Pseudotyped lentiviral vectors

Abstract

The present invention relates to pseudotyped lentiviral vectors, in particular lentiviral vectors pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein, as well as related constructs, methods and therapeutic applications.

Description

[Technical field]

[0001] The present invention relates to pseudotyped lentiviral vectors, in particular lentiviral vectors pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein, as well as related constructs, methods and therapeutic applications. [Background technology]

[0002] The coronavirus disease 2019 (COVID-19) pandemic, caused by severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2), remains an ongoing public health problem. This is primarily due to the continued identification and emergence of novel mutations in the SARS-CoV-2 genome occurring in COVID-19 infected patients worldwide. Continuous global genome-wide surveillance efforts of SARS-CoV-2 sequences have uncovered thousands of mutations, many of which are being further explored to predict variants of interest (VOIs) early in their emergence. Of particular importance are the increasingly numerous and independent variants under investigation (VUI) or variants of concern (VOC), found worldwide (e.g., SARS-CoV-2 lineages originating from the UK (B.1.1.7, alpha), South Africa (B.1.351, beta); B.1.1.529, (Omicron), Brazil (P.1, gamma), and India (B.1.617.2, delta); VOCs are defined as VOCs for their increased propensity for transmission and / or disease severity, resistance to treatment, and originally, to various degrees, escape from neutralizing antibodies (nAbs), including nAbs induced by anti-SARS-CoV-2 Spike (S) glycoprotein vaccine efforts.

[0003] With the emergence of VOCs, there is an increasing need for continued cross-examination of these new variants, especially with existing nAbs, vaccine strategies, and therapeutics. However, the manipulation of authentic SARS-CoV-2 (a risk group 3 pathogen) requires high-level biosafety level (BSL) 3 containment facilities, the access and availability of which are limited. Thus, there continues to be an unprecedented need for safe, improved, and easily accessible SARS-CoV-2 equivalent resources to support related research studies. To help meet this need, pseudotyped viral vectors to generate pseudoviral particles (PSVs) have been widely adopted to model infectious / pathogenic viruses. In general, viral envelope glycoprotein(s), which are the minimal and essential components for viral infection and contribute to viral entry into target cells, are expressed on the membrane of killed viral vectors. These viral mimics are relatively safe to manipulate, obviating the need for high BSL facilities required to manipulate live / authentic pathogens. The SARS-CoV-2 membrane S glycoprotein, which mediates viral attachment to target cells by binding to human angiotensin-converting enzyme 2 (hACE2) and primes membrane fusion between the virus and the target using a human serine protease (hTMPRSS2), has been readily repurposed to generate useful SARS-CoV-2 PSVs. In these cases, the SARS-CoV-2 S protein presumably assembles as a functional trimer within the acquired envelope of the viral vector. A key advantage of this feature is that the resulting PSVs employ a similar target cell entry mechanism as their parent pathogenic SARS-CoV-2. Their exploitation in the current SARS-CoV-2 / COVID-19 pandemic is helping to advance and accelerate efforts in vaccine development and therapeutics. However, well-established SARS-CoV-2 S PSVs are associated with a number of problems and drawbacks that limit their usefulness.

[0004] In particular, current SARS-CoV-2 PSVs are based on pseudotyped γ-retroviruses, rhabdoviruses, or first / second generation rHIV1 LVs. These platforms are still restricted to high BSL2 settings for operation. Pseudotyped γ-retroviruses are further challenged by their limited ability to transduce non-dividing cells, which limits their utility as PSV resources, including in SARS-CoV-2 related research studies. Despite the current SARS-CoV-2 PSV repertoire, there is a growing global demand for high titer, accessible, and easy to operate SARS-CoV-2 PSV resources to robustly cross-test for persistently emerging / circulating SARS-CoV-2 variants. This is especially true for VOCs that pose an additional level of threat to public health, given their ability to evade well-established immunity derived from prior infection with Wuhan Hu-1 or G614 strains and, to various degrees, first-generation vaccine efforts. Moreover, the design of the first-generation vaccine is based on the SARS-CoV-2 S glycoprotein of the Wuhan Hu-1 isolate, which is no longer the predominant, pandemic-defining SARS-CoV-2 strain in circulation. This design construct raises concerns about how effective a given SARS-CoV-2 vaccine strategy will be against new / novel emerging VOCs. Thus, there is a persistent and urgent need to cross-study SARS-CoV-2 variants and representative PSVs under more controlled and standardized research study conditions. In turn, this allows for standardization of studies of SARS-CoV-2-related nAbs, vaccine efficacy, and therapeutic robustness and quality.

[0005] In addition, good animal and in vitro models will aid in the research and development of preventive, therapeutic and vaccine strategies. Currently, available mouse models for authentic SARS-CoV-2 and non-mouse adapted SARS-CoV-2 infection are difficult to manipulate due to significant costs and animal waste associated with the provision of hACE2 transgenic or CRISPR / Cas9-mediated knock-in animals, to name a few key examples. Simplified humanization by introducing hACE2 in trans into mouse lungs and airways, for example via replication-incompetent adenovirus (AdV), recombinant adeno-associated virus (rAAV) or LV vectors, and even the sensitization step of mouse models to SARS-CoV-2 results in a physiologically relevant biodistribution of hACE2 in the lungs of mice, depending on the tropism of the selected gene transfer vector. In addition, the complexity of challenging animal models with multiple vectors (probably requiring at least two different virus-based agents (i. the chosen vector for gene transfer to achieve humanization of hACE2, and ii. PSV or authentic SARS-CoV-2 for challenge)) is mitigated by the mACE2-copermissive SARS-CoV-2. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention seeks to overcome one or more of these problems. In particular, it is an object of the present invention to provide lentiviral vectors pseudotyped with a modified SARS-CoV-2 spike protein that (i) are not related to the current SARS-CoV-2 PSVs, and (ii) are rodent-adapted, in particular mouse-adapted, and thus capable of transducing rodent / mouse cells without encountering the problems associated with conventional SARS-CoV-2 mouse models. [Means for solving the problem]

[0007] The inventors have created mouse-adapted S-LV vectors with improved function and functional titer, providing advantages for modeling SARS-CoV-2, preclinical models (in vitro and animal models). The S-LVs of the present invention also retain the ability to transduce cells via hACE2, thus potentially bridging the gap between preclinical and clinical applications. As an example presented herein, and in more detail, the inventors pseudotyped third-generation self-inactivating (SIN) HIV1 lentiviral vectors and pseudotyped them with S glycoproteins derived from multiple clinically relevant SARS-CoV-2 mutant strains (including Wuhan Hu-1, G614, Australia / VIC01 / 2020 (Aus / VIC01), B.1.1.7, B.1.351) with modifications (i.e., a modification that truncates the C-terminal tail by 19 amino acids) to create "S-LVs". Surprisingly, the S-LVs of the present invention are produced at high titers, which allows for downstream applications and broadening the scope of use of SARS-CoV-2 mutants. In particular, as an example shown herein, impressive functional titers of S-LVs were achieved after transient transfection of suspension 293T / 17 with HIV1 LV genomes encoding eGFP or FLuc reporters, HIV1 Gag-Pol, HIV1 Rev plasmids, and plasmid(s) encoding the S glycoprotein of interest. S-LVs can be further concentrated and purified to broaden downstream uses, including in vivo applications.

[0008] Thus, the inventors provide an S-LV platform that can be used to model libraries of SAR-CoV-2 S glycoproteins of interest or clinical relevance, all under standard laboratory containment conditions, to model, evaluate, and predict the infectivity of clinically relevant VOCs, or to support SARS-CoV-2 related research studies by providing a means to examine the neutralizing propensity of neutralizing antibodies or convalescent plasma from patients who have recovered from COVID-19. Given its broad utility, the S-LV platform can be potentially used to rapidly model emerging / novel VUIs or VOCs in vitro and in vivo to help evaluate their infectious profiles, thereby providing metrics that contribute to predetermining their potential impact on global health, and to screen predicted variants prior to their potential emergence in nature, facilitating rapid and strategic responses in the face of the ongoing COVID-19 / SARS-CoV-2 pandemic.

[0009] Significantly, we have provided for the first time murine (m)ACE2-adapted (ma)S-LVs that achieve potent gene transfer in BALB / c mice in vivo without the need for expression of hACE2 in trans in the mouse airway. The exemplified maS-LVs contain multiple mutations in the SARS-CoV-2 S protein, including the mutations Q498Y, P499T, and Δ19, and optionally also N501Y.

[0010] As exemplified herein, we first present a demonstration of the application of S-LVs in vivo by intranasal administration in BALB / c mice as a rapid and straightforward means of modeling SARS-CoV-2 infection in vivo, independent of hACE2 expression, and supporting robust gene transfer capabilities. Taken all together, this S-LV platform accurately represents authentic SARS-CoV-2, particularly representative variants modeled at the level of the SARS-CoV-2 S glycoprotein. This S-LV platform demonstrates robustness across a broad range of SARS-CoV-2 variants represented in this study, and flexibility that is not constrained by high BSL requirements. Thus, the S-LV platform is easy to use, easy to access, and serves as a safe SARS-CoV-2 PSV resource for relevant research studies against the ongoing COVID-19 / SARS-CoV-2 pandemic.

[0011] Thus, the present invention provides a lentiviral vector comprising a transgene pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein and operably linked to a promoter; said spike protein comprising: (a) mutations at amino acid positions corresponding to or aligning with positions 498, 499, and 614 of SEQ ID NO:1; and (b) a deletion of at least a portion of the cytoplasmic tail.

[0012] The present invention also provides a lentiviral vector comprising a transgene pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein and operably linked to a promoter; said spike protein comprising: (a) a mutation at an amino acid position corresponding to or aligning with position 614 of SEQ ID NO:1; (b) a deletion of at least a portion of the cytoplasmic tail; and (c) (i) a mutation at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1; and / or (ii) a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1.

[0013] The cytoplasmic tail of the spike protein may correspond to or align with amino acid residues 1235 to 1273 of SEQ ID NO: 1. Deletion of at least a portion of the cytoplasmic tail of the spike protein may include (a) deletion of at least 10 amino acids, preferably at least 15 amino acids, from the cytoplasmic tail; and / or (b) deletion of amino acid residues corresponding to or aligning with positions 1255 to 1273 of SEQ ID NO: 1.

[0014] One or more of the mutations of the spike protein at amino acid positions corresponding to or aligning with positions 498, 499, and 614 of SEQ ID NO:1 may be amino acid substitutions, and preferably all of the mutations are amino acid substitutions. The amino acid substitutions may be non-conservative amino acid substitutions. (a) the amino acid corresponding to or aligning with position 498 of SEQ ID NO:1 may be substituted with tyrosine; (b) the amino acid corresponding to or aligning with position 499 of SEQ ID NO:1 may be substituted with threonine; and / or (c) the amino acid corresponding to or aligning with position 614 of SEQ ID NO:1 may be substituted with glycine. The mutations may be Q498Y, P499T, and D614G.

[0015] The modified spike protein may be capable of binding to the enzymatic domain of human angiotensin-converting enzyme 2 (ACE2).

[0016] The modified SARS-CoV-2 spike protein can be derived from a SARS-CoV-2 strain selected from the Wuhan-Hu-1, B.1.1.7, B.1.351, P.1, B.1.617.2, B.1.427, B.1.1.529, C.37, B.1.429, or Australia / VIC01 / 2020 (Aus / VIC01) strains.

[0017] The modified spike protein may not be detected by an anti-coronavirus spike protein antibody, preferably the anti-coronavirus spike protein antibody MM43 or R001.

[0018] The modified spike protein may comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 13. The modified spike protein may optionally further comprise one or more additional mutations, including a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1.

[0019] The one or more further mutations comprising a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1, or a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1, optionally include (a) an amino acid substitution, preferably a non-conservative amino acid substitution, even more preferably a substitution with tyrosine; and / or (b) N501Y.

[0020] The modified spike protein may comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO:20.

[0021] The modified spike protein may include (a) mutations at amino acid positions corresponding to or aligning with one or more of positions 80, 215, 417, 484, 501, 614, and 701 of SEQ ID NO:1, preferably all of these residues are mutated; and (b) a deletion of at least a portion of the cytoplasmic tail. Optionally, (a) the modified SARS-CoV-2 spike protein may be derived from the spike protein of the B.1.351 strain; (b) (i) the amino acid corresponding to or aligning with position 80 of SEQ ID NO:1 is replaced by an alanine; (ii) the amino acid corresponding to or aligning with position 215 of SEQ ID NO:1 is replaced by a glycine; (iii) the amino acid corresponding to or aligning with position 417 of SEQ ID NO:1 is replaced by an asparagine; (iv) the amino acid corresponding to or aligning with position 484 of SEQ ID NO:1 is replaced by a lysine; (v) the sequence (vi) the amino acid corresponding to or aligning with position 614 of SEQ ID NO:1 is substituted with glycine, and / or (vii) the amino acid corresponding to or aligning with position 701 of SEQ ID NO:1 is substituted with valine; in which case, preferably, all of these residues are substituted; and / or (c) the deletion of at least a portion of the cytoplasmic tail comprises or consists of a deletion of amino acid residues corresponding to or aligning with positions 1255 to 1273 of SEQ ID NO:1.

[0022] The lentiviral vector of the present invention may be selected from or derived from the group consisting of simian immunodeficiency virus (SIV) vectors, human immunodeficiency virus (HIV) vectors, feline immunodeficiency virus (FIV) vectors, equine infectious anemia virus (EIAV) vectors, and Visna / Maedi virus vectors.

[0023] The lentiviral vectors of the invention may be capable of transducing rodent cells in vivo, preferably mouse cells in vivo.

[0024] The present invention also provides a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein of the present invention.

[0025] The present invention further provides a polynucleotide molecule encoding the modified spike protein of the present invention. The present invention also provides an expression construct comprising a polynucleotide of the present invention, optionally wherein the polynucleotide is operably linked to a promoter.

[0026] The present invention also provides a host cell comprising a lentiviral vector of the invention, a modified spike protein of the invention, a polynucleotide of the invention, or an expression construct of the invention.

[0027] The present invention further provides a virus-like particle (VLP) comprising a modified SARS-CoV-2 spike protein of the present invention.

[0028] The present invention also provides a lentiviral vector of the invention, a modified spike protein of the invention, a polynucleotide of the invention, an expression construct of the invention, or a VLP of the invention for use in therapy, wherein preferably the therapy is gene therapy.

[0029] The present invention further provides an in vitro use of a lentiviral vector of the present invention, a modified spike protein of the present invention, a polynucleotide of the present invention, an expression construct of the present invention, or a VLP of the present invention.

[0030] The present invention also provides a method of making a lentiviral vector of the present invention, comprising: (a) introducing into a viral vector producer cell one or more nucleic acid sequences encoding (i) a nucleic acid sequence encoding a modified SARS-CoV-2 spike protein of the present invention; and (ii) a lentiviral packaging component, a lentiviral envelope component, and a lentiviral genome; and (b) culturing the producer cell under conditions suitable for producing a lentiviral vector. The method may further comprise harvesting the lentiviral vector. The nucleic acid sequence encoding the modified SARS-CoV-2 spike protein is contained within a polynucleotide molecule of the present invention or within an expression construct of the present invention. The one or more nucleic acid sequences encoding the lentiviral packaging component, the lentiviral envelope component, and the lentiviral genome are contained (i) within the same polynucleotide molecule or expression construct as the nucleic acid sequence encoding the modified SARS-CoV-2 spike protein, or (ii) within one or more separate polynucleotide molecules or expression constructs. The SARS-CoV-2 nucleoprotein may be co-expressed during the cultivation of the production cells, in which case preferably the SARS-CoV-2 nucleoprotein is derived from the Wuhan-Hu-1 or B.1.1.529 strain. [Brief description of the drawings]

[0031] [Figure 1-1]A: Representative schematics for full-length and 19-amino acid-deleted C-terminal truncated SARS-CoV-2 S proteins (top and bottom panels, respectively) and annotation domains. Open triangles indicate S1 / S2 furin cleavage sites, and closed triangles indicate S2 cleavage sites. Proteins and annotation domains are not to scale. aa: amino acid(s); CT: cytoplasmic tail; FL: full-length; FP: fusion peptide; HR1 and HR2: heptad repeat 1 and heptad repeat 2, respectively; NTD: N-terminal domain; RBD: receptor binding domain; SS: signal sequence; TM: transmembrane domain; Δ: deletion. B: Representative SARS-CoV-2 S pseudotype plasmid constructs and their associated S-LV variants (v01-05). C: Plasmid map for pGM998 (maS498Y, P499T, N501Y + Δ19aa). D: Plasmid map for pGM1000 (S1.1.7 + 1.351 chimera + Δ19aa). E: Plasmid map for pGM1027 (SB.1.617.2 + Δ19aa). F: Plasmid map for pGM1028 (SC.37 + Δ19aa). G: Plasmid map for pGM1038 (SB.1.617.2, Y501 + Δ19aa). H: Plasmid map for pGM1039 (SC.37, Y501 + Δ19aa). I: Plasmid map for pGM1040 (SB.1.617.2, Y498, T499, Y501 + Δ19aa). J: Plasmid map for pGM1041 (SC.37, Y498, T499, Y501 + Δ19aa). The schematic depicts the construction of the pseudotyped plasmid engineered to express SARS-CoV-2 (co)S protein under the control of the CMVIE enhancer and chicken β-actin promoter.The specific set of mutations that define SARS-CoV-2 S variants are annotated highlighting the amino acid changes: mutations annotated in blue refer to mutations within the N-terminal domain (NTD); mutations annotated in red refer to mutations within the receptor binding domain (RBD); mutations annotated in black refer to mutations outside the aforementioned domains (i.e., the remaining S1 and S2 domains). CBA / RBG intron: chicken β-actin and rabbit β-globin chimeric intron; co: codon optimized; CMVIE enhancer: cytomegalovirus immediate-early enhancer; UTR: untranslated region. [Figure 1-2] Continued from Figure 1-1. [Figure 1-3] Continued from Figure 1-2. [Figure 1-4] Continued from Figure 1-3. [Figure 1-5] Continued from Figure 1-4. [Figure 1-6] Continued from Figure 1-5. [Figure 1-7] Continued from Figure 1-6. [Figure 1-8] Continued from Figure 1-7. [Figure 1-9] Continued from Figure 1-8. [Figure 1-10] Continued from Figure 1-9. [Figure 1-11] Continued from Figure 1-10. [Figure 2-1] Figure 1 shows multiple sequence alignment of cDNA sequences between Wuhan Hu-1 and the SARS-CoV-2 S mutant used to pseudotype rHIV1 lentiviral vectors. The underlined sequence indicates the silent introduction of an AgeI restriction enzyme site into the B.1.1.7+Δ19aa cDNA sequence, which has no effect on the coding protein sequence. [Figure 2-2] Continued from Figure 2-1. [Figure 2-3] Continued from Figure 2-2. [Figure 2-4] Continued from Figure 2-3. [Figure 2-5] Continued from Figure 2-4. [Figure 2-6] Continued from Figure 2-5. [Figure 2-7] Continued from Figure 2-6. [Figure 2-8] Continued from Figure 2-7. [Figure 2-9] Continued from Figure 2-8. [Figure 2-10] Continued from Figure 2-9. [Figure 2-11] Continued from Figure 2-10. [Figure 2-12] Continued from Figure 2-11. [Figure 2-13] Continued from Figure 2-12. [Figure 3-1] Figure 1 shows multiple sequence alignments of SARS-CoV-2 S protein sequences between Wuhan Hu-1 and the SARS-CoV-2 S mutants used to pseudotype rHIV1 lentiviral vectors. Highlighted and underlined amino acid residues or deletions indicate mutations / changes compared to the Wuhan Hu-1 reference sequence to generate the respective SARS-CoV-2 S mutants and / or +Δ19aa derivatives. [Figure 3-2] Continued from Figure 3-1. [Figure 3-3] Continued from Figure 3-2. [Diagram 3-4] Continued from Figure 3-3. [Figure 3-5] Continued from Figure 3-4. [Figure 4-1]Figure 1 shows that co-expression of (co)hACE2 and hTMPRSS2 significantly improves permissiveness of 293T / 17 cells to S-LV and rescues transduction by S-LV. The indicated LV.eGFP pseudotyped with SARS-CoV-2(co)S, VSVg, or bald LV were generated by transient co-transfection of 293T / 17 SF cells as described (see Materials and Methods), and crude LVs were harvested 72 hours after transfection. Fixed dilutions of (A) rHIV1.VSVg (n=4) and the prototypic SARS-CoV-2 pseudotyped S-LVs (B) SWuhan Hu-1±Δ19aa (n=4), (C) SG614±Δ19aa (n=4), and (D) SAus / VIC01±Δ19aa (n=4) were transduced into parental 293T / 17 cell lines expressing (co)hACE2 with or without hTMPRSS2. Approximately 72 hours after infection, cells were subjected to flow cytometric analysis for transduction efficiency by EGFP reporter. Individual data points reflecting transduction efficiency are presented with the mean ± SD of the indicated groups (*, **, ***, and **** represent P<0.05, <0.01, <0.001, and <0.0001, respectively). Using inoculation of parental and engineered cell lines with rHIV1.bald material, the mean baseline fluorescence and low gating threshold for the EGFP positive cell population were determined by flow cytometry and are presented on each graph as dotted lines. [Figure 4-2] Continued from Figure 4-1. [Figure 5-1]Figure 2: The S-LV platform can model SARS-CoV-2 VOCs or VOIs and recapitulate their intrinsic functions in vitro. The indicated S-LVs and maS-LVs, as well as rHIV1.bald, were generated by transient co-transfection of 293T / 17 SF cells, and crude LVs were harvested 72 hours post-transfection. (A) Fixed dilutions of S-LVs pseudotyped with (co)SB.1.1.7+Δ19aa or (co)SB.1.351+Δ19aa, and maS-LVs pseudotyped with maSWuhan Hu-1,Y498,T499+Δ19aa or maSY498,T499,G614+Δ19aa (n=4 each) in the parental 293T / 17 cell line expressing (co)hACE2 with or without hTMPRSS2. Individual data points reflecting transduction efficiency are presented with the mean ± SD of the indicated group (*, **, ***, and **** represent P<0.05, <0.01, <0.001, and <0.0001, respectively). On the other hand, to support permissiveness to SARS-CoV-2(co)S containing N501Y or Q498Y, and P499T using the mACE2 cell entry receptor, selected S-LVs and maS-LVs described in (A) were also transduced into (B) cell lines expressing (co)mACE2 with or without hTMPRSS2. Data are presented as mean ± SD. Using inoculation of parental and engineered cell lines with rHIV1.bald material, the mean baseline fluorescence for the eGFP-positive cell population and the lower gating threshold were determined by flow cytometry and are presented as dotted lines. (C) The following day, parental 293T / 17 cells were seeded into 24-well plates at 70% confluency. Cells were then co-transfected with 200 ng of pCMV+eGFP reporter plasmid and the indicated SARS-CoV-2(co)S or maS pseudotyped plasmids, or 100 ng of pCAG eGFP as a mock control, at a 1:2 ratio with FuGene 6 transfection reagent. Cells were cultured and visualized for eGFP fluorescence at the indicated time points.Cells highlighted by white arrows indicate cells exhibiting syncytia. Scale bar = 500 μm. [Figure 5-2] Continued from Figure 5-1. [Figure 6] Figure 1: Deletion of 19 amino acids and addition of D614G in the SARS-CoV-2 (co)S cytoplasmic tail rescues S-LV titers in permissive 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2. S-LVs pseudotyped (A) (co)SWuhan Hu-1 ± Δ19aa, (B) (co)SG614 ± Δ19aa, and (C) (co)SAus / VIC01 ± Δ19aa were generated. They were harvested at 24-h intervals between 72 and 144 hours after transfection and then titrated against 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2. Titers were determined after FCS analysis on transduced cells. S-LVs carrying a 19 amino acid deletion in the cytoplasmic tail encompassing a putative endoplasmic reticulum retention signal showed substantial improvement and rescued functional titers compared to their full-length counterparts, with peak titers in IU / mL calculated for material harvested 72 hours post-transfection. Additional pseudotypes, (D) (co)SB.1.1.7+Δ19aa, and (co)SB.1.1351+Δ19aa, and (E) maSY498,T499±G614+Δ19aa, also show successful packaging and similar production kinetics, with impressive titers using FCS analysis. [Figure 7]Figure 1 shows that N501Y-containing / mouse ACE2-adjusted S-LVs are permissive to and titrated against cells co-expressing (co)mACE2 and hTMPRSS2. (A) LVs pseudotyped with SARS-CoV-2(co)S proteins containing G614, N501Y, or Y498, T499 were transduced into 293T / 17 cells co-expressing (co)mACE2 and hTMPRSS2. Using fluorescence microscopy, LVs pseudotyped with SARS-CoV-2(co)S containing N501Y, or Y498, T499, showed striking permissiveness to 293T / 17 cells co-expressing (co)mACE2 and hTMPRSS2, compared to reduced / close to loss of permissiveness for G614-containing S-LVs. (B) SB.1.1.7+Δ19aa, SB.1.1351+Δ19aa, and maSY498,T499+Δ19aa-LVs were generated and harvested at 24-h intervals between 72 and 144 h post-transfection, then titrated against 293T / 17 cells co-expressing (co)mACE2 and hTMPRSS2. Titers were determined after FCS analysis on transduced cells. [Figure 8] Figure 1 shows that Y498 and T499-mediated murine ACE2 adaptation further rescues the functional titer of SARS-CoV-2 (co)SAus / VIC01 pseudotyped maS-LVs. SAus / VIC01+Δ19aa-LVs and maSAus / VIC01,Y498,T499+Δ19aa-LVs were generated, harvested 72 hours after transfection, and titrated against permissive 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2. Transduced cells were analyzed by FCS. The calculated potencies in IU / mL for SAus / VIC01+Δ19aa-LV and maSAus / VIC01,Y498,T499+Δ19aa-LV indicate that the mutations Y498 and T499 both confer mouse ACE2 habituation and may further potentially rescue the functional titer of LV pseudotyped with SARS-CoV-2 SAus / VIC01. [Figure 9]Figure 2 shows that S-LVs can be produced at high functional titers after AEX and TFF to model the infectivity of SARS-CoV-2 S VOCs. The indicated S-LV.FLuc and maS-LV.FLuc vectors were produced, purified, diafiltered, and concentrated by a combined AEX / TFF method. Purified and concentrated vector material was titrated against 293T / 17 cells (seeded to achieve 30-40% confluency on the day of transduction) co-expressing (co)hACE2 or (co)mACE2 (as indicated) and hTMPRSS2. 72 hours after infection, cells were harvested, lysed, and luciferase activity was measured according to the dilution factor. (A) Luciferase activity per well was normalized to the input amount of p24 in ng at the time of transduction of cells co-expressing (co)hACE2 and hTMPRSS2. Group mean values ​​± SD are shown (Kruskal-Wallis one-way ANOVA with Dunn's multiple comparison test; **** indicates P<0.0001). (B) Luciferase activity per well was normalized to the input amount of p24 in ng at the time of transduction of cells co-expressing (co)mACE2 and hTMPRSS2. Group mean values ​​± SD are shown (Kruskal-Wallis one-way ANOVA with Dunn's multiple comparison test; *** and **** indicate P<0.001 and 0.0001, respectively). [Figure 10-1]Figure 1 shows that maSY498,T499,G614+Δ19aa-LVs are potently neutralized in vitro by commercially available neutralizing antibodies raised against SARS-CoV-2 spike protein. S-LVs were transduced into permissive 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2 at a multiplicity of infection of 1 in the presence of MM43, a mouse IgG1 (SARS-CoV-2 S neutralizing antibody; Sino Biological), or an isotype control, and R001, a rabbit IgG (SARS-CoV-2 S neutralizing antibody; Sino Biological), or an isotype control, at the indicated working concentrations. 48-72 hours after transduction, cells were subjected to FCS and IC50 was calculated. (A) Transduction profile of maSY498,T499,G614+Δ19aa-LV in the presence of MM43 or isotype control across the range of antibodies tested. (B) Neutralization curve of maSY498,T499,G614+Δ19aa-LV by MM43; neutralization was calculated as % transduction of mouse IgG1 isotype control. (C) Transduction profile of maSY498,T499,G614+Δ19aa-LV in the presence of R001 or isotype control across the range of antibodies tested. (D) Neutralization curve of maSY498,T499,G614+Δ19aa-LV by R001; neutralization was calculated as % transduction of rabbit IgG isotype control. (E) Neutralization curves for G614+Δ19aa; alpha+Δ19aa, beta+Δ19aa, and maS2+Δ19aa by R001. The dotted lines indicate 50% neutralization, for which the average IC50 was calculated. (F) Neutralization curves for G614+Δ19aa; alpha+Δ19aa, beta+Δ19aa, and maS2+Δ19aa by MM43. The dotted lines indicate 50% neutralization, for which the average IC50 was calculated. [Figure 10-2] Continued from Figure 10-1. [Figure 11]Figure 1 shows preliminary rSIV1.S-LV titers by flow cytometry. S-LVs were generated using transient transfection of 293T / 17 SF cells with VSVg pseudotyped rSIV1 lentiviral vector (n=1) or SARS-CoV-2(co)SG614+Δ19aa and maSY498,T499,G614+Δ19aa (n=2 each). 72 hours after transfection, crude rSIV1.VSVg / rSIV1.S-LV vector material was harvested, serially diluted, and transduced into cells co-expressing (co)hACE2 and hTMPRSS2. 72 hours after transduction, cells were subjected to flow cytometry to determine titers in IU / mL based on transduction of eGFP. [Figure 12-1] Figure 1 shows that maSG614+Δ19aa-LV (S-LV v03) and S-LV containing N501Y (S-LV v04) are transduced into BALB / c mice in vivo without exogenous (co)hACE2 priming. (A) Bioluminescence images of BALB / c mice were captured by IVIS at the indicated time points after intranasal administration with the indicated S-LV doses based on p24 quantification (40 or 166 ng). The IVIS results provide evidence that maS-LV and N501Y-containing S-LV can robustly transduce mouse lungs without airway priming and humanization by exogenous (co)hACE2 expression. IVIS images were further analyzed to determine luminescence activity between groups in (B) the nasal cavity and (C) the lungs, further confirming that maS-LVs and N501Y-containing S-LVs are capable of transducing the mouse respiratory airways in a dose-dependent manner, independent of (co)hACE2 priming. Naive mice administered TSSM LV formulation buffer alone served as negative controls and exhibited no to background luminescence. in: intranasal; ma: mACE2 conditioned. [Figure 12-2] Continued from Figure 12-1. [Figure 13]Figure 1 shows a representative exploration plan to support gene therapy application of SARS-CoV-2 S-pseudotyped LVs using in vitro models. S-LVs (S-LV v02, 03, 05; see Figure 1) can be generated to correct mutant SFTPB or CFTR cell models (SFTPBko or 16HBE14o-models with CFTR F508Δ, respectively) encoding the therapeutic gene of interest: (so)SFTPB or (so)CFTR2. Rescue of protein expression profiles can be supported by Western blot. [Figure 14] Graph showing luciferase transgene expression in vivo in the lungs using SY498,T499,G613 Δ19aa-LV (S-LV maS2), SB.1.351+Δ19aa-LV (S-LV beta), and vehicle control. (A) Using IVIS in vivo imaging, luciferase expression in the lungs was determined at the indicated days post-delivery. (B) Cumulative luciferase expression in the lungs over the duration of the study was determined by calculating the area under the curve presented in (A). [Figure 15] Western blot (SDS PAGE under non-reducing conditions) showing that SARS-CoV-2 S-permissive 293T / 17 (stably co-expressing hACE2 and hTMPRSS2) transduced with mouse-adapted S-LV (maS3; SARS-CoV-2 SP498, T499, Y501, G614 + Δ19aa) expresses mature SP-B homodimers compared to null background levels in non-transduced cells. GAPDH was used as a loading control. [Figure 16]Figure 1. S-LVs transducing lung bud organoids (LBOs) to model COVID-19 infection. Concentrated S-LVs encoding EGFP (G614+Δ19aa; SARS-CoV-2 SG614+Δ19aa) were mixed with phenol red (2:1 ratio) and microinjected at maximum feasible dose (MFD) into LBOs embedded in Matrigel. Microinjection of rAAV8 encoding human IgG was used as a negative control. Fluorescence microscopy (eGFP) was performed 72 hours after injection using an EVOS FL Auto. BF=bright field microscopy. Scale bar refers to 500 μm. [Figure 17] Graph showing that SARS-CoV-2 2 nucleoprotein (N) boosts the titer of recombinant HIV1 lentiviral vector (LV). (A) Titers from crude vector material titrated on SARS-CoV-2 permissive 293T / 17 cells stably expressing hACE2 and hTMPRSS2. nt = no test. (B) Graph showing the difference between matched, log10 transformed titer pairs from (A) (paired t-test; P=0.0006). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] definition Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains. Singleton et al., Dictionary of Microbiology and Molecular Biology, 20th edition, John Wiley and Sons, New York (1994); and Hale and Marham, HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide those skilled in the art with a general dictionary of many of the terms used in this disclosure. The meaning and scope of the terms shall be clear; however, in the unlikely event of any potential ambiguity, the definitions provided herein shall take precedence over any dictionary or extraneous definitions. It is to be understood that the present invention is not limited to the specific methods, protocols, and reagents, etc. described herein, which may vary.

[0033] The disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the disclosure. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0034] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the present disclosure to the precise form disclosed. Specific embodiments of the present disclosure and examples thereof are described herein for illustrative purposes, but those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while steps or functions of a method are presented in a given order, alternative embodiments may perform the functions in a different order or substantially synchronically. The teachings of the present disclosure presented herein may be applied to other procedures or methods as appropriate. The various embodiments described herein may be combined to present further embodiments. Aspects of the present disclosure may be modified, if necessary, to utilize the compositions, functions, and concepts of the above references and the present application to produce still further embodiments of the present disclosure. Furthermore, considerations of biological functional equivalence may result in some changes being made in protein structure without affecting the type or amount of biological or chemical action. These and other changes may be made to the present disclosure in light of the detailed description, and all such modifications are intended to be included within the scope of the appended claims.

[0035] Unless otherwise indicated, each nucleic acid sequence is written left to right in 5' to 3' orientation; each amino acid sequence is written left to right in amino to carboxy orientation.

[0036] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure.

[0037] As used herein, the term "capable of" when used with a verb encompasses or means the action of the corresponding verb. For example, "capable of interacting" also means "interacting", "capable of cleaving" also means "cleaving", "capable of binding to" also means "binding to", and "capable of specifically targeting to" also means "specifically targeting to".

[0038] Definitions of other terms can be found throughout the specification. Before describing exemplary embodiments in more detail, it is to be understood that the disclosure is not limited to the specific embodiments described, and may therefore vary. It is also to be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting, since the scope of the present invention is defined only by the appended claims.

[0039] Numerical ranges include the numbers that define the range. When a range of values ​​is presented, it is understood that each intermediate value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, is also specifically disclosed, unless the context clearly dictates otherwise. Each subrange between any stated or intermediate value within a stated range and any other stated or intermediate value within that stated range is also included within the disclosure. The upper and lower limits of these subranges may be independently included or excluded within the range, but each range in which one or both of the limits are included within the subrange, or each range in which neither of the limits are included, is also included within the disclosure and is subject to any specifically excluded limits within the stated range. When a stated range includes one or both of the limits, ranges excluding one or both of those included limits are also included within the disclosure.

[0040] As used herein, the articles "a" and "an" may refer to one or to more than one (i.e., at least one) of the grammatical object of the article. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. In this application, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" are not limiting.

[0041] "About" generally refers to an acceptable degree of error for the quantity being measured given the nature or precision of the measurement. Exemplary degrees of error are within 20 percent (%), typically within 10%, and more typically within 5% of a given value or range of values. Preferably, as used herein, the term "about" is to be understood as + or - (±) 5% from the numerical value of the number with which it is used, preferably ± 4%, ± 3%, ± 2%, ± 1%, ± 0.5%, ± 0.1%.

[0042] The term "consisting of" refers to compositions, methods, and their respective components, as described herein, excluding any element not recited in this description of the invention.

[0043] As used herein, the term "consisting essentially of" refers to elements required for a given invention. The term "consisting essentially of" permits the presence of elements that do not substantially affect the basic characteristic(s) and novel characteristic(s) or functional characteristic(s) of the invention (i.e., inactive or non-immunogenic components).

[0044] Any embodiment described herein as "comprising" one or more features is also considered as a disclosure of the corresponding embodiment "consisting of" and / or "consisting essentially of" such features.

[0045] Concentrations, amounts, volumes, percentages, and other numerical values ​​are presented herein in a range format, with it also being understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values ​​explicitly recited as the limits of the range, but also to include all individual numerical values ​​or subranges subsumed within the range as if each numerical value and subrange were explicitly recited.

[0046] As used herein, the terms "vector," "viral vector," and "lentiviral vector" are used interchangeably to refer to a lentiviral vector pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein, unless otherwise stated.

[0047] As used herein, the terms "titer" and "yield" are used interchangeably to mean the amount of lentiviral (e.g., SIV) vectors produced by the methods of the present invention. Titer is the main criterion that characterizes production efficiency, and a higher titer generally indicates that more lentiviral (e.g., SIV) vectors are produced (e.g., using the same amount of reagents). Titer or yield may refer to the number of vector genomes integrated into the genome of target cells (integration titer), which is a measure of "active" viral particles, i.e., the number of particles that can transduce cells. Transduction units (TU / mL, also referred to as TTU / mL) are a biological readout for the number of host cells transduced under certain tissue culture / virus dilution conditions, and are a measure for the number of "active" viral particles. The number of "active" viral particles is quantified in terms of the number of infectious units (IU) per unit volume, such as IU / mL. The total number of viral particles (active viral particles + inactive viral particles) is also determined by any suitable means, such as by measuring how many Gag molecules are present in the test solution or how many copies of viral RNA are present in the test solution.Then, the assumption is made that the lentiviral particle contains 2000 Gag molecules or 2 viral RNA molecules.Once the total particle number and transduction titer / TU are measured, the particle:infectivity ratio is calculated.In this specification, amino acids are referred to using the amino acid name, three-letter abbreviation, or one-letter abbreviation.

[0048] As used herein, the terms "protein" and "polypeptide" are used interchangeably herein to refer to a series of amino acid residues joined to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein" and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated amino acids, glycated amino acids, glycosylated amino acids, etc.) and amino acid analogs, regardless of their size or function. Although "protein" and "polypeptide" are often used in reference to relatively large polypeptides, while the term "peptide" is often used in reference to small polypeptides, the use of these terms overlaps in the art. As used herein, the terms "protein" and "polypeptide" are used interchangeably when referring to gene products and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants, fragments, and analogs of the foregoing.

[0049] As used herein, the terms "polynucleotide", "nucleic acid" and "nucleic acid sequence" refer to any molecule, preferably a polymeric molecule, that incorporates units of ribonucleic acid, deoxyribonucleic acid, or analogs thereof. A nucleic acid may be single-stranded or double-stranded. A single-stranded nucleic acid may be one of the nucleic acid strands of a denatured double-stranded DNA. Alternatively, a nucleic acid may be a single-stranded nucleic acid that is not derived from double-stranded DNA. In one embodiment, a nucleic acid may be DNA. In another embodiment, a nucleic acid may be RNA. A suitable nucleic acid molecule is DNA, including genomic DNA or cDNA. Other suitable nucleic acid molecules are RNA, including siRNA, shRNA, and antisense oligonucleotides. The terms "transgene" and "gene" are also used interchangeably, and both terms encompass fragments or variants thereof that code for a target protein.

[0050] Transgenes of the present invention include nucleic acid sequences that have been removed from their naturally occurring environment, recombinantly or cloned, DNA isolates, chemically synthesized analogs, or biosynthesized analogs in heterologous systems.

[0051] Minor variations within the amino acid sequences of the present invention are contemplated as variations encompassed by the present invention, provided that the variations within the amino acid sequence(s) maintain at least 60%, at least 70%, more preferably at least 80%, at least 85%, at least 90%, at least 95% sequence identity, and most preferably at least 97% or at least 99% sequence identity, to the amino acid sequences of the present invention or fragments thereof as defined anywhere herein. As used herein, the term "homology" is used to mean "identity". Thus, mutant or analog sequences of the amino acid sequences of the present invention may differ based on substitutions (typically conservative substitutions), deletions, or insertions. As used herein, proteins containing such variations are referred to as "variants".

[0052] The proteins of the invention may include variants in which amino acid residues from one species are substituted with the corresponding residues in another species, either at conserved or non-conserved positions. Variants of the protein molecules disclosed herein may be made and used in the present invention. Following the precedent of computational chemistry in the application of multivariate data analysis techniques to structure / property-activity relationships [see, e.g., Wold et al., "Multivariate data analysis in chemistry. Chemometrics-Mathematics and Statistics in Chemistry," ed. B. Kowalski; D. Reidel Publishing Company, Dordrecht, Holland, 1984 (ISBN 90-277-1846-6)], quantitative activity-property relationships of proteins can be analyzed using well-known mathematical techniques, such as statistical regression, pattern recognition and pattern classification [see, e.g., Norman et al., "Applied Regression Analysis," Wiley-Interscience; 3rd Edition (April 1998) ISBN: 0471170828; Kandel, Abraham et al., "Computer-Assisted Reasoning in Cluster Analysis," Prentice Hall, 1999]. PTR (May 11, 1995), ISBN: 0133418847;Krzanowski, Wojtek, "Principles of Multivariate Analysis: A User's Perspective" (Oxford Statistical Science Series, Issue 22 (Paper)), Oxford University Press; (December 2000), ISBN: 0198507089;Witten, Ian H. et al., "Data Mining: Practical Machine Learning Tools and Techniques with Java Implementations", Morgan Kaufmann; (October 11, 1999), ISBN: 1558605525;Denison David GT(Eds.), "Bayesian Methods for Nonlinear Classification and Regression" (Wiley Series in Probability and Statistics), John Wiley & Sons; (July 2002), ISBN: 0471490369; see Ghose, Arup K. et al., "Combinatorial Library Design and Evaluation Principles, Software, Tools, and Applications in Drug Discovery", ISBN: 0-8247-0487-8]. Protein properties are derived from empirical / theoretical models of protein sequence, functional structure, and three-dimensional structure (e.g., analysis of likely contact residues or calculation of physicochemical properties), and these properties are considered individually and in combination.

[0053] As used herein, amino acids are referred to using the amino acid name, three-letter abbreviations, or single-letter abbreviations. As used herein, the term "protein" includes proteins, polypeptides, and peptides. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". As used herein, the terms "protein" and "polypeptide" are used interchangeably. In the present disclosure and claims, conventional single-letter and three-letter codes for amino acid residues are used. The three-letter codes for amino acids are defined in accordance with the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that due to the degeneracy of the genetic code, a polypeptide is coded for by more than one nucleotide sequence.

[0054] Amino acid residues at non-conserved positions may be replaced by conserved or non-conserved residues, in particular conservative amino acid replacements are contemplated.

[0055] "Conservative amino acid substitution" refers to an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. In the art, a family of amino acid residues having similar side chains is defined, which includes basic side chains (e.g., lysine, arginine, or histidine), acidic side chains (e.g., aspartic acid or glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, or cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, or histidine). Thus, when an amino acid in a polypeptide is replaced with another amino acid from the same side chain family, the amino acid substitution is considered to be conservative. The incorporation of conservatively modified variants into the proteins of the present invention does not exclude other forms of variants, such as polymorphic variants, interspecies homologs, and alleles.

[0056] "Non-conservative amino acid substitutions" include (i) substitutions in which a residue having an electropositive side chain (e.g., Arg, His, or Lys) is replaced with or by an electronegative residue (e.g., Glu or Asp); (ii) substitutions in which a hydrophilic residue (e.g., Ser or Thr) is replaced with or by a hydrophobic residue (e.g., Ala, Leu, Ile, Phe, or Val); (iii) substitutions in which a cysteine ​​or proline is replaced with or by any other residue; or (iv) substitutions in which a residue having a bulky hydrophobic or aromatic side chain (e.g., Val, His, Ile, or Trp) is replaced with or by a residue having a small side chain (e.g., Ala or Ser) or no side chain (e.g., Gly).

[0057] An "insertion" or "deletion" is typically in the range of about 1, 2, or 3 amino acids. Permitted mutations are determined experimentally by using recombinant DNA methods to systematically introduce amino acid insertions or deletions into a protein and assaying the resulting recombinant mutants for activity. This does not require undue experimentation on the part of one of ordinary skill in the art.

[0058] A "fragment" of a polypeptide comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97% or more of the original polypeptide.

[0059] The polynucleotide of the present invention is produced by any means known in the art.For example, large amounts of polynucleotides are produced by replication in suitable host cells.The natural or synthetic DNA fragments encoding desired fragments are incorporated into recombinant nucleic acid constructs, typically DNA constructs, which can be introduced into and replicated in prokaryotic or eukaryotic cells.Generally, DNA constructs will be suitable for self-replication in unicellular hosts such as yeast or bacteria, but are also intended for introduction and integration into the genome of cultured insect cell systems, mammalian cell systems, plant cell systems, or other eukaryotic cell systems.

[0060] The polynucleotide of the present invention can also be produced by chemical synthesis, for example, the phosphoramidite method or the triester method, and the production is carried out on a commercially available automated oligonucleotide synthesizer. Double-stranded fragments can be obtained from the single-stranded product of chemical synthesis by synthesizing a complementary strand and annealing the strands together under appropriate conditions, or can be obtained from the single-stranded product of chemical synthesis by adding a complementary strand using DNA polymerase with an appropriate primer sequence.

[0061] The term "isolated" in the context of the present invention, when applied to a nucleic acid sequence, indicates that the polynucleotide sequence has been removed from its natural genetic environment and is thus free of other exogenous or undesired coding sequences (but may include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators), and is in a form suitable for use in engineered protein production systems. Such isolated molecules are molecules that have been separated from their natural environment.

[0062] Given the degeneracy of the genetic code, considerable sequence variation is possible among the polynucleotides of the present invention. Degenerate codons, including all possible codons for a given amino acid, are set forth below:

[0063] [Table 1]

[0064] One of skill in the art will understand that there is flexibility in determining degenerate codons that represent all possible codons encoding each amino acid, for example, some polynucleotides encompassed by a degenerate sequence may encode variant amino acid sequences, and one of skill in the art can readily identify such variant sequences by reference to the amino acid sequences of the present invention.

[0065] A "variant" nucleic acid sequence has substantial homology or substantial similarity to a reference nucleic acid sequence (or a fragment thereof). A nucleic acid sequence or a fragment thereof is "substantially homologous" (or "substantially identical") to a reference sequence if, when optimally aligned with another nucleic acid (or its complementary strand) (with appropriate nucleotide insertions or deletions), there is nucleotide sequence identity in at least about 70%, 75%, 80%, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more of the nucleotide bases. Methods for determining the homology of nucleic acid sequences are known in the art.

[0066] Alternatively, a "variant" nucleic acid sequence is substantially homologous (or substantially identical) to a reference sequence (or a fragment thereof) if the "variant" sequence and the reference sequence are capable of hybridizing under stringent (e.g., highly stringent) hybridization conditions. Hybridization of nucleic acid sequences will be influenced by conditions such as salt concentration (e.g., NaCl), temperature, or organic solvents, in addition to base composition, length of complementary strands, and number of nucleotide base mismatches between hybridizing nucleic acids, as will be readily understood by those skilled in the art. Preferably, stringent temperature conditions are utilized, including temperatures generally greater than 30°C, typically greater than 37°C, and preferably greater than 45°C. Stringent salt conditions will usually be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. pH is typically between 7.0 and 8.3. A combination of parameters is more important than any single parameter.

[0067] The method of determining nucleic acid sequence identity percentage is known in the art.For example, when evaluating nucleic acid sequence identity, a sequence having a specified number of consecutive nucleotides is aligned with the nucleic acid sequence (having the same number of consecutive nucleotides) derived from the corresponding part of the nucleic acid sequence of the present invention.The tool known in the art for determining nucleic acid sequence identity percentage includes nucleotide BLAST (described below).

[0068] Those skilled in the art will appreciate that different species exhibit "preferential codon usage". As used herein, the term "preferential codon usage" refers to a codon that is most frequently used in a particular species of cell, and thus prefers one or a few codons that represent the possible codons that code for each amino acid. For example, the amino acid threonine (Thr) is encoded by ACA, ACC, ACG, or ACT, but in mammalian host cells, ACC is the most commonly used codon; in other species, different codons may be preferred. Preferred codons for a particular host cell species are introduced into the polynucleotides of the invention by various methods known in the art. The introduction of preferred codon sequences into recombinant DNA enhances protein production, for example, by making protein translation more efficient in a particular cell type or species. Thus, in accordance with the present invention, any nucleic acid sequence, in addition to the gag-pol gene, is codon-optimized for expression in a host cell or target cell. In particular, the vector genome (or corresponding plasmid), the REV gene (or corresponding plasmid), the fusion protein (F) gene (or corresponding plasmid), and / or the hemagglutinin-neuraminidase (HN) gene (or corresponding plasmid), or any combination thereof, are codon optimized.

[0069] A "fragment" of a polynucleotide of interest comprises a contiguous stretch of nucleotides from said full-length polynucleotide sequence. By way of example, a "fragment" of a polynucleotide of interest may comprise (or consist of) at least 30 contiguous nucleotides from said polynucleotide sequence (e.g., at least 35, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 contiguous nucleic acid residues of said polynucleotide). A fragment may comprise at least one antigenic determinant and / or may encode at least one antigenic epitope of the corresponding polypeptide of interest. Typically, a fragment as defined herein retains the same function as the full-length polynucleotide.

[0070] As used herein, the terms "reduce", "reduced", "reduction", or "inhibit" are all used to mean a statistically significant reduction. The terms "reduce", "reduction", or "reduce" or "inhibit" typically mean a reduction of at least 10% compared to a reference level (e.g., in the absence of a given treatment), and can include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or more. As used herein, "reduce" or "inhibit" encompasses complete inhibition or reduction compared to a reference level. "Complete inhibition" is 100% inhibition (ie, abolition) compared to the reference level.

[0071] As used herein, the terms "increased," "increases," "enhances," or "activates" are all used to mean an increase by a statistically significant amount. The terms "increased," "increases," "enhances," or "activates" can mean an increase of at least 25%, at least 50% compared to a reference level, for example, an increase of at least about 50%, or at least about 75%, or at least about 80%, or at least about 90%, or at least about 100%, or at least about 150%, or at least about 200%, or at least about 250% or more compared to a reference level, or an increase of at least about 1.5-fold, or at least about 2-fold, or at least about 2.5-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase between 1.5-fold and 10-fold or more compared to a reference level. In the context of yield or titer, "increases" is an observable or statistically significant increase in such level.

[0072] As used herein, the terms "signal peptide", "signal sequence", "targeting sequence", "leader sequence" and "secretory signal" are used interchangeably to mean a heterologous peptide sequence found at the N-terminus of a secretory protein that is useful in triggering the secretion process. In particular, signal peptides are found in proteins that are directed to be targeted to the endoplasmic reticulum and ultimately secreted or retained in the plasma membrane of a cell, in particular as single-pass transmembrane proteins. The signal peptide is typically removed to produce the mature form of the protein. Signal peptides are usually short peptides that are typically about 5 to about 35, or about 10 to about 35 amino acids in length, preferably about 5 to about 40 amino acids in length, such as about 10 to about 30 or about 15 to about 30 amino acids in length. Signal peptides can include a core of hydrophobic amino acids, which is typically about 4 to about 20 amino acids in length, such as about 5 to about 20, about 5 to about 16 or about 5 to about 15 amino acids in length. If present, the signal peptide is typically at the N-terminus of the protein.

[0073] As used herein, the terms "individual," "subject," and "patient" are used interchangeably to refer to a mammalian subject for whom diagnosis, prognosis, disease monitoring, treatment, therapy, and / or therapy optimization is desired. The mammal may be (including without limitation) a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In a preferred embodiment, the individual, subject, or patient is human. An "individual" may be an adult, juvenile, or infant. An "individual" may be male or female.

[0074] A "subject in need" of treatment for a particular condition can be an individual who has the condition, has been diagnosed as having the condition, or is at risk of developing the condition.

[0075] The subject may be a subject who has already been diagnosed with, or who has been identified as suffering from, a condition requiring treatment, or one or more complications or symptoms associated with such a condition, and may have already been treated for a condition as defined herein, or one or more complications or symptoms associated with said condition. Alternatively, the subject may also be a subject who has not yet been diagnosed with a condition as defined herein, or one or more symptoms or complications associated with said condition. For example, the subject may be a subject who exhibits one or more risk factors for a condition, or one or more symptoms or complications associated with said condition, or a subject who does not exhibit risk factors.

[0076] As used herein, the term "healthy individual" refers to an individual or group of individuals in a healthy state, e.g., individuals who do not show symptoms of disease, have not been diagnosed with a disease, and / or are not likely to develop a disease, e.g., cystic fibrosis (CF), or any other disease described herein. Preferably, the healthy individual(s) are not taking medication that affects CF and have not been diagnosed with other diseases. One or more healthy individuals may have similar gender, age, and / or body mass index (BMI) compared to the test individual. Application of standard statistical methods used in medicine allows the determination of normal expression levels in healthy individuals, and significant deviations from such normal levels.

[0077] As used herein, the terms "control" and "reference population" are used interchangeably.

[0078] As used herein, the term "pharmaceutical acceptable" means approved by a regulatory agency of the Federal or State government or listed in the United States Pharmacopoeia, the European Pharmacopoeia, or other generally recognized pharmacopoeias.

[0079] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that such publications constitute prior art to the claims appended hereto.

[0080] Disclosure relating to the various methods of the present invention is intended to apply equally to other methods, therapeutic uses or treatments, data storage media, or devices, computer program products, and vice versa.

[0081] Lentiviral Vectors The present invention relates to lentiviral (e.g., SIV) vectors pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein. The term "lentivirus" refers to a genus of RNA viruses in the Retroviridae family that encode the enzyme reverse transcriptase.

[0082] Examples of lentiviruses suitable for use in the present invention include simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), and visna / maedi virus. Particularly preferred lentivirus vectors are HIV vectors (including all strains and subtypes), such as SIV-AGM (originally isolated from African green monkeys, Cercopithecus aethiops), or SIV vectors (including all strains and subtypes).

[0083] The lentiviral (e.g., HIV / SIV) vectors of the invention are pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein, as described herein. Thus, the pseudotyped lentiviral vectors of the invention may be referred to interchangeably as S-LV vectors.

[0084] The lentiviral (e.g., HIV / SIV) vectors of the invention include a transgene operably linked to a promoter. The transgene may encode a therapeutic protein, as described herein. In embodiments where the therapeutic protein is a secreted protein, the therapeutic protein may include or be associated with a signal peptide. The transgene may include a nucleic acid sequence encoding a signal peptide (such as an endogenous signal peptide of a secreted protein) or may exclude a nucleic acid sequence encoding a signal peptide. The therapeutic protein may include a signal peptide (such as an endogenous signal peptide of a secreted protein) or may exclude a signal peptide. Where appropriate, endogenous signal peptides are identified in the sequence information section herein. All disclosures herein relate to both transgenes and therapeutic proteins that include a signal peptide and transgenes and therapeutic proteins that exclude a signal peptide, unless expressly stated otherwise. By way of non-limiting example, the sequence identity of variants and / or length of fragments may be based on sequences with or without a signal peptide. Suitable signal peptides are known in the art and are routinely selected by those skilled in the art. Non-limiting examples of suitable signal peptides are described in British Patent Application No. 2105277.4, which is incorporated herein by reference in its entirety.

[0085] The lentiviral (e.g., HIV / SIV) vectors of the present invention may not have an intron located between the promoter and the nucleic acid encoding the signal peptide and / or the nucleic acid encoding the therapeutic protein. Similarly, there may be no introns present between the promoter and the nucleic acid encoding the signal peptide and / or the nucleic acid encoding the therapeutic protein in the vector genome plasmid.

[0086] The lentiviral (e.g., HIV / SIV) vector according to the present invention can be an integrase-competent (IC) vector. Alternatively, the lentiviral (e.g., HIV / SIV) vector can be an integrase-deficient (ID) vector.

[0087] Retroviral / lentiviral (e.g., SIV) vectors of the invention can include a cPPT (central polypurine tract), and / or a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE). An exemplary WPRE sequence is provided by SEQ ID NO:46.

[0088] Lentiviral vectors, such as lentiviral vectors according to the present invention, are integrated into the genome of transduced cells, resulting in long-term persistent expression, and are therefore suitable for transducing stem / progenitor cells.In the lung, several cell types have been identified that contribute to maintaining specific cell lineages in the conducting airways and alveoli with regenerative capacity.These include basal cells and submucosal gland duct cells in the upper airways, club cells and neuroendocrine cells in the bronchial airways, bronchoalveolar stem cells in terminal bronchioles, and type II alveolar epithelial cells in the alveoli. Thus, and without being bound by theory, it is believed that the lentiviral (e.g., HIV / SIV) vectors induce long-term gene expression of a transgene of interest by introducing the transgene into one or more long-lived airway epithelial cells or cell types, such as basal cells and submucosal gland duct cells in the upper respiratory tract, club cells and neuroendocrine cells in the bronchial airways, bronchoalveolar stem cells in the terminal bronchioles, and type II alveolar epithelial cells in the alveoli.

[0089] Thus, lentiviral (e.g., HIV / SIV) vectors made according to the present invention may transduce one or more cells or cell lines with regenerative potential in the lungs (including airways and respiratory tract) to achieve long-term gene expression. For example, lentiviral (e.g., HIV / SIV) vectors may transduce basal cells, such as basal cells in the upper airways / respiratory tract. Basal cells have a central role in the process of epithelial maintenance and repair after injury. In addition, basal cells are widely distributed along the human respiratory epithelium, with a relative distribution ranging from 30% (large airways) to 6% (small airways).

[0090] Lentiviral (e.g., HIV / SIV) vectors according to the invention are used to transduce stem / progenitor cells that have been isolated and expanded ex vivo prior to administration to a patient. Preferably, lentiviral (e.g., HIV / SIV) vectors made according to the invention are used to transduce cells in the lungs (or airways / respiratory tract) in vivo.

[0091] The lentiviral (e.g., HIV / SIV) vectors of the present invention exhibit remarkable resistance to shear forces when passed through clinically relevant delivery devices such as bronchoscopes, spray bottles, and nebulizers, with only minor reduction in transduction capacity.

[0092] The modified SARS-CoV-2 spike protein with which the lentiviral (e.g., HIV / SIV) vectors of the invention are pseudotyped is the rodent / mouse-adapted modified SARS-CoV-2 spike protein described herein. Thus, the modified SARS-CoV-2 spike protein with which the lentiviral (e.g., HIV / SIV) vectors of the invention are pseudotyped allows the vector to transduce rodent cells in vitro, ex vivo, and in vivo. In particular, the modified SARS-CoV-2 spike protein with which the lentiviral (e.g., HIV / SIV) vectors of the invention are pseudotyped allows the vector to transduce mouse cells in vitro, ex vivo, and in vivo. This makes the lentiviral vectors of the invention particularly useful for research studies, including preclinical research studies, and the lentiviral vectors of the invention are used with rodent (particularly mouse) cell lines and animal models. In contrast, the wild-type SARS-CoV-2 spike protein is not capable of facilitating entry into rodent cells, and therefore the pseudotyped lentiviral vectors of the present invention are capable of transducing rodent cells, particularly mouse cells, in vitro, ex vivo, and in vivo.

[0093] In addition, and as described herein, the modified SARS-CoV-2 spike protein with which the lentiviral (e.g., HIV / SIV) vectors of the present invention are pseudotyped is typically capable of binding to human ACE. Thus, the modified SARS-CoV-2 spike protein with which the lentiviral (e.g., HIV / SIV) vectors of the present invention are pseudotyped allows the vectors to transduce human cells in vitro, ex vivo, and in vivo. The ability to transduce both rodent / mouse cells and human cells is advantageous, as it allows the vectors of the present invention to be used in both research studies, including preclinical research studies, and clinical research studies and clinical applications.

[0094] Typically, the lentiviral (e.g., HIV / SIV) vector of the present invention comprises a transgene that is expressed in a host cell. The transgene may code for any protein of interest, such as a therapeutic protein or a reporter protein. Typically, the transgene is operably linked to a promoter as described herein.

[0095] The lentiviral (e.g., HIV / SIV) vectors of the present invention allow high levels of transgene expression, resulting in high levels (therapeutic levels) of expression of therapeutic proteins. The lentiviral (e.g., HIV / SIV) vectors of the present invention typically result in high expression levels of transgenes when administered to a patient. In this specification, the terms "high expression" and "therapeutic expression" are used interchangeably. Expression is measured by any suitable method (qualitative or quantitative, preferably quantitative), and concentration is given in any suitable measurement unit, for example, in ng / ml or nM.

[0096] The expression of the transgene of interest is given relative to the expression of the corresponding endogenous (deficient) gene in the patient. The expression may be measured in terms of mRNA expression or in terms of protein expression. The expression of the transgene of the present invention is quantified relative to endogenous gene. For non-limiting purposes, when the transgene contained in the lentiviral vector of the present invention is a functional CFTR gene, the expression of the transgene can be the expression relative to endogenous (dysfunctional) CFTR gene in terms of mRNA copy number per cell or any other suitable unit.

[0097] When administered to a subject, the in vivo expression levels of the transgenes of the invention and / or the encoded (therapeutic) proteins are measured in lung tissue, epithelial lining fluid, and / or serum / plasma, as applicable. Thus, high and / or therapeutic expression levels may refer to concentrations in the lung, epithelial lining fluid, and / or serum / plasma.

[0098] When used in vitro or ex vivo, the expression levels of the transgenes of the invention and / or the encoded (therapeutic) proteins may be measured in conditioned culture medium or may be measured intracellularly (e.g., in a cell lysate).

[0099] The transgene contained in the vector of the present invention is modified to facilitate expression.For example, the sequence of the transgene may be in CpG-depleted (or CpG-free) form and / or in codon-optimized form to facilitate gene expression.In this way, standard techniques for modifying the sequence of the transgene are known in the art.

[0100] The lentiviral (e.g., HIV / SIV) vectors of the present invention exhibit efficient uptake into airway cells, enhanced transgene expression, and do not suffer from loss of efficacy upon repeated administration. Thus, the lentiviral (e.g., HIV / SIV) vectors of the present invention are capable of providing long-lasting, repeatable, high-level expression in airway cells without inducing unwanted immune responses.

[0101] The lentiviral (e.g., HIV / SIV) vectors of the present invention allow long-term transgene expression resulting in long-term expression of therapeutic proteins. As described herein, the terms "long-term expression", "sustained expression", "long-term sustained expression" and "sustained expression" are used interchangeably. Long-term expression according to the present invention means expression of (therapeutic) genes and / or proteins, preferably at therapeutic levels, for at least 45 days, at least 60 days, at least 90 days, at least 120 days, at least 180 days, at least 250 days, at least 360 days, at least 450 days, at least 730 days or more. Preferably, long-term expression means expression for at least 90 days, at least 120 days, at least 180 days, at least 250 days, at least 360 days, at least 450 days, at least 720 days or more, more preferably at least 360 days, at least 450 days, at least 720 days or more. This long-term expression may be achieved by repeated administration or by a single administration.

[0102] Repeated doses are administered twice daily, daily, twice weekly, weekly, monthly, every two months, every three months, every four months, every six months, annually, every two years or more. Administration continues for as long as required, for example, at least six months, at least one year, two years, three years, four years, five years, ten years, fifteen years, twenty years or more, up to the life of the patient being treated (for in vivo applications) or over the time course of the experiment (for in vitro or ex vivo applications).

[0103] Lentiviral (e.g., HIV / SIV) vectors typically include a promoter operably linked to the transgene, allowing expression of the transgene. The promoter may be a hybrid human CMV enhancer / EF1a (hCEF) promoter. The hCEF promoter may lack an intron corresponding to nucleotides 570-709 and an exon corresponding to nucleotides 728-733 of the hCEF promoter. A preferred example of an hCEF promoter sequence of the present invention is provided by SEQ ID NO: 43. The promoter may be a CMV promoter. An example of a CMV promoter sequence is provided by SEQ ID NO: 44. The promoter may be a human elongation factor 1a (EF1a) promoter. An example of an EF1a promoter is provided by SEQ ID NO: 45. Other promoters for transgene expression are known in the art, and their suitability for the lentiviral (e.g., HIV / SIV) vectors of the present invention is determined using routine techniques known in the art. Non-limiting examples of other promoters include UbC and UCOE. As described herein, promoters are modified to further regulate expression of the transgenes of the present invention.

[0104] The promoters contained within the lentiviral (e.g., HIV / SIV) vectors of the invention are specifically selected and / or modified to further refine the regulation of the expression of the therapeutic gene. Again, suitable promoters and standard techniques for their modification are known in the art. By way of non-limiting example, a number of suitable (CpG-free) promoters suitable for use in the present invention are described in Pringle et al. (J. Mol. Med. Berl., 2012, 90(12):1487-96), which is incorporated herein by reference in its entirety. Preferably, the lentiviral vectors of the invention (especially SIV vectors) comprise an hCEF promoter that has a low CpG dinucleotide content or does not contain any CpG dinucleotides. The hCEF promoter may have all CG dinucleotides replaced by any one of AG, TG, or GT. Thus, the hCEF promoter may be CpG-free. A preferred example of a CpG-free hCEF promoter sequence of the invention is provided by SEQ ID NO: 43. The absence of CpG dinucleotides further improves the performance of the lentiviral (e.g., HIV / SIV) vectors of the invention, particularly in situations where it is not desirable to induce an immune response to the expressed antigen or an inflammatory response to the delivered expression construct. The absence of CpG dinucleotides reduces the occurrence of flu-like symptoms and inflammation that can result from administration of the construct, particularly when administered to the respiratory tract.

[0105] The lentiviral (e.g., HIV / SIV) vector of the present invention is modified to allow gene expression to be silenced. Standard techniques are known in the art for modifying vectors in this manner. As a non-limiting example, Tet-responsive promoters are commonly used.

[0106] Preferably, the present invention relates to lentiviral vectors, particularly HIV / SIV vectors, that contain a promoter and a transgene. Pseudotyping with modified SARS-CoV-2 spike protein according to the present invention is particularly efficient in targeting cells in the airway epithelium, and as such, for therapeutic applications, typically delivered to cells of the respiratory tract, including cells of the airway epithelium. Thus, the lentiviral (e.g., HIV / SIV) vectors of the present invention are particularly suitable for treating airway, respiratory, or pulmonary diseases or disorders. Typically, lentiviral (e.g., HIV / SIV) vectors are used for the treatment of inherited respiratory diseases.

[0107] The lentiviral (e.g., HIV / SIV) vectors of the invention can contain a transgene encoding a polypeptide or protein that is therapeutic for the treatment of such diseases, particularly airway, respiratory, or pulmonary diseases or disorders.

[0108] The present invention also provides a method for expressing a transgene in a target cell, comprising delivering to the target cell a pharmaceutical composition or vector as defined herein, said delivering step may comprise integrating a lentiviral (e.g. SIV) vector of the pharmaceutical composition into the genome of the target cell.

[0109] SARS-CoV-2 spike protein The SARS-CoV-2 spike protein (also interchangeably referred to herein and in the art as SARS-CoV-2 S protein) is a class I fusion transmembrane structural glycoprotein composed of an S1 subunit and an S2 subunit. The structure of the SARS-CoV-2 spike protein has been the subject of intensive research since the emergence of the SARS-CoV-2 virus and the COVID-19 pandemic. For this reason, details of its structure and function are well known in the art, as described, for example, in Almehdi et al. (Infection, 2021, doi:10.1007 / s15010-021-01677-8, incorporated herein by reference in its entirety). Briefly, the SARS-CoV-2 spike protein is a homotrimer with a size of 180-200 kDa and a total length of between 1273 and 1300 amino acids.

[0110] The SARS-CoV-2 spike contains a signal peptide (amino acid residues 1-13) and two functional subunits, the S1 subunit and the S2 subunit. The S1 subunit contains an N-terminal domain (NTD) and a receptor binding domain (RBD). The S2 subunit contains a fusion peptide (FP), heptad repeat 1 (HR1), central helix (CH), connector domain (CD), heptad repeat 2 (HR2), transmembrane domain (TM), and a cytoplasmic tail (CT). The function of the S1 subunit is to bind to a receptor (ACE2) on the target cell. The S2 subunit functions to fuse the viral membrane with the target cell membrane, thereby facilitating the entry of the SARS-CoV-2 viral particle into the target cell. At the interface between the S1 and S2 subunits, there is a cleavage site called the S1 / S2 protease cleavage site. For all coronaviruses, a protease within the target cell cleaves the spike protein at the S2' cleavage site, activating, through an irreversible conformational change, a protein that is crucial for fusing the viral membrane with that of the target cell.

[0111] The SARS-CoV-2 spike protein protrudes from the surface of the SARS-CoV-2 virus, where it is able to recognize and bind to the human angiotensin-converting enzyme 2 (ACE2) receptor on the surface of target cells. ACE2 is found in specific cell types within most organs. For example, ACE2 is abundant in type II alveolar epithelial (ATII) cells in the lungs, enterocytes in the small intestine, arterial / venous endothelial cells, glial cells in the brain, and cortical neurons. It is reasonably hypothesized that SARS-CoV-2 pseudotyped lentiviral vectors will efficiently target such cells.

[0112] SARS-CoV-2 entry into cells relies on the binding of the viral spike protein to ACE2, an interaction synergized by cleavage of the spike protein by TMPRSS2 (Transmembrane protease Serine 2). The sequence for human TMPRSS2 has been deposited under UniProt accession number: O15393 (sequence version 3, accessed October 1, 2021).

[0113] However, all currently identified natural variant spike proteins found in the wild bind to human ACE2 but not to the rodent homologue. In particular, currently identified natural variants of SARS-CoV-2 do not bind to mouse ACE2. This represents a technical obstacle when investigating SARS-CoV-2 and potential treatments and vaccines against COVID-19, since the use of standard research tools such as rodent cell lines and rodent models is not possible. Rather, it is necessary to carry out research using only human cells / tissues (which increases the cost and limits the scope of preclinical trials) or even develop rodent-adapted SARS-CoV-2 spike proteins (which also increases the cost and complexity of research studies).

[0114] To this end, some research has been conducted towards the creation of mouse-adapted SARS-CoV-2 spike proteins. However, to date, the primary focus of this work has been to generate SARS-CoV-2 viral mutants for use in research studies on SARS-Co-V2, as well as treatments and vaccines for COVID-19. To date, despite all the ongoing research studies related to SARS-CoV-2 worldwide, there have been no attempts to utilize mouse-adapted SARS-CoV-2 spike proteins to pseudotype viral vectors for research / therapeutic purposes beyond COVID-19.

[0115] The present inventors are the first to develop lentiviral vectors pseudotyped with modified mouse-adapted SARS-CoV-2 spike proteins. Accordingly, the present invention provides modified SARS-CoV-2 spike proteins as described herein, as well as lentiviral (e.g., HIV / SIV) vectors pseudotyped with said modified SARS-CoV-2 spike proteins.

[0116] The modified SARS-CoV-2 spike proteins of the invention can be derived from any SARS-CoV-2 spike protein. By "derived from," it is meant that the modified SARS-CoV-2 spike protein of the invention can include one or more modifications, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modifications, compared to the SARS-CoV-2 spike protein from which it is derived.

[0117] The modified SARS-CoV-2 spike proteins of the invention can be derived from the spike protein or mutants of any SARS-CoV-2 strain. For example, the modified SARS-CoV-2 spike proteins of the invention can be derived from the spike protein or mutants of any SARS-CoV-2 strain, including Wuhan-Hu-1, B.1.1.529 (omicron mutant), B.1.351 (beta mutant), P.1 (gamma mutant), B.1.617.2 (delta mutant), B.1.621 (mu mutant), C.37 (lambda mutant), B.1.620, B.1.1.7 (alpha mutant), B.1.427 or B.1.429 (epsilon mutant), B.1.525 (eta mutant), B.1.526 (iota mutant), B.1.617 (kappa mutant), B.1.627 (alpha ... The spike protein of the Wuhan-Hu-1 strain of SARS-CoV-2 may be derived from any one of the SARS-CoV-2 spike proteins having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or more sequence identity to any one of the SARS-CoV-2 spike proteins of the Wuhan-Hu-1 strain of SARS-CoV-2 (Wuhan-Hu-1 strain), G614, Australia / VIC01 / 2020 (Aus / VIC01), B.1.1.529 (Omicron variant), or any substrain / sublineage thereof. The spike protein of the Wuhan-Hu-1 strain of SARS-CoV-2 is SEQ ID NO: 1 herein. By way of non-limiting example, the modified SARS-CoV-2 spike proteins of the invention can be derived from spike proteins having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or more sequence identity to SEQ ID NO:1.

[0118] The modified SARS-CoV-2 spike proteins of the invention typically contain modifications at one or more amino acid positions that correspond to or align with one or more specific amino acid positions of SEQ ID NO: 1. If the modified SARS-CoV-2 spike protein is derived from a SARS-CoV-2 spike protein other than the SARS-CoV-2 spike protein of SEQ ID NO: 1, one of skill in the art would be readily able to determine the corresponding amino acid positions within the SARS-CoV-2 spike protein from which the modified SARS-CoV-2 spike protein of the invention is derived. By way of non-limiting example, the SARS-CoV-2 spike protein from which the modified SARS-CoV-2 spike protein of the invention is derived is readily aligned with the SARS-CoV-2 spike protein of SEQ ID NO: 1 using available alignment tools (such as the BLAST tools described herein). A modified SARS-CoV-2 spike protein of the invention is then derived and amino acid residues within the SARS-CoV-2 spike protein that align with / correspond to the residues identified within SEQ ID NO:1 (e.g., residues 498, 499, 614 of SEQ ID NO:1) are readily identified using the alignment.

[0119] Amino acid modifications according to the invention may be mutations such as substitutions, deletions, additions, or other modifications, including post-translational modifications, unless the relevant disclosure expressly states otherwise. Preferably, said modifications are amino acid substitutions. In other words, an amino acid at a specified position in a SARS-CoV-2 spike protein is replaced with a naturally occurring or non-naturally occurring amino acid different from the amino acid present at this position in the SARS-CoV-2 spike protein from which the modified SARS-CoV-2 spike protein of the invention is derived. Alternatively, an amino acid at a specified position in a modified SARS-CoV-2 spike protein of the invention is modified post-translationally. Post-translational modifications include glycosylation, acetylation, acylation, deamination, phosphorylation, isoprenylation, glycosylphosphatidylinositolylation, and further modifications known to those skilled in the art.

[0120] Modification of one or more amino acid positions described herein is carried out, for example, by directed mutagenesis or any other method known in the art.

[0121] When one or more amino acid positions are substituted compared to the corresponding SARS-CoV-2 spike protein from which the modified SARS-CoV-2 spike protein of the invention is derived, the substitution may be a conservative or non-conservative substitution, preferably a non-conservative substitution.

[0122] The modified SARS-CoV-2 spike proteins of the invention typically include a modification at each amino acid position that corresponds to or aligns with amino acid positions 498, 499, and 614 of SEQ ID NO:1. Typically, the modification at one or more of the amino acid positions that correspond to or align with amino acid positions 498, 499, and 614 of SEQ ID NO:1, or any combination thereof, is a mutation, preferably a substitution. In some particularly preferred embodiments, the modified SARS-CoV-2 spike proteins of the invention include a substitution at each amino acid position that corresponds to or aligns with amino acid positions 498, 499, and 614 of SEQ ID NO:1.

[0123] The amino acid residue corresponding to or aligning with amino acid position 498 of SEQ ID NO:1 is substituted with a tyrosine or a histidine residue.

[0124] The amino acid residue corresponding to or aligning with amino acid position 499 of SEQ ID NO:1 is substituted with a threonine residue.

[0125] The amino acid residue corresponding to or aligning with amino acid position 614 of SEQ ID NO:1 is substituted with a glycine residue.

[0126] Any combination of these substitutions may be included in the modified SARS-CoV-2 spike protein of the invention. For example, (i) the amino acid residue corresponding to or aligning with amino acid position 498 of SEQ ID NO:1 may be replaced by a tyrosine residue and the amino acid residue corresponding to or aligning with amino acid position 499 of SEQ ID NO:1 may be replaced by a threonine residue; (ii) the amino acid residue corresponding to or aligning with amino acid position 498 of SEQ ID NO:1 may be replaced by a tyrosine residue and the amino acid residue corresponding to or aligning with amino acid position 614 of SEQ ID NO:1 may be replaced by a glycine residue; (iii) the amino acid residue corresponding to or aligning with amino acid position 499 of SEQ ID NO:1 may be replaced by a threonine residue; may be substituted with a threonine residue and the amino acid residue corresponding to or aligning with amino acid position 614 of SEQ ID NO:1 is substituted with a glycine residue; or (iv) the amino acid residue corresponding to or aligning with amino acid position 498 of SEQ ID NO:1 may be substituted with a tyrosine residue and the amino acid residue corresponding to or aligning with amino acid position 499 of SEQ ID NO:1 may be substituted with a threonine residue and the amino acid residue corresponding to or aligning with amino acid position 614 of SEQ ID NO:1 is substituted with a glycine residue. Preferably, the modified SARS-CoV-2 spike protein of the invention comprises an amino acid substitution at each amino acid position corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 498 of SEQ ID NO:1 is replaced with a tyrosine residue, the amino acid residue corresponding to or aligning with amino acid position 499 of SEQ ID NO:1 is replaced with a threonine residue, and the amino acid residue corresponding to or aligning with amino acid position 614 of SEQ ID NO:1 is replaced with a glycine residue.

[0127] The modified SARS-CoV-2 spike protein of the invention may include one or more of the following mutations: (i) Q498Y; (ii) P499T; or (iii) D614G; or any combination thereof. The modified SARS-CoV-2 spike protein of the invention may include the mutations Q498Y and P499T, the mutations Q498Y and D614G, the mutations P499T and D614G, or the mutations Q498Y, P499T, and D614G.

[0128] The present invention also provides a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein comprising: (a) a mutation at an amino acid position corresponding to or aligning with position 614 of SEQ ID NO:1; (b) a deletion of at least a portion of the cytoplasmic tail; and (c) (i) a mutation at an amino acid position corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1; and / or (ii) a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1. For the avoidance of doubt, all disclosures herein relating to the modified SARS-CoV-2 spike protein of the present invention apply equally and without reservation to said modified SARS-CoV-2 spike protein. By way of non-limiting example, said modified SARS-CoV-2 spike protein may comprise one or more further mutations as described herein, and / or the deletion of at least a portion of the cytoplasmic tail may be a deletion as described herein.

[0129] The present inventors are the first to successfully create lentiviral vectors pseudotyped with mouse-adapted SARS-CoV-2 spike protein. Thus, the present invention provides lentiviral vectors comprising one or more mutations in the SARS-CoV-2 spike protein that allow cell entry via mouse ACE2. Thus, the present invention also provides modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike proteins comprising (a) a modification at each amino acid position corresponding to or aligning with amino acid positions 498 and 499 of SEQ ID NO:1; and (b) a deletion of at least a portion of the cytoplasmic tail. The modified SARS-CoV-2 spike protein may comprise one or more additional mutations as described herein. By way of non-limiting example, the modified SARS-CoV-2 spike protein may comprise one or more additional mutations as described herein, and / or the deletion of at least a portion of the cytoplasmic tail may be a deletion as described herein.

[0130] The modified SARS-CoV-2 spike proteins of the invention may comprise a mutation, typically a substitution at an amino acid position corresponding to or aligning with amino acid position 493 of SEQ ID NO:1, instead of or in addition to a mutation at an amino acid position corresponding to or aligning with amino acid position 498 or 499 of SEQ ID NO:1. The amino acid residue corresponding to or aligning with amino acid position 493 of SEQ ID NO:1 may be substituted with a lysine residue. Any disclosure herein relating to a modified SARS-CoV-2 spike protein of the invention comprising a mutation at amino acid position 498, 499, and / or 614 of SEQ ID NO:1, or any combination thereof, applies equally and without reservation to a modified SARS-CoV-2 spike protein of the invention comprising a mutation at an amino acid position corresponding to or aligning with amino acid position 493 of SEQ ID NO:1. By way of non-limiting example, a modified SARS-CoV-2 spike protein of the invention may have mutations at (i) amino acid positions 493 and 498 of SEQ ID NO:1; (ii) amino acid positions 493 and 499 of SEQ ID NO:1; (iii) amino acid positions 493 and 614 of SEQ ID NO:1; (iv) amino acid positions 493, 498, and 499 of SEQ ID NO:1; (v) amino acid positions 493, 498, and 614 of SEQ ID NO:1; (vi) amino acid positions 493, 499, and 614 of SEQ ID NO:1; or (vii) amino acid positions 493, 498, 499, and 614 of SEQ ID NO:1. The combinations may also include C-terminal deletions, and / or any other mutations or substitutions described herein.

[0131] The modified SARS-CoV-2 spike protein of the invention typically comprises a C-terminal deletion compared to the unmodified SARS-CoV-2 spike protein from which it is derived. The C-terminal deletion typically deletes at least a portion of the cytoplasmic tail of the spike protein. The cytoplasmic tail of the SARS-CoV-2 spike protein of the Wuhan-Hu-1 strain corresponds to amino acid residues 1235-1273 of SEQ ID NO: 1. The cytoplasmic tail of spike proteins from other SARS-CoV-2 strains typically corresponds to or aligns with the cytoplasmic tail of the SARS-CoV-2 spike protein of the Wuhan-Hu-1 strain.

[0132] The modified SARS-CoV-2 spike protein of the invention may comprise a C-terminal deletion of at least 10 amino acids, at least 15 amino acids, at least 16 amino acids, at least 17 amino acids, at least 18 amino acids, at least 19 amino acids, at least 20 amino acids, or more, compared to the unmodified SARS-CoV-2 spike protein from which it is derived. The modified SARS-CoV-2 spike protein of the invention may comprise a C-terminal deletion of the entire cytoplasmic tail. The C-terminal deletion may delete at least a portion of a putative endoplasmic reticulum retention signal (ERS) in the cytoplasmic tail of the SARS-CoV-2 spike protein. The C-terminal deletion may delete in the entire putative endoplasmic reticulum retention signal (ERS) in the cytoplasmic tail of the SARS-CoV-2 spike protein. In some preferred embodiments, the modified SARS-CoV-2 spike protein of the invention may comprise a C-terminal deletion of amino acids corresponding to or aligning with amino acid positions 1255-1273 of SEQ ID NO:1.

[0133] Typically, the lentiviral vector of the invention comprises a modified SARS-CoV-2 spike protein comprising both (i) a modification (such as a mutation, in particular a substitution) at amino acid positions corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO:1; and (ii) a deletion of at least a portion of the cytoplasmic tail. Any modification at amino acid positions corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO:1 is used in combination with any deletion or partial deletion of the cytoplasmic tail in the modified SARS-CoV-2 spike protein according to the invention. In a particularly preferred embodiment, the lentiviral vector of the invention comprises a substitution at amino acid positions corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO:1, as well as a deletion of at least 15 amino acids in the cytoplasmic tail, in which case, even more preferably, the deletion corresponds to or aligns with positions 1255 to 1273 of SEQ ID NO:1.

[0134] The modified SARS-CoV-2 spike protein of the invention may comprise or consist of an amino acid sequence having at least 90% identity, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or more sequence identity to SEQ ID NO:13.

[0135] The modified SARS-CoV-2 spike protein of the invention may comprise one or more further modifications, typically one or more further mutations, compared to the SARS-CoV-2 spike protein from which it is derived. The one or more further mutations may be amino acid substitutions.

[0136] Examples of further modifications, in particular further mutations, and even more particularly substitutions, within the SARS-CoV-2 spike protein are well known in the art, and it is well within the skill of the art to select and introduce one or more further modifications into the modified SARS-CoV-2 spike protein of the invention.

[0137] Typically, when the modified SARS-CoV-2 spike protein of the invention comprises one or more further modifications, said one or more further modifications comprise or consist of a modification at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO:1. Said modification at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO:1 is typically a mutation. Said mutation at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO:1 may be an amino acid substitution that is a non-conservative amino acid substitution or a conservative amino acid substitution. In some preferred embodiments, said substitution at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO:1 is a non-conservative amino acid substitution, with substitution with tyrosine being particularly preferred. Thus, in some preferred embodiments, the modified SARS-CoV-2 spike proteins of the invention comprise one or more additional amino acid modifications comprising or consisting of a substitution at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 501 of SEQ ID NO:1 is replaced by a tyrosine residue.

[0138] Thus, the modified SARS-CoV-2 spike proteins of the invention may contain one or more additional modifications, including N501Y.

[0139] Other non-limiting examples of amino acid modifications that may be included in the modified SARS-CoV-2 spike proteins of the invention include modifications at any one of the amino acid positions that correspond to or align with residues 5, 69, 70, 80, 95, 142, 144, 154, 157, 215, 241, 242, 243, 253, 346, 417, 452, 477, 478, 484, 494, 570, 981, 701, 716, 859, 950, 951, 957, 982, 1071, 1118, and 1191 of SEQ ID NO:1, or any combination thereof. In particular, other non-limiting examples of amino acid modifications that may be included in the modified SARS-CoV-2 spike proteins of the invention include a substitution at an amino acid position corresponding to or aligning with amino acid position 5 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 5 of SEQ ID NO:1 is replaced with a phenylalanine residue; a deletion at an amino acid position corresponding to or aligning with amino acid position 69 of SEQ ID NO:1; a deletion at an amino acid position corresponding to or aligning with amino acid position 70 of SEQ ID NO:1; a substitution at an amino acid position corresponding to or aligning with amino acid position 80 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 80 of SEQ ID NO:1 is replaced with a phenylalanine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 95 of SEQ ID NO:1 where the amino acid residue corresponding to or aligning with amino acid position 95 of SEQ ID NO:1 is replaced with an isoleucine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 142 of SEQ ID NO:1 where the amino acid residue corresponding to or aligning with amino acid position 142 of SEQ ID NO:1 is replaced with an aspartic acid residue; a substitution or deletion at an amino acid position corresponding to or aligning with amino acid position 144 of SEQ ID NO:1;a substitution at an amino acid position corresponding to or aligning with amino acid position 154 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 154 of SEQ ID NO:1 is replaced with a lysine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 157 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 157 of SEQ ID NO:1 is replaced with a serine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 215 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 215 of SEQ ID NO:1 is replaced with a glycine residue; a deletion at an amino acid position corresponding to or aligning with amino acid position 241 of SEQ ID NO:1; a deletion at an amino acid position corresponding to or aligning with amino acid position 242 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 243 of SEQ ID NO:1 is replaced with a glycine residue. a deletion at an amino acid position corresponding to or aligning with amino acid position 243 of SEQ ID NO:1; a substitution at an amino acid position corresponding to or aligning with amino acid position 253 of SEQ ID NO:1 where the amino acid residue corresponding to or aligning with amino acid position 253 of SEQ ID NO:1 is replaced with a glycine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 346 of SEQ ID NO:1 where the amino acid residue corresponding to or aligning with amino acid position 346 of SEQ ID NO:1 is replaced with a lysine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 417 of SEQ ID NO:1 where the amino acid residue corresponding to or aligning with amino acid position 417 of SEQ ID NO:1 is replaced with an asparagine or a threonine residue;a substitution at an amino acid position corresponding to or aligning with amino acid position 452 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 452 of SEQ ID NO:1 is replaced with an arginine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 477 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 477 of SEQ ID NO:1 is replaced with an asparagine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 478 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 478 of SEQ ID NO:1 is replaced with a lysine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 484 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 484 of SEQ ID NO:1 is replaced with a lysine or glutamine residue. substitutions at an amino acid position corresponding to or aligning with amino acid position 494 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 494 of SEQ ID NO:1 is replaced with a proline residue; at an amino acid position corresponding to or aligning with amino acid position 570 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 570 of SEQ ID NO:1 is replaced with an aspartic acid residue; at an amino acid position corresponding to or aligning with amino acid position 618 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 618 of SEQ ID NO:1 is replaced with an arginine residue; at an amino acid position corresponding to or aligning with amino acid position 681 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 681 of SEQ ID NO:1 is replaced with a histidine residue;a substitution at an amino acid position corresponding to or aligning with amino acid position 701 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 701 of SEQ ID NO:1 is replaced with a valine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 716 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 716 of SEQ ID NO:1 is replaced with an isoleucine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 859 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 859 of SEQ ID NO:1 is replaced with an asparagine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 950 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 950 of SEQ ID NO:1 is replaced with a histidine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 957 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 957 of SEQ ID NO:1 is replaced by an arginine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 982 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 982 of SEQ ID NO:1 is replaced by an alanine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 1071 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 1071 of SEQ ID NO:1 is replaced by a histidine residue; a substitution at an amino acid position corresponding to or aligning with amino acid position 1118 of SEQ ID NO:1, where the amino acid residue corresponding to or aligning with amino acid position 1118 of SEQ ID NO:1 is replaced by a histidine residue;or a substitution at an amino acid position corresponding to or aligning with amino acid position 1191 of SEQ ID NO:1, wherein the amino acid residue corresponding to or aligning with amino acid position 1191 of SEQ ID NO:1 is replaced with an asparagine residue; or any combination thereof;

[0140] The modified SARS-CoV-2 spike proteins of the invention thus include L5F, T19R, 69del, V70F, 70del, G75V, T76I, D80G / A, T95I, G142D, Y144X or 144del, E154K, E156-, F157-, F157S, R158G, D215G, A222V, 241del, 242del, 243del, 246-252del, D253G, W2 It may contain one or more additional modifications including one or more of 58L, R346K, K417N / T, L452Q / R, S477N, T478K, E484K / Q, F490S, S494P, A570D, P618R, P681H, A701V, T716I, T859N, D950N / H, Q957R, S982A, Q1071H, D1118H, or K1191N, or any combination thereof.

[0141] The lentiviral vectors of the invention may comprise a modified SARS-CoV-2 spike protein comprising: (i) a modification (such as a mutation, in particular a substitution) at amino acid positions corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO: 1; (ii) a deletion of at least a portion of the cytoplasmic tail; and (iii) a modification (such as a mutation, in particular a substitution) at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO: 1. Any modification at amino acid positions corresponding to or aligning with amino acid positions 498, 499, and 614 of SEQ ID NO: 1 may be used in combination with any deletion or partial deletion of the cytoplasmic tail and any modification at an amino acid position corresponding to or aligning with amino acid position 501 of SEQ ID NO: 1 in a modified SARS-CoV-2 spike protein according to the invention. In a particularly preferred embodiment, the lentiviral vector of the invention comprises substitutions at amino acid positions corresponding to or aligning with amino acid positions 498, 499, 501, and 614 of SEQ ID NO:1, as well as a deletion of at least 15 amino acids in the cytoplasmic tail, in which case, even more preferably, the deletion corresponds to or aligns with positions 1255 to 1273 of SEQ ID NO:1.

[0142] The modified SARS-CoV-2 spike protein of the invention may comprise or consist of an amino acid sequence having at least 90% identity, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or more sequence identity to SEQ ID NO:20.

[0143] In some embodiments, a modified SARS-CoV-2 spike protein of the invention may comprise a mutation at a position corresponding to or aligning with amino acid position 614 (as described herein) of SEQ ID NO:1, where said modified SARS-CoV-2 spike protein is derived from the spike protein of the B.1.351 strain (beta mutant). Preferably, such modified SARS-CoV-2 spike protein of the invention further comprises a deletion of at least a portion of the cytoplasmic tail (as described herein), more preferably a deletion of at least 15 amino acids of the cytoplasmic tail, where even more preferably, the deletion corresponds to or aligns with positions 1255-1273 of SEQ ID NO:1. The present invention provides modified SARS-CoV-2 spike proteins comprising D80A, D215G, K417N, E484K, N501Y, D614G, A701V, and C-terminal deletions corresponding to or aligning with positions 1255-1273 of SEQ ID NO: 1. Such modified SARS-CoV-2 spike proteins are typically derived from the spike protein of the B.1.351 strain (beta mutant). As exemplified herein, such modified SARS-CoV-2 spike proteins can provide further increased transgene expression in the lung in vivo.

[0144] Thus, the present invention provides a lentiviral vector pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein, comprising a transgene operably linked to a promoter, said spike protein comprising (a) a mutation at an amino acid position corresponding to or aligning with one or more of positions 80, 215, 417, 484, 501, 614, and 701 of SEQ ID NO: 1, preferably all of these residues are mutated; and (b) a deletion of at least a portion of the cytoplasmic tail. The modified SARS-CoV-2 spike protein may be derived from the spike protein of the B.1.351 strain. In some embodiments, (i) the amino acid corresponding to or aligning with position 80 of SEQ ID NO:1 is substituted with alanine; (ii) the amino acid corresponding to or aligning with position 215 of SEQ ID NO:1 is substituted with glycine; (iii) the amino acid corresponding to or aligning with position 417 of SEQ ID NO:1 is substituted with asparagine; (iv) the amino acid corresponding to or aligning with position 484 of SEQ ID NO:1 is substituted with lysine; (v) the amino acid corresponding to or aligning with position 501 of SEQ ID NO:1 is substituted with tyrosine; (vi) the amino acid corresponding to or aligning with position 614 of SEQ ID NO:1 is substituted with glycine; and / or (vii) the amino acid corresponding to or aligning with position 701 of SEQ ID NO:1 is substituted with valine; in this case, preferably all of these residues are substituted. Alternatively, or in addition, the deletion of at least a portion of the cytoplasmic tail comprises or consists of a deletion of amino acid residues corresponding to or aligning with positions 1255 to 1273 of SEQ ID NO:1.

[0145] As described herein, the modified SARS-CoV-2 spike protein of the present invention is rodent-adapted, in particular mouse-adapted. As used herein, the term "rodent-adapted" means that the modified SARS-CoV-2 spike protein is capable of binding to rodent ACE2 and facilitating entry into target rodent cells expressing rodent ACE2. Similarly, "mouse-adapted" means that the modified SARS-CoV-2 spike protein is capable of binding to mouse ACE2 and facilitating entry into target mouse cells expressing mouse ACE2. Methods for determining mouse adaptation include assays for determining / quantifying transduction into mouse cells, such as those described in the Examples herein. Other suitable techniques are known in the art and can be readily selected and used by the skilled artisan without undue burden.

[0146] The rodent / mouse adaptation of the SARS-CoV-2 spike protein contained within the pseudotyped lentiviral vectors of the invention allows for increased flexibility of the pseudotyped lentiviral vectors of the invention for use in research studies, such as in vitro and / or ex vivo assays using rodent / mouse cells or rodent / mouse tissues, or in vivo rodent / mouse models, as described herein.

[0147] The modified SARS-CoV-2 spike protein of the present invention is typically capable of binding to human ACE2, in particular the enzymatic domain of human ACE2, facilitating entry into target human cells expressing human ACE2. Typically, the modified SARS-CoV-2 spike protein of the present invention, in addition to being rodent / mouse adapted, is capable of binding to human ACE2, in particular the enzymatic domain of human ACE2. Standard techniques for assessing binding (such as surface plasmon resonance) are known in the art and can be readily used by the skilled artisan without undue burden.

[0148] The modified SARS-CoV-2 spike protein of the invention is detected by anti-coronavirus spike protein antibodies. In other words, the modified SARS-CoV-2 spike protein of the invention can bind to / is recognized by an antibody that specifically binds to the unmodified SARS-CoV-2 spike protein. This is described as the modified SARS-CoV-2 spike protein of the invention being neutralized by a neutralizing antibody that specifically binds to the unmodified SARS-CoV-2 spike protein. By way of non-limiting example, the modified SARS-CoV-2 spike protein of the invention is bound to / is detected / recognized by the MM43 antibody and / or the R001 antibody (both available from SinoBiological: R001=Cat. No.: 40592-R001, MM43=Cat. No.: 40591-MM43).

[0149] Alternatively, the modified SARS-CoV-2 spike protein of the invention is not detected by anti-coronavirus spike protein antibodies. In other words, the modified SARS-CoV-2 spike protein of the invention cannot bind to / is not recognized by antibodies that specifically bind to the unmodified SARS-CoV-2 spike protein. This is described as the modified SARS-CoV-2 spike protein of the invention escaping neutralization by neutralizing antibodies that specifically bind to the unmodified SARS-CoV-2 spike protein. By way of non-limiting example, the modified SARS-CoV-2 spike protein of the invention cannot bind to / is not detected / recognized by MM43 and / or R001 antibodies. Preferably, the modified SARS-CoV-2 spike protein of the invention is not detected by anti-coronavirus spike protein antibodies. Thus, lentiviral vectors of the invention pseudotyped with a modified SARS-CoV-2 spike protein of the invention are capable of evading the immune system of an individual following administration of the pseudotyped lentiviral vector to said individual and are more effective and / or persist longer within an individual than lentiviral vectors pseudotyped with the corresponding unmodified SARS-CoV-2 spike protein.

[0150] Neutralization or escape from neutralization by modified SARS-CoV-2 spike proteins of the invention may be specific to a particular antibody that specifically binds to the unmodified SARS-CoV-2 spike protein. By way of non-limiting example, a modified SARS-CoV-2 spike protein of the invention derived from the B.1.1.7 strain of SARS-CoV-2 may escape neutralization by MM43, but may not escape neutralization by R001. By way of further non-limiting example, a modified SARS-CoV-2 spike protein of the invention derived from the B.1.351 strain of SARS-CoV-2 may escape neutralization by R001, but may not escape neutralization by MM43.

[0151] Polynucleotides and constructs The present invention also provides polynucleotides encoding the modified SARS-CoV-2 spike proteins of the present invention. The term "polynucleotide" encompasses both DNA and RNA sequences.

[0152] The polynucleotides of the invention are used for recombinant expression of the modified SARS-CoV-2 spike protein of the invention.

[0153] The polynucleotide of the present invention is optionally codon-optimized for expression in a particular cell type, for example, eukaryotic cells (e.g., mammalian cells, yeast cells, insect cells or plant cells), or prokaryotic cells (e.g., E. coli). The term "codon optimization" refers to the replacement of at least one codon in a base polynucleotide sequence with a codon that is preferentially used by the host organism in which the polynucleotide is expressed. Typically, the codon that is most frequently used in the host organism is used in the codon-optimized polynucleotide sequence. Methods of codon optimization are well known in the art.

[0154] It will be understood by those skilled in the art that, as a result of the degeneracy of the genetic code, many different polynucleotides can code for the same polypeptide. It will also be understood by those skilled in the art that, using routine techniques, nucleotide substitutions that do not affect the polypeptide sequence encoded by the nucleic acid molecule can be made to reflect the codon usage of any particular host organism in which the polypeptide is expressed. Thus, unless otherwise specified, a "polynucleotide encoding a protein or immunogenic fragment of the present invention" includes all polynucleotide sequences that are degenerate versions of each other and code for the same amino acid sequence.

[0155] The present invention also provides an expression cassette comprising the polynucleotide of the present invention operably linked to a promoter. The choice of promoter will depend on where the final expression of the polynucleotide is to occur. Generally, constitutive promoters are preferred, although inducible promoters may be used as well. Suitable promoter sequences are well known in the art, and examples are described herein.

[0156] The expression cassette may be a DNA, such as a DNA plasmid, or an RNA vector, such as an mRNA vector or a self-amplifying RNA vector. The expression cassette of the invention may be capable of expression in eukaryotic and / or prokaryotic cells.

[0157] The polynucleotide or expression cassette may also comprise a suitable terminator sequence. Suitable terminator sequences are well known in the art.

[0158] The polynucleotide and expression cassette of the present invention can be produced using any suitable process known in the art.Thus, the polynucleotide and expression cassette can be produced using chemical synthesis methods.Alternatively, the polynucleotide and expression cassette of the present invention can be produced using molecular biology methods.

[0159] The polynucleotides and expression cassettes of the present invention are computer designed and then synthesized by conventional polynucleotide synthesis techniques.

[0160] Preparation The present invention also provides methods for making lentiviral (e.g., HIV / SIV) vectors pseudotyped with the modified SARS-CoV-2 spike proteins of the present invention.

[0161] Thus, the present invention provides a method of making a lentiviral vector as described herein, comprising: (a) introducing into a viral vector producer cell one or more nucleic acid sequences encoding (i) a nucleic acid sequence encoding a modified SARS-CoV-2 spike protein of the present invention; and (ii) a lentiviral packaging component, a lentiviral envelope component, and a lentiviral genome; and (b) culturing the producer cell under conditions suitable for producing a lentiviral vector. The method may further comprise harvesting the lentiviral vector.

[0162] A nucleic acid sequence encoding a modified SARS-CoV-2 spike protein is included in a polynucleotide or expression construct of the invention.

[0163] The method may include the use of a codon-optimized gag-pol gene. Typically, the codon-optimized gag-pol gene used in the production method of the present invention is matched with the lentiviral vector to be produced. By way of non-limiting example, when the lentiviral vector is an HIV vector, the codon-optimized gag-pol gene used in the production method of the present invention is an HIV gag-pol gene. By way of non-limiting example, when the lentiviral vector is an SIV vector, the codon-optimized gag-pol gene used in the production method of the present invention is an SIV gag-pol gene.

[0164] In addition to codon optimization, the codon-optimized gag-pol gene used in the production method of the present invention may contain other modifications, such as translation slippage (allowing translation to slip from one region to another to allow production of both Gag and Pol). Any suitable alteration of codon usage may be used within the codon-optimized gag-pol gene of the present invention, provided that (i) homology between the vector genome plasmid and the Gag-Pol plasmid is reduced to minimize the risk of RCL production, and (ii) sufficient Gag-Pol is produced after codon optimization without the incorporation of an RRE (which further reduces the risk of homology and RCL production).

[0165] The codon-optimized gag-pol genes used in the production methods of the present invention may be fully (100%) codon-optimized or partially codon-optimized, including at least 70%, at least 80%, at least 95%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more codon-optimized.

[0166] Preferably, the gag-pol gene itself is fully codon-optimized, but may contain regions that do not contain non-codon-optimized sequences (e.g., between the gag and pol genes). By way of non-limiting example, in order to maintain slippage of the reading frame between the gag and pol genes, regions adjacent to the slippage sequence may not be codon-optimized (e.g., if the correct slippage sequence is important for this function).

[0167] The methods of the invention can be scalable, GMP-compatible methods, and thus typically allow for the production of high titer purified pseudotyped lentiviral (e.g., HIV / SIV) vectors.

[0168] Typically, the C-terminal deletions in the modified SARS-CoV-2 spike proteins of the invention described herein are associated with the production of lentiviral (e.g., HIV / SIV) vector titers that are at least equivalent to the titers of lentiviral (e.g., HIV / SIV) vectors made using the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. As used herein, the term "equivalent" is defined as the use of the C-terminal deletion does not significantly reduce the titer of the lentiviral (e.g., HIV / SIV) vector compared to the use of the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. By way of non-limiting example, the use of a C-terminal deletion may produce / be associated with a lentiviral (e.g., HIV / SIV) vector titer that is at least 2-fold, 1.5-fold, 1.0-fold, 0.5-fold, 0.25-fold, or less than the titer of a lentiviral (e.g., HIV / SIV) vector compared to the use of a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. The term "equivalent" is defined such that the titer of a lentiviral (e.g., HIV / SIV) vector made using a C-terminal deletion is statistically unchanged (e.g., p<0.05, p<0.01) compared to the titer of a lentiviral (e.g., HIV / SIV) vector made using a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion.

[0169] In particular, the C-terminal deletions in the modified SARS-CoV-2 spike proteins of the invention described herein may produce / be associated with increased titers of lentiviral vectors pseudotyped with said modified SARS-CoV-2 spike proteins compared to lentiviral vectors pseudotyped with the corresponding SARS-CoV-2 spike proteins (modified or unmodified) lacking the C-terminal deletion.

[0170] Preferably, the use of the C-terminal deletion produces / is associated with an increased titer of the lentiviral (e.g., HIV / SIV) vector compared to the titer of a lentiviral (e.g., HIV / SIV) vector made with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. The titer of the lentiviral (e.g., HIV / SIV) vector can be at least 2-fold, at least 3-fold, or at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold or more than the titer of a lentiviral (e.g., HIV / SIV) vector made with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion.

[0171] As described in the art, the incorporation of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 is associated with reduced titer production compared to the corresponding SARS-CoV-2 spike protein without these mutations. However, the inventors have surprisingly shown that for some S-LVs with SARS-CoV-2 spike proteins, particularly S-LVs known in the art to be difficult to produce reasonable titers (e.g., the AUS / VIC1 strain of SARS-CoV-2), the incorporation of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 surprisingly increases S-LV titers. This rescue of S-LV titers by the incorporation of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 is further increased by the C-terminal deletions described herein. Thus, in accordance with the present invention, mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 in the modified SARS-CoV-2 spike protein of the present invention described herein are associated with the production of lentiviral (e.g., HIV / SIV) vector titers that are at least equivalent to the titers of lentiviral (e.g., HIV / SIV) vectors produced using a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking a mutation at one or both of these positions. As used herein, the term "equivalent" is defined such that the use of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 does not significantly reduce the titers of lentiviral (e.g., HIV / SIV) vectors compared to the use of a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking a C-terminal deletion.By way of non-limiting example, the use of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 may yield / be associated with lentiviral (e.g., HIV / SIV) vector titers that are at least 2-fold, 1.5-fold, 1.0-fold, 0.5-fold, 0.25-fold, or less than the lentiviral (e.g., HIV / SIV) vector titers compared to the use of the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking these mutations. The term "equivalent" is defined as the titer of a lentiviral (e.g., HIV / SIV) vector made with mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 is statistically unchanged (e.g., p<0.05, p<0.01) compared to the titer of a lentiviral (e.g., HIV / SIV) vector made with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking these mutations.

[0172] In particular, the mutations in the modified SARS-CoV-2 spike protein of the invention described herein at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 may produce / be associated with increased titers of lentiviral vectors pseudotyped with said modified SARS-CoV-2 spike protein compared to lentiviral vectors pseudotyped with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking these mutations. This improved titer is observed especially when the modified SARS-CoV-2 spike protein is derived from a strain that is traditionally difficult to produce at reasonable titers, such as the Australia / VIC01 / 2020 (Aus / VIC01) strain described and exemplified herein.

[0173] Preferably, the use of mutations at amino acid positions corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1 produces / is associated with an increased titer of the lentiviral (e.g., HIV / SIV) vector compared to the titer of a lentiviral (e.g., HIV / SIV) vector made with a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking these mutations. The titer of the lentiviral (e.g., HIV / SIV) vector can be at least 1.5-fold, at least 2-fold, at least 3-fold, or at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold or more than the titer of a lentiviral (e.g., HIV / SIV) vector made with a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking these mutations.

[0174] Typically, lentiviral (e.g., HIV / SIV) vectors of the invention, such as lentiviral (e.g., HIV / SIV) vectors obtained by the methods of the invention or using the polynucleotides, expression cassettes, and / or host cells of the invention, are produced at high titers. In particular, lentiviral vectors of the invention comprising the C-terminal deletions described herein are produced at high titers. Titers are measured in transducing units, as defined herein. As described herein, lentiviral (e.g., SIV / HIV) vectors of the invention, in particular lentiviral vectors comprising the C-terminal deletions described herein, are produced at titers equal to or greater than the corresponding lentiviral vectors comprising the corresponding unmodified SARS-CoV-2 spike protein. In particular, lentiviral vectors of the invention comprising the SARS-CoV-2 spike protein with the C-terminal deletions described herein are produced at titers equal to or greater than the corresponding lentiviral vectors pseudotyped with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. Thus, a lentiviral (e.g., HIV / SIV) vector of the invention, such as a lentiviral (e.g., HIV / SIV) vector obtained by the methods of the invention or using the polynucleotides, expression cassettes, and / or host cells of the invention, optionally has a total cell population of at least about 2.0×10 6 IU / mL, at least about 2.5 × 10 6 IU / mL, at least about 3.0 × 10 6 IU / mL, at least about 3.5 × 10 6 IU / mL, at least about 3.7 × 10 6 IU / mL, at least about 4.0 × 10 6 IU / mL, at least about 4.2 × 10 6 IU / mL, at least about 4.5 × 10 6 IU / mL, at least about 5.0 × 10 6 IU / mL, at least about 5.5 × 10 6 IU / mL, at least about 5.7 × 10 6 IU / mL, at least about 6.0 × 10 6 IU / mL, at least about 6.1 × 106 IU / mL, at least about 6.2 × 10 6 Preferably, the retroviral / lentiviral (e.g., SIV) vector is at least about 3.0×10 6 IU / mL, at least about 4.0 × 10 6 IU / mL, or at least about 6.0 × 10 6 It is produced in a titer of IU / mL.

[0175] The method of the invention may include a step of co-expressing SARS-CoV-2 nucleoprotein in the producer cell. As exemplified herein, co-expression of SARS-CoV-2 nucleoprotein may further increase S-LV production titer. Preferably, co-expression of SARS-CoV-2 nucleoprotein produces / is associated with increased lentiviral (e.g., HIV / SIV) vector titer compared to lentiviral (e.g., HIV / SIV) vector titer produced using the corresponding SARS-CoV-2 spike protein (modified or unmodified), in which case the method does not include co-expression of SARS-CoV-2 nucleoprotein. The titer of the lentiviral (e.g., HIV / SIV) vector can be at least 1.5-fold, at least 2-fold, at least 3-fold, or at least 4-fold, at least 5-fold or more than the titer of a lentiviral (e.g., HIV / SIV) vector produced using a corresponding SARS-CoV-2 spike protein (modified or unmodified) made by a method that does not include co-expression of the SARS-CoV-2 nucleoprotein.

[0176] Typically, the SARS-CoV-2 nucleoprotein is co-expressed during cultivation of the production cells. The nucleic acid sequence encoding the SARS-CoV-2 nucleoprotein is included either (i) in the same polynucleotide molecule or expression construct as the nucleic acid sequence encoding the modified SARS-CoV-2 spike protein, and / or in one or more separate polynucleotide molecules or expression constructs.

[0177] The SARS-CoV-2 nucleoprotein may be derived from any SARS-CoV-2 strain, such as the SARS-CoV-2 strains disclosed herein. Preferably, the SARS-CoV-2 nucleoprotein is derived from the Wuhan-Hu-1 or B.1.1.529 (Omicron) strains.

[0178] The production of high titer lentiviral (e.g., SIV / HIV) vectors according to the present invention may impart other desirable properties to the resulting vector product. For example, without being bound by theory, it is believed that production at high titers without the need for high concentration by methods such as TFF results in a higher quality vector product than lentiviral vectors, including the corresponding unmodified SARS-CoV-2 spike protein, or the corresponding lentiviral vector pseudotyped with the corresponding SARS-CoV-2 spike protein (modified or unmodified) that lacks a C-terminal deletion. Without being bound by theory, it is believed that vectors produced at high titers and without the need for high concentration are less exposed to shear forces that can damage viral particles and their RNA cargo.

[0179] The present invention also provides a method of increasing the titer of a SARS-CoV-2 spike protein pseudotyped lentiviral (e.g., SIV / HIV) vector, comprising the use of a C-terminal deletion in the SARS-CoV-2 spike protein. The method of increasing lentiviral (e.g., SIV / HIV) vector titer according to the present invention may increase titer by at least 2-fold, at least 3-fold, or at least 4-fold, at least 5-fold, at least 10-fold, at least 15-fold, or more, compared to the production of a corresponding lentiviral vector pseudotyped with a corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. Alternatively, the method of increasing lentiviral (e.g., SIV / HIV) titer according to the invention may increase titer by at least about 50%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 500% or more compared to the production of the corresponding lentiviral vector pseudotyped with the corresponding SARS-CoV-2 spike protein (modified or unmodified) lacking the C-terminal deletion. Preferably, the method of increasing lentiviral (e.g., SIV / HIV) titer according to the invention may increase titer by (a) at least 5-fold or at least 10-fold; and / or (b) at least about 100%, more preferably at least about 200%, even more preferably at least about 300%. Typically, the corresponding lentiviral vector / SARS-CoV-2 spike protein is identical to the lentiviral vector / SARS-CoV-2 spike protein of the invention, except that it lacks the C-terminal deletion. All disclosures herein relating to methods of making lentiviral (e.g., SIV / HIV) vectors apply equally and without reservation to the methods of increasing lentiviral (e.g., SIV / HIV) titers of the invention.

[0180] The production of lentiviral (e.g., HIV / SIV) vectors typically utilizes one or more plasmids that provide the elements required for the production of the vector: genome for the retroviral / lentiviral vector, Gag-Pol, Rev, SARS-CoV-2 spike protein. Multiple elements are provided on a single plasmid. Preferably, each element is provided on a separate plasmid such that there are four plasmids, one each for the vector genome, Gag-Pol, Rev, and SARS-CoV-2 spike protein.

[0181] Alternatively, a single plasmid may provide the Gag-Pol and Rev elements and is referred to as the packaging plasmid (pDNA2). The remaining elements (genome, SARS-CoV-2 spike protein) are provided by separate plasmids (pDNA1 and pDNA3, respectively) such that four plasmids are used for the production of lentiviral (e.g., HIV / SIV) vectors according to the invention. In the three-plasmid approach, pDNA1 and pDNA3 may be as described herein in the context of the four-plasmid approach.

[0182] In the preferred four-plasmid method of the present invention, the vector genome plasmid is packaged into the final lentiviral vector and encodes all the genetic material, including the transgene. Typically, only a portion of the genetic material found in the vector genome plasmid remains in the virus. Herein, the vector genome plasmid is designated as "pDNA1" and typically contains the transgene and the transgene promoter.

[0183] The other three plasmids are production plasmids encoding the Gag-Pol, Rev, and SARS-CoV-2 spike proteins, designated "pDNA2a," "pDNA2b," and "pDNA3," respectively.

[0184] In the four-plasmid method of the present invention, all four plasmids contribute to the formation of the final lentiviral (e.g., HIV / SIV) vector. During the production of lentiviral (e.g., HIV / SIV) vectors, the vector genome plasmid (pDNA1) typically provides enhancer / promoter, Psi, RRE, cPPT, mWPRE, SIN LTR, polyA (e.g., SV40 polyA), which are important for mass production of virus. RRE, cPPT, promoter, transgene, and mWPRE are typically found in the final lentiviral (e.g., HIV / SIV) vector. SIN LTR (long terminal repeats; SIN / IN self-inactivating type) and Psi (packaging signal) are found in the final lentiviral (e.g., HIV / SIV) vector.

[0185] The SARS-CoV-2 spike protein from pDNA3 is important for final lentiviral (e.g., HIV / SIV) vector infection of the target cell, i.e., entry into the patient's epithelial cells (typically lung or nasal cells, as described herein). The products of the pDNA2a and pDNA2b plasmids are important for viral transduction, i.e., insertion of the lentiviral (e.g., HIV / SIV) DNA into the host genome. The promoter, regulatory elements (such as the WPRE), and transgene are important for expression of the transgene in the target cell(s).

[0186] The method of the invention may comprise or consist of the following steps: (a) growing cells in suspension; (b) transfecting the cells with one or more plasmids; (c) adding a nuclease; (d) harvesting the lentivirus (e.g., HIV / SIV); and (e) purifying the lentivirus (e.g., HIV / SIV). The method of the invention may comprise or consist of the following steps: (a) growing cells in suspension; (b) transfecting the cells with one or more plasmids; (c) adding a nuclease; (d) harvesting the lentivirus (e.g., HIV / SIV); (e) adding trypsin; and (f) purifying the lentivirus (e.g., HIV / SIV).

[0187] The method may use a four-plasmid system or a three-plasmid system, as described herein. Thus, for the preferred four-plasmid method, the one or more plasmids may include or consist of pDNA1, the vector genome plasmid; pDNA2a, the galpol plasmid (which may be codon-optimized); pDNA2b, the Rev plasmid; and pDNA3, the SARS-CoV-2 spike protein plasmid.

[0188] Any suitable ratio of vector genome plasmid:gagpol plasmid:Rev plasmid:SARS-CoV-2 spike protein plasmid can be used to further optimize (increase) the lentivirus (e.g., HIV / SIV) titer produced. Suitable ratios can be easily determined by those skilled in the art. By way of non-limiting example, a ratio of 20:9:6:12 is used.

[0189] Steps (a)-(f) of the method are typically carried out sequentially, starting with step (a) and continuing through step (f). The method may include one or more additional steps, such as further purification steps, buffer exchange, concentration of the lentiviral (e.g., HIV / SIV) vector after purification, and / or formulation of the lentiviral (e.g., HIV / SIV) vector after purification (or concentration). Each of the steps may include one or more substeps. For example, the harvesting step may involve one or more steps or substeps, and / or the purification step may involve one or more steps or substeps.

[0190] Any suitable cell type is transfected with one or more plasmids to produce the lentiviral (e.g., HIV / SIV) vector of the present invention. Typically, mammalian cells, particularly human cell lines, are used. Non-limiting examples of cells suitable for use in the method of the present invention are HEK293 cells (such as HEK293F cells or HEK293T cells) and 293T / 17 cells. Commercially available cell lines suitable for virus production are also readily available (e.g., Gibco Viral Production Cells: ThermoFisher Scientific; model number: A35347).

[0191] The cells are grown in animal component-free media, including serum-free media. The cells are grown in media containing human components. The cells are grown in chemically defined media, which contain or consist of synthetically produced components.

[0192] According to the present invention, any suitable transfection means can be used. The selection of a suitable transfection means is within the routine practice of those skilled in the art. By way of non-limiting example, transfection can be carried out by using PEIPro™, Lipofectamine2000™, or Lipofectamine3000™.

[0193] Any suitable nuclease may be used according to the present invention. The selection of a suitable nuclease is within the routine practice of one of ordinary skill in the art. Typically, the nuclease is an endonuclease. By way of non-limiting example, the nuclease may be Benzonase® or Denarase®. The addition of the nuclease may be at a pre-harvesting stage, at a post-harvesting stage, or during the harvesting process.

[0194] If used, trypsin activity is preferably provided by a recombinant enzyme, such as TrypLE Select™, which is free of animal-derived enzymes. Trypsin may be added at a pre-harvest stage, a post-harvest stage, or during the harvesting process.

[0195] Any suitable purification means can be used to purify lentiviral (e.g., HIV / SIV) vectors. Non-limiting examples of suitable purification steps include depth / end filtration, tangential flow filtration (TFF), and chromatography. A purification step typically includes at least one chromatography step. Non-limiting examples of chromatography steps used according to the present invention include mixed-mode size exclusion chromatography (SEC), and / or anion exchange chromatography. Elution can be performed with or without the use of a salt gradient, and is preferably performed without the use of a salt gradient.

[0196] Harvesting of lentiviral (e.g., HIV / SIV) vectors is performed after any suitable time after transfection, such as between about 12 and about 144 hours after transfection, between about 24 and about 96 hours after transfection, between about 36 and about 96 hours after transfection, between about 54 and about 84 hours after transfection, between about 54 and about 72 hours after transfection, or between about 72 and about 96 hours after transfection. In some preferred embodiments, harvesting is performed about 72 hours after transfection.

[0197] The method is used to generate lentiviral (eg, HIV / SIV) vectors of the invention.

[0198] The method of the present invention may use a codon-optimized gag-pol gene (or a nucleic acid or plasmid consisting of or consisting of the same) since it facilitates the production of high titer lentiviral (e.g., HIV / SIV) vectors. Typically, the codon-optimized gag-pol gene is used to produce a lentiviral (e.g., HIV / SIV) vector titer that is at least equivalent to the titer of a lentiviral (e.g., HIV / SIV) vector produced by a corresponding method described herein that does not use a codon-optimized gag-pol gene. Preferably, the codon-optimized gag-pol gene allows the production of an increased lentiviral (e.g., HIV / SIV) vector titer compared to the titer of a lentiviral (e.g., HIV / SIV) vector produced by a corresponding method described herein that does not use a codon-optimized gag-pol gene.

[0199] The present invention also provides a host cell (also referred to as a viral vector producing cell) comprising: (i) a lentiviral (e.g., HIV / SIV) vector of the present invention; (ii) a modified SARS-CoV-2 spike protein as described herein; (iii) an expression construct of the present invention and / or (iii) a polynucleotide of the present invention; or any combination thereof. Typically, the host cell is a mammalian cell, in particular a human cell or a human cell line. Non-limiting examples of host cells include HEK293 cells (such as HEK293F cells or HEK293T cells) and 293T / 17 cells. Commercially available cell lines suitable for virus production are also readily available (described herein). The host cell of the present invention may express human TMPRSS2 (hTMPRSS2) endogenously or after introduction of an exogenous nucleic acid, vector, or plasmid, or a functional fragment thereof. The amino acid sequence of the expressed TMPRSS2 may be as described herein.

[0200] The present invention also provides lentiviral (e.g., HIV / SIV) vectors obtained by the methods of the invention or by using the expression constructs, polynucleotides, plasmids, modified SARS-CoV-2 spike proteins, and / or host cells of the invention.

[0201] One or more nucleic acid sequences encoding lentiviral packaging components, lentiviral envelope components, and the lentiviral genome are contained (i) within the same polynucleotide molecule or expression construct as the nucleic acid sequence encoding the modified SARS-CoV-2 spike protein, or (ii) within one or more separate polynucleotide molecules or expression constructs. Described herein are exemplary plasmid systems for use in the methods of the invention.

[0202] Virus-like particles The present invention also provides virus-like particles (VLPs) comprising one or more modified SARS-CoV-2 spike proteins of the invention as described herein.

[0203] As defined herein, the VLPs of the present invention are empty lentiviral particles, ie, the VLPs lack a lentiviral genome.

[0204] Methods for producing VLPs are known in the art (see, e.g., Brune et al. Sci. Rep. (2016), 19(6):19234, which is incorporated by reference in its entirety) and are readily adapted to the present invention. References herein to vectors of the invention may equally apply to VLPs of the invention.

[0205] In vitro and animal models The present invention also provides in vitro and animal models suitable for use in developing prophylactic, therapeutic, and vaccine strategies for SARS-CoV-2, or other diseases or disorders.

[0206] The present invention provides an in vitro model comprising rodent cells, particularly mouse cells, transduced with a lentiviral (e.g., HIV / SIV) vector of the present invention. Such a model can be used, for example, to evaluate whether a given antibody is capable of preventing lentiviral vector entry into cells in vitro.

[0207] The present invention also provides an in vivo animal model, particularly a rodent model, especially a mouse model. For example, a vector expressing a candidate antibody is administered to a mouse. After transduction of the vector, the candidate antibody is produced by mouse cells in vivo. Subsequent challenge with the lentiviral (e.g., HIV / SIV) vector of the present invention is used to evaluate, for example, whether a given antibody can prevent the lentiviral vector from entering cells in vitro.

[0208] Treatment indications The nucleic acid cassettes and vectors of the present invention, particularly the pseudotyped lentiviral (e.g., HIV / SIV) vectors of the present invention, typically allow (i) airway transduction without disrupting epithelial integrity; (ii) sustained gene expression; (iii) lack of chronic toxicity; and / or (iv) efficient repeated administration. Preferably, long-term / sustained stable gene expression at therapeutically effective levels is achieved using repeated administration of the nucleic acid cassette or vector of the present invention. Alternatively, a single administration is used to achieve the desired long-term expression.

[0209] Thus, the nucleic acid cassette and vector of the present invention, in particular the lentiviral (e.g., HIV / SIV) vector of the present invention, are advantageously used in gene therapy.Thus, the present invention provides a nucleic acid cassette or gene therapy vector as defined herein for use in a method for treating or preventing a disease.The disease to be treated may be chronic or acute.

[0210] The nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, are used to deliver any transgene that is useful in gene therapy.Typically, the nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, are vectors for use in gene therapy for the treatment of airway, respiratory, or pulmonary diseases or disorders.

[0211] By way of example, the efficient airway cell uptake properties of the nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, make them highly suitable for the treatment of respiratory (respiratory or respiratory tract) diseases, particularly genetic respiratory diseases. In particular, and without being bound by theory, given that lentiviral (e.g., HIV / SIV) vectors pseudotyped by SARS-CoV-2 bind to ACE2, which is abundant in ATII cells in the lungs, the lentiviral (e.g., HIV / SIV) vectors of the present invention are used to express therapeutic proteins in ATII cells. Non-limiting examples of such therapeutic proteins include surfactant protein A1 (SP-A1: encoded by SFTPA1), surfactant protein A2 (SP-A2: encoded by SFTPA2), surfactant protein B (SP-B: encoded by SFTPB), surfactant protein C (SP-C: encoded by SFTPC), surfactant protein D (SP-D: encoded by SFTPD), ABCA3 (ATP-binding cassette sub-family member A), TITF1 (thyroid transcription factor 1; encoded by NKX2-1 (NK2 homeobox 1)), and SLC34A2 (solute carrier family 34 member 2), as well as other therapeutic proteins disclosed herein. Expression of SP-A1 and / or SP-A2 is used to treat a number of diseases, including ARDS, COPD, pulmonary fibrosis (e.g., IPF), and respiratory infections. Expression of SP-B is used to treat SP-B deficiency (also called SMDP1 (surfactant metabolism dysfunction, pulmonary, 1)). Expression of SP-C is used to treat SP-C deficiency (also called SMDP2 (surfactant metabolism dysfunction, pulmonary, 2)). Expression of SP-D is used to treat respiratory infections.Expression of ABCA3 is used to treat ABCA3 deficiency (also called SMDP3 (surfactant metabolism dysfunction, pulmonary, 3)). Expression of SLC34A2 is used to treat alveolar microlithiasis and IPF.

[0212] The lentiviral (e.g., HIV / SIV) vectors of the invention are used to express two or more (e.g., about 2 to about 10, about 2 to about 5, 2, 3, 4, or 5) therapeutic proteins in ATII cells. Expression of two or more therapeutic proteins by ATII cells using the nucleic acid cassettes and vectors of the invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the invention, may be useful in treating diseases or disorders involving two or more genes (e.g., about 2 to about 10, about 2 to about 5, 2, 3, 4, or 5 genes). For example, the nucleic acid cassettes and vectors of the invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the invention, are used to express two or more (e.g., about 2 to about 10, about 2 to about 5, 2, 3, 4, or 5) therapeutic proteins selected from SP-A1, SP-A2, SP-B, SP-C, SP-D, ABCA3, TITF1, SLC34A2, telomerase reverse transcriptase (TERT), telomerase RNA component (TERC), decorin, TRIM72, GM-CSF, and GM-CSF receptor (including CSF2RA and CSF2RB). Non-limiting examples of such diseases and disorders include pulmonary alveolar proteinosis (PAP; hereditary PAP (hPAP) and / or acquired PAP (aPAP)) and pulmonary fibrotic diseases (including idiopathic pulmonary fibrosis (IPF)). For example, treatment of aPAP can include expression of GM-CSF. Treatment of hPAP may include expression of CSF2RA and / or CSF2RB. Treatment of IPF may include expression of one or more of SP-A2, decorin, TRIM72, TERT, and / or TERC.

[0213] The nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, are also used in gene therapy methods to promote the secretion of therapeutic proteins. By way of further example, the present invention provides for the secretion of therapeutic proteins into the respiratory lumen (e.g., the lung lumen) and / or the circulatory system. In such cases, transduction of ATII cells with the nucleic acid cassettes and vectors of the present invention may not be essential, since ATII cells are not the intended target cells and the therapeutic protein is secreted into the respiratory lumen (e.g., the lung lumen) or the circulatory system. Without being bound by theory, expression of therapeutic proteins by ATII cells may be advantageous, since ATII cells are typically adjacent to endothelial cells in the respiratory tract, such that the expression of therapeutic proteins by ATII cells may be well suited for secretion into the circulatory system. Thus, administration of the nucleic acid cassette and vector of the present invention, particularly the lentiviral (e.g., HIV / SIV) vector of the present invention, and its uptake by airway cells may allow the lung (or nasal cavity or airway) to be used as a "factory" to produce therapeutic proteins, which can then be secreted and enter the systemic circulation at therapeutic levels and migrate to cells / tissues of interest to induce a therapeutic effect. In contrast to intracellular or membrane proteins, the production of such secreted proteins does not depend on transduction of specific disease target cells, which is a significant advantage, and achieves high levels of protein expression. Thus, other diseases that are not respiratory diseases, such as cardiovascular diseases, particularly inherited cardiovascular diseases, or blood disorders, particularly coagulation disorders, are also treated by the nucleic acid cassette and vector of the present invention, particularly the lentiviral (e.g., SIV / HIV) vector of the present invention.

[0214] Non-limiting examples of therapeutic secreted proteins expressed by the nucleic acid cassettes and vectors of the invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the invention, include AAT, Factor VIII, SP-A1, SP-A2, SP-B, SP-C, SP-D, Factor VII, Factor IX, Factor X, Factor XI, von Willebrand factor, granulocyte-macrophage colony-stimulating factor (GM-CSF), decorin, anti-inflammatory proteins (e.g., IL-10 or TGFβ) monoclonal antibodies, anti-inflammatory decoys, and monoclonal antibodies against infectious agents.

[0215] Non-limiting examples of other therapeutic proteins expressed by the nucleic acid cassettes and vectors of the invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the invention, include CFTR, TRIM72, CSF2RA, ABCA3, TITF1, SLC34A2, TERT, TERC, and CSF2RB.

[0216] The nucleic acid cassette and vector of the present invention, particularly the lentiviral (e.g., HIV / SIV) vector of the present invention, can effectively treat disease by providing a transgene for disease correction. For example, inserting a functional copy of the CFTR gene to improve or prevent lung disease in CF patients, independent of underlying mutations. Thus, the nucleic acid cassette and vector of the present invention, particularly the lentiviral (e.g., HIV / SIV) vector of the present invention, is typically used to treat cystic fibrosis (CF) by gene therapy with the CFTR transgene described herein.

[0217] By way of further example, the nucleic acid cassettes and vectors of the invention, in particular the lentiviral (e.g., HIV / SIV) vectors of the invention, are typically used to treat SFTPB (also known as SMDP1 (surfactant metabolism dysfunction, pulmonary 1)) deficiency by gene therapy involving the SFTPB transgene, as described herein.

[0218] As another example, the nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, are typically used to treat alpha 1 antitrypsin (AAT) deficiency by gene therapy with the AAT transgene (SERPINA1) as described herein. AAT is a secreted antiprotease that is mainly produced in the liver and then trafficked to the lungs in small amounts, but also produced in the lungs themselves. The main function of AAT is to bind and neutralize / inhibit neutrophil elastase. Gene therapy with AAT according to the present invention is relevant in AAT-deficient patients as well as in other lung diseases, such as CF or chronic obstructive pulmonary disease (COPD), and offers the opportunity to overcome some of the problems encountered with conventional enzyme replacement therapy (AAT is isolated from human blood and administered intravenously weekly), resulting in stable, long-lasting expression in target tissues (lung / nasal epithelium), ease of administration, and unlimited availability.

[0219] Transduction by the nucleic acid cassette and vector of the present invention, particularly the lentivirus (e.g., HIV / SIV) vector of the present invention, can result in the secretion of recombinant protein into the lung lumen and into circulation. One benefit of this is that therapeutic protein reaches the interstitium. Thus, gene therapy with AAT can also be beneficial in other disease indications, including, but not limited to, type 1 / type 2 diabetes, acute myocardial infarction, ischemic heart disease, rheumatoid arthritis, inflammatory bowel disease, transplant rejection, graft-versus-host (GvH) disease, multiple sclerosis, liver disease, liver cirrhosis, vasculitis, and infectious diseases such as bacterial and / or viral infections.

[0220] AAT exerts numerous other anti-inflammatory and tissue protective effects, for example, in preclinical models of diabetes, graft-versus-host disease, and inflammatory bowel disease. Thus, production of AAT in the lungs and / or nasal cavity following transduction according to the present invention may be more broadly applicable to indications including these indications.

[0221] Other examples of diseases that may be treated with gene therapy using secreted proteins according to the present invention include cardiovascular diseases, and blood disorders, particularly clotting disorders such as hemophilia (A, B, or C), von Willebrand's disease, and factor VII deficiency.

[0222] Other examples of diseases or disorders to be treated include inflammatory, infectious, immune, or metabolic conditions, such as primary ciliary dyskinesia (PCD), acute lung injury, surfactant type B (SFTB) deficiency, pulmonary alveolar proteinosis (PAP; hereditary and / or acquired PAP), chronic obstructive pulmonary disease (COPD), pulmonary surfactant metabolism dysfunction 3 (SMDP3) or another surfactant deficiency, acute respiratory distress syndrome (ARDS), COVID-19, pulmonary fibrotic diseases (including idiopathic pulmonary fibrosis), pulmonary allergic conditions, asthma, lung cancer, or dysplastic changes in the lungs, hemophilia, and / or lysosomal storage diseases or pulmonary bacterial infections, or any other lung disease or disorder.

[0223] The nucleic acid cassettes and vectors of the present invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the present invention, when administered to a patient, typically result in high expression levels of therapeutic proteins. In this specification, the terms "high expression" and "therapeutic expression" are used interchangeably. Expression is measured by any suitable method (qualitative or quantitative, preferably quantitative), and concentrations are given in any suitable measurement unit, for example, in ng / ml or nM.

[0224] The expression / secretion / membrane insertion of a Therapeutic protein of interest is given in absolute terms. Alternatively, the expression / secretion / membrane insertion of a Therapeutic protein may be given in relative terms, e.g., compared to the expression / secretion / membrane insertion of a Therapeutic protein encoded by a corresponding nucleic acid cassette or vector of the invention without an exogenous signal peptide or with the endogenous signal peptide of the Therapeutic protein, or compared to the expression / secretion / membrane insertion of the corresponding endogenous (defective) gene.

[0225] Expression may be measured in terms of mRNA expression or in terms of protein expression. Expression of the therapeutic protein of the present invention, such as functional CFTR gene, may be quantified in terms of protein concentration, number of mRNA copies per cell, or any other suitable unit, relative to endogenous protein or gene, such as endogenous (dysfunctional) CFTR gene. Secretion and / or membrane insertion of therapeutic protein may be quantified in terms of the secretion / membrane insertion of corresponding endogenous protein, or in terms of the level of secretion / membrane insertion of therapeutic protein introduced via expression cassette lacking exogenous signal peptide and / or containing endogenous signal peptide of therapeutic protein.

[0226] Expression levels of a nucleic acid encoding a therapeutic protein, and / or expression / secretion / membrane insertion of the encoded therapeutic protein of the invention, may, where applicable, be measured ex vivo (e.g., in conditioned medium used to culture the cells or in the cells themselves) or in vivo (e.g., in lung tissue, epithelial lining fluid, and / or serum / plasma). Thus, high and / or therapeutic expression levels may refer to concentrations in the lung, in the epithelial lining fluid, and / or in serum / plasma.

[0227] Repeated administration of the nucleic acid cassettes and vectors of the invention, particularly the lentiviral (e.g., HIV / SIV) vectors of the invention, can be administered twice daily, daily, twice weekly, weekly, monthly, every two months, every three months, every four months, every six months, annually, every two years or more. Administration can continue for as long as required, for example, at least six months, at least one year, two years, three years, four years, five years, ten years, fifteen years, twenty years or more, up to the life of the patient being treated.

[0228] The present invention also provides nucleic acid cassettes and vectors of the invention, and in particular lentiviral (e.g., HIV / SIV) vectors of the invention, as described herein, for use in a method of gene therapy, the method comprising: (a) transducing cells (e.g., airway cells) ex vivo to generate modified cells that express a transgene of interest; and (b) administering the resulting modified cells.

[0229] The present invention provides a method for treating a disease, comprising administering to a subject a nucleic acid cassette or vector of the present invention, particularly a lentiviral (e.g., HIV / SIV) vector of the present invention. Any disease described herein may be treated according to the present invention. In particular, the present invention provides a method for treating a pulmonary disease using a nucleic acid cassette or vector of the present invention, particularly a lentiviral (e.g., HIV / SIV) vector of the present invention. The disease to be treated may be a chronic disease.

[0230] The present invention also provides a nucleic acid cassette or vector of the present invention, in particular a lentiviral (e.g., HIV / SIV) vector of the present invention, as described herein, for use in a method for treating a disease. Any disease described herein may be treated according to the present invention. In particular, the present invention also provides a nucleic acid cassette or vector of the present invention, in particular a lentiviral (e.g., HIV / SIV) vector of the present invention, for use in a method for treating a pulmonary disease. The disease to be treated may be a chronic disease.

[0231] The present invention also provides the use of the nucleic acid cassette or vector of the present invention, in particular the use of the lentiviral (e.g., HIV / SIV) vector of the present invention described herein, in the manufacture of a medicament for use in a method for treating a disease. Any disease described herein may be treated according to the present invention. In particular, the present invention provides the use of the nucleic acid cassette or vector of the present invention, in particular the use of the lentiviral (e.g., HIV / SIV) vector of the present invention for the manufacture of a medicament for use in a method for treating a pulmonary disease. The disease to be treated may be a chronic disease.

[0232] The present invention also provides a cell comprising a nucleic acid cassette or vector of the invention, in particular a lentiviral (e.g. HIV / SIV) vector, which may be an airway cell as described herein or a host cell for the production of the nucleic acid cassette or vector of the invention as described herein.

[0233] Any and all disclosures herein relating to the nucleic acid cassettes or vectors of the invention, in particular the lentiviral (e.g., HIV / SIV) vectors of the invention, apply equally and without reservation to the therapeutic uses and methods of treatment described herein.

[0234] Preferably, long-term / sustained stable gene expression at therapeutically effective levels is achieved using repeated administrations of the nucleic acid cassettes or vectors of the invention, particularly lentiviral (e.g., HIV / SIV) vectors of the invention. Alternatively, a single administration is used to achieve the desired long-term expression.

[0235] Formulation and Administration The present invention also provides compositions comprising a nucleic acid cassette or vector of the invention, in particular a lentiviral (e.g., HIV / SIV) vector of the invention, and optionally a pharma- ceutically acceptable carrier, excipient, buffer, or diluent.

[0236] The nucleic acid cassettes or vectors of the present invention, particularly lentiviral (e.g., HIV / SIV) vectors of the present invention, are administered at any dosage appropriate to achieve the desired therapeutic effect. Appropriate dosages are determined by physicians, or other medical personnel, using standard methods, within their normal course of care. A non-limiting example of an appropriate dosage for the viral vectors of the present invention is 1×10 8 Transducing units (TU), 1 x 10 9 TU, 1×10 10 TU, 1×10 11 Non-limiting examples of suitable dosages of the non-viral vectors / non-viral delivery vehicles of the present invention include up to 30 mL per administration, up to 25 mL per administration, up to 20 mL per administration, up to 15 mL per administration, up to 10 mL or less per administration, preferably up to 20 mL per administration.

[0237] Non-limiting examples of pharma- ceutically acceptable carriers included in the compositions of the present invention include water, saline, and phosphate buffered saline. In some embodiments, however, the compositions are in lyophilized form, in which case the compositions may include a stabilizing agent, such as bovine serum albumin (BSA). In some embodiments, it may be desirable to formulate the compositions with a preservative, such as thiomersal or sodium azide, to facilitate long-term storage.

[0238] The nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, is administered by any suitable route. It may be desirable to direct the composition of the present invention (described above) to the respiratory system of the subject. Efficient delivery of the therapeutic / prophylactic composition or therapeutic / prophylactic drug to the site of disease or disorder in the respiratory tract may be achieved by oral administration or intranasal administration, for example, as an aerosol (e.g., nasal spray) or via a catheter. Typically, the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, is stable in clinically relevant nebulizers, inhalers (including metered dose inhalers), catheters, aerosols, and the like.

[0239] Other routes of administration, including but not limited to intravenous administration, intranasal administration, and intrapleural injection, are also encompassed by the present invention. Suitable routes of administration are known in the art.

[0240] In some embodiments, the nasal cavity is the preferred production site for therapeutic proteins using the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, for at least one of the following reasons: (i) extracellular barriers such as inflammatory cells and sputum are less prominent in the nasal cavity; (ii) ease of vector administration; (iii) small amount of vector required; and (iv) ethical considerations.Therefore, the nasal administration of the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, can result in efficient (high level) and long-lasting expression of therapeutic proteins of interest.Therefore, the nasal administration of the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, can be preferred.

[0241] The formulation for intranasal administration may be in the form of nasal drops or nasal sprays. The intranasal formulation may include drops with an approximate diameter ranging from 100 to 5000 μm, such as 500 to 4000 μm, 1000 to 3000 μm, or 100 to 1000 μm. Alternatively, in terms of volume, the drops may range from about 0.001 to 100 μl, or 0.001 to 1 μl, such as 0.1 to 50 μl or 1.0 to 25 μl.

[0242] Aerosol formulations may take the form of a powder, a suspension, or a solution. The size of the aerosol particles is related to the deliverability of the aerosol. Small particles may travel further into the respiratory tract and to the alveoli than larger particles. In one embodiment, the aerosol particles have a diameter distribution that facilitates delivery along the entire length of the bronchi, bronchioles, and alveoli. Alternatively, the particle size distribution is selected to target specific compartments of the respiratory tract, such as the alveoli. For aerosol delivery of medicaments, the particles may range from approximately 0.1 to 50 μm in diameter, preferably 1 to 25 μm, and more preferably 1 to 5 μm.

[0243] The aerosol particles may be for delivery using a nebulizer (e.g., via the mouth) or a nasal spray. The aerosol formulation may optionally contain a propellant and / or a surfactant.

[0244] The formulation of medicinal aerosols is a formulation that is routine to those skilled in the art (see, for example, Sciarra, J., "Remington's Pharmaceutical Sciences," supra). The drug may be formulated as a dry powder aerosol solution, aerosol dispersion, or aerosol suspension, or as an emulsion, or as a semi-solid product. The aerosol is delivered using any propellant system known to those skilled in the art. The aerosol may be applied to the upper or lower respiratory tract, or both, for example, by nasal inhalation. The portion of the lung to which the drug is delivered is determined by the lesion. The composition comprising the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, may include a moisturizing agent, particularly when intranasal delivery is used. This may help reduce or prevent drying of the mucous membrane and prevent membrane irritation. Suitable moisturizing agents include, for example, sorbitol, mineral oil, vegetable oil, and glycerin; soothing agents; membrane conditioners; sweeteners; and combinations thereof. The composition may include a surfactant. Suitable surfactants include nonionic surfactants, anionic surfactants, and cationic surfactants. Examples of surfactants used include, for example, Tween 80, polyoxyl 40 stearate, polyoxyethylene 50 stearate, fusidates, bile salts, and octoxynol, for example, polyoxyethylene derivatives of partial fatty acid esters of sorbitol anhydride.

[0245] In some cases, subsequent administration of the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, may be performed after the initial administration. The administration may be, for example, at least one week, two weeks, one month, two months, six months, one year or more after the initial administration. In some cases, the nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector of the present invention, is administered at least once every week, once every other week, once every month, every two months, every six months, every year, or more. Preferably, the administration is every six months, more preferably every year. The nucleic acid cassette or vector of the present invention, particularly the retroviral / lentiviral (e.g., SIV) vector, is administered at the indicated intervals, for example, when the effect of the previous administration is decreasing.

[0246] sequence homology Any of a variety of sequence alignment methods, including, but not limited to, global, local, and hybrid methods such as, for example, segmental methods, can be used to determine percent identity. Protocols for determining percent identity are routine procedures within the skill of those in the art. Global methods align sequences from the beginning to the end of the molecule, adding up the scores of each residue pair, and applying gap penalties to determine the best alignment. Non-limiting methods include, for example, CLUSTAL W (see, e.g., Julie D. Thompson et al., "CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position - Specific Gap Penalties and Weight Matrix Choice," 22(22), Nucleic Acids Research, 4673-4680 (1994)); and iterative refinement (see, e.g., Osamu Gotoh, "Significant Improvement in Accuracy of Multiple Proteins. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments," 264(4), J. Mol. Biol., 823-838 (1996)). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences.Non-limiting methods include, for example, the Match-box method (see, e.g., Eric Depiereux and Ernest Feytmans, "Match-Box: A Fundamentally New Algorithm for Simultaneous Alignment of Several Protein Sequences", 8(5), CABIOS, 501-509 (1992)); the Gibbs sampling method (see, e.g., CELawrence et al., "Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment", 262(5131), Science, 208-214 (1993)); the Align-M method (see, e.g., Ivo Van WaIIe et al., "Align -M - A New Algorithm for Multiple Alignment of Highly Divergent Sequences", 20(9), Bioinformatics, 1428-1435 (2004)).

[0247] Thus, percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio., 48:603-16, 1986; and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA, 89:10915-19, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment score using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix by Henikoff and Henikoff (ibid.), as shown below (amino acids are designated by standard single-letter code).

[0248] The "percent sequence identity" between two or more nucleic acid or amino acid sequences is a function of the number of identical positions shared by the sequences. Thus, percent identity is calculated as the number of identical nucleotides / amino acids divided by the total number of nucleotides / amino acids multiplied by 100. The calculation of percent sequence identity can also take into account the number of gaps and the length of each gap that need to be introduced to optimize the alignment of two or more sequences. The comparison of sequences and the determination of percent identity between two or more sequences are carried out using specific mathematical algorithms, such as BLAST, which are familiar to those skilled in the art.

[0249] Alignment scores for determining sequence identity ARNDCQEGHILKMFPSTWYV A4 R -1 5 N -2 0 6 D -2 -2 1 6 C0 -3 -3 -3 9 Q -1 1 0 0 -3 5 E -1 0 0 2 -4 2 5 G 0 -2 0 -1 -3 -2 -2 6 H -2 0 1 -1 -3 0 0 -2 8 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4 Thus, the percent identity is: [total number of identical matches] / [length of the longer sequence + number of gaps introduced into the longer sequence to align the two sequences] x 100 It is calculated as:

[0250] Substantially homologous polypeptides are characterized as those having one or more amino acid substitutions, deletions, or additions. These changes are preferably of a minor nature, being conservative amino acid substitutions (described herein) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically from 1 to about 30 amino acids; as well as small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, small linker peptides up to about 20-25 residues, or affinity tags.

[0251] In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline, and α-methylserine) are substituted for amino acid residues in the polypeptides of the invention. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids are substituted for amino acid residues in the polypeptides. The polypeptides of the invention can also include non-naturally occurring amino acid residues.

[0252] Non-naturally occurring amino acids include, but are not limited to, trans-3-methylproline, 2,4-methano-proline, cis-4-hydroxyproline, trans-4-hydroxyproline, N-methylglycine, allo-threonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins. For example, an in vitro system is utilized in which nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylated tRNAs are known in the art. The transcription and translation of plasmids containing nonsense mutations are carried out in a cell-free system that includes E. coli S30 extracts and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, e.g., Robertson et al., J. Am. Chem. Soc., 113:2722, 1991; Ellman et al., Methods Enzymol., 202:301, 1991; Chung et al., Science, 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA, 90:10145-9, 1993. In the second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNA (Turcatti et al., J. Biol. Chem., 271:1991-8, 1996). In a third method, E. coli cells are cultured in the absence of the natural amino acid to be replaced (e.g., phenylalanine) and in the presence of a desired unnatural amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The unnatural amino acid is incorporated into the polypeptide in place of its natural counterpart.See Koide et al., Biochem., 33:7470-6, 1994. Naturally occurring amino acid residues are converted to non-naturally occurring species by in vitro chemical modification. Chemical modification is combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci., 2:395-403, 1993).

[0253] A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids are substituted for amino acid residues in the polypeptides of the invention.

[0254] Essential amino acids within the polypeptides of the invention are identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science, 244:1081-5, 1989). Sites of biological interaction are also determined by physical analysis of structures determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, with mutation of amino acids at putative contact sites. See, e.g., de Vos et al., Science, 255:306-12, 1992; Smith et al., J. Mol. Biol., 224:899-904, 1992; Wlodaver et al., FEBS Lett., 309:59-64, 1992. Identification of essential amino acids is also inferred from analysis of homologies with related components of the polypeptides of the invention, such as translocation or protease components.

[0255] Multiple amino acid substitutions are made and examined using known mutagenesis and screening methods, such as those disclosed by Reidhaar-Olson and Sauer (Science, 241:53-7, 1988); or Bowie and Sauer (Proc. Natl. Acad. Sci. USA, 86:2152-6, 1989). Briefly, these authors disclose methods in which two or more positions within a polypeptide are simultaneously randomized, selected for functional polypeptides, and then the mutated polypeptides are sequenced to determine the spectrum of permissible substitutions at each position. Other methods in use include phage display (e.g., Lowman et al., Biochem., 30:10832-7, 1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO Publication No. WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., Gene, 46:145, 1986; Ner et al., DNA, 7:127, 1988).

[0256] Multiple amino acid substitutions are made and examined using known mutagenesis and screening methods, such as those disclosed by Reidhaar-Olson and Sauer (Science, 241:53-7, 1988); or Bowie and Sauer (Proc. Natl. Acad. Sci. USA, 86:2152-6, 1989). Briefly, these authors disclose methods in which two or more positions within a polypeptide are simultaneously randomized, selected for functional polypeptides, and then the mutated polypeptides are sequenced to determine the spectrum of permissible substitutions at each position. Other methods in use include phage display (e.g., Lowman et al., Biochem., 30:10832-7, 1991; Ladner et al., U.S. Pat. No. 5,223,409; Huse, WIPO Publication No. WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., Gene, 46:145, 1986; Ner et al., DNA, 7:127, 1988).

[0257] Sequence information Array solution SEQ ID NO:1 = Amino acid sequence of Wuhan-Hu-1 spike protein (encoded by pGM887 S-LV v01) SEQ ID NO:2 = Amino acid sequence of Wuhan Hu-1+Δ19aa (encoded by pGM896 S-LV v02) SEQ ID NO:3 = Amino acid sequence of S:G614 (encoded by pGM906 S-LV v01) SEQ ID NO:4 = Amino acid sequence of S:G614+Δ19aa (encoded by pGM907 S-LV v02) SEQ ID NO:5 = Amino acid sequence of S:Aus / VIC01 (encoded by pGM898 S-LV v01) SEQ ID NO:6 = Amino acid sequence of S:Aus / VIC01+Δ19aa (encoded by pGM904 S-LV v02) SEQ ID NO:7 = Amino acid sequence of S:B.1.1.7+Δ19aa (encoded by pGM965 S-LV v04) SEQ ID NO:8 = Amino acid sequence of S:B.1.1351+Δ19aa (encoded by pGM970 S-LV v04) SEQ ID NO:9 = Amino acid sequence of S:B.1.1.7 / B.1.1351 chimera + Δ19aa (encoded by pGM1000 S-LV v02) SEQ ID NO:10 = Amino acid sequence of S:B.1.617.2+Δ19aa (encoded by pGM1027 S-LV v02) SEQ ID NO:11 = Amino acid sequence of C.37+Δ19aa (encoded by pGM1028 S-LV v02) SEQ ID NO:12 = Amino acid sequence of maS:Y498,T499+Δ19aa (encoded by pGM937 S-LV v03) SEQ ID NO:13 = Amino acid sequence of maS:Y498,T499,G614+Δ19aa (encoded by pGM939 S-LV v03) SEQ ID NO:14 = Amino acid sequence of maS:Aus / VIC01,Y498,T499+Δ19aa (encoded by pGM938 S-LV v03) SEQ ID NO:15 = Amino acid sequence of S:B.1.617.2, Y501+Δ19aa (encoded by pGM1038 S-LV v04) SEQ ID NO:16 = Amino acid sequence of C.37, Y501 + Δ19aa (encoded by pGM1039 S-LV v05) SEQ ID NO:17 = Amino acid sequence of S:B.1.617.2, Y489, T499, Y501 + Δ19aa (encoded by pGM1040 S-LV v04) SEQ ID NO:18 = Amino acid sequence of C.37, Y489, T499, Y501 + Δ19aa (encoded by pGM1041 S-LV v05) SEQ ID NO:19 = Amino acid sequence of maS:Y498,T499,Y501+Δ19aa (encoded by pGM998 S-LV v05) SEQ ID NO:20 = Amino acid sequence of maS: Y498, T499, Y501, G614 + Δ19aa (encoded by pGM999 S-LV v05) SEQ ID NO:21 = Amino acid sequence of S:G614 with furin site knocked out (encoded by pGM1026 S-LV v05) SEQ ID NO:22 = Nucleic acid sequence of Wuhan-Hu-1 spike protein (contained within pGM887 S-LV v01) SEQ ID NO:23 = Nucleic acid sequence of Wuhan Hu-1+Δ19aa (contained within pGM896 S-LV v02) SEQ ID NO:24 = Nucleic acid sequence of S:G614 (contained within pGM906 S-LV v01) SEQ ID NO:25 = Nucleic acid sequence of S:G614+Δ19aa (contained within pGM907 S-LV v02) SEQ ID NO:26 = Nucleic acid sequence of S:Aus / VIC01 (contained within pGM898 S-LV v01) SEQ ID NO:27 = Nucleic acid sequence of S:Aus / VIC01+Δ19aa (contained within pGM904 S-LV v02) SEQ ID NO:28 = Nucleic acid sequence of S:B.1.1.7+Δ19aa (contained within pGM965 S-LV v04) SEQ ID NO:29 = Nucleic acid sequence of S:B.1.1351+Δ19aa (contained within pGM970 S-LV v04) SEQ ID NO:30 = Nucleic acid sequence of S:B.1.1.7 / B.1.1351 chimera + Δ19aa (contained within pGM1000 S-LV v02) SEQ ID NO:31 = Nucleic acid sequence of S:B.1.617.2+Δ19aa (contained within pGM1027 S-LV v02) SEQ ID NO:32 = Nucleic acid sequence of C.37+Δ19aa (contained within pGM1028 S-LV v02) SEQ ID NO:33 = Nucleic acid sequence of maS:Y498,T499+Δ19aa (contained within pGM937 S-LV v03) SEQ ID NO:34 = Nucleic acid sequence of maS:Y498,T499,G614+Δ19aa (contained within pGM939 S-LV v03) SEQ ID NO:35 = Nucleic acid sequence of maS:Aus / VIC01,Y498,T499+Δ19aa (contained within pGM938 S-LV v03) SEQ ID NO:36 = Nucleic acid sequence of S:B.1.617.2, Y501+Δ19aa (contained within pGM1038 S-LV v04) SEQ ID NO:37 = Nucleic acid sequence of C.37, Y501+Δ19aa (contained within pGM1039 S-LV v05) SEQ ID NO:38 = Nucleic acid sequence of S:B.1.617.2, Y489, T499, Y501 + Δ19aa (contained within pGM1040 S-LV v04) SEQ ID NO:39 = Nucleic acid sequence of C.37, Y489, T499, Y501 + Δ19aa (contained within pGM1041 S-LV v05) SEQ ID NO:40 = Nucleic acid sequence of maS:Y498,T499,Y501+Δ19aa (contained within pGM998 S-LV v05) SEQ ID NO:41 = Nucleic acid sequence of maS:Y498, T499, Y501, G614 + Δ19aa (contained within pGM999 S-LV v05) SEQ ID NO:42 = Nucleic acid sequence of S:G614 with the Furin site knocked out (contained within pGM1026 S-LV v05) SEQ ID NO: 43 = hCEF promoter SEQ ID NO:44 = CMV promoter SEQ ID NO:45 = human elongation factor 1a (EF1a) promoter SEQ ID NO:46 = WPRE component (mWPRE) SEQ ID NO: 47 = Forward primer for (co)hACE2 SEQ ID NO: 48 = Reverse primer for (co)hACE2 SEQ ID NO: 49 = forward primer SEQ ID NO:50 = reverse primer SEQ ID NO:51 = Forward primer for hTMPRSS2 SEQ ID NO:52 = Reverse primer for hTMPRSS2 SEQ ID NO:53 = forward primer SEQ ID NO:54 = reverse primer SEQ ID NO:55 = Forward primer for SARS-CoV-2(co)S (Wuhan Hu-1) SEQ ID NO:56 = Reverse primer for SARS-CoV-2(co)S (Wuhan Hu-1) SEQ ID NO:57 = Forward primer for SARS-CoV-2(co)S(Wuhan Hu-1)Δ19 SEQ ID NO:58 = Reverse primer for SARS-CoV-2(co)S(Wuhan Hu-1)Δ19 SEQ ID NO:59 = Forward primer for SARS-CoV-2 S Australia / VIC01 / 2020 SEQ ID NO:60 = Reverse primer for SARS-CoV-2 S Australia / VIC01 / 2020 SEQ ID NO:61 = Forward primer for SARS-CoV-2 D614G mutant strain SEQ ID NO:62 = Reverse primer for SARS-CoV-2 D614G mutant strain SEQ ID NO:63 = Forward primer for SARS-CoV-2 S mACE2 adaptation SEQ ID NO:64 = Reverse primer for SARS-CoV-2 S mACE2 adaptation

[0258] array SEQ ID NO:1 = Amino acid sequence of Wuhan-Hu-1 spike protein (encoded by pGM887 S-LV v01) Please refer to Figure 3 SEQ ID NO:2 = Amino acid sequence of Wuhan Hu-1+Δ19aa (encoded by pGM896 S-LV v02) Please refer to Figure 3 SEQ ID NO:3 = Amino acid sequence of S:G614 (encoded by pGM906 S-LV v01) Please refer to Figure 3 SEQ ID NO:4 = Amino acid sequence of S:G614+Δ19aa (encoded by pGM907 S-LV v02) Please refer to Figure 3 SEQ ID NO:5 = Amino acid sequence of S:Aus / VIC01 (encoded by pGM898 S-LV v01) Please refer to Figure 3 SEQ ID NO:6 = Amino acid sequence of S:Aus / VIC01+Δ19aa (encoded by pGM904 S-LV v02) Please refer to Figure 3 SEQ ID NO:7 = Amino acid sequence of S:B.1.1.7+Δ19aa (encoded by pGM965 S-LV v04) Please refer to Figure 3 SEQ ID NO:8 = Amino acid sequence of S:B.1.1351+Δ19aa (encoded by pGM970 S-LV v04) Please refer to Figure 3

[0259] SEQ ID NO:9 = Amino acid sequence of S:B.1.1.7 / B.1.1351 chimera + Δ19aa (encoded by pGM1000 S-LV v02)

[0260] SEQ ID NO:10 = Amino acid sequence of S:B.1.617.2+Δ19aa (encoded by pGM1027 S-LV v02)

[0261] SEQ ID NO:11 = Amino acid sequence of C.37+Δ19aa (encoded by pGM1028 S-LV v02)

[0262] SEQ ID NO:12 = Amino acid sequence of maS:Y498,T499+Δ19aa (encoded by pGM937 S-LV v03) Please refer to Figure 3 SEQ ID NO:13 = Amino acid sequence of maS:Y498,T499,G614+Δ19aa (encoded by pGM939 S-LV v03) Please refer to Figure 3 SEQ ID NO:14 = Amino acid sequence of maS:Aus / VIC01,Y498,T499+Δ19aa (encoded by pGM938 S-LV v03) Please refer to Figure 3

[0263] SEQ ID NO:15 = Amino acid sequence of S:B.1.617.2, Y501+Δ19aa (encoded by pGM1038 S-LV v04)

[0264] SEQ ID NO:16 = Amino acid sequence of C.37, Y501 + Δ19aa (encoded by pGM1039 S-LV v05)

[0265] SEQ ID NO:17 = Amino acid sequence of S:B.1.617.2, Y498, T499, Y501 + Δ19aa (encoded by pGM1040 SLV v04)

[0266] SEQ ID NO:18 = Amino acid sequence of C.37, Y489, T499, Y501 + Δ19aa (encoded by pGM1041 S-LV v05)

[0267] SEQ ID NO:19 = Amino acid sequence of maS:Y498,T499,Y501+Δ19aa (encoded by pGM998 S-LV v05)

[0268] SEQ ID NO:20 = Amino acid sequence of maS: Y498, T499, Y501, G614 + Δ19aa (encoded by pGM999 S-LV v05) Please refer to Figure 3

[0269] SEQ ID NO:21 = Amino acid sequence of S:G614 with furin site knocked out (encoded by pGM1026 S-LV v05)

[0270] SEQ ID NO:22 = Nucleic acid sequence of Wuhan-Hu-1 spike protein (contained within pGM887 S-LV v01) Please refer to Figure 2 SEQ ID NO:23 = Nucleic acid sequence of Wuhan Hu-1+Δ19aa (contained within pGM896 S-LV v02) Please refer to Figure 2 SEQ ID NO:24 = Nucleic acid sequence of S:G614 (contained within pGM906 S-LV v01) Please refer to Figure 2 SEQ ID NO:25 = Nucleic acid sequence of S:G614+Δ19aa (contained within pGM907 S-LV v02) Please refer to Figure 2 SEQ ID NO:26 = Nucleic acid sequence of S:Aus / VIC01 (contained within pGM898 S-LV v01) Please refer to Figure 2 SEQ ID NO:27 = Nucleic acid sequence of S:Aus / VIC01+Δ19aa (contained within pGM904 S-LV v02) Please refer to Figure 2 SEQ ID NO:28 = Nucleic acid sequence of S:B.1.1.7+Δ19aa (contained within pGM965 S-LV v04) Please refer to Figure 2 SEQ ID NO:29 = Nucleic acid sequence of S:B.1.1351+Δ19aa (contained within pGM970 S-LV v04) Please refer to Figure 2

[0271] SEQ ID NO:30 = Nucleic acid sequence of S:B.1.1.7 / B.1.1351 chimera + Δ19aa (contained within pGM1000 S-LV v02)

[0272] SEQ ID NO:31 = Nucleic acid sequence of S:B.1.617.2+Δ19aa (contained within pGM1027 S-LV v02)

[0273] SEQ ID NO:32 = Nucleic acid sequence of C.37+Δ19aa (contained within pGM1028 S-LV v02)

[0274] SEQ ID NO:33 = Nucleic acid sequence of maS:Y498,T499+Δ19aa (contained within pGM937 S-LV v03) Please refer to Figure 2 SEQ ID NO:34 = Nucleic acid sequence of maS:Y498,T499,G614+Δ19aa (contained within pGM939 S-LV v03) Please refer to Figure 2 SEQ ID NO:35 = Nucleic acid sequence of maS:Aus / VIC01,Y498,T499+Δ19aa (contained within pGM938 S-LV v03) Please refer to Figure 2

[0275] SEQ ID NO:36 = Nucleic acid sequence of S:B.1.617.2, Y501+Δ19aa (contained within pGM1038 S-LV v04)

[0276] SEQ ID NO:37 = Nucleic acid sequence of C.37, Y501+Δ19aa (contained within pGM1039 S-LV v05)

[0277] SEQ ID NO:38 = Nucleic acid sequence of S:B.1.617.2, Y484, T499, Y501 + Δ19aa (contained within pGM1040 S-LV v04)

[0278] SEQ ID NO:39 = Nucleic acid sequence of C.37, Y489, T499, Y501 + Δ19aa (contained within pGM1041 S-LV v05)

[0279] SEQ ID NO:40 = Nucleic acid sequence of maS:Y498,T499,Y501+Δ19aa (contained within pGM998 S-LV v05)

[0280] SEQ ID NO:41 = Nucleic acid sequence of maS:Y498, T499, Y501, G614 + Δ19aa (contained within pGM999 S-LV v05) Please refer to Figure 2

[0281] SEQ ID NO:42 = Nucleic acid sequence of S:G614 with the Furin site knocked out (contained within pGM1026 S-LV v05)

[0282] SEQ ID NO: 43 = hCEF promoter 1 AGATCTGTTA CATAACTTAT GGTAAATGGC CTGCCTGGCT GACTGCCCAA TGACCCCTGC 61 CCAATGATGT CAATAATGAT GTATGTTCCC ATGTAATGCC AATAGGGACT TTCCATTGAT 121 GTCAATGGGT GGAGTATTTA TGGTAACTGC CCACTTGGCA GTACATCAAG TGTATCATAT 181 GCCAAGTATG CCCCCTATTG ATGTCAATGA TGGTAAATGG CCTGCCTGGC ATTATGCCCA 241 GTACATGACC TTATGGGACT TTCCTACTTG GCAGTACATC TATGTATTAG TCATTGCTAT 301 TACCATGGGA ATTCACTAGT GGAGAAGAGC ATGCTTGAGG GCTGAGTGCC CCTCAGTGGG 361 CAGAGAGCAC ATGGCCCACA GTCCCTGAGA AGTTGGGGGG AGGGGTGGGC AATTGAACTG 421 GTGCCTAGAG AAGGTGGGGC TTGGGTAAAC TGGGAAAGTG ATGTGGTGTA CTGGCTCCAC 481 CTTTTTCCCC AGGGTGGGGG AGAACCATAT ATAAGTGCAG TAGTCTCTGT GAACATTCAA 541 GCTTCTGCCT TCTCCCTCCT GTGAGTTTGC TAGC

[0283] SEQ ID NO: 44 = CMV promoter CCGCGGAGATCTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCT ATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACC GCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCA TATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCC CATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGT GGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATT GACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTT GGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCG TGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGG CACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGC GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGC GGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGC AGAAGTTGGTCGTGAGGCACTGGGCAGGCTAGC

[0284] SEQ ID NO: 45 = Human elongation factor 1a (EF1a) promoter AGATCCATATCCGCGGCAATTTTAAAAGAAAGGGAGGAATAGGGGGACAGACTTCAGCAGAGAGACTAATTAATATAATAACAACACAATTAGAAATACAACATTTACAAACCAAAATTCAAAAAATTTTAAATTTTAGAGCCGCGGAGATCCCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTAGC

[0285] Sequence number 46 = WPRE component (mWPRE) 1 GGGCCCAATC AACCTCTGGA TTACAAAATT TGTGAAAGAT TGACTGGTAT TCTTAACTAT 61 GTTGCTCCTT TTACGCTATG TGGATACGCT GCTTTAATGC CTTTGTATCA TGCTATTGCT 121 TCCCGTATGG CTTTCATTTT CTCCTCCTTG TATAAATCCT GGTTGCTGTC TCTTTATGAG 181 GAGTTGTGGC CCGTTGTCAG GCAACGTGGC GTGGTGTGCA CTGTGTTTGC TGACGCAACC 241 CCCACTGGTT GGGGCATTGC CACCACCTGT CAGCTCCTTT CCGGGACTTT CGCTTTCCCC 301 CTCCCTATTG CCACGGCGGA ACTCATCGCC GCCTGCCTTG CCCGCTGCTG GACAGGGGCT 361 CGGCTGTTGG GCACTGACAA TTCCGTGGTG TTGTCGGGGA AATCATCGTC CTTTCCTTGG 421 CTGCTCGCCT GTGTTGCCAC CTGGATTCTG CGCGGGACGT CCTTCTGCTA CGTCCCTTCG 481 GCCCTCAATC CAGCGGACCT TCCTTCCCGC GGCCTGCTGC CGGCTCTGCG GCCTCTTCCG 541 CGTCTTCGCC TTCGCCCTCA GACGAGTCGG ATCTCCCTTT GGGCCGCCTC CCCGCAAGCT

[0286] SEQ ID NO: 47 = Forward primer for (co)hACE2 CGA TCT AGA GAA ACT TGT TTG CAC GT SEQ ID NO: 48 = Reverse primer for (co)hACE2 CGA TCT AGA GAA ACT TGT TTG CAC GT SEQ ID NO: 49 = forward primer CGA CTC TAG AGT CGA CGG TT SEQ ID NO:50 = reverse primer GAT GCG GCC GCT TCA GGC ACC GGG CTT G SEQ ID NO:51 = Forward primer for hTMPRSS2 AAT GCT AGC CAC CAT GGC TTT GAA CTC AG SEQ ID NO:52 = Reverse primer for hTMPRSS2 GTC TCT AGA GCC GTC TGC CCT CAT TT SEQ ID NO:53 = forward primer ACG TCT AGA GCA ACA AAC TTC TCT CTG CT SEQ ID NO:54 = reverse primer TAT GCG GCC GCT TAG CCC TCC CAC ACA TAA C SEQ ID NO:55 = Forward primer for SARS-CoV-2(co)S (Wuhan Hu-1) CAG GCT AGC CAC CAT GTT CGT GTT CCT GGT SEQ ID NO:56 = Reverse primer for SARS-CoV-2(co)S (Wuhan Hu-1) ATA GCG GCC GCT CAG GTG TAG TGC AGC TTC AC SEQ ID NO:57 = Forward primer for SARS-CoV-2(co)S(Wuhan Hu-1) Δ19 CAG GCT AGC CAC CAT GTT CGT GTT CCT GGT SEQ ID NO:58 = Reverse primer for SARS-CoV-2(co)S(Wuhan Hu-1) Δ19 ATA GCG GCC GCT TCA GCA GCA GGA CCC ACA CGA ACA SEQ ID NO:59 = Forward primer for SARS-CoV-2 S Australia / VIC01 / 2020 CCT GCA CAG AAA GTA TCT TAC ACC AGG CGA TTC SEQ ID NO:60 = Reverse primer for SARS-CoV-2 S Australia / VIC01 / 2020 GCC AGC AGG GTC TGG AAT SEQ ID NO:61 = Forward primer for SARS-CoV-2 D614G mutant strain GCT GTA CCA GGG CGT GAA TTG C SEQ ID NO:62 = Reverse primer for SARS-CoV-2 D614G mutant strain ACG GCC ACC TGA TTG CTG SEQ ID NO:63 = Forward primer for SARS-CoV-2 S mACE2 adaptation CTA CGG CTT CTA TAC TAC CAA TGG CG SEQ ID NO:64 = Reverse primer for SARS-CoV-2 S mACE2 adaptation CTC TGC AGA GGG AAG TAG

[0287] Working Example The present invention will now be described by reference to the following examples. These are not limitations on the scope of the invention, and those skilled in the art will understand that appropriate equivalents are used within the scope of the invention. Thus, the examples are considered to be part of the invention, and each aspect described in the examples is considered to be as disclosed independently or in any combination.

[0288] material and method Synthetic cDNA sequences, plasmids, cloning, and site-directed mutagenesis Human (h)ACE2 cDNA (NM_021804.2) was codon-optimized for expression in humans ((co)hACE2) using the Java Codon Adaptation Tool (JCat; http: / / www.jcat.de / CAICalculation.jsp) and synthesized as a cloning plasmid (pGM845) with restriction enzyme sites 5'NheI and 3'PspOMI by Twist Bioscience (https: / / www.twistbioscience.com / products / genes). Mouse (m)ACE2 (NM_001130513.1) was codon-optimized for expression in humans ((co)mACE2), with its canonical stop codon deleted and restriction sites 5'NheI and 3'XbaI added, using GeneArt Gene Synthesis services (https: / / www.thermofisher.com / order / geneartgenes). The hTMPRSS2 cDNA was encoded by pCSDest-hTMPRSS2 and was a kind gift from Roger Reeves (Addgene, 53887; http: / / n2t.net / addgene:53887; RRID:Addgene_53887). The plasmids OCT4-F2A-Puromycin resistance (puroR) and pHIV1.EF1a-spCas9-FLAG-P2A-Blasticidin resistance (BSR)-WPRE were kind gifts from Jacob Hanna (Addgene, 52379; http: / / n2t.net / addgene:52379; RRID:Addgene_52379) and Feng Zhang (Addgene, 52962; http: / / n2t.net / addgene:52962; RRID:Addgene_52962), respectively.Codon-optimized SARS-CoV-2 Spike ((co)S), derived from the Wuhan Hu-1 strain sequence, was provided in the expression vector pcDNA3.1(+)SARS-CoV-2(co)SWuhanHu-1-Strep tag II and was a kind gift from Nigel Temperton, University of Kent. Partial SARS-CoV-2(co)S sequences (derived from and encompassing 5'NheI and 3'SbfI) encompassing mutations in the S protein defining the alpha (B.1.1.7:Δ69-70, Δ145, N501Y, A570D, D614G, 9681H, T716I, S982A, D1118H) and beta (B.1.351:D80A, D215G, K417N, E484K, N501Y, D614G, A701V) VOCs were synthesized as cloning plasmids (pGM964 and pGM969, respectively) by Twist Bioscience.

[0289] Third generation self-inactivating (SIN) LV vector plasmids included the LV genomes, pGM285 (pHIV1 CMV eGFP WPRE), pGM836 (HIV1 CMV Firefly Luciferase [FLuc] WPRE), pGM849 (pHIV1 CMV(co)hACE2-F2A-puroR WPRE), pGM889 (pHIV1 CMV hTMPRSS2-P2A-BSR WPRE), and pGM943 (pHIV1 CMV(co)mACE2-F2A-puroR WPRE), as described below. Additionally, HIV1 packaging plasmids included pMDLg / pRRE (HIV1 Gag-Pol) and pRSV-Rev (HIV1 Rev), kindly provided by Didier Trono (Addgene:12251; http: / / n2t.net / addgene:12251; RRID:Addgene_12251, and Addgene:12253; http: / / n2t.net / addgene:12253; RRID:Addgene_12253, respectively). Finally, the envelope plasmids incorporate pMD2-G encoding VSVg, a gift from Didier Trono (Addgene:12259; http: / / 623n2t.net / addgene:12259; RRID:Addgene_12259), and pGM887, pGM896, pGM898, pGM904, pGM906, pGM907, pGM937, pGM939, pGM965, and pGM970, as described below.

[0290] (co)hACE2 cDNA was PCR amplified from pGM845 as an NheI-XbaI fragment (using primer pair: 5'CGA TCT AGA GAA ACT TGT TTG CAC GT 3' (SEQ ID NO: 47) and 5'CGA TCT AGA GAA ACT TGT TTG CAC GT 3' (SEQ ID NO: 48)) with its wild type stop codon deleted, and (co)hACE2-F2A-puroR was PCR amplified from pGM845 as an NheI-XbaI fragment (using primer pair: 5'CGA TCT AGA GAA ACT TGT TTG CAC GT 3' (SEQ ID NO: 49) and 5'CGA TCT AGA GAA ACT TGT TTG CAC GT 3' (SEQ ID NO: 50)) with T4 DNA ligase (NEB) to assemble into the final NheI-NotI fragment, (co)hACE2-F2A-puroR. 3' (using SEQ ID NO:50)) was ligated with the F2A-puroR sequence, which had been PCR amplified as an XbaI-NotI fragment. hTMPRSS2 cDNA was PCR amplified from pCSDest-hTMPRSS2 as an NheI-XbaI fragment (using primer pair: 5' AAT GCT AGC CAC CAT GGC TTT GAA CTC AG 3' (SEQ ID NO: 51) and 5' GTC TCT AGA GCC GTC TGC CCT CAT TT 3' (SEQ ID NO: 52)) to delete its wild type stop codon, and ligated with pHIV1.EF1a-spCas9-FLAG-P2A-BSR-WPRE (primer pair: 5' ACG TCT AGA GCA ACA AAC TTC TCT CTG CT 3' (SEQ ID NO: 53) and 5' TAT GCG GCC GCT TAG CCC TCC CAC ACA TAA CTC TCT CTG CT 3' (SEQ ID NO: 54)) with T4 DNA ligase to assemble hTMPRSS2-P2A-BSR as the final NheI-NotI fragment. 3' (using SEQ ID NO:54)) was ligated with the P2A-BSR sequence, which had been PCR amplified as an XbaI-NotI fragment.The assembled cDNA was gel purified and cloned into the HIV lentiviral vector genome plasmid pGM836 via the restriction enzyme sites NheI and NotI using T4 DNA ligase (NEB) to generate the LV genome plasmids pGM849 (pHIV1 CMV(co)hACE2-F2A-puroR WPRE) and pGM889 (pHIV1 CMV hTMPRSS2-P2A-BSR WPRE). The (co)mACE2 sequence was cloned from pGM942 as an NheI-XbaI fragment into the pGM849 backbone using T4 DNA ligase, keeping the (co)mACE2 sequence in frame with the open reading frame of F2A-puroR to generate the LV genome plasmid pGM943 (pHIV1 CMV(co)mACE2-F2A-puroR-WPRE). pcDNA3.1-SARS-CoV-2(co)S. Wuhan Hu-1-Strep tag II The template was either the full-length cDNA of 647 (using primer pair: 5'CAG GCT AGC CAC CAT GTT CGT GTT CCT GGT 3' (SEQ ID NO: 55), and 5'ATA GCG GCC GCT CAG GTG TAG TGC AGC TTC AC 3' (SEQ ID NO: 56); based on YP_009724390.1 to recover the SARS-CoV-2 S cDNA), or a deletion of the 3' end corresponding to the extreme C-terminal 19 amino acids and the endoplasmic reticulum retention signal (+Δ19aa; using primer pair: 5'CAG GCT AGC CAC CAT GTT CGT GTT CCT GGT 3' (SEQ ID NO: 57), and 5'ATA GCG GCC GCT TCA GCA GGA CCC ACA CGA ACA 3' (SEQ ID NO: 58)) to generate SARS-CoV-2(co)S (Wuhan The Hu-1) sequence was PCR amplified as an NheI-NotI cloning fragment and cloned into the envelope plasmid, pCAGG-coFct4.1 backbone (pGM321), to create the envelope plasmid, pCAG.SARS-CoV-2(co)S Wuhan Hu-1 (pGM887) and (co)S Wuhan Hu-1+Δ19aapGM887 was used as a template to model the SARS-CoV-2 S Australia / VIC01 / 2020 (Aus / VIC01; S247R) and D614G mutants by Q5® Site Directed Mutagenesis (SDM; NEB) using primer pairs: 5'CCT GCA CAG AAA GTA TCT TAC ACC AGG CGA TTC 3' (SEQ ID NO: 59), and 5'GCC AGC AGG GTC TGG AAT 3' (SEQ ID NO: 60), or 5'GCT GTA CCA GGG CGT GAA TTG C 3' (SEQ ID NO: 61), and 5'ACG GCC ACC TGA TTG CTG 3', (SEQ ID NO: 62), respectively. The NheI-BstBI or KpnI-SbfI fragments (containing the mutations conferring S247R and D614G) were subcloned back into pGM887 and pGM896, respectively, using DNA ligase to create the envelope plasmids pCAGG-SARS-CoV-2(co)S, respectively. Aus / VIC01 (pGM898) and pCAGG-SARS-CoV-2(co)S Aus / VIC01+Δ19aa (pGM904), or pCAGG-SARS-CoV-2(co)S, respectively. G614 (pGM906) and pCAGG-SARS-CoV-2(co)S G614+Δ19aa Sequences encompassing the SARS-CoV-2 VOCs B.1.1.7 and B.1.351 were subcloned back into the pGM907 backbone from plasmids pGM964 and pGM969 (respectively) as NheI-SbfI fragments to generate the envelope plasmids pCAGG-SARS-CoV-2(co)S, respectively. B.1.1.7+Δ19aa (pGM965) and (co)S B.1.351+Δ19aaFinally, the primer pair 5'CTA CGG CTT CTA TAC CAA TGG CG 3' (SEQ ID NO: 63) and 5'CTC TGC AGA GGG AAG TAG 3' (SEQ ID NO: 64) were used with plasmids pGM896 and pGM907 as templates to mediate the mutations Q498Y and P499T to confer SARS-CoV-2 S mACE2-dominated (maS), which were then subcloned as BstBI and KpnI fragments into the backbone pGM896 and pGM907, respectively, using T4 DNA ligase to generate the envelope plasmid pCAGG-SARS-CoV-2 maS. Wuhan Hu-1,Y498,T499+Δ19aa (pGM937) and pCAGG-SARS-CoV-2 maS Y498,T499,G614+Δ19aa (pGM939) was produced.

[0291] Cell lines and culture conditions Human embryonic kidney (HEK) 293T / 17 cells (ATC® CRL-11268™) and derived cells described herein were cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Sigma-Aldrich), 1% penicillin-streptomycin (Gibco), and GlutaMAX™ (Gibco) at 37° C. and 5% CO2 atmosphere. Stable (co)hACE2 with or without hTMPRSS2 cell lines, where applicable, were cultured in complete DMEM supplemented with 3 μg / mL puromycin (MP Biomedicals) with or without 5 μg / mL blasticidin S (Gibco) as above. (HEK)293T / 17SF (ATCC® ACS-4500™) were cultured in FreeStyle™ 293 Expression Medium (Gibco) at 37° C. in an 8% CO atmosphere and with orbital shaking at 125 rpm.

[0292] Generation of third-generation SIN rHIV1 LV The generation of S-LV and rHIV1.VSVg LV was performed by co-transfection of human embryonic kidney (HEK) 293T / 17 SF suspension cells with third generation SIN rHIV1 LV vector genome plasmids encoding the reporter genes of interest (indicated enhanced green fluorescent protein: eGFP, or firefly luciferase: FLuc), HIV1 GagPol, pMDLg / pRRE, and HIV1 Rev, pRSV-Rev, using PEIpro® (Polyplus). VSVg pseudotyped LV was achieved by co-transfection with pMD2-G; for SARS-CoV-2 S-LV pseudotype, the pMD2-G plasmid was replaced with the SARS-CoV-2 S-LV pseudotype plasmid described in Synthetic cDNA sequences, plasmids, cloning, and site-directed mutagenesis. Approximately 16 hours after transfection, cells were fed with FreeStyle™ 293 Expression Medium supplemented with sodium butyrate (Sigma-Aldrich) to a final concentration of 5 mM. Transfected cells were cultured for a total of 72 hours (or as otherwise stated), at which point LV-containing culture medium was harvested. LV-containing supernatants were then treated with 50 U / mL Benzonase (Merck) in the presence of 1 mM MgCl2 (Gibco) for 1 hour at 37°C. If indicated, LV-containing supernatants were further centrifuged at 4,650×g for 24 hours at 4°C or purified by anion exchange chromatography (AEX) and tangential flow filtration (TFF). In all cases, LV material was filter sterilized and stored at -80°C.

[0293] Expression and syncytial studies of SARS-CoV-2 S pseudotypes The next day, 293T / 17 cells were seeded into 24-well plates at approximately 70% confluency. Cells were transfected with 200 ng of pCMVIE+eGFP plasmid per well and 100 ng of the indicated SARS-CoV-2 S pseudotyped plasmid. Mock transfection was accompanied by co-transfection with 200 ng of pCAGG-eGFP plasmid. Transfection was performed using FuGENE 6 with a 1:2 ratio of plasmid to FuGENE 6 reagent. Cells were visualized at the indicated post-transfection time points and eGFP fluorescent images were captured using an EVOS™ FL Auto 2 fluorescent microscope (Thermo Scientific™).

[0294] Establishment of SARS-CoV-2 S-LV permissive cell lines The next day, 293T / 17 cells were seeded into 6-well plates at approximately 30-40% confluency. Crude rHIV1(VSVg)CMV(co)mACE2-F2A-puroR WPRE LV or crude rHIV1(VSVg)CMV(co)hACE2-F2A-puroR WPRE LV diluted in OptiMEM-I (Gibco) were transduced into cells for 6 h at 37°C, 5% CO2, in the presence of 8 μg / mL polybrene (Sigma-Aldrich), after which the medium was replaced with culture medium. Transduced cells were incubated at 37°C for 6 h at 5% CO2. 2The cells were cultured at 37°C for a total of 72 hours, and 3 μg / mL puromycin (MP Biomedicals) was added to the culture medium to select for puromycin-resistant cells. The cells were maintained in culture medium with 3 μg / mL puromycin for several passages to establish (co)hACE2-only or (co)mACE2-only cell lines. After this, both cell lines were seeded and transduced with rHIV1(VSVg)CMV hTMPRSS2-P2A-BSR WPRE LV as described above into these cell lines. To select for puromycin-resistant and blasticidin-resistant cells, the cells were selected with culture medium supplemented with 3 μg / mL puromycin and 5 ug / mL blasticidin (Gibco). The cells were maintained in culture medium with 3 μg / mL puromycin and 5 μg / mL blasticidin for several passages to establish cell lines co-expressing (co)hACE2 and hTMPRSS2 or (co)mACE2 and hTMPRSS2.

[0295] LV transduction and titration The following day, for transduction and LV titration experiments, the indicated cell lines were seeded into 24-well plates at approximately 30-40% confluency. On the day of transduction, cells were counted and medium aspirated. LV inocula (pseudotypes as indicated) diluted in OptiMEM-I were transduced into cells in the presence of 8 μg / mL polybrene to achieve the required multiplicity of infection (MOI) or dilution series. Cells were incubated with the diluted vector inocula for 6 hours, after which the transduction mix was replaced with culture medium. After a total of 48-72 hours, cells were subjected to flow cytometry as described below. Only transductions between 2-20%, inclusive, were analyzed for titer calculations. Titers were calculated according to the formula: where N is the number of cells counted at the time of transduction, P is the percentage of eGFP positive cells, DF is the dilution factor applied at the time of transduction, V is the total volume (mL) of vector inoculum per well, and IU is the infectious unit. Alternatively, for vectors encoding firefly luciferase, LV material was subjected to HIV1 p24 ELISA (SEK11695, SinoBiological) to measure p24 concentration according to the manufacturer's instructions with the minor modification that prior to serial dilution, vector material was dissolved in a minimum volume of assay dilution buffer with 0.5% Triton™ X-100 for 15 min at room temperature.

[0296] In vitro S-LV neutralization assay The next day, 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2 were seeded into 24-well plates at approximately 30-40% confluency. On the day of transduction, culture medium was aspirated and cells were transduced with S-LV (indicated mutants) at an MOI of 1 (based on cell count) diluted in OptiMEM-I with polybrene to a final concentration of 8 μg / mL, together with nAbs (40591-MM43, SinoBiological; or 40592-R001, SinoBiological) or the corresponding human IgG isotype control (GTX35068, GeneTex), mouse IgG isotype control (MAB002, R&D Systems), or rabbit IgG isotype control (AB-105-C, R&D Systems). IgG titrations are indicated in the figure captions. Cells were incubated with the antibody:S-LV premix for 6 hours at 37° C. with 5% CO2. After this, the transduction mix was replaced with culture medium and cells were cultured for up to 72 hours. Cells were then subjected to flow cytometry as described below.

[0297] Western Blotting (WB) Purified S-LV or transduced / transfected cells and their appropriate controls (as indicated in the figure captions) were rapidly lysed at the indicated time points in ice-cold RIPA buffer (150 mM NaCl, 1% Triton™ X-100 [v / v], 0.5% sodium deoxycholate, 0.1% SDS [w / v], 50 mM Tris-HCl [pH 8.0] supplemented with protease inhibitor cocktail (Roche). Insoluble debris was pelleted at maximum speed for 30 min at 4°C and supernatants were measured for protein concentration by DC protein assay (Bio-Rad). After boiling samples in Laemlli Buffer with or without β-mercaptoethanol (Sigma-Aldrich) to a final concentration of 550 mM as indicated, protein lysates (or approximately 300 ng equivalent of p24 for purified S-LV) were separated via 10% SDS-PAGE. Proteins were then transferred to 0.45 μm nitrocellulose membranes and blocked with TBS-Tween® 20 (0.1%) and 5% milk for 2 hours. Blots were incubated overnight at room temperature with hACE2 (R&D Systems, AF933; 1:650), mACE2 (R&D Systems, AF3437; 1:1000), hTMPRSS2 (Abcam, ab242384; 1:2000), SARS-CoV-2 S2 (Thermo Fisher Scientific, MA5-35946[1A9]; 1:4000), VSVg (Santa Cruz, sc-365019[F-6]; 1:1000), HIV1 p24 (R&D The sections were then incubated with primary antibodies for mouse (Merck; MAB7360, 1:700), rabbit (Merck; CB1001, 1:20,000), or goat (Merck; CB1002, 1:20,000) at room temperature for 2 hours, followed by incubation with anti-mouse-HRP-conjugated secondary antibodies (Abcam; ab6789, 1:20,000), anti-rabbit-HRP-conjugated secondary antibodies (Abcam; ab6721, 1:20,000), or anti-goat-HRP-conjugated secondary antibodies (Abcam; ab6885 1:20,000), respectively, for 2 hours at room temperature.All antibodies were diluted in TBS-Tween20 (0.1%) / 5% milk. Blotted proteins were then detected via chemiluminescence with Clarity™ Western ECL Substrate (Bio-Rad). Chemiluminescent signals were visualized and captured on an iBright™ FL1000 (Invitrogen™).

[0298] Immunocytochemistry (ICC) Cell lines were seeded on sterile No. 1.0 coverslips in 24-well plates. Confluent cells and their appropriate controls (as indicated in the figure captions) were fixed in 4% final formaldehyde solution for 15 min at room temperature, then permeabilized with 0.1% Triton™ X-100 [v / v] solution for 20 min at room temperature. Cells were then blocked with blocking solution (5 mg / mL BSA [w / v], 5% FBS [v / v] in D-PBS) for 2 h with gentle agitation. Cells were then incubated overnight at 4° C. with primary antibodies: anti-ACE2 (AF933, 791; 1:100) or anti-TMPRSS2 (ab242384; 1:100). Then, after this, the cells were incubated with secondary anti-goat-Alexa-Fluor 488 conjugated secondary antibody (A11078, Invitrogen, 1:500) or anti-rabbit-Alexa-Fluor 488 conjugated secondary antibody (A11008, Invitrogen, 1:500) correspondingly at room temperature for 2 hours with gentle agitation. Between steps, the cells were washed five times with D-PBS. Parental 293T / 17 cells were also completely stained with anti-ACE2 or anti-TMPRSS2 and secondary antibodies corresponding to the threshold for non-specific primary antibody staining. The cells were washed five times with D-PBS, and then the coverslip was mounted onto a microscope slide with DAPI-containing mounting medium (Fluoroshield™; Sigma-Aldrich). Images were captured on an EVOS™ FL Auto 2 fluorescent microscope (Thermo Scientific™).

[0299] Flow cytometry Cells were harvested by washing with D-PBS (Gibco) and trypsinized to dissociate cells from well plates using TypLE Express (Gibco). Cells were then prepared by washing with D-PBS with centrifugation at 500×g for 5 minutes and fixed in formaldehyde solution with a final concentration of 2% for 15 minutes at room temperature. Fixative was removed, cells were washed and resuspended in D-PBS, and then subjected to flow cytometry using BD™ LSR II Flow Cytometer System. Data was analyzed using FlowJo™ v10.7 software.

[0300] animal research All procedures involving laboratory mice were performed in accordance with UK Home Office approved project and personal licenses under the terms of the Animals Scientific Procedures ACT 1986 (ASPA, 1986). All animal procedures were carried out at the University of Oxford's Biomedical Services (BMS) Unit, based at the John Radcliffe Hospital, Oxford, UK.

[0301] Administration of S-LV.FLuc and maS-LV.FLuc in vivo Female BALB / c mice (6 weeks old; Envigo RMS, UK) were administered the indicated S-LV.FLuc or maS-LV.FLuc vectors (corresponding to the indicated doses based on a quantification of p24 (40 or 166 ng) via nasal aspiration under light isoflurane anesthesia). S-LV.FLuc and maS-LV.FLuc were delivered directly to the nares via single and continuous instillations (100 μL total) by intranasal instillation (in). Control mice were instead administered 100 μL of LV formulation buffer (TSSM) in.

[0302] In vivo bioluminescence imaging and quantitative analysis At the indicated time points after administration of S-LV.FLuc, maS-LV.FLuc, or control TSSM as described in In vivo administration of S-LV.FLuc and maS-LV.FLuc, mice were administered 100 μL of 15 mg / mL D-luciferin (Xenogen Corporation, Alameda) via infusion under light isoflurane anesthesia. After 10 minutes of incubation, bioluminescence imaging was performed using an IVIS spectrum imaging system (IVIS Lumina LT, Series III, PerkinElmer). Mean bioluminescence (photons / sec / cm2 / sr) values ​​were visualized and quantified using pseudocolor ranges representing light intensity within a standardized tissue area for mouse nasal cavity and lungs.

[0303] statistics Post-hoc statistical analysis was performed using Prism 8.4.3 (GraphPad Software). Comparisons between multiple groups were performed using one-way ANOVA followed by Dunn's multiple comparison test for selected comparison groups, where appropriate, or Tukey's comparison for all groups as appropriate. When the assumptions of one-way ANOVA were violated, the nonparametric Kruskal-Wallis test followed by Dunn's multiple comparison test for selected comparison groups was used, or data were log10 transformed and analyzed by one-way ANOVA followed by Tukey's comparison for all groups, where appropriate. Data are presented as group means and / or with individual data points plotted, and as mean ± standard deviation (SD), where appropriate. In all cases, P values ​​of <0.05 were considered statistically significant. ns, * , ** , *** , and **** indicates P values ​​of >0.05, <0.05, <0.01, <0.001, and <0.0001, respectively. EXAMPLES

[0304] Deletion of SARS-CoV-2 S putative ERS and transduction into cells co-expressing permissive (co)hACE2 and hTMPRSS2 rescues S-LV transduction To investigate and function of in-house produced SARS-CoV-2 S-pseudotyped LVs (S-LVs) and biosafety level 1 (BSL1)-compatible SARS-CoV-2 S-LVs for subsequent titration and in vitro neutralization, we first engineered permissive cell lines expressing the human ACE2 receptor with or without the TMPRSS2 protease. Stable cell lines co-expressing codon-optimized (co)hACE2 with or without hTMPRSS2 were generated from the parental 293T / 17 cell line using VSVg-pseudotyped SIN rHIV1 LVs (not shown) encoding (co)hACE2-F2A-puroR or hTMPRSS2-P2A-BSR, both transgenes under the control of the CMV promoter.

[0305] Stable cell lines were selected and established, and the expression of (co)hACE2 with or without hTMPRSS2 was confirmed by immunocytochemistry (ICC) and Western blotting (WB) (data not shown). As expected, detectable levels of ACE2 or TMPRSS2 were appreciably higher than that of parental 293T / 17 in these respective cell lines. The engineered (co)hACE2 cell lines showed a marked increase in (co)hACE2 expression compared to their counterparts co-expressing (co)hACE2 and hTMPRSS2 (data not shown, P=0.0173, unpaired t-test with Welch's correction), corresponding to a reduction in signal intensity of about 42.8%. The expression of hTMPRSS2 was appreciably better than that of the parental 293T / 17 cell line and the cell line expressing only (co)hACE2 (data not shown). Despite the imbalance in (co)hACE2 expression among stable (co)hACE2 cell lines, the fact that expression is low in engineered cell lines co-expressing (co)hACE2 and hTMPRSS2 subsequently allowed us to make useful comparisons among permissive cell lines in the context and function of hTMPRSS2 co-expression.

[0306] Going forward, and as a proof of principle, we modeled the following SARS-CoV-2 S variants: Wuhan Hu-1, G614, Aus / VIC01, with or without a deletion of 19 amino acid residues in the C-terminal tail (+Δ19aa; see Figure 1A for a graphical representative comparison of full-length and +Δ19aa SARS-CoV-2 S proteins compared to annotation domains), which is predicted to harbor an endoplasmic reticulum retention signal. The complete mutational profiles (compared to the Wuhan Hu-1 reference profile) defining the modeled SARS-CoV-2 S variants used to pseudotype LV in this study are presented in Table 1.

[0307] [Table 2]

[0308] [Table 3]

[0309] The sequences were cloned into an expression plasmid as codon-optimized cDNA under the control of a CAG promoter (see Figure 1B for an overview of the pseudotyped plasmid constructs and the annotated mutations that confer each SARS-CoV-2 S mutant). The sequences of the modified SARS-CoV-2 S mutants are aligned in Figure 2.

[0310] Transduction with rHIV1 LV (encoding eGFP: S-LV.eGFP) pseudotyped with SARS-CoV-2(co)S (Wuhan Hu-1 with or without the 19 amino acid deletion, G614 with or without the 19 amino acid deletion, and Aus / VIC01 with or without the 19 amino acid deletion) was investigated in newly engineered (co)hACE cell lines with or without hTMPRSS2, or in the parental 293T / 17 (Figure 4).

[0311] As expected, rHIV1.VSVg LV transduced parental 293T / 17 and engineered cell lines similarly (Figure 4A; P>0.05, repeated measures one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test). In contrast, the modeled non-mouse-adapted S-LV.eGFP showed a clearly minimal requirement for (co)hACE2 receptor-dependent transduction, and in the context of the 19 amino acid deletion, transduction efficiency generally showed the greatest improvement in cells expressing (co)hACE2 alone (Figure 4B-4D; P<0.05, repeated measures one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test). Moreover, transduction was rescued even more significantly by co-expression of hTMPRSS2 by permissive cell lines, especially in the context of S-LV with a C-terminal truncation of the SARS-CoV-2 S glycoprotein with a deletion of 19 amino acids (Figures 4B-4D; P<0.001, repeated measures one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test). In general, and for the tested repertoire of truncated S-LV.eGFP with a deletion of 19 amino acids, the greatest logarithmic transduction improvements were measured between the parental cell line, the cell line expressing only (co)hACE2, and the cell line expressing (co)hACE2 and hTMPRSS2. Since 293T / 17 expressing only hTMPRSS2 was not permissive for S-LV (data not shown), without being bound by theory, the substantial improvement in transduction and rescue by S-LV is likely attributable to a complex interaction between the ACE2 entry receptor and hTMPRSS2. EXAMPLES

[0312] The S-LV platform can rapidly model S glycoproteins derived from VOCs or VOIs. The COVID-19 / SARS-CoV-2 pandemic continues to be an ongoing challenge with repeated surges of novel / emerging SARS-CoV-2 S VOCs occurring worldwide. These VOCs have shown increased transmissibility potential, thus posing additional concerns for public health. The B.1.1.7 / B.1.351 VOC S glycoprotein (+Δ19aa) was modeled for rapid LV pseudotyping. In addition to this, to capture the ability of the S-LV platform to be pseudotyped with a broad range of SARS-CoV-2 S glycoproteins and thus serve as a broad resource for modeling alternative SARS-CoV-2s, a mouse (m)ACE2-adapted SARS-CoV-2 S carrying the mutations Q498Y and P499T was also modeled (see overview in Figure 1B for these pseudotype plasmid constructs and the annotated mutations that confer each SARS-CoV-2 S variant). The complete mutational profiles defining these additional SARS-CoV-2 S / maS variants (relative to the Wuhan Hu-1 reference strain) are also presented in Table 1. Nucleic acid / amino acid alignments of the SARS-CoV-2 S / maS variants are shown in Figures 2 and 3, respectively.

[0313] B.1.1.7(S B.1.1.7+Δ19aa -LV.eGFP), B.1.351(S B.1.351+Δ19aa -LV.eGFP), and maS (maS Wuhan Hu-1,Y498,T499+Δ19aa -LV.eGFP, and ma SY498,T499,G614+Δ19aa S-LV, pseudotyped with S-LV.eGFP and carrying a C-terminal truncation with a deletion of 19 amino acids, was Wuhan Hu-1+Δ19aa -LV, and S G614+Δ19aaeGFP-LV performed similarly to S-LV; transduced predictably into (co)hACE cell lines and parental 293T / 17 with or without hTMPRSS2, exhibiting minimal requirements for (co)hACE2 receptor-dependent transduction, and transduction was further substantially rescued by coexpression of hTMPRSS2 (Fig. 5A; in all cases P < 0.05 within each S-LV.eGFP- or maS-LV.eGFP-transduced group; repeated measures one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test).

[0314] maS(Q498Y and P499T)-LV.eGFP and N501Y-containing S (especially for the VOCs B.1.1.7 and B.1.351 pseudotypes)-LV.eGFP were further able to transduce mACE2-expressing cells (Figure 5B). G614+Δ19aa The low to negligible transduction of mACE2-expressing cell lines by S-LV.eGFP was statistically non-significant in light of the transduction measured from rHIV1.bald-treated cells (Fig. 5B; P < 0.05; repeated measures 193 one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test). Transduction by mACE2-copermissive S-LV / maS-LV was found to be even more significantly rescued (up to 1 log) by co-expression of hTMPRSS2 (Fig. 5B; in all cases P < 0.01 between (co)mACE2 cell lines and (co)mACE2 and hTMPRSS2 co-expressing cell lines within each S-LV.eGFP- or maS-LV.eGFP-transduced group; repeated measures 194 one-way ANOVA with Geisser-Greenhouse correction and Tukey's multiple comparison test). Finally, the expressed S glycoproteins retained their function of mediating cell-cell fusion / syncytosis after transfection of parental 293T / 17 cells in a time-dependent and SARS-CoV-2 S G614 content-dependent manner (Figure 5C). Wuhan Hu-1+Δ19aa , SARS-CoV-2 S G614+Δ19aa , or SARS-CoV-2 SB.1.1.7+Δ19aa Representative fluorescence imaging of co-transfected cells expressing S compared to mock-co-transfected eGFP cells as a control. Wuhan Hu-1+Δ19aa The results confirmed that S. cerevisiae was able to potently mediate syncytia by 72 hours after transfection. Wuhan Hu-1+Δ19aa Whereas cell death and cytotoxicity were dramatic for co-expressing cells, G614-containing S glycoprotein co-expressing cells exhibited a dramatic attenuation of syncytia at 72 hours post-transfection, the onset of which was delayed until 144 hours post-transfection (Figure 5C; see white arrows highlighting syncytia formation in the 72 hour eGFP panel).

[0315] Collectively, these data demonstrate the robust and rapid ability of this S-LV platform to replicate functional SARS-CoV-2 S glycoproteins, model VOCs and VOIs, and recapitulate their inherent functions according to their S-defined mutational profiles, including mediating mACE2 co-permissiveness and syncytia formation. In particular, the substitutions Q498Y, P499T, D614G, and N501Y were found to be effective in achieving mouse habituation, both in terms of facilitating transduction and mediating syncytia formation. EXAMPLES

[0316] The S-LV platform achieves high titer PSV Optimal transduction of non-mouse adapted S-LVs was achieved using cells co-expressing (co)hACE2 and hTMPRSS2, which were used to test the functional titer of S-LVs. First, the optimal harvest point of S-LVs was determined by testing S-LV.eGFP titers over a production time course of 72 to 144 hours, with crude LVs harvested at 24 hour intervals (Figure 6), with the given preliminary titers suggesting that 48 hours post-transfection was not the optimal harvest window for S-LVs (data not shown). Baseline rHIV1.VSVg titers were determined to be approximately 2 × 10 at 72 hours post-transfection. 7 In IU / mL (data not shown), S-LVs derived from Wuhan Hu-1, G614, Aus / VIC01, VOC strains B.1.1.7 and B.1.351, and VOI, which harbor mACE2 permissive mutations and contain C-terminal truncations with a 19 amino acid deletion, generally yielded peak functional titers 72 h post-transfection, >1 × 10 6 Achieving titers of over 100 IU / mL (Figures 6A-6E, respectively), S G614+Δ19aa- L.V., S. B.1.1.7+Δ19aa- L.V., S. B.1.351+Δ19aa LV, and maS Y498,T488,±G614+Δ19aa - LV: 5~7×10 6 IU / mL (Figures 3B, 3D, and 3E, respectively). An exception to this rule was found at approximately 3 × 10 5 IU / mL low titer achieved, Aus / VIC01+Δ19aa The S Wuhan , S G614 , and S Aus / VIC01 performed poorly over the production time course (FIGS. 3A-3C, respectively), consistent with the initial transduction trends for these S-pseudotyped derivatives depicted in FIG.

[0317] No additional gain in functional titer was measured in the transfection cultures over the long term; indeed, functional titers generally began to decay after 96 hours post-transfection (Figure 7). Moreover, functional titers correlated with the expression profiles of monomeric SARS-CoV-2 S protein and HIV1 p24 protein over a 144-hour time course, with both peaking in expression generally 72 hours post-transfection, as measured by Western blot (data not shown). Concentration of S-LVs and maS-LVs by slow spin centrifugation was found to be a feasible protocol and was also implemented to allow for the inclusion of more conventional means of purifying LVs that are more suitable for translation, including a combination of anion exchange chromatography (AEX) and tangential flow filtration (TFF). Selected S-LVs and maS-LVs (S Wuhan Hu-1+Δ19aa -LV, S G614+Δ19aa -LV, S Aus / VIC01+Δ19aa -LV, S B.1.1.7+Δ19aa -LV, S B.1.351+Δ19aa - L.V., maS. Y498,T499+Δ19aa -LV, and maS Y498,T499,G614+Δ19aa Centrifugation and volumetric concentration of the crude S-LV (S-LV) results in, among other things, a high functional titer of the corresponding crude S-LV material (S Aus / VIC01+Δ19aa - LV about 6.75 x 10 5 >1 × 10 for all mutants except for IU / mL 6 Improved functional titers (≥ 1 × 10 8 This was successfully achieved, as indicated by the concentration of 1.5 IU / mL of S-LVs in the culture. When up to 100-fold volumetric enrichment of centrifuged S-LVs was applied across the generated S-LV library, an average increase in functional titer of 138.8 ± 35.22-fold was demonstrated.

[0318] Overall, this S-LV platform, incorporating, among other things, a C-terminal truncation with a 19 amino acid deletion into the SARS-CoV-2 S glycoprotein, demonstrated the ability to achieve high functional titers and model VOCs with profound clinical relevance, particularly by enabling the production of high titers of mouse-adapted S-LVs, making this platform a potentially valuable research tool. Exemplary titers are shown in Table 2.

[0319] Next, S Aus / VIC01+Δ19aa We explored whether the low titers observed for S-LV could be further rescued using mouse-adapted mutations. Thus, substitutions Y498 and T499 were added to the S Aus / VIC01+Δ19aa As shown in Figure 8, compared to the functional titers reported in Figure 6, initial experiments demonstrated that substitutions Y498 and T499, in addition to the Δ19 C-terminal truncation, conferred a novel functional potency in the S-LV strain. Aus / VIC01 - indicating that LV functional titer can be further rescued. EXAMPLES

[0320] S-LV can model and estimate the infectivity of SARS-CoV-2 S VOC in vitro Having established the feasibility of producing high functional titers of crude S-LVs derived from a wide variety of clinically relevant or engineered SARS-CoV-2 S mutants, we expanded the utility of the S-LV library for further downstream applications. Given that significant volumetric enrichment of S-LVs was achieved after centrifugation, we asked whether S-LVs could also be generated to subclinically relevant standards for in vivo use. To accomplish this, we used a codon-optimized (co)SG1A1 gene encoding firefly luciferase. 614+Δ19aa , (co)S B.1.1.7+Δ19aa , (co)S B.1.351+Δ19aa , ma(co)S Y498,T499,G614+Δ19aaS-LVs pseudotyped with were generated and subjected to AEX and TFF combined concentration and purification. In addition, given that N501Y-containing S (especially for VOCs B.1.1.7 and B.1.351 pseudotypes)-LV.eGFP was able to transduce mACE2-expressing cells, as observed for maS-LVs containing substitutions Q498Y and P499T (see Example 2 and Figure 5), it was decided to introduce the substitution N501Y into maS-LVs to explore whether the addition of N501Y would further improve the function / functional titer of maS-LVs. The substitution N501Y was introduced into maS-LVs pseudotyped with cDNA (maS Y498,T499,G614+Δ19aa The ma(co)S gene was cloned into maS-LV v5 (pGM999; see FIG. 1) to generate maS-LV v5 (pGM999; see FIG. 1). Y498,T499,Y501,G614+Δ19aa was generated and subjected to a combination of AEX and TFF enrichment and purification. The resulting S-LV.FLuc vector was used to transduce 293T / 17 cells co-expressing (co)hACE2 and hTMPRSS2, and lysates were assayed for functional titer by luciferase activity.

[0321] The RLU captured from permissive cells co-expressing (co)hACE2 and hTMPRSS2 was normalized by the input p24 function at the time of transduction, and each purified S-LV (S G614+Δ19aa Batches 1 to 3 of, and maS Y498,T499,G614+Δ19aa -For LV, the RLU per ng of p24 input in 20 µL of lysate is 1.57 x 10 7 ±8.01×10 6 , 1.19×10 7 ±3.07×10 6 , 1.49×10 7 ±2.44×10 6 , 4.15×10 7 ±2.31×10 7 , 1.38×10 7 ±3.06×10 6The functional quality of the modeled SARS-CoV-2 S VOCs (B.1.1.7 and B.1.351), and ma(co)S VOCs (B.1.1.7 and B.1.351), was similar and not statistically significant (Figure 9A; P < 0.05 compared to SG614+Δ19aa-LV batch 1, respectively; Mann-Whitney t test). Y498,T499,Y501,G614+Δ19aa All are S G614+Δ19aa -LV (RLU per 20 µL of lysate per ng of p24 input, 4.15 × 10 7 ±2.27×10 7 , 6.45×10 7 ±2.77×10 7 , and 9.92 × 10 7 ±3.17×10 7 It is noted that both showed a statistically significant increase in their functionality per ng of p24 input compared to maS (P<0.001 and P<0.0001; Mann-Whitney t-test). Y498,T499,Y501,G614+Δ19aa It is striking that an approximately 7-fold improvement in functional quality was calculated between S-LVs (i.e., with the addition of the mutation N501Y) and the G614-containing S mutant. Alternatively, a 3- to 4-fold improvement in transduction was calculated between S-LVs modeling SARS-CoV-2 S VOCs and the G614-containing S mutant per ng of p24 input. A similar improvement was calculated by RLUs captured from cells co-expressing (co)mACE2 and hTMPRSS2 (the functional quality of S-LVs per ng of p24 input was also reflected by S-LVs modeling VOCs showing a 2- to 3-fold improvement in transduction into permissive cells) (Figure 9B; ma(co)S, respectively). Y498,T499,G614+Δ19aa - P < 0.001 compared with LV; Mann-Whitney t test).

[0322] Overall, these data further highlight the success of S-LV and maS-LV purification and enrichment after enrichment and purification by AEX and TFF, and demonstrate that the modeled VOCs are able to mimic their infectivity profile in vitro, similar to that of S G614+Δ19aaThey further emphasized that these mutations will be further evaluated to qualify and confirm against S-LV or appropriate PSV references. The data also support that the mutation N501Y improves functional transduction by S-LVs, particularly maS-LVs. EXAMPLES

[0323] maS-LV is neutralized by commercially available SARS-CoV-2 neutralizing antibodies Next, maS Y498,T499,G614+Δ19aa By examining the neutralization sensitivity of maS-LVs, we explored whether maS-LVs would prove to be a useful resource for preclinical / clinical use. maS-LVs were also used to model prospective neutralization propensity for potential S VOIs. After characterizing the optimal MOI for transduction into cell lines co-expressing (co)hACE2 and hTMPRSS2 without saturating transduction efficiency (an MOI of 1 supported high transduction efficiency without saturating transduction sensitivity at upper values; data not shown), maS Y498,T499,G614+Δ19aa -LV was subjected to an in vitro neutralization assay with commercially available neutralizing antibodies (nAbs).

[0324] As shown in Figures 10C and 10D, the RBD-targeting R001 nAb aSY498,T499,G614+Δ19aa As shown in Figures 10A and 10B, S1-targeting MM43 also potently neutralized maS-LV (IC50 = 0.05 μg / mL). Y498,T499,G614+Δ19aa -LV was neutralized (IC50=1.2 μg / mL).

[0325] However, as shown in Figures 10E and 10F, S-LVs are neutralized by neutralizing antibodies in a SARS-CoV-2 S variant-dependent manner. 293T / 17 cells (seeded to achieve 30-40% confluency on the day of transduction) co-expressing (co)hACE2 or (co)mACE2 (as indicated) and hTMPRSS2 were transfected with the indicated S-LV.eGFP or maS-LV.eGFP (SARS-CoV-2 S variant-dependent antibodies) at the indicated final working concentrations.G614+Δ19aa (G614+Δ19); B.1.1.7+Δ19 (alpha+Δ19); B.1.351+Δ19 (beta+Δ19); and SARS-CoV-2 S G614+Y498+T499+Δ19aa (maS2+Δ19)); and (E) R001 nAb targeting the SARS-CoV-2 S RBD, or (F) MM43 nAb targeting the SARS-CoV-2 S1 domain. Transduction efficiency at 72 hours post-infection was measured by flow cytometry, and % neutralization was calculated as % of the mean transduction of the corresponding IgG isotype control. The dotted line indicates the mean IC 50 is calculated, which refers to 50% neutralization.

[0326] The measured IC50 values ​​(ug / mL) for R001 were: for G614+19del S-LV, 0.06; for alpha+19del S-LV, 0.32; for beta+19del S-LV, escaped neutralization; and for maS2+19del (S-LV v02) S-LV, 0.05.

[0327] Measured IC50 values ​​(ug / mL) for MM43: for G614+19del S-LV, 0.8; for alpha+19del S-LV, escapes neutralization; for beta+19del S-LV, 0.5; for maS2+19del (S-LV v02) S-LV, 1.25.

[0328] Collectively, these data help support that the S-LV platform is capable of recapitulating neutralization or neutralization escape profiles using nAbs. EXAMPLES

[0329] Mouse-adapted SARS-CoV-2 spike protein can be used to pseudotype SIV1 vectors with acceptable functional titers Next, we used maS to pseudotype other lentiviral vectors. Y498,T499,G614+Δ19aaWe explored whether SIV1 could be used for proof-of-concept studies.

[0330] VSVg pseudotyped rSIV1 lentiviral vector (n=1) or SARS-CoV-2(co)S G614+Δ19aa and maS Y498,T499,G614+Δ19aa S-LV was generated using transient transfection of 293T / 17 SF cells for each (n=2). Seventy-two hours after transfection, crude rSIV1.VSVg / rSIV1.S-LV vector material was harvested, serially diluted, and transduced into cells co-expressing (co)hACE2 and hTMPRSS2. Seventy-two hours after transduction, cells were subjected to flow cytometry to determine titers in IU / mL based on transduction of eGFP.

[0331] As shown in Figure 11, the rSIV1 vector genome was able to be packaged with the SARS-CoV-2(co)S pseudotype. Y498,T499,G614+Δ19aa S-LV pseudotypes containing 5 It was incorporated into the envelope at titers in the IU / mL range. EXAMPLES

[0332] We demonstrate that mACE2-permissive S-LVs are a potent gene transfer tool in vivo, independent of hACE2 expression in trans. To further validate the mACE2 / hACE2 co-permissiveness of maS-LV transduction in vitro, purified and concentrated maS-LV were used to assess its bridging to gene transfer potential. Y498,T499,G614+Δ19aa-LV.FLuc was examined in vivo. In addition, given the observed transduction advantage exhibited by VOC-derived S-LV, we explored whether S-LV could be modeled as a predictive tool to screen SARS-CoV-2 S mutants in vivo as an extension of the in vitro findings reported in Example 4 (Figure 9). A dose titration study involved administration of increasing percentages of maximum feasible doses (MFDs) to non-hACE2 expressing BALB / c mice and monitoring luciferase expression kinetics.

[0333] A dose-dependent increase in maS-LV.FLuc transduction was observed and estimated by in vivo bioluminescence over a time course, independent of hACE2 expression in trans (Figure 12). Notably, according to representative Figure 12A, transduction by maS-LV was measurable in mouse lungs, but significantly in mouse nasal passages by the tested mACE2-copermissive maS-LVs. Luciferase expression was well above background, as estimated by naive animals, for both mouse nasal passages (Figure 12B) and lungs (Figure 12C), with signal intensity detected by 2 days after intranasal administration, peaking approximately 7 days after administration, and sustained (without decay) for up to 21 days after administration for mouse nasal passages or lungs (Figures 12B and 12C, respectively). In addition, similar transduction kinetics was observed in mouse nasal passages over a 21-day time course, with maS-LVs. Y498,T499,G614+Δ19aa -LV (approximately 1000-fold improvement in signal intensity over background); the exception was S, which showed approximately 100-fold improvement in signal intensity over background. B.1.1.7+Δ19aa In the mouse lungs, S B.1.351+Δ19aa - Regarding administration of LV.FLuc, maS Y498,T499,G614+Δ19aa -LV signal intensity is approximately 10-fold increase in signal intensity above background (e.g., maS Y498,T499,G614+Δ19aa- for a 40 ng dose of p24 for LV.FLuc) to approximately a 100-fold increase.

[0334] These observations were further understood given that treated mice did not experience substantial weight loss and were generally comparable to control mice treated with TSSM (data not shown), presumably indicating that S-LV was well tolerated as an in vivo gene transfer tool at the ng doses tested.

[0335] Collectively, the data presented support that the S-LV platform can be administered in the lungs and airways of mice in vivo without the requirement for hACE2 expression in trans. EXAMPLES

[0336] mACE2-permissive S-LV as a gene therapy agent The maS-LV vectors exemplified herein, such as the maS-LV vector illustrated in FIG. 1, are used as gene therapy vectors. The mutant strains, SFTPB cell model or CFTR cell model (SFTPB with CFTR F508Δ, respectively) are used. ko S-LVs (S-LV v02, 03, 05) were generated encoding the therapeutic gene of interest: (so)SFTPB or (so)CFTR2 to correct the 16HBE14o-model or 16HBE14o-model). Rescue of protein expression profile was confirmed by Western blot. A representative scheme is illustrated in FIG. 13. EXAMPLES

[0337] S B.1.351+Δ19aa -LV is S Y498,T499,G613 Δ19aa -Directing transgene expression in the lung to a higher degree than LV In vivo experiments were performed to compare the expression of the transgene in the lungs of mice. Y498,T499,G613 Δ19aa -LV(S-LV maS2) B.1.351+Δ19aa -Compared with LV (S-LV beta).

[0338] S Y498,T499,G613 Δ19aa -LV(S-LV maS2), S B.1.351+Δ19aa -LV (S-LV beta) or vehicle was delivered to the lungs of BALB / c mice (n=6 per group receiving 166 ng of p24 S-LV).

[0339] Compared with the Wuhan isolate of SARS-CoV-2, S B.1.351+Δ19aa S-LV (S-LV beta) contained the following sequence mutations: D80A, D215G, K417N, E484K, N501Y, D614G, A701V, and a deletion of 19 amino acids at the C-terminus. Y498,T499,G613 Δ19aa -LV (S-LV maS2) contained Q498Y, P498T, D614G, and a 19 amino acid deletion at the C-terminus. Both S-LV vectors contained a firefly luciferase transgene under the control of the CMV promoter.

[0340] As shown in FIG. Y498,T499,G613 Δ19aa -LV (S-LV maS2) and S B.1.351+Δ19aa Both S-LV (S-LVbeta) induced significantly greater luciferase activity than vehicle-treated animals (47.5-fold and 107.6-fold, respectively; p<0.0001; one-way ANOVA). B.1.351+Δ19aa -LV (S-LV beta) is S Y498,T499,G613 Δ19aa -LV (S-LV maS2) directed transgene expression in the lungs in vivo at approximately 2.3-fold higher than that of S-LV (S-LV maS2) (p<0.0001; one-way ANOVA). EXAMPLES

[0341] S-LVs can deliver therapeutic transgenes into SARS-CoV-2 permissive human cells According to Example 8, mACE2-permissive S-LV (maS3; SARS-CoV-2 S P498,T499,Y501,G614+Δ19aa) was made with a transgene for surfactant protein B (SP-B) and used to transduce SARS-CoV-2 permissive 293T / 17 (stably co-expressing hACE2 and hTMPRSS2) in crude or concentrated S-LV form at concentrations of 100 μl, 250 μl, or 500 μl (crude), or 1 μl, 10 μl, or 50 μl (concentrated). After transduction, cell lysates were subjected to SDS-PAGE and Western blot analysis (under non-reducing conditions) for expression of mature SP-B homodimer and compared to null background levels in non-transduced cells. GAPDH was used as a loading control.

[0342] As shown in Figure 15, this mACE2-permissive S-LV (maS3; SARS-CoV-2 S P498,T499,Y501,G614+Δ19aa ) successfully drove SARS-CoV-2 permissive human 293T / 17 cells to express a therapeutic transgene (human SF-B) when delivered as crude or concentrated forms, even at the lowest doses administered.

[0343] In addition, (G614+Δ19aa; SARS-CoV-2 S G614+Δ19aa ) was generated with the transgene EGFP and microinjected into human lung bud organoids (LBOs). LBOs were generated from the human RUES2 embryonic stem cell line to model type II alveolar epithelial cells in 3D organoids. Concentrated S-LVs encoding EGFP were mixed with phenol red (2:1 ratio) and microinjected into LBOs embedded in Matrigel with MFD. Microinjection of rAAV8 encoding human IgG was used as a negative control. Fluorescence microscopy was performed 72 hours after injection using an EVOS FL Auto.

[0344] As shown in FIG. 16, EGFP (G614+Δ19aa; SARS-CoV-2 S G614+Δ19aa ) was expressed in the LBO after delivery. EXAMPLES

[0345] SARS-CoV-2 nucleoprotein (N) boosts the titer of recombinant HIV1 lentiviral vector (LV) The following S-LV vectors were examined: SARS-CoV-2 S G614+Δ19aa =G614+Δ19 SARS-CoV-2 S G614+FKO+Δ19aa =G614+FKO+Δ19 B.1.617.2+Δ19=Δ+Δ19 C.37+Δ19=Lambda+Δ19

[0346] These S-LV vectors encoding EGFP with and without the SARS-CoV-2 nucleoprotein from the Wuhan or Omicron variants were generated as described in the Materials and Methods section above and incorporated during co-transfection. Both SARS-CoV-2 nucleoprotein from the Wuhan or Omicron variants were examined along with B.1.617.2+Δ19 (delta+Δ19) and C.37+Δ19 (lambda+Δ19). Only the SARS-CoV-2 nucleoprotein from the Wuhan variant was associated with SARS-CoV-2 S G614+Δ19aa (G614+Δ19) and SARS-CoV-2 S G614+FKO+Δ19aa (G614+FKO+Δ19; where FKO=Fulin knockout) was investigated.

[0347] Crude vector material was titrated on SARS-CoV-2 permissive 293T / 17 cells stably expressing hACE2 and hTMPRSS2, and titers were calculated after flow cytometry analysis (Figure 17A). These titers were log10 transformed and analyzed for differences between matched titer pairs. As shown in Figure 17B, significant improvements in yield and titer were observed when co-transfected with SARS-CoV-2 N (Wuhan or Omicron) (paired t-test; P=0.0006).

[0348] Consideration In response to the demand for high-titer SARS-CoV-2 PSV resources, an S-LV platform has been established that is readily utilized to model a library of clinically relevant SARS-CoV-2 S glycoproteins. It incorporates S derived from VOCs (i.e., G614, B.1.1.7, and B.1.351), or S VOIs, as surrogates to model potential emerging SARS-CoV-2 variants. Notably, this is exemplified by using a modified S protein containing Q498Y and P499T, mutations shown herein to confer mACE2 co-permissiveness.

[0349] A comprehensive review of the S-LV platform and its ability to model SARS-CoV-2 was presented. We achieved impressively high functional titers of mouse-adapted S-LVs using scalable 293T / 17 suspension cells and incorporating a truncation (+Δ19aa) of the SARS-CoV-2 S cytoplasmic tail encompassing the putative ERS, thereby improving SARS-CoV-2 S packaging and titers following its deletion. Despite this Δ19aa truncation of the cytoplasmic tail, the SARS-CoV-2 S encoded within our S-LV library demonstrably retained their native tertiary structure in accordance with the native SARS-CoV-2 S, recapitulating a functional SARS-CoV-2 S protein (given evidence for ACE2-dependent cell entry, the ability to mediate syncytia, and the co-purification of SARS-CoV-2 S trimers with the S-LV PSV preparation exemplified above, we used predicted 3D models using the IntFOLD tool30 and structural alignments of our encoded SARS-CoV-2 S sequence (e.g., predicted 3D models reliably resolved against the Wuhan Hu-1S protein according to PDB: 7czpA, 7cwl, and 7a93A (data not shown)). Interestingly, using our S-LV platform and the use of permissive 293T / 17 cells incorporating the Δ19aa truncation and expressing both the ACE2 entry receptor and the hTMPRSS2 serine protease, we observed a significant rescue of SARS-CoV-2 S-pseudotyped LVs (up to logarithmic functional titers in a given preparation). This was especially true for SARS-CoV-2 mutants that are difficult to pseudotype. The Aus / VIC01 strain, especially as the full-length S protein, was found to be particularly difficult to pseudotype to titers comparable to the other modeled S-LVs.

[0350] Further scrutiny of the SARS-CoV-2 S glycoprotein and the S-LV platform was performed to document the impressive yields and titers achieved. In particular, we investigated whether the modified SARS-CoV-2 S glycoprotein of the present invention recapitulates well-known and characterized intrinsic features that improve the potential translational benefits of the S-LV platform. For example, demonstrable neutralization was achieved in the context of well-established and commercially available neutralizing antibodies. Neutralization escape against monoclonal nAbs was demonstrable in a mutant-dependent manner, as expected, given the distinct mutational profiles that confer escape from nAbs. Furthermore, the expressed SARS-CoV-2 S glycoprotein demonstrated a strong ability to induce cell-cell fusion and syncytia that is intrinsic to the fusion peptide located within the S2 domain. Mutant S G614 The strains have improved S glycoprotein stability, reduced cleavage and excretion of premature S1, and D614 Compared with , a dynamically more open prefusion conformation was found to promote facile binding to ACE2, which was observed here as a substantial delay in the onset of syncytia in transfection studies.

[0351] Through further representative S-LVs, the inventors were further able to demonstrate the successful ability to model the tendency of SARS-CoV-2 VOC strains (B.1.1.7 and B.1.351) (in this case PSV represents the G614 mutant) to dramatically infect permissive cells in vitro, compared to a reference reference. Importantly, we managed to reproduce the 3-4 fold improvement in measured transduction capacity specific to N501Y-containing VOCs, as suggested in the literature for authentic SARS-CoV-2 mutants. Taken together, and in the S Aus / VIC01With this in mind, we present perhaps the first example where modeling SARS-CoV-2 as a PSV can infer a great deal about the ability of the associated S glycoprotein to infect permissive cells via the ACE2 entry receptor. This S-LV tool offers a potential means to rapidly examine what range of VUIs, VOCs, emerging and predicted SARS-CoV-2 variants can infect permissive cells in the context of their S glycoprotein, enhancing surveillance efforts.

[0352] Encouragingly, these results also support that selected SARS-CoV-2 PSVs can function directly in vivo without the need for expression of hACE2 in trans after utilizing the mutations SARS-CoV-2 S Q498Y / P499T19 and possibly also the mutation N501Y. The ability of selected S-LVs (and, by extension, their corresponding, authentic SARS-CoV-2 counterparts) to infect via the endogenous mACE2 entry receptor has useful implications, especially in the context of investigating the efficacy of prophylactic, therapeutic, and vaccine strategies. We note that currently available mouse models for authentic SARS-CoV-2 and non-mouse-adapted SARS-CoV-2 infection are difficult to manipulate due to the significant costs and animal waste associated with the provision of hACE2 transgenic52 animals or CRISPR / Cas9-mediated knock-in animals, to name a few key examples. For example, the introduction of hACE2 in trans into the lungs and airways of mice via replication-incompetent adenovirus (AdV), recombinant adeno-associated virus (rAAV), or LV vectors simplifies humanization and results in a physiologically relevant biodistribution of hACE2 in the lungs of mice, depending on the tropism of the selected gene transfer vector, even during the sensitization process of the mouse model to SARS-CoV-2. In addition, the complexity of challenging the animal model with multiple vectors (possibly requiring at least two different virus-based agents (i. the chosen vector for gene transfer to achieve humanization of hACE2, and ii. PSV or authentic SARS-CoV-2 for challenge)) is mitigated by the mACE2-co-permissive SARS-CoV-2.

[0353] Moreover, individual variants of S-LV provide additional advantages over and above the advantageous properties of the S-LV of the present invention as a whole, particularly with respect to transgene expression in vivo. B.1.351+Δ19aa -LV is a method to evaluate the expression of transgenes in the lung in vivo. Y498,T499,G613 Δ19aa- has been shown to provide a significant increase compared to LV.

[0354] Our mouse-adapted S-LVs can also efficiently transduce SARS-CoV-2 permissive human cells to drive the expression of therapeutic transgenes, demonstrating that SARS-CoV-2 S G614+Δ19aa were able to transduce human cells in LBO, an acceptable model for type II alveolar epithelial cells. Thus, these data suggest that the S-LVs of the present invention can be used to deliver therapeutic transgenes to human type II alveolar epithelial cells in vivo. Since type II alveolar epithelial cells are the target cell type for many respiratory diseases and disorders, such as surfactant deficiency (ABCA3 deficiency or SP-B deficiency) and idiopathic pulmonary fibrosis, the S-LVs of the present invention have potential as vectors for gene therapy.

[0355] In conclusion, the examples herein support the ability to pseudotype third generation SIN HIV1 LVs (designated S-LVs) with SARS-CoV-2 S. We established an extensive S-LV library encompassing and modeling S glycoproteins derived from clinically relevant variants or VOCs of particular interest that serve as novel PSV resources for use in standard laboratory containment conditions. Impressive functional titers of S-LVs were achieved following transient transfection of suspension 293T / 17 with HIV1 LV genomes encoding eGFP or FLuc reporters, HIV1 GagPol, HIV1 Rev plasmids, and plasmid(s) encoding the S glycoprotein(s) of interest. S-LVs can be further concentrated and purified to expand downstream uses, including in vivo applications. Importantly, this S-LV platform / library could potentially aid in the advancement of COVID-19 / SARS-CoV-2 related research studies by modeling VOCs and VOIs to probe the neutralizing potential of SARS-CoV-2 S variants against nAbs or convalescent plasma from patients who have recovered from COVID-19, or features that help determine the infectious potential of SARS-CoV-2 variants via strains that define the S glycoprotein. Finally, these examples provide the first demonstration of the application of S-LVs in vivo by intranasal administration to BALB / c mice as a rapid and straightforward means of modeling SARS-CoV-2 infection in vivo, supporting robust gene transfer capability independent of hACE2 expression. Taken all together, this S-LV platform accurately represents authentic SARS-CoV-2, specifically representative variants modeled at the level of the SARS-CoV-2 S glycoprotein. This S-LV platform exhibits robustness across a wide range of SARS-CoV-2 variants, as represented in this study, and flexibility such that it is not constrained by high BSL requirements.Therefore, the S-LV platform is easy to use, accessible, and serves as a safe SARS-CoV-2 PSV resource for relevant research studies against the ongoing COVID-19 / SARS-CoV-2 pandemic. Furthermore, these S-LV vectors are also capable of transducing SARS-CoV-2 permissive human cells to drive the expression of therapeutic transgenes, indicating that these S-LVs may be useful as gene therapy vectors in the clinic as well as a SARS-CoV-2 PSV resource.

Claims

1. a transgene pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein and operably linked to a promoter; said spike protein comprising: a) mutations at amino acid positions corresponding to or aligning with positions 498, 499, and 614 of SEQ ID NO:1; and b) Deletion of at least a portion of the cytoplasmic tail A lentiviral vector comprising:

2. a transgene pseudotyped with a modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein and operably linked to a promoter; said spike protein comprising: a) a mutation at an amino acid position corresponding to or aligning with position 614 of SEQ ID NO:1; b) a deletion of at least a portion of the cytoplasmic tail; and c) (i) a mutation at an amino acid position corresponding to or aligning with positions 498 and 499 of SEQ ID NO:1; and / or (ii) a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:

1. A lentiviral vector comprising:

3. 3. The lentiviral vector of claim 1 or 2, wherein the cytoplasmic tail of the spike protein corresponds to or aligns with amino acid residues 1235 to 1273 of SEQ ID NO:

1.

4. Deletion of at least a portion of the cytoplasmic tail of the spike protein a) a deletion of at least 10 amino acids, preferably at least 15 amino acids, of the cytoplasmic tail; and / or b) a deletion of amino acid residues corresponding to or aligning with positions 1255 to 1273 of SEQ ID NO:

1. The lentiviral vector according to any one of claims 1 to 3, comprising:

5. 5. The lentiviral vector of any one of claims 1 to 4, wherein one or more of the mutations in the spike protein at amino acid positions corresponding to or aligning with positions 498, 499, and 614 of SEQ ID NO:1 are amino acid substitutions, preferably all of the mutations are amino acid substitutions.

6. The lentiviral vector of claim 5 , wherein the amino acid substitution is a non-conservative amino acid substitution.

7. a) the amino acid corresponding to or aligning with position 498 of SEQ ID NO:1 is replaced by tyrosine; b) the amino acid corresponding to or aligning with position 499 of SEQ ID NO:1 is replaced by threonine; and / or A lentiviral vector according to any one of claims 1 to 6, wherein c) the amino acid corresponding to or aligning with position 614 of SEQ ID NO: 1 is replaced by glycine.

8. The lentiviral vector of any one of claims 1 to 7, wherein the mutation is Q498Y, P499T, and / or D614G.

9. The lentiviral vector of any one of claims 1 to 8, wherein the modified spike protein is capable of binding to the enzyme domain of human angiotensin-converting enzyme 2 (ACE2).

10. 10. The lentiviral vector of any one of claims 1 to 9, wherein the modified SARS-CoV-2 spike protein is derived from a SARS-CoV-2 strain selected from Wuhan-Hu-1, B. 1.1.7, B. 1.351, P. 1, B. 1.617.2, B. 1.427, C. 37, B. 1.429, or Australia / VIC01 / 2020 (Aus / VIC01) strains.

11. The lentiviral vector of any one of claims 1 to 10, wherein the modified spike protein is not detectable by an anti-coronavirus spike protein antibody, preferably the anti-coronavirus spike protein antibody MM43 or R001.

12. The lentiviral vector of any one of claims 1 to 11, wherein the modified spike protein comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

13.

13. The lentiviral vector of any one of claims 1 to 12, wherein the modified spike protein further comprises one or more additional mutations.

14. or the one or more further mutations comprise a mutation at an amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1, and optionally a) the mutation at the amino acid position corresponding to or aligning with position 501 of SEQ ID NO:1 is an amino acid substitution, preferably a non-conservative amino acid substitution, even more preferably a substitution with tyrosine; and / or b) the one or more additional mutations include N501Y; The lentiviral vector according to any one of claims 1 to 13.

15. The lentiviral vector of any one of claims 1 to 14, wherein the modified spike protein comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

20.

16. The spike protein is a) mutations at amino acid positions corresponding to or aligning with one or more of positions 80, 215, 417, 484, 501, 614, and 701 of SEQ ID NO:1, preferably all of these residues are mutated; and b) Deletion of at least a portion of the cytoplasmic tail Including, The lentiviral vector according to any one of claims 2 to 15.

17. a) the modified SARS-CoV-2 spike protein is derived from the spike protein of the B.1.351 strain; b) (i) the amino acid corresponding to or aligning with position 80 of SEQ ID NO:1 is replaced by an alanine; (ii) the amino acid corresponding to or aligning with position 215 of SEQ ID NO:1 is replaced by a glycine; (iii) the amino acid corresponding to or aligning with position 417 of SEQ ID NO:1 is replaced by an asparagine; (iv) the amino acid corresponding to or aligning with position 484 of SEQ ID NO:1 is replaced by a lysine; (v) the amino acid corresponding to or aligning with position 501 of SEQ ID NO:1 is replaced by a tyrosine; (vi) the amino acid corresponding to or aligning with position 614 of SEQ ID NO:1 is replaced by a glycine, and / or (vii) the amino acid corresponding to or aligning with position 701 of SEQ ID NO:1 is replaced by a valine; preferably, all of these residues are replaced; and / or c) the deletion of at least a portion of the cytoplasmic tail comprises or consists of a deletion of amino acid residues corresponding to or aligning with positions 1255 to 1273 of SEQ ID NO:

1. The lentiviral vector of claim 16,

18. 18. The lentiviral vector of any one of claims 1 to 17, which is selected from the group consisting of a simian immunodeficiency virus (SIV) vector, a human immunodeficiency virus (HIV) vector, a feline immunodeficiency virus (FIV) vector, an equine infectious anemia virus (EIAV) vector, and a Visna / Maedi virus vector.

19. A lentiviral vector according to any one of claims 1 to 18, capable of transducing rodent cells in vivo, preferably mouse cells in vivo.

20. A modified severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike protein according to any one of claims 1 to 16.

21. A polynucleotide molecule encoding the modified spike protein of claim 20.

22. 22. An expression construct comprising the polynucleotide of claim 21 operably linked to a promoter.

23. A host cell comprising the lentiviral vector of any one of claims 1 to 19, the modified spike protein of claim 20, the polynucleotide of claim 21, or the expression construct of claim 22.

24. A virus-like particle (VLP) comprising the modified SARS-CoV-2 spike protein of claim 20.

25. A lentiviral vector according to any one of claims 1 to 19, a modified spike protein according to claim 20, a polynucleotide according to claim 21, an expression construct according to claim 22 or a VLP according to claim 24 for use in therapy, preferably wherein the therapy is gene therapy.

26. 25. An in vitro use of a lentiviral vector according to any one of claims 1 to 19, a modified spike protein according to claim 20, a polynucleotide according to claim 21, an expression construct according to claim 22, or a VLP according to claim 24.

27. A method for producing the lentiviral vector according to any one of claims 1 to 19, comprising: a) introducing into a viral vector producing cell one or more nucleic acid sequences encoding (i) a nucleic acid sequence encoding the modified SARS-CoV-2 spike protein of claim 20; and (ii) a lentiviral packaging component, a lentiviral envelope component, and a lentiviral genome; and b) culturing the producer cells under conditions suitable for the production of the lentiviral vector. The method includes:

28. a) further comprising the step of harvesting the lentiviral vector; b) a nucleic acid sequence encoding a modified SARS-CoV-2 spike protein is comprised within a polynucleotide molecule of claim 21 or an expression construct of claim 22; c) one or more nucleic acid sequences encoding the lentiviral packaging components, the lentiviral envelope components, and the lentiviral genome are (i) contained within the same polynucleotide molecule or expression construct as the nucleic acid sequence encoding the modified SARS-CoV-2 spike protein, or (ii) contained within one or more separate polynucleotide molecules or expression constructs; and / or 28. The method according to claim 27, wherein d) SARS-CoV-2 nucleoprotein is co-expressed during the cultivation of the producer cells, preferably the SARS-CoV-2 nucleoprotein is derived from the Wuhan-Hu-1 or B.1.1.529 strains.

Images