Nucleotides and their uses

Abstract

The present invention provides nucleotides and uses thereof, in particular a nucleic acid molecule that specifically binds to USH2A pre-mRNA exon 13, and also provides a method for preparing and using the nucleic acid molecule. The nucleic acid molecule has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and can target and interfere with pre-mRNA splicing, increasing the rate of single-skipping of USH2A pre-mRNA exon 13, significantly improving efficiency while ensuring safety.

Description

[Technical field]

[0001] The present application relates to the biomedical field, and in particular to nucleotides and their uses. [Background technology]

[0002] Usher syndrome, also known as deafness-retinitis pigmentosa syndrome, is a type of genetic disorder characterized by variable degrees of congenital sensorineural hearing loss and progressive vision loss due to retinitis pigmentosa (RP). Among them, mutations in the USH2A gene are the most common cause of type II Usher syndrome, accounting for more than 50% of Usher syndrome patients. At the same time, mutations in the USH2A gene are also one of the important causes of nonsyndromic retinitis pigmentosa (NSRP). Mutations in exon 13, exon 50, and intron 40 of the USH2A gene cause Usher syndrome. To date, more than 1,000 pathogenic mutations distributed throughout the USH2A gene have been identified, and exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35%. The USH2A coding region is approximately 15.6 kb in length, and current conventional gene therapy delivery methods (e.g., recombinant lentivirus, recombinant adeno-associated virus) have difficulty packaging such a large coding sequence, making it difficult to directly target USH2A for therapy.

[0003] Therefore, there is an urgent need in this field for a treatment method for USH2A gene mutation-associated diseases that can improve the efficiency of exon skipping and ensure the safety of treatment. Summary of the Invention

[0004] In one aspect, the present application provides a nucleic acid molecule capable of specifically binding to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, wherein the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753.

[0005] In one aspect, the present application provides a nucleic acid molecule capable of specifically binding to the sequence shown in SEQ ID NO:1 or a fragment thereof.

[0006] In one aspect, the application provides a nucleic acid molecule that is complementary to 16 or more contiguous nucleotides of the sequence set forth in SEQ ID NO:1.

[0007] In one aspect, the present application provides a nucleic acid molecule comprising 16 or more contiguous nucleotides of the sequence set forth in SEQ ID NO:1, or a complementary sequence thereof.

[0008] In one aspect, the present application provides gene expression cassettes that include or encode the nucleotide sequences of the nucleic acid molecules described herein, and any expression control elements.

[0009] In one aspect, the present application provides vectors that include or encode the nucleotide sequences of the nucleic acid molecules described herein and / or the nucleotide sequences of the gene expression cassettes described herein.

[0010] In one aspect, the present application provides a viral particle comprising a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, and / or a vector described herein.

[0011] In one aspect, the present application provides a cell comprising a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, and / or a viral particle described herein.

[0012] In one aspect, the present application provides a pharmaceutical composition comprising a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, a viral particle described herein, and / or a cell described herein, and optionally a pharma- ceutical acceptable carrier.

[0013] In one aspect, the present application provides a kit comprising a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, a viral particle described herein, a cell described herein, and / or a pharmaceutical composition described herein.

[0014] In one aspect, the present application provides a method for preparing a nucleic acid molecule described in the present application, comprising expressing and / or synthesizing the nucleic acid molecule capable of binding to the 3'-end sequence of USH2A exon 13 or a fragment thereof, wherein the genomic location of the 3'-end sequence of USH2A exon 13 is Chr1:216246563-216246753.

[0015] In one aspect, the present application provides a method for inhibiting expression and / or function of USH2A pre-mRNA exon 13 comprising providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0016] In one aspect, the present application provides a method for splicing skipping of USH2A pre-mRNA exon 13, comprising providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0017] In one aspect, the present application provides a method for preparing a mature USH2A mRNA lacking exon 13, comprising providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0018] In one aspect, the present application provides a method for reducing levels of Usherin protein comprising an expression product of exon 13, comprising providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0019] In one aspect, the present application provides a method for preparing Usherin protein that does not contain an expression product of exon 13 and / or a method for increasing the amount of Usherin protein that does not contain an expression product of exon 13, comprising providing a nucleic acid molecule described in the present application, a vector described in the present application, a viral particle described in the present application, a cell described in the present application, a pharmaceutical composition described in the present application, and / or a kit described in the present application.

[0020] In one aspect, the present application provides a method for restoring function of a mutant Usherin protein comprising providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0021] In one aspect, the present application provides the use of a nucleic acid molecule described in the present application, a vector described in the present application, a viral particle described in the present application, a cell described in the present application, a pharmaceutical composition described in the present application and / or a kit described in the present application in the preparation of a medicament, wherein the medicament is used for the prevention and / or treatment of a disease caused by a USH2A gene mutation.

[0022] The present application provides a nucleic acid molecule capable of specifically binding to the 3'-end sequence of USH2A mRNA exon 13 or a fragment thereof. Currently, there exists a technology of antisense oligonucleotides (AONs) targeting exon skipping. However, existing AONs promote the skipping of exon 13 while also promoting the simultaneous skipping of exon 12 and exon 13, and some AON treatments cause double skipping of exon 12 and exon 13, but not single skipping. The full length of exon 12 is 196 bp, which is not an integer multiple of 3, so that deletion of exon 12 causes a frameshift mutation, which inactivates the USH2A protein. For example, the USH2A exon 12 described in the present application is human USH2A exon 12. For example, the USH2A exon 13 described in the present application is human USH2A exon 13. The oligonucleotides provided in the present application can carry out targeted interference with pre-mRNA splicing and increase the rate of single skipping of exon 13, thereby significantly improving efficiency while ensuring safety.

[0023] Those skilled in the art can readily appreciate other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As those skilled in the art will appreciate, the contents of this application will enable those skilled in the art to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention related to this application. Accordingly, the drawings and descriptions of the present application are illustrative only and not restrictive. [Brief description of the drawings]

[0024] Particular features of the invention related to this application are set forth in the appended claims. The features and advantages of the invention related to this application can be better understood with reference to the exemplary embodiments described in detail below and the accompanying drawings, the brief description of which is as follows: [Figure 1] FIG. 1 is a schematic diagram of the structure and function of U7-snRNA of the present application. [Diagram 2] FIG. 13 shows the splicing skipping effect of USH2A pre-mRNA exon 13 induced by AONs of different target sites. [Figure 3A] 3A to 3B are diagrams showing the splicing skipping effect of USH2A pre-mRNA exon 13 in reporter cells induced by U7 snRNA at different target sites. [Figure 3B] Same as above [Figure 4A] 4A to 4B are diagrams showing the splicing skipping effect of USH2A pre-mRNA exon 13 induced by combinations of U7 snRNAs with different target sites. [Figure 4B] Same as above [Diagram 5] FIG. 2 is a schematic diagram of a snRNA vector carrying hnRNP A1. [Figure 6A] 6A-6B are diagrams showing the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by U7-hnRNP A1-snRNA. [Figure 6B] Same as above [Figure 7] FIG. 13 shows the efficiency of single splicing skipping of USH2A pre-mRNA exon 13 efficiently induced by snRNAs of different target sites. [Figure 8A]Figure 8B shows the efficiency of USH2A pre-mRNA exon 13 splicing skipping induced by chemically synthesized U7 snRNA detected in WERI cells. Lane 1: 50 pmol of chemically synthesized and modified U7-snRNA #30-#4; Lane 2: 50 pmol of chemically synthesized and modified U7-snRNA #26-#16; Lane 3: 50 pmol of AON1; Lane 4: 50 pmol of AON2; Lane 5: EGFP; Lane 6: GL DNA Marker 2000. Figure 8B shows the histogram of quantitative analysis of RT-PCR electrophoretic bands. ▲E12-E13 represents USH2A mRNA splice skipping exon 12 and exon 13 simultaneously, and total ▲ indicates the total of USH2A mRNA splice skipping exon 13 or splice skipping exon 12 and exon 13 simultaneously. [Figure 8B] Same as above DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Below, the embodiment of the invention of the present application will be described with specific examples, but those familiar with the present technology will be able to easily understand other advantages and effects of the invention of the present application from the contents disclosed in this specification.

[0026] [Term definition] In this application, the term "isolated" is generally intended to include a molecule that is separated from other substances present in a natural source. For example, an isolated nucleic acid can refer to a nucleic acid molecule that is separated from other substances present in a natural source. For example, a molecule that is isolated in this application can be an artificial molecule, such as an artificially synthesized molecule.

[0027] In this application, the term "expression control elements" generally refers to sequences that provide for the transcription and translation of a gene and / or to control the expression of a protein in vivo, e.g., in a desired host cell.

[0028] In this application, the term "viral particle" generally refers to a nucleic acid vector. For example, the viral particle may be a viral vector that can be used to function as a nucleic acid delivery vehicle, including a vector genome (e.g., DNA and / or RNA) packaged within the viral particle.

[0029] In this application, the term "antisense oligonucleotide" generally refers to a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding fragment of a target nucleic acid.

[0030] In this application, the term "nucleic acid" generally refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0031] In this application, the term "small nuclear RNA" generally refers to a small nucleic acid molecule. For example, small nuclear RNA can participate in RNA processing in the nucleus of eukaryotes. For example, small nuclear RNA can combine with associated proteins to form small nuclear ribonucleoproteins (snRNPs, i.e., small nuclear ribonucleoproteins), which participate in the splicing of messenger RNA precursors (pre-mRNA).

[0032] As used herein, the terms "complementarity" or "base complementarity" generally refer to the capacity of the nucleobases of an antisense oligonucleotide to precisely base pair (i.e., hybridize) with corresponding nucleobases in a target nucleic acid, and is mediated by the binding of Watson-Crick interaction forces between corresponding nucleobases.

[0033] In this application, the term "gene expression cassette" generally refers to a DNA segment that can be inserted into a nucleic acid or polynucleotide at a specific restriction site or by homologous recombination. For example, a gene expression cassette includes a polynucleotide fragment that encodes a target nucleic acid.

[0034] In this application, the term "genomic location" generally refers to chromosomal coordinates that describe a DNA region of interest. For example, the chromosomal coordinates may correspond to the Human Genome Database version Hg19 (or referred to as "Hg19 coordinates") released in February 2009. For example, the DNA region of this application may be derived from the region defined by the Hg19 coordinates.

[0035] In the present application, the term "splicing skipping" generally refers to the fact that in the process of processing an RNA molecule, the splicing skipped sequence is not included in the processed RNA molecule.For example, splicing skipping can cause a part of the sequence to be skipped.For example, splicing skipping can cause a part of the sequence not to be included in the spliced ​​RNA molecule.

[0036] In this application, the term "modified oligonucleotide" generally refers to an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase. In this application, the term "2'-O-methoxyethyl" (also referred to as 2'-MOE and 2'-OCH2CH2-OCH3 and MOE) generally refers to an O-methoxy-ethyl modification at the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar. In this application, the term "2'-MOE nucleoside" (also referred to as 2'-O-methoxyethyl nucleoside) generally refers to a nucleoside containing a MOE modified sugar moiety. In this application, the term "2' substituted nucleoside" generally refers to a nucleoside containing a substituent other than H or OH at the 2' position of the furanose ring. In certain embodiments, 2' substituted nucleosides include nucleosides having bicyclic modified sugars. In this application, the term "5-methylcytosine" generally refers to a cytosine modified with a methyl attached to the 5' position. 5-Methylcytosine is a modified nucleobase.

[0037] In this application, the term "modified phosphate linkage" generally refers to the substitution or any change in the presence of a modified phosphate linkage relative to a naturally occurring internucleoside linkage (ie, a phosphodiester internucleoside linkage).

[0038] In this application, the term "stem-loop domain" generally refers to a secondary structure formed by a nucleic acid molecule itself through base pairing, e.g., the double-stranded portion where base pairs are formed is the "stem" and the sequence between the base pairs forms the "loop."

[0039] In this application, the term "contiguous" generally refers to two or more nucleobases that are immediately adjacent to one another.

[0040] In this application, the term "exon" generally refers to a part of a gene that is present in the mature form of mRNA.

[0041] In this application, the term "vector" generally refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.

[0042] In this application, the term "Cas enzyme" generally refers to a CRISPR-associated nuclease that is a DNA endonuclease. For example, it can form a double-stranded break in a specific DNA sequence. Cas nucleases are usually complementary to CRISPR sequences and can use the CRISPR sequence as a guide to recognize and cut a specific DNA strand.

[0043] In this application, the term "pre-mRNA" generally refers to precursor mRNA. For example, a primary transcript is a single-stranded ribonucleic acid product synthesized by DNA transcription, and the transcript may not be modified. For example, the genomic structure of exons and introns in pre-mRNA is not changed.

[0044] In this application, the term "sm protein" generally refers to a protein or variant thereof that can bind to snRNA to form the small nuclear ribonucleoprotein complex snRNP.

[0045] In this application, the term "USH2A" generally refers to a gene encoding the Usherin protein. For example, the NCBI gene accession number for USH2A (Usher Syndrome Type-2A) may be 7399. In this application, USH2A may include substances including its unprocessed form, any processed form, its mutants, or functionally active fragments thereof.

[0046] In this application, the term "administration" generally refers to providing a pharmaceutical agent to an animal and includes, but is not limited to, administration by a medical professional and self-administration.

[0047] [Detailed Description of the Invention] In one aspect, the present application provides a nucleic acid molecule capable of specifically binding to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753 (corresponding to the NCBI database GRch38 version). For example, the USH2A The genomic positions corresponding to the 3' end sequence of pre-mRNA exon 13 are Chr1:216246563-216246626, Chr1:216246563-216246621, Chr1:216246563-216246624, Chr1:216246563-216246617, Chr1:216246563-216246591, Chr1:216246563-216246596, Chr1:216246563-216246593, Chr1:216246563-216246590, and / or Chr1:216246563-216246586. For example, the genomic locations corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application are Chr1:216246563-216246626, Chr1:216246567-216246626, Chr1:216246570-216246626, Chr1:216246594-216246626, Chr1:216246598-216246626, and / or Chr1:216246603-216246626. For example, the genomic locations corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application are Chr1:216246563-216246621, Chr1:216246567-216246621, Chr1:216246570-216246621, Chr1:216246594-216246621, Chr1:216246598-216246621, and / or Chr1:216246603-216246621.For example, the genomic locations corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application are Chr1:216246563-216246624, Chr1:216246567-216246624, Chr1:216246570-216246624, Chr1:216246594-216246624, Chr1:216246598-216246624, and / or Chr1:216246603-216246624. For example, the genomic locations corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application are Chr1:216246563-216246617, Chr1:216246567-216246617, Chr1:216246570-216246617, Chr1:216246594-216246617, Chr1:216246598-216246617, and / or Chr1:216246603-216246617. For example, the genomic location corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application is Chr1:216246563-216246593, Chr1:216246567-216246593, and / or Chr1:216246570-216246593. For example, the genomic location corresponding to the 3' end sequence of the USH2A pre-mRNA exon 13 of the present application is Chr1:216246563-216246626, the sequence of which is as shown in SEQ ID NO: 39. For example, it may be a combination of 70%, 80%, 90%, 95%, 98% or 99% or more base pairs. For example, it may be a combination of mutated sequences. For example, the combination may include 1 bp, 2 bp, 3 bp, 4 bp or 5 bp mismatch.

[0048] USH2A gene exon 13 may contain mutations, including c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.E767SfsX21, the most frequent mutation in European and American patients), c.2276G>T (amino acid change: p.C759F), C.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (p.C84 7X), c.2761delC(Leu921fs) and C.2776C>T(p.R926C), C.2209C>T, C.2310delA, c.2391_2392deITG, c.2431A>T, C.2431_2 432delAA, c.2440C>T, c.2525dup, C.2610C>A, C.2755C>T, C.2176T>C, C.2236C>G, c.2296T>C, and / or C.2332G>T.

[0049] In one aspect, the present application provides a nucleic acid molecule that may have the ability to specifically bind to the sequence shown in SEQ ID NO: 1 or a fragment thereof. For example, the combination may be 70%, 80%, 90%, 95%, 98% or 99% or more of base pairs. For example, the combination may be to a mutated sequence. For example, the combination may include 1 bp, 2 bp, 3 bp, 4 bp or 5 bp mismatch.

[0050] In one aspect, the present application provides a nucleic acid molecule that may be complementary to 16 or more consecutive nucleotides in the sequence shown in SEQ ID NO: 1. For example, 70%, 80%, 90%, 95%, 98% or 99% or more of the base pairs may be complementary. For example, it may be complementary to a mutated sequence. For example, the complementarity may include 1 bp, 2 bp, 3 bp, 4 bp or 5 bp mismatches.

[0051] In one aspect, the present application provides a nucleic acid molecule that may comprise 16 or more consecutive nucleotides in the sequence shown in SEQ ID NO:1 or a complementary sequence thereof. For example, 70%, 80%, 90%, 95%, 98% or 99% or more of the base pairs may be complementary. For example, it may be complementary to a mutated sequence. For example, the complementarity may include 1 bp, 2 bp, 3 bp, 4 bp or 5 bp mismatches.

[0052] For example, the nucleic acid molecule comprises at least 16 nucleotides that may be complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof. For example, the nucleic acid molecule comprises 22 to 27 nucleotides that may be complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof. For example, the nucleic acid molecule may contain 15 to 27, 16 to 27, 18 to 27, 20 to 27, 22 to 27, 25 to 27, 15 to 25, 16 to 25, 18 to 25, 20 to 25, 22 to 25, 15 to 22, 16 to 22, 18 to 22, 20 to 22, 15 to 20, 16 to 20, 18 to 20, 15 to 18, or 16 to 18 nucleotides that may be complementary to the 3'-end sequence or a fragment thereof of USH2A pre-mRNA exon 13. For example, the length of the recognition domain sequence may be 16 bp or more, 18 bp to 40 bp, or even 20 bp to 27 bp. In some chemically synthesized modified U7 snRNA embodiments, the length of the recognition domain sequence can be extended through reverse complementary pairing along the 5' or / and 3' end of the target sequence, preferably the length of the extended single recognition domain sequence is 40 bp or less.

[0053] For example, the nucleic acid molecule may comprise at least 16 nucleotides. For example, the nucleic acid molecule may comprise at least 22-27 nucleotides. For example, the nucleic acid molecule may comprise 15-27, 16-27, 18-27, 20-27, 22-27, 25-27, 15-25, 16-25, 18-25, 20-25, 22-25, 15-22, 16-22, 18-22, 20-22, 15-20, 16-20, 18-20, 15-18, or 16-18 nucleotides. For example, the nucleic acid molecule is an AON molecule.

[0054] For example, the nucleic acid molecule may comprise at least 60 nucleotides. For example, the nucleic acid molecule may comprise at least 65, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, or at least 500 nucleotides. For example, the nucleic acid molecule is a snRNA molecule. For example, the snRNA molecule may comprise more elements and may have theoretically infinite length. In one embodiment, the total length of the chemically synthesized snRNA sequence is 96 bp or more. In one embodiment, 3 to 40 bases on both sides of the chemically synthesized snRNA are modified and linked by specific phosphate ester bonds.

[0055] For example, the nucleic acid molecule may be any of the following: Chr1:216246603-216246626, Chr1:216246598-216246621, Chr1:216246598-216246624, Chr1:216246594-216246617, Chr1:216246570-216246593, Chr1:216246570-21624659 1, Chr1:216246570-216246596, Chr1:216246570-216246593, Chr1:216246570-216246596, Chr1:216246567-216246590, and Chr1:216246563-216246586.

[0056] For example, the nucleic acid molecule may comprise a sequence complementary to any one of SEQ ID NOs: 10-21. For example, the base pair complementarity may be 70%, 80%, 90%, 95%, 98%, or 99% or more. For example, the complementarity may be to a mutated sequence. For example, the complementarity may comprise a 1 bp, 2 bp, 3 bp, 4 bp, or 5 bp mismatch. In some chemically synthesized modified U7 snRNA embodiments, the recognition domain may have 0-5 mismatched nucleotides in a reverse complementary pair with the target site, for example, 0-1.

[0057] For example, the nucleic acid molecule may comprise any one of the sequences shown in SEQ ID NOs: 10-21.

[0058] For example, the nucleic acid molecule may contain modified nucleotides.

[0059] For example, the modified nucleotides may include a modification selected from the group consisting of 2'-O-alkyl, 2'-O-methoxy, and / or 2'-O-methoxyethyl.

[0060] For example, the modified nucleotides may include a modification selected from the group consisting of 2'-O-methyl and / or 2'-O-ethyl.

[0061] For example, the nucleic acid molecule may include at least one modified nucleotide. In some embodiments, only 1-10, 6-80, or all nucleotides on either side of the snRNA are modified and linked by a specific phosphate bond, the modifications being a combination of one or more modifications, and the specific phosphate bond being a combination of one or more phosphate bonds. In some embodiments, all nucleotides in the chemically synthesized U7 snRNA are linked to each other via phosphate bonds and all are modified with 2'-O-methoxy. In some embodiments, only three nucleotides on either side of the snRNA are linked via phosphate bonds and modified with 2'-O-methoxy. In some preferred embodiments of chemically synthesized modified U7 snRNA, the first nucleotide at the 5' end of the U7 snRNA is preferably adenylic acid (A), and if the first nucleotide at the 5' end of the recognition domain is not adenylic acid (A), then adenylic acid (A) is linked to the 5' end.

[0062] For example, the 5' end of the nucleic acid molecule may comprise at least one modified nucleotide. For example, the 5' end of the nucleic acid molecule may comprise 1 to 3 modified nucleotides. For example, the 5' end of the nucleic acid molecule may comprise 1, 2, 3, 4 or 5 modified nucleotides.

[0063] For example, the 3' end of the nucleic acid molecule may comprise at least one modified nucleotide. For example, the 3' end of the nucleic acid molecule may comprise 1 to 3 modified nucleotides. For example, the 3' end of the nucleic acid molecule may comprise 1, 2, 3, 4 or 5 modified nucleotides.

[0064] In the nucleic acid molecules described in the present application, the nucleotide molecules in said nucleic acid molecule may comprise those selected from the group consisting of 6'-modified bicyclic nucleosides, 5'-modified bicyclic nucleosides, 6'-disubstituted bicyclic nucleosides, tetrahydropyran nucleoside analogs and / or 2'-deoxy 2'-fluoro-β-D-arabinose nucleotides (2'-FANA modified nucleotides).

[0065] For example, the nucleic acid molecule has modified phosphate linkages.

[0066] For example, the nucleotide molecules are linked through a phosphate linkage selected from the group consisting of a thiophosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thiocarbonylalkylphosphonate linkage, a thiocarbonylalkylphosphotriester linkage, a phosphorothioate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0067] For example, the modified phosphate linkage may comprise a combination selected from the group consisting of a phosphodiester linkage, a phosphotriester linkage, a thiophosphate linkage (5'OP(S)O-3O-, 5'S-P(O)O-3'-O- and 5'OP(O)O-3'S-), a phosphorodithioate linkage, an Rp-phosphorothioate linkage, an Sp-phosphorothioate linkage, a boranophosphate linkage, a methylene linkage (methylimino), an amide linkage (3'-CH2-CO-NH-5' and 3'-CH2-NH-CO-5'), a methylphosphonate linkage, a 3'-thiomethylal linkage, an amide linkage (3'CH2-C(O)NH-5'), and / or a phosphoramidate group.

[0068] For example, the modified phosphate linkages may include a combination selected from the group consisting of thiophosphate linkages, phosphorodithioate linkages, alkylphosphonate linkages, amidophosphate linkages, and / or boranophosphate linkages.

[0069] For example, the modified phosphate linkage may comprise a combination selected from the group consisting of a phosphodiester linkage, a phosphotriester linkage, a thiophosphate linkage (5'OP(S)O-3O-, 5'S-P(O)O-3'-O- and 5'OP(O)O-3'S-), a phosphorodithioate linkage, an Rp-phosphorothioate linkage, an Sp-phosphorothioate linkage, a boranophosphate linkage, a methylene linkage (methylimino), an amide linkage (3'-CH2-CO-NH-5' and 3'-CH2-NH-CO-5'), an alkylphosphate linkage, an amidophosphate linkage, a methylphosphonate linkage, a 3'-thiomethylal linkage, an amide linkage (3'CH2-C(O)NH-5') and / or a phosphoroamidate group.

[0070] For example, the nucleic acid molecule may contain at least one modified phosphate linkage.

[0071] For example, the 5' end of the nucleic acid molecule may contain at least one modified phosphate bond. For example, the 5' end of the nucleic acid molecule may contain 1 to 3 modified phosphate bonds. For example, the 5' end of the nucleic acid molecule may contain 1, 2, 3, 4 or 5 modified phosphate bonds.

[0072] For example, the 3' end of the nucleic acid molecule may contain at least one modified phosphate bond. For example, the 3' end of the nucleic acid molecule may contain 1 to 3 modified phosphate bonds. For example, the 5' end of the nucleic acid molecule may contain 1, 2, 3, 4 or 5 modified phosphate bonds.

[0073] For example, the nucleic acid molecule may include DNA and / or RNA.

[0074] For example, the nucleic acid molecule is single-stranded or double-stranded.

[0075] For example, the nucleic acid molecule may comprise an antisense oligonucleotide, an shRNA, an siRNA, an miRNA and / or an aptamer.

[0076] For example, the nucleic acid molecule may include small nuclear RNA.

[0077] For example, the small nuclear RNA may comprise U1 small nuclear RNA and / or U7 small nuclear RNA. For example, the small nuclear RNA may comprise U1, U2, U3, U4, U5, U6 and / or U7 small nuclear RNA. For example, the small nuclear RNA may comprise U1 small nuclear RNA. For example, the small nuclear RNA may comprise U7 small nuclear RNA.

[0078] For example, the nucleic acid molecule does not bind to a Cas enzyme. For example, the nucleic acid molecule may not contain a structure capable of binding to a Cas enzyme. For example, the Cas enzyme is a Cas13 enzyme.

[0079] For example, the nucleic acid molecule may comprise a stem-loop domain or a derivative thereof. For example, the stem-loop domain may comprise the sequence shown in SEQ ID NO:6.

[0080] For example, the nucleic acid molecule may comprise a domain capable of binding to an SM protein or a derivative structure thereof. For example, the domain capable of binding to an SM protein may comprise a sequence as set forth in SEQ ID NO:5. For example, the domain capable of binding to an sm protein may comprise an optimized smOPT sequence. For example, the sm protein binding domain may comprise a human, mouse or porcine origin.

[0081] For example, the nucleic acid molecule may comprise a domain capable of recruiting a splicing regulatory protein, for example, the nucleic acid molecule may comprise a domain capable of binding to a histone selected from the group consisting of Serine and Arginine Rich Splicing Factor 1 (SRSF1), RNA Binding Motif Protein 4 (RBM4), DAZ Associated Protein 1 (DAZAP1), and Serine and Arginine-Rich Protein (SR).

[0082] For example, the nucleic acid molecule may comprise a domain capable of binding to hnRNP A1 protein. For example, the domain capable of binding to hnRNP A1 protein may comprise the sequence shown in SEQ ID NO:30.

[0083] For example, the nucleic acid molecule of the present application has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753, and the nucleic acid molecule may comprise at least 16 nucleotides complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the nucleic acid molecule may comprise at least 16 nucleotides.

[0084] For example, the nucleic acid molecule of the present application has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753, and the nucleic acid molecule may comprise at least 16 nucleotides complementary to the 3'-end sequence of exon 13 of USH2A pre-mRNA or a fragment thereof, and the nucleic acid molecule may comprise at least 60 nucleotides.

[0085] For example, the nucleic acid molecule of the present application has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753, and the nucleic acid molecule may comprise at least 16 nucleotides complementary to the 3'-end sequence of exon 13 of USH2A pre-mRNA or a fragment thereof, and the nucleic acid molecule may comprise at least 60 nucleotides, in which 3 to 40 bases on both sides of chemically synthesized snRNA are modified and linked by specific phosphate bonds.

[0086] For example, the nucleic acid molecule of the present application has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, and the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753, and the nucleic acid molecule may contain at least 16 nucleotides complementary to the 3'-end sequence of exon 13 of USH2A pre-mRNA or a fragment thereof, and the nucleic acid molecule may contain at least 60 nucleotides, and 3 to 40 bases on both sides of the chemically synthesized snRNA are modified with 2'-methoxy and linked by a thiophosphate bond.

[0087] For example, the nucleic acid molecule of the present application has the ability to specifically bind to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753, the nucleic acid molecule may comprise at least 16 nucleotides complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, the nucleic acid molecule may comprise at least 60 nucleotides, three bases on both sides of the chemically synthesized snRNA are modified with 2'-methoxy and linked by thiophosphate bonds, and the nucleic acid molecule may comprise a domain capable of binding to sm protein or a derivative structure thereof. Optionally, the nucleic acid molecule may comprise a domain capable of binding to hnRNP A1 protein.

[0088] In one aspect, the present application provides gene expression cassettes that include or can encode the nucleotide sequences of the nucleic acid molecules described herein, and optional expression control elements.

[0089] In one aspect, the present application provides a vector that includes or can encode the nucleotide sequence of the nucleic acid molecule described herein and / or the nucleotide sequence of the gene expression cassette described herein. In one aspect, the present application provides a viral particle that may include the nucleic acid molecule described herein, the nucleotide sequence of the gene expression cassette described herein, and / or the vector described herein. For example, the vector of the present application may be pUC57, or may be selected from pAAV-CMV (TAKARA, Code No.:6650), lentivirus, transposon, and nucleic acid vectors known in the art. For example, the present application describes a method for inducing splicing skipping of USH2A pre-mRNA exon 13 by delivering U7 snRNA via AAV, the capsid protein of which may be naturally derived or may be a mutant based on naturally derived capsid protein, may have undergone directed evolution, or may have rational modifications such as amino acids / peptides (codon optimization, chimerism of different serotype functional peptide segments, etc.) to improve tissue and organ tropism, immunogenicity, transfection efficiency, such as AAV2.5, AAV2i8, AAV-TT, AAV9.HR, CAM130, etc. The naturally derived AAV capsid protein may be derived from an animal or a plant, and the animal-derived AAV capsid protein may be derived from a human (e.g., AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, etc.), a non-human primate (e.g., AAVrh.8, AAVrh.10, and AAVrh.43), a vertebrate such as a mouse or a pig, or an insect. In the AAV plasmid system of the present invention, for example, the AAV ITR serotype must match the Rep gene serotype, but may not match the Cap gene serotype.

[0090] In one aspect, the present application provides a cell that may comprise a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, and / or a viral particle described herein.

[0091] In one aspect, the present application provides a pharmaceutical composition that may include a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, a viral particle described herein, and / or a cell described herein, and an optional pharma- ceutically acceptable carrier.

[0092] For example, the pharmaceutical composition may include a first carrier and a second carrier, the first carrier may include a nucleic acid molecule described in the present application, and the second carrier may include a nucleic acid molecule capable of specifically binding to USH2A pre-mRNA exon 13 and both sides thereof or a fragment thereof. For example, the second vector may include a nucleic acid molecule capable of specifically binding to a sequence selected from USH2A pre-mRNA intron 12-exon 13-intron 13, for example, exon 13 and the target adjacent regions on both sides thereof. For example, it may be selected from the pre-mRNA region corresponding to chr1:216246563-216247246. For example, two or more U7-snRNAs whose target sequences are not exactly the same may be used in combination.

[0093] For example, the flanking regions of the USH2A pre-mRNA exon 13 may include USH2A pre-mRNA intron 12 and / or intron 13.

[0094] In one aspect, the present application provides a kit comprising a nucleic acid molecule described herein, a nucleotide sequence of a gene expression cassette described herein, a vector described herein, a viral particle described herein, a cell described herein, and / or a pharmaceutical composition described herein.

[0095] In one aspect, the present application provides a method for preparing the nucleic acid molecule described in the present application, which can express and / or synthesize a nucleic acid molecule capable of binding to the 3'-end sequence of USH2A exon 13 or a fragment thereof, and the genomic location of the 3'-end sequence of USH2A exon 13 is Chr1:216246563-216246753.

[0096] In one aspect, the present application provides a method of inhibiting expression and / or function of USH2A pre-mRNA exon 13, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein. For example, inhibiting expression and / or function of USH2A pre-mRNA exon 13 can mean that the mature USH2A pre-mRNA does not include a region of the expression product of exon 13.

[0097] In one aspect, the present application provides a method for splicing skipping of USH2A pre-mRNA exon 13, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0098] In one aspect, the present application provides a method for preparing a mature USH2A pre-mRNA lacking exon 13, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0099] In one aspect, the present application provides a method for reducing levels of Usherin protein, which may include an expression product of exon 13, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein.

[0100] In one aspect, the present application provides methods for preparing Usherin protein, which may not include an expression product of exon 13, and / or for increasing the amount of Usherin protein that does not include an expression product of exon 13, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein. For example, the Usherin protein prepared in the present application does not include an exon 13-expressed polypeptide or a variant thereof.

[0101] In one aspect, the present application provides a method of restoring function of a mutant Usherin protein, which may include providing a nucleic acid molecule described herein, a vector described herein, a viral particle described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein. For example, by splicing skipping exon 13, the Usherin protein prepared in the present application maintains or essentially maintains the function of wild-type Usherin protein in healthy subjects. For example, symptoms of retinitis pigmentosa, congenital degenerative nerve hearing loss, vestibular dysfunction, and other diseases are alleviated in subjects expressing the mutant Usherin protein.

[0102] In one aspect, the present application provides the use of a nucleic acid molecule described herein, a vector described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein in the preparation of a medicament, the medicament being used for the prevention and / or treatment of a disease caused by a USH2A gene mutation. For example, the disease may include an eye disease and / or an ear disease. For example, the disease may include Usher syndrome. For example, the disease may include Usher syndrome type II.

[0103] In one aspect, the present application provides a method for preventing and / or treating a disease caused by a USH2A gene mutation, comprising administering a nucleic acid molecule described herein, a vector described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein. For example, the disease may include an eye disease and / or an ear disease. For example, the disease may include Usher syndrome. For example, the disease may include Usher syndrome type II.

[0104] In one aspect, the present application provides a nucleic acid molecule described herein, a vector described herein, a cell described herein, a pharmaceutical composition described herein, and / or a kit described herein for preventing and / or treating a disease caused by a USH2A gene mutation. For example, the disease may include an eye disease and / or an ear disease. For example, the disease may include Usher syndrome. For example, the disease may include Usher syndrome type II.

[0105] USH2A usually refers to the gene that codes for Usherin. USH2A is located at 1q41 and spans more than 800 kb in the genome, encoding the large transmembrane protein Usherin, which is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is an essential component in the development and maintenance of cilia. In the retina, Usherin is an important part of the USH2 complex and is thought to play a role in stabilizing the outer segments of photoreceptors. There are two subtypes of USH2A, and the main subtype of retinal cells contains 72 exons, with the coding region being approximately 15.6 kb in length. The extracellular portion of the Usherin protein contains many repeat domains, including 10 Laminin EGF-like (LE) domains and 35 Fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp long and codes for amino acids 723-936, which are 4 of the 10 LE domains in the Usherin protein.

[0106] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene cause Usher syndrome. To date, over 1,000 pathogenic mutations have been identified throughout the USH2A gene, of which exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35% of all cases. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.E767SfsX21, the most frequent mutation in European and American patients), c.2276G>T (amino acid change: p.C759F), C.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (p.C841Y), and c.2541C>A (p.C841Y). 7X), c.2761delC(Leu921fs) and C.2776C>T(p.R926C), C.2209C>T, C.2310delA, c.2391_2392deITG, c.2431A>T, C.2 Including 431_2432delAA, c.2440C>T, c.2525dup, C.2610C>A, C.2755C>T, C.2176T>C, C.2236C>G, c.2296T>C, C.2332G>T.

[0107] The length of the USH2A coding region is about 15.6 kb, and current conventional gene therapy delivery methods (e.g., recombinant lentivirus, recombinant adeno-associated virus, etc.) have difficulty packaging such a large coding sequence, making treatment by direct delivery of USH2A difficult. Mouse USH2A exon 12 is homologous to human USH2A exon 13, both of which are 642 bp in length, and removal of the exon does not cause subsequent frameshift mutations. Research has shown that even after exon 12 of mouse USH2A is knocked down, Usherin can still be correctly located and perform normal functions. For human USH2A exon 13 containing pathogenic mutations, a series of methods can be used to induce skipping and treat.

[0108] Genomic DNA editing by the CRISPR / Cas system directly deletes exon 13 or destroys RNA splicing-related sites. The use of fragment removal entails risks such as chromosomal rearrangements, viral integration, and reverse reintegration, as well as a high probability of off-targets of two gRNA-induced double cleavage due to long-term expression of the CAS system or a relatively large genomic background. Exon skipping may also be promoted by using a single base editor to change the key base of the above splicing-related site. However, existing single base editors may not be able to be loaded via a single AAV vector, may be limited by PAM, editing window, and base conversion type, and may not have a suitable gRNA near the splicing-related site. Antisense oligonucleotides (AONs) are used to target and inhibit pre-mRNA splicing to promote exon skipping with higher efficiency. AONs promote exon 13 skipping while also promoting simultaneous skipping of exons 12 and 13, and some AON processing may result in double skipped reads. The total length of exon 12 is 196bp, which is not an integer multiple of 3, so the deletion causes a frameshift mutation. By targeting and interfering with pre-mRNA splicing with U7 snRNA, the efficiency of promoting exon skipping is higher than that of AON, and the rate of single skipping of exon 13 is increased, significantly improving efficiency while ensuring safety. The effect discovered by the present application, that is, the snRNA molecule targeting the region of the present application has a higher effect of promoting the efficiency of exon skipping than the AON molecule with the same target, which is not clear in the known prior art. For example, the AON molecule targeting Chr1:216247218-216247241 in the present field has a significantly better exon skipping effect of promoting the efficiency of exon than the snRNA molecule targeting the region.Small nuclear RNAs (snRNAs) are present in cells, which are the main components of the RNA spliceosome during post-transcriptional processing in eukaryotes and are involved in the processing of pre-mRNA by binding to snRNP proteins. Their length ranges from about 100 to 215 nucleotides in mammals, and they are divided into seven categories, numbered U1 to U7, due to their richness of U. Modified U7 SnRNA can replace the non-canonical Sm-binding site of U7 snRNA with a consensus sequence derived from the major spliceosomal U snRNPs, change the histone-binding sequence in the 5' region of U7 snRNA to the complementary sequence of the gene to be modified, and target exons to induce exon splicing skipping.

[0109] Without intending to be bound by any theory, the following examples are only illustrative of the nucleotides, preparation methods and uses of the present application and are not intended to limit the scope of the invention of the present application. EXAMPLES

[0110] Example 1 Synthesis of snRNA The snRNA scaffold was synthesized. The wild-type U7 snRNA contains a stem-loop structure (scaffold), a U7-specific Sm sequence (AAUUUGUCUAG, SEQ ID NO:2), and a recognition domain (complementary to histone pre-mRNA). The U7 snRNA of the present application is based on the gene sequence of mouse wild-type U7 snRNA on NCBI (NCBI Reference Sequence: NR_024201.3), in which the U7-specific Sm-binding site (AATTTGTCTAG, SEQ ID NO: 3) is replaced with an optimized consensus Sm sequence, i.e., SmOPT (AATTTTTGGAG, SEQ ID NO: 4; or AAUUUUUGGAG, SEQ ID NO: 5), the original recognition domain at the 5' end of the SmOPT sequence is replaced with a recognition domain that is reverse-complementary to the specific target site of USH2A pre-mRNA, and the 3' end of the SmOPT sequence retains the original stem-loop structural sequence of U7 (CAGGUUUUCUGACUUCGGUCGGAAAACCCCU, SEQ ID NO: 6).

[0111] FIG. 1 shows a schematic diagram of the structure and function of the U7-snRNA of the present application. The U7 snRNA recognition domain sequence that targets and induces USH2A pre-mRNA exon 13 forms a reverse complementary pair with a target sequence selected from USH2A pre-mRNA intron 12-exon 13-intron 13, and the target sequence can be selected from the 3'-end sequence target region of USH2A pre-mRNA exon 13. The preferred length of the snRNA recognition domain sequence is 16 bp or more, more preferably 18 bp to 40 bp, and even more preferably 20 bp to 27 bp.

[0112] Specific operation process: First, a pUC57 vector containing gene sequence-U7-snRNA gene expression cassette backbone (5'-mouse U7 promoter-smOPT sequence-U7-snRNA scaffold-snRNA gene specific 3' cassette-3') was synthesized by total gene synthesis. Two Tye IIs type restriction endonuclease recognition sites (e.g., BsaI, AarI, BsmBI, etc.) were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement and insertion of other recognition domain sequences. The snRNA gene specific 3' cassette contains the sequence "GTCTACAATGAAA (SEQ ID NO: 7)" behind the 3' end of the U7 snRNA gene in the mouse genome (GenBank: X54748.1) and is involved in the processing of pre-snRNA. Preferably, the sequence behind the 3' end of the U7 snRNA gene is a gene fragment with a length of 28 to 131 bp, more preferably, the sequence length is 106 bp.

[0113] Construction of U7 snRNA vectors targeting the target region According to the pretranscriptional DNA sequence corresponding to the snRNA recognition domain sequence in Table 1A, the corresponding Oligo DNA was synthesized. The sense strand of the Oligo DNA is a DNA sequence corresponding to the recognition domain sequence, with CCGCA added to the 5', and the antisense strand has AATT added to the 5' and T added to the 3' of the antisense complementary sequence of the recognition domain sequence. For example, when the recognition domain sequence is 5'-NNN-3', the synthesized Oligo DNA sense strand is 5'-CCGCANNN-3', and the antisense strand is 5'-AATTNNNT-3'.

[0114] The synthesized Oligo DNA sense and antisense strands were mixed according to the annealing reaction system (total reaction volume 20 μl: Oligo-F (100 μM) 2 μl + Oligo-R (100 μM) 2 μl + 10×NEB Cutter smart buffer 2 μl + deionized water 16 μl), incubated at 95 °C for 5 minutes, then placed on ice to cool and anneal to form double-stranded DNA with sticky ends. After dilution 100 times, 1 μl was taken and T4 ligase ligation was performed with linearized pUC57-U7 snRNA backbone plasmid enzymatically cut and recovered by 10 ng of BsaI. The ligation product was further transformed into E. coli competent cells, single cloning, PCR and sequencing to obtain U7 snRNA vector for inducing splicing skipping of USH2A exon 13. The plasmid was purified and stored at -20 °C for later use.

[0115] Synthesis of AONs According to the target regions of USH2A pre-mRNA exon 13 in Table 1B, the sequences of antisense oligonucleotide AONs corresponding to the regions were designed and synthesized.

[0116] [Table 1A]

[0117] [Table 1B]

[0118] Chemical synthesis and modification of U7-snRNA Similar to oligonucleotides, U7 snRNA can be directly chemically synthesized to generate RNA containing a guide sequence, smOPT, and U7 snRNA scaffold. In vitro synthesized U7 snRNA can be specifically modified to resist nuclease degradation and to enhance affinity for the target sequence.

[0119] In this example, U7 snRNA was chemically synthesized, and three bases at the 5' and 3' ends were modified with 2'-methoxy (2'-OME) and thiol, respectively, to enhance nuclease resistance. Taking snRNA#25 and snRNA#26 as examples, the sequences and modifications of the chemically synthesized snRNAs are as follows (* represents a phosphorothioate backbone, m represents a 2'-methoxy modification, the underline represents a recognition domain that is reverse-complementary to the target sequence, and italics represent the smOPT sequence):

[0120] [ka]

[0121] One or more nucleotides in the U7 snRNA of the present application are modified with one or two of 2'-O alkyl, 2'-O-methoxy, 2'-O-methoxyethyl, and the 2'-O alkyl is modified with 2'-O methyl. The phosphate linkages linked to the nucleotides of the snRNA may be linked through specific phosphate linkages, the specific phosphate linkages being comprised of one or more of thiophosphate linkages, phosphorodithioate linkages, alkylphosphate linkages, phosphoroamidate linkages, boranophosphate linkages, and chiral linkage phosphorus. In some embodiments, only 1-10, 6-80, or all nucleotides on both sides of the snRNA are modified and linked through specific phosphate linkages, the modifications being a combination of one or more modifications, and the specific phosphate linkages being a combination of one or more phosphate linkages. In some embodiments, all nucleotides of the chemically synthesized U7 snRNA are linked to each other via thiophosphate bonds and are all modified with 2'-O-methoxy. In some embodiments, only three nucleotides on either side of the snRN are linked to each other via thiophosphate bonds and are modified with 2'-O-methoxy. In some preferred embodiments of the chemically synthesized modified U7 snRNA, the first nucleotide at the 5' end of the U7 snRNA is preferably adenylic acid (A), and if the first nucleotide at the 5' end of the recognition domain is not adenylic acid (A), then adenylic acid (A) is linked to the 5' end. In some embodiments of the chemically synthesized modified U7 snRNA, there may be 0 to 5, preferably 0 to 1 mismatch nucleotides in the reverse complementary pair of the recognition domain and the target site. The preferred length of the recognition domain sequence is 16 bp or more, more preferably 18 bp to 40 bp, and even more preferably 20 bp to 27 bp.In some embodiments of chemically synthesized modified U7 snRNA, the length of the recognition domain sequence can be extended through reverse complementary pairing along the 5' and / or 3' end of the target sequence, preferably the length of the single recognition domain sequence after extension is 40 bp or less. In some embodiments, preferably the total length of the chemically synthesized snRNA sequence is 96 bp or more. In some embodiments, preferably 3-40 bases on both sides of the chemically synthesized snRNA are modified and linked via specific phosphate bonds.

[0122] Example 2 A reporter vector for quantitative evaluation of splicing skipping efficiency of USH2A exon 13 R.G. left -USH2A EXON13 mut -RG right The sequence (with AgeI and EcoRI restriction sites at the 5' and 3' ends, respectively) was obtained by total gene synthesis, and the synthetic sequence, pX601 plasmid (Addgene, 61591) was digested with restriction endonucleases AgeI and EcoRI, electrophoresed, gel collected, ligated, and the synthesized sequence was inserted between the AgeI and EcoRI restriction sites of the pX601 vector to replace the SaCas9 gene sequence of the original vector to obtain a reporter vector. Further, through transformation into E. coli competent cells, single cloning selection, PCR, and sequencing, a purified reporter vector plasmid was obtained and stored at -20°C for later use.

[0123] Report vector structure: pCMV-RG left -USH2A EXON13 mut -RG right , RG stands for reporter gene, RG left represents the first half of the 5' end of the reporter gene without reporting function, and RG right represents the latter half of the 3' end of the reporter gene without reporting function, and RG left and R.G. rightTandem expression of the reporter gene can usually function as a complete reporter gene. In an embodiment of the present invention, the reporter gene is the green fluorescent gene EGFP, so the vector structure is pCMV-EGFP. left -Exon13 mut -EGFP right It was. EXON13 mut represents USH2A exon 13 containing a pathogenic mutation and its upstream and downstream intron sequences (the upstream intron sequence is a combination of the 5'-end 204bp and 3'-end 490bp gene sequences of intron 12 of the human USH2A gene; the downstream intron sequence is a combination of the 5'-end 703bp and 3'-end 216bp gene sequences of intron 13 of human USH2A). The pathogenic mutation in USH2A exon 13 described in the examples of the present invention can be c.2299delG or c.2802T>G, or any mutation, and the resulting vector structure is pCMV-EGFP, respectively. left -Exon13 c.2299delG -EGFP right、 pCMV-EGFP left -Exon13 c.2802T>G -EGFP right In some embodiments, the mutation may also be or include c.2276G>T, C.2522C>A, c.2242C>T, c.2541C>A, c.2761delC, and C.2776C>T.

[0124] R.G. left , e.g., EGFP left Array of: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgag(SEQ ID NO: 26)

[0125] RG right , for example, EGFP right sequence of: gtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa(SEQ ID NO: 27)

[0126] Example 3 293T cells were seeded in a 24-well plate at a predetermined amount so that the cell confluence reached about 80% after 24 hours. 100 pmol of antisense oligonucleotides AON#20, AON#24, AON#25, and AON#31 (all nucleoside monomers of the synthesized AONs are modified with 2'-O-methoxy and phosphorothioate) synthesized using Lipofectamine2000 were transfected with the reporter plasmid pCMV-EGFP. left -Exon13 mut -EGFP right and simultaneously transfected into 293T cells. The transfected cells were subsequently cultured for 48-72 hours and digested into single cells using trypsin, and then flow cytometry was used to detect the GFP-positive rate (i.e., the ratio of cells induced to splice skip USH2A pre-mRNA exon 13) and the average FITC intensity of GFP-positive cells (i.e., the average level of splice skipping of USH2A pre-mRNA exon 13 in GFP cells) of different AON groups. Table 2 and Figure 2 below show the splice skipping effect of USH2A pre-mRNA exon 13 induced by AONs targeting two regions. The experimental results show that the effect of AONs targeting the 3'-terminal region is significantly better than that of AONs targeting other regions such as the #20 region.

[0127] [Table 2]

[0128] Example 4 293T cells were seeded in a 24-well plate at a given volume so that the cell confluence reached approximately 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine2000. left -Exon13 mut -EGFP rightpUC57-U7 snRNA plasmids targeting USH2A pre-mRNA were simultaneously transfected into 293T cells (vector mass ratio was 100ng:400ng), and the reporter plasmid alone (Report, reporter group) and the reporter plasmid and pUC57-U7 Scramble (SC group) were simultaneously transfected into 293T cells, respectively, as two negative controls, and 293T cells not transfected with any plasmid were used as blank controls. The transfected cells were then cultured for 48-72 hours and digested into single cells using trypsin, and then flow cytometry was used to detect the GFP positivity rate (i.e., the ratio of cells induced to skip USH2A exon 13 splicing) of different U7 snRNA groups. This example detected the average FITC intensity of different experimental groups, i.e., the average FITC fluorescence intensity of GFP-positive cells, as well as the GFP positivity rate and the expression level of GFP protein in positive cells.

[0129] In this example, the splice skipping efficiency induced by U7-snRNAs with different target sites was compared. Table 3 and Figures 3A-3B below show the splice skipping effect of USH2A pre-mRNA exon 13 in reporter cells induced by U7 snRNAs with different target sites. The results show that all U7-snRNAs targeting the 3'-end sequence of USH2A pre-mRNA exon 13 can induce splice skipping of USH2A exon 13 in reporter cells, and US H2A induces splice skipping with high efficiency.

[0130] [Table 3]

[0131] Example 5 Single splicing skipping of USH2A pre-mRNA exon 13 induced efficiently by chemically synthesized snRNA Human host cells were cultured in a 24-well plate at 6 x 10 5 The human retinal neuronal cells selected in this example were WERI-Rb-1 cells (retinal neuronal cell line), which were seeded at 100 μg / well. WERI cells were transfected with 100 pmol of U7-snRNA #24, #25, #26, #27, #28, #29, #30, #33, and #34, which were synthesized in vitro using Lipofectamine2000. The transfected cells were cultured for 72 hours, after which the RNA of the cells in each experimental group was extracted and reverse transcribed to obtain cDNA, and RT-PCR experiments were performed via primers AGCCTTTCCGCCAAGGTGATC (SEQ ID NO: 34) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 35) to detect exon splicing skipping of mature USH2A mRNA, and the electrophoretic results are shown in FIG. 7. The results show that U7-snRNA#24-34 can all efficiently induce splicing skipping of exon 13, with little co-splicing skipping of exon 13 and exon 12. U7 snRNA targeting the 3'-terminal region can efficiently induce single splicing skipping of USH2A pre-mRNA exon 13 and has high safety.

[0132] Example 6 Splicing skipping effect of USH2A exon 13 mediated by combinations of U7-snRNAs from different target sites A U7-snRNA multi-target combination vector was constructed. According to Golden Gate Assembly technology, different U7 snRNA plasmids were used as templates to amplify U7 snRNA cassettes (expression cassettes) by PCR, and additional 5' flanking bases and a BsaI enzyme cleavage site in the correct direction were introduced at both ends of the amplicon via primers, so that adjacent different U7 snRNA cassettes were digested by BsaI to generate specific complementary sticky ends, and head and tail U7 snRNA cassettes were digested by BsaI to generate the same sticky ends as the linear backbone vector digested by HindIII+NotI. Finally, the NEB® Golden Gate Assembly Kit (BsaI-HF® v2) (NEB#E1601) was used to assemble the above PCR products and the pUC57-U7 snRNA Backbone recovered by HindIII+NotI digestion. Assembly method: pUC57-U7 snRNA Backbone-HindIII+NotI, 80ng; U7 snRNA#A cassette PCR product, 20ng; U7 snRNA#B cassette PCR product, 20ng; U7 snRNA#C cassette PCR product, 20ng; T4 DNA Ligase Buffer (10X), 2μl; NEB Golden Gate Assembly Mix, 1μl; Reaction process: (37℃, 5min→16℃, 5min)×20→60℃, 5min.

[0133] The Golden Gate Assembly assembly product was further identified by transformation of E. coli competent cells, selection of single clones, PCR and sequencing to obtain a U7 snRNA multi-target combination vector for inducing splicing skipping of USH2A exon 13. The plasmid was purified and stored at -20°C for later use. The constructed vector was named, for example, pUC57-U7 snRNA#A+U7 snRNA#B+U7 snRNA#C.

[0134] The combination of U7-snRNAs with different target sites more efficiently induced splicing skipping of USH2A pre-mRNA exon 13. 293T cells were seeded in a 24-well plate at a given amount so that the cell confluence reached approximately 80% after 24 hours. Lipofectamine2000 was used to transfect pCMV-EGFP. left -Exon13 mut -EGFP right The 293T cells were co-transfected with different target U7 snRNA combination plasmids or single target plasmids, and the 293T cells co-transfected with reporter plasmid (Report, reporter group) alone and reporter plasmid and pUC57-U7 Scramble (SC group) were used as two negative controls, respectively, and the 293T cells not transfected with any plasmid were used as blank controls. The transfected cells were then cultured for 48-72 hours and digested into single cells using trypsin, after which the GFP positivity rate of the different snRNA groups was detected using a flow cytometer. Table 4 and Figures 4A-4B below show the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by U7-snRNA combinations targeting different target sites.

[0135] In this example, it was found that the combination of U7-snRNAs targeting different target sites can improve the induction efficiency of splicing skipping of USH2A exon 13 in reporter gene cells. The splicing skipping efficiency induced by the combination of different targets in this example is higher than that of a single target, and may be superior to known splicing skipping technologies of USH2A exon 13.

[0136] [Table 4]

[0137] In the combination of U7-snRNAs with different target sites of the present application, one snRNA can target the 3'-end sequence of USH2A pre-mRNA exon 13 of the present application or a fragment thereof, and another snRNA or snRNAs can target the intron 12-exon 13-intron 13 sequence of USH2A pre-mRNA or a fragment thereof, for example, the recognition domain sequence of U7-snRNA is reverse complementary to the target sequence of intron 12, exon 13, or intron 13 of USH2A pre-mRNA, preferably selected from exon 13 and both target adjacent regions (pre-mRNA regions corresponding to chr1:216246563-216247246). The combination of U7-snRNAs with different target sites is a combination of two or more U7-snRNAs whose target sequences are not exactly the same.

[0138] Example 7 Splicing skipping of USH2A pre-mRNA exon 13 induced by a combination of chemically synthesized U7 snRNA in WERI cells Human host cells were cultured in a 24-well plate at 6 x 10 5The cells were seeded at 1000 x 1000 / well, and the WERI-Rb-1 cell line was used in this example. WERI cells were transfected with 50 pmol of snRNA combination 1 (U7-snRNA#30 and U7-snRNA#4) and combination 2 (U7-snRNA#26 and U7-snRNA#16) synthesized in vitro using Lipofectamine2000, and the same dose (50 pmol) of antisense oligonucleotide AON1 (5′-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3′, “M USH2A mRNA was extracted from the cells of each experimental group and reverse transcribed to obtain cDNA. RT-PCR experiments were performed using primers AGCCTTCCGCCAAGGTGATTC (SEQ ID NO: 34) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 35) to detect whether there is splicing skipping in the mature USH2A mRNA exon. The electrophoretic results are shown in FIG. 8A. The rt-PCR electrophoresis bands were further quantitatively analyzed by ImageJ software, and statistics and analysis were performed on the proportion of mature USH2A mRNA with splicing skipping of exon 13 or splicing skipping of exons 12 and 13, as shown in Figure 8B.

[0139] In WERI cells endogenously expressing Usherin protein, the splicing skipping effect of USH2A pre-mRNA exon 13 induced by different target site U7 snRNA combinations was compared with the preferred AON technical solution of the existing technology, and the RT-PCR test data and analysis results showed that the single splicing skipping effect of exon 13 induced by snRNA combination 1 and snRNA combination 2 was significantly better than that of the conventional optimal technical solutions AON1 and AON2, and the proportion of double splicing skipping mRNA of exons 12 and 13 induced by snRNA combination 1 and snRNA combination 2 in the total splicing skipping mRNA was lower than that of AON1 and AON2. Therefore, it can be confirmed that U7 snRNA significantly improves the efficiency of single splicing skipping of exon 13 while ensuring the reduction of double skipping USH2A mRNA by-products.

[0140] Furthermore, snRNA combination 2 targets AON sites adjacent to exons 12 and 13 in the prior art, which have a very high probability of double splice skipping, whereas snRNA combination 2 has a very low probability of double splice skipping.

[0141] Example 8 Splicing-skipping effect of U7 snRNA containing a motif that recruits splicing regulatory proteins A U7 snRNA linked to an hnRNP A1 binding motif was constructed. According to the pretranscriptional DNA sequence corresponding to the sequence in the table, the corresponding Oligo DNA was synthesized. The sense strand of the Oligo DNA is the reverse complementary sequence of the target sequence (DNA sequence corresponding to the recognition domain sequence), with CCGCAATATGATAGGGACTTAGGGTG (SEQ ID NO: 28) added to the 5', and the antisense strand has AATT added to the 5' of the target sequence and CACCCTAAGTCCCTATCATATT (SEQ ID NO: 29) added to the 3'. For example, the recognition domain sequence is NNN (the length of the recognition domain is preferably longer than 16 nucleotides),

[0142] [ka]

[0143] The synthesized Oligo DNA sense and antisense strands were mixed according to the annealing reaction system (total reaction volume 20 μl: Oligo-F (100 μM) 2 μl + Oligo-R (100 μM) 2 μl + 10 × NEB Cutter smart buffer 2 μl + deionized water 16 μl), incubated at 95 ° C for 5 minutes, then placed on ice to cool and anneal to form double-stranded DNA with sticky ends. After diluting 100 times, 1 μl was taken and digested with 10 ng of BsaI, and the recovered linearized pUC57-U7 snRNA backbone plasmid was ligated. Furthermore, by transformation of E. coli competent cells, single cloning, PCR and sequencing, a U7-snRNA vector containing hnRNP A1 binding motif for inducing USH2A exon 13 splicing jumping was obtained, and the vector was named pUC57-U7-hnRNP A1-snRNA#A. The plasmid was purified and stored at -20°C for future use. Figure 5 shows a schematic diagram of the snRNA vector containing hnRNP A1.

[0144] U7-hnRNP A1-snRNA can also be chemically synthesized and modified according to the methods described in the Examples of this application. Taking snRNA#25 as an example, the chemically synthesized U7-hnRNP A1-snRNA sequence and modifications are as follows (* indicates phosphorothioate backbone, m indicates 2'-methoxy modification, underline indicates recognition domain reverse-complementary to target sequence, italics indicates smOPT sequence, and bold indicates hnRNP A1 protein binding motif):

[0145] [ka]

[0146] U7 snRNA linked to the hnRNP A1 binding motif induced splicing skipping of USH2A exon 13 in reporter gene cells. 293T cells were seeded in 24-well plates at a given amount so that the cell confluence reached approximately 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine2000. left -Exon13 mut -EGFP right pUC57-U7-hnRNP A1-snRNA plasmid, pUC57-U7 snRNA plasmid and 293T cells (vector mass ratio is 100ng:400ng) were transfected simultaneously, and 293T cells transfected with reporter plasmid alone (reporter group), reporter plasmid and pUC57-U7 Scramble (SC group) were used as two negative controls, respectively, and 293T cells not transfected with any plasmid were used as blank control. The transfected cells were then cultured for 48-72 hours, digested into single cells using trypsin, and the splicing jumping efficiency induced by different snRNA groups was detected using a flow cytometer. Table 5 and Figures 6A-6B below show the splicing skipping efficiency of U7-hnRNP A1-snRNAUSH2A pre-mRNA exon 13.

[0147] The data show that the introduction of hnRNP A1 binding motif into the 5' end of U7-snRNA can significantly improve the effect of inducing splicing jumping of USH2A pre-mRNA exon 13, not only increasing the proportion of cells (GFP+) with exon 13 splicing jumping, but also increasing the level (average FITC intensity) of splice-skipping exon mRNA in each cell. At the same time, the introduction of hnRNP A1 binding motif into U7 snRNA#25 increases the average FITC intensity by 3.25-fold, significantly improving the efficiency of splicing skipping induction.

[0148] [Table 5]

[0149] In this embodiment, a free tail is introduced at the 5' end of U7-snRNA, and the free tail sequence includes the hnRNP A1 protein binding motif sequence "UAGGGU". The free tail sequence may include one, two, or more than two hnRNP A1 protein binding motifs, preferably two. The free tail sequence is preferably

[0150] [ka] and can recruit hnRNP A1 protein to promote splicing jumping of USH2A exon 13, without increasing double skipping of exon 12 and exon 13, without affecting other target specificity, and without inducing or increasing target off-target effect. For example, the USH2A exon 12 described in the present application is human USH2A exon 12. For example, the USH2A exon 13 described in the present application is human USH2A exon 13.

[0151] In some embodiments, the free tail introduced at the 5' end of the U7 snRNA is a motif that can recruit a splicing regulatory protein, such as hnRNP A1 (Heterogeneous Nuclear Ribonucleoprotein A1), SRSF1 (Serine And Arginine Rich Splicing Factor 1), RBM4 (RNA Binding Motif Protein 4), DAZAP1 (DAZ Associated Protein 1), or SR (Serine And Arginine-Rich Protein).

[0152] Example 9 Construction and viral packaging of AAV-U7 snRNA-associated plasmid vectors targeting induction of splicing skipping of USH2A pre-mRNA exon 13 In this embodiment, the U7-snRNA gene targeting and inducing splicing jumping of USH2A pre-mRNA exon 13 was inserted to replace the central gene sequence of the two ITR domains of the pAAV-CMV vector to construct a pAAV-U7 snRNA vector, and the AAV packaging plasmid: serotype pRC plasmid (containing the AAV2 Rep gene and the respective Cap genes of each serotype), pHelper plasmid (vector plasmid containing adenovirus E2A, E4, and VA genes) was co-transfected into host cells and packaged to obtain an AAV-U7 snRNA virus targeting splicing jumping of USH2A pre-mRNA exon 13. The specific operation process is as follows:

[0153] First, a gene sequence-U7-snRNA gene expression cassette backbone (without recognition domain): 5'-mouse U7 promoter-smOPT sequence-U7-snRNA scaffold-snRNA gene specific 3' cassette-3' was synthesized by total gene synthesis. Here, two Tpye IIs type restriction endonuclease recognition sites (e.g., BsaI, AarI, BsmBI, etc.) were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement and insertion of other recognition domain sequences. The total gene synthetic sequence was inserted and replaced between the two AAV2-ITR domains of the pAAV-CMV plasmid (AAVpro (registered trademark) Helper Free System (AAV5) kit, TAKARA Co., Ltd., Code No.: 6650) to obtain a pAAV-U7-snRNA backbone vector.

[0154] U7-snRNA gene expression cassette backbone (without recognition domain) (SEQ ID NO:33): AAGCTTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGT GGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAgagaccaatgtgggtctcgAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGCGGCCGC

[0155] According to the method described in the above examples, the corresponding Oligo DNA sense strand and antisense strand were synthesized according to the pretranscriptional DNA sequence corresponding to the snRNA recognition domain sequence or the tandem combination of the recognition domain sequence of the present application, and sticky ends similar to those cleaved by the Tpye IIs type restriction endonuclease recognition site were added to both ends. The recognition domain (single / tandem) double-stranded DNA with sticky ends was formed by annealing, and T4 ligase was ligated with the corresponding Tpye IIs type restriction endonuclease digested linearized pAAV-U7-snRNA backbone plasmid to form a pAAV-U7-snRNA plasmid that targets and induces splicing jumping of a specific site in USH2A pre-mRNA exon 13, and was named according to the snRNA number corresponding to the recognition domain sequence, such as pAAV-U7 snRNA#25.

[0156] The target gene (U7-snRNA gene expression cassette targeting and inducing splicing jumping of USH2A pre-mRNA exon 13) was inserted to replace the gene sequence between the AAV2-ITR domains of the pAAV-CMV plasmid, and then the pAAV-U7 snRNA plasmid vector was obtained. The AAV-U7-snRNA virus targeting and inducing splicing jumping of USH2A pre-mRNA exon 13 was packaged and obtained according to the AAVpro® Helper Free System (AAV5) kit instructions and standard cell manipulation procedures.

[0157] 24 hours before transfection, HEK293 / 293T cells were seeded in 100 mm cell culture dishes, the medium was DMEM medium containing 10% FBS, and transfection was performed when the confluence reached 80%-90%. 3 hours before transfection, the old medium was discarded and replaced with new medium. At the time of transfection, pAAV-U7 snRNA plasmid, pRC plasmid, pHelper plasmid, and PEI (polyethyleneimine) transfection reagent were simultaneously prepared according to the system in the table below and added dropwise to the culture dish. After adding the PEI transfection mixture, the culture dish was gently shaken to uniformly disperse the transfection reagent, and the medium was cultured in a 37 °C, 5% CO2 incubator.

[0158] PEI transfection system: pAAV plasmid (1 μg / μl), 6 μL; pRC1 / 2 / 5 / 6 plasmid (1 μg / μl); (pRC plasmid capsid gene determines serotype), 6 μL; pHelper plasmid (1 μg / μl), 6 μL; serum-free DMEM medium, 500 μL; PEI (1 mg / mL), 110 μL. Treatment method: vortex several times to mix and incubate at room temperature for 5 min.

[0159] 24 hours after transfection, the medium was replaced with fresh DMEM medium with 2% FBS. 48-72 hours after transfection, the cells containing AAV virus were collected, washed, centrifuged, and the cell pellet was collected and vortexed to loosen the cell pellet. Then, according to the AAVpro® Helper Free System (AAV5) kit instructions, 0.5 mL of AAV Extraction Solution A was added to the cell pellet and vortexed for 15 seconds to completely suspend the cell pellet. After leaving it at room temperature for 5 minutes, it was vortexed for another 15 seconds. It was centrifuged at 2000-14000g at 4°C for 10 minutes to remove cell debris. The supernatant was collected in a new sterile centrifuge tube, 50 μL of AAV Extraction Solution B was added, and mixed uniformly using a pipette to obtain an AAV-U7 snRNA virus solution with different recognition domains. A portion was taken to detect the virus titer using qPCR, and stored at 80°C for later use.

[0160] Since the target gene fragment inserted between the AAV2-ITR domains of the pAAV-U7-snRNA plasmid must be less than 2.5 kb, the expression level of U7-snRNA is increased while ensuring the same number of AAV viral particles by inserting multiple U7-snRNA gene expression cassettes (5'-mouse U7 promoter recognition domain-smOPT sequence, snRNA gene-specific 3' cassette-3'), and the length of the gene sequence is about 450 bp. Preferably, the pAAV-U7-snRNA plasmid carries 1 to 5 U7-snRNA gene expression cassettes, and the multiple U7-snRNA gene expression cassettes in the pAAV-U7-snRNA plasmid may have the same recognition domain or combination of recognition domains, or may have different or non-identical combinations of recognition domains.

[0161] In the present application, AAV is used to deliver U7 snRNA to induce USH2A pre-mRNA exon 13 splicing skipping, and the capsid protein of said AAV may be naturally derived or may be a mutant of naturally derived capsid protein, directed evolution, or rational amino acid / peptide modification (codon optimization, chimerism of functional peptide segments of different serotypes, etc.) to improve tissue and organ tropism, immunogenicity, transfection efficiency, such as AAV2.5, AAV2i8, AAV-TT, AAV9.HR, CAM130, etc. The naturally derived AAV capsid protein may be derived from an animal or a plant, and the capsid protein of the animal-derived AAV virus may be derived from a human (e.g., AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, etc.), a non-human primate (e.g., AAVrh.8, AAVrh.10, and AAVrh.43), a vertebrate such as a mouse or a pig, or an insect. In the AAV plasmid system of the present invention, for example, the AAV ITR serotype must match the Rep gene serotype, but may not match the Cap gene serotype.

[0162] The foregoing detailed description has been provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications to the embodiments described herein will be apparent to those skilled in the art and remain within the scope of the appended claims and their equivalents.

Claims

1. A nucleic acid molecule capable of specifically binding to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof, wherein the genomic location corresponding to the 3'-end sequence of USH2A pre-mRNA exon 13 is Chr1:216246563-216246753.

2. A nucleic acid molecule capable of specifically binding to the sequence shown in SEQ ID NO:1 or a fragment thereof.

3. A nucleic acid molecule which is complementary to 16 or more consecutive nucleotides in the sequence shown in SEQ ID NO:

1.

4. A nucleic acid molecule comprising 16 or more consecutive nucleotides of the sequence shown in SEQ ID NO:1, or its complementary sequence.

5. The nucleic acid molecule according to any one of claims 1 to 4, wherein the nucleic acid molecule comprises at least 16 nucleotides complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof.

6. The nucleic acid molecule according to any one of claims 1 to 5, wherein the nucleic acid molecule comprises 22 to 27 nucleotides complementary to the 3'-end sequence of USH2A pre-mRNA exon 13 or a fragment thereof.

7. The nucleic acid molecule according to any one of claims 1 to 6, wherein the nucleic acid molecule comprises at least 16 nucleotides.

8. The nucleic acid molecule according to any one of claims 1 to 7, wherein the nucleic acid molecule comprises 22 to 27 nucleotides.

9. The nucleic acid molecule according to any one of claims 1 to 8, wherein the nucleic acid molecule comprises at least 60 nucleotides.

10. The nucleic acid molecules are Chr1: 216246603-216246626, Chr1: 216246598-216246621, Chr1: 216246598-216246624, Chr1: 216246594-216246617, Chr1: 216246570-216246593, Chr1: 216246570-216246591, Chr1: 216246570- 10. The nucleic acid molecule of any one of claims 1 to 9, comprising a corresponding pre-mRNA sequence complementary to a genomic location selected from the group consisting of: Chr1: 216246596, Chr1: 216246570-216246593, Chr1: 216246570-216246596, Chr1: 216246567-216246590, and Chr1: 216246563-216246586.

11. The nucleic acid molecule according to any one of claims 1 to 10, comprising a sequence complementary to any one of SEQ ID NOs: 10 to 21.

12. The nucleic acid molecule according to any one of claims 1 to 11, comprising a sequence as set forth in any one of SEQ ID NOs: 10 to 21.

13. The nucleic acid molecule according to any one of claims 1 to 12, wherein the nucleic acid molecule comprises modified nucleotides.

14. 14. The nucleic acid molecule of claim 13, wherein the modified nucleotides comprise a modification selected from the group consisting of 2'-O-alkyl, 2'-O-methoxy and / or 2'-O-methoxyethyl.

15. The nucleic acid molecule according to any one of claims 13 to 14, wherein the modified nucleotides comprise a modification selected from the group consisting of 2'-O-methyl and / or 2'-O-ethyl.

16. The nucleic acid molecule according to any one of claims 13 to 15, wherein the nucleic acid molecule comprises at least one modified nucleotide.

17. The nucleic acid molecule according to any one of claims 13 to 16, wherein the 5' end of the nucleic acid molecule comprises at least one modified nucleotide.

18. The nucleic acid molecule according to any one of claims 13 to 17, wherein the 5' end of the nucleic acid molecule comprises 1 to 3 modified nucleotides.

19. The nucleic acid molecule according to any one of claims 13 to 18, wherein the 3' end of the nucleic acid molecule comprises at least one modified nucleotide.

20. The nucleic acid molecule according to any one of claims 13 to 19, wherein the 3' end of the nucleic acid molecule comprises 1 to 3 modified nucleotides.

21. 21. The nucleic acid molecule of any one of claims 1 to 20, wherein the nucleic acid molecule comprises nucleotide or nucleotide analog monomers selected from the group consisting of 6'-modified bicyclic nucleosides, 5'-modified bicyclic nucleosides, 6'-disubstituted bicyclic nucleosides, tetrahydropyran nucleoside analogs and / or 2'-deoxy 2'-fluoro-β-D-arabinose nucleotides (2'-FANA modified nucleotides).

22. The nucleic acid molecule according to any one of claims 1 to 21, wherein the nucleic acid molecule comprises modified phosphate linkages.

23. The nucleotide molecule may include a thiophosphate, phosphorodithioate, phosphotriester, alkyl phosphonate, aminoalkyl phosphotriester, alkylene phosphonate, phosphinate, phosphoramidate, aminoalkyl phosphoramidate, thiophosphoramidate, thiocarbonyl alkyl phosphonate, thiocarbonyl alkyl phosphotriester, phosphorothioate, selenophosphate, boranophosphate, phosphodiester bond, Rp-phosphorothioate bond, Sp-phosphorothioate bond, boranophosphate bond, methylene bond (methylimino), amide bond (3′-CH ２ -CO-NH-5',3'-CH ２ -NH-CO)-5'), methylphosphonate bond and / or 3'-thiomethylal bond (3'S-CH ２ The nucleic acid molecule according to any one of claims 1 to 22, wherein the nucleic acid molecule is linked by a chemical bond selected from the group consisting of:

24. The nucleic acid molecule of any one of claims 22 to 23, wherein the modified phosphate linkage comprises a linkage selected from the group consisting of phosphorothioate linkage, phosphorodithioate linkage, alkylphosphate linkage, phosphoramidate linkage, and / or boranophosphate linkage.

25. The nucleic acid molecule according to any one of claims 22 to 24, wherein the nucleic acid molecule comprises at least one modified phosphate linkage.

26. The nucleic acid molecule according to any one of claims 22 to 25, wherein the 5' end of the nucleic acid molecule comprises at least one modified phosphate bond.

27. The nucleic acid molecule according to any one of claims 22 to 26, wherein the 5' end of the nucleic acid molecule comprises one to three modified phosphate bonds.

28. The nucleic acid molecule according to any one of claims 22 to 27, wherein the 3' end of the nucleic acid molecule comprises at least one modified phosphate bond.

29. The nucleic acid molecule according to any one of claims 22 to 28, wherein the 3' end of the nucleic acid molecule comprises one to three modified phosphate bonds.

30. The nucleic acid molecule according to any one of claims 1 to 29, wherein the nucleic acid molecule comprises DNA and / or RNA.

31. The nucleic acid molecule according to any one of claims 1 to 30, wherein the nucleic acid molecule is single-stranded or double-stranded.

32. The nucleic acid molecule according to any one of claims 1 to 31, wherein the nucleic acid molecule comprises an antisense oligonucleotide, an shRNA, an siRNA, an miRNA and / or an aptamer.

33. The nucleic acid molecule according to any one of claims 1 to 32, wherein the nucleic acid molecule comprises a small nuclear RNA.

34. 34. The nucleic acid molecule of claim 33, wherein the small nuclear RNA comprises a U1 small nuclear RNA and / or a U7 small nuclear RNA.

35. The nucleic acid molecule of any one of claims 1 to 34, wherein the nucleic acid molecule does not bind to a Cas enzyme.

36. The nucleic acid molecule of any one of claims 1 to 35, wherein the nucleic acid molecule does not comprise a structure capable of binding to a Cas enzyme.

37. The nucleic acid molecule of any one of claims 35 to 36, wherein the Cas enzyme is a Cas13 enzyme.

38. The nucleic acid molecule according to any one of claims 1 to 37, wherein the nucleic acid molecule comprises a stem-loop domain or a derivative structure thereof.

39. 39. The nucleic acid molecule of claim 38, wherein the stem-loop domain comprises the sequence set forth in SEQ ID NO:

6.

40. 40. The nucleic acid molecule according to any one of claims 1 to 39, wherein the nucleic acid molecule comprises a domain capable of binding to an sm protein or a derivative structure thereof.

41. 41. The nucleic acid molecule of claim 40, wherein the domain capable of binding to an sm protein comprises the sequence shown in SEQ ID NO:

5.

42. The nucleic acid molecule according to any one of claims 1 to 41, comprising a domain capable of binding to a splicing regulatory protein.

43. The nucleic acid molecule according to any one of claims 1 to 42, comprising a domain capable of binding to a protein selected from the group consisting of Serine and Arginine Rich Splicing Factor 1 (SRSF1), RNA Binding Motif Protein 4 (RBM4), DAZ Associated Protein 1 (DAZAP1), and Serine and Arginine-Rich Protein (SR).

44. The nucleic acid molecule according to any one of claims 1 to 43, wherein the nucleic acid molecule comprises a domain capable of binding to hnRNP A1 protein.

45. 45. The nucleic acid molecule of claim 44, wherein the domain capable of binding to the hnRNP A1 protein comprises the sequence set forth in SEQ ID NO:

30.

46. A gene expression cassette comprising or encoding the nucleotide sequence of a nucleic acid molecule according to any one of claims 1 to 45, and optionally expression control elements.

47. A vector comprising or encoding the nucleotide sequence of a nucleic acid molecule according to any one of claims 1 to 45 and / or the nucleotide sequence of a gene expression cassette according to claim 46.

48. A viral particle comprising a nucleic acid molecule according to any one of claims 1 to 45, a nucleotide sequence of a gene expression cassette according to claim 46, and / or a vector according to claim 47.

49. A cell comprising a nucleic acid molecule according to any one of claims 1 to 45, a nucleotide sequence of a gene expression cassette according to claim 46, a vector according to claim 47 and / or a viral particle according to claim 48.

50. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 45, a nucleotide sequence of a gene expression cassette according to claim 46, a vector according to claim 47, a viral particle according to claim 48 and / or a cell according to claim 49, and optionally a pharma- ceutical acceptable carrier.

51. The pharmaceutical composition according to claim 50, comprising a first carrier and a second carrier, the first carrier comprising a nucleic acid molecule according to any one of claims 1 to 45, and the second carrier comprising a nucleic acid molecule capable of specifically binding to USH2A pre-mRNA exon 13 and both sides thereof or fragments thereof.

52. The pharmaceutical composition according to any one of claims 50 to 51, wherein the flanking regions of the USH2A pre-mRNA exon 13 include USH2A pre-mRNA intron 12 and / or intron 13.

53. A kit comprising a nucleic acid molecule according to any one of claims 1 to 45, a nucleotide sequence of a gene expression cassette according to claim 46, a vector according to claim 47, a viral particle according to claim 48, a cell according to claim 49 and / or a pharmaceutical composition according to any one of claims 50 to 52.

54. 46. ​​A method for preparing a nucleic acid molecule according to any one of claims 1 to 45, comprising expressing and / or synthesizing said nucleic acid molecule capable of binding to the 3'-end sequence of USH2A exon 13 or a fragment thereof, wherein the genomic location of the 3'-end sequence of USH2A exon 13 is Chr1:216246563-216246753.

55. A method for inhibiting expression and / or function of USH2A pre-mRNA exon 13 comprising providing a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52, and / or a kit according to claim 53.

56. A method for splicing skipping of exon 13 of USH2A pre-mRNA, comprising providing a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52, and / or a kit according to claim 53.

57. A method for preparing a mature USH2A mRNA lacking exon 13, comprising providing a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52, and / or a kit according to claim 53.

58. A method for reducing a level of Usherin protein comprising an expression product of exon 13, comprising providing a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52, and / or a kit according to claim 53.

59. A method for preparing an Usherin protein that does not contain an expression product of exon 13 and / or a method for increasing the amount of an Usherin protein that does not contain an expression product of exon 13, the method comprising providing a nucleic acid molecule described in any one of claims 1 to 45, a vector described in claim 47, a viral particle described in claim 48, a cell described in claim 49, a pharmaceutical composition described in any one of claims 50 to 52, and / or a kit described in claim 53.

60. A method for restoring function of a mutated Usherin protein, comprising providing a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a viral particle according to claim 48, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52, and / or a kit according to claim 53.

61. Use of a nucleic acid molecule according to any one of claims 1 to 45, a vector according to claim 47, a viral particle according to claim 48, a cell according to claim 49, a pharmaceutical composition according to any one of claims 50 to 52 and / or a kit according to claim 53 in the preparation of a medicament for the prevention and / or treatment of a disease caused by a USH2A gene mutation.

62. 62. The use according to claim 61, wherein the disease comprises an eye disease and / or an ear disease.

Images