the cardiomyocyte. 62. The array described in embodiment 61, comprising a multi-well tissue culture plate. 63. The array of embodiment 61, wherein each well or container holds only cells that contain a single gene edit or a single level of altered gene expression. 64. An array described in any one of embodiments 62 and 63, further comprising one or more elements of an in vitro cardiotoxicity assay. 65. An array described in any one of embodiments 61 to 64, wherein the gene editing or gene expression modification system comprises one or more pegRNAs described in any one of embodiments 1 to 14, one or more gRNAs described in any one of embodiments 15 and 16, and / or any composition described in any one of embodiments 17 to 21. 66. The method, pegRNA, gRNA, polynucleotide, vector, and cell according to any one of embodiments 1 to 66, wherein the coding DNA sequence encoding the pegRNA comprises any one of SEQ ID NOs: 1100 to 1113 and / or the coding sequence encoding the gRNA comprises any one of SEQ ID NOs: 1116 to 1134 (or if the target is any one of SEQ ID NOs: 1055 to 1073), and the DNA coding sequence of the mRNA / SNP comprises any one of SEQ ID NOs: 2 to 1054.

[0008] The patent or patent application file contains at least one drawing of color. Copies of this patent or patent application publication with color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0009] [Figure 1A] Figure 1A: SNPs selected for prime editing into hiPSCs. The structure of the hERG channel and how the V476I SNP alters its structure. [Figure 1B] FIG. 1B: Structure of the hERG channel and modeling of the V476I mutant. [Diagram 2] Sequencing of plasmids containing prime editing gRNA sequences. [Diagram 3] Plasmid DNA electroporation efficiency into hiPSCs using GenePulser. [Figure 4] Efficiency of cardiomyocyte differentiation using different Wnt activator concentrations and several starting cell densities in 6-well plates, and effect of enrichment protocols on cardiomyocyte population purity. [Diagram 5]Expression of cardiac troponin T (cTnT) in iPSC-CMs. Nuclei and cytoplasm were stained with the whole cell stain CellMask Blue. [Figure 6] Basal beating of iPSC-derived cardiomyocytes. [Figure 7] Characterization of drug responses in wild-type and V476I mutant cardiomyocytes. hiPSC-CMs were treated with a fluorescent calcium-sensing probe for 2 h before adding drugs. Cells were then incubated with drugs for 1.5–2 h. Fluctuations in fluorescence were measured for 30 s using a plate reader (SpectraMax). Images were analyzed using PeakPro to generate peak frequencies, a surrogate for beats per minute. Both wild-type and V476I mutants showed the expected responses to proarrhythmic drugs, demonstrating the functional responsiveness of this cell model. [Figure 8] Optimization of the CRISPR interference system for gene expression control. SHSY5Y cells expressing high levels of KCNH2 were transduced with lentivirus carrying Sp dCas9-KRAB-rTTA and selected with antibiotics. The selected population was transduced with lentivirus carrying sgRNAs against different (positive control) genes, POLR2D or SF3B1, and again subjected to antibiotic selection to generate cell lines carrying the complete CRISPRi system. After selection, cells were treated with doxycycline for 72 hours to activate expression of the Sp dCas9-KRAB construct, leading to gene silencing. Relative gene expression was measured by qPCR using TaqMan probes. Grey bars indicate qPCR for SF3B1 and blue bars indicate qPCR for POLR2D. Significant silencing of relative gene expression was observed in wells treated with doxycycline, indicating an active CRISPRi system against the positive control gene. [Figure 9] Reproduction of arrhythmias induced by cardiotoxic drugs in an in vitro system. [Figure 10] The B3 clone shows a disruption of normal rhythm. [Figure 11] B3 clone hypersensitive to arrhythmogenic compounds. [Figure 12]B3 clone non-responsive to antiarrhythmic compounds. [Figure 13] Exemplary pegRNA library designs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] definition In order that this disclosure may be more readily understood, certain terms are first defined below. Additional definitions for the following terms, as well as other terms, are provided throughout the specification.

[0011] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0012] As used herein, unless otherwise stated or clear from the context, the term "or" is understood to be inclusive, including both "or" and "and." The term "and / or" as used herein is deemed to specifically disclose each of the two specified features or components with or without the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0013] As used herein, the terms "for example" and "i.e." are used merely as examples without any intended limitation and should not be construed as referring only to the items explicitly listed herein. Terms such as "or more," "at least," and "more than," for example, "at least one" means at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 110, 111, 112, 113, 114, 115, 116, 1 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 1 06, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 1 This is understood to include, but is not limited to, 39, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than the stated value, and any larger number or fraction therebetween.

[0014] Conversely, the term "less than" includes every value less than the recited value. For example, "100 nucleotides or less" includes 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 55, 56, 57, 58 ...8, 58, 58 , 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, and 0 nucleotides. Also included are any smaller numbers or fractions in between.

[0015] Terms such as "multiple," "at least two," "two or more," and "at least a second" mean at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty-nine, twenty-nine, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty-nine, twenty-nine, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty-nine, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-six ... 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 1 06, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 1 This is understood to include, but is not limited to, 39, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more, and any higher number or fraction therebetween.

[0016] Throughout this specification, the word "comprising" or variations such as "comprises" or "comprising" are understood to mean the inclusion of the stated elements, integers or steps, or group of elements, integers or steps, but not the exclusion of any other elements, integers or steps, or group of elements, integers or steps. When an embodiment is described herein with the phrase "comprising", it is understood that other similar embodiments described with the phrase "consisting of" and / or "consisting essentially of" are also provided. The term "consisting of" excludes any element, step, or ingredient not specified in the claim. Gray, 53 F.2d 520, 11 USPQ 255 (CCPA 1931); Davis, 80 USPQ 448, 450 (Bd.App.1948) ("consisting of" is defined as "including materials other than those claimed, except for impurities ordinarily accompanying them"). The term "consisting essentially of" limits the scope of a claim to specified materials or steps that "do not materially affect the basic and novel characteristics" of the claimed invention.

[0017] As used herein, unless specifically stated or clear from the context, the term "about" refers to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which depends in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, "about" or "approximately" may mean within one standard deviation or more than one standard deviation, according to the practice in the art. "About" or "approximately" may mean a range of up to 10% (i.e., ±10%). Thus, "about" may be understood to be within a range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, or 0.001% greater or less than the stated value. For example, about 5 mg may include any amount between 4.5 mg and 5.5 mg. Additionally, particularly with respect to biological systems or processes, the term may mean up to an order of magnitude or up to 5 times the value. When a particular value or composition is provided in this disclosure, unless otherwise specified, the meaning of "about" or "approximately" should be assumed to be within an acceptable error range for that particular value or composition.

[0018] As described herein, any concentration range, percentage range, ratio range, or integer range should be understood to include any integer value within the stated range, and fractions thereof, where appropriate (such as tenths and hundredths of integers), unless otherwise indicated.

[0019] Units, prefixes, and symbols used herein are provided using the format accepted by the International System of Units (SI). Numeric ranges are inclusive of the numbers defining the range.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains. For example, Juo, "The Concise Dictionary of Biomedicine and Molecular Biology", 2nd ed., (2001), CRC Press; "The Dictionary of Cell & Molecular Biology", 5th ed., (2013), Academic Press; and "The Oxford Dictionary Of Biochemistry And Molecular Biology", Cammack et al. eds., 2nd ed, (2006), Oxford University Press provide those skilled in the art with a general dictionary of many of the terms used in this disclosure.

[0021] The terms "transduction" and "transduced" refer to the process by which foreign DNA is introduced into a cell via a viral vector (see Jones et al., "Genetics: principles and analysis", Boston: Jones & Bartlett Publ. (1998)). In some embodiments, the vector is a retroviral vector, a DNA vector, an RNA vector, an adenoviral vector, a baculoviral vector, an Epstein-Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adenovirus-associated vector, a lentiviral vector, or any combination thereof. A "therapeutically effective amount," "effective dose," "effective amount," or "therapeutically effective dosage" of a therapeutic agent, such as an engineered CAR T cell, a small molecule, or an "agent" as described herein, when used alone or in combination with another therapeutic agent, is any amount that protects a subject from developing a disease or promotes regression of the disease as evidenced by a decrease in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or prevention of functional impairment or disability due to disease morbidity. Such terms can be used interchangeably. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to those of skill in the art, such as by assaying the activity of the agent in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or in in vitro assays. Therapeutically effective amounts and dosing regimens can be empirically determined by testing in known in vitro or in vivo (e.g., animal model) systems.

[0022] The term "combination" refers to either a fixed combination in one dosage unit form, or a combined administration in which the compound of the present invention and a combination partner (e.g., another drug as described below, also referred to as a "therapeutic agent" or "drug") can be administered simultaneously or separately within a time interval, especially if these time intervals allow the combination partners to exhibit a cooperative, e.g., synergistic, effect. The single components may be packaged in one kit or packaged separately. One or both of the components (e.g., powder or liquid) can be reconstituted or diluted to the desired dose before administration. Terms such as "co-administration" or "combined administration" as used herein are meant to encompass administration of the selected combination partners to a single subject (e.g., patient) in need thereof, and are intended to include therapeutic regimens in which the agents are not necessarily administered by the same route of administration or at the same time. The term "genetically engineered" or "engineered" refers to methods of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or portion thereof, or inserting a coding region or portion thereof.

[0023] As used herein, the term "homology", "homology" or "percent homology" refers to the degree of sequence identity between an amino acid sequence or a polynucleotide sequence and a corresponding reference sequence. "Homology" can refer to a polymer sequence, such as a similar polypeptide sequence or DNA sequence. Homology can refer to, for example, a nucleic acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity. In other embodiments, a "homologous sequence" of a nucleic acid sequence can exhibit 93%, 95%, or 98% sequence identity to a reference nucleic acid sequence. For example, a "region of homology to a genomic region" can be a region of DNA that has a similar sequence to a given genomic region in a genome. A region of homology can be of any length sufficient to facilitate binding of a spacer or protospacer sequence to a genomic region. For example, a region of homology can be at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3 The homology may comprise 0, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, or more bases in length, such that the region of homology has sufficient homology to bind to the corresponding genomic region. When a percentage of sequence homology or identity is specified, in the context of two nucleic acid sequences or two polypeptide sequences, the percentage of homology or identity generally refers to the alignment of two or more sequences over a portion of their length when the two or more sequences are compared and aligned for maximum correspondence. If a position in the compared sequences can be occupied by the same base or amino acid, then the molecules can be homologous at that position.Unless otherwise specified, sequence homology or identity is evaluated over a specified length of a nucleic acid, polypeptide, or portion thereof. In some embodiments, homology or identity is evaluated over a specific portion of a functional portion or length. Alignment of sequences for evaluating sequence homology can be performed by algorithms known in the art, for example, the Basic Local Alignment Search Tool (BLAST) algorithm described in Altschul et al., J. Mol. Biol. 215:403- 410, 1990. Publicly available internet interfaces for performing BLAST analyses can be accessed through the National Center for Biotechnology Information. Other known algorithms include those by Smith & Waterman, "Comparison of Biosequences", Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, "A general method applicable to the search for the similarities in the amino acid sequence of two proteins" J. Mol. Biol. 48:443, 1970; Pearson & Lipman "Improved tools for biological sequence comparison", Proc. Natl. Acad. Sci. USA 85:2444, 1988; or automated implementations of these or similar algorithms. Global alignment programs can also be used to align similar sequences of approximately equal size.Examples of global alignment programs include NEEDLE, part of the EMBOSS package (available at www.ebi.ac.uk / Tools / psa / emboss_needle / ) (Rice P et al., Trends Genet., 2000; 16: 276-277), and the GGSEARCH program, part of the FASTA package fasta.bioch.virginia.edu / fasta_www2 / (Pearson W and Lipman D, 1988, Proc. Natl. Acad. Sci. USA, 85: 2444-2448). Both of these programs are based on the Needleman-Wunsch algorithm and are used to find the optimal alignment (including gaps) over the entire length of two sequences. A detailed discussion of sequence analysis can also be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998).

[0195] Those skilled in the art will understand that amino acid (or nucleotide) positions can be determined in homologous sequences based on alignment.

[0024] As used herein, a "patient" or "subject" includes any human suffering from a cardiac disease or disorder. The terms "subject" and "patient" are used interchangeably herein. As used herein, the term "in vitro cells" refers to any cells cultured ex vivo. In particular, in vitro cells can include T cells. The term "in vivo" means within a patient. The terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide contains at least two amino acids, with no limit on the maximum number of amino acids that may make up the sequence of a protein or peptide. A polypeptide includes any peptide or protein that contains two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains of which there are many varieties, commonly referred to in the art as proteins. "Polypeptides" include, inter alia, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins. A polypeptide includes natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0025] The term "prime editor (PE)" or "prime editor" refers to compositions involved in the genome editing methods using targeted primed reverse transcription (TPRT) described herein, including, but not limited to, napDNAbp, reverse transcriptase, a fusion protein (e.g., comprising napDNAbp and reverse transcriptase), a prime editor guide RNA, and a complex comprising the fusion protein and the prime editor guide RNA, as well as accessory elements such as a second strand nicking component and a 5' endogenous DNA flap removal endonuclease to help drive the prime editing process towards the formation of an edited product.

[0026] Prime editing is also sometimes described as "target primed reverse transcription" (TPRT) because a target DNA molecule is used to prime the synthesis of a DNA strand by a polymerase (e.g., reverse transcriptase). The use of the term "reverse transcription" in the name "target primed reverse transcription" is not intended to limit prime editing to the use of reverse transcriptase, rather TPRT or prime editor can include any polymerase (e.g., DNA-dependent DNA polymerase or RNA-dependent DNA polymerase). In various embodiments, prime editing operates by contacting a target DNA molecule (where a nucleotide sequence change is desired to be introduced) with a nucleic acid programmable DNA binding protein (napDNAbp) complexed with a prime editor guide RNA.

[0027] As used herein, the term "DNA synthesis template" refers to a region or portion of the extension arm of a PEgRNA that is utilized as a template strand by the polymerase of a prime editor to encode a 3' single-stranded DNA flap containing the desired edit, which then displaces the corresponding endogenous DNA strand at the target site by the mechanism of prime editing. The extension arm that comprises the DNA synthesis template can be composed of DNA or RNA. In the case of RNA, the polymerase of the prime editor can be an RNA-dependent DNA polymerase (e.g., reverse transcriptase). In the case of DNA, the polymerase of the prime editor can be a DNA-dependent DNA polymerase. In some embodiments, the DNA synthesis template is a single-stranded portion of a PEgRNA that is 5' of the PBS, includes a region of complementarity with the PAM strand (i.e., the non-target strand or the edited strand), and includes one or more nucleotide edits compared to the endogenous sequence of the double-stranded target DNA. In some embodiments, the DNA synthesis template is complementary or substantially complementary to a sequence on the non-target strand downstream of the nick site, except for one or more non-complementary nucleotides at the intended nucleotide editing position. In some embodiments, the DNA synthesis template is complementary or substantially complementary to a sequence on the non-target strand immediately downstream (i.e., directly downstream) of the nick site, except for one or more non-complementary nucleotides at the intended nucleotide editing position. In some embodiments, the one or more non-complementary nucleotides at the intended nucleotide editing position are immediately downstream of the nick site. In some embodiments, the DNA synthesis template comprises one or more nucleotide edits to the double-stranded target DNA sequence. In some embodiments, the DNA synthesis template comprises one or more nucleotide edits to the non-target strand of the double-stranded target DNA sequence. For each PEgRNA described herein, the nick site is characteristic of the particular napDNAbp with which the gRNA core of the PEgRNA associates, and is characteristic of the particular PAM required for napDNAbp recognition and function.For example, in the case of a PEgRNA comprising a gRNA core associated with SpCas9, the nick site is at the phosphodiester bond between base 3 (position "-3" relative to position 1 of the PAM sequence) and base 4 (position "-4" relative to position 1 of the PAM sequence). In some embodiments, the DNA synthesis template and the primer binding site are immediately adjacent to each other. The terms "nucleotide edit", "nucleotide change", "desired nucleotide change", and "desired nucleotide edit" are used interchangeably and refer to a specific nucleotide edit, such as a specific deletion of one or more nucleotides, a specific insertion of one or more nucleotides, a specific substitution (or substitutions) of one or more nucleotides, or a combination thereof, at a specific position of the DNA synthesis template of the PEgRNA to be incorporated into the target DNA sequence. In some embodiments, the DNA synthesis template comprises two or more nucleotide edits to the double-stranded target DNA sequence. In such an embodiment, each nucleotide edit is a specific nucleotide edit at a specific position in the DNA synthesis template, each nucleotide edit is at a specific position that is different relative to any of the other nucleotide edits in the DNA synthesis template, and each nucleotide edit is independently selected from a specific deletion of one or more nucleotides, a specific insertion of one or more nucleotides, a specific substitution (or substitutions) of one or more nucleotides, or a combination thereof. The nucleotide edit may refer to an edit on the DNA synthesis template compared to a sequence on the target strand of the target gene, or the nucleotide edit may refer to an edit encoded by the DNA synthesis template on a newly synthesized single-stranded DNA that replaces an endogenous target DNA sequence on a non-target strand.

[0028] In one embodiment, the "spacer" sequence is a sequence (having a length of about 20 nts) in the guide RNA or PEgRNA that binds to a protospacer in the target DNA. In one embodiment, the "gRNA core" (or gRNA scaffold or backbone sequence) refers to the sequence in the gRNA that is responsible for napDNAbp binding (e.g., Cas9), and does not include the 20 bp spacer / target sequence used to guide Cas9 to the target DNA. In some embodiments, the gRNA core or scaffold comprises a sequence that includes one or more nucleotide changes compared to a naturally occurring CRISPR-Cas guide RNA scaffold, e.g., a Cas9 guide RNA scaffold. In some embodiments, the sequence of the gRNA core is designed to include minimal or no sequence homology with the endogenous sequence of the target nucleic acid at the target site, thereby reducing unintended editing. In some embodiments, the gRNA core comprises minimal sequence homology to the sequence of the target site, where the gRNA core may comprise no more than 1%, 5%, 10%, 15%, 20%, 25%, or 30% sequence homology to the sequence of the double-stranded target DNA flanking 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides upstream or downstream of the position(s) of nucleotide edit.

[0029] A DNA "barcode" is a unique sequence of nucleotides that can be incorporated into a pegRNA expression vector to identify a pegRNA in a complex mixture, such as in the context of a pooled library of pegRNAs. Barcodes can be inserted into a pegRNA expression vector by restriction fragment cloning of small oligonucleotides containing a unique 8-bp DNA sequence that differs from other sequences by at least 2 bases, flanked by restriction sites compatible with the acceptor expression vector. The pegRNA can be identified by sequencing the expression cassette. Another method is to insert a U6-pegRNA expression cassette downstream of a polymerase II promoter (CMV, EFla, UBC, etc.) and upstream of a polyA sequence. This flanking of the U6-pegRNA expression cassette in a lentiviral expression vector allows the pegRNA to be expressed from a Pol II promoter and each pegRNA can be identified by RNA sequencing using standard polyA capture. In some embodiments, the pegRNA is its own barcode.

[0030] Gene editing methods The genome of the cells of the present disclosure may be edited by any method known to those skilled in the art. In one embodiment, the cells are edited with zinc finger nucleases. In one embodiment, the cells are edited with transcription activator-like effector nucleases (TALENs). In one embodiment, the cells are edited with homing nucleases. In one embodiment, the cells are edited with clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems. In one embodiment, the cells are edited with CRISPR-Cas9 systems. In one embodiment, the cells are edited with base editing. In one embodiment, the cells are edited with prime editing. Components of each of these systems are well known in the art.

[0031] In some embodiments, the expression of one or more target genes is altered in cells, and the effect of altering gene expression on the resulting cells (e.g., cardiotoxicity) is evaluated. In some embodiments, the expression level is altered by CRISPR interference. CRISPR / Cas9-mediated transcriptional interference (CRISPRi) allows programmable gene knockdown, resulting in a loss-of-function phenotype for almost all genes. Genes can be analyzed with CRISPRi, and knockdown can be activated and deactivated by conditional expression of dCas9 fusion proteins or guide RNAs. In some embodiments, expression of one or more genes is completely blocked. In other embodiments, expression of one or more genes is altered at various rates. In some embodiments, gene expression can be altered by Cas9:gRNA complexes, dCas9-SAM system, or dCas9-KRAB system.

[0032] Genetic manipulation of precursor stem cells In some embodiments, the present disclosure provides that specific genetic mutations (e.g., SNPs) engineered into iPSCs by gene editing can generate iPSC-derived cardiomyocytes that can be used as models for cardiac disease. In some embodiments, the mutations represent known SNPs with known and unknown clinical significance. In some embodiments, the mutations are not SNPs. In some embodiments, the mutations are introduced via prime editing (PE), which is described in more detail herein.

[0033] KCNH2 mutations The present disclosure provides that KCNH2 encodes a voltage-gated transmembrane potassium channel called hERG (ether-a-go-go). hERG is primarily expressed on the surface of cardiomyocytes, where it controls the efflux of ok K+ ions during the rectification phase of the action potential. When hERG is blocked, the return of the membrane potential to its normal value is delayed, which leads to proarrhythmic events. V476I (rsl99472908) is a mutation in the transmembrane domain of the hERG channel. Thus, in one embodiment, the present disclosure provides genetically engineered iPSCs carrying the mutation V476I, and cardiomyocytes derived therefrom. In some embodiments, the mutation is introduced via genetic engineering using CRISPR or a CRISPR-like system. In some embodiments, the mutation is introduced via any other means of recombinantly altering one or more nucleobases in a gene. In some embodiments, the genetic modification is introduced via prime editing. In some embodiments, the present disclosure provides a prime edit (pegRNA) designed to introduce such a mutation into a cell.

[0034] In some embodiments, the mutation is selected from a collection of over 2,347 kcnh-2 SNPs from ClinVar. In some embodiments, the mutation is a SNP listed in SEQ ID NOs: 1-1054 and Table 1. It should be noted that due to the large number of mRNA sequences available, the exact sequences are included only in the sequence listing that is part of this invention and disclosure. In the database, the SNPs are classified according to their sequence location (e.g., promoter, exon, intron, UTR, etc.) and type (e.g., missense mutation, nonsense mutation, insertion, deletion, etc.). ClinVar provides a list of attributes including the clinical significance of each kcnh-2 SNP (e.g., pathogenic, unspecified significance, not provided, etc.) and a ranking based on review status. Review status provides a confidence score, i.e., how well supported the clinical attribute is based on number of submissions, review by expert panels, etc. In one embodiment, the inventors have curated a subset of 700 nonsense mutations (SNPs that code for changes to protein coding sequences) for use according to the methods of the invention. In some embodiments, the results may then be validated with a biophysical model for machine learning prediction. In some embodiments, the results are validated according to the methods of the present disclosure.

[0035] In some embodiments, the mutation is predicted to be clinically pathogenic. In some embodiments, the mutation is predicted to be likely to be clinically pathogenic. In some embodiments, there is conflicting clinical evidence for a particular mutation. In some embodiments, the mutation is clinically benign. In some embodiments, the mutation is clinically unclassified. See, e.g., Table 1 and FIG. 13.

[0036] Other mutations The present disclosure also provides genetic modification of iPSCs and / or cardiomyocytes in other target genes.Thus, in some embodiments, the present disclosure provides genetically engineered iPSCs and cardiomyocytes derived therefrom, and pegRNA for introducing and carrying mutations in any target gene.In some embodiments, the target gene is known to modify the activity, proliferation and growth of cardiomyocytes.In some embodiments, the target gene is not known to modify the activity, proliferation and growth of cardiomyocytes, but can be identified as such by the method of the present disclosure. In some embodiments, target genes include genes encoding KCNQ1, SCNA5, KCNE1, KCNE2, and other channels, ATP-binding cassette (ABC) transporters involved in drug transport (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP in splicing of sarcomere genes. Elav-like family member 4 (e.g., CELF4), DNA polymerase gamma in mitochondrial replication (e.g., DPOG2), and chaperones involved in ion channel trafficking (e.g., Hsp70 and Hsp90). In other embodiments, the target gene may be selected from human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium (Kir) channel; inward rectifier potassium channel; G protein-coupled inward rectifier potassium channel; ATP-sensitive potassium channel; sodium channel / related gene selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A;Calcium channel / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; and KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta.4 genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta.4 involved in drug transport. Other genes selected from ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport;

[0037] Computational approaches to predict pathogenicity of SNPs In one embodiment, the mutations that can be analyzed by the method of the present disclosure can be identified in public databases. In one embodiment, the databases are selected from ClinVar, dbSNP, gnomAD, SNPnexus, EMBI-EBI, SNPedia, and European Variant Archive. These and other databases provide resources to identify SNPs of interest to engineer into iPSC cell lines for drug testing on differentiated cardiomyocytes. The present disclosure provides that inter-individual differences in LQTS-related genes (such as hERG) affect the control of QT intervals, thus forming the biochemical basis of adverse cardiotoxicity responses to drugs.

[0038] Clinical manifestations of cardiotoxicity for many gene alleles (e.g., hERG (aka kcnh-2)) have been reported in the literature and collated in databases (e.g., ClinVar, dbSNP, etc.). Allele frequencies in human populations, along with ethnic breakdowns, have been compiled from large-scale genomic studies and made available as online resources (e.g., gnomAD). As a result, in one embodiment, target genes for the disclosed methods are selected based on these characteristics in the database.

[0039] In other embodiments, SNPs have been identified by sequencing studies but have not yet been classified with respect to LQTS and / or drug-induced cardiotoxicity. Thus, in one embodiment, these SNPs are referred to as variants of unknown significance (VUS). In one embodiment, available protein structures in the RSC-PDB database can be used to draw inferences about the outcome of a given VUS, e.g., benign or pathogenic. As mentioned above, variation in kcnh-2 is extensive, with over 1,300 SNPs identified, some of which are listed in Table 1. In some embodiments, these SNPs are tested using the cells and methods of the present disclosure.

[0040] In one embodiment, we developed a computational method to identify potentially clinically relevant SNPs using i) SNP data from online resources (i.e., ClinVar, dbSNP, gnomAD) in combination with ii) biophysical features derived from protein structure (pdbid 5val) and physical and biochemical analysis (e.g., solvent accessible surface area, conservation, subunit interfaces, etc.). Using a combination of the above data as a feature set for machine learning (ML) and with input from domain expertise in biochemistry, we accurately predicted the effect of SNPs on QT interval and cardiotoxicity response to drugs (data not shown).

[0041] Thus, in one embodiment, the computational method provides a means to narrow down the number of SNPs that can be experimentally tested using the cells and methods of the present disclosure. In one embodiment, inferences can be drawn from experimental data to accurately predict (>80% accuracy) cardiotoxicity effects. These embodiments and their derivatives can be generalized to other LQTS-associated genes to guide the selection of SNPs for genome editing of iPSCs for drug response testing. In some embodiments, the most frequent variants may be prioritized as a downselection criterion to identify target SNIPs that can be tested in the methods of the disclosure, e.g., 3.4×10 -5 The above allele frequencies encompass 99 non-synonymous SNPs. In some embodiments, the variant is a KCNH-2 / hERG variant.

[0042] In one embodiment, allele frequencies in human populations and ethnic groups therein can be used as a criterion to prioritize SNPs for experimental characterization using the methods of the present disclosure. In some embodiments, the assessment of allele frequencies can be performed using ALFA: Allele Frequency Aggregator. NCBI has developed the ALFA (Allele Frequency Aggregator) pipeline to calculate allele frequencies of variants in dbGaP across approved unrestricted tests and provide the data as open access to the public through dbSNP. The goal of the ALFA project is to make frequency data from over 1M subjects in the Genotypes and Phenotypes (dbGaP) database available in a future release with open access, facilitating the discovery and interpretation of common and rare variants that have biological effects or cause disease.

[0043] In some embodiments, the target gene mutation is selected using PharmGKB, a comprehensive resource that curates knowledge about the impact of genetic variations on drug response for clinicians and researchers. In some embodiments, the PharmGKB data entry for kcnh-2 can be downloaded and cross-checked with the ClinVar entry for drug-gene interactions. In some embodiments, the target gene mutation is selected from the Genome Aggregation Database (gnomAD). gnomAD is a resource developed by an international coalition of researchers with the goal of aggregating and harmonizing both exome and genome sequencing data from a wide variety of large-scale sequencing projects, making the summarized data available to the broader scientific community. The v2.1.1 dataset (GRCh37 / hgl9) provided on this website spans 125,748 exome sequences and 15,708 whole genome sequences from unrelated individuals sequenced as part of a variety of disease-specific and population genetic studies. The v3.1.2 dataset (GRCh38) spans 76,156 genomes selected similarly to v2.

[0044] Prime editing for gene modification of iPSCs and cardiomyocytes The iPSCs and cardiomyocytes of the present disclosure may be genetically modified by any gene editing method, including CRISPR, base editing, and prime editing. They may also be modified by CRISPR interference as a means to regulate the expression level of any gene. In one embodiment, the gene editing method is prime editing. Prime editing allows for the insertion, deletion, and / or replacement of genomic DNA sequences without the need for error-prone double-stranded DNA breaks. It was first described by Anzalon et al., "Search-and-replace genome editing without double-strand breaks or donor DNA," Nature, 201, Vol.576, pp.149-157, the contents of which are incorporated herein by reference. Since then, multiple variations of the original prime editing technology have continued to be developed, some of which are known as PE1, PE2, PE3, PE4, and PE5. Prime editing generally includes a prime editor (PE) and a prime editing guide RNA (pegRNA). Generally, prime editing involves pairing an engineered Cas9 nickase-reverse transcriptase fusion protein (PE1, PE2) with an engineered prime editing guide RNA (pegRNA) that not only guides Cas9 to the target genomic site but also encodes information for introducing the desired edit into the target gene.The first version of prime editing is thought to proceed through a multi-step editing process: 1) the Cas9 domain binds and nicks the target genomic DNA site specified by the spacer sequence of the pegRNA; 2) the reverse transcriptase domain uses the nicked genomic DNA as a primer and initiates synthesis of an edited DNA strand using the engineered extension on the pegRNA as a template for reverse transcription—which generates a single-stranded 3' flap containing the edited DNA sequence; 3) cellular DNA repair separates the 3' flap intermediate by replacement of the 5' flap species that occurs via invasion by the edited 3' flap, excision of the 5' flap containing the original DNA sequence, and ligation of a new 3' flap to incorporate the edited DNA strand, forming a heteroduplex of edited and unedited strands; and 4) cellular DNA repair replaces the unedited strand in the heteroduplex using the edited strand as a repair template, completing the editing process.

[0045] In some embodiments, the target gene is mutated by different base editing and prime editing methods. Newer versions of prime editing include approaches that rely on adding other elements to the system to reduce errors. PE2 uses a PE complex that contains a fusion protein containing Cas9(H840A) and a variant MMLV RT. This improves DNA-RNA affinity, enzymatic processivity, and thermostability. In addition, PE3 is a modified version of PE2 that creates an additional nick in the opposite DNA strand. Despite the improved efficacy of PE2, the edit inserted by PE2 can still be removed by DNA mismatch repair of the edited strand. To circumvent this problem, an additional single guide RNA (sgRNA) is introduced during heteroduplex resolution. This sgRNA is designed to match the edit sequence introduced by the pegRNA, but does not match the original allele. This sgRNA instructs the Cas9 nickase portion of the fusion protein to nick the unedited strand at a nearby site opposite the original nick. Nicking the non-edited strand allows the cell's natural repair system to copy the information in the edited strand to the complementary strand, permanently installing the edit. PE4 contains PE2 and an MLH1 dominant-negative protein (e.g., wild-type MLH1 truncated at amino acids 754-756). The dominant-negative MLH1 can essentially knock out endogenous MLH1 by inhibition, thereby decreasing the cellular DNA mismatch repair response and increasing prime editing efficiency.

[0046] In one embodiment, the prime editor comprises a fusion protein comprising (i) a nucleic acid programmable DNA binding protein (napDNAbp) and (ii) a DNA polymerase, where the napDNAbp is a Cas9 nickase (nCas9) and / or the DNA polymerase is a reverse transcriptase (RT). In some embodiments, the Cas9 is replaced by another napDNAbp. In some embodiments, the napDNAbp is a nuclease-active Cas9 domain, a nuclease-inactive Cas9 domain, or a Cas9 nickase domain or variants thereof. In some embodiments, the napDNAbp is selected from Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, ArgonauteCasl2b2, Casl3a, Casl2c, Casl2d, Casl2e, Casl2h, Casl2i, Casl2g, Casl2f (Casl4), Casl2fl, Casl2j (Casl), and Argonaute, and may have nickase activity.

[0047] In some embodiments, the RT is replaced with another DNA polymerase. In some embodiments, the polymerase is a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase. In some embodiments, the polymerase is a reverse transcriptase. In some embodiments, the reverse transcriptase is a retroviral reverse transcriptase, the reverse transcriptase may be Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT), and the MMLV-RT may include one or more amino acid substitutions compared to wild-type MMLV-RT. In some embodiments, the napDNAbp and the polymerase of the prime editor are combined to form a fusion protein, and the napDNAbp and the polymerase may be linked by a linker. In some embodiments, the DNA polymerase is provided in trans. In some embodiments, the prime editor and the pegRNA are encoded by one or more DNA vectors. In some embodiments, the one or more DNA vectors include an AAV or lentiviral DNA vector.

[0048] In addition to the prime editor, prime editing requires a prime editing guide RNA (pegRNA) or a nucleic acid sequence encoding the pegRNA, where the pegRNA comprises a spacer sequence, a gRNA backbone, and an extension arm comprising a DNA synthesis template (RT template) and a primer binding site (PBS), where the spacer sequence comprises a region complementary to a target strand of a double-stranded target DNA sequence, the gRNA core associates with napDNAbp, the DNA synthesis template comprises a region complementary to a non-target strand of the double-stranded target DNA sequence, and the target strand comprises one or more nucleotide edits compared to the double-stranded target DNA sequence, and the primer binding site comprises a region complementary to a non-target strand of the double-stranded target DNA sequence. In one embodiment, a different pegRNA is specifically designed for each of the target gene mutations. In one embodiment, the pegRNA is a pegRNA encoded by a DNA sequence comprising any one of the sequences of SEQ ID NOs: 1100 to 1113. In one embodiment, the polynucleotide is an RNA, including RNA encoded by DNA of SEQ ID NO: 1100-1113. Once a particular desired mutation is identified, there are multiple publicly available computational methods that can be used to design a pegRNA sequence for a particular desired mutation in a particular gene. For accessible providers of pegRNA sequences for a desired mutation, see, e.g., Hsu, JY, Grunewald, J., Szalay, R. et al. PrimeDesign software for rapid and simplified design of prime editing guide RNAs (e.g., Hsu, JY, Grunewald, J., Szalay, R. et al. PrimeDesign software for rapid and simplified design of prime editing guide RNAs. Nat Commun 12, 1034 (2021)).

[0049] In some embodiments, the pegRNA is a G-quadruplex modified pegRNA. In some embodiments, the pegRNA is an xrRNA motif-linked pegRNA. In some embodiments, the pegRNA is a tethered or split pegRNA.

[0050] In some embodiments, once the pegRNA is designed, the first step of prime editing involves contacting a target nucleotide molecule with the prime editor, which may include (i) directly delivering an effective amount of a prime editor fusion protein (e.g., PE1 or PE2) complexed with a lipid delivery system to the cell; (ii) delivering an mRNA or a delivery complex comprising the mRNA encoding the prime editor fusion protein and / or the appropriate pegRNA to the cell; and / or (iii) delivering a DNA vector encoding the prime editor fusion protein and / or the appropriate pegRNA on one or more DNA vectors to the cell. In some embodiments, the RT is provided in trans. In some embodiments, nucleic acid delivery may occur through a viral vector, a plasmid, or other nucleic acid delivery vector. In some embodiments, the vector is an adeno-associated (AAV) vector or a lentiviral vector.

[0051] In one embodiment, prime editing reproduces known single nucleotide polymorphisms, or SNPs. If more than 1% of a population does not carry the same nucleotide at a particular position in a DNA sequence, this variation can be classified as a SNP. If the SNP is present within a gene, the gene is described as having multiple alleles. In such cases, the SNP may lead to variations in amino acid sequence. However, SNPs are not only associated with genes, but can also occur in non-coding regions of DNA.

[0052] In some embodiments, the one or more modifications to the nucleic acid molecule installed at the target site include one or more transitions, one or more translocations, one or more insertions, one or more deletions, one or more inversions, or any combination thereof, and may be less than 15 bp. In one embodiment, the one or more transitions are selected from the group consisting of: (a) T to C; (b) A to G; (c) C to T; and (d) G to A. In one embodiment, the one or more modifications are selected from the group consisting of: (1) G:C to T:A base pair, (2) G:C to A:T base pair, (3) G:C to C:G base pair, (4) T:A to G:C base pair, (5) TA to A:T base pair, (6) T:A to C:G base pair, (7) C:G to G:C base pair, (8) C:G to T:A base pair, (9) C:G to T:A base pair, (10) C:G to G:C base pair, (11) C:G to T:A base pair, (12) C:G to G:C base pair, (13) C:G to T:A base pair, (14) C:G to T:A base pair, (15) C:G to G:C base pair, (16) C:G to T:A base pair, (17) C:G to G:C base pair, (18) C:G to T:A base pair, (19) C:G to T:A base pair, (20) C:G to T:A base pair, (21) C:G to T:A base pair, (22) C:G to T:C base pair, (23) C:G to T:A base pair, (24) C:G to T:A base pair, (25) C:G to T:A base pair, (26) C:G to T:A base pair, (27) C:G to T:C base pair, (28) C:G to T:A (10) a C:G base pair to an A:T base pair, (11) an A:T base pair to a T:A base pair, or (12) an A:T base pair to a C:G base pair, the base pair being selected from the group consisting of (a) T to A; (b) T to G; (c) C to G; (d) C to A; (e) A to T; (f) A to C; (g) G to C, and (h) G to T. In one embodiment, the one or more modifications include an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the one or more edits may include an insertion or deletion of 1-15 nucleotides.

[0053] In yet other embodiments, the method introduces a desired nucleotide change that is an insertion. In certain cases, the insertion is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides in length. In other embodiments, the method introduces a desired nucleotide change that is a deletion. In certain other cases, the deletion is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides in length.

[0054] In some embodiments, the mutation is V476I SNP rsl99472908 C>T, which results in SNP GRCh38.pl3(version)chr 7:NC_000007.14:g.l50952556C>T(KCNH2 RefSeqGene(LRG 288):NG_008916.1:g.30371G>A).I(protein alteration). In other embodiments, the mutation may be selected by those identified as above. In some embodiments, the mutation is selected from the SNPs of Table 1 represented by mRNA SEQ ID NOs: 2-1054.

[0055] Other components of the gene editing system In some embodiments, the disclosure provides a vector. In some embodiments, the disclosure provides a vector that may encode a component of a gene editing system. In some embodiments, the gene editing system is a prime editing (PE) system. In some embodiments, the vector encodes a component of the PE system (e.g., a PE fusion protein, or any of its components (e.g., napDNAbp, linker, or polymerase)). In other embodiments, the vector may encode a pegRNA, and / or an accessory gRNA for second strand nicking. In some embodiments, the vector may drive expression of one or more coding sequences in a cell. In some embodiments, the cell is a pluripotent cell. In some embodiments, the cell is an iPSC. In some embodiments, the cell is a cardiomyocyte. In some embodiments, the cell is an iPSC-derived cardiomyocyte. In some embodiments, the cell may be a prokaryotic cell, such as, for example, a bacterial cell, when used to prepare a component of the editing system. In some embodiments, the cell may be another eukaryotic cell, such as, for example, a yeast, plant, insect, or mammalian cell, preferably for expressing a component of the editing system. In some embodiments, the eukaryotic cell may be a mammalian cell. In some embodiments, the eukaryotic cell may be a rodent cell. In some embodiments, the eukaryotic cell may be a human cell.

[0056] Suitable promoters for driving expression in different types of cells are known in the art. In some embodiments, the promoter may be wild type. In other embodiments, the promoter may be modified for more efficient or efficient expression. In still other embodiments, the promoter may be truncated but retain its function. For example, the promoter may have a normal size or a reduced size suitable for proper packaging of the vector into a virus. In some embodiments, the promoter that may be used in the prime editor vector may be constitutive, inducible, or tissue specific. In some embodiments, the promoter may be a constitutive promoter. Non-limiting exemplary constitutive promoters include cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor alpha (EFla) promoter, ubiquitin promoter, actin promoter, tubulin promoter, immunoglobulin promoter, functional fragments thereof, or any combination of the foregoing. In some embodiments, the promoter can be a CMV promoter. In some embodiments, the promoter can be a truncated CMV promoter. In other embodiments, the promoter can be an EFla promoter. In some embodiments, the promoter can be an inducible promoter. Non-limiting exemplary inducible promoters include those that are inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments, an inducible promoter can be one that has a low basal (non-inducible) expression level.

[0057] In some embodiments, the nucleotides encoding the guide RNA crRNA and the nucleotides encoding the guide RNA tracrRNA may be provided on the same vector. In some embodiments, the nucleotides encoding the crRNA and the nucleotides encoding the tracr RNA may be driven by the same promoter. In some embodiments, the crRNA and the tracr RNA may be transcribed into a single transcript. For example, the crRNA and the tracr RNA may be processed from a single transcript to form a two-molecule guide RNA. Alternatively, the crRNA and the tracr RNA may be transcribed into a single-molecule guide RNA. In some embodiments, the nucleotide sequence encoding the guide RNA may be located on the same vector that includes the nucleotide sequence encoding the PE fusion protein. In some embodiments, the expression of the guide RNA and the PE fusion protein may be driven by their corresponding promoters. In some embodiments, the expression of the guide RNA may be driven by the same promoter that drives the expression of the PE fusion protein. In some embodiments, the transcripts of the guide RNA and the PE fusion protein may be included within a single transcript. For example, the guide RNA may be present within the untranslated region (UTR) of the Cas9 protein transcript. In some embodiments, the guide RNA may be present within the 5'UTR of the PE fusion protein transcript. In other embodiments, the guide RNA may be within the 3'UTR of the PE fusion protein transcript.

[0058] delivery Exemplary delivery strategies include vector-based strategies, delivery of (PE) ribonucleoprotein complexes, and delivery of the prime editor by mRNA methods. In some embodiments, the delivery methods provided include nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced uptake of DNA. Exemplary delivery methods for nucleic acids include lipofection, nucleofection, electroporation, stable genomic integration (e.g., piggyback), microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced uptake of DNA. In one embodiment, lipofection reagents are commercially available (e.g., Transfectam™, Lipofectin™, and SF Cell Line 4D-Nucleofector X Kit™ (Lonza)). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides are known in the art. In one embodiment, delivery can be to iPSCs or cardiomyocytes (e.g., in vitro or ex vivo administration). Delivery can be achieved by the use of RNP complexes. Preparation of lipid-nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those skilled in the art. In other embodiments, the delivery methods and vectors provided herein are RNP complexes. RNP delivery of fusion proteins significantly increases DNA specificity of base editing. RNP delivery of fusion proteins results in decoupling of on-target and off-target DNA editing. Additional methods for delivering nucleic acids to cells are known to those skilled in the art. See, for example, International Publication No. WO2022150790, which is incorporated herein by reference.

[0059] In specific embodiments, the disclosure provides a method of delivering a prime editor construct to a cell to form a complete and functional prime editor in the cell. For example, in some embodiments, a cell is contacted with a composition described herein (e.g., a composition comprising a nucleotide sequence encoding a Cas9-RT protein or a prime editor, or an AAV particle comprising a nucleic acid vector comprising such a nucleotide sequence). In some embodiments, the contact results in delivery of such a nucleotide sequence to the cell, and the N-terminal portion of the Cas9-RT protein or prime editor and the C-terminal portion of the Cas9-RT protein or prime editor are expressed and joined to form a complete Cas9-RT protein or a complete prime editor in the cell. Any rAAV particle, nucleic acid molecule or composition provided herein can be introduced into a cell in any suitable manner, either stably or transiently. In some embodiments, the disclosed proteins can be transfected into iPSC cells. In some embodiments, the disclosed proteins can be transfected into cardiomyocytes. In some embodiments, the cell can be transduced or transfected with a nucleic acid molecule. For example, cells can be transduced (e.g., with a virus encoding a split protein) or transfected (e.g., with a plasmid encoding a split protein) with a rAAV particle that includes a nucleic acid molecule encoding a protein, or a viral genome encoding one or more nucleic acid molecules. Such transduction can be stable or transient. In some embodiments, cells expressing or containing split proteins can be transduced or transfected with one or more guide RNA sequences, for example, in the delivery of Cas9-RT (e.g., nCas9) proteins. In some embodiments, a plasmid expressing a Cas9-RT protein can be introduced into a cell by electroporation, transient (e.g., lipofection) and stable genomic integration (e.g., piggyback) and viral transduction, or other methods known to those skilled in the art.

[0060] In some embodiments, human iPSCs are transfected with two separate plasmids. In some embodiments, one plasmid encodes Cas9-RT fusion protein, and the other plasmid encodes pegRNA. In some embodiments, the plasmid is transfected via electroporation. In some embodiments, the plasmid is transfected using nucleogecter. In some embodiments, this method is used to introduce V476I variant into iPSCs.

[0061] pluripotent stem cells The present disclosure provides that cardiomyocytes derived from pluripotent stem cells genetically engineered to carry mutations in specific genes are a useful and novel model for studying the cardiotoxicity of those mutations and testing drugs for their cardiotoxicity.In some other embodiments, the cardiomyocytes may be derived from human embryonic stem cells, mesenchymal stem cells, pluripotent cardiac stem cells, or cardiac mesenchymal stem cells.In some embodiments, these cells may be genetically engineered to carry one or more specific mutations in one or more target genes.

[0062] Thus, in one embodiment, the present disclosure provides induced pluripotent stem cells (iPSCs) that are genetically engineered to carry one or more specific mutations in one or more target genes. In some embodiments, the target genes are genes known or suspected to have a role in cardiac function. In some embodiments, the genes include KCNH2, KCNQ1, SCNA5, KCNE1, KCNE2, and other channels, genes encoding ATP-binding cassette (ABC) transporters involved in drug transport (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP in splicing of sarcomere genes. Selected from Elav-like family member 4 (eg, CELF4), DNA polymerase gamma in mitochondrial replication (eg, DPOG2), and chaperones involved in ion channel trafficking (eg, Hsp70 and Hsp90). In some embodiments, the target gene is a potassium channel / related gene selected from human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; a transient outward potassium current channel; a slowly activating delayed rectifier potassium current channel; a rapidly activating delayed rectifier potassium current channel; an inward rectifier potassium (Kir) channel; an inward rectifier potassium channel; a G protein-coupled inward rectifier potassium channel; an ATP-sensitive potassium channel; a sodium channel / related gene selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; a calcium channel / related gene selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; and KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, Ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, Caveolin-3, Nav.beta.4 genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, Ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, Caveolin-3, Nav.beta.4 involved in drug transport. Other genes selected from ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport.

[0063] In some embodiments, the target gene is KCNH2, which encodes a voltage-gated transmembrane potassium channel called hERG. In some embodiments, the mutation is a SNP. In some embodiments, the SNP is in the KCNH2 gene. In some embodiments, the SNP is selected from SEQ ID NOs: 2-1054 listed in Table 1, obtained from the ClinVar database. In some embodiments, the SNP is V476I in the KCNH2 gene. In some embodiments, the SNP is introduced into the iPSC cells by prime editing, CRISPR, base editing, or any other method that can be used to mutate one or more bases of the target gene. In some embodiments, the SNP may be introduced directly into the cardiomyocytes from any source.

[0064] In some embodiments, the cardiomyocytes are differentiated from stem cells. In some embodiments, the stem cells are induced pluripotent stem cells. In some embodiments, the stem cells are human embryonic stem cells, mesenchymal stem cells, pluripotent cardiac stem cells, or cardiac mesenchymal stem cells. In some embodiments, the stem cells are obtained from a commercial source. In some embodiments, the iPSCs are developed as described in the literature. See, for example, Dowey, S., Huang, X., Chou, BK. et al. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc 7, 2013-2021 (2012). doi.org / 10.1038 / nprot.2012.121. In some embodiments, the iPSCs are generated as described in the Examples.

[0065] In some embodiments, the disclosure provides an iPSC cell. In some embodiments, the cell carries one or more mutations of the disclosure or carries genetic engineering means to alter the expression of one or more genes. In some embodiments, the disclosure provides a composition (e.g., a culture) comprising or consisting of said iPSC cell. In some embodiments, the composition comprises or consists of two or more iPSC cells, each cell carrying one or more mutations as described herein. In some embodiments, the composition comprises a library of cells of the disclosure.

[0066] Cardiomyocytes In some embodiments, the disclosure provides cardiomyocytes carrying one or more mutations of the disclosure, or one or more genes with altered gene expression levels. In some embodiments, the cardiomyocytes are primary cardiomyocytes. In some embodiments, the cardiomyocytes are differentiated in vitro from stem cells. In some embodiments, the cardiomyocytes are differentiated in vitro from iPSCs. In some embodiments, the cardiomyocytes are obtained by a method comprising the steps of the method of Example 6. In some embodiments, the disclosure provides a panel of cardiomyocytes or cell lines containing genetic variations of established clinical relevance and variants of unknown significance to study the functionality of the cells with different drugs. In some embodiments, cardiomyocytes can be derived from iPSCs by in vivo differentiation using a combination of small molecules and / or growth factors and nucleic acids (i.e., RNA, miRNA, siRNA) including modulation of the Wnt pathway followed by glucose starvation to select for highly purified populations of cardiomyocytes (as described in Cyganek et al, JCI insight. 3, 2018), as described in Lian et al, Nature Protocols. 8, 162-175, 2013 and Sharma et al, Journal of visualized experiments JoVE. 2015.

[0067] In the present application, a mutation, gene expression level, or drug is associated with cardiotoxicity (and therefore clinical toxicity) of cardiomyocytes if the mutation, gene expression level, or drug has a negative effect on one or more of cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, in vitro "heartbeat" (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells, where a negative effect is a statistically significant effect. In some embodiments, a mutation, gene expression level, or drug is associated with cardiotoxicity (and therefore clinical toxicity) of cardiomyocytes if the mutation, gene expression level, or drug has a negative effect on one or more of cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, in vitro "heartbeat" (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells, where a negative effect is present if there is at least a 5% change compared to wild-type.

[0068] In this application, a "wild type" subject is a healthy subject with no clinical evidence of cardiac disease. In this application, an "iPSC-derived wild type cardiomyocyte" is a cardiomyocyte obtained from iPSCs from a healthy subject with no clinical evidence of cardiac disease. In some embodiments, a "standard iPSC-derived wild type cardiomyocyte" is a cardiomyocyte derived from an iPSC cell line that is generally considered the standard in the art. In some embodiments, it is possible to specify which genes must be wild type. In those embodiments, the genes are genes associated with cardiac disease. In some embodiments, the gene is a sodium channel / related gene selected from KCNH2 / hERG, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRP1, Kir2.1, Cav1.2, caveolin-3, and Nav.beta.4 genes; other channel-encoding genes, SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward Rectifying potassium (Kir) channels; inward rectifying potassium channels; G protein-coupled inward rectifying potassium channels; ATP-sensitive potassium channels; calcium channels / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, caveolin-3, Nav.beta involved in drug transport.4 ATP-binding cassette (ABC) transporters (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, and other genes selected from chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport.

[0069] Exemplary Non-Limiting Methods of Using the Cells of the Disclosure Methods for identifying genes or gene mutations associated with or causing heart disease - Patents.com For purposes of the following methods or models, the cells of the present disclosure include any type of stem cell, iPSC, stem cell-derived cardiomyocytes, and cardiomyocytes from any other source, where the cells have been genetically modified to carry any one of the mutations described in this disclosure, to fix any previously unknown or previously known mutations associated with a cardiac disease or disorder, or to alter the expression of one or more genes. For example, the following methods can be performed with iPSC-derived cardiomyocytes or cardiomyocytes from any other source, so long as the cells have been genetically modified to introduce or correct a mutation in a gene associated with cardiac function, preferably cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, "heartbeat" in vitro (which may model arrhythmias) relative to wild-type (e.g., syngeneic) cells, or to alter the expression of one or more genes.

[0070] In one embodiment, the disclosure provides a method in which iPSCs (or other stem cells) are genetically modified to carry one or more mutations in one or more genes. Cardiomyocytes are derived from these cells. The cardiomyocytes are tested for their function, proliferation, viability, survival, morphology, expression of specific markers and receptors, and the effect of the mutations on "heartbeat" (which may model arrhythmias) in vitro versus wild-type (e.g., syngeneic) cells. Genetic mutations associated with a negative effect on one or more of these cardiomyocyte properties are classified as mutations associated with or causing cardiac disease.

[0071] In one embodiment, the disclosure provides a method in which iPSCs (or other stem cells) are genetically modified to alter gene expression of one or more genes. Cardiomyocytes are derived from these cells. In some embodiments, the cardiomyocytes are genetically modified to alter gene expression of one or more genes. The cardiomyocytes are tested for the effect of changes in gene expression / gene expression levels on their function, proliferation, viability, survival, morphology, expression of specific markers and receptors, and "heartbeat" in vitro (which may model arrhythmias) relative to wild-type (e.g., syngeneic) cells. Changes in gene expression levels associated with a negative effect on one or more of these cardiomyocyte properties are classified as genes whose expression levels are associated with or cause cardiac disease.

[0072] In all embodiments of the present application, cardiomyocytes may or may not be derived from iPSCs. Cardiomyocytes may be derived from any source. The genetic alterations described for iPSCs can also be directly introduced into cardiomyocytes instead of iPSCs. Throughout this application, any gene that is mutated may also or instead have its gene expression altered (e.g., CRISPR interference). As a result, all embodiments directed to gene mutations can be implemented with genes whose expression levels are altered by genetic manipulation as well, and are included in this application even if not explicitly disclosed. Thus, in one embodiment, the mutations and alterations in gene expression levels are as described in the previous section, including mutations selected from any of the listed databases. In one embodiment, the database lists genetic mutations identified in the population in any gene. In one embodiment, the genes are HERG / KCNH2, SCN5A, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, Ankyrin-B, MinK, MiRPl, Kir2.1, Cavl.2, Caveolin-3, Nav.beta.4 ATP-binding cassette (ABC) transporters involved in drug transport (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A4, SLC22A5, SLC22A6, SLC22A7, SLC22A8, SLC22A9, SLC22B1, SLC22B2, SLC22B3, SLC22B4, SLC22B5, SLC22B6, SLC22B7, SLC22B8, SLC22B9, SLC22B10, SLC22B11, SLC22B12, SLC22B13, SLC22B14, SLC22B15, SLC22B16, SLC22B17, SLC22B18, SLC22B19, SLC22B210, SLC22B22, SLC22B23, SLC22B24, SLC22B25, SLC22B26, SLC22B27 A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport.In some embodiments, the sodium channel / related gene is selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; the potassium channel / related gene is selected from human ether-a-go-go related gene (hERG), hyperpolarization-activated; the sodium channel / related gene is selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, SCN10A; the potassium channel / related gene is selected from human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium (Kir) channel; inward rectifier potassium channel; G protein-coupled inward rectifier potassium channel; ATP-sensitive potassium channel; the calcium channel / related gene is selected from CACNA 1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; other genes were selected from SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium (Kir) channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; ATP-sensitive potassium channels; calcium channel / related genes are selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, CALM1-3; other genes are selected from SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS.

[0073] In one embodiment, the mutation is / represents a SNP. In one embodiment, the SNP is as described in the previous section and in Table 1 and / or SEQ ID NOs: 2-1054. In one embodiment, the mutation results in In one embodiment, the SNP is selected for testing according to the disclosed method based on its "clinical significance". (See Table 1). In one embodiment, the SNP is selected for testing according to the disclosed method based on the "status" with which the SNP is associated in the ClinVar database (See Table 1 and database update). At this time, no specific SNPs other than the SNPs in the examples have been selected for testing, but each individual SNP is considered relevant for testing according to the disclosed method and may be claimed independently as an individual embodiment. The clinical significance and associated status are sufficient "blaze marks" to direct one of skill in the art to any of these SNPs, and one may choose any SNP from among the remaining SNPs in the table without need for further guidance.

[0074] In one embodiment, a panel of cells carrying a panel of gene mutations prepared by the method of the present disclosure can be tested for the effect of the panel of mutations on cardiomyocytes. The panel can be a library of cells with known and unknown mutations. In one embodiment, the cells are not part of a library. The results can then be compared to a database of gene mutations to confirm the negative effect of the mutation on the patient's cardiac function or to confirm that the mutation is not pathogenic. In some embodiments, the mutation has been previously identified as affecting cardiomyocytes. In other embodiments, the present disclosure provides the first identification of genes or gene mutations that are important for cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, and "heartbeat" in vitro (which may model arrhythmias) compared to wild-type (e.g., syngeneic) cells. In some embodiments, the present disclosure provides mutations that are associated with or cause cardiac disease. In some embodiments, a subject can be diagnosed as likely to be suffering from one of the diseases listed in Table 1 based on the associations listed in the table.

[0075] In some embodiments, the disease is arrhythmia. In some embodiments, the arrhythmia is selected from long QT syndrome (including congenital long QT syndrome, long QT syndrome type 2, and bradycardia-induced long QT syndrome), Brugada syndrome, short QT syndrome type 1, sudden infant death syndrome, acquired long QT syndrome, ventricular tachycardia, Wolff-Parkinson-White pattern arrhythmia, arrhythmogenic right ventricular cardiomyopathy, atrial fibrillation, catecholaminergic polymorphic ventricular tachycardia type 1, prolonged QT interval, paroxysmal familial ventricular fibrillation type 1, sudden cardiac arrest / death, and torsades de pointes. In some embodiments, the disease is hypertrophic cardiomyopathy, sudden death of unknown cause, obesity-related heart disease, primary dilated cardiomyopathy, primary familial hypertrophic cardiomyopathy, or stroke. In some embodiments, the effect of the genetic mutation on cardiomyocytes is assessed by cardiotoxicity assays that may measure the effect of the mutation on cardiomyocyte viability, survival, morphology, expression of certain markers and receptors, and / or "heartbeat" in vitro (which may model arrhythmias). In some embodiments, cardiotoxicity assays include using patch clamp techniques, external recordings, voltage-sensitive dyes, or intracellular ion-sensitive dyes. These assays may be used in any of the methods of the present disclosure.

[0076] Method for diagnosing a subject as susceptible to heart disease In some embodiments, the present disclosure provides a means for identifying a subject as susceptible to cardiac disease. In some embodiments, a subject is identified as susceptible to cardiac disease if the subject carries one or more mutations in his genome that have been identified, preferably by the methods disclosed herein, as affecting cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, and "heartbeat" in vitro (which may model arrhythmias) relative to wild-type (e.g., syngeneic) cells. In one embodiment, a negative effect on any one or more of each of these cardiomyocyte characteristics represents cardiotoxicity. In some embodiments, the subject was already aware that he had cardiac disease. In some embodiments, the subject was unaware that he had cardiac disease. In some embodiments, the subject was not previously aware that he had a genetic mutation. In some embodiments, the subject was not previously aware that he had a genetic mutation associated with susceptibility to cardiac disease. In some embodiments, the subject may subsequently be diagnosed as likely to have one of the diseases listed in Table 1 based on the associations listed in the table.

[0077] In some embodiments, the disease is arrhythmia. In some embodiments, the arrhythmia is selected from long QT syndrome (including congenital long QT syndrome, long QT syndrome type 2, and bradycardia-induced long QT syndrome), Brugada syndrome, short QT syndrome type 1, sudden infant death syndrome, acquired long QT syndrome, ventricular tachycardia, Wolff-Parkinson-White pattern arrhythmia, arrhythmogenic right ventricular cardiomyopathy, atrial fibrillation, catecholaminergic polymorphic ventricular tachycardia type 1, prolonged QT interval, paroxysmal familial ventricular fibrillation type 1, sudden cardiac arrest / death, and torsades de pointes. In some embodiments, the disease is hypertrophic cardiomyopathy, sudden death of unknown cause, obesity-related heart disease, primary dilated cardiomyopathy, primary familial hypertrophic cardiomyopathy, or stroke. In some embodiments, family members of a subject (e.g., offspring) are tested for the presence of one or more of the mutations identified by the methods of the present disclosure as being associated with cardiotoxicity or cardiac disease. In some embodiments, the mutations are incorporated into a commercially available diagnostic test. In some embodiments, the present disclosure provides a kit for diagnosing an individual as carrying one or more of the mutations initially identified as associated with cardiotoxicity or cardiac disease by the methods of the present invention. In some embodiments, the kit is as previously described in this application.

[0078] Methods for identifying gene mutations associated with drug-induced heart disease In one embodiment, the present disclosure provides a method for identifying genetic mutations that confer sensitivity to one or more drugs to cardiomyocytes carrying those mutations. In one embodiment, cardiomyocytes derived from iPSCs carrying one or more genetic mutations as described above are exposed to a drug and the effect of drug exposure on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, and / or "heartbeat" in vitro (which may model arrhythmias) is evaluated. In one embodiment, if a drug has a negative effect on any one or more of these cardiomyocyte properties, the drug is said to be "cardiotoxic" or "associated with cardiotoxicity" in a subject carrying that mutation. In some embodiments, cardiomyocytes are derived from iPSCs by the methods of the present disclosure.

[0079] In some embodiments, the presence of a cardiotoxic gene mutation in a subject is used to identify subjects who will exhibit cardiac disease if exposed to a drug, hi some embodiments, the method identifies subjects who should not be exposed to said drug. In one embodiment, individual drugs are evaluated at a time. In another embodiment, a library or panel of drugs can be evaluated simultaneously on multiple cardiomyocytes. In one embodiment, cardiomyocytes are cultured in multi-well plates (e.g., 96-well plates) and a different drug is tested in each well or set of wells (e.g., one drug per each of 3 wells for triplicate results). In one embodiment, the drug is a new drug. In another embodiment, the drug is not a new drug. In one embodiment, the assay is used as a model of drug-induced cardiotoxicity for regulatory purposes (e.g., FDA approval). In one embodiment, the drug is selected from the drugs listed in Tables 2 and 3 and other drugs of the same class. In one embodiment, the drug is selected from sotalol, propranolol, and isoproterenol.

[0080] How to assess whether a drug is cardiotoxic In one embodiment, the present disclosure provides a method for identifying drugs as generally cardiotoxic to a "wild type" population. In one embodiment, cardiomyocytes derived from iPSCs that do not carry one or more genetic mutations identified herein (i.e., cardiomyocytes from one or more representatives of wild type individuals whose nucleotide sequence is dominant or most frequently observed in the population) are exposed to a drug and the effect of drug exposure on cardiomyocyte function, proliferation, viability, survival, morphology, expression of specific markers and receptors, and / or "heartbeat" in vitro (which may model arrhythmias) is evaluated. In one embodiment, a drug is said to be cardiotoxic or associated with cardiotoxicity if it has a negative effect on any one or more of these cardiomyocyte properties. In some embodiments, cardiomyocytes are derived from iPSCs by the methods of the present disclosure.

[0081] In one embodiment, individual drugs are evaluated at a time. In another embodiment, a library or panel of drugs can be evaluated simultaneously on multiple cardiomyocytes. In one embodiment, cardiomyocytes are cultured in a multi-well plate (e.g., a 96-well plate) and a different drug is tested in each well or set of wells (e.g., one drug per each of three wells for triplicate results). In one embodiment, the drug is a new drug. In another embodiment, the drug is not a new drug. In one embodiment, the assay is used as a model of drug-induced cardiotoxicity for regulatory purposes (e.g., FDA approval). In one embodiment, the drug is selected from those listed in Tables 2 and 3, as well as other drugs of the same class.

[0082] Methods of Treating a Subject with Cardiovascular Disease In one embodiment, a subject is identified as having cardiovascular disease using the method disclosed above. In one embodiment, the subject is further treated for the disease after experiencing symptoms of the disease. In one embodiment, the subject is treated prophylactically. In one embodiment, the subject is identified as being at risk for any one of the cardiovascular diseases associated with arrhythmia. In one embodiment, a cardiac defibrillator is implanted in the subject prophylactically or after experiencing arrhythmia. In one embodiment, the subject is treated by correcting a disease-associated or disease-causing mutation discovered by the methods of the invention. In one embodiment, the correction of the mutation is performed by CRISPR, base editing, or prime editing.

[0083] Reverse Method In one embodiment, the methods just described are performed not by introducing a mutation into a gene, but by correcting the mutation in the gene and evaluating the effect of the correction on cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, and / or "heart rate" in vitro (which may model arrhythmias). In one embodiment, the mutation is known or suspected to be cardiotoxic, and the effect on cardiotoxicity of changing or correcting the mutation to a different base / sequence (e.g., a wild-type sequence) is evaluated using the methods of the present disclosure. In some embodiments, the discovery that altering or correcting mutations in the genome of cardiomyocytes can improve cardiomyocyte function, proliferation, viability, survival, morphology, expression of certain markers and receptors, and / or "heartbeat" in vitro (which can model arrhythmias) can be used to treat cardiac disease or reduce drug cardiotoxicity in a subject by altering or modifying the subject's cardiomyocytes by gene editing. In some embodiments, gene editing comprises CRISPR, base editing, or prime editing. In some embodiments, the subject is a human.

[0084] Other methods The nucleic acids and cells of the present disclosure may be used in any other method in which a relationship between a particular gene mutation and / or gene expression level and cardiotoxicity (as defined above) plays a role. All such methods are within the scope of the present disclosure.

[0085] composition In one embodiment, the present disclosure provides a composition comprising or consisting of one or more nucleic acids and / or proteins of the present disclosure. In one embodiment, the present disclosure provides a composition comprising one or more cells (i.e., iPSCs and cardiomyocytes) of the present disclosure. In some embodiments, the composition is a pharmacological composition. In some embodiments, the composition comprises or consists of one or more components of the gene editing system described herein, and can be administered to cells, tissues, or organisms by any suitable means, such as by gene therapy, mRNA delivery, virus-like particle delivery, or ribonucleoprotein (RNP) delivery, and combinations thereof, as described above.

[0086] In one embodiment, the present disclosure provides a composition for delivering a nucleic acid of the present disclosure to a cell. In one embodiment, the composition comprises or consists of a pegRNA of the present disclosure. In one embodiment, the composition comprises or consists of a prime editor of the present disclosure. In one embodiment, the composition or consists of both. More compositions are described above in the delivery method of the gene editing system.

[0087] In one embodiment, the one or more modifications include a correction to a disease-associated mutation in a disease-associated gene. In one embodiment, the one or more modifications include the introduction of a disease-associated mutation in a disease-associated gene. In one embodiment, the mutation is a SNP of the present disclosure. In one embodiment, the disease-associated gene is associated with cardiac disease. In one embodiment, the disease is selected from diseases described elsewhere in this application. In one embodiment, the disease-associated gene is the HERG gene. In one embodiment, the disease-associated gene is selected from those described elsewhere herein.

[0088] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises any of the compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises any of the compositions disclosed herein and a pharma- ceutically acceptable carrier. In some embodiments, the composition comprises or consists of one or more cells of the present disclosure. In one embodiment, the composition comprises iPSCs. In one embodiment, the composition comprises cardiomyocytes. In one embodiment, the composition comprises or consists of both iPSCs and cardiomyocytes. In one embodiment, the composition comprises or consists of any one of these cells and one or more components (nucleic acid / polynucleotide; protein; combination) of the gene editing system. In some embodiments, the pharmaceutical composition comprises or consists of any of the polynucleotides disclosed herein. In some embodiments, the pharmaceutical composition comprises or consists of any of the polynucleotides disclosed herein and a pharma- ceutically acceptable carrier. All references to a composition of the present disclosure "comprising" something are also references to that same composition "consisting of" and "consisting essentially of" that same composition, even if not explicitly disclosed or listed herein.

[0089] Some examples of materials that can function as pharma- ceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycosyltransferases, such as propylene glycol. (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids; (23) serum components, such as serum albumin, HDL, and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, coloring agents, releasing agents, coating agents, sweetening agents, flavoring agents, perfumes, preservatives, and antioxidants may also be present in the formulation. The terms "excipient," "carrier," "pharmaceutically acceptable carrier," and the like are used interchangeably herein.

[0090] kit The compositions of the present disclosure can be assembled into kits. In some embodiments, the kits include cells (iPSCs and / or cardiomyocytes) of the present disclosure. In some embodiments, the kits include a nucleic acid vector for expression of a prime editor instead of or in addition to the cells. In other embodiments, the kits further include a suitable guide nucleotide sequence (e.g., PEgRNA and second site gRNA) or a nucleic acid vector for expression of such a guide nucleotide sequence to target the Cas9 protein or prime editor to a desired target sequence. In some embodiments, the kits described herein may include one or more containers containing components and, optionally, instructions for carrying out the methods described herein. Any of the kits described herein may further include components necessary to carry out an assay method. In some embodiments, each component of the kit may be provided in liquid form (e.g., solution) or solid form (e.g., dry powder), as applicable. In certain embodiments, some of the components may be reconstituted or otherwise processable (e.g., into an active form), for example, by the addition of a suitable solvent or other species (e.g., water), which may or may not be provided with the kit. In some embodiments, the kit may optionally include instructions and / or promotions regarding the use of the components provided. As used herein, "instructions" may define an instructional and / or promotional component, and typically includes written instructions on or associated with the packaging of the present disclosure. Instructions may also include any oral or electronic communication provided in any manner that clearly identifies the user as an instruction associated with the kit, such as, for example, audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communication. Written instructions may be in a format prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceutical or biological products, and may reflect approval by the governmental agency of manufacture, use, or sale for animal administration.As used herein, "promoted" includes all methods of doing business, including education, hospital and other clinical teaching, scientific research, drug discovery or development, academic research, pharmaceutical industry activities including pharmaceutical sales, and any advertising or other promotional activities, including all forms of written, oral and electronic communication, related to this disclosure. In some embodiments, the kit may include other components as described herein depending on the particular application. In some embodiments, the kit may include any one or more of the components described herein in one or more containers. In some embodiments, the components may be prepared aseptically, packaged in syringes, and shipped refrigerated. Alternatively, they may be contained and stored in vials or other containers. A second container may have other components prepared aseptically. In some embodiments, the kit may include active agents that are premixed and shipped in vials, tubes, or other containers. The kits can have a variety of forms, such as blister pouches, shrink-wrap pouches, vacuum-sealable pouches, sealable thermoformed trays, or similar pouch or tray forms, with the accessories loosely packed in a pouch, one or more tubes, containers, boxes, or bags. The kits may be sterilized after the accessories are added, allowing the individual accessories in the container to be unpackaged in other ways. In some embodiments, the kits may be sterilized using any suitable sterilization technique, such as radiation sterilization, heat sterilization, or other sterilization methods known in the art. In some embodiments, the kits may also include other components, such as, for example, containers, cell culture media, salts, buffers, reagents, syringes, needles, cloths such as gauze for applying or removing disinfectants, disposable gloves, supports for the drug prior to administration, etc., depending on the particular application.In some embodiments, the present disclosure provides kits that include nucleic acid constructs that include nucleotide sequences encoding various components of the prime editing system utilized in the methods and compositions described herein (e.g., including but not limited to napDNAbp, reverse transcriptase, polymerase, fusion proteins (e.g., including but not limited to napDNAbp and reverse transcriptase (or more broadly, polymerase)), extended guide RNAs, and complexes comprising fusion proteins and extended guide RNAs, as well as accessory elements, such as second strand nicking components (e.g., second strand nicking gRNAs) and 5' endogenous DNA flap removal endonucleases to help drive the prime editing process toward editing product formation). In some embodiments, the nucleotide sequences include heterologous promoters (or more than a single promoter) that drive expression of the prime editing system components. Other embodiments of the present disclosure provide kits that include one or more nucleic acid constructs that encode various components of the prime editing system utilized in the methods and compositions described herein, such as kits that include nucleotide sequences that encode components of a gene editing (e.g., prime editing) system that can modify a target DNA sequence.

[0091] Example for characterizing the PREDICT PLATFORM The PREDICT PLATFORM includes a combination of iPSCs and iPSC-derived cardiomyocytes genetically modified to carry a cardiac disease-associated gene mutation and can be used in any model in which such cells are applied to study the effects of gene mutations on cardiomyocytes and drug-associated cardiotoxicity.It also includes a combination of iPSCs and iPSC-derived cardiomyocytes modified to carry a genetically engineered change in the expression of one or more genes and can be used in any model in which such cells are applied to study the effects of gene expression on cardiomyocytes and drug-associated cardiotoxicity. EXAMPLES

[0092] Example 1: Bioinformatics-Based SNP Selection Public databases were searched for variations in the KCHN2 gene. SNPs were ranked according to known drug interactions, pathogenicity, and uncertainty based on the ClinVar classification. SNPs were then ranked according to frequency. The most frequent SNPs were selected for experimental validation.

[0093] Predicting pathogenicity of KCNH-2 SNPs of unknown significance The biochemical logic used by experts can predict the pathogenicity of SNPs with reasonable accuracy for well-defined cases. For example, a nonsynonymous mutation may introduce a helix-disrupting substitution (i.e., Pro or Gly) in an alpha helix or insert a sterically bulky side chain (e.g., Trp) into the channel pore, blocking ion flow; both SNPs are predicted to disrupt channel function. Conversely, SNPs occurring in highly variable (less conserved) positions present on the surface of the protein are likely to be well tolerated and have negligible effects on function. However, many SNPs where biophysical modeling and analysis suggest subtle effects are the most difficult cases to predict. We have developed new methods to discover and characterize mutations in various genes that may be associated with cardiac disease. These methods are useful for screening large libraries of mutants for mutations that lead to cardiac cell toxicity. They are also useful for screening drugs.

[0094] In this example, we introduced known SNPs into iPSCs by prime editing and investigated their effects on iPSC-derived cardiomyocytes. We selected V476I, a SNP that may be associated with cardiac disease. This V476I SNP was found in the FAMILION® Long QT Syndrome genetic test described by Kapplinger et al., Heart rhythm. 6: 1297-1303, 2009. In this retrospective analysis of the first 2,500 cases (1,515 female patients, mean age at testing 23-17 years, range 0-90 years), mutations in 5 of the LQTS susceptibility genes were scanned, as referenced in Duzkale et al, Clinical genetics. 84:453-463, 2013 and Ware et al., Human mutation. 33: 1188-1191, 2012, and described in ClinVar https: / / www.ncbi.nlm.nih.gov / clinvar / RCV000057908 / . The inventors applied their own machine learning (ML) artificial intelligence to multiple data sets and examined the ML training data, resulting in no notable findings regarding the significance (disease association) of this mutation. Specifically, V476I was found to have i) a moderate centrality (network) score, ii) low conservation (0.2) indicating that this position should tolerate substitutions, iii) an epistatic score (-4.58) of borderline significance, and iv) not involved in subunit interactions, pores, etc. Our structural analysis showed that V476I participates as a central "packing" residue in the helix-loop-helix fold and contacts pathogenic residues (407 and 407) identified in ClinVar (Figure IB). Thus, the knock-on effect of V476I may be able to affect the kchn-2 subunit interface via residue interaction network effects. From prior calculations, V476I was predicted to be a pathogenic mutation by the SNP&Go5 and KvSNP6 algorithms.

[0095] Example 2: Design and cloning of prime editing constructs The list of SNP IDs, including V476I, was entered into an online tool for the design of prime-edited pegRNAs (pegIT https: / / pegit.giehmlab.dk / ), which consisted of three pairs of oligos for each pegRNA: spacer, extension, and scaffold oligos. DNA oligos were ordered from IDT and annealed in-house. Only the scaffold oligos were phosphorylated at the 5' end when ordered. Prime-editing plasmids pCMV-PE2-P2A-GFP and pU6-pegRNA-GG-acceptor were kindly provided by David Liu (AddGene #132776, #132777, and / or #132775). Cloning of pegRNAs was performed as previously described (Anzalone et al., 2019). Briefly, pU6-pegRNA-GG-acceptor was digested with Bsal to generate an open backbone for cloning. The backbone fragment was purified from a 2% agarose gel. A ligation reaction was performed using the three oligos and the digested pU6-pegRNA-GG-acceptor backbone, which was then transformed into E. coli. The sequence of the resulting plasmid was confirmed using Sanger sequencing (primer 5'-GAGGGCCTATTTCCCATGATT-3'). The component of the pegRNA for V476I mutation is an mRNA encoded by the following DNA sequence: CTCCTCGTTGGCATTGAcGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGT CCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCACCACCTACaTCAATGCCAA CGA Spacer-pegRNA backbone-RT template-PBS CTCCTCGTTGGCATTGAcGT-spacer GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC - pegRNA backbone GCACCACCTACa-RT template TCAATGCCAACGA-PBS

[0096] Other pegRNAs are encoded by the DNA sequences referred to in FIG. 1 and are as follows (corresponding to SEQ ID NOs: 1100 to 1113 in order of appearance): rsl805123 VCV000200480 132777_K897M TTCCGCAGGCGCACGGACAaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCCCCGCCTCACCCaTGTCCGTGCGCCTGCGGAAGGA rs12720441 VCV000014433 132777_R784W GCAGGATCTCGATGGAGCCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACTTCATCTCCtGGGGCTCCATCGAGATC rs36210421 VCV000628410 132777_R1047H CTCACCTGTTGAGCTGGcGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCCCTCCAGCaCCAGCTCAACAGGT rs138776684 VCV000067163 132777_P347S TGGTGGGCGAAGCCAAGAAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGTGCTCAAGGGCGACtCCTTCTTGGCTTCGCCCACCAGT rs199472944 VCV000029777 132777_A614V CATCAAGGACAAGTATGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGAAGTAGAGCaCCGTCACATACTTGTCCTTG rs199472959 VCV000067320 132777_S631A ATCTTCTCTGAGTTGGTGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCGGCAACGTCgCTCCCAACACCAACTCAGAGA rs104894021 VCV000014437 132777_N588K GTTTGCCTATCTGGTCGCCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGCTGCACAAaCTGGGCGACCAGATAGGCA rs199472918 VCV000067225 132777_L552S CCAGTGCGCGATGAGCGCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGCTGTTCTcGCTCATGTGCACCTTTGCGCTCATCGCGCACTGGCTA rs199473428 VCV000067261 132777_G584S CCACACATGGACTCACGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTGCAGCCAGCtGATGCGTGAGTCCATGT rs121912510 VCV000014432 132777_S818L CTGAACCTGTATGCAAGGCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATCCCCGTTCaACTTGCCAGGCCTTGCATACAGGT rs199473538 VCV000067402 132777_R823W CAAGTCGAACGGGGATGTGcGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGAGGGCCCaCACATCCCCGTTCGACT rs150817714 VCV000067512 132777_A190T GTCCACCACCACGGCCCCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCGGCGCGGGCaCCCCGGGGGCCGTGGTGGTGGACGT rs199473669 VCV000067428 132777_G903R CCCACAGACACGGAGCAGCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGACACCTCCCtTGGCTGCTCCGTGTCTGT rs199472908 VCV000067200 PE2_V476I CTCCTCGTTGGCATTGAcGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCACCACCTACaTCAATGCCAACGA

[0097] Barcodes can be inserted into pegRNA expression vectors by restriction fragment cloning of small oligonucleotides containing a unique 8 bp DNA sequence that differs from other sequences by at least 2 bases flanked by restriction sites compatible with the acceptor expression vector. The pegRNA can be identified by sequencing the expression cassette. Another method is to insert a U6-pegRNA expression cassette downstream of a polymerase II promoter (CMV, EFla, UBC, etc.) and upstream of a polyA sequence. Such flanking of the U6-pegRNA expression cassette in a lentiviral expression vector allows the pegRNA to be expressed from the Pol II promoter and each pegRNA can be identified by RNA sequencing using standard polyA capture. In this example, the pegRNA is its own barcode.

[0098] Example 3: Cultivation of hiPSCs Human induced pluripotent stem cells (hiPSCs) were obtained from commercial sources and / or generated by reprogramming PMBCs from healthy donors using non-integrative methods (Dowey et al., 2012). hiPSC cultures were grown in Matrigel (Corning) coated plates using mTeSR plus (STEMCELL) and maintained in a humidified incubator set at 5% CO2 and ambient O2 tension. Colonies were passaged using Accutase every 4-5 days. ROCK inhibitor (Y-27632) was added to hiPSC cultures for the first 24 hours after passaging.

[0099] Example 4: Transfection of HiPSCs For the V476I mutant, hiPSC transfection was performed on an Amaxa Nucleofector platform using P3 solution and program CB150. For the remaining mutants, DNA plasmid transfection was performed by electroporation using a GenePulser xCell 0.2 mm cuvette. Briefly, 100,000 cells were harvested in l00uL Ingenio electroporation solution (Mirus Bio) and 2ug of total DNA was added (1.5ug of plasmid #132776 and 0.5ug of plasmid #132777). The cell suspension containing DNA was added to the electroporation cuvette. The electroporation procedure consisted of a square wave of 160V, 950uF, 20ms. The transfection efficiency was estimated by electroporation of an EGFP expression plasmid, and the transfection efficiency was approximately 30%.

[0100] Example 5: Isolation of prime-edited hiPSC clones For the V476I mutant (created with PE2 plasmid #132775), clones were selected by seeding pooled (unsorted) transfected cells in 10 cm dishes at a very low cell density (5,000 cells per dish). Colonies formed after 1-2 weeks were harvested and clones were expanded for sequencing. For the other mutants created with PE2 plasmid #132776, transfected hiPSCs become GFP fluorescent. After transfection, cells are sorted by FACS approximately 5 days later to create pools of transfected cells. Isolation of clones is performed by limiting dilution into 96-well plates (approximately 0.7 cells / well). Clones are expanded and DNA is extracted for sequencing.

[0101] Example 6: Differentiation of hiPSCs into cardiomyocytes The hiPSC cardiomyocyte differentiation process used was based on a previously published protocol from the Allen Institute (Sop_for_cardiomyocyte_differentiation_methods_vl.2_200211.pdf, n.d.), followed by a modified enrichment step based on another published protocol (Cygane et al., 2018).

[0102] A protocol for differentiation of hiPSCs into cardiomyocytes (CMs) [Table 1]

[0103] Example 7: Testing of proarrhythmic drugs in iPSC-derived cardiomyocytes The hiPSC-derived cardiomyocytes are incubated with an intracellular calcium-sensitive fluorescent dye (EarlyTox Cardiotoxicity kit, Molecular Devices, #R8211) for 2 hours at 37 °C, after which the drug to be tested is added. Fluctuations in the fluorescence of the dye directly correlate with the fluctuations in intracellular calcium levels that occur during cardiomyocyte beating. This assay allows for high-throughput collection of data related to beating rate, as well as peak amplitude and width, among other parameters. A first reading of calcium influx is taken to determine the basal level of cardiomyocyte activity. After the basal reading, drug or vehicle is added and incubated for 1,5-2 hours, after which a second reading is taken. Fluorescence intensity readings can be taken using a plate reader or a high-content microscope. With a plate reader, 300 frames are collected in one reading, a 30-second read. With a high-content microscope, a series of 600 images is collected over a 30-second period. Fluorescence intensity data is analyzed with the software PeakPro to determine peak characteristics. The peak frequency is determined and utilized as beats per minute (BPM). Alternatively, multi-electrode arrays can be used to measure the electrical activity of iPSC-CMs, but this generally involves reduced throughput.

[0104] Example 8: Immunocytochemistry hiPSC-derived cardiomyocytes were fixed with 4% formaldehyde for l0 min and washed 3 times with DPBS. They were permeabilized with 0.1% Triton-X in PBS and incubated overnight with primary antibody (Troponin T, Novus Biologicals #NBP27543). Cells were washed 3 times, incubated with secondary antibody for l~2 h, washed twice, and then briefly incubated with whole cell stain CellMask Blue (ThermoFisher, #H32720). Cells were washed one more time and covered with DPBS. Images were acquired from 12 wells for each genotype iPSC-CM using ImageXpress Micro. (Example 9: Prime Editing) Design, cloning and Sanger sequencing of pegRNA constructs A total of 14 SNPs were selected for CRISPR prime editing into hiPSCs. (Figure 1A) gRNA sequences and prime editing template fragments were synthesized, annealed in-house, and cloned into the digested backbone containing the gRNA scaffold. The resulting plasmids were Sanger sequenced. (Figure 2)

[0105] Example 10: Prime Editing Transfection optimization Electroporation parameters for delivery of plasmid DNA were performed in hIPSC cells using the CMV-EGFP plasmid. Briefly, a total of 2ug of DNA was added to 100,000 cells suspended in Ingenio electroporation solution and transferred to a 0.2cm GenePulser (BioRad) cuvette. Eight different electroporation protocols were tested, including both square wave and exponential decay curve protocols. Transfection efficiency (GFP positive cells) and toxicity (propidium iodide positive cells) were measured by microscopy. The protocol with the highest percentage of EGFP positive live cells was used for follow-up experiments and further validation. Figure 3.

[0106] Example 11: Prime Editing Differentiation of hiPSCs into cardiomyocytes Using a protocol manipulating the Wnt pathway, wild-type and V476I hiPSC clonal lines were successfully differentiated into cardiomyocytes. See Example 6. Differentiation efficiency was measured by flow cytometry using a FITC-tagged antibody against troponin T (cTnT), a bona fide cardiomyocyte marker. The hiPSC-CM generation protocol was optimized by adjusting the starting cell density and the concentration of Wnt pathway modulators. After optimization, a CM population showing more than 80% cTnT positivity was routinely obtained. Expression of cTnT was confirmed using a fluorescent microscope. Figures 4 and 5.

[0107] Example 12: Functional characterization of hiPSC-CMs Unedited and V476I hiPSC-CMs were treated with pro- (isoproterenol and propranolol) and anti-arrhythmic (sotalol) drugs to observe their ability to recapitulate myocardial physiology. The observed basal beat rates (BPM) were similar to previously published data for hiPSC-derived CMs (Bedut et al., 2016). Figure 6.

[0108] Example 13: Characterization of drug responses in wild-type and v476i mutant cardiomyocytes hiPSC-CMs were treated with the fluorescent calcium-sensing probe for 2 h before the addition of drugs. The cells were then incubated with drugs for 1.5–2 h. Fluctuations in fluorescence were measured for 30 s using a plate reader (SpectraMax). Images were analyzed using PeakPro to generate peak frequencies, a surrogate for beats per minute. Both wild type and V476I mutants showed the expected response to proarrhythmic drugs, demonstrating the functional responsiveness of this cell model. Figure 7.

[0109] Example 14: Characterization of additional variants The gnomAD Browser (Broad Institute) resource was used to examine the variation frequency of kcnh-2 in the v3.1.2 dataset and the Exome Aggregation Consortium (ExAC). 555 missense variants and allele frequencies were extracted for kcnh-2. Based on this analysis, the most frequent kcnh-2 variants were prioritized as a criterion for downselection, e.g., 3.4 × 10 -5 The allele frequencies above include 99 nonsynonymous SNPs. Various variants are engineered into the cells of the present disclosure. The resulting cells are analyzed for evidence of cardiotoxicity according to any method, including those of the present invention. The resulting cells are also used to test the toxicity of any drug. Variants of pathogenic, unknown significance, benign, etc. are identified. Some drugs cause cardiotoxicity (survival, arrhythmia, etc.) and some do not. The results are used in diagnostic and prognostic methods.

[0110] Example 15: Characterization of Additional Genes Databases such as ClinVar, dbSNP, and gnomAD provide resources to identify SNPs of interest in any other genes to engineer into iPSC cell lines for drug testing on differentiated cardiomyocytes. Some genes are selected from ion channels, ATP-binding cassette (ABC) transporters involved in drug transport (e.g., ABCB1, ABCB4, ABCCI, ABCC2, SLC10A2, SLC28A3, SLC22A7, SLC22A17), carbonyl reductases (e.g., CBR3) in drug metabolism, hyaluronan synthase 3 (e.g., HAS3) involved in oxidative stress response, hereditary hemochromatosis proteins (e.g., HFE) in iron metabolism, retinoic acid receptor gamma and DNA topoisomerases (e.g., RARG, TOP2B) in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 (e.g., CELF4) in splicing of sarcomere genes, DNA polymerase gamma (e.g., DPOG2) in mitochondrial replication, chaperones (e.g., Hsp70 and Hsp90) involved in ion channel transport.

[0111] (Example 16: Regulation of KCNH2 gene expression by CRISPRi gRNA) CRISPRi involves gRNA-directed targeting of nuclease-dead Cas9 (dCas9) fused to a transcriptional repressor (KRAB) to the promoter region of a gene of interest (see, e.g., Larson et al., Nature Protocols, 8:2180-2196, 2013). Anchoring of dCas9-KRAB to the promoter region recruits additional transcriptional repressors to disrupt the formation and elongation of the transcription machinery and / or negatively regulate gene expression. Targeting dCas-KRAB to the promoter region of KCNH2 regulates the expression of the hERG channel to various levels, mimicking the effect of the naturally occurring KCNH2 SNP that results in a net reduction of hERG channel units on the surface of cardiomyocytes. To do this, 42 sgRNAs against the promoter region of the KCNH2 gene have been designed and screened for the effect of these gRNAs on a non-cardiomyocyte cell line (SHSY5Y cells) expressing high levels of KCNH2 via lentiviral vectors. Successful gRNAs, defined as those capable of significantly reducing the expression of the KCNH2 gene by 25%, 50%, 75%, and >90% as measured by qPCR, are introduced into human iPSCs. These cells are differentiated into cardiomyocytes and tested against a broad panel of drugs to detect signs of arrhythmic events. This system allows the (predicted) effects of dozens of uncharacterized SNPs to be mimicked in a manner that reduces sample size.

[0112] Table 4 shows examples of gRNA target sequences that have been tested in CRISPRi. For convenience, the large number of sequence IDs can be summarized as follows:

[0113] [Table 2]

[0114] All publications, patents, patent applications, and other documents cited in this application are herein incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other document was individually indicated to be incorporated by reference for all purposes.

[0115] While various specific embodiments / aspects have been illustrated and described, it will be understood that various modifications can be made without departing from the spirit and scope of the disclosure.

[0116] An embodiment or description including "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless indicated to the contrary or otherwise clear from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the enumerated claims are introduced into another claim. For example, any claim that is dependent on another claim can be amended to include one or more limitations found in any other claim that is dependent on the same base claim. When elements are presented as a list, e.g., in Markush group format, each subgroup of elements is also disclosed and any element can be deleted from the group. In general, when the invention or aspects of the invention are referred to as consisting of certain elements and / or features, it is to be understood that certain embodiments of the disclosure or aspects of the disclosure consist of or consist essentially of such elements and / or features. For the sake of brevity, those embodiments are not specifically described in this specification in haec verba. It is also noted that the terms "comprising" and "containing" are intended to be open and allow for the inclusion of additional elements or steps. When ranges are given, the endpoints are included. Moreover, unless otherwise indicated or clear from the context and the understanding of one of ordinary skill in the art, values ​​expressed as ranges can assume any particular value or subrange within the stated range to one tenth of the unit of the lower limit of the range in different embodiments of the invention, unless the context clearly dictates otherwise.

[0117] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. In the event of any inconsistency between the incorporated references and the present specification, the present specification will control. Furthermore, certain embodiments of the present invention that fall within the prior art may be expressly excluded from any one or more of the embodiments. Such embodiments may be excluded even if the exclusion is not expressly set forth herein, since they are deemed to be known to those of skill in the art. Any particular embodiment of the present invention may be excluded from any embodiment for any reason, whether related to the existence of prior art or not. Those skilled in the art will recognize or be able to ascertain, with no more than routine experimentation, many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above description, but rather as defined in the accompanying embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present specification without departing from the spirit or scope of the present invention as expressly disclosed above and defined in the claims.

[0118] References TIFF2025500011000004.tif144170 TIFF2025500011000005.tif220170

[0119] Table 1: ClinVar SNPs identified as potentially associated with cardiac disease that may be examples of SNPs to test in the disclosed method (PREDICT PLATFORM)

[0120] [Table 3] JPEG2025500011000007.jpg229167 JPEG2025500011000008.jpg215168 JPEG2025500011000009.jpg215166 JPEG2025500011000010.jpg184166 JPEG2025500011000011.jpg184166 JPEG2025500011000012.jpg183166 JPEG2025500011000013.jpg205168 JPEG2025500011000014.jpg206168 JPEG2025500011000015.jpg228168 JPEG2025500011000016.jpg227166 JPEG2025500011000017.jpg218167 JPEG2025500011000018.jpg220167 JPEG2025500011000019.jpg219168 JPEG2025500011000020.jpg218167 JPEG2025500011000021.jpg218168 JPEG2025500011000022.jpg219168 JPEG2025500011000023.jpg219168 JPEG2025500011000024.jpg219167 JPEG2025500011000025.jpg220168 JPEG2025500011000026.jpg219167 JPEG2025500011000027.jpg220167 JPEG2025500011000028.jpg222168 JPEG2025500011000029.jpg9528

[0121]

Table 4

[0122]

Table 5

[0123]

Table 6

Claims

1. A prime editing guide RNA (pegRNA) designed for prime editing of a target gene, comprising a spacer sequence and a DNA synthesis template, wherein the spacer sequence comprises a region complementary to a target strand of a double-stranded target gene DNA sequence to be edited, and the DNA synthesis template comprises a region complementary to a non-target strand of the double-stranded target gene DNA sequence and one or more nucleotide edits relative to the target strand of the double-stranded target gene DNA sequence.

2. A guide RNA (gRNA) core and an extension arm comprising the DNA synthesis template and a primer binding site (PBS), The gRNA core is associated with a nucleic acid programmable DNA binding protein (napDNAbp) fused to a domain containing polymerase activity, and 2. The pegRNA of claim 1, wherein the primer binding site comprises a region complementary to a non-target strand of a double-stranded target gene DNA sequence.

3. 2. The pegRNA of claim 1, wherein the target gene is selected from genes encoding potassium channels or potassium channel-associated genes, sodium channels or sodium channel-associated genes, calcium channels and calcium channel-associated genes, and cardiomyocyte structural genes, Preferably, the target gene is a potassium channel / related gene selected from human ether-a-go-go related gene (hERG) / KCNH2, hyperpolarization-activated cyclic nucleotide-gated (HCN) channel; transient outward potassium current channel; slowly activating delayed rectifier potassium current channel; rapidly activating delayed rectifier potassium current channel; inward rectifier potassium (Kir) channel; inward rectifier potassium channel; G protein-coupled inward rectifier potassium channel; and ATP-sensitive potassium channel. sodium channel / related genes selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, and SCN10A; calcium channel / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, and CALM1-3; and KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRP1, Kir2.1, Cav1.2, caveolin-3, and Nav. beta. Four genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cav1.2, caveolin-3, and Nav. beta. involved in drug transport. 4 ATP-binding cassette (ABC) transporter, carbonyl reductase in drug metabolism, hyaluronan synthase 3 involved in oxidative stress response, hereditary hemochromatosis protein in iron metabolism, retinoic acid receptor gamma and DNA topoisomerase in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 in splicing of sarcomere genes, DNA polymerase gamma in mitochondrial replication, and chaperones involved in ion channel transport.

4. 2. The pegRNA of claim 1, which is designed to introduce a mutation into the human KCNH2 gene, wherein the mutation is selected from a SNP, preferably the SNP is selected from the SNPs identified in Table 1 and / or SEQ ID NOs: 2 to 1054, preferably the SNP causes a V476I mutation in the KCNH2 protein as in SEQ ID NO: 105, and Preferably, the pegRNA is encoded by the DNA sequence of any one of SEQ ID NOs: 1100 to 1113.

5. A gRNA designed for regulating expression of a target gene by CRISPR interference, wherein the target gene is tested for its role in cardiomyocyte function, proliferation, viability, survival, morphology, marker and receptor expression, and heartbeat in vitro, preferably wherein the target gene is selected from human ether-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channels; transient outward potassium current channels; slowly activating delayed rectifier potassium current channels; rapidly activating delayed rectifier potassium current channels; inward rectifier potassium (Kir) channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; and ATP-sensitive potassium channels. sodium channel / related genes selected from SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, and SCN10A; calcium channel / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, and CALM1-3; and calcium channel / related genes selected from KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRP1, Kir2.1, Cav1.2, caveolin-3, and Nav. beta. Four genes, SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQTl, Nav1.5, ankyrin-B, MinK, MiRPl, Kir2.1, Cav1.2, caveolin-3, and Nav. beta. involved in drug transport. 4 gRNA selected from other genes selected from ATP-binding cassette (ABC) transporters, carbonyl reductase in drug metabolism, hyaluronan synthase 3 involved in oxidative stress response, hereditary hemochromatosis proteins in iron metabolism, retinoic acid receptor gamma and DNA topoisomerase in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 in splicing of sarcomere genes, DNA polymerase gamma in mitochondrial replication, and chaperones involved in ion channel transport.

6. The gRNA of claim 5, wherein the gRNA target sequence is selected from SEQ ID NOs: 1116-1155.

7. 10. A composition comprising the pegRNA nucleic acid of claim 1, and optionally a prime editor comprising a nucleic acid-programmable DNA-binding protein (napDNAbp) fused or linked to a domain comprising polymerase activity, an sgRNA, an induced pluripotent stem cell (iPSC), and a cardiomyocyte. Preferably, the composition comprises a library of two or more pegRNA nucleic acids of claim 1, all of which are designed for prime editing of one or more cardiomyocyte genes at one or more sites, and optionally the composition comprises the prime editor comprising a nucleic acid-programmable DNA-binding protein (napDNAbp) fused or linked to a domain comprising polymerase activity, an sgRNA, an induced pluripotent stem cell (iPSC), and a cardiomyocyte.

8. 8. The composition of claim 7, further comprising one or more negative controls, each comprising a pegRNA that does not introduce any edits into the one or more genes.

9. A cell modified by CRISPR interference using a DNA polynucleotide encoding the gRNA of claim 5.

10. 1. A cell genetically engineered to carry one or more specific mutations in one or more target genes, wherein the cell has been genetically engineered with the pegRNA of claim 1; The target gene is a sodium channel / related gene selected from KCNH2 / hERG, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, Ankyrin-B, MinK, MiRP1, Kir2.1, Cav1.2, Caveolin-3, and Nav. beta.4 genes; other channel-encoding genes, SCN5A, ACN1B, SCN2B, SCN3B, SCN4B, GPD1L, RANGRF, and SCN10A; human ether-a-go-go related gene (hERG), hyperpolarization-activated cyclic nucleotide-gated (HCN) channels; transient outward potassium current channels; slowly activating delayed rectifier potassium current channels; rapidly activating delayed rectifier potassium current channels; inward rectifier potassium (Kir) channels; inward rectifier potassium channels; G protein-coupled inward rectifier potassium channels; potassium channel / related genes selected from ATP-sensitive potassium channels; calcium channel / related genes selected from CACNA1C, CACNB2, CACNA2D1, RYR2, CASQ2, TRDN, and CALM1-3; SNTA1, SLMAP, PKP2, ANK2, CAV3, SLC4A3, TRPM4, DPP6, IRX3, GNAI2, ADORA1, GNAS, KCNQ1, SCNA5, KCNE1, KCNE2, KvLQT1, Nav1.5, ankyrin-B, MinK, MiRP1, Kir2.1, Cav1.2, caveolin-3, and Nav. beta involved in drug transport. 4 ATP-binding cassette (ABC) transporter, carbonyl reductase in drug metabolism, hyaluronan synthase 3 involved in oxidative stress response, hereditary hemochromatosis protein in iron metabolism, retinoic acid receptor gamma and DNA topoisomerase in topoisomerase-induced DNA damage, CUGBP Elav-like family member 4 in splicing of sarcomere genes, DNA polymerase gamma in mitochondrial replication, and chaperones involved in ion channel transport.

11. The mutation replicates one or more SNPs listed in Table 1 of SEQ ID NOs: 2 to 1054, preferably SEQ ID NO: 105, and preferably carries the V476I mutation in the KCNH2 gene; and Preferably, the mutation is known to be associated with heart disease or is being tested to be associated with heart disease.

12. The cell of claim 10, which expresses an mRNA having a sequence comprising any of SEQ ID NOs: 2 to 1054 of Table 1, preferably SEQ ID NO:

105.

13. 11. A composition comprising a library of two or more induced pluripotent stem cells (iPSCs) and / or cardiomyocytes, wherein each iPSC / cardiomyocyte has been modified to comprise one or more pegRNA molecules according to any one of claims 1 to 4 or is a cell according to claim 10, and preferably further comprising induced pluripotent stem cells (iPSCs) and / or cardiomyocytes that have not been exposed to pegRNA and / or iPSCs that have been exposed to one or more pegRNAs that do not edit one or more genes.

14. A method for prime editing an induced pluripotent stem cell (iPSC) cell or an iPSC-derived cardiomyocyte, comprising contacting double-stranded target DNA of the cell with a pegRNA designed to edit a target gene, preferably a pegRNA according to any one of claims 1 to 4, and a prime editor and optionally an sgRNA, wherein preferably the prime editor comprises a nucleic acid programmable DNA binding protein (napDNAbp) fused to a domain comprising polymerase activity, and wherein the prime contact edits the cell by installing one or more nucleotide edits in the double-stranded target DNA, thereby editing the double-stranded target DNA.

15. 15. The method of claim 14, wherein a nucleic acid encoding pegRNA and / or napDNAbp fused to a domain containing RNA-dependent DNA polymerase activity is introduced into iPSC- or IPSC-derived cardiomyocytes by transfection, viral transduction, nanoparticles, or nucleofection, Preferably, the napDNAbp is selected from the group consisting of Cas9, Casl2e, Casl2d, Casl2a, Casl2bl, Casl3a, Casl2c, Casl2b2, Casl3a, Casl2c, Casl2d, Casl2e, Casl2h, Casl2i, Casl2g, Casl2f (Casl4), Casl2fl, Casl2j (Casi), and Argonaute, and may have nickase activity.

16. A DNA sequence encoding the pegRNA according to any one of claims 1 to 4, or the gRNA according to any one of claims 5 and 6, preferably a sequence of SEQ ID NOs: 1116 to 1134, or a pegRNA encoded thereby. A polynucleotide comprising a DNA sequence encoding the pegRNA.

17. 17. A vector comprising the polynucleotide of claim 16, wherein expression of the pegRNA or gRNA may be under the control of a promoter.

18. An array of cell culture wells or vessels each comprising one or more induced pluripotent stem cells (iPSCs) or iPSC-derived cardiomyocytes and one or more components of a gene editing system and / or gene expression modification system, wherein the gene editing system is designed to introduce one or more gene edits per iPSC / cardiomyocyte into one or more target genes, and the gene expression modification system is designed to modify expression of one or more target genes, wherein the target gene edits and / or modification of expression levels, when introduced into or present in the genome of the cardiomyocyte, are associated with causing cardiotoxicity or drug-induced cardiotoxicity, and the gene editing or gene expression modification system comprises one or more pegRNAs according to any one of claims 1 to 4, one or more gRNAs according to any one of claims 5 and 6, and / or a composition according to claim 7.

19. 20. The array of claim 18, comprising a multi-well tissue culture plate, Preferably, the array, wherein each well or vessel holds only cells that contain a single gene edit or a single level of altered gene expression, and preferably further comprises one or more elements of an in vitro cardiotoxicity assay.