Circular polyribonucleotides encoding antifusogenic polypeptides

Abstract

The present disclosure relates generally to compositions and methods for producing, purifying and using circular RNAs that encode antifusogenic polypeptides.

Description

[Technical field]

[0001] (Background technology) The delivery of polynucleotides and proteins is important for a wide variety of therapeutic fields. However, current delivery modes are often ineffective. For example, the delivery of short polypeptides, such as polypeptides encoding antifusogenic polypeptides, often results in short half-life and rapid clearance of the polypeptide. Therefore, there is a need for improved compositions and methods for delivering antifusogenic polypeptides, for example, to treat or prevent viral infections. Summary of the Invention [Means for solving the problem]

[0002] The present disclosure provides compositions and methods for producing, purifying and using circular RNAs encoding antifusogenic polypeptides.

[0003] In one aspect, the invention features a cyclic polyribonucleotide that includes a polyribonucleotide cargo that encodes an antifusogenic polypeptide. In some embodiments, the polyribonucleotide cargo includes an expression sequence that encodes an antifusogenic polypeptide.

[0004] In some embodiments the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide of Table 1. In some embodiments the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g. at least 90%, 95%, 97%, 99%, or 100%) sequence identity to a polypeptide of Table 1. In some embodiments the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g. at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-324.

[0005] In some embodiments, the circular polyribonucleotide comprises a splice junction joining the 5' exon fragment and the 3' exon fragment.

[0006] In some embodiments, the polyribonucleotide cargo comprises an IRES operably linked to an expression sequence encoding an antifusogenic polypeptide. The circular polyribonucleotide may further comprise a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment. The spacer region may be at least 5 ribonucleotides in length. For example, the spacer region may be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or more ribonucleotides in length. In some embodiments, the spacer region is 5-500 ribonucleotides in length. The spacer region may comprise a polyA, polyAC, polyAU, or polyAG sequence. The spacer region may be a random sequence.

[0007] In some embodiments, the cyclic polyribonucleotide is at least 500 ribonucleotides in length. For example, the cyclic polyribonucleotide can be at least 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, or more polyribonucleotides. In some embodiments, the cyclic polyribonucleotide is 500 to 20,000 ribonucleotides in length.

[0008] In another aspect, the invention features a linear polyribonucleotide comprising, from 5' to 3', (A) a 3' intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo encoding an antifusogenic polypeptide; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' intron fragment.

[0009] In some embodiments the polyribonucleotide cargo comprises an expression sequence encoding an antifusogenic polypeptide.

[0010] In some embodiments, the polyribonucleotide cargo comprises an IRES operably linked to an expression sequence encoding an antifusogenic polypeptide (e.g., a polypeptide of Table 1). The circular polyribonucleotide may further comprise a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment. The circular polyribonucleotide may further comprise a spacer region between one or more of (A), (B), (C), (D), (E), (F), and (G).

[0011] The spacer region can be at least 5 ribonucleotides in length. For example, the spacer region can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or more ribonucleotides in length. In some embodiments, the spacer region is 5-500 ribonucleotides in length. The spacer region can include a polyA, polyAC, polyAU, or polyAG sequence. The spacer region can be a random sequence.

[0012] In some embodiments, the circular polyribonucleotide lacks an IRES. In some embodiments, the circular polyribonucleotide lacks one or both of a 5' cap and a polyA sequence.

[0013] In some embodiments, the circular polyribonucleotide comprises a protein translation initiation site. In some embodiments, the protein translation initiation site comprises a Kozak sequence.

[0014] In some embodiments, the linear polyribonucleotide is at least 500 ribonucleotides in length. For example, the linear polyribonucleotide can be at least 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, or more polyribonucleotides. In some embodiments, the linear polyribonucleotide is 500 to 20,000 ribonucleotides in length.

[0015] Another aspect features a DNA vector encoding the polyribonucleotides (eg, linear or circular polyribonucleotides) described herein.

[0016] Another aspect features a method of expressing an antifusogenic polypeptide (e.g., a polypeptide in Table 1) in a cell. The method includes providing a circular polyribonucleotide, a linear polyribonucleotide, or a DNA vector described herein to the cell under conditions suitable for expression of the antifusogenic polypeptide.

[0017] Another aspect features a method of producing a circular polyribonucleotide from a linear polyribonucleotide described herein, the method including providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.

[0018] Another aspect features a pharmaceutical composition including a circular polyribonucleotide, a linear polyribonucleotide, or a DNA vector of any of the above embodiments and a diluent, carrier, or excipient.

[0019] Another aspect features a method of expressing an antifusogenic polypeptide (e.g., a polypeptide of Table 1) in a subject. The method includes administering to the subject at least 500 ng / mL (e.g., at least 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1,000 ng / mL, 1,100 ng / mL, 1,200 ng / mL, 1,300 ng / mL, 1,400 ng / mL, 1,500 ng / mL, 1,600 ng / mL, 1,700 ng / mL, 1,800 ng / mL, 1,900 ng / mL, 2,000 ng / mL, or 3,000 ng / mL). In some embodiments, the method includes administering a first dose of the pharmaceutical composition in an amount sufficient to result in a serum concentration of an antifusogenic polypeptide (e.g., a polypeptide of Table 1) of at least 2,100 ng / mL, 2,200 ng / mL, 2,300 ng / mL, 2,400 ng / mL, 2,500 ng / mL, 2,600 ng / mL, 2,700 ng / mL, 2,800 ng / mL, 2,900 ng / mL, 3,000 ng / mL, or more.

[0020] In some embodiments, the method may further include administering a second dose of the pharmaceutical composition. The method may further include administering a third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more doses of the pharmaceutical composition.

[0021] In some embodiments, the second dose is administered at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more) after the first dose of the pharmaceutical composition.

[0022] In some embodiments, the second dose is administered 1 hour to 1 year (e.g., 1 hour to 1 day, e.g., 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 1 day, e.g., 1 day to 1 week, e.g., 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week, e.g., 1 week to 1 month, e.g., 2 weeks, 3 weeks, or 1 month, e.g., 1 month to 1 year, e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year) after the first dose of the pharmaceutical composition. In some embodiments, the second dose is administered within 1 day to 180 days (e.g., 1 day to 90 days, 1 day to 45 days, 1 day to 30 days, 1 day to 14 days, 1 day to 7 days, 2 days to 45 days, 2 days to 30 days, 2 days to 14 days, 2 days to 7 days, 3 days to 90 days, 3 days to 45 days, 3 days to 30 days, 3 days to 14 days, 3 days to 7 days, 4 days to 90 days, 4 days to 45 days, 4 days to 30 days, 4 days to 14 days, 4 days to 7 days, 5 days to 90 days, 5 days to 45 days, 5 days to 30 days, 5 days to 14 days, 5 days to 7 days, 6 days to 90 days, 6 days to 45 days, 6 days to 30 days, 6-14 days, 6-7 days, 7-90 days, 7-45 days, 7-30 days, 7-14 days, 14-90 days, 14-45 days, 14-30 days, 21-90 days, 21-60 days, 21-45 days, 21-30 days, 30-90 days, 30-60 days, 30-45 days, 45-180 days, 45-120 days, 45-100 days, 45-90 days, 45-60 days, 60-180 days, 60-120 days, 60-100 days, 60-90 days, 90-100 days, 90-120 days, or 90-180 days).

[0023] In some embodiments, the third dose is administered at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more) after the second dose of the pharmaceutical composition.

[0024] In some embodiments, the third dose is administered 1 hour to 1 year (e.g., 1 hour to 1 day, e.g., 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 1 day, e.g., 1 day to 1 week, e.g., 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week, e.g., 1 week to 1 month, e.g., 2 weeks, 3 weeks, or 1 month, e.g., 1 month to 1 year, e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year) after the second dose of the pharmaceutical composition. In some embodiments, the third dose is administered within 1 day to 180 days (e.g., 1 day to 90 days, 1 day to 45 days, 1 day to 30 days, 1 day to 14 days, 1 day to 7 days, 2 days to 45 days, 2 days to 30 days, 2 days to 14 days, 2 days to 7 days, 3 days to 90 days, 3 days to 45 days, 3 days to 30 days, 3 days to 14 days, 3 days to 7 days, 4 days to 90 days, 4 days to 45 days, 4 days to 30 days, 4 days to 14 days, 4 days to 7 days, 5 days to 90 days, 5 days to 45 days, 5 days to 30 days, 5 days to 14 days, 5 days to 7 days, 6 days to 90 days, 6 days to 45 days, 6 days to 30 days, 6-14 days, 6-7 days, 7-90 days, 7-45 days, 7-30 days, 7-14 days, 14-90 days, 14-45 days, 14-30 days, 21-90 days, 21-60 days, 21-45 days, 21-30 days, 30-90 days, 30-60 days, 30-45 days, 45-180 days, 45-120 days, 45-100 days, 45-90 days, 45-60 days, 60-180 days, 60-120 days, 60-100 days, 60-90 days, 90-100 days, 90-120 days, or 90-180 days).

[0025] In some embodiments, the second dose is administered before the serum concentration of the antifusogenic polypeptide is less than about 500 ng / mL in the subject's serum.

[0026] In some embodiments, the method provides for the administration of at least 500 ng / mL (e.g., at least 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1,000 ng / mL, 1,100 ng / mL, 1,200 ng / mL, 1,300 ng / mL, 1,400 ng / mL, 1,500 ng / mL, 1,600 ng / mL, 1,700 ng / mL, 1,800 ng / mL, 1,900 ng / mL, 2,000 ng / mL, 2,100 ng / mL, 2,200 ng / mL, 2,300 ng / mL, 2,400 ng / mL, 2,500 ng / mL, 2,600 ng / mL, 2,700 ng / mL, ng / mL, 2,800 ng / mL, 2,900 ng / mL, 3,000 ng / mL) for, e.g., at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more).

[0027] In some embodiments, the method treats or prevents a viral infection in a subject. For example, the pharmaceutical composition can be administered to a subject in an amount and for a period of time sufficient to treat or prevent a viral infection. The pharmaceutical composition can be administered to a subject to reduce the risk of a viral infection.

[0028] In some embodiments, the methods treat or prevent human immunodeficiency virus (HIV) infection.

[0029] In some embodiments, the method treats or prevents a coronavirus infection (e.g., a betacoronavirus infection, e.g., a SARS-CoV-2 infection, such as a SARS-CoV-2 infection that results in symptoms of COVID-19 infection).

[0030] In some embodiments, the methods treat or prevent a Hepatitis C virus (HCV) infection.

[0031] In some embodiments, a circular polynucleotide encoding an antifusogenic polypeptide (eg, a polypeptide of Table 1) is used to reduce viral entry.

[0032] Another aspect features a circular polyribonucleotide comprising a polyribonucleotide cargo that encodes a plurality of antifusogenic polypeptides. The polyribonucleotide cargo can comprise an expression sequence that encodes an antifusogenic polypeptide. In some embodiments, the antifusogenic polypeptides are directed against the same virus. Alternatively, the antifusogenic polypeptides can be directed against two or more viruses.

[0033] definition To facilitate understanding of the present disclosure, several terms are defined below. Terms defined herein have the meanings as commonly understood by those skilled in the art in the areas relevant to the present disclosure. Terms such as "a", "an" and "the" are not intended to refer to a singular entity only, but also include general classes, specific examples of which may be used for illustration. The term "or" is used to mean "and / or" unless expressly specified to refer to alternatives only or the alternatives are not mutually exclusive, but the present disclosure supports a definition that refers to alternatives only and "and / or". Although the terms in this specification are used to describe specific embodiments, their use should not be construed as limiting, except as outlined in the claims.

[0034] As used herein, any value provided in a range of values ​​includes both the upper and lower limits, as well as any value subsumed within the upper and lower limits.

[0035] As used herein, the term "about" refers to a value within ±10% of the recited value.

[0036] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., cyclic polyribonucleotide) to a cell, via a partially or fully encapsulated agent, or a combination thereof, by covalent modification of the cyclic polyribonucleotide. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g., nanoparticles encapsulated or covalently attached to cyclic polyribonucleotides), liposomes, fusosomes, exosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently attached to polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents).

[0037] As used herein, the terms "cyclic polyribonucleotide", "circular RNA" and "circRNA" are used interchangeably and refer to polyribonucleotide molecules having a structure with no free ends (i.e., free 3' and / or 5' ends), e.g., polyribonucleotide molecules that form a circular or endless structure through covalent or non-covalent bonds. A circular polyribonucleotide may be, for example, a covalently closed polyribonucleotide.

[0038] As used herein, the term "circularization efficiency" is a measure of the resulting circular polyribonucleotide relative to its non-circular starting material.

[0039] The term "diluent" refers to a vehicle comprising an inert solvent in which the compositions described herein (e.g., compositions comprising cyclic polyribonucleotides) can be diluted or dissolved. The diluent can be an RNA solubilizing agent, a buffer, an isotonic agent, or a mixture thereof. The diluent can be a liquid diluent or a solid diluent. Non-limiting examples of liquid diluents include water or other solvents, solubilizing agents and emulsifying agents, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and 1,3-butanediol. Non-limiting examples of solid diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, or powdered sugar.

[0040] As used herein, the terms "disease," "disorder," and "condition" each refer to a state of less than optimal health, e.g., a condition that is or would be normally diagnosed or treated by a medical professional.

[0041] As used herein, the term "expressed sequence" is a nucleic acid sequence that encodes a product, such as a peptide or polypeptide (e.g., an antifusogenic polypeptide). An exemplary expressed sequence that encodes a peptide or polypeptide can include multiple nucleotide triplets, each of which can encode an amino acid, referred to as a "codon."

[0042] As used herein, the term "fragment" with respect to a polypeptide or nucleic acid sequence, e.g., an antifusogenic polypeptide or a nucleic acid sequence encoding an antifusogenic polypeptide, refers to a contiguous, less than full portion of the polypeptide or nucleic acid sequence. A fragment of a polypeptide or a nucleic acid sequence encoding a polypeptide refers to a contiguous, less than full portion (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the full length) fragment of a sequence, such as, for example, a sequence disclosed herein. It is understood that all of the present disclosure contemplates fragments of any antifusogenic polypeptide disclosed herein.

[0043] As used herein, the term "Fc domain" refers to at least the hinge domain and the second and third antibody constant domains (C H 2 and C H3) or a functional fragment thereof (e.g., a fragment capable of dimerizing and binding to an Fc receptor). The Fc domain can be any immunoglobulin antibody isotype, including IgG, IgE, IgM, IgA, or IgD (e.g., IgG). Additionally, the Fc domain can be an IgG subtype (e.g., IgG1, IgG2a, IgG2b, IgG3, or IgG4) (e.g., IgG1). The Fc domain does not include any portion of an immunoglobulin that can act as an antigen recognition region, such as a variable domain or a complementarity determining region (CDR). The Fc domain in the conjugates as described herein can include one or more changes from the wild-type Fc domain sequence (e.g., 1-10, 1-8, 1-6, 1-4 amino acid substitutions, additions, or deletions) that alter the interaction between the Fc domain and the Fc receptor. Examples of suitable modifications are known in the art. Unless otherwise specified herein, numbering of amino acid residues in an IgG or Fc domain is according to the EU numbering system for antibodies, also called the Kabat EU index, as described, e.g., in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

[0044] As used herein, the term "GC content" refers to the percentage of guanine (G) and cytosine (C) in a nucleic acid sequence. The formula for calculating GC content is (G+C) / (A+G+C+U)x100% (for RNA) or (G+C) / (A+G+C+T)x100% (for DNA). Similarly, the term "uridine content" refers to the percentage of uridine (U) in a nucleic acid sequence. The formula for calculating uridine content is U / (A+G+C+U)x100%. Similarly, the term "thymidine content" refers to the percentage of thymidine (T) in a nucleic acid sequence. The formula for calculating thymidine content is T / (A+G+C+T)x100%.

[0045] "Heterologous" means occurring under a situation other than the naturally occurring (natural) situation. A "heterologous" polynucleotide sequence indicates that the polynucleotide sequence is used in a manner other than that found in the sequence's native genome. For example, a "heterologous promoter" is used to drive the transcription of a sequence that is not naturally transcribed by that promoter; therefore, a "heterologous promoter" sequence is often included in an expression construct using recombinant nucleic acid technology. The term "heterologous" is also used to refer to a given sequence that is placed in a non-naturally occurring relationship with another sequence; for example, a heterologous coding or non-coding nucleotide sequence is commonly inserted into a genome by genome transformation techniques, resulting in a genetically modified or recombinant genome.

[0046] As used herein, the term "intron fragment" refers to a portion of an intron where a first intron fragment and a second intron fragment together form an intron, such as a catalytic intron. The intron fragment can be a 5' portion of an intron (e.g., the 5' portion of a catalytic intron) or a 3' portion of an intron (e.g., the 3' portion of a catalytic intron), such that a 5' intron fragment and a 3' intron fragment together form a functional intron, such as a functional intron capable of catalytic self-splicing. The term intron fragment is meant to refer to an intron split into two portions. The term intron fragment is not meant to state, imply, or suggest that the two portions or halves are equal in length. The term intron fragment is used synonymously with the term split intron and can be used in place of the term "half intron".

[0047] As used herein, the term "linear counterpart" refers to a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage of sequence identity therebetween) as a circular polyribonucleotide and has two free ends (i.e., a non-circularized version of a circularized polyribonucleotide (and fragments thereof)). In some embodiments, a linear counterpart (e.g., a pre-circularized version) is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage of sequence identity therebetween) as a circular polyribonucleotide and the same or similar nucleic acid modifications and has two free ends (i.e., a non-circularized version of a circularized polyribonucleotide (and fragments thereof)). In some embodiments, a linear counterpart is a polyribonucleotide molecule (and fragments thereof) that has the same or similar nucleotide sequence as a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage sequence identity therebetween), and has a different or no nucleic acid modification, and has two free ends (i.e., a non-circularized version (and fragments thereof) of a circularized polyribonucleotide). In some embodiments, a fragment of a polyribonucleotide molecule that is a linear counterpart is any portion of the linear counterpart polyribonucleotide molecule that is shorter than the linear counterpart polyribonucleotide molecule. In some embodiments, the linear counterpart further comprises a 5' cap. In some embodiments, the linear counterpart further comprises a polyadenosine tail. In some embodiments, the linear counterpart further comprises a 3' UTR. In some embodiments, the linear counterpart further comprises a 5' UTR.

[0048] As used herein, the terms "linear RNA", "linear polyribonucleotide", and "linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having a 5' and a 3' end. Either or both of the 5' and 3' ends may be free ends or may be attached to another moiety. Linear RNA includes RNA that has not been subjected to circularization (e.g., previously circularized) and can be used as starting material for circularization, for example, by splint ligation or chemical, enzymatic, ribozyme- or splicing-catalyzed circularization methods.

[0049] As used herein, the term "modified ribonucleotide" means a nucleotide having at least one modification to the sugar, nucleobase, or internucleoside linkage.

[0050] As used herein, the term "naked delivery" refers to a formulation for delivery to cells without the aid of a carrier or covalent modification of moieties that aid in delivery to cells. Naked delivery formulations do not include transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, a naked delivery formulation of cyclic polyribonucleotide is a formulation that includes cyclic polyribonucleotide without covalent modification and does not include a carrier.

[0051] As used herein, the terms "nicked RNA," "nicked linear polyribonucleotide," and "nicked linear polyribonucleotide molecule" are used interchangeably and refer to a polyribonucleotide molecule having 5' and 3' ends that result from the nicking or degradation of circular RNA.

[0052] The term "pharmaceutical composition" is also intended to disclose that the cyclic or linear polyribonucleotides contained within the pharmaceutical composition can be used for the treatment of the human or animal body by therapy, and thus is meant to be equivalent to "polyribonucleotides for therapeutic use."

[0053] As used herein, the term "polynucleotide" refers to a molecule that includes one or more nucleic acid subunits or nucleotides, and can be used interchangeably with "nucleic acid" or "oligonucleotide." A polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least one, two, three, four, five, six, seven, eight, nine, ten, or more phosphate (PO3) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. Polyribonucleotide or ribonucleic acid, or RNA, can refer to a polymer that includes multiple ribonucleotides polymerized through phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose. As used herein, a polyribonucleotide sequence that represents thymine (T) is understood to represent uracil (U).

[0054] As used herein, the term "polyribonucleotide cargo" herein includes any sequence comprising at least one polyribonucleotide. In embodiments, the polyribonucleotide cargo comprises one or more expressed sequences, each expressed sequence encoding a polypeptide. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences, such as polyribonucleotides with regulatory or catalytic functions. In embodiments, the polyribonucleotide cargo comprises a combination of expressed and non-coding sequences. In embodiments, the polyribonucleotide cargo comprises one or more polyribonucleotide sequences as described herein, for example, one or more regulatory elements, internal ribosome entry site (IRES) elements, or spacer sequences.

[0055] As used interchangeably herein, the terms "polyA" and "polyA sequence" refer to an untranslated flanking region of a nucleic acid molecule that is at least 5 nucleotides in length and consists of adenosine residues. In some embodiments, the polyA sequence is at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 nucleotides in length. In some embodiments, the polyA sequence is located 3' to (e.g., downstream of) an open reading frame (e.g., an open reading frame encoding a polypeptide), and the polyA sequence is present 3' to a termination sequence (e.g., a stop codon) such that the polyA is not translated. In some embodiments, the polyA sequence is located 3' to the termination sequence and the 3' untranslated region.

[0056] As used herein, nucleic acid elements are "operably connected" or "operably linked" when they are placed in a vector such that they can be transcribed to form linear RNA and then circularized into circular RNA using the methods provided herein.

[0057] Polydeoxyribonucleotide, deoxyribonucleic acid, and DNA refer to a polymer comprising multiple deoxyribonucleotides polymerized via phosphodiester bonds. Nucleotides can be nucleoside monophosphates or nucleoside polyphosphates. Nucleotides refer to deoxyribonucleoside polyphosphates, such as deoxyribonucleoside triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP), and deoxythymidine triphosphate (dTTP) dNTPs, including detectable tags (e.g., fluorophores), such as luminescent tags and markers. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits may be A, C, G, T, or U, or any other subunits that are specific to one or more complementary A, C, G, T, or U, or that are complementary to purines (i.e., A or G, or variants thereof) or pyrimidines (i.e., C, T, or U, or variants thereof). In some instances, the polynucleotide is a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or a derivative or variant thereof. In some instances, the polynucleotide is a small interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a small hairpin RNA (shRNA), a small nuclear RNA (snRNA), a messenger RNA (mRNA), a pre-mRNA (pre-mRNA), an antisense RNA (asRNA), to name a few, and includes both nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, helical, hairpin, etc. In some instances, the polynucleotide molecule is circular. The polynucleotide may have a variety of lengths. The nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. Polynucleotides can be isolated from cells or tissues.Polynucleotide sequence embodiments can include isolated and purified DNA / RNA molecules, synthetic DNA / RNA molecules, and synthetic DNA / RNA analogs.

[0058] Polynucleotide embodiments, such as polyribonucleotides or polydeoxyribonucleotides, may include one or more nucleotide variants, including non-standard nucleotides, non-natural nucleotides, nucleotide analogs, or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, These include 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-D46-isopentenyladenine, uracil-5-oxyacetic acid, wybutoxocine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. In some cases, nucleotides can include modifications of their phosphate moieties, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications of the thiol moiety (e.g., α-thiotriphosphate and β-thiotriphosphate).In embodiments, the nucleic acid molecules are also modified at the base moiety, sugar moiety, or phosphate backbone (e.g., at one or more atoms typically available to form hydrogen bonds with complementary nucleotides, or at one or more atoms typically not available to form hydrogen bonds with complementary nucleotides). In embodiments, the nucleic acid molecules include amine-modified groups such as aminoallyl-dUTP (aa-dUTP) and aminohexylacrylamide-dCTP (aha-dCTP) to allow covalent attachment of amine-reactive moieties such as N-hydroxysuccinimide ester (NHS). Alternatives to standard DNA or RNA base pairs in the oligonucleotides of the present disclosure may provide high bit density per cubic mm, higher safety (resistance to accidental or deliberate synthesis of natural toxins), easier identification in photoprogrammed polymerases, or subsecondary structures. Such alternative base pairs compatible with native and mutant polymerases for de novo or amplicon synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012 Jul;8(7):612-4, incorporated herein by reference for all purposes.

[0059] As used herein, "polypeptide" refers to a polymer of amino acid residues (natural or non-natural) linked together, most often by peptide bonds. The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs thereof. Polypeptides can be single molecules or multi-molecular complexes such as dimers, trimers, or tetramers. Polypeptides can also include single chain or multi-chain polypeptides such as antibodies or insulin, which can be associated or linked. Disulfide bonds are most commonly found in multi-chain polypeptides. The term polypeptide can also be applied to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0060] As used herein, the term "prevent" means reducing the likelihood of developing a disease, disorder, or condition (e.g., a viral infection, e.g., HIV, SARS-CoV-2, HCV, influenza, or RSV) or reducing the severity or frequency of symptoms of a disease or disorder that subsequently develops. Therapeutic agents can be administered to subjects who are at increased risk of developing a viral infection compared to members of the general population to prevent the onset of a disease or condition or to reduce its severity. Therapeutic agents can be administered as a prophylactic, e.g., prior to the onset of any symptoms or manifestations of a viral infection.

[0061] As used herein, the term "regulatory element" is a portion of a nucleic acid sequence or the like that alters the expression of an expression sequence within a circular or linear polyribonucleotide.

[0062] As used herein, "spacer" refers to any adjacent nucleotide sequence (eg, of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions.

[0063] A "signal sequence" refers to a polypeptide sequence, eg, 10-45 amino acids in length, present at the N-terminus of a polypeptide sequence of a nascent protein that targets the polypeptide sequence to the secretory pathway.

[0064] As used herein, the term "sequence identity" is determined by alignment of two peptide sequences or two nucleotide sequences using a global or local alignment algorithm. Sequences are called "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity when optimally aligned (aligned by a program such as GAP or BESTFIT using default parameters). GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, the default parameters of GAP are used: gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignment and sequence identity percentage scores are determined using computer programs such as, for example, GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or EmbossWin version 2.10.0 (using the program "needle"). Alternatively, or in addition, percent identity is determined by searching in a database, for example, using algorithms such as FASTA, BLAST, etc. Sequence identity refers to sequence identity over the entire length of the sequence.

[0065] As used herein, the term "subject" refers to an organism, such as an animal, a plant, or a microorganism. In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a bison, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxonomic group such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks. In embodiments, the subject is an invertebrate that is an invertebrate agricultural pest or a parasite on an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgo), fern, horsetail, club moss, or bryophyte. In embodiments, the subject is a eukaryotic alga (unicellular or multicellular). In embodiments, the subject is an agriculturally or horticulturally important plant, such as row crops, fruit-bearing plants and trees, vegetables, trees, and ornamentals, e.g., ornamental flowers, shrubs, trees, ground covers, and turf.

[0066] As used herein, the term "antifusogenic polypeptide" refers to a polypeptide, such as a polypeptide of 10-200 amino acids, that inhibits viral fusion-related events, such as viral entry or viral fusion. Antifusogenic polypeptides include, for example, the polypeptides of Table 1. Antifusogenic polypeptides include polypeptides as well as any biologically active fragments thereof (e.g., fragments of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 amino acids). Antifusogenic polypeptides include, for example, polypeptides that target HIV, SARS-CoV-2, HCV, or RSV. In some embodiments, antifusogenic polypeptides include polypeptides having at least 70%, such as at least 80%, such as at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-324. An antifusogenic polypeptide also refers to a polynucleotide, such as a polyribonucleotide, e.g., a circular polyribonucleotide, that encodes an antifusogenic polypeptide, e.g., a polypeptide of Table 1, or a biologically active fragment thereof.

[0067] As used herein, the terms "treat" and "treating" refer to prophylactic or therapeutic treatment of a viral infection, such as HIV, SARS-CoV-2, HCV, influenza, or RSV, in a subject. The effect of treatment can include reversing, alleviating, reducing the severity, curing, inhibiting progression, reducing the likelihood of recurrence, stabilizing (i.e., not worsening) the condition of the viral infection, or preventing the spread of the viral infection, as compared to the state or condition of the viral infection in the absence of therapeutic treatment.

[0068] As used herein, the term "termination element" is a portion of a nucleic acid sequence or the like that terminates translation of an expressed sequence in a circular or linear polyribonucleotide.

[0069] As used herein, the term "translation efficiency" refers to the rate or amount of protein or peptide production from a ribonucleotide transcript. In an embodiment, translation efficiency can be expressed as the amount of protein or peptide produced per a given amount of transcript encoding the protein or peptide, for example, in a given translation system, for example, a cell-free translation system such as rabbit reticulocyte lysate, for example, in a given period of time.

[0070] As used herein, the term "translation initiation sequence" is a nucleic acid sequence that initiates the translation of an expression sequence in a circular or linear polyribonucleotide.

[0071] As used herein, "vector" refers to a piece of DNA that is synthesized (e.g., using PCR) or taken from a virus, plasmid, or cell of a higher organism into which a foreign DNA piece can or has been inserted for cloning or expression purposes. In some embodiments, the vector can be stably maintained in the organism. The vector can include, for example, an origin of replication, a selectable marker or reporter gene, such as antibiotic resistance or GFP, or a multiple cloning site (MCS). The term includes linear DNA pieces (e.g., PCR products, linearized plasmid fragments), plasmid vectors, viral vectors, cosmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and the like. In one embodiment, the vectors provided herein include a multiple cloning site (MCS). In another embodiment, the vectors provided herein do not include a MCS. [Brief description of the drawings]

[0072] [Figure 1] FIG. 1 is a schematic diagram showing the protein domains or regions of various coronavirus S proteins and the sequences of the HR1 and HR2 regions. [Diagram 2] FIG. 1 is a schematic diagram showing various antifusogenic polypeptides and sequences derived from the HR2 region of SARS CoV-2. [Diagram 3]FIG. 1 is a schematic diagram showing an exemplary embodiment of a multi-ORF antifusogenic polypeptide construct. [Figure 4] 4A and 4B are graphs showing the inhibitory effect on fusion using Omicron and Delta pseudotyped viruses. Figure 4A shows the % inhibition of Delta and Omicron using either full-length HR2 or full-length HR2 with HiBiT tag. Figure 4B shows the relative expression of antifusogenic polypeptides compared to mock controls. [Diagram 5] 1 is a graph showing in vivo expression of HR2 full-length antifusogenic polypeptide with and without HiBiT tag at 6 hours and 24 hours. [Figure 6] 6A and 6B are graphs showing in vitro neutralization of pseudotyped viruses of the Wuhan and Omicron strains of SARS CoV-2 using HR2A polypeptides. FIG. 6A shows neutralization of the Wuhan strain of SARS CoV-2 using HR2A. FIG. 6B shows neutralization of the Omicron strain of SARS CoV-2 using HR2A. [Figure 7] Graph showing the percent inhibition of SARS CoV-2 pseudotyped virus Omicron BA4 and BA.5 (FIG. 7A) or SARS CoV-1 pseudotyped virus (FIG. 7B) strains. [Figure 8] 8A-8D are graphs showing the % inhibition of SARS CoV-2 pseudotyped virus using full length HR2 (HR2 complete). Figure 8A shows inhibition of Wuhan strain. Figure 8B shows inhibition of Omicron BA.4 and BA.5 strains. Figure 8C shows inhibition of Omicron BA.1 strain. Figure 8D shows inhibition of SARS CoV-1 pseudotyped virus. [Figure 9] FIG. 1 is a schematic diagram showing the construct designs and sequences of various HIV antifusogenic polypeptides. [Figure 10] 10A and 10B are graphs and tables showing the expression of various HIV antifusogenic polypeptides from circular RNA. [Figure 11] 11A-11B are graphs showing expression of various HIV antifusogenic polypeptides from circular RNA (FIG. 11A) or plasmid DNA (FIG. 11B). [Figure 12]1 is a table showing the expression of various HIV antifusogenic polypeptides from circular RNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0073] The present invention features compositions containing circular polyribonucleotides (circular RNAs) encoding antifusogenic polypeptides and methods of using the same. The circular polyribonucleotides described herein are particularly useful for delivering polynucleotide cargo encoding antifusogenic polypeptides to target cells.

[0074] The cyclic polyribonucleotide may comprise a polyribonucleotide cargo encoding a polypeptide of Table 1. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to a polypeptide of Table 1. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-324.

[0075] Cyclic polyribonucleotides can be generated from precursors such as linear deoxyribonucleotides, cyclic deoxyribonucleotides, or cyclic polyribonucleotides.

[0076] The circular polyribonucleotide may, for example, comprise a splice junction connecting a 5' exon fragment and a 3' exon fragment.

[0077] The linear RNA molecule described herein is a polyribonucleotide that encodes an antifusogenic polypeptide. In some embodiments, the linear RNA molecule comprises, from 5' to 3', (A) a 3' catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo that encodes an antifusogenic polypeptide (e.g., a polyribonucleotide cargo that encodes an IRES that is operably linked to an expression sequence that encodes an antifusogenic polypeptide); (E) a 5' exon fragment; (F) a 5' splice site; (G) a 5' catalytic intron fragment. The catalytic intron fragment and the splice site can then allow the linear polyribonucleotide to self-splice, thus forming a circular polyribonucleotide that encodes an antifusogenic polypeptide.

[0078] Also featured are methods of using the cyclic polyribonucleotides described herein.For example, the cyclic polyribonucleotides can be formulated as compositions (e.g., pharmaceutical compositions) for administration to a subject, e.g., a human subject.The pharmaceutical compositions can be administered in one or more doses of the composition.The compositions can be administered to a subject to treat or prevent a viral infection (e.g., HIV, SARS-CoV-2, HCV, influenza, or RSV).

[0079] Polynucleotides The present disclosure features cyclic polyribonucleotide compositions encoding antifusogenic polypeptides, their uses, and methods for making cyclic polyribonucleotides encoding antifusogenic polypeptides. In some embodiments, the cyclic polyribonucleotides are generated from linear polyribonucleotides (e.g., by self-splicing compatible ends of linear polyribonucleotides). In some embodiments, the linear polyribonucleotides are transcribed from deoxyribonucleotide templates (e.g., vectors, linearized vectors, or cDNAs). Thus, the present disclosure features deoxyribonucleotides, linear polyribonucleotides, and cyclic polyribonucleotides and compositions thereof that are useful for producing cyclic polyribonucleotides encoding antifusogenic polypeptides.

[0080] Template deoxyribonucleotide The present invention features a template deoxyribonucleotide for making a circular RNA as described herein. In some embodiments, the deoxyribonucleotide comprises the following operably linked in a 5' to 3' direction: (A) a 3' catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo encoding an antifusogenic polypeptide; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' catalytic intron fragment. In embodiments, the deoxyribonucleotide comprises additional elements, for example, outside or between any of elements (A), (B), (C), (D), (E), (F), or (G). In embodiments, any of elements (A), (B), (C), (D), (E), (F), or (G) are separated from each other by a spacer sequence as described herein.

[0081] In embodiments, the deoxyribonucleotides are, for example, a circular DNA vector, a linearized DNA vector, or linear DNA (eg, generated from a DNA vector, e.g., cDNA).

[0082] In some embodiments, the deoxyribonucleotide further comprises an RNA polymerase promoter operably linked to the linear RNA coding sequence described herein. In embodiments, the RNA polymerase promoter is heterologous to the linear RNA coding sequence. In some embodiments, the RNA polymerase promoter is a T7 promoter, a T6 promoter, a T4 promoter, a T3 promoter, an SP6 viral promoter, or an SP3 promoter.

[0083] In some embodiments, the deoxyribonucleotides comprise a multiple cloning site (MCS).

[0084] In some embodiments, deoxyribonucleotides are used to generate circular RNAs having a size range of about 100 to about 20,000 nucleotides, in some embodiments, the circular RNAs are at least 100, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, or 5,000 nucleotides in size. In some embodiments, the circular RNA is less than or equal to 20,000, 15,000, 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, or 4,000 nucleotides in size.

[0085] Linear Polyribonucleotides The present invention also features linear polyribonucleotides encoding antifusogenic polypeptides. Linear polyribonucleotides can be used to generate circular polyribonucleotides, for example, by ligating or splicing (e.g., self-splicing) linear polyribonucleotides to generate circular polyribonucleotides. In some embodiments, the linear polyribonucleotides include the following operably linked in a 5' to 3' direction: (A) a 3' catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo encoding an antifusogenic polypeptide; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' catalytic intron fragment. In some embodiments, the linear polyribonucleotide includes additional elements, for example, additional elements outside or between any of elements (A), (B), (C), (D), (E), (F), or (G). For example, any of elements (A), (B), (C), (D), (E), (F), or (G) can be separated by a spacer sequence, as described herein.

[0086] In certain embodiments, provided herein is a method of generating a linear RNA encoding an antifusogenic polypeptide by performing transcription in a cell-free system (e.g., in vitro transcription) using a deoxyribonucleotide (e.g., a vector, a linearized vector, or a cDNA) encoding an antifusogenic polypeptide provided herein as a template (e.g., a vector, a linearized vector, or a cDNA provided herein in which an RNA polymerase promoter is positioned upstream of the region encoding the linear RNA).

[0087] In embodiments, the deoxyribonucleotide template is transcribed to produce a linear RNA containing the components described herein. Upon expression, the linear polyribonucleotide produces a splicing-compatible polyribonucleotide that can self-splice to produce a circular polyribonucleotide.

[0088] In some embodiments, the linear polyribonucleotide is 50 to 20,000, 100 to 20,000, 200 to 20,000, 300 to 20,000 (e.g., 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, In embodiments, the linear polyribonucleotide is at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.

[0089] Circular Polyribonucleotides In some embodiments, the present invention features a circular polyribonucleotide comprising an expression sequence encoding an antifusogenic polypeptide. In embodiments, the polyribonucleotide comprises an IRES operably linked to the expression sequence encoding the antifusogenic polypeptide. The circular polyribonucleotide may comprise a splice junction, for example, joining a 5' exon fragment and a 3' exon fragment. The circular polyribonucleotide may comprise any one or more of the elements described herein. In some embodiments, the circular polyribonucleotide comprises any feature or any combination of features disclosed in WO 2019 / 118919, which is incorporated herein by reference in its entirety.

[0090] In embodiments, the circular polynucleotide further comprises a polyribonucleotide cargo. In embodiments, the polyribonucleotide cargo comprises an expressed (or coding) sequence, a non-coding sequence, or a combination of expressed (coding) and non-coding sequences. In embodiments, the polyribonucleotide cargo comprises an expressed (coding) sequence encoding a polypeptide. In embodiments, the polyribonucleotide comprises an IRES operably linked to an expressed sequence encoding a polypeptide. In some embodiments, the IRES is located upstream of the expressed sequence. In some embodiments, the IRES is located downstream of the expressed sequence. In some embodiments, the circular polyribonucleotide further comprises a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment. The spacer region may, for example, be at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. The spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides. In some embodiments, the spacer region comprises a polyA sequence. In some embodiments, the spacer region comprises a polyAC sequence. In some embodiments, the spacer region comprises a polyAG sequence. In some embodiments, the spacer region comprises a polyAT sequence. In some embodiments, the spacer region comprises a random sequence. In some embodiments, the first annealing region and the second annealing region are linked, thereby forming a circular polyribonucleotide.

[0091] In some embodiments, the circular RNA is generated by a deoxyribonucleotide template or a linear RNA as described herein. In some embodiments, the circular RNA is generated by any of the methods described herein.

[0092] In some embodiments, a cyclic polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

[0093] In some embodiments, the cyclic polyribonucleotide is 500 to 20,000 nucleotides, 1,000 to 20,000 nucleotides, 2,000 to 20,000 nucleotides, or 5,000 to 20,000 nucleotides. In some embodiments, the cyclic polyribonucleotide is 500 to 10,000 nucleotides, 1,000 to 10,000 nucleotides, 2,000 to 10,000 nucleotides, or 5,000 to 10,000 nucleotides.

[0094] As a result of its circularization, circular polyribonucleotides may contain certain characteristics that distinguish it from linear RNA. For example, circular polyribonucleotides are less susceptible to exonuclease degradation compared to linear RNA. As such, circular polyribonucleotides are more stable than linear RNA, especially when incubated in the presence of exonucleases. The increased stability of circular polyribonucleotides compared to linear RNA makes them more useful as cell transformation reagents for producing polypeptides, and they can be stored more easily and for longer periods of time than linear RNA. The stability of exonuclease-treated circular polyribonucleotides can be tested using standard methods in the art to determine whether RNA degradation has occurred (e.g., by gel electrophoresis). Furthermore, unlike linear RNA, circular polyribonucleotides are less susceptible to dephosphorylation when circular polyribonucleotides are incubated with phosphatases, such as calf intestinal phosphatase.

[0095] The cyclic polyribonucleotides and compositions or pharmaceutical compositions described herein can be used in therapeutic and veterinary methods of dosing to produce a level of cyclic polyribonucleotide, a level of binding to a target, or a level of protein in a plurality of cells after providing the plurality of cells with at least two doses of cyclic polyribonucleotide.In some embodiments, the cyclic polyribonucleotide is non-immunogenic in mammals, such as humans. In some embodiments, the cyclic polyribonucleotides can replicate or replicate in cells from aquaculture animals (such as fish, crabs, shrimp, oysters, etc.), mammalian cells, such as cells from pet or zoo animals (such as cats, dogs, lizards, birds, lions, tigers and bears), cells from farm or work animals (such as horses, cows, pigs, chickens, etc.), human cells, cultured cells, primary cells or cell lines, stem cells, progenitor cells, differentiated cells, germ cells, cancer cells (e.g., tumorigenic, metastatic), non-tumorigenic cells (normal cells), fetal cells, embryonic cells, adult cells, mitotic cells, non-mitotic cells, or any combination thereof. In some embodiments, the invention includes cells comprising the cyclic polyribonucleotides described herein, the cells being cells from aquaculture animals (fish, crabs, shrimp, oysters, etc.), mammalian cells, such as cells from pet or zoo animals (cats, dogs, lizards, birds, lions, tigers and bears, etc.), cells from farm or work animals (horses, cows, pigs, chickens, etc.), human cells, cultured cells, primary cells or cell lines, stem cells, progenitor cells, differentiated cells, germ cells, cancer cells (e.g., tumorigenic, metastatic), non-tumorigenic cells (normal cells), fetal cells, embryonic cells, adult cells, mitotic cells, non-mitotic cells, or any combination thereof. In some embodiments, the cells are modified to comprise cyclic polyribonucleotides.

[0096] In some embodiments, the cyclic polyribonucleotide comprises a sequence for an expression product. In some embodiments, the cyclic polyribonucleotide comprises a binding site for binding to a target. In some embodiments, the cyclic polyribonucleotide is provided to the plurality of cells by any of the dosing regimens described herein. In some embodiments, the cyclic polyribonucleotide as described herein induces a response or level of response in the subject. In some embodiments, the expression product encoded by the sequence contained in the cyclic polyribonucleotide is expressed in one or more cells of the plurality of cells.

[0097] In some embodiments, the cyclic polyribonucleotide has a half-life at least that of its linear counterpart, e.g., the linear expression sequence or linear polyribonucleotide. In some embodiments, the cyclic polyribonucleotide has a half-life that is increased over the half-life of its linear counterpart. In some embodiments, the half-life is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more. In some embodiments, the cyclic polyribonucleotide has a half-life or persistence in cells of at least about 1 hour, e.g., at least 2 hours, 3 hours, 4 hours, 5 hours 6 hours, 12 hours, 24 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 6 months, or more. In some embodiments, the cyclic polyribonucleotide has a half-life or persistence in cells of about 1 hour to about 60 days, for example, about 1 hour, 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 35 days, 40 days, 45 days, 50 days, 55 days, or 60 days. In some embodiments, the cyclic polyribonucleotide has a half-life or persistence in cells while the cells are dividing. In some embodiments, the cyclic polyribonucleotide has a half-life or persistence in cells after division. In certain embodiments, the cyclic polyribonucleotide has a half-life or persistence in dividing cells of at least about 10 minutes, e.g., at least about 1 hour, e.g., at least 2 hours, 3 hours, 4 hours, 5 hours 6 hours, 12 hours, 24 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 6 months, or more.In certain embodiments, the cyclic polyribonucleotide has a half-life or persistence in dividing cells of about 10 minutes to about 60 days, e.g., about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or 60 days.

[0098] In some embodiments, the cyclic polyribonucleotide modulates cellular function, for example, transiently or chronically. In certain embodiments, the cellular function is stably altered, such as modulation that lasts for at least about 10 minutes, for example, at least about 1 hour, for example, at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 6 months or more. In certain embodiments, the cellular function is stably altered, such as a modulation lasting for about 1 hour to about 60 days, e.g., about 1 hour to about 30 days, e.g., at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or 60 days.

[0099] Polynucleotide Elements The polynucleotides described herein (eg, circular polyribonucleotides) can include any one or more of the elements described herein and an expression sequence that encodes an antifusogenic polypeptide.

[0100] Antifusogenic Polypeptides The present disclosure provides a circular polyribonucleotide that encodes at least one expression sequence that encodes an anti-fusogenic polypeptide.In some embodiments, the anti-fusogenic polypeptide inhibits viral entry.In some embodiments, the anti-fusogenic polypeptide inhibits viral fusion.

[0101] In some embodiments, the antifusogenic polypeptide is a polypeptide comprising an amino acid sequence selected from a sequence in Table 1 or a variant thereof. In some embodiments, the antifusogenic polypeptide is a polypeptide comprising a contiguous stretch of at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids of a sequence in Table 1. In some embodiments, the antifusogenic polypeptide is a polypeptide comprising a contiguous stretch of at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the amino acids of a sequence in Table 1. In some embodiments, the antifusogenic polypeptide is a polypeptide comprising a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a sequence in Table 1. In some embodiments, the antifusogenic polypeptide is a variant of a sequence in Table 1 comprising no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations (e.g., substitutions, deletions, or insertions). In some embodiments, the cyclic polyribonucleotide comprises an expression sequence encoding two or more antifusogenic polypeptides. In some embodiments, the cyclic polyribonucleotide encoding two or more fusion proteins reduces the chance of viral escape.

[0102] In some embodiments, the antifusogenic polypeptide targets one or more (e.g., 2, 3, 4, or 5) viruses. Viruses that can be targeted by the antifusogenic polypeptide include, but are not limited to, all virus strains listed in Table 1. In some embodiments, the virus does not infect humans. In some embodiments, the virus infects humans.

[0103]

Table 1-1

[0104]

Table 1-2

[0105]

Table 1-3

[0106]

Table 1-4

[0107]

Table 1-5

[0108]

Table 1-6

[0109]

Table 1-7

[0110]

Table 1-8

[0111]

Table 1-9

[0112]

Table 1-10

[0113]

Table 1-11

[0114]

Table 1-12

[0115]

Table 1-13

[0116]

Table 1-14

[0117]

Table 1-15

[0118]

Table 1-16

[0119]

Table 1-17

[0120]

Table 1-18

[0121]

Table 1-19

[0122]

Table 1-20

[0123]

Table 1-21

[0124] [Table 1-22]

[0125] [Table 1-23]

[0126] [Table 1-24]

[0127] [Table 1-25]

[0128] [Table 1-26]

[0129] [Table 1-27]

[0130] [Table 1-28]

[0131] In some embodiments, the virus is a human immunodeficiency virus (HIV) (e.g., the antifusogenic polypeptide inhibits viral entry of HIV). In some embodiments, the HIV is HIV-1. In some embodiments, the HIV is an HIV-1 strain (e.g., an HIV-1 HE , HIV-1 IIIB , HIV-1 MN , HIV-1 NDK , HIV-1 NL4-3 , HIV-1 RF, or HIV-1 SF2 In some embodiments, the HIV is an HIV-2 strain (e.g., HIV-2 EHO or HIV-2 ROD). In some embodiments, the HIV is an HIV pseudovirion. In some embodiments, the antifusogenic polypeptide prevents HIV viral fusion by specifically binding to HIV glycoprotein 120 (gp120). In some embodiments, the antifusogenic polypeptide prevents gp120 binding to cluster of differentiation 4 (CD4) co-receptor. In some embodiments, the antifusogenic polypeptide reduces the affinity of gp120 for co-receptors (e.g., CC chemokine receptor type 5 (CCR5) and CXC chemokine receptor type 4 (CXCR4)). In some embodiments, the antifusogenic polypeptide prevents gp120 binding to co-receptors (e.g., CCR5 and CXCR4). In some embodiments, the antifusogenic polypeptide prevents HIV viral fusion by specifically binding to HIV glycoprotein 41 (gp41). In some embodiments, the antifusogenic polypeptide inhibits HIV viral core entry into cells. In some embodiments the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide (e.g. a polypeptide that inhibits HIV viral entry) of any one of SEQ ID NOs: 1, 5, 11, 13-18, 22-38, 40-46, 49-56, 58, 59, 61, 66-78, 80-85, 87-91, 95-100, 112, 113, 153, 163, 64, 168, 169, 171-184, 211-215, 242, 243, 247, 255, 256, 258, 261, 261, 265, 267, 271, 272, 274, 276, 286, 287, or 312-324.In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g. at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of the polypeptides of SEQ ID NOs: 1, 5, 11, 13-18, 22-38, 40-46, 49-56, 58, 59, 61, 66-78, 80-85, 87-91, 95-100, 112, 113, 153, 163, 64, 168, 169, 171-184, 211-215, 242, 243, 247, 255, 256, 258, 261, 261, 265, 267, 271, 272, 274, 276, 286, 287, or 312-324.

[0132] In some embodiments, the virus is a hepatitis virus (e.g., the antifusogenic polypeptide inhibits viral entry of a hepatitis virus). In some embodiments, the hepatitis virus is a hepatitis A virus (HAV). In some embodiments, the hepatitis virus is a hepatitis B virus (HBV). In some embodiments, the hepatitis virus is a hepatitis C virus (HCV). In some embodiments, the hepatitis virus is a hepatitis D virus (HDV). In some embodiments, the hepatitis virus is a hepatitis E virus (HEV). In some embodiments, the hepatitis virus is a duck hepatitis virus (DHV). In some embodiments, the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide of any one of SEQ ID NOs: 104, 109, 112, 113, 141-145, 158-160, or 284 (e.g., a polypeptide that inhibits viral entry of a hepatitis virus, such as HCV). In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 104, 109, 112, 113, 141-145, 158-160, or 284.

[0133] In some embodiments, the virus is a coronavirus, e.g., a betacoronavirus (e.g., the antifusogenic polypeptide inhibits viral entry of a coronavirus). In some embodiments, the betacoronavirus is SARS-CoV type 1 (SARS-CoV-1). In some embodiments, the betacoronavirus is SARS-CoV type 2 (SARS-CoV-2). In some embodiments, the betacoronavirus is a pseudotyped virus that expresses the SARS-CoV-2 spike protein. In some embodiments, the polyribonucleotide cargo comprises an expression sequence that encodes a polypeptide of any one of SEQ ID NOs: 6-9, 119-123, 165-167, or 288-311 (e.g., a polypeptide that inhibits viral entry of a betacoronavirus, such as SARS-CoV-1 or SARS-CoV-2). In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 6-9, 119-123, 165-167, or 288-311.

[0134] In some embodiments, the virus is a respiratory syncytial virus (RSV) (e.g., the antifusogenic polypeptide inhibits viral entry of RSV). In some embodiments, the RSV is RSV subtype A (RSV A). In some embodiments, the RSV is RSV subtype B (RSV B). In some embodiments, the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide (e.g., a polypeptide that inhibits viral entry of RSV) of any one of SEQ ID NOs: 11, 13, 39, 112, 113, 153, 185-188, 216-219, 244, 246, 247-249, 251, 252, 257, 259, 264, 266, 268, 270, 273, 282, or 285. In some embodiments, the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g., at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of the polypeptides of SEQ ID NOs: 11, 13, 39, 112, 113, 153, 185-188, 216-219, 244, 246, 247-249, 251, 252, 257, 259, 264, 266, 268, 270, 273, 282, or 285.

[0135] In some embodiments, the virus is influenza (e.g., seasonal influenza, pandemic influenza, influenza A, influenza H1N1 subtype, influenza B, influenza C, influenza D). In some embodiments, the influenza is influenza A. In some embodiments, the influenza is influenza B. In some embodiments, the influenza is influenza C. In some embodiments, the influenza is influenza D. In some embodiments, the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide (e.g., a polypeptide that inhibits influenza viral entry) of any one of SEQ ID NOs: 1, 4, 11, 245, 247, 253, 262, 269, 275, 277, 278, 279, 280, 281, or 283. In some embodiments the polyribonucleotide cargo comprises an expressed sequence encoding a polypeptide having at least 85% (e.g. at least 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1, 4, 11, 245, 247, 253, 262, 269, 275, 277, 278, 279, 280, 281, or 283.

[0136] In some embodiments, the virus is an influenza virus (e.g., the antifusogenic polypeptide inhibits influenza viral entry). In some embodiments, the influenza virus is an influenza A virus (IAV). In some embodiments, the influenza virus is an influenza B virus (IBV). In some embodiments, the influenza virus is an influenza virus that expresses hemagglutinin (HA).

[0137] In some embodiments, the virus is a herpes simplex virus (HSV) (e.g., the antifusogenic polypeptide inhibits viral entry of HSV). In some embodiments, the HSV is HSV-1. In some embodiments, the HSV is HSV-2.

[0138] In some embodiments, the virus is a human papillomavirus (HPV) (e.g., the antifusogenic polypeptide inhibits viral entry of HPV). In some embodiments, the HPV is a high-risk HPV strain (e.g., HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, or HPV58). In some embodiments, the HPV is a low-risk HPV strain (e.g., HPV6, HPV11, HPV42, HPV43, HPV or 44).

[0139] In some embodiments, the virus is any virus listed in Table 1.

[0140] In some embodiments, the GC content of the nucleic acid sequence encoding the antifusogenic polypeptide is at least 51% (e.g., at least 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%). In some embodiments, the GC content of the nucleic acid sequence encoding the antifusogenic polypeptide is at most 52%, 53%, 54%, 55%, 56%, 57%, 58%, or 59%, or 60%. In some embodiments, the GC content of the nucleic acid sequence encoding the antifusogenic polypeptide is 51%-60%, 52%-60%, 53%-60%, 54%-60%, 55%-60%, 52%-58%, or 53%-58%.

[0141] In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the antifusogenic polypeptide is greater than 10% (e.g., greater than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the antifusogenic polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the antifusogenic polypeptide is between 20% and 28%, between 21% and 26%, between 10% and 24%, between 15% and 24%, between 20% and 24%, between 21% and 24%, between 22% and 24%, between 23% and 24%, between 10% and 23%, between 15% and 23%, between 20% and 23%, between 21% and 23%, or between 22% and 23%.

[0142] The GC content of an expressed sequence encoding an antifusogenic polypeptide refers to the GC content of the expressed sequence that exclusively encodes an antifusogenic polypeptide and does not contain other coding regions that encode polypeptides other than the antifusogenic polypeptide. Similarly, the uridine content or thymidine content of an expressed sequence encoding an antifusogenic polypeptide refers to the uridine content of an expressed sequence that exclusively encodes an antifusogenic polypeptide and does not contain other coding regions that encode polypeptides other than the antifusogenic polypeptide. In some embodiments, the calculation of the GC content or uridine (or thymidine) content of an expressed sequence encoding an antifusogenic polypeptide takes into account only the contiguous nucleic acid sequence starting in the 5' to 3' direction from the first nucleoside of the start codon of the open reading frame encoding the antifusogenic polypeptide to the last nucleoside of the stop codon of the same open reading frame. In other embodiments, the calculation of the GC content or uridine (or thymidine) content of an expressed sequence encoding an antifusogenic polypeptide takes into account only the contiguous nucleic acid sequence starting in the 5' to 3' direction from the first nucleoside of the codon encoding the N-terminal amino acid residue of the antifusogenic polypeptide to the last nucleoside of the codon encoding the C-terminal amino acid residue of the antifusogenic polypeptide.

[0143] In some embodiments, the nucleic acid sequence encoding the antifusogenic polypeptide has a uridine content of more than 20%. In some embodiments, the uridine content of the nucleic acid sequence encoding the antifusogenic polypeptide is more than 10% (e.g., more than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content of the nucleic acid sequence encoding the antifusogenic polypeptide is up to 30% (e.g., up to 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content of the nucleic acid sequence encoding the antifusogenic polypeptide is between 20% and 28%, between 21% and 26%, between 10% and 24%, between 15% and 24%, between 20% and 24%, between 21% and 24%, between 22% and 24%, between 23% and 24%, between 10% and 23%, between 15% and 23%, between 20% and 23%, between 21% and 23%, or between 22% and 23%. In some embodiments, the nucleic acid sequence encoding the antifusogenic polypeptide has a uridine content of between 20% and 28%.

[0144] Multiple Antifusogenic Polypeptides In some embodiments, the circular polyribonucleotide encodes multiple expression sequences (e.g., two or more expression sequences, such as 2-100, 2-50, 2-20, 2-10, 5-100, 5-50, 5-20, or 5-10), each encoding an antifusogenic polypeptide.

[0145] In some embodiments, a circular polyribonucleotide encodes two or more (e.g., 2-100, 2-50, 2-20, 2-10, 5-100, 5-50, 5-20, or 5-10) copies of the same antifusogenic polypeptide.

[0146] In some embodiments, the cyclic polyribonucleotide encodes two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) different (e.g., sharing less than 100% sequence identity) anti-fusogenic polypeptides. In some embodiments, each of the two or more different anti-fusogenic polypeptides is selected from the anti-fusogenic polypeptides in Table 1. In some embodiments, each of the two or more different anti-fusogenic polypeptides inhibits a different virus. For example, the cyclic polyribonucleotide may encode a first anti-fusogenic polypeptide that inhibits influenza and a second anti-fusogenic polypeptide that inhibits RSV. The cyclic polyribonucleotide may include a first anti-fusogenic polypeptide that inhibits influenza and a second anti-fusogenic polypeptide that inhibits SARS-CoV-2. The cyclic polyribonucleotide may include a first anti-fusogenic polypeptide that inhibits HIV and a second anti-fusogenic polypeptide that inhibits SARS-CoV-2. The cyclic polyribonucleotide may include a first anti-fusogenic polypeptide that inhibits HIV and a second anti-fusogenic polypeptide that inhibits HCV. Where either the first or second antifusogenic polypeptide inhibits multiple viruses, the first and second antifusogenic polypeptides may have different virus specificities.

[0147] When a circular polyribonucleotide encodes more than one antifusogenic polypeptide, the antifusogenic polypeptides may be encoded in a single open reading frame or in multiple open reading frames.

[0148] In some embodiments, the present disclosure provides a circular polyribonucleotide comprising an open reading frame (e.g., an open reading frame operably linked to an IRES) comprising two or more expression sequences, each of which encodes an antifusogenic polypeptide. In some embodiments, translation of the open reading frame produces a polypeptide fusion comprising two or more antifusogenic polypeptides. The antifusogenic polypeptides can be linked, for example, by a linker as described herein (e.g., a peptide linker encoded by the open reading frame, such as a glycine-serine linker described below for peptide-Fc fusions). In some embodiments, the antifusogenic polypeptides can be separated by a cleavage domain (e.g., a staggered sequence), for example, as described herein.

[0149] In some embodiments, the disclosure provides a circular polyribonucleotide comprising a first open reading frame encoding a first anti-membrane fusion polypeptide (e.g., operably linked to a first IRES) and a second open reading frame encoding a second anti-membrane fusion polypeptide (e.g., operably linked to a second IRES).

[0150] Antifusogenic polypeptide-Fc fusions In some embodiments, the cyclic polyribonucleotide comprises an expression sequence encoding a fusion protein comprising an antifusogenic polypeptide. In some embodiments, the fusion protein comprises an antifusogenic polypeptide fused to an Fc domain (e.g., a single chain of an Fc domain) of an immunoglobulin. In some embodiments, the antifusogenic polypeptide is selected from Table 1. In some embodiments, the cyclic polyribonucleotide comprises an expression sequence encoding two or more fusion proteins comprising an antifusogenic polypeptide. In some embodiments, the cyclic polyribonucleotide comprises an expression sequence encoding two or more antifusogenic polypeptides. In some embodiments, the cyclic polyribonucleotide encoding two or more fusion proteins reduces the chance of viral escape.

[0151] In some embodiments, the Fc domain is an IgG4 Fc domain or a fragment thereof. In some embodiments, the Fc domain is an IgG1 Fc domain or a fragment thereof. In some embodiments, the Fc domain is an IgG2 Fc domain or a fragment thereof. In some embodiments, the Fc domain is an IgG2a Fc domain or a fragment thereof. In some embodiments, the Fc domain is an IgG2b Fc domain or a fragment thereof. In some embodiments, the Fc domain is an IgG3 Fc domain or a fragment thereof.

[0152] In some embodiments, the C-terminal amino acid residue of the antifusogenic polypeptide is fused to the N-terminal amino acid residue of the Fc domain, optionally via a peptide linker. In some embodiments, the N-terminal amino acid residue of the antifusogenic polypeptide is fused to the C-terminal amino acid residue of the Fc domain, optionally via a peptide linker. In some embodiments, the peptide linker between the antifusogenic polypeptide and the Fc domain comprises at least two amino acid residues (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 amino acid residues). In some embodiments, the peptide linker between the antifusogenic polypeptide and the Fc domain is 2 to 200 amino acid residues (e.g., 2 to 200, 2 to 180, 2 to 160, 2 to 140, 2 to 120, 2 to 100, 2 to 90, 2 to 80, 2 to 70, 2 to 60, 2 to 50, 2 to 45, 2 to 40, 2 to 35, 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 7, 2 to 8, 2 to 9, 2 to 10 ... 4, 4 to 200, 5 to 200, 6 to 200, 7 to 200, 8 to 200, 9 to 200, 10 to 200, 15 to 200, 20 to 200, 25 to 200, 30 to 200, 35 to 200, 40 to 200, 45 to 200, 50 to 200, 60 to 200, 70 to 200, 80 to 200, 90 to 200, 100 to 200, 120 to 200, 140 to 200, 160 to 200, or 180 to 200 amino acid residues). In some embodiments, the peptide linker comprises a glycine (Gly) residue and a serine (Ser) residue. In some embodiments, the peptide linker comprises a GS residue. x , (GGS) x , (GGGGS) x , (GGSG) x , or (SGGG) x (x is an integer of 1 to 50 (e.g., 1 to 40, 1 to 30, 1 to 20, 1 to 10, or 1 to 5)). In some embodiments, the peptide linker comprises any one of the amino acid sequences of (GS) x , (GGS) x , (GGGGS) x , (GGSG) x, or (SGGG) x (x is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, the peptide linker comprises 6 to 36 amino acids. In some embodiments, the peptide linker comprises 21 to 31 amino acids.

[0153] Polyribonucleotide Cargo The polyribonucleotide cargo described herein includes any sequence that includes at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo includes an expressed sequence, a non-coding sequence, or an expressed sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo includes an expressed sequence that encodes an antifusogenic polypeptide. In some embodiments, the polyribonucleotide cargo includes an IRES operably linked to an expressed sequence that encodes an antifusogenic polypeptide. In some embodiments, the polyribonucleotide cargo includes an expressed sequence that encodes an antifusogenic polypeptide that has a biological effect on a subject.

[0154] The polyribonucleotide cargo may comprise, for example, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments the polyribonucleotide cargo comprises from 1 to 20,000 nucleotides, from 1 to 10,000 nucleotides, from 1 to 5,000 nucleotides, from 100 to 20,000 nucleotides, from 100 to 10,000 nucleotides, from 100 to 5,000 nucleotides, from 500 to 20,000 nucleotides, from 500 to 10,000 nucleotides, from 500 to 5,000 nucleotides, from 1,000 to 20,000 nucleotides, from 1,000 to 10,000 nucleotides, or from 1,000 to 5,000 nucleotides.

[0155] In embodiments, the polyribonucleotide cargo comprises one or more expressed (or coding) sequences, where each expressed (or coding) sequence encodes a polypeptide (e.g. an antifusogenic polypeptide). In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences. In embodiments, the polyribonucleotide cargo consists entirely of non-coding sequences. In embodiments, the polyribonucleotide cargo comprises a combination of expressed (or coding) sequences and non-coding sequences.

[0156] In some embodiments, the polyribonucleotide comprises any feature, or any combination of features, as disclosed in WO 2019 / 118919, the entirety of which is incorporated by reference herein.

[0157] Polypeptide Expression Sequences In some embodiments, a polyribonucleotide described herein (e.g., a polyribonucleotide cargo of a circular polyribonucleotide) comprises one or more expressed (or coding) sequences, where each expressed sequence encodes an antifusogenic polypeptide. In some embodiments, a circular polyribonucleotide comprises two, three, four, five, six, seven, eight, nine, ten or more expressed (or coding) sequences.

[0158] Each encoded polypeptide may be linear or branched. In various embodiments, the polypeptide has a length of about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, polypeptides have a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less that may be useful.

[0159] The polypeptides included herein may include naturally occurring or non-naturally occurring polypeptides. In some embodiments, the polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., a biologically active fragment or variant of an antifusogenic polypeptide). For example, the polypeptide may be a functionally active variant of any of the polypeptides described herein that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of a polypeptide described herein or a naturally occurring polypeptide, e.g., over a specific region or over the entire sequence. In some cases, a polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) identity to a protein of interest.

[0160] In embodiments, the polypeptide comprises multiple polypeptides, e.g., multiple copies of a single polypeptide sequence, or multiple different polypeptide sequences, In embodiments, the multiple polypeptides are connected by linker or spacer amino acids.

[0161] In an embodiment, the polynucleotide cargo comprises a sequence encoding a signal peptide. Many signal peptide sequences have been described, for example, the Tat (twin arginine translocation) signal sequence is typically an N-terminal peptide sequence containing a consensus SRRxFLK "twin arginine" motif that serves to translocate folded proteins containing such Tat signal peptides through lipid bilayers. Also see, for example, the publicly available signal peptide database at www[dot]signalpeptide[dot]de. Signal peptides are also useful for directing proteins to specific organelles; see, for example, the experimentally determined and computationally predicted signal peptides disclosed in the publicly available Spdb signal peptide database at proline.bic.nus.edu.sg / spdb.

[0162] In some embodiments, the expressed (or coding) sequence comprises a polyA sequence (e.g., at the 3' end of the expressed sequence). In some embodiments, the length of the polyA sequence is more than 10 nucleotides in length. In one embodiment, the polyA sequence is more than 15 nucleotides in length (e.g., is at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length). In some embodiments, the polyA sequence is designed according to the description of polyA sequences in paragraphs

[0202] to

[0204] of WO 2019 / 118919 A1, the entirety of which is incorporated herein by reference. In some embodiments, the expression sequence lacks a polyA sequence (e.g., at the 3' end of the expression sequence).

[0163] In some embodiments, the cyclic polyribonucleotide comprises a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide lacks a polyA or has a modified polyA to improve one or more functional properties, such as immunogenicity (e.g., the level of one or more markers of an immune or inflammatory response), half-life, and / or expression efficiency.

[0164] Internal ribosome entry sites In some embodiments, the circular polyribonucleotides described herein contain one or more internal ribosome entry sites (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression sequences (e.g., each IRES is operably linked to one or more expression sequences). In embodiments, the IRES is located between the heterologous promoter and the 5' end of the coding sequence.

[0165] IRES elements suitable for inclusion within a polyribonucleotide comprise an RNA sequence capable of associating with a eukaryotic ribosome, hi some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.

[0166] In some embodiments, the IRES element is derived from DNA of organisms including, but not limited to, viruses, mammals, and Drosophila. Such viral DNA can be derived from, but is not limited to, encephalomyocarditis virus (EMCV) cDNA and poliovirus cDNA, as well as picornavirus complementary DNA (cDNA). In one embodiment, the Drosophila DNA from which the IRES element is derived includes, but is not limited to, the antennapedia gene from Drosophila melanogaster.

[0167] In some embodiments, the IRES sequence is selected from the group consisting of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invictavirus 1, Rhopalopsis aphid virus, Reticuloendotheliosis virus, Fuman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, Human rhinovirus 2 (HRV-2), Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, virus, Tea grass moth picorna-like virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen brood virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus (AEV), Acute bee paralysis virus, Hibiscus chlorotic ringspot virus virus), classical swine fever virus, human FGF2, human SFTPAl, human AMLl / RUNXl, Drosophila antennapedia, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Salivirus, cosavirus, parechovirus, Drosophila hairless, yeast (S. cerevisiae) TFIID, yeast (S.cerevisiae YAP1, human c-src, human FGF-1, picomavirus, Turnip crinkle virus, Aichi virus, Krohi virus, Echovirus 11, an aptamer for eIF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2) IRES sequence. In yet another embodiment, the IRES is a Coxsackievirus B3 (CVB3) IRES sequence. In a further embodiment, the IRES is an encephalomyocarditis virus IRES sequence. In a further embodiment, the IRES is a Theiler's encephalomyelitis virus IRES sequence.

[0168] The IRES sequence may have a modified sequence compared to the wild-type IRES sequence.In some embodiments, if the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence may be modified so that it is a cytosine residue.For example, the IRES sequence may be a CVB3 IRES sequence in which the terminal adenosine residue is modified to a cytosine residue.In some embodiments, the modified CVB3 IRES may have the following nucleic acid sequence: [ka]

[0169] In some embodiments, the IRES sequence is an Enterovirus 71 (EV17) IRES. In some embodiments, the terminal guanosine residue of the EV17 IRES sequence is modified to a cytosine residue. In some embodiments, the modified EV71 IRES may have the following nucleic acid sequence: [ka]

[0170] In some embodiments, the polyribonucleotide comprises at least one IRES flanking at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, an IRES flanks both sides of at least one (e.g., two, three, four, five or more) expressed sequence. In some embodiments, the polyribonucleotide comprises one or more IRES sequences on either or both sides of each expressed sequence, resulting in separation of the resulting peptides and / or polypeptides. For example, the polyribonucleotides described herein can comprise a first IRES operably linked to a first expressed sequence and a second IRES operably linked to a second expressed sequence.

[0171] In some embodiments, a polyribonucleotide described herein comprises an IRES (eg, an IRES operably linked to a coding region). For example, polyribonucleotides can be prepared using the methods described in Chen et al. MOL. CELL 81(20):4300-18, 2021; Jopling et al. ONCOGENE 20:2664-70, 2001; Baranick et al. PNAS 105(12):4733-38, 2008; Lang et al. MOLECULAR BIOLOGY OF THE CELL 13(5):1792-1801, 2002; Dorokhov et al. PNAS 99(8):5301-06, 2002; Wang et al. NUCLEIC ACIDS RESEARCH 33(7):2248-58, 2005; Petz et al. NUCLEIC ACIDS RESEARCH 35(8):2473-82, 2007; Chen et al. al. SCIENCE 268:415-417, 1995; Fan et al. NATURE COMMUNICATION 13(1):3751-3765, 2022, and WO 2021 / 263124.

[0172] Signal sequence In some embodiments, the antifusogenic polypeptides expressed from the cyclic polyribonucleotides disclosed herein include secretory proteins, such as proteins that naturally contain a signal sequence, or proteins that do not normally encode a signal sequence but have been modified to contain one. In some embodiments, the antifusogenic polypeptides encoded by the cyclic polyribonucleotides include a secretory signal. For example, the secretory signal can be a secretory signal that is naturally encoded for the secretory protein. In another example, the secretory signal can be a modified secretory signal for the secretory protein. In other embodiments, the antifusogenic polypeptides encoded by the cyclic polyribonucleotides do not include a secretory signal.

[0173] In some embodiments, the signal sequence is selected from SecSP38 (MWWRLWWLLLLLLLLWPMVWA; SEQ ID NO: 327); SecD4 (MWWLLLLLLLLWPMVWA; SEQ ID NO: 328), gLuc (MGVKVLFALICIAVAEAK; SEQ ID NO: 329); INHC1 (MASRLTLLTLLLLLLAGDRASS; SEQ ID NO: 330); Epo (MGVHECPAWLWLLLSLLSLPLGLPVLG; SEQ ID NO: 331); and IL-2 (MYRMQLLSCIALSLALVTNS; SEQ ID NO: 332).

[0174] In some embodiments, the cyclic polyribonucleotide encodes multiple copies of the same anti-fusion polypeptide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more). In some embodiments, at least one copy of the anti-fusion polypeptide includes a signal sequence and at least one copy of the anti-fusion polypeptide does not include a signal sequence. In some embodiments, the cyclic polyribonucleotide encodes multiple anti-fusion polypeptides (e.g., multiple different anti-fusion polypeptides or multiple anti-fusion polypeptides having less than 100% sequence identity), at least one of the multiple anti-fusion polypeptides includes a signal sequence and at least one copy of the multiple anti-fusion polypeptides does not include a signal sequence.

[0175] In some embodiments, the signal sequence is a wild-type signal sequence present at the N-terminus of the corresponding wild-type antifusogenic polypeptide, e.g., when endogenously expressed. In some embodiments, the signal sequence is heterologous to the antifusogenic polypeptide, e.g., not present when the wild-type antifusogenic polypeptide is endogenously expressed. The polyribonucleotide sequence encoding the antifusogenic polypeptide may be modified to remove nucleotide sequences encoding the wild-type signal sequence and / or to add sequences encoding a heterologous signal sequence.

[0176] The polypeptide encoded by the polyribonucleotide (e.g., an antifusogenic polypeptide) may contain a signal sequence that directs the antifusogenic polypeptide to the secretory pathway. In some embodiments, the signal sequence may direct the antifusogenic polypeptide to be present in a specific organelle (e.g., the endoplasmic reticulum, the Golgi apparatus, or an endosome). In some embodiments, the signal sequence directs the antifusogenic polypeptide to be secreted from the cell. In the case of a secreted protein, the signal sequence may be cleaved after secretion to result in the mature protein. In other embodiments, the signal sequence may be embedded in the membrane of the cell or a specific organelle to form a transmembrane segment that anchors the protein to the membrane of the cell, the endoplasmic reticulum, or the Golgi apparatus. In certain embodiments, the signal sequence of a transmembrane protein is a short sequence at the N-terminus of the polypeptide. In other embodiments, the first transmembrane domain acts as a first signal sequence that targets the protein to the membrane.

[0177] In some embodiments, the secretion signal is a human interleukin-2 (IL-2) secretion signal. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 90% sequence identity to MYRMQLLSCIALSLALVTNS (SEQ ID NO: 332). In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 332. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 332. In some embodiments, the IL-2 secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 332.

[0178] In some embodiments, the secretion signal is a Gaussia luciferase secretion signal. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 90% sequence identity to MGVKVLFALICIAVAEAK (SEQ ID NO: 329). In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 329. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 329. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 329.

[0179] In some embodiments, the secretion signal is an EPO (e.g., human EPO) secretion signal. In some embodiments, the EPO secretion signal has an amino acid sequence with at least 90% sequence identity to MGVHECPAWLWLLLSLLSLPLGLPVLGA (SEQ ID NO: 333). In some embodiments, the EPO secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 333. In some embodiments, the EPO secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 333. In some embodiments, the EPO secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 333.

[0180] In some embodiments, the secretion signal is a wild-type SARS-CoV-2 secretion signal. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence of at least 90% sequence identity to MFVFLVLLPLVSS (SEQ ID NO: 334). In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence of at least 95% sequence identity to SEQ ID NO: 334. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence of at least 99% sequence identity to SEQ ID NO: 334. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence of 100% sequence identity to SEQ ID NO: 334.

[0181] In some embodiments, the antifusogenic polypeptide encoded by the polyribonucleotide comprises either a secretory signal sequence, a transmembrane insertion signal sequence, or no signal sequence.

[0182] Adjustment element In some embodiments, a polyribonucleotide described herein (e.g., a polyribonucleotide cargo of a polyribonucleotide) comprises one or more regulatory elements. In some embodiments, a polyribonucleotide comprises a regulatory element, e.g., a sequence that regulates expression of an expression sequence within the polyribonucleotide.

[0183] Regulatory elements may include sequences located adjacent to the expression sequence that codes for the expression product. Regulatory elements may be operably linked to adjacent sequences. Regulatory elements may increase the amount of expressed product compared to the amount of expressed product in the absence of the regulatory element. Furthermore, one regulatory element may increase the amount of expressed product for multiple expression sequences that are linked side by side. Thus, one regulatory element can promote the expression of one or more expression sequences. Multiple regulatory elements are well known to those skilled in the art.

[0184] In some embodiments, the regulatory element is a translation modulator. The translation modulator may regulate the translation of an expressed sequence in the polyribonucleotide. The translation modulator may be a translation enhancer or suppressor. In some embodiments, the polyribonucleotide comprises at least one translation modulator adjacent to at least one expressed sequence. In some embodiments, the polyribonucleotide comprises a translation modulator adjacent to each expressed sequence. In some embodiments, the translation modulator is on one or both sides of each expressed sequence, resulting in the separation of the expression products, e.g., peptides and / or polypeptides.

[0185] In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.

[0186] Further examples of regulatory elements are described, for example, in paragraphs

[0154] to

[0161] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0187] Cleavage Domain A circular polyribonucleotide of the disclosure can include a cleavage domain (e.g., a stagger element or a cleavage sequence).

[0188] The term "stagger element" refers to a moiety, e.g., a nucleotide sequence, that induces ribosome pausing during translation. In some embodiments, the stagger element is a non-conserved sequence of amino acids with strong alpha-helical propensity, followed by the consensus sequence -D(V / I)ExNPGP, where x=any amino acid (SEQ ID NO: 335). In some embodiments, the stagger element can include a chemical moiety, such as glycerol, a non-nucleic acid linking moiety, a chemical modification, a modified nucleic acid, or any combination thereof.

[0189] In some embodiments, the cyclic polyribonucleotide comprises at least one stagger element flanking the expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element flanking each expressed sequence. In some embodiments, the stagger element is present on one or both sides of each expressed sequence, resulting in separation of the expression products, e.g., peptides and / or polypeptides. In some embodiments, the stagger element is part of one or more expressed sequences. In some embodiments, the cyclic polyribonucleotide comprises one or more expressed sequences, each of which is separated from the subsequent expressed sequence by a stagger element on the cyclic polyribonucleotide. In some embodiments, the stagger element prevents the generation of a single polypeptide from (a) two translations of a single expressed sequence, or (b) one or more translations of two or more expressed sequences. In some embodiments, the stagger element is a separate sequence from one or more expressed sequences. In some embodiments, the stagger element comprises a portion of an expressed sequence of one or more expressed sequences.

[0190] In some embodiments, the circular polyribonucleotide comprises a stagger element. To avoid the production of continuous expression products, such as peptides or polypeptides, while maintaining rolling circle translation, a stagger element can be included to induce ribosome pausing during translation. In some embodiments, the stagger element is at the 3' end of at least one of the one or more expressed sequences. The stagger element can be configured to stall ribosomes during rolling circle translation of the circular polyribonucleotide. The stagger element can include, but is not limited to, 2A-like or CHYSEL (SEQ ID NO: 336) (cis-acting hydrolase element) sequences. In some embodiments, the stagger element encodes a sequence having a C-terminal consensus sequence that is X1X2X3EX5NPGP (SEQ ID NO: 337), where X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid. In some embodiments, the sequence comprises a non-conserved sequence of amino acids with a strong alpha-helical propensity followed by the consensus sequence -D(V / I)EXNPGP (SEQ ID NO:338), where x=any amino acid. Some non-limiting examples of stagger elements include GDVESNPGP (SEQ ID NO:339), GDIEENPGP (SEQ ID NO:340), VEPNPGP (SEQ ID NO:341), IETNPGP (SEQ ID NO:342), GDIESNPGP (SEQ ID NO:343), GDVELNPGP (SEQ ID NO:344), GDIETNPGP (SEQ ID NO:345), GDVENPGP (SEQ ID NO:346), GDVEENPGP (SEQ ID NO:347), GDVEQNPGP (SEQ ID NO:348), IESNPGP (SEQ ID NO:349), GDIELNPGP (SEQ ID NO:350), HDIETPGP (SEQ ID NO:351), HDVETNPGP (SEQ ID NO:352), HDVEMNPGP (SEQ ID NO:353), GDMESNPGP (SEQ ID NO:354), GDVETNPGP (SEQ ID NO:355), GDIEQNPGP (SEQ ID NO:356), and DSEFNPGP (SEQ ID NO:357).

[0191] In some embodiments, the stagger elements described herein cleave the expression product, such as between the G and P of the consensus sequences described herein. As one non-limiting example, the cyclic polyribonucleotide comprises at least one stagger element for cleaving the expression product. In some embodiments, the cyclic polyribonucleotide comprises a stagger element adjacent to at least one expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element after each expressed sequence. In some embodiments, the cyclic polyribonucleotide comprises a stagger element present on one or both sides of each expressed sequence, resulting in the translation of individual peptides and / or polypeptides from each expressed sequence.

[0192] In some embodiments, the stagger element comprises one or more modified or non-natural nucleotides that induce ribosome pausing during translation. Non-natural nucleotides can include peptide nucleic acids (PNAs), morpholinos and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Examples such as these are distinguished from naturally occurring DNA or RNA by changes in the backbone of the molecule. Exemplary modifications can include any modification to the sugar, nucleobase, internucleoside bond (e.g., to the linking phosphate / to the phosphodiester bond / to the phosphodiester backbone), and any combination thereof that can induce ribosome pausing during translation. Some of the exemplary modifications provided herein are described elsewhere herein.

[0193] In some embodiments, the stagger element is present in the circular polyribonucleotide in other forms. For example, in some exemplary circular polyribonucleotides, the stagger element comprises a termination element of a first expression sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination element from a first translation initiation sequence of expression following the first expression sequence. In some examples, the first stagger element of the first expression sequence is upstream (5') of the first translation initiation sequence of expression following the first expression sequence in the circular polyribonucleotide. In some cases, the first expression sequence and the expression sequence following the first expression sequence are two separate expression sequences in the circular polyribonucleotide. The distance between the first stagger element and the first translation initiation sequence may allow for continuous translation of the first expression sequence and the subsequent expression sequence.

[0194] In some embodiments, the first stagger element comprises a termination element, which separates the expression product of a first expression sequence from the expression product of the subsequent expression sequence, thereby creating discrete expression products. In some cases, a circular polyribonucleotide comprising a first stagger element upstream of a first translation initiation sequence of a subsequent sequence in the circular polyribonucleotide is translated continuously, and a corresponding circular polyribonucleotide comprising a stagger element of a second expression sequence upstream of a second translation initiation sequence of a subsequent expression sequence of a second expression sequence is not translated continuously. In some cases, there is only one expression sequence in the circular polyribonucleotide, and the first expression sequence and the subsequent expression sequence are the same expression sequence. In some exemplary circular polyribonucleotides, the stagger element comprises a first termination element of a first expression sequence in the circular polyribonucleotide and a nucleotide spacer sequence that separates the termination element from a downstream translation initiation sequence. In some such examples, the first stagger element is upstream (5') of a first translation initiation sequence of a first expression sequence in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation initiation sequence allows for continuous translation of the first expressed sequence and any subsequent expressed sequences.

[0195] In some embodiments, the first stagger element separates the expression products of one round of the first expression sequence from the expression products of the next round of the first expression sequence, thereby creating discrete expression products. In some cases, a circular polyribonucleotide that includes a first stagger element upstream of a first translation initiation sequence of a first expression sequence in a circular polyribonucleotide is translated continuously, and a corresponding circular polyribonucleotide that includes a stagger element upstream of a second translation initiation sequence of a second expression sequence in a corresponding circular polyribonucleotide is not translated continuously. In some cases, the distance between the second stagger element and the second translation initiation sequence is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold greater in the corresponding circular polyribonucleotide than the distance between the first stagger element and the first translation initiation in the circular polyribonucleotide. In some cases, the distance between the first stagger element and the first translation start is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or more. In some embodiments, the distance between the second staggered element and the second translation start is at least 2nt, 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 25nt, 30nt, 35nt, 40nt, 45nt, 50nt, 55nt, 60nt, 65nt, 70nt, 75nt, or greater than the distance between the first staggered element and the first translation start. In some embodiments, the circular polyribonucleotide comprises two or more expressed sequences.

[0196] Examples of stagger elements are described in paragraphs

[0172] to

[0175] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0197] In some embodiments, the multiple anti-fusion polypeptides encoded by the cyclic ribonucleotide can be separated by an IRES between each anti-fusion polypeptide (e.g., each anti-fusion polypeptide is operably linked to a separate IRES). For example, the cyclic polyribonucleotide can include a first IRES operably linked to a first expression sequence and a second IRES operably linked to a second expression sequence. The IRES can be the same IRES between all the anti-fusion polypeptides. The IRES can be different between different anti-fusion polypeptides.

[0198] In some embodiments, the antifusogenic polypeptides can be separated by a 2A self-cleaving peptide. For example, a circular polyribonucleotide can encode an IRES operably linked to an open reading frame encoding a first antifusogenic polypeptide, 2A, and a second antifusogenic polypeptide.

[0199] In some embodiments, the multiple antifusogenic polypeptides can be separated by a protease cleavage site (e.g., a furin cleavage site). For example, a circular polyribonucleotide can encode an IRES operably linked to an open reading frame encoding a first antifusogenic polypeptide, a protease cleavage site (e.g., a furin cleavage site), and a second antifusogenic polypeptide.

[0200] In some embodiments, the multiple antifusogenic polypeptides may be separated by a 2A autocleavage peptide and a protease cleavage site (e.g., a furin cleavage site). For example, a circular polyribonucleotide may encode an IRES operably linked to an open reading frame encoding a first antifusogenic polypeptide, 2A, a protease cleavage site (e.g., a furin cleavage site), and a second antifusogenic polypeptide. A circular polyribonucleotide may also encode an IRES operably linked to an open reading frame encoding a first antifusogenic polypeptide, a protease cleavage site (e.g., a furin cleavage site), 2A, and a second antifusogenic polypeptide. The tandem 2A and furin cleavage site may be referred to as furin 2A (including furin-2A or 2A-furin, arranged in either orientation).

[0201] Furthermore, multiple antifusogenic polypeptides encoded by cyclic ribonucleotides can be separated by both IRES and 2A sequences. For example, an IRES can be between one antifusogenic polypeptide and a second antifusogenic polypeptide, while a 2A peptide can be between the second antifusogenic polypeptide and a third antifusogenic polypeptide. Selection of a specific IRES or 2A self-cleaving peptide can be used to control the expression level of the antifusogenic polypeptide under the control of the IRES or 2A sequence. For example, depending on the IRES and / or 2A peptide selected, expression on the polypeptide can be higher or lower.

[0202] In some embodiments, the circular polyribonucleotide comprises at least one cleavage sequence. In some embodiments, the cleavage sequence is adjacent to an expression sequence. In some embodiments, the cleavage sequence is between two expression sequences. In some embodiments, the cleavage sequence is included in the expression sequence. In some embodiments, the circular polyribonucleotide comprises 2-10 cleavage sequences. In some embodiments, the circular polyribonucleotide comprises 2-5 cleavage sequences. In some embodiments, multiple cleavage sequences are between multiple expression sequences, for example, the circular polyribonucleotide may comprise three expression sequences, two cleavage sequences, such that there is a cleavage sequence between each expression sequence. In some embodiments, the circular polyribonucleotide comprises a cleavage sequence, such as in a sacrificial circRNA or a cleavable circRNA or a self-cleaving circRNA. In some embodiments, the circular polyribonucleotide comprises two or more cleavage sequences that result in the separation of the circular polyribonucleotide into multiple products, such as miRNA, linear RNA, smaller circular polyribonucleotides, etc.

[0203] In some embodiments, the cleavage sequence comprises a ribozyme RNA sequence. Ribozymes (from ribonucleic acid enzymes, also called RNA enzymes or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze either the hydrolysis of one of their own phosphodiester bonds or the hydrolysis of bonds in other RNAs, but have also been found to catalyze the aminotransferase activity of ribosomes. Catalytic RNAs can be "evolved" by in vitro methods. Similar to the riboswitch activity described above, ribozymes and their reaction products can regulate gene expression. In some embodiments, catalytic RNAs or ribozymes can be placed within a larger non-coding RNA so that the ribozyme is present in many copies within the cell for the purpose of chemical transformation of molecules from bulk volume. In some embodiments, the aptamer and ribozyme can both be encoded in the same non-coding RNA.

[0204] In some embodiments, the cleavage sequence encodes a cleavable polypeptide linker. For example, the polyribonucleotide may encode two or more antifusogenic polypeptides, e.g., two or more antifusogenic polypeptides are encoded by a single open reading frame (ORF). For example, two or more antifusogenic polypeptides may be encoded by a single open reading frame, the expression of which is controlled by an IRES. In some embodiments, the ORF further encodes a polypeptide linker, e.g., such that the expression product of the ORF encodes two or more antifusogenic polypeptides, each separated by a sequence encoding a polypeptide linker (e.g., a linker of 5-200, 5-100, 5-50, 5-20, 50-100, or 50-200 amino acids). The polypeptide linker may include a cleavage site, e.g., a cleavage site that is recognized and cleaved by a protease (e.g., an endogenous protease in the subject following administration of the polyribonucleotide to the subject). In such embodiments, a single expression product containing the amino acid sequences of two or more antifusogenic polypeptides is cleaved during expression, resulting in the separation of two or more antifusogenic polypeptides after expression. Exemplary protease cleavage sites, such as amino acid sequences that act as protease cleavage sites recognized by metalloproteinases (e.g., matrix metalloproteinases (MMPs), e.g., any one or more of MMP1-28), disintegrin and metalloproteinases (ADAMs, e.g., any one or more of ADAM2, 7-12, 15, 17-23, 28-30, and 33), serine proteases (e.g., furin), urokinase-type plasminogen activator, matriptase, cysteine ​​proteases, aspartic acid proteases, or cathepsin proteases, are known to those of skill in the art. In some embodiments, the protease is MMP9 or MMP2. In some embodiments, the protease is matriptase.

[0205] In some embodiments, the cyclic polyribonucleotide described herein is a sacrificial cyclic polyribonucleotide, a cleavable cyclic polyribonucleotide, or a self-cleaving cyclic polyribonucleotide. The cyclic polyribonucleotide can deliver cellular components, including, for example, RNA, lncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA. In some embodiments, the cyclic polyribonucleotide comprises an miRNA separated by (i) a self-cleaving element; (ii) a cleavage recruitment site; (iii) a degradable linker; (iv) a chemical linker; and / or (v) a spacer sequence. In some embodiments, the circRNA comprises an siRNA separated by (i) a self-cleaving element; (ii) a cleavage recruitment site (e.g., ADAR); (iii) a degradable linker (e.g., glycerol); (iv) a chemical linker; and / or (v) a spacer sequence. Non-limiting examples of self-cleaving elements include hammerhead, splicing elements, hairpin, Hepatitis delta virus (HDV), Varkud satellite (VS) and the glmS ribozyme.

[0206] Translation initiation sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one translation initiation sequence. In some embodiments, a polyribonucleotide comprises a translation initiation sequence that is operably linked to an expression sequence.

[0207] In some embodiments, the polyribonucleotide may encode a polypeptide and include a translation initiation sequence, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the polyribonucleotide includes a translation initiation sequence, e.g., a Kozak sequence, flanking the expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, a translation initiation sequence, e.g., a Kozak sequence, is present on one or both sides of each expression sequence to provide separation of the expression products. In some embodiments, the polyribonucleotide includes at least one translation initiation sequence flanking the expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the polyribonucleotide. In some embodiments, the translation initiation sequence is within a substantially single-stranded region of the circular polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs

[0163] to

[0165] of WO 2019 / 118919, which is incorporated herein by reference in its entirety.

[0208] A polyribonucleotide may comprise two or more start codons, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may begin at the first start codon or may begin downstream of the first start codon.

[0209] In some embodiments, the polyribonucleotide may initiate at the first start codon, e.g., a codon that is not AUG. Translation of the polyribonucleotide may initiate at an alternative translation start sequence, e.g., but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. In some embodiments, translation initiates at an alternative translation start sequence under selective conditions, e.g., stress-inducing conditions. As a non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, e.g., ACG. As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, CTG / CUG. As another non-limiting example, translation of the polyribonucleotide may initiate at an alternative translation start sequence, GTG / GUG. As another non-limiting example, a polyribonucleotide may initiate translation at alternative translation initiation sequences, including repeat-associated non-AUG (RAN) sequences, e.g., short stretches of repetitive RNA, e.g., CGG, GGGGCC, CAG, CTG.

[0210] Termination sequence In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one termination sequence. In some embodiments, the polyribonucleotide comprises a termination sequence that is operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination sequence.

[0211] In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence, such that the polyribonucleotide is continuously translated. Exclusion of the termination sequence may result in rolling circle translation or continuous expression of the expression product.

[0212] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may or may not have a termination sequence. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, each of which may lack a termination sequence, such that the circular polyribonucleotide is translated continuously. The exclusion of the termination sequence may result in rolling circle translation or continuous expression of expression products, such as peptides or polypeptides, due to lack of ribosome stalling or shedding. In such embodiments, the rolling circle translation expresses continuous expression products through each expression sequence. In some other embodiments, the termination sequence of the expression sequence may be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide include a termination sequence. However, rolling circle translation or expression of subsequent (e.g., second, third, fourth, fifth, etc.) expression sequences in the circular polyribonucleotide is performed. In such cases, the expression product may be shedding from the ribosome when the ribosome encounters a termination sequence, such as a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, eg, at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.

[0213] In some embodiments, the circular polyribonucleotide comprises a termination sequence at the end of one or more expressed sequences. In some embodiments, the one or more expressed sequences comprise two or more subsequent termination sequences. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome is completely separated from the circular polyribonucleotide. In some such embodiments, the generation of the subsequent (e.g., second, third, fourth, fifth, etc.) expressed sequences in the circular polyribonucleotide may require the ribosome to reassociate with the circular polyribonucleotide before the start of translation. Generally, the termination sequence comprises an in-frame nucleotide triplet, e.g., UAA, UGA, UAG, that signals the termination of translation. In some embodiments, one or more termination sequences in the circular polyribonucleotide are frame-shifted termination sequences, such as, but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., cryptic stops), that may terminate translation. Frameshifted termination sequences include the triple nucleotides TAA, TAG, and TGA that occur in the second and third reading frames of the expressed sequence.Frameshifted termination sequences can be important to prevent misreading of mRNA, which is often harmful to cells.In some embodiments, the termination sequence is a stop codon.

[0214] Further examples of termination sequences are described in paragraphs

[0169] to

[0170] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0215] Untranslated Regions In some embodiments, the circular polyribonucleotide comprises an untranslated region (UTR). The UTR of a genomic region that comprises a gene may be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expression sequence described herein. In some embodiments, the UTR may be included downstream of the expression sequence described herein. In some cases, one UTR for a first expression sequence is the same as, contiguous with, or overlaps with another UTR for a second expression sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, such as ZKSCAN1.

[0216] Exemplary untranslated regions are described in paragraphs

[0197] to

[0201] of International Publication No. 2019 / 118919, the entirety of which is incorporated herein by reference.

[0217] In some embodiments, the cyclic polyribonucleotide comprises a polyA sequence. Exemplary polyA sequences are described in paragraphs

[0202] to

[0205] of WO 2019 / 118919, the entirety of which is incorporated herein by reference. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence.

[0218] In some embodiments, the cyclic polyribonucleotide comprises a UTR that contains one or more stretches of adenosines and uridines. These AU-rich signatures may increase the turnover rate of the expression product.

[0219] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs can be useful for modulating the stability or immunogenicity (e.g., the level of one or more markers of immune or inflammatory response) of a cyclic polyribonucleotide. When modifying a particular cyclic polyribonucleotide, one or more copies of an ARE may be introduced into the cyclic polyribonucleotide, and the copies of the ARE may modulate the translation and / or production of the expression product. Similarly, AREs can be identified and removed or modified into a cyclic polyribonucleotide to modulate the intracellular stability, which in turn affects the translation and production of the resulting protein.

[0220] It should be understood that any UTR from any gene may be incorporated into each flanking region of the circular polyribonucleotide.

[0221] In some embodiments, the circular polyribonucleotide lacks a 5'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 3'UTR and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a polyA sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a termination sequence and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks an internal ribosome entry site and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a cap and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide lacks a 5'UTR, a 3'UTR, and an IRES and is capable of protein expression from its one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding a therapeutic, a regulatory element (e.g., a translation modulator, e.g., a translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids (e.g., siRNA, lncRNA, shRNA) targeting an endogenous gene, and a sequence encoding a therapeutic mRNA or protein.

[0222] In some embodiments, the cyclic polyribonucleotide lacks a 5' UTR. In some embodiments, the cyclic polyribonucleotide lacks a 3' UTR. In some embodiments, the cyclic polyribonucleotide lacks a polyA sequence. In some embodiments, the cyclic polyribonucleotide lacks a termination sequence. In some embodiments, the cyclic polyribonucleotide lacks an internal ribosome entry site. In some embodiments, the cyclic polyribonucleotide lacks susceptibility to degradation by exonucleases. In some embodiments, the fact that the cyclic polyribonucleotide lacks susceptibility to degradation can mean that the cyclic polyribonucleotide is not degraded by exonucleases or is degraded to a limited extent in the presence of exonucleases, e.g., is equivalent or similar in the absence of exonucleases. In some embodiments, the cyclic polyribonucleotide is not degraded by exonucleases. In some embodiments, the cyclic polyribonucleotide has reduced degradation when exposed to exonucleases. In some embodiments, the cyclic polyribonucleotide lacks binding to cap-binding proteins. In some embodiments, the circular polyribonucleotide lacks a 5' cap.

[0223] Protein Binding Sequences In some embodiments, the cyclic polyribonucleotide comprises one or more protein binding sites that allow proteins, such as ribosomes, to bind to internal sites within the RNA sequence.By designing a protein binding site, such as a ribosome binding site, into the cyclic polyribonucleotide, the cyclic polyribonucleotide can evade or reduce detection by the host's immune system by masking the cyclic polyribonucleotide from components of the host's immune system, regulating degradation, or regulating translation.

[0224] In some embodiments, the cyclic polyribonucleotide comprises at least one immunity protein binding site, e.g., to evade an immune response, e.g., a CTL (cytotoxic T lymphocyte) response. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous. In some embodiments, the immunity protein binding site is a nucleotide sequence that binds to an immunity protein and aids in masking the cyclic polyribonucleotide as exogenous or foreign.

[0225] The traditional mechanism of ribosome association to linear RNA involves ribosome binding to the capped 5' end of the RNA. The first peptide bond is formed as soon as the ribosome moves from the 5' end to the start codon. According to the present disclosure, internal initiation of translation of a circular polyribonucleotide (i.e., cap-independent) does not require a free or capped end. Rather, the ribosome binds to an uncapped internal site, whereby the ribosome initiates polypeptide elongation at the start codon. In some embodiments, the circular polyribonucleotide comprises one or more RNA sequences that include a ribosome binding site, e.g., a start codon.

[0226] Natural 5'UTRs have characteristics that play a role in translation initiation. They contain signatures such as the Kozak sequence, which is commonly known to be involved in the process by which the ribosome initiates the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO:358), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0227] In some embodiments, the cyclic polyribonucleotide encodes a protein binding sequence that binds to a protein. In some embodiments, the protein binding sequence targets or localizes the cyclic polyribonucleotide to a specific target. In some embodiments, the protein binding sequence specifically binds to an arginine-rich region of a protein.

[0228] In some embodiments, the protein binding sites include, but are not limited to, ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, EL AVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP7, LIN28A, LIN28B , m6A, MBNL2, METTL3, MOV10, MSI1, MSI2, NONO, NONO-, NOP58, NPM1, NUDT21, PCBP2, POLR2A, PRPF8, PTBP1, RBFO X2, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SLTM, SMNDC1, SND1, SRRM4, SRS Binding sites for proteins such as F1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other protein that binds RNA.

[0229] Spacer sequence In some embodiments, the polyribonucleotides described herein comprise one or more spacer sequences. A spacer refers to any adjacent nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. A spacer may be present between any of the nucleic acid elements described herein. A spacer may also be present within the nucleic acid elements described herein.

[0230] For example, a nucleic acid may include two or more of any of the following elements: (A) a 3' catalytic intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' group I catalytic intron fragment; a spacer region may be present between any one or more of the elements. Any of the elements (A), (B), (C), (D), (E), (F), or (G) may be separated by a spacer sequence, as described herein. For example, a spacer may be present between (A) and (B), between (B) and (C), between (C) and (D), between (D) and (E), between (E) and (F), or between (F) and (G).

[0231] In some embodiments, the polyribonucleotide further comprises a first spacer region between the 5' exon fragment of (C) and the polyribonucleotide cargo of (D). The spacer may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, the polyribonucleotide further comprises a second spacer region between the polyribonucleotide cargo of (D) and the 5' exon fragment of (E).

[0232] Spacer sequences can be used to separate IRES from adjacent structural elements to adjust the structure and function of IRES or adjacent elements. Spacers can be specifically engineered according to IRES. In some embodiments, RNA folding computer software such as RNAFold can be used to guide the design of various elements of vectors, including spacers.

[0233] The spacer may be, for example, at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, each spacer region is at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. Each spacer region may be, for example, 5 to 500 (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyA sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may comprise a polyAC sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a poly-AG sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a poly-AT sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region comprise a random sequence.

[0234] Spacers may also be present within the nucleic acid regions described herein. For example, a polynucleotide cargo region may include one or more spacers. A spacer may separate regions within a polynucleotide cargo.

[0235] In some embodiments, the spacer sequence can be, for example, at least 10 nucleotides in length, at least 15 nucleotides in length, or at least 30 nucleotides in length. In some embodiments, the spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the spacer sequence is 20-50 nucleotides in length. In certain embodiments, the spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length.

[0236] The spacer sequence can be a polyA, polyAC, polyC, or polyU sequence.

[0237] In some embodiments, the spacer sequence can be polyAT, polyAC, polyAG, or a random sequence.

[0238] Exemplary spacer sequences are described in paragraphs

[0293] to

[0302] of International Publication No. 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0239] In some embodiments, the polyribonucleotide comprises a 5' spacer sequence (e.g., between the 5' annealing region and the polyribonucleotide cargo). In some embodiments, the 5' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 5' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 5' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In some embodiments, the 5' spacer sequence comprises a polyAG sequence. In some embodiments, the 5' spacer sequence comprises a polyAT sequence. In some embodiments, the 5' spacer sequence comprises a random sequence.

[0240] In some embodiments, the polyribonucleotide comprises a 3' spacer sequence (e.g., between the 3' annealing region and the polyribonucleotide cargo). In some embodiments, the 3' spacer sequence is at least 10 nucleotides in length. In another embodiment, the 3' spacer sequence is at least 15 nucleotides in length. In further embodiments, the 3' spacer sequence is at least 30 nucleotides in length. In some embodiments, the 3' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments, the 3' spacer sequence is 20-50 nucleotides in length. In certain embodiments, the 3'spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 3'spacer sequence is a polyA sequence. In another embodiment, the 5'spacer sequence is a polyAC sequence. In some embodiments, the 5'spacer sequence comprises a polyAG sequence. In some embodiments, the 5'spacer sequence comprises a polyAT sequence. In some embodiments, the 5'spacer sequence comprises a random sequence.

[0241] In one embodiment, the polyribonucleotide comprises a 5' spacer sequence but does not comprise a 3' spacer sequence. In another embodiment, the polyribonucleotide comprises a 3' spacer sequence but does not comprise a 5' spacer sequence. In another embodiment, the polyribonucleotide does not comprise a 5' or 3' spacer sequence. In another embodiment, the polyribonucleotide does not comprise an IRES sequence. In a further embodiment, the polyribonucleotide does not comprise an IRES sequence, a 5' spacer sequence or a 3' spacer sequence.

[0242] In some embodiments, the spacer sequence is at least 3 ribonucleotides, at least 4 ribonucleotides, at least 5 ribonucleotides, at least about 8 ribonucleotides, at least about 10 ribonucleotides, at least about 12 ribonucleotides, at least about 15 ribonucleotides, at least about 20 ribonucleotides, at least about 25 ribonucleotides, at least about 30 ribonucleotides, at least about 40 ribonucleotides, at least about 50 ribonucleotides, at least about 60 ribonucleotides, at least about 70 ribonucleotides, at least about 80 ribonucleotides, ribonucleotides, at least about 90 ribonucleotides, at least about 100 ribonucleotides, at least about 120 ribonucleotides, at least about 150 ribonucleotides, at least about 200 ribonucleotides, at least about 250 ribonucleotides, at least about 300 ribonucleotides, at least about 400 ribonucleotides, at least about 500 ribonucleotides, at least about 600 ribonucleotides, at least about 700 ribonucleotides, at least about 800 ribonucleotides, at least about 900 ribonucleotides, or at least about 100 ribonucleotides.

[0243] qualification The polyribonucleotides described herein (e.g., cyclic polyribonucleotides) may contain one or more substitutions, insertions and / or additions, deletions, and covalent modifications relative to a reference sequence, particularly a parent polyribonucleotide, and are included within the scope of the present disclosure.

[0244] In some embodiments, the cyclic polyribonucleotide comprises one or more post-transcriptional modifications (e.g., capping, truncation, polyadenylation, splicing, polyA sequences, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the over 100 different nucleoside modifications identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid comprises a messenger RNA (mRNA). In some embodiments, the polyribonucleotide comprises at least one nucleoside selected from a group such as those described in

[0311] of WO 2019 / 118919, the entire contents of which are incorporated herein by reference.

[0245] Polyribonucleotides may include any useful modifications to the sugar, nucleobase, or internucleoside linkage (e.g., to the linking phosphate / to the phosphodiester bond / to the phosphodiester backbone), etc. One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl) or halo (e.g., chloro or fluoro). In certain embodiments, a modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside linkage. The modification may be a modification from ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof. Further modifications are described herein.

[0246] In some embodiments, the polyribonucleotide comprises at least one N(6) methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the m6A modification can reduce the immunogenicity of the cyclic polyribonucleotide (e.g., reduce the level of one or more markers of an immune or inflammatory response).

[0247] In some embodiments, the modification may include chemical or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan in "RNA modifications and structures cooperate to guide RNA-protein interactions" in Nat Reviews Mol Cell Biol, 2017, 18:202-210.

[0248] In some embodiments, chemical modifications to the ribonucleotides of the cyclic polyribonucleotides may enhance immune evasion. The cyclic polyribonucleotides may be modified according to methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, SLet al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, end modifications, such as 5' end modifications (phosphorylation (mono-, di- and tri-), conjugation, reverse linkage, etc.), 3' end modifications (conjugation, DNA nucleotides, reverse linkage, etc.), base modifications (e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners), removal of bases (abasic nucleotides) or conjugated bases. Modified ribonucleotide bases may also include 5-methylcytidine and pseudouridine. In some embodiments, base modifications can regulate the expression, immune response, stability, and intracellular localization of cyclic polyribonucleotides, to name a few functional effects. In some embodiments, modifications include biorthogonal nucleotides, such as unnatural bases. See, for example, Kimoto et al, Chem Commun (Camb), 2017, 53:12309, DOI:10.1039 / c7cc06661a, which is incorporated herein by reference.

[0249] In some embodiments, the sugar modification (e.g., at the 2' or 4' position) or sugar substitution of one or more ribonucleotides of a cyclic polyribonucleotide may include a modification or substitution of a phosphodiester bond, as well as a backbone modification. Specific examples of cyclic polyribonucleotides include, but are not limited to, cyclic polyribonucleotides that include modified backbones or do not include natural internucleoside linkages, such as internucleoside modifications that include modification or substitution of a phosphodiester bond. Cyclic polyribonucleotides with modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In certain embodiments, a cyclic polyribonucleotide will include ribonucleotides that have a phosphorus atom in their internucleoside backbone.

[0250] Modified polyribonucleotide backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, such as 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, such as 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linkage analogs, and those with reverse polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms. In some embodiments, cyclic polyribonucleotides may be negatively or positively charged.

[0251] Modified nucleotides that can be incorporated into polyribonucleotides can be modified at the internucleoside bond (e.g., phosphate backbone). In the context of polynucleotide backbone, the terms "phosphate" and "phosphodiester" are used interchangeably herein. The backbone phosphate group can be modified by replacing one or more of the oxygen atoms with different substituents. In addition, modified nucleosides and nucleotides can include a bulk replacement of the unmodified phosphate moiety with another internucleoside bond as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linked oxygens replaced with sulfur. The phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates).

[0252] The α-thio substituted phosphate moieties are provided to confer stability to RNA and DNA polymers via unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently longer half-life in the cellular environment. Phosphorothioates attached to circular polyribonucleotides are predicted to reduce innate immune responses via weaker binding / activation of cellular innate immune molecules.

[0253] In certain embodiments, the modified nucleoside comprises an alpha-thionucleoside (e.g., 5'-0-(l-thiophosphate)-adenosine, 5'-0-(l-thiophosphate)-cytidine (a-thio-cytidine), 5'-0-(l-thiophosphate)-guanosine, 5'-0-(l-thiophosphate)-uridine, or 5'-0-(1-thiophosphate)-pseudouridine).

[0254] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.

[0255] In some embodiments, the cyclic polyribonucleotide can include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides can be incorporated into the cyclic polyribonucleotide, such as bifunctional modifications. Cytotoxic nucleosides may include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4'-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylidenecytidine (DMDC), and 6-mercaptopurine. Further examples include fludarabine phosphate, N4-behenoyl-l-beta-D-arabinofuranosylcytosine, N4-octadecyl-1-beta-D-arabinofuranosylcytosine, N4-palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)cytosine, and P-4055 (cytarabine 5'-elaidate).

[0256] A polyribonucleotide may or may not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more or all of A, G, U, C, I, pU) may or may not be uniformly modified in a circular polyribonucleotide or a given predetermined sequence region thereof. In some embodiments, the circular polyribonucleotide includes pseudouridine. In some embodiments, the circular polyribonucleotide includes inosine, which may assist the immune system in characterizing the circular polyribonucleotide as endogenous RNA versus viral RNA. Incorporation of inosine may also mediate improved RNA stability / reduced degradation. See, for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as "self". Cell Res. 25, 1283-1284, incorporated herein by reference in its entirety.

[0257] In some embodiments, all nucleotides in a polyribonucleotide (or a given sequence region thereof) are modified. In some embodiments, modifications may include m6A, which may enhance expression; inosine, which may attenuate immune response; pseudouridine, which may increase RNA stability, or m5C, which may increase stability, translational read-through (stagger element); and 2,2,7-trimethylguanosine, which aids in intracellular internalization (e.g., nuclear localization).

[0258] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) can be present at various positions of the cyclic polyribonucleotide. Those skilled in the art will understand that nucleotide analogs or other modifications can be placed at any position of the cyclic polyribonucleotide such that the function of the cyclic polyribonucleotide is not substantially reduced. Modifications can also be non-coding region modifications. A cyclic polyribonucleotide may contain from about 1% to about 100% modified nucleotides (either in relation to the overall nucleotide content or in relation to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intervening percentage (e.g., less than 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 10 ... The ranges may include 0%-90%, 10%-95%, 10%-100%, 20%-25%, 20%-50%, 20%-60%, 20%-70%, 20%-80%, 20%-90%, 20-95%, 20%-100%, 50%-60%, 50%-70%, 50%-80%, 50%-90%, 50%-95%, 50%-100%, 70%-80%, 70%-90%, 70%-95%, 70%-100%, 80%-90%, 80%-95%, 80%-100%, 90%-95%, 90%-100%, and 95%-100%).

[0259] Method of cyclization The present disclosure provides methods for generating circular polyribonucleotides encoding antifusogenic polypeptides (e.g., polypeptides of Table 1), including, for example, recombinant techniques or chemical synthesis. For example, the DNA molecules used to generate the RNA circle can include DNA sequences of the original nucleic acid sequence occurring in nature, modified versions thereof, or DNA sequences encoding synthetic polypeptides not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques, including, but not limited to, classical mutagenesis techniques and recombinant techniques, such as site-specific mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures and ligation of mixtures into a mixture of nucleic acid molecules "assembly," and combinations thereof.

[0260] In some embodiments, the linear polyribonucleotide for circularization can be circularized or concatemerized. In some embodiments, the linear polyribonucleotide for circularization can be circularized in vitro before formulation and / or delivery. In some embodiments, the circular polyribonucleotide can be a mixture with the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide has the same nucleic acid sequence as the circular polyribonucleotide.

[0261] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized using chemical methods to form a circular polyribonucleotide. In some chemical methods, the 5'-end and 3'-end of the nucleic acid (e.g., the linear polyribonucleotide for circularization) contain chemically reactive groups that, when in close proximity to each other, can form a new covalent bond between the 5'-end and 3'-end of the molecule. The 5'-end can contain an NHS-ester reactive group, and the 3'-end can contain a 3' amino terminal nucleotide, so that in an organic solvent, the 3' amino terminal nucleotide on the 3'-end of the linear RNA molecule undergoes nucleophilic attack on the 5'-NHS-ester moiety to form a new 5' / 3' amide bond.

[0262] In some embodiments, a DNA or RNA ligase is used to enzymatically ligate a 5'-phosphorylated nucleic acid molecule (e.g., a linear polyribonucleotide for circularization) to the 3'-hydroxyl group of a nucleic acid (e.g., a linear nucleic acid) forming a new phosphorodiester bond. In an exemplary reaction, a linear polyribonucleotide for circularization is incubated with 1-10 units of T4 RNA ligase (New England Biolabs, Ipswich, MA) for 1 hour at 37°C according to the manufacturer's protocol. The ligation reaction can be performed in the presence of a linear nucleic acid that can base pair with both the 5' and 3' regions in juxtaposition to aid in the enzymatic ligation reaction. In some embodiments, the ligation is a splint ligation. For example, a splint ligase such as SplintR® ligase can be used for splint ligation, RNA ligase II, T4 RNA ligase, or T4 DNA ligase. For splint ligation, a single-stranded polynucleotide (splint), such as a single-stranded RNA, can be designed to hybridize with both ends of a linear polyribonucleotide, such that the two ends can be juxtaposed upon hybridization with the single-stranded splint. Thus, the splint ligase can catalyze the ligation of the two juxtaposed ends of the linear polyribonucleotide to generate a circular polyribonucleotide.

[0263] In some embodiments, DNA ligase or RNA ligase is used in the synthesis of the circular polynucleotide. In some embodiments, either the 5' or 3' end of the linear polyribonucleotide for circularization can encode a ligase ribozyme sequence, such that the linear polyribonucleotide for circularization can contain an active ribozyme sequence that can ligate the 5' end of the linear polyribonucleotide for circularization to the 3' end of the linear polyribonucleotide for circularization during in vitro transcription. The ligase ribozyme can be derived from group I introns, hepatitis delta virus, hairpin ribozymes, or selected by SELEX (Systematic Evolution of Ligands by Exponential Enrichment). The ribozyme ligase reaction can take 1 to 24 hours at temperatures between 0 and 37°C.

[0264] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with a region or feature near the 5' end and / or near the 3' end of the linear polyribonucleotide for circularization to circularize or concatemerize the linear polyribonucleotide for circularization. In another aspect, the at least one non-nucleic acid moiety may be located within or linked near the 5' end and / or 3' end of the linear polyribonucleotide for circularization. The contemplated non-nucleic acid moiety may be homogeneous or heterogeneous. As a non-limiting example, the non-nucleic acid moiety may be a bond such as a hydrophobic bond, an ionic bond, a biodegradable bond, and / or a cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker as described herein.

[0265] In some embodiments, linear polyribonucleotides for circularization are synthesized using IVT and RNA polymerase, where the nucleotide mixture used for IVT may contain an excess of guanosine monophosphate compared to guanosine triphosphate to preferentially produce RNA with a 5' monophosphate, and the purified IVT product may be circularized using splint DNA.

[0266] In some embodiments, the linear polyribonucleotide for circularization is circularized or concatemerized due to non-nucleic acid moieties that cause attractive forces between atoms, molecular surfaces at or near the 5' and 3' ends of the linear polyribonucleotide for circularization or between atoms, molecular surfaces that are connected thereto. As a non-limiting example, one or more linear polyribonucleotides for circularization can be circularized or concatemerized by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonance bonds, invisible bonds, dipolar bonds, conjugation, hyperconjugation, and antibonds.

[0267] In some embodiments, the linear polyribonucleotide for circularization may include ribozyme RNA sequences near the 5' and 3' ends. The ribozyme RNA sequences may be covalently linked to peptides when the sequences are exposed to the remainder of the ribozyme. In one aspect, the peptides covalently linked to the ribozyme RNA sequences near the 5' and 3' ends may associate with each other to circularize or concatemerize the linear polyribonucleotide for circularization. In another aspect, the peptides covalently linked to the ribozyme RNA near the 5' and 3' ends may be subjected to ligation using various methods known in the art, such as, but not limited to, protein ligation, to circularize or concatemerize the linear primary construct or linear mRNA. A non-limiting list of examples of ribozymes or methods of incorporating and / or covalently linking peptides for use in the linear primary constructs or linear RNA of the present invention are described in U.S. Patent Application Publication No. 20030082768, the contents of which are incorporated herein by reference in their entirety.

[0268] In some embodiments, linear polyribonucleotides for circularization may include 5' triphosphates of nucleic acids that have been converted to 5' monophosphates, for example, by contacting the 5' triphosphates with RNA 5' pyrophosphohydrolase (RppH) or ATP diphosphohydrolase (apyrase). In some embodiments, the 5' ends of at least some of the linear polyribonucleotides include a monophosphate moiety. In some embodiments, a population of polyribonucleotides including circular and linear polyribonucleotides is contacted with RppH prior to digesting at least some of the linear polyribonucleotides with a 5' exonuclease and / or a 3' exonuclease. Alternatively, converting the 5' triphosphate of a linear polyribonucleotide for circularization to a 5' monophosphate can occur by a two-step reaction including: (a) contacting the 5' nucleotide of the linear polyribonucleotide for circularization with a phosphatase (e.g., Antarctic phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) contacting the 5' nucleotide after step (a) with a kinase (e.g., polynucleotide kinase) that adds a single phosphate.

[0269] In some embodiments, the cyclization efficiency of the cyclization methods provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, the cyclization efficiency of the cyclization methods provided herein is at least about 40%. In some embodiments, the provided cyclization method has a cyclization efficiency of about 10% to about 100%, for example, the cyclization efficiency can be about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, the cyclization efficiency is about 20% to about 80%. In some embodiments, the cyclization efficiency is about 30% to about 60%. In some embodiments, the cyclization efficiency is about 40%.

[0270] In some embodiments, the circular polyribonucleotide contains an internal splicing element where the spliced ​​ends are joined together when duplicated. Some examples may include motifs found in cis sequence elements proximal to a back splice event (suptable4 enriched motifs), such as miniature introns (<100 nt) with splice site sequences and short inverted repeats (30-40 nt) such as AluSq2, AluJr, and AluSz, inverted sequences in adjacent introns, Alu elements in adjacent introns, and sequences within 200 bp before (upstream) or after (downstream) a back splice site with adjacent exons. In some embodiments, the linear polyribonucleotide contains at least one repeated nucleotide sequence described elsewhere herein as an internal splicing element. In such embodiments, the repeated nucleotide sequence may include a repeated sequence from the Alu family of introns. In some embodiments, splicing-associated ribosome-binding proteins can regulate circular polyribonucleotide biosynthesis (e.g., Muscle blind and Quaking (QKI) splicing factors).

[0271] In some embodiments, the linear polyribonucleotide may comprise a canonical splice site adjacent to the head-to-tail junction of the circular polyribonucleotide.

[0272] In some embodiments, a linear polyribonucleotide may contain a bulge-helix-bulge motif, which comprises a four base pair stem flanked by two three nucleotide bulges. Cleavage occurs at the site of the bulge region, generating characteristic fragments with terminal 5'-hydroxyl groups and 2',3'-cyclic phosphates. Circularization proceeds by nucleophilic attack of the 5'-OH group on the 2',3'-cyclic phosphate of the same molecule forming a 3',5'-phosphodiester bridge.

[0273] In some embodiments, the linear polyribonucleotide may comprise a multimeric repeat RNA sequence having an HPR element. The HPR comprises a 2',3'-cyclic phosphate and a 5'-OH terminus. The HPR element self-processes the 5' and 3' ends of the linear polyribonucleotide, thereby linking the ends together.

[0274] In some embodiments, the linear polyribonucleotide may include a sequence that mediates self-ligation. In one embodiment, the linear polyribonucleotide may include a HDV sequence, such as the HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (Beeharry et al 2004) (SEQ ID NO: 359) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 360), for self-ligation. In one embodiment, the linear polyribonucleotide may include a loop E sequence (e.g., PSTVd) for self-ligation. In another embodiment, the linear polyribonucleotide may include a self-circularizing intron, such as a 5' and 3' slice junction, or a self-circularizing catalytic intron, such as a Group I, Group II, or Group III intron. Non-limiting examples of Group I intron self-splicing sequences may include the self-splicing permuted intron-exon sequence from the T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena.

[0275] In some embodiments, linear polyribonucleotides for circularization may contain complementary sequences that include either repetitive or non-repetitive nucleic acid sequences within individual introns or across adjacent introns. Repetitive nucleic acid sequences are sequences that are present within a segment of a linear polyribonucleotide. In some embodiments, a linear polyribonucleotide comprises a repetitive nucleic acid sequence. In some embodiments, the repetitive nucleotide sequence comprises a poly-CA or poly-UG sequence. In some embodiments, a linear polyribonucleotide comprises at least one repetitive nucleic acid sequence that hybridizes to a complementary repetitive nucleic acid sequence in another segment of the linear polyribonucleotide, and the hybridized segment forms an internal duplex. In some embodiments, a linear polyribonucleotide comprises 1 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, and 10) repetitive nucleic acid sequences that hybridize to a complementary repetitive nucleic acid sequence in another segment of the linear polyribonucleotide, and the hybridized segment forms an internal duplex. In some embodiments, the linear polyribonucleotide comprises two repeat nucleic acid sequences that hybridize to complementary repeat nucleic acid sequences in another segment of the linear polyribonucleotide, and the hybridized segments form an internal duplex. In some embodiments, the repeat nucleic acid sequences and complementary repeat nucleic acid sequences from two separate linear polyribonucleotides hybridize to generate a single circularized polyribonucleotide, and the hybridized segments form an internal duplex. In some embodiments, the complementary sequences are found at the 5' and 3' ends of the linear polyribonucleotide for circularization. In some embodiments, the complementary sequence comprises about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides.

[0276] In some embodiments, chemical methods of circularization can be used to generate circular polyribonucleotides. Such methods can include, but are not limited to, click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiamine limine crosslinking, base modification, and any combination thereof.

[0277] In some embodiments, enzymatic methods of circularization can be used to generate circular polyribonucleotides. In some embodiments, ligation enzymes, such as DNA or RNA ligases, can be used to generate circular polyribonucleotides or their complements, complementary strands of circular polyribonucleotides, or templates of circular polyribonucleotides.

[0278] Circularization of linear polyribonucleotides can be achieved by methods known in the art, for example those described in "RNA circularization strategies in vivo and in vitro" by Petkovic and Muller, Nucleic Acids Res, 2015, 43(4):2454-2465 and "In vitro circularization of RNA" by Muller and Appel, RNA Biol, 2017, 14(8):1018-1027.

[0279] The circular polyribonucleotide may encode sequences and / or motifs useful for replication. Exemplary replication elements are described in paragraphs 1011-1018919, incorporated herein by reference in its entirety.

[0280] ~It is described in

[0286] .

[0280] In some embodiments, a linear polyribonucleotide may contain complementary sequences that include either repeat or non-repetitive nucleic acid sequences within individual introns or across adjacent introns. Repeat nucleic acid sequences are sequences that are present within a segment of a circular polyribonucleotide. In some embodiments, a linear polyribonucleotide comprises a repeat nucleic acid sequence. In some embodiments, the repeat nucleotide sequence comprises a poly-CA or poly-UG sequence. In some embodiments, a linear polyribonucleotide comprises at least one repeat nucleic acid sequence that hybridizes to a complementary repeat nucleic acid sequence in another segment of the linear polyribonucleotide, and the hybridized segment forms an internal duplex. In some embodiments, the repeat nucleic acid sequence and the complementary repeat nucleic acid sequence from two separate linear polyribonucleotides hybridize to generate a single circularized polyribonucleotide, and the hybridized segment forms an internal duplex. In some embodiments, the complementary sequences are found at the 5' and 3' ends of the linear polyribonucleotide. In some embodiments, the complementary sequence comprises about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides.

[0281] In some embodiments, chemical methods of circularization can be used to generate circular polyribonucleotides. Such methods can include, but are not limited to, click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiamine limine crosslinking, base modification, and any combination thereof.

[0282] Methods for making the circular polyribonucleotides described herein are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, (First Edition), Academic Press (2013); Muller and Appel (from RNA Biol, 2017, 14(8):1018-1027); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012). Other methods of making cyclic polyribonucleotides are described, for example, in WO 2022 / 247943, U.S. Pat. No. 11000547, WO 2018 / 191722, WO 2019 / 236673, WO 2020 / 023595, WO 2022 / 204460, WO 2022 / 204464, and WO 2022 / 204466.

[0283] Various methods of synthesizing circular polyribonucleotides have also been described elsewhere (see, e.g., U.S. Pat. No. 6,210,931, U.S. Pat. No. 5,773,244, U.S. Pat. No. 5,766,903, U.S. Pat. No. 5,712,128, U.S. Pat. No. 5,426,180, U.S. Patent Publication No. 20100137407, WO 1992001813, WO 2010084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015), the contents of each of which are incorporated herein by reference in their entirety.

[0284] In some embodiments, the circular polyribonucleotides are purified, e.g., free ribonucleic acid, linear or nicked RNA, DNA, proteins, etc. In some embodiments, the circular polyribonucleotides can be purified by any known method commonly used in the art. Non-limiting examples of purification methods include column chromatography, gel excision, size exclusion, etc.

[0285] Generation method Cell-free production method The present disclosure also provides a method for generating circular RNA.For example, deoxyribonucleotide template can be transcribed in cell-free system (for example, by in vitro transcription) to generate linear RNA.Linear polyribonucleotide generates splicing-compatible polyribonucleotide, which can self-splice to generate circular polyribonucleotide.

[0286] In some embodiments, the disclosure provides methods of producing a circular polyribonucleotide (e.g., in a cell-free system) by providing a linear polyribonucleotide; and a self-splicing linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide; thereby producing a circular polyribonucleotide.

[0287] In some embodiments, the disclosure provides methods of producing a circular polyribonucleotide by providing deoxyribonucleotides encoding a linear polyribonucleotide; transcribing the deoxyribonucleotides in a cell-free system to produce a linear polyribonucleotide; optionally purifying the splicing-compatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide.

[0288] In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by providing deoxyribonucleotides encoding a linear polyribonucleotide; transcribing the deoxyribonucleotides in a cell-free system to produce a linear polyribonucleotide, where the transcription is performed in solution under conditions suitable for splicing of the 3' and 5' splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5' split-intron and a 3' split-intron (e.g., a self-splicing construct to produce a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5' annealing region and a 3' annealing region.

[0289] Suitable conditions for in vitro transcription and self-splicing can include any conditions (e.g., a solution or buffer, such as an aqueous buffer or solution) that recapitulate physiological conditions in one or more respects. In some embodiments, suitable conditions include 0.1-100 mM Mg2+ ions or a salt thereof (e.g., 1-100 mM, 1-50 mM, 1-20 mM, 5-50 mM, 5-20 mM, or 5-15 mM). In some embodiments, suitable conditions include 1-1000 mM K+ ions or a salt thereof, such as KCl (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include 1-1000 mM Cl- ions or a salt thereof such as KCl (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include 0.1-100 mM Mn2+ ions or a salt thereof such as MnCl2 (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1 to 1000 μM, 1 to 500 μM, 1 to 200 μM, 50 to 500 μM, 100 to 500 μM, 100 to 300 μM, 0.1 to 100 mM, 0.1 to 50 mM, 0.1 to 20 mM, 0.1 to 10 mM, 0.1 to 5 mM, 0.1 to 2 mM, 0.5 to 50 mM, 0.5 to 20 mM, 0.5 to 15 mM, 0.5 to 5 mM, 0.5 to 2 mM, or 0.1 to 10 mM). In some embodiments, suitable conditions include 0.1 mM and 100 mM ribonucleoside triphosphates (NTPs) (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-10 mM, 1-100 mM, 1-50 mM, or 1-10 mM). In some embodiments, suitable conditions include a pH of 4-10 (e.g., a pH of 5-9, a pH of 6-9, or a pH of 6.5-8.5).In some embodiments, suitable conditions include a temperature between 4°C and 50°C (e.g., between 10°C and 40°C, between 15°C and 40°C, between 20°C and 40°C, or between 30°C and 40°C).

[0290] In some embodiments, the linear polyribonucleotide is generated from a deoxyribonucleic acid, such as a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA. In some embodiments, the linear polyribonucleotide is transcribed from a deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription).

[0291] How is it produced in cells? The present disclosure also provides a method of producing circular RNA in a cell, e.g., a prokaryotic or eukaryotic cell. In some embodiments, an exogenous polyribonucleotide is provided to the cell (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding the transcription of a linear polyribonucleotide described herein). The linear polyribonucleotide may be transcribed within the cell from an exogenous DNA molecule provided to the cell. The linear polyribonucleotide may be transcribed within the cell from an exogenous recombinant DNA molecule transiently provided to the cell. In some embodiments, the exogenous DNA molecule is not integrated into the genome of the cell. In some embodiments, the linear polyribonucleotide is transcribed within the cell from a recombinant DNA molecule integrated into the genome of the cell.

[0292] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell comprising the polyribonucleotide described herein may be a bacterial cell or an archaeal cell. For example, prokaryotic cells comprising the polyribonucleotides described herein can be selected from the group consisting of E. coli, halophilic archaea (e.g., Haloferax volcaniii), Sphingomonas, cyanobacteria (e.g., Synechococcus elongatus, Spirulina (Arthrospira) spp., and Synechocystis spp.), Streptomyces, actinomycetes (e.g., Nonomuraea, Kitasatospora, or Thermobifida), Bacillus spp. (e.g., Bacillus subtilis, Bacillus anthracis, Bacillus subtil ... The prokaryotic cell may be Bacillus anthracis, Bacillus cereus, betaproteobacteria (e.g., Burkholderia), alphaproteobacterial (e.g., Agrobacterium), Pseudomonas (e.g., Pseudomonas putida), and enterobacteria. The prokaryotic cell may be grown in a culture medium. The prokaryotic cell may be contained within a bioreactor.

[0293] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell comprising the polyribonucleotide described herein is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic organism is a unicellular fungal cell, such as a yeast cell (e.g., Saccharomyces cerevisiae and other Saccharomyces species), Brettanomyces species, Schizosaccharomyces species, Torulaspora species, and Pichia species. In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. The unicellular animal cell may be a cell isolated from a multicellular animal and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular animal cell may be dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. The unicellular plant cell may be a cell isolated from a multicellular animal and grown in culture, or a daughter cell thereof. In some embodiments, the unicellular plant cell may be dedifferentiated. In some embodiments, the unicellular plant cell is derived from a plant callus. In embodiments, the unicellular cell is a plant cell protoplast. In some embodiments, the unicellular eukaryotic cell is a unicellular eukaryotic algae cell, such as a unicellular green algae, diatom, euglenid, or dinoflagellate.Non-limiting examples of unicellular eukaryotic algae of interest include Dunaliella salina, Chlorella vulgaris, Chlorella zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris species, Protosiphon botryoides, Botryococcus braunii, Cryptococcus species, Chlamydomonas reinhardtii and other Chlamydomonas species. In some embodiments, the unicellular eukaryotic cell is a protist cell. In some embodiments, the unicellular eukaryotic cell is a protozoan cell.

[0294] In some embodiments, the eukaryotic cell is a cell of a multicellular eukaryotic organism. For example, the multicellular eukaryotic organism may be selected from the group consisting of a vertebrate, an invertebrate, a multicellular fungus, a multicellular alga, and a multicellular plant. In some embodiments, the eukaryotic organism is a human. In some embodiments, the eukaryotic organism is a non-human vertebrate. In some embodiments, the eukaryotic organism is an invertebrate. In some embodiments, the eukaryotic organism is a multicellular fungus. In some embodiments, the eukaryotic organism is a multicellular plant. In embodiments, the eukaryotic cell is a human cell or a cell of a non-human mammal, such as a non-human primate (e.g., monkey, ape), ungulate (e.g., bovids including cows, buffalo, bison, sheep, goats, and muskoxen; pigs; camelids including camels, llamas, and alpacas; deer, antelope; and equines including horses and donkeys), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse, guinea pig, hamster, squirrel), or lagomorph (e.g., rabbit, hare). In embodiments, the eukaryotic cell is an avian, e.g., a member of the avian taxon Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, geese), Paleaognathae (e.g., ostrich, emu), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrot) cell. In embodiments, the eukaryotic cell is an arthropod (e.g., insect, arachnid, crustacean), nematode, annelid, worm, or mollusc cell. In embodiments, the eukaryotic cell is a cell of a multicellular plant, such as an angiosperm (which may be dicotyledonous or monocotyledonous) or gymnosperm (e.g., conifers, cycads, Gnetophytes, ginkgoes), ferns, horsetails, club mosses, or the like. In embodiments, the eukaryotic cell is a cell of a eukaryotic multicellular alga.

[0295] The eukaryotic cells may be grown in a culture medium. The eukaryotic cells may be contained within a bioreactor.

[0296] Purification method One or more purification steps may be included in the methods described herein. For example, in some embodiments, the linear polyribonucleotide is substantially concentrated or pure (e.g., purified) before self-splicing the linear polyribonucleotide. In other embodiments, the linear polyribonucleotide is not purified before self-splicing the linear polyribonucleotide. In some embodiments, the resulting circular RNA is purified.

[0297] Purification may include separating or concentrating the desired reaction product from one or more undesired components, such as any unreacted starting materials, by-products, enzymes, or other reaction components. For example, purification of linear polyribonucleotides after transcription in a cell-free system (e.g., in vitro transcription) may include separation or concentration from the DNA template before the linear polyribonucleotide self-splices. Purification of the circular RNA product after splicing can be used to separate or concentrate the circular RNA from its corresponding linear RNA. Methods for purifying RNA are known to those of skill in the art and include enzymatic purification or chromatographic purification.

[0298] In some embodiments, the purification method results in circular polyribonucleotides having less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polyribonucleotides.

[0299] Bioreactor In some embodiments, any method for producing circular polyribonucleotides described herein may be carried out in a bioreactor. A bioreactor refers to any container in which a chemical or biological process involving an organism or a biochemically active substance derived from such an organism is carried out. A bioreactor may be adapted for the cell-free method for producing circular RNA described herein. Containers for bioreactors may include culture flasks, dishes, or bags, which may be single-use (disposable), autoclavable, or sterilizable. Bioreactors may be made of glass, or may be polymer-based, or may be manufactured from other materials.

[0300] Examples of bioreactors include, but are not limited to, stirred tank (e.g., well-mixed) and flat plate (e.g., plug flow) bioreactors, air-lift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibratory mixers, fluidized bed reactors, and membrane bioreactors. The mode of operation of a bioreactor may be a batch or continuous process. A bioreactor is continuous when the streams of reagents and products are continuously fed and removed from the system. A batch bioreactor may have a continuous recirculation flow but may not have a continuous feed of reagents or product withdrawal.

[0301] Some methods of the present disclosure are directed to large-scale production of cyclic polyribonucleotides. For large-scale production methods, the methods can be carried out in volumes ranging from 1 liter (L) to 50 L or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L, or more). In some embodiments, the method can be performed with a volume of 5L to 10L, 5L to 15L, 5L to 20L, 5L to 25L, 5L to 30L, 5L to 35L, 5L to 40L, 5L to 45L, 10L to 15L, 10L to 20L, 10L to 25L, 20L to 30L, 10L to 35L, 10L to 40L, 10L to 45L, 10L to 50L, 15L to 20L, 15L to 25L, 15L to 30L, 15L to 35L, 15L to 40L, 15L to 45L, or 15L to 50L.

[0302] In some embodiments, the bioreactor may produce at least 1 g of circular RNA. In some embodiments, the bioreactor may produce 1-200 g of circular RNA (e.g., 1-10 g, 1-20 g, 1-50 g, 10-50 g, 10-100 g, 50-100 g, 50-200 g of circular RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200 g per liter), per batch or reaction (e.g., 1-200 g per batch or reaction), or per unit of time (e.g., 1-200 g per hour or day).

[0303] In some embodiments, two or more bioreactors can be utilized in series to increase production capacity (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 bioreactors can be used in series).

[0304] How to use In some embodiments, a circular polyribonucleotide encoding an antifusogenic polypeptide (e.g., a polypeptide of Table 1) is used to treat or prevent a viral infection (e.g., HIV, SARS-CoV-2, HCV, influenza, or RSV).

[0305] In some embodiments, a circular polynucleotide encoding an antifusogenic polypeptide (eg, a polypeptide of Table 1) is used to reduce viral entry.

[0306] In some embodiments, a circular polynucleotide encoding an antifusogenic polypeptide (e.g., a polypeptide of Table 1) can be administered to a subject to reduce the risk of a viral infection (e.g., HIV, SARS-CoV-2, HCV, influenza, or RSV).

[0307] For example, a cyclic polyribonucleotide produced by the methods described herein may be administered to a subject (e.g., in a pharmaceutical, veterinary, or agricultural composition). In some embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, such as a member of an avian taxon such as Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleaognathae (e.g., ostriches, emus), Columbiformes (e.g., pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks.

[0308] In some embodiments, the disclosure provides a method of modifying a subject by providing a composition or preparation described herein to the subject. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that contains a nucleic acid described herein.

[0309] In some embodiments, the disclosure provides a method of treating a viral infection in a subject in need thereof by providing a composition or preparation described herein to the subject. In some embodiments, the composition or preparation is or comprises a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule described herein), and the polynucleotide is provided to a eukaryotic subject. In some embodiments, the composition or preparation is or comprises a eukaryotic or prokaryotic cell that comprises a nucleic acid described herein. In some embodiments, the polyribonucleotide is provided in an amount and for a duration sufficient to treat, for example, a viral infection in a subject in need of such treatment.

[0310] In some embodiments, the methods can be used to treat or prevent HIV. For example, in some embodiments, the circular polyribonucleotide encodes an antifusogenic polypeptide that targets HIV, and the compositions can be used to treat or prevent HIV.

[0311] In some embodiments, the methods can be used to treat or prevent SARS-CoV-2. For example, in some embodiments, the circular polyribonucleotide encodes an antifusogenic polypeptide that targets SARS-CoV-2, and the composition can be used to treat or prevent SARS-CoV-2.

[0312] In some embodiments, the methods can be used to treat or prevent HCV. For example, in some embodiments, the cyclic polyribonucleotide encodes an antifusogenic polypeptide that targets HCV, and the compositions can be used to treat or prevent HCV.

[0313] In some embodiments, the methods can be used to treat or prevent RSV. For example, in some embodiments, the circular polyribonucleotide encodes an antifusogenic polypeptide that targets RSV, and the composition can be used to treat or prevent RSV.

[0314] Method of administration Disclosed herein are dosing methods for producing a level of cyclic polyribonucleotides encoding an antifusogenic polypeptide (e.g., a polypeptide in Table 1) or expressing a level of an antifusogenic polypeptide (e.g., a polypeptide in Table 1) in a cell after providing the cell with at least two doses or compositions of cyclic polyribonucleotides. Disclosed herein are administration methods for producing a level of cyclic polyribonucleotides or expressing a level of an antifusogenic polypeptide (e.g., a polypeptide in Table 1, e.g., any one of the polypeptides in Tables 2-4) in a subject after providing (e.g., administering) at least two doses or compositions of cyclic polyribonucleotides to a subject (e.g., a mammal, e.g., a human). The composition comprises a cyclic polyribonucleotide encoding an antifusogenic polypeptide as described herein. The administration method may include administering two or more doses of a cyclic polyribonucleotide composition, e.g., over a short or long period of time. In some embodiments, the composition containing cyclic polyribonucleotide further comprises a pharma- ceutically acceptable carrier or excipient. The cyclic polyribonucleotide encodes an antifusogenic polypeptide that may be expressed in the cell, e.g., after administration.

[0315] The methods described herein include administering to a subject a blood glucose level of at least 500 ng / mL (e.g., at least 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1,000 ng / mL, 1,100 ng / mL, 1,200 ng / mL, 1,300 ng / mL, 1,400 ng / mL, 1,500 ng / mL, 1,600 ng / mL, 1,700 ng / mL, 1,800 ng / mL, 1,900 ng / mL, In some embodiments, the method may include administering a first dose of the pharmaceutical composition in an amount sufficient to result in a serum concentration of the antifusogenic polypeptide of 2,000 ng / mL, 2,100 ng / mL, 2,200 ng / mL, 2,300 ng / mL, 2,400 ng / mL, 2,500 ng / mL, 2,600 ng / mL, 2,700 ng / mL, 2,800 ng / mL, 2,900 ng / mL, 3,000 ng / mL, or more.

[0316] In some embodiments, the method may further include administering a second dose of the pharmaceutical composition. The method may further include administering a third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more doses of the pharmaceutical composition. In some embodiments, subsequent doses provide a total concentration of at least 500 ng / mL (e.g., at least 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1,000 ng / mL, 1,100 ng / mL, 1,200 ng / mL, 1,300 ng / mL, 1,400 ng / mL, 1,500 ng / mL, 1,600 ng / mL, 1,700 ng / mL, 1,800 ng / mL, 2,100 ng / mL, 2,200 ng / mL, 2,300 ng / mL, 2,400 ng / mL, 2,500 ng / mL, 2,600 ng / mL, 2,700 ng / mL, 2,800 ng / mL, 2,900 ng / mL, 3,100 ng / mL, 3,100 ng / mL, 3,200 ng / mL, 3,300 ng / mL, 3,400 ng / mL, 3,500 ng / mL, 3,600 ng / mL, 3,700 ng / mL, 3,800 ng / mL, 4,1 ... In some embodiments, the administration of a subsequent dose helps maintain a serum concentration of the antifusogenic polypeptide of less than 500 ng / mL in the subject.

[0317] In some embodiments, multiple doses are provided to produce or maintain a level of a composition or to express a level of an antifusogenic polypeptide in a cell, tissue, or subject. In some embodiments, multiple doses are provided to produce or maintain a level of a composition or to produce or maintain a level of an antifusogenic polypeptide in a cell, tissue, or subject for a period of time, e.g., at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, 21, or 24 months, or at least 1, 2, 3, 4, or 5 years.

[0318] In some embodiments, the second dose is administered at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more) after the first dose of the pharmaceutical composition.

[0319] In some embodiments, the second dose is administered 1 hour to 1 year (e.g., 1 hour to 1 day, e.g., 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 1 day, e.g., 1 day to 1 week, e.g., 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week, e.g., 1 week to 1 month, e.g., 2 weeks, 3 weeks, or 1 month, e.g., 1 month to 1 year, e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year) after the first dose of the pharmaceutical composition. In some embodiments, the second dose is administered within 1 day to 180 days (e.g., 1 day to 90 days, 1 day to 45 days, 1 day to 30 days, 1 day to 14 days, 1 day to 7 days, 2 days to 45 days, 2 days to 30 days, 2 days to 14 days, 2 days to 7 days, 3 days to 90 days, 3 days to 45 days, 3 days to 30 days, 3 days to 14 days, 3 days to 7 days, 4 days to 90 days, 4 days to 45 days, 4 days to 30 days, 4 days to 14 days, 4 days to 7 days, 5 days to 90 days, 5 days to 45 days, 5 days to 30 days, 5 days to 14 days, 5 days to 7 days, 6 days to 90 days, 6 days to 45 days, 6 days to 30 days, 6-14 days, 6-7 days, 7-90 days, 7-45 days, 7-30 days, 7-14 days, 14-90 days, 14-45 days, 14-30 days, 21-90 days, 21-60 days, 21-45 days, 21-30 days, 30-90 days, 30-60 days, 30-45 days, 45-180 days, 45-120 days, 45-100 days, 45-90 days, 45-60 days, 60-180 days, 60-120 days, 60-100 days, 60-90 days, 90-100 days, 90-120 days, or 90-180 days).

[0320] In some embodiments, the third dose is administered at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more) after the second dose of the pharmaceutical composition.

[0321] In some embodiments, the third dose is administered 1 hour to 1 year (e.g., 1 hour to 1 day, e.g., 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 1 day, e.g., 1 day to 1 week, e.g., 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week, e.g., 1 week to 1 month, e.g., 2 weeks, 3 weeks, or 1 month, e.g., 1 month to 1 year, e.g., 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year) after the second dose of the pharmaceutical composition. In some embodiments, the third dose is administered within 1 day to 180 days (e.g., 1 day to 90 days, 1 day to 45 days, 1 day to 30 days, 1 day to 14 days, 1 day to 7 days, 2 days to 45 days, 2 days to 30 days, 2 days to 14 days, 2 days to 7 days, 3 days to 90 days, 3 days to 45 days, 3 days to 30 days, 3 days to 14 days, 3 days to 7 days, 4 days to 90 days, 4 days to 45 days, 4 days to 30 days, 4 days to 14 days, 4 days to 7 days, 5 days to 90 days, 5 days to 45 days, 5 days to 30 days, 5 days to 14 days, 5 days to 7 days, 6 days to 90 days, 6 days to 45 days, 6 days to 30 days, 6-14 days, 6-7 days, 7-90 days, 7-45 days, 7-30 days, 7-14 days, 14-90 days, 14-45 days, 14-30 days, 21-90 days, 21-60 days, 21-45 days, 21-30 days, 30-90 days, 30-60 days, 30-45 days, 45-180 days, 45-120 days, 45-100 days, 45-90 days, 45-60 days, 60-180 days, 60-120 days, 60-100 days, 60-90 days, 90-100 days, 90-120 days, or 90-180 days).

[0322] In some embodiments, the second dose is administered before the serum concentration of the antifusogenic polypeptide is less than about 500 ng / mL in the subject's serum.

[0323] In some embodiments, the method provides for the administration of at least 500 ng / mL (e.g., at least 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1,000 ng / mL, 1,100 ng / mL, 1,200 ng / mL, 1,300 ng / mL, 1,400 ng / mL, 1,500 ng / mL, 1,600 ng / mL, 1,700 ng / mL, 1,800 ng / mL, 1,900 ng / mL, 2,000 ng / mL, 2,100 ng / mL, 2,200 ng / mL, 2,300 ng / mL, 2,400 ng / mL, 2,500 ng / mL, 2,600 ng / mL, 2,700 ng / mL, L, 2,800 ng / mL, 2,900 ng / mL, 3,000 ng / mL, or more) of the antifusogenic polypeptide, for example, at least 1 hour (e.g., at least 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more).

[0324] A method of administering multiple doses of a composition of nucleic acid molecules (e.g., cyclic polyribonucleotides) described herein comprises providing two or more compositions to a cell, tissue or subject (e.g., a mammal) over a period of time. According to certain embodiments, multiple doses of a composition of nucleic acid molecules described herein can be administered to a subject over a defined time course. A method according to this aspect of the invention comprises administering a composition of nucleic acid molecules (e.g., cyclic polyribonucleotides, linear polyribonucleotides, cyclic polydeoxyribonucleotides, linear polydeoxyribonucleotides) described herein (e.g., in a pharmaceutical or veterinary composition) multiple times to a subject. As used herein, "administering sequentially" means that each dose of a composition of nucleic acid molecules described herein is administered to a subject at different time points, e.g., on different days separated by a predetermined interval (e.g., hours, days, weeks or months). In some embodiments, the invention provides a method comprising sequentially administering to a subject a single initial dose of a composition of nucleic acid molecules described herein, followed by one or more secondary doses of the composition, and optionally followed by one or more tertiary doses of the composition.

[0325] The terms "initial dose", "secondary dose" and "tertiary dose" refer to the temporal order of administration of the nucleic acid molecule compositions described herein. Thus, an "initial dose" is a dose administered at the beginning of a treatment regimen, a "secondary dose" is a dose administered after the initial dose, and a "tertiary dose" is a dose administered after the secondary dose. The initial dose, secondary dose, and tertiary dose may all contain the same amount of the nucleic acid molecule compositions described herein, and in certain embodiments, may differ from each other in terms of frequency of administration. In certain embodiments, the amount of the nucleic acid molecule compositions described herein contained in the initial, secondary, and / or tertiary doses differ from each other during the course of treatment (e.g., adjusted up or down as needed). In certain embodiments, one or more (e.g., 2, 3, 4, or 5) doses are administered as a "loading dose" at the beginning of a treatment regimen, followed by subsequent doses (e.g., "maintenance doses") administered on a less frequent basis.

[0326] In certain embodiments, each secondary and / or tertiary dose is administered after the immediately preceding dose. The phrase "immediately preceding dose" as used herein refers to a dose of a composition of a nucleic acid molecule described herein that is administered to a subject in a multiple dose sequence before administration of the very next dose in the sequence without any intervening dose. In certain embodiments, each secondary and / or tertiary dose is administered every day, every 2nd day, every 3rd day, every 4th day, every 5th day, every 6th day, or every 7th day after the immediately preceding dose. In certain embodiments, each secondary and / or tertiary dose is administered every 0.5 weeks, every week, every 2 weeks, every 3 weeks, or every 4 weeks after the immediately preceding dose.

[0327] The method according to this aspect of the invention may include administering to a subject any number of secondary and / or tertiary doses of a composition of nucleic acid molecules described herein. For example, in certain embodiments, only a single secondary dose is administered to a subject. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) secondary doses are administered to a subject. Similarly, in certain embodiments, only a single tertiary dose is administered to a subject. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) tertiary doses are administered to a subject.

[0328] In certain embodiments, the frequency at which secondary and / or tertiary doses are administered to a subject may vary over the course of a treatment regimen. The frequency of administration may also be adjusted during the course of treatment.

[0329] In some embodiments, the method includes providing (e.g., administering) at least a first composition and a second composition to a cell, tissue, or subject (e.g., a mammal, e.g., a human). In some embodiments, the method further includes providing (e.g., administering) a third composition, a fourth composition, a fifth composition, a sixth composition, a seventh composition, an eighth composition, a ninth composition, a tenth composition, or more compositions. In some embodiments, the additional compositions are provided over the lifespan of the cell. In some embodiments, the additional compositions are provided (e.g., administered) while the cell, tissue, or subject is benefiting from the compositions.

[0330] In some embodiments, the first composition in the multiple dose regimen comprises a first amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide) disclosed herein. In some embodiments, the second composition in the multiple dose regimen comprises a second amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide) disclosed herein. In some embodiments, the third composition, the fourth composition, the fifth composition, the sixth composition, the seventh composition, the eighth composition, the ninth composition, the tenth composition or more compositions in the multiple dose regimen comprise a third, fourth, fifth, sixth, seventh, eighth, ninth, tenth or more amounts of a nucleic acid molecule (e.g., a cyclic polyribonucleotide) disclosed herein. In some embodiments, the second amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide) is the same as the first amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide). In some embodiments, the third amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide) is the same as the first amount of a nucleic acid molecule (e.g., a cyclic polyribonucleotide). In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amount of nucleic acid molecules (e.g., circular polyribonucleotides) is the same as the first amount of nucleic acid molecules (e.g., circular polyribonucleotides). In some embodiments, the second amount of nucleic acid molecules (e.g., circular polyribonucleotides) is less than the first amount of nucleic acid molecules (e.g., circular polyribonucleotides). In some embodiments, the third amount of nucleic acid molecules (e.g., circular polyribonucleotides) is less than the first amount of nucleic acid molecules (e.g., circular polyribonucleotides). In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amount of nucleic acid molecules (e.g., circular polyribonucleotides) is less than the first amount of nucleic acid molecules (e.g., circular polyribonucleotides). In some embodiments, the second amount of nucleic acid molecules (e.g., circular polyribonucleotides) is more than the first amount of nucleic acid molecules (e.g., circular polyribonucleotides). In some embodiments, the third amount of nucleic acid molecules (eg, circular polyribonucleotides) is greater than the first amount of nucleic acid molecules (eg, circular polyribonucleotides).In some embodiments, the fourth, fifth, sixth, seventh, eighth, ninth, tenth, or more amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) is greater than the first amount of nucleic acid molecules (e.g., cyclic polyribonucleotides). In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the second composition varies by no more than 1%, 5%, 10%, 15%, 20%, or 25% of the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the second composition is no more than 1%, 5%, 10%, 15%, 20%, or 25% less than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the second composition is 0.1-1000 times greater than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the second composition is 0.1-fold, 1-fold, 5-fold, 10-fold, 100-fold, or 1000-fold greater than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the subsequent composition (e.g., a composition administered after the first composition) is 0.1-fold, 1-fold, 5-fold, 10-fold, 100-fold, or 1000-fold greater than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the second composition is 0.1-fold to 1000-fold lower than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., circular polyribonucleotides) in the second composition is 0.1, 1, 5, 10, 100, or 1000 times lower than the amount of nucleic acid molecules (e.g., circular polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., circular polyribonucleotides) in a subsequent composition (e.g., a composition administered after the first composition) is 0.1, 1, 5, 10, 100, or 1000 times lower than the amount of nucleic acid molecules (e.g., circular polyribonucleotides) in the first composition.In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in a subsequent composition (e.g., after a first composition with an amount of nucleic acid molecules (e.g., cyclic polyribonucleotides)) is 0.1-1000 times higher or lower than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. In some embodiments, the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in a subsequent composition (e.g., after a first composition with an amount of nucleic acid molecules (e.g., cyclic polyribonucleotides)) is 0.1-, 1-, 5-, 10-, 100-, or 1000-fold higher or lower than the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition. For example, the first composition contains 1x the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) compared to the first composition, the second composition contains 5x the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) compared to the first composition, and the third composition contains 0.2x the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) compared to the first composition. In some embodiments, the second composition contains at least 5x the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) compared to the amount of nucleic acid molecules (e.g., cyclic polyribonucleotides) in the first composition.

[0331] In some embodiments, the first composition comprises a greater amount of nucleic acid molecules (e.g., circular polyribonucleotides) than the second composition. In some embodiments, the first composition comprises a greater amount of nucleic acid molecules (e.g., circular polyribonucleotides) than the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth compositions.

[0332] In some embodiments, the multiple (e.g., two or more) compositions of nucleic acid molecules (e.g., cyclic polyribonucleotides) encoding antifusogenic polypeptides administered in a multiple-dosing regimen as described herein are the same composition. In some embodiments, the multiple (e.g., two or more) compositions of nucleic acid molecules (e.g., cyclic polyribonucleotides) encoding antifusogenic polypeptides administered in a multiple-dosing regimen as described herein are different compositions. In some embodiments, the same composition comprises nucleic acid molecules (e.g., cyclic polyribonucleotides) encoding the same antifusogenic polypeptide. In some embodiments, the different compositions comprise nucleic acid molecules (e.g., cyclic polyribonucleotides) encoding different antifusogenic polypeptides or combinations thereof.

[0333] In some embodiments, the methods of administering a nucleic acid molecule (e.g., a circular polyribonucleotide) provided herein in a multiple dose regimen include administering the nucleic acid molecule to a subject in need thereof multiple times (multiple doses), e.g., at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40, 50, 60, 100, 150, 200, or 500 times, for 1 to 56 days, e.g., about 49, 42, 35, 28, 21, 14, or 7 days. In some embodiments, the methods provided herein in a multiple dose regimen include administering the nucleic acid molecule to a subject in need thereof at least three times, spaced apart by about 7 days. In some embodiments, in subjects receiving multiple doses of a nucleic acid molecule provided herein (e.g., at least 3, 4, 5, 6, 7, 8, or 9 doses), levels of antifusogenic polypeptides (e.g., plasma antifusogenic polypeptides) are maintained at levels with less than 50%, 40%, 30%, 20%, or 10% variation for a period of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, or 20 weeks after the last dose. In some embodiments, in a subject receiving multiple doses of a nucleic acid molecule provided herein (e.g., at least 3, 4, 5, 6, 7, 8, or 9 doses), the level of an antifusogenic polypeptide (e.g., plasma antifusogenic polypeptide level) is maintained at a first level for a period of time greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, or 20 weeks after the second, third, fourth, fifth, sixth, seventh, eighth, or last dose, wherein the first level is greater than the level of the antifusogenic polypeptide measured shortly after the first dose (e.g., measured about 12, 24, 36, or 48 hours after the first dose).In some embodiments, in a subject receiving multiple doses of a nucleic acid molecule provided herein (e.g., at least three doses) administered at intervals of about 7 days, the level of an antifusogenic polypeptide (e.g., plasma antifusogenic polypeptide level) is maintained at a first level for a period of time greater than 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks after the second, third, fourth, fifth, sixth, seventh, eighth, or last dose, wherein the first level is greater than the level of an antifusogenic polypeptide measured shortly after the first dose (e.g., measured about 12, 24, 36, or 48 hours after the first dose).

[0334] Delivery method A circular polyribonucleotide encoding an antifusogenic polypeptide described herein (eg, a polypeptide of Table 1) can be included in a pharmaceutical composition with or without a carrier.

[0335] The pharmaceutical compositions described herein can be formulated, for example, to include a carrier, such as a pharmaceutical carrier and / or a polymeric carrier, such as a liposome, and delivered to a subject in need thereof (e.g., a human or non-human agricultural or livestock animal, such as a cow, dog, cat, horse, poultry) by known methods. Such methods include, but are not limited to, transfection (e.g., lipid-mediated cationic polymers, calcium phosphate, dendrimers); electroporation or other methods of membrane disruption (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV), microinjection, microprojectile bombardment ("gene gun"), fugene, direct sonic loading, cell squeezing, phototransfection, protoplast fusion, impalfection, magnetofection, exosome-mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof. Delivery methods are also described, for example, in Gori et al., Delivery and Specificity of CRISPR / Cas9 Genome Editing Technologies for Human Gene Therapy. Human Gene Therapy. July 2015, 26(7):443-451. doi:10.1089 / hum.2015.074; and Zuris et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2014 Oct 30;33(1):73-80.

[0336] In some embodiments, the cyclic polyribonucleotides can be delivered in a "naked" delivery formulation, which delivers the cyclic polyribonucleotides to cells without the aid of a carrier and without covalent modification of the cyclic polyribonucleotide or partial or complete encapsulation of the cyclic polyribonucleotide.

[0337] A naked delivery formulation is a formulation that does not include a carrier, does not have a covalent modification that binds the cyclic polyribonucleotide to a moiety that aids in its delivery to cells, and does not partially or completely encapsulate the cyclic polyribonucleotide. In some embodiments, a cyclic polyribonucleotide that does not have a covalent modification that binds the cyclic polyribonucleotide to a moiety that aids in its delivery to cells can be a polyribonucleotide that is not covalently bound to a moiety that aids in its delivery to cells, such as a protein, small molecule, particle, polymer, or biopolymer. In some embodiments, the cyclic polyribonucleotide can be delivered in a delivery formulation that includes protamine or a protamine salt (e.g., protamine sulfate).

[0338] A polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to a cell may not contain modified phosphate groups. For example, a polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to a cell may not contain phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, or phosphotriesters.

[0339] In some embodiments, the naked delivery formulation may be free of any or all of a transfection reagent, a cationic carrier, a carbohydrate carrier, a nanoparticle carrier, or a protein carrier. For example, naked delivery formulations include phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin, lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxypropyl)-1,2-dimethylamino-3-propane ... May not contain N,N-dioleyloxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N\N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

[0340] The naked delivery formulation may include a non-carrier excipient. In some embodiments, the non-carrier excipient may include an inactive ingredient that does not exhibit an active cell permeation effect. In some embodiments, the non-carrier excipient may include a buffer, such as PBS. In some embodiments, the non-carrier excipient may be a solvent, a non-aqueous solvent, a diluent, a suspension aid, a surfactant, an isotonicity agent, a thickener, an emulsifier, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersant, a granulating agent, a disintegrant, a binder, a buffer, a lubricant, or an oil.

[0341] In some embodiments, the naked delivery formulation may include a diluent, such as a parenterally acceptable diluent. The diluent (e.g., parenterally acceptable diluent) may be a liquid diluent or a solid diluent. In some embodiments, the diluent (e.g., parenterally acceptable diluent) may be an RNA solubilizing agent, a buffer, or an isotonic agent. Examples of RNA solubilizing agents include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of buffers include 2-(N-morpholino)ethanesulfonic acid (MES), bis-tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Examples of isotonicity agents include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.

[0342] In some embodiments, the formulation comprises a cell-penetrating agent. In some embodiments, the formulation is a topical formulation and comprises a cell-penetrating agent. The cell-penetrating agent can comprise an organic compound such as an alcohol having one or more hydroxyl functional groups. In some cases, the cell-penetrating agent comprises an alcohol, such as, but not limited to, a monohydric alcohol, a polyhydric alcohol, an unsaturated aliphatic alcohol, and an alicyclic alcohol. The cell-penetrating agent can comprise one or more of methanol, ethanol, isopropanol, phenoxyethanol, triethanolamine, phenethyl alcohol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, ethoxylated fatty acid, or hydroxyethyl cellulose. In certain embodiments, the cell-penetrating agent comprises ethanol. The cell permeation agent can include any cell permeation agent in any amount or in any formulation described in WO 2020 / 180751 or WO 2020 / 180752, which are incorporated by reference in their entireties.

[0343] In some embodiments, the pharmaceutical formulation disclosed herein, the pharmaceutical composition disclosed herein, the drug substance of the disclosed ones, or the drug product disclosed herein is in a parenteral nucleic acid delivery system. The parent nucleic acid delivery system can include the pharmaceutical formulation disclosed herein, the pharmaceutical composition disclosed herein, the drug substance of the disclosed ones, or the drug product disclosed herein, and a parenterally acceptable diluent. In some embodiments, in the parenteral nucleic acid delivery system, the pharmaceutical formulation disclosed herein, the pharmaceutical composition disclosed herein, the drug substance of the disclosed ones, or the drug product disclosed herein does not include any carrier.

[0344] The present disclosure further relates to a host or host cell comprising the cyclic polyribonucleotides described herein. In some embodiments, the host or host cell is a vertebrate, mammal (e.g., human), or other organism or cell.

[0345] In some embodiments, the cyclic polyribonucleotide causes a reduced or no undesirable response by the host's immune system compared to the response caused by a reference compound, for example, a linear polynucleotide corresponding to the described cyclic polyribonucleotide.In some embodiments, the cyclic polyribonucleotide is non-immunogenic in the host.Some immune responses include, but are not limited to, humoral immune responses (e.g., production of immunogen-specific antibodies) and cell-mediated immune responses (e.g., lymphocyte proliferation).

[0346] In some embodiments, a host or host cell is contacted (e.g., delivered or administered) with a cyclic polyribonucleotide. In some embodiments, the host is a mammal, such as a human. The amount of cyclic polyribonucleotide or linear, expression product, or both in the host can be measured at any time after administration. In certain embodiments, a time course of host growth in culture is determined. If growth increases or decreases in the presence of cyclic polyribonucleotide or linear, the cyclic polyribonucleotide or expression product, or both, is identified as effective for increasing or decreasing host growth.

[0347] Methods for delivering a circular polyribonucleotide molecule described herein to a cell, tissue, or subject include administering a pharmaceutical composition, drug substance, or drug product described herein to the cell, tissue, or subject.

[0348] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is an ungulate cell. In some embodiments, the cell is an animal cell. In some embodiments, the cell is an immune cell. In some embodiments, the tissue is connective tissue, muscle tissue, nervous tissue, or epithelial tissue. In some embodiments, the tissue is an organ (e.g., liver, lung, spleen, kidney, etc.).

[0349] In some embodiments, the method of delivery is an in vivo method. For example, the method of delivery of cyclic polyribonucleotides described herein comprises parenterally administering to a subject in need thereof a pharmaceutical composition, drug substance, or drug product described herein to a subject in need thereof. As another example, the method of delivery of cyclic polyribonucleotides to a cell or tissue of a subject comprises parenterally administering to a cell or tissue a pharmaceutical composition, drug substance, or drug product described herein. In some embodiments, the cyclic polyribonucleotide is in an amount effective to elicit a biological response in the subject. In some embodiments, the cyclic polyribonucleotide is in an amount effective to have a biological effect on a cell or tissue in the subject. In some embodiments, the pharmaceutical composition, drug substance, or drug product described herein comprises a carrier. In some embodiments, the pharmaceutical composition, drug substance, or drug product described herein comprises a diluent and does not comprise any carrier.

[0350] In some embodiments, the pharmaceutical composition, drug substance, or drug product is administered parenterally. In some embodiments, the pharmaceutical composition, drug substance, or drug product is administered intravenously, intraarterially, intraperitoneally, intradermally, intracranially, intrathecally, intralymphatically, subcutaneously, or intramuscularly. In some embodiments, the parenteral administration is intravenous, intramuscular, ophthalmic, subcutaneous, intradermal, or topical.

[0351] In some embodiments, a pharmaceutical composition, drug substance, or drug product described herein is administered intramuscularly. In some embodiments, a pharmaceutical composition, drug substance, or drug product described herein is administered subcutaneously. In some embodiments, a pharmaceutical composition, drug substance, or drug product described herein is administered topically. In some embodiments, a pharmaceutical composition, drug substance, or drug product described herein is administered intratracheally.

[0352] In some embodiments, the pharmaceutical composition, drug substance, or drug product is administered by injection. Administration can be systemic or local. In some embodiments, any of the delivery methods as described herein are performed using a carrier. In some embodiments, any of the delivery methods described herein are performed without a carrier or cell permeation agent.

[0353] In some embodiments, the cyclic polyribonucleotides or products translated from the cyclic polyribonucleotides are detected in the cell, tissue, or subject at least 1 day, at least 2 days, at least 3 days, at least 4 days, or at least 5 days after the administration step. In some embodiments, the presence of the cyclic polyribonucleotides or products translated from the cyclic polyribonucleotides is assessed in the cell, tissue, or subject before the administration step. In some embodiments, the presence of the cyclic polyribonucleotides or products translated from the cyclic polyribonucleotides is assessed in the cell, tissue, or subject after the administration step.

[0354] preparation In some embodiments of the present disclosure, the cyclic polyribonucleotides described herein can be formulated in a composition, such as an agricultural, animal, or pharmaceutical composition, for delivery to a cell, a plant, an invertebrate, a non-human vertebrate, or a human subject. In some embodiments, the cyclic polyribonucleotides are formulated in a pharmaceutical composition. In some embodiments, the composition comprises a cyclic polyribonucleotide and a diluent, a carrier, an adjuvant, or a combination thereof. In certain embodiments, the composition comprises a cyclic polyribonucleotide described herein and a carrier or a diluent without any carrier. In some embodiments, a composition comprising a cyclic polyribonucleotide and a diluent without any carrier is used for naked delivery of the cyclic polyribonucleotide to a subject.

[0355] The pharmaceutical composition may optionally include one or more additional active substances, for example, therapeutically and / or prophylactically active substances. The pharmaceutical composition may optionally include an inactive substance that serves as a vehicle or medium for the compositions described herein (e.g., a composition that includes a cyclic polyribonucleotide, such as any one of the inactive ingredients approved by the U.S. Food and Drug Administration (FDA) and listed in the inactive ingredient database). The pharmaceutical composition of the present invention may be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams&Wilkins, 2005 (incorporated herein by reference). Non-limiting examples of inert substances include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersion liquids, suspending aids, surfactants, isotonic agents, thickening agents, emulsifiers, preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersing agents, granulating agents, disintegrating agents, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof.

[0356] Although the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other animal, e.g., non-human animals, e.g., non-human mammals. Modifications of pharmaceutical compositions suitable for administration to humans to provide compositions suitable for administration to various animals are well understood, and a skilled veterinary pharmacologist can design and / or perform such modifications, if any, with no more than routine experimentation. Subjects to which the pharmaceutical compositions are intended to be administered include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0357] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparation methods include the steps of bringing into association the active ingredient with an excipient and / or one or more other accessory ingredients and then, as necessary and / or desirable, portioning, shaping, and / or packaging the product.

[0358] In some embodiments, the reference standard for the amount of circular polyribonucleotide molecules present in the formulation is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 100% (w / w), 150 ... 94%(w / w), 95%(w / w), 96%(w / w), 97%(w / w), 98%(w / w), 99%(w / w), 99.1%(w / w), 99.2%(w / w), 99.3%(w / w), 99.4%(w / w), 99.5%(w / w), 99.6%(w / w), 99.7%(w / w), 99.8%(w / w), 99.9%(w / w), or 100%(w / w) molecules.

[0359] In some embodiments, the reference standard for the amount of linear polyribonucleotide molecules present in the formulation is 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, The presence of less than 200ng / ml, 300ng / ml, 400ng / ml, 500ng / ml, 600ng / ml, 1μg / ml, 10μg / ml, 50μg / ml, 100μg / ml, 200μg / ml, 300μg / ml, 400μg / ml, 500μg / ml, 600μg / ml, 700μg / ml, 800μg / ml, 900μg / ml, 1mg / ml, 1.5mg / ml, or 2mg / ml.

[0360] In some embodiments, a reference standard for the amount of linear polyribonucleotide molecules present in a formulation is less than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) of linear polyribonucleotide molecules of the total ribonucleotide molecules in the pharmaceutical formulation.

[0361] In some embodiments, a reference standard for the amount of nicked polyribonucleotide molecules present in a formulation is less than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) nicked polyribonucleotide molecules of the total ribonucleotide molecules in the pharmaceutical formulation.

[0362] In some embodiments, the reference standard for the amount of combination of nicked and linear polyribonucleotide molecules present in the formulation is 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) or less of combination of nicked and linear polyribonucleotide molecules of the total ribonucleotide molecules in the pharmaceutical formulation. In some embodiments, the pharmaceutical formulation is an intermediate pharmaceutical formulation of the final circular polyribonucleotide drug product. In some embodiments, the pharmaceutical formulation is an active pharmaceutical ingredient or active ingredient (API). In some embodiments, the pharmaceutical formulation is a drug product for administration to a subject.

[0363] In some embodiments, the preparation of circular polyribonucleotides is further processed (before, during or after reduction of the linear RNA) to substantially remove DNA, protein contaminants (e.g., cellular proteins such as host cell proteins or protein process impurities), endotoxins, mononucleotide molecules, and / or process-related impurities.

[0364] In some embodiments, the pharmaceutical formulations disclosed herein can include (i) a compound disclosed herein (e.g., a cyclic polyribonucleotide); (ii) a buffer; (iii) a non-ionic surfactant; (iv) a tonicity agent; and / or (v) a stabilizer. In some embodiments, the pharmaceutical formulations disclosed herein are stable liquid pharmaceutical formulations. In some embodiments, the pharmaceutical formulations disclosed herein include protamine or a protamine salt (e.g., protamine sulfate).

[0365] Preservatives The compositions or pharmaceutical compositions provided herein may include material for single administration or may include material for multiple administration (e.g., "multi-dose" kits). Polyribonucleotides can be present in either linear or cyclic form. The compositions or pharmaceutical compositions may include one or more preservatives, such as thiomersal or 2-phenoxyethanol. Preservatives may be used to prevent microbial contamination during use. Suitable preservatives include benzalkonium chloride, thimerosal, chlorobutanol, methylparaben, propylparaben, phenylethyl alcohol, edetate disodium, sorbic acid, Onamer M, or other agents known to those skilled in the art. In ophthalmic products, for example, such preservatives may be used at levels of 0.004% to 0.02%. In the compositions described herein, preservatives, such as benzalkonium chloride, may be used at levels of 0.001% to less than 0.01% by weight, for example, 0.001% to 0.008% by weight, preferably about 0.005% by weight.

[0366] Polyribonucleotides may be susceptible to RNases that may be abundant in the surrounding environment. The compositions provided herein may include reagents that inhibit RNase activity, thereby preventing degradation of polyribonucleotides. In some cases, the compositions or pharmaceutical compositions include any RNase inhibitor known to those skilled in the art. Alternatively or additionally, the polyribonucleotides in the compositions provided herein, as well as the cell permeation agent and / or the pharma- ceutical acceptable diluent or carrier, vehicle, excipient, or other reagent, may be prepared in an RNase-free environment. The compositions may be formulated in an RNase-free environment.

[0367] In some cases, the compositions provided herein may be sterile.The compositions may be formulated as sterile solutions or suspensions in suitable vehicles known in the art.The compositions may be sterilized by conventional known sterilization techniques, for example, the compositions may be sterile filtered.

[0368] salt In some cases, the compositions or pharmaceutical compositions provided herein include one or more salts. To control osmolality, physiological salts such as sodium salts can be included in the compositions provided herein. Other salts can include potassium chloride, potassium dihydrogen phosphate, disodium phosphate, and / or magnesium chloride, and the like. In some cases, the compositions are formulated with one or more pharma- ceutically acceptable salts. The one or more pharma-ceutically acceptable salts can include those of inorganic ions, such as, for example, sodium, potassium, calcium, and magnesium ions. Such salts can include salts of inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid. Polyribonucleotides can exist in either linear or cyclic form.

[0369] Buffer / pH The compositions or pharmaceutical compositions provided herein may include one or more buffers, such as Tris buffer, borate buffer, succinate buffer, histidine buffer (e.g., with aluminum hydroxide adjuvant), or citrate buffer, etc. The buffers are in some cases within the range of 5-20 mM.

[0370] The compositions or pharmaceutical compositions provided herein can have a pH between about 5.0 and about 8.5, between about 6.0 and about 8.0, between about 6.5 and about 7.5, or between about 7.0 and about 7.8. The compositions or pharmaceutical compositions can have a pH of about 7. Polyribonucleotides can exist in either linear or circular form.

[0371] Detergents / Surfactants The compositions or pharmaceutical compositions provided herein may contain, depending on the intended route of administration, one or more detergents and / or surfactants, such as polyoxyethylene sorbitan ester surfactants (commonly referred to as "Tween®"), such as polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and / or butylene oxide (BO), such as linear EO / PO block copolymers, sold under the trade name DOWFAX™; octoxynols, which may vary in the number of repeating ethoxy(oxy-1,2-ethanediyl) groups, such as octoxynol-9 (Triton® X-100, or t-octylphenoxypolyethoxyethanol); (octylphenoxy)polyethoxyethanol (IGEPAL®); CA-630 / NP-40; phospholipids such as phosphatidylcholine (lecithin); nonylphenol ethoxylates such as the Tergitol™ NP series; polyoxyethylene fatty ethers derived from lauryl alcohol, cetyl alcohol, stearyl alcohol and oleyl alcohol (known as Brij® surfactants), such as triethylene glycol monolauryl ether (Brij® 30); and sorbitan esters (commonly known as “SPAN®”) such as sorbitan trioleate (Span® 85) and sorbitan monolaurate, octoxynol (such as octoxynol-9 (Triton® X-100) or t-octylphenoxypolyethoxyethanol), cetyltrimethylammonium bromide ("CTAB"), or sodium deoxycholate. One or more detergents and / or surfactants may be included only in trace amounts. In some examples, the composition may contain less than 1 mg / ml each of octoxynol-10 and polysorbate 80. Non-ionic surfactants may be used herein. Surfactants may be classified by their "HLB" (hydrophilic / lipophilic balance). In some examples, the surfactant has an HLB of at least 10, at least 15, and / or at least 16.The polyribonucleotide may be included in a linear or circular form.

[0372] Diluent In some embodiments, the compositions of the present disclosure comprise a cyclic polyribonucleotide and a diluent. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a diluent.

[0373] The diluent may be a non-carrier excipient. The non-carrier excipient serves as a vehicle or medium for the composition, such as the cyclic polyribonucleotide described herein. The non-carrier excipient serves as a vehicle or medium for the composition, such as the linear polyribonucleotide described herein. Non-limiting examples of non-carrier excipients include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersions, suspension aids, surfactants, isotonicity agents, thickening agents, emulsifiers, preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersants, granulating agents, disintegrants, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof. The non-carrier excipient may be any of the inactive ingredients listed in the Inactive Ingredient Database that are approved by the United States Food and Drug Administration (FDA) and do not exhibit cell-penetrating effects. A non-carrier excipient can be, for example, any inactive ingredient suitable for administration to a non-human animal suitable for veterinary use. Modifications of compositions suitable for administration to humans to make them suitable for administration to a variety of animals are well understood and a veterinary pharmacologist of ordinary skill can design and / or make such modifications with only routine experimentation, if any.

[0374] In some embodiments, the cyclic polyribonucleotides can be delivered as a naked delivery formulation, such as one that includes a diluent. Naked delivery formulations deliver the cyclic polyribonucleotides to cells without a carrier and without modification or partial or complete encapsulation of the cyclic polyribonucleotides, capped polyribonucleotides, or complexes thereof.

[0375] Naked delivery formulations are formulations that do not contain carriers, where the cyclic polyribonucleotide does not have a covalent modification that is attached to a moiety that aids in delivery to cells, or does not have partial or complete encapsulation of the cyclic polyribonucleotide. In some embodiments, the cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells is a polyribonucleotide that is not covalently attached to a protein, small molecule, particle, polymer, or biopolymer. The cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells does not contain modified phosphate groups. For example, the cyclic polyribonucleotide that does not have a covalent modification that is attached to a moiety that aids in delivery to cells does not contain phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoroamidates, phosphorodiamidates, alkyl or aryl phosphonates, or phosphotriesters.

[0376] In certain embodiments, the naked delivery formulation does not include any or all of a transfection reagent, a cationic carrier, a carbohydrate carrier, a nanoparticle carrier, or a protein carrier. In certain embodiments, the naked delivery formulation is selected from the group consisting of phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydrous modified phytoglycogen β-dextrin, lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-β-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3 -(2-Hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

[0377] In some embodiments, the naked delivery formulation comprises a non-carrier excipient. In some embodiments, the non-carrier excipient comprises an inactive ingredient that does not exhibit a cell-penetrating effect. In some embodiments, the non-carrier excipient comprises a buffer, such as PBS. In some embodiments, the non-carrier excipient is a solvent, a non-aqueous solvent, a diluent, a suspending aid, a surfactant, an isotonicity agent, a thickener, an emulsifier, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersant, a granulating agent, a disintegrant, a binder, a buffer, a lubricant, or an oil.

[0378] In some embodiments, the naked delivery formulation comprises a diluent. The diluent can be a liquid diluent or a solid diluent. In some embodiments, the diluent is an RNA solubilizing agent, a buffer, or an isotonic agent. Examples of RNA solubilizing agents include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of buffers include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Examples of isotonicity agents include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.

[0379] Carrier In some embodiments, the compositions of the present disclosure comprise a cyclic polyribonucleotide and a carrier. In some embodiments, the compositions of the present disclosure comprise a linear polyribonucleotide and a carrier.

[0380] In certain embodiments, the compositions comprise a circular polyribonucleotide as described herein in a vesicle or other membrane-based carrier. In certain embodiments, the compositions comprise a linear polyribonucleotide as described herein in a vesicle or other membrane-based carrier.

[0381] In other embodiments, the composition comprises a cyclic polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In other embodiments, the composition comprises a linear polyribonucleotide in or through a cell, vesicle, or other membrane-based carrier. In one embodiment, the composition comprises a cyclic polyribonucleotide in a liposome or other similar vesicle. In one embodiment, the composition comprises a linear polyribonucleotide in a liposome or other similar vesicle. Liposomes are spherical vesicular structures composed of a mono- or multi-membrane lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood-brain barrier (BBB) ​​(see, e.g., for review, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi:10.1155 / 2011 / 469679).

[0382] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to produce liposomes as drug carriers. Methods for the preparation of multilamellar vesicle lipids are known in the art (see, for example, U.S. Pat. No. 6,693,086, the teachings of which are incorporated herein by reference for their related preparation of multilamellar vesicle lipids). When lipid membranes are mixed with aqueous solution, vesicle formation can occur spontaneously, but it can also be promoted by applying force in the form of shaking, by using homogenizers, sonicators, or extrusion devices (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011.doi:10.1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extrusion through reduced size filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.

[0383] In certain embodiments, the compositions of the present disclosure include cyclic polyribonucleotides and lipid nanoparticles, such as lipid nanoparticles, as described herein. In certain embodiments, the compositions of the present disclosure include linear polyribonucleotides and lipid nanoparticles. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for cyclic polyribonucleotide molecules as described herein. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for linear polyribonucleotide molecules as described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the properties of SLNs, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a new type of carrier that combines liposomes and polymers, can also be used. These nanoparticles have the complementary advantages of PNPs and liposomes. PLN consists of a core-shell structure; the polymer core provides a stable structure, and the phospholipid shell provides good biocompatibility. Thus, the two components increase drug encapsulation efficiency, facilitate surface modification, and prevent leakage of water-soluble drugs. For a review, see, for example, Li et al. 2017, Nanomaterials 7, 122; doi:10.3390 / nano7060122.

[0384] Further non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), protein carriers (e.g., proteins covalently attached to cyclic polyribonucleotides or proteins covalently attached to linear polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfection reagents). Non-limiting examples of carbohydrate carriers include phytoglycogen octenyl succinate, phytoglycogen β-dextrin, and anhydride-modified phytoglycogen β-dextrin. Non-limiting examples of cationic carriers include lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)-1,2-propanediol ... N,N-diisopropyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N\N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), and N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). Non-limiting examples of protein carriers include human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

[0385] Exosomes can also be used as drug delivery vehicles for the circular RNA compositions or preparations described herein.Exosomes can also be used as drug delivery vehicles for the linear polyribonucleotide compositions or preparations described herein.For review, see Ha et al.July 2016.Acta Pharmaceutica Sinica B.Volume 6, Issue 4, Pages 287-296;doi.org / 10.1016 / j.apsb.2016.02.001.

[0386] Ex vivo differentiated erythrocytes may also be used as a carrier for the circular RNA compositions or preparations described herein.Ex vivo differentiated erythrocytes may also be used as a carrier for the linear polyribonucleotide compositions or preparations described herein. See, for example, WO 2015 / 073587; WO 2017 / 123646; WO 2017 / 123644; WO 2018 / 102740; WO 2016 / 183482; WO 2015 / 153102; WO 2018 / 151829; WO 2018 / 009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Pat. No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. See USA.111(28):10131-10136. For example, fusosome compositions as described in WO 2018 / 208728 can also be used as carriers for delivering the circular polyribonucleotide molecules described herein. For example, fusosome compositions as described in WO 2018 / 208728 can also be used as carriers for delivering the linear polyribonucleotide molecules described herein.

[0387] Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the circular polyribonucleotide molecules described herein to target cells. Virosomes and virus-like particles (VLPs) can also be used as carriers for delivering the linear polyribonucleotide molecules described herein to target cells.

[0388] For example, plant nanovesicles and plant messenger packs (PMPs), as described in International Patent Publication Nos. WO 2011 / 097480, WO 2013 / 070324, WO 2017 / 004526, or WO 2020041784, may also be used as carriers for delivering the circular RNA compositions or preparations described herein. Plant nanovesicles and plant messenger packs (PMPs) may also be used as carriers for delivering the linear polyribonucleotide compositions or preparations described herein.

[0389] Microbubbles can also be used as a carrier for delivering the circular polyribonucleotide molecules described herein.Microbubbles can also be used as a carrier for delivering the linear polyribonucleotide molecules described herein.See, for example, U.S. Pat. No. 7,115,583;Beeri, R. et al., Circulation.2002 Oct 1;106(14):1756-1759;Bez, M. et al., Nat Protoc.2019 Apr;14(4):1015-1026;Hernot, S. et al., Adv Drug Deliv Rev.2008 Jun 30;60(10):1153-1166;Rychak, JJ et al., Adv Drug Deliv Rev.2014 Jun;72:82-93.In some embodiments, the microbubbles are albumin-coated perfluorocarbon microbubbles.

[0390] A carrier comprising a cyclic polyribonucleotide as described herein may comprise a plurality of particles. The particles may have a median article size of 30-700 nanometers (e.g., 30-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 100-500, 50-500, or 200-700 nanometers). The size of the particles may be optimized to favor deposition of the payload comprising cyclic polyribonucleotide into cells. Deposition of cyclic polyribonucleotide into specific cell types may favor different particle sizes. For example, the particle size may be optimized for deposition of cyclic polyribonucleotide into antigen-presenting cells. The particle size may be optimized for deposition of cyclic polyribonucleotide into dendritic cells. Additionally, the particle size may be optimized for deposition of cyclic polyribonucleotide into draining lymph node cells.

[0391] Lipid Nanoparticles The compositions, methods, and delivery systems provided by the present disclosure may use any suitable carrier or delivery modality, including, in certain embodiments, lipid nanoparticles (LNPs) as described herein. The lipid nanoparticles, in certain embodiments, include one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic, or amphoteric lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers as described in Table 5 of International Publication No. WO2019217941, which is incorporated herein by reference in its entirety); and one or more sterols (e.g., cholesterol).

[0392] Lipids (e.g., lipid nanoparticles) that can be used in nanoparticle formation include, for example, those described in Table 4 of WO2019217941, which is incorporated by reference - for example, a lipid-containing nanoparticle can include one or more of the lipids in Table 4 of WO2019217941. The lipid nanoparticle can include additional elements, such as a polymer, for example, a polymer described in Table 5 of WO2019217941, which is incorporated by reference.

[0393] In certain embodiments, the conjugated lipid, if present, is PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2',3'-di(tetradecyl)glycerol), PEG-glyceryl-2,3-diamino-2-(trimethylsilyl)-1,1-dimethylethyl)-2,2-dimethylethyl)-1,1-dimethylethyl)-2,3-dimethylethyl ... The polyoxyalkylene glycols may include one or more of the following: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, N-(carbonyloxypropyl)-1-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019051289 (incorporated by reference), as well as combinations of the above.

[0394] In some embodiments, sterols that may be incorporated into the lipid nanoparticles include one or more of cholesterol or cholesterol derivatives, such as those described in WO 2009 / 127060 or U.S. Patent Publication No. 2010 / 0130588, which are incorporated by reference. Further exemplary sterols include plant sterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated by reference herein.

[0395] In some embodiments, the lipid particles include an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be independently varied to achieve desired properties. For example, in some embodiments, the lipid nanoparticles include an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20-70% (mol), 30-60% (mol), or 40-50% (mol); about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticle), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugated lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the ratio of total lipid to nucleic acid (mass or weight) can be about 10:1 to about 30:1.

[0396] In certain embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of the lipid nanoparticle formulation can range from about 5 mg / ml to about 30 mg / mL.

[0397] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), include the following: [ka] In certain embodiments, an LNP comprising formula (i) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0398] [ka] In certain embodiments, an LNP comprising formula (ii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0399] [ka] In certain embodiments, an LNP comprising formula (iii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0400] [ka] In certain embodiments, an LNP comprising formula (v) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0401] [ka] In certain embodiments, an LNP comprising formula (vi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0402] [ka] In certain embodiments, an LNP comprising formula (viii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0403] [ka] In certain embodiments, an LNP comprising formula (ix) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0404] [ka] During the ceremony, X 1 But, O, NR 1 or a direct bond, X 2 is C2-5 alkylene, and X 3 is C(=O) or a direct bond, and R 1 is H or Me, and R 3 is C1-3 alkyl, R 2 is C1-3 alkyl, or R 2 The nitrogen atom to which it is attached and X 2 together with 1 to 3 carbon atoms of X to form a 4-, 5-, or 6-membered ring, or 1 But NR 1 and R 1 and R 2 together with the nitrogen atom to which they are attached form a 5- or 6-membered ring, or R 2 But R 3 and together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered ring; Y 1 is C2-12 alkylene, and Y 2 but, [ka] is selected from n is 0 to 3, R 4is C1-15 alkyl, Z 1 is C1-6 alkylene or a direct bond, Z 2 but [ka] (in either orientation) or absent, with the proviso that Z 1 is a direct bond, and Z 2 If is non-existent; R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R 7 is H or Me, or a salt thereof, with the proviso that R 3 and R 2 is a C2 alkyl group, and X 1 is O and X 2 is a linear C3 alkylene, and X 3 But C(=0) and Y 1 is a linear Ce alkylene, (Y 2 )nR 4 but, [ka] and R 4 is a linear C5 alkyl; Z 1 is C2 alkylene, and Z 2 is absent, W is methylene, and R 7 If H, then R 5 and R 6 But Cx is not alkoxy.

[0405] In certain embodiments, an LNP comprising formula (xii) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0406] [ka] In certain embodiments, an LNP comprising formula (xi) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0407] [ka] In certain embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

[0408] [ka] In certain embodiments, an LNP comprising formula (xv) is used to deliver the polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell.

[0409] [ka] In some embodiments, an LNP comprising a formulation of formula (xvi) is used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to a cell. [ka]

[0410] In certain embodiments, the lipid compounds used to form lipid nanoparticles for delivery of the compositions described herein, e.g., the nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)), are made by one of the following reactions: [ka]

[0411] In some embodiments, LNPs comprising formula (xxi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxi) are LNPs described by WO2021113777 (e.g., lipids of formula (1), such as lipids in Table 1 of WO2021113777). [ka] During the ceremony, Each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)- * or -C(O)O- * In the formula, * " refers to the point of attachment to R1 or R3; R1 and R3 are each independently oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclylalkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclyl)(alkyl)aminoalkyl, heterocyclyl, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkyl linear or branched C9-C alkyl groups optionally substituted with one or more substituents selected from the group consisting of oxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclylalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl, and alkylsulfonealkyl;20 Alkyl or C9-C 20 alkenyl; and R2 is [ka] is selected from the group consisting of:

[0412] In some embodiments, LNPs comprising formula (xxii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxii) are LNPs described by WO2021113777 (e.g., lipids of formula (2), such as lipids in Table 2 of WO2021113777). [ka] During the ceremony, each n is independently an integer from 1 to 15; R1 and R2 each independently represent [ka] is selected from the group consisting of:

[0413] R3 is, [ka] is selected from the group consisting of:

[0414] In some embodiments, LNPs comprising formula (xxiii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. In some embodiments, the LNPs of formula (xxiii) are LNPs described by WO2021113777 (e.g., lipids of formula (3), such as lipids in Table 3 of WO2021113777). [ka] During the ceremony, X is -O-, -S-, or -OC(O)-. * is selected from the group consisting of * indicates the point of attachment to R1; R1 is, [ka] is selected from the group consisting of R2 is [ka] is selected from the group consisting of:

[0415] In some embodiments, the compositions described herein (e.g., nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) or proteins) are provided in LNPs that include an ionizable lipid. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), e.g., as described in Example 1 of U.S. Pat. No. 9,867,888, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecanedioate (LP01), e.g., as synthesized in Example 13 of WO 2015 / 095340, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl)9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., as synthesized in Examples 7, 8, or 9 of U.S. Patent Publication No. 2012 / 0027803, which is incorporated herein by reference in its entirety. In one embodiment, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), for example, as synthesized in Examples 14 and 16 of WO 2010 / 053572, which is incorporated by reference in its entirety.In certain embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,14,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, e.g., structure (I) from WO 2020 / 106946, which is incorporated herein by reference in its entirety.

[0416] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, for example, a cationic lipid that may exist in a positively charged or neutral form depending on pH, or an amine-containing lipid that may be easily protonated. In some embodiments, the cationic lipid is a lipid that may be positively charged, for example, under physiological conditions. Exemplary cationic lipids include one or more amine groups with a positive charge. In some embodiments, the lipid particles include cationic lipids in a combination with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein may have an effective pKa greater than 6.0. In some embodiments, the lipid nanoparticle may include a second cationic lipid that has a different effective pKa (e.g., higher than the first effective pKa) than the first cationic lipid. The lipid nanoparticles can include 40-60 mol percent cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and a therapeutic agent, such as a nucleic acid described herein (e.g., RNA (e.g., cyclic polyribonucleotides, linear polyribonucleotides)) encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is formulated simultaneously with the cationic lipids. The nucleic acid can be adsorbed to the surface of the LNP, e.g., LNPs including cationic lipids. In some embodiments, the nucleic acid can be encapsulated within the LNP, e.g., LNPs including cationic lipids. In some embodiments, the lipid nanoparticles can include a targeting moiety, e.g., coated with a targeting agent. In some embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, e.g., formula (i), (ii), (vii) and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98% or 100% of the RNA molecules.

[0417] Exemplary ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. WO2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; No. Ic; U.S. Patent Application Publication No. 2013 / 0178541, No. A; U.S. Patent Application Publication No. 2013 / 0303587 or U.S. Patent Application Publication No. 2013 / 0123338, No. I; U.S. Patent Application Publication No. 2015 / 0141678, No. I; U.S. Patent Application Publication No. 2015 / 0239926, No. II, III, IV, or V; U.S. Patent Application Publication No. 2017 / 0119904, No. I; WO 2017 / 117528, No. I or II; U.S. Patent Application Publication No. 2012 / 0149894 A; U.S. Patent Application Publication No. 2015 / 0057373 A; WO 2013 / 116126 A; U.S. Patent Application Publication No. 2013 / 0090372 A; U.S. Patent Application Publication No. 2013 / 0274523 A; U.S. Patent Application Publication No. 2013 / 0274504 A; U.S. Patent Application Publication No. 2013 / 0053572 A; WO 2013 / 0 16058, A; WO 2012 / 162210, A; U.S. Patent Application Publication No. 2008 / 042973, I; U.S. Patent Application Publication No. 2012 / 01287670, I, II, III, or IV; U.S. Patent Application Publication No. 2014 / 0200257, I or II; U.S. Patent Application Publication No. 2015 / 0203446, I, II, or III; U.S. Patent Application Publication No. 2015 / 0005363, I or III;U.S. Patent Application Publication No. 2014 / 0308304, I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV; U.S. Patent Application Publication No. 2013 / 0338210; WO 2009 / 132131, I, II, III, or IV; U.S. Patent Application Publication No. 2012 / 01011478, A; U.S. Patent Application Publication No. 2012 / 0027796, I or XXXV; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; No. 2013 / 0323269; U.S. Patent Application Publication No. I of U.S. Patent Application Publication No. 2011 / 0117125; U.S. Patent Application Publication No. I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, IX, X, XI, or XII of U.S. Patent Application Publication No. 2012 / 0202871; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; U.S. Patent Application Publication No. 2006 / 008378 I or II of the specification; I of U.S. Patent Application Publication No. 2013 / 0123338; ​​I or XAYZ of U.S. Patent Application Publication No. 2015 / 0064242; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013 / 0022649; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I or II of U.S. Patent Application Publication No. 2010 / 0062967; U.S. Patent Application Publication No. 2013 / 0189351 I-X of US Patent Application Publication No. 2014 / 0039032; V of US Patent Application Publication No. 2018 / 0028664; I of US Patent Application Publication No. 2016 / 0317458; I of US Patent Application Publication No. 2013 / 0195920; 5, 6, or 10 of US Patent Application Publication No. 10,221,127; III-3 of WO 2018 / 081480; I-5 or I-8 of WO 2020 / 081938; 18 or 25 of US Patent Application Publication No. 9,867,888;US2019 / 0136231A;WO2020 / 219876II;US2012 / 0027803A1;US2019 / 0240349OF-02;US10,086,013A23;cKK-E12 / A6 of Miao et al (2020);C12-200 of WO2010 / 053572;7C1 of Dahlman et al (2017);Whitehead et al al., 304-O13 or 503-O13; TS-P4C2 of U.S. Pat. No. 9,708,628; I of WO 2020 / 106946; I of WO 2020 / 106946; and (1), (2), (3) or (4) of WO 2021 / 113777. Exemplary lipids further include any one of the lipids in Tables 1 to 16 of WO 2021 / 113777.

[0418] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,3lZ)-heptatriaconta-6,9,28,3l-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), as described in, for example, Example 9 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, as described in, for example, Example 10 of WO2019051289A9 (incorporated herein in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-diene-1-amine (compound 32), e.g., as described in Example 11 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, e.g., as described in Example 12 of WO2019051289A9 (incorporated herein by reference in its entirety).

[0419] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidyl 16-O-dimethyl-1-propanolamine (DMPE), ... PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), diercoyl phosphatidylcholine (DEPC), palmitoyl oleoyl ... dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanol phatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Further exemplary lipids include, in certain embodiments, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. Such lipids include, in certain embodiments, plant lipids that have been shown to improve hepatic transfection with mRNA (e.g., DGTS).

[0420] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO 2017 / 099823 or US 2018 / 0028664, the entire contents of which are incorporated herein by reference.

[0421] In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II, or IV of US Patent Publication No. 2018 / 0028664 (herein incorporated by reference in its entirety). The non-cationic lipid may, for example, comprise 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0422] In some embodiments, the lipid nanoparticles do not contain any phospholipids.

[0423] In some embodiments, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. One exemplary sterol that may be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 , 4'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0424] In some embodiments, components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipid present in the lipid nanoparticle (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components comprise 20-50% (mol) 30-40% (mol) of the total lipid content of the lipid nanoparticle.

[0425] In some embodiments, the lipid nanoparticles may contain polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit lipid nanoparticle aggregation and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol)-conjugated lipid.

[0426] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl)propionate (PEG-DMG ...dialkyloxypropyl (DAA), PEG-phospholipid, PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, PEG-phospholipid, propyl-1-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Further exemplary PEG-lipid conjugates are described, for example, in U.S. Pat. No. 5,885,613, U.S. Pat. No. 6,287,591, U.S. Patent Application Publication No. 2003-2006, and the like. No. 2003 / 0077829, U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, and U.S. Patent Application No. 099823, all of which are incorporated herein by reference in their entireties. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664, the entire contents of which are incorporated herein by reference. In some embodiments, the PEG-lipid is of formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224, both of which are incorporated herein by reference in their entireties.In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be, for example, PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[β]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB ( PEG-lipids may be one or more of PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000], 3,4-ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether, and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, ... [ka] The present invention includes a structure selected from the following:

[0427] In some embodiments, lipids conjugated with molecules other than PEG can be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used in place of or in addition to PEG-lipids.

[0428] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019051289A9, all of which are incorporated herein by reference in their entireties.

[0429] In some embodiments, the PEG or conjugated lipid may comprise 0-20% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid may be varied as needed. For example, the lipid particles may comprise 30-70% ionizable lipid per mole or total weight of the composition, 0-60% cholesterol per mole or total weight of the composition, 0-30% non-cationic lipid per mole or total weight of the composition, and 1-10% conjugated lipid per mole or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid per mole or total weight of the composition, 40-50% cholesterol per mole or total weight of the composition, and 10-20% non-cationic lipid per mole or total weight of the composition. In some other embodiments, the composition is 50-75% ionizable lipid per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition and 1-10% conjugated lipid per mole or total weight of the composition. The composition may contain 60-70% ionizable lipid per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition. The composition may also contain up to 90% ionizable lipid per mole or total weight of the composition and 2-15% non-cationic lipid per mole or total weight of the composition.Formulations may also be used that contain, for example, 8-30% ionizable lipid per mole or total weight of the composition, 5-30% non-cationic lipid per mole or total weight of the composition, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipid per mole or total weight of the composition, 4-25% non-cationic lipid per mole or total weight of the composition, 2-25% cholesterol per mole or total weight of the composition, 10-35% conjugated lipid per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or The lipid nanoparticle formulation may comprise 2-30% ionizable lipid per mole or total weight of the composition, 2-30% non-cationic lipid per mole or total weight of the composition, 1-15% cholesterol per mole or total weight of the composition, 2-35% conjugated lipid per mole or total weight of the composition, and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipid per mole or total weight of the composition and 2-10% non-cationic lipid per mole or total weight of the composition, or 100% cationic lipid per mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipid, cholesterol, and PEGylated lipid in a molar ratio of 60:38.5:1.5.

[0430] In one embodiment, the lipid particle comprises an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, where the molar ratio of lipids is in the range of 20-70 mole percent for the ionizable lipid with a target of 40-60, the molar percent of the non-cationic lipid is in the range of 0-30 with a target of 0-15, the molar percent of the sterol is in the range of 20-70 with a target of 30-50, and the molar percent of the PEGylated lipid is in the range of 1-6 with a target of 2-5.

[0431] In one embodiment, the lipid particles comprise an ionizable lipid / non-cationic lipid / sterol / conjugated lipid molar ratio of 50:10:38.5:1.5.

[0432] In one aspect, the disclosure provides a lipid nanoparticle formulation comprising a phospholipid, a lecithin, a phosphatidylcholine, and a phosphatidylethanolamine.

[0433] In some embodiments, one or more additional comp...

Claims

1. A circular polyribonucleotide comprising a polyribonucleotide cargo encoding an antifusogenic polypeptide.

2. 2. The circular polyribonucleotide of claim 1, wherein the polyribonucleotide cargo comprises an expression sequence encoding the antifusogenic polypeptide.

3. 3. A circular polyribonucleotide according to claim 1 or 2, comprising a splice junction joining a 5' exon fragment and a 3' exon fragment.

4. 4. The circular polyribonucleotide of claim 2 or 3, wherein the polyribonucleotide cargo comprises an IRES operably linked to the expression sequence encoding the antifusogenic polypeptide.

5. The circular polyribonucleotide of claim 4, further comprising a spacer region between the IRES and the 3' exon fragment or the 5' exon fragment.

6. 6. The circular polyribonucleotide of claim 5, wherein the spacer region is at least 5 ribonucleotides in length.

7. 7. The circular polyribonucleotide of claim 6, wherein the spacer region is 5 to 500 ribonucleotides in length.

8. 8. The circular polyribonucleotide of claim 5, wherein the spacer region comprises a poly A, a poly A-C, a poly A-U, or a poly A-G sequence.

9. 9. A circular polyribonucleotide according to any one of claims 1 to 8, which is at least 500 ribonucleotides in length.

10. 10. The circular polyribonucleotide of claim 9, which is 500 to 20,000 ribonucleotides in length.

11. A linear polyribonucleotide comprising, from 5' to 3', (A) a 3' intron fragment; (B) a 3' splice site; (C) a 3' exon fragment; (D) a polyribonucleotide cargo encoding an antifusogenic polypeptide; (E) a 5' exon fragment; (F) a 5' splice site; and (G) a 5' intron fragment.

12. 12. A linear polyribonucleotide according to claim 11, wherein the polyribonucleotide cargo comprises an expression sequence encoding the antifusogenic polypeptide.

13. 13. The linear polyribonucleotide of claim 12, wherein the polyribonucleotide cargo comprises an IRES operably linked to the expression sequence encoding the antifusogenic polypeptide.

14. 14. The linear polyribonucleotide of any one of claims 11 to 13, wherein the cyclic polyribonucleotide further comprises a spacer region between one or more of (A), (B), (C), (D), (E), (F), and (G).

15. 15. The linear polyribonucleotide of claim 14, wherein the spacer region is at least 5 ribonucleotides in length.

16. 16. The linear polyribonucleotide of claim 15, wherein the spacer region is 5 to 500 ribonucleotides in length.

17. 17. A linear polyribonucleotide according to any one of claims 14 to 16, wherein the spacer region comprises a poly A, a poly A-C, a poly A-U, or a poly A-G sequence.

18. 18. A linear polyribonucleotide according to any one of claims 11 to 17, which is at least 500 ribonucleotides in length.

19. 19. The linear polyribonucleotide of claim 18, which is 500 to 20,000 ribonucleotides in length.

20. A DNA vector encoding the linear polyribonucleotide of any one of claims 11 to 19.

21. A method for expressing an antifusogenic polypeptide in a cell, comprising providing said cell with a circular polyribonucleotide according to any one of claims 1 to 10, a linear polyribonucleotide according to any one of claims 11 to 19, or a DNA vector according to claim 20 under conditions suitable for expressing said antifusogenic polypeptide.

22. 21. A method for producing a circular polyribonucleotide from a linear polyribonucleotide according to any one of claims 11 to 20, comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce the circular polyribonucleotide.

23. A pharmaceutical composition comprising a circular polyribonucleotide according to any one of claims 1 to 10, a linear polyribonucleotide according to any one of claims 11 to 19, or a DNA vector according to claim 20, and a diluent, carrier, or excipient.

24. A method for expressing an anti-membrane fusion polypeptide in a subject, comprising administering a first dose of the pharmaceutical composition described in claim 23 in an amount sufficient to result in a serum concentration of the anti-membrane fusion polypeptide in the subject of at least 500 ng / mL.

25. 25. The method of claim 24, further comprising administering a second dose of the pharmaceutical composition.

26. 26. The method of claim 25, wherein the second dose is administered at least one day after the first dose of the pharmaceutical composition.

27. 27. The method of claim 26, wherein the second dose is administered 1 to 90 days after the first dose of the pharmaceutical composition.

28. The method of any one of claims 25 to 27, wherein the second dose is administered before the serum concentration of the antifusogenic polypeptide is less than about 500 ng / mL in the serum of the subject.

29. 29. The method of claim 28, wherein the method maintains a serum concentration of the antifusogenic polypeptide in the subject of at least 500 ng / mL.

30. The method of any one of claims 24 to 29, for treating or preventing a viral infection in the subject.

31. 31. The method of claim 30, wherein the pharmaceutical composition is administered to the subject in an amount and for a duration sufficient to treat or prevent the viral infection.

32. The method of any one of claims 24 to 31, which reduces viral entry.

33. A circular polyribonucleotide comprising a polyribonucleotide cargo encoding multiple antifusogenic polypeptides.

34. 34. The circular polyribonucleotide of claim 33, wherein the polyribonucleotide cargo comprises an expression sequence encoding the antifusogenic polypeptide.

35. 35. The circular polyribonucleotide of claim 33 or 34, wherein the antifusogenic polypeptides are directed against the same virus.

36. 35. The circular polyribonucleotide of claim 33 or 34, wherein the antifusogenic polypeptide is directed against two or more viruses.

Images