Methods for efficient fermentation broth recycling

Abstract

Disclosed are methods for efficient fermentation broth recycling, methods for improving bottoms recycling, and methods for converting CO, CO2, and optionally H2 to ethanol and other oxygenated products, comprising providing a bioreactor with a gaseous substrate comprising CO, CO2, and optionally H2, at least one acetogenic carboxydotrophic bacterium, and a liquid nutrient medium, and providing conditions within the bioreactor for the at least one acetogenic carboxydotrophic bacterium to convert CO, CO2, and optionally H2 to at least one oxygenated product. Also disclosed are methods for preparing animal feed and methods for preparing fertilizer.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This patent application claims the benefit of co-pending U.S. Provisional Patent Application No. 63 / 298,426, filed January 11, 2022, which is incorporated by reference herein in its entirety.

[0002] Incorporation by Reference of Electronically Submitted Materials Incorporated herein by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing, which was submitted contemporaneously herewith and is identified as follows: a single 16,539 byte XML file entitled "766306.xml" dated January 6, 2023. [Background technology]

[0003] 2. Background of the Invention Carbon monoxide (CO), carbon dioxide (CO), such as industrial waste gases or synthetic gases 2 ), and / or hydrogen (H 2 It would be desirable to use microorganisms to convert gases containing CO, CO into a variety of products, such as fuels and chemicals, using fermentation. 2 , and H 2 The low ethanol tolerance of organisms capable of consuming ethanol necessitates the use of continuous fermentation techniques, whereby broth containing ethanol, acetate, and cells is removed from the fermenter and new growth medium is added. Ethanol and cells are then recovered from the removed broth. The ethanol-depleted removed broth then needs to be subjected to wastewater treatment before discharge, which significantly increases capital and process costs. For example, a commercial-scale bioreactor may contain over one million liters of aqueous broth, and creating a wastewater treatment system to process all of the ethanol-depleted removed broth would require significant capital costs.

[0004] Thus, there remains a need for methods to reduce the costly wastewater treatment and high water usage requirements associated with continuous fermentation. One approach to reducing this wastewater treatment burden is to recycle the harvested broth back into the fermenter (referred to as bottoms recycle). However, the percentage of harvested broth that can be reintroduced into the fermenter is limited by the tolerance of the microorganisms to this recycle broth. Thus, improved microorganisms that allow for more efficient wastewater recycling would be advantageous. Summary of the Invention

[0005] BRIEF SUMMARY OF THE INVETION One aspect of the present invention provides a method for efficient fermentation broth recycling, the method comprising the steps of: feeding CO, CO 2 , and optionally H 2 providing a gaseous substrate comprising at least one acetogenic carboxydotrophic bacterium, and a liquid nutrient medium in the bioreactor, and allowing the at least one acetogenic carboxydotrophic bacterium to circulate CO, CO 2 , and H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0006] Another aspect of the invention provides a method for improving bottoms recycle, the method comprising the steps of: feeding CO, CO 2 , and optionally H 2 providing at least one acetogenic carboxydotrophic bacterium in a gaseous substrate, the gaseous substrate comprising CO, CO 2 , and optionally H2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0007] A further aspect of the present invention is 2 , CO, and optionally H 2 The present invention provides a method for converting CO, CO 2 , and optionally H 2 providing at least one acetogenic carboxydotrophic bacterium in a gaseous substrate, the gaseous substrate comprising CO, CO 2 , and H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0008] Additional aspects include methods of preparing animal feed and methods of preparing fertilizer. [Brief description of the drawings]

[0009] A brief description of several views of the drawing(s) [Figure 1]1A and 1B are images showing plots of average read density of gene clusters (determined by RNA-seq analysis) in the organisms SB1 (SB1 is a bacterium in one embodiment of the present invention) (FIG. 1A) and Clostridium autoethanogenum (FIG. 1B). The following genes are illustrated in FIGS. 1A and 1B: fdhH, moeA, moeB, fdhD, nuoE, nuoF, nuoG, hydN, and hydrogenase-1. Higher lines on the plots are proportional to higher levels of gene expression. [Diagram 2] 2A and 2B are graphs showing the average amount of gene expression for the hydrogenase-1 and formate dehydrogenase gene clusters in the organisms SB1 (FIG. 2A) and C. autoethanogenum (FIG. 2B). Formate dehydrogenase represents the average gene expression of formate dehydrogenase-related genes (fdhH-fdhD), and hydrogenase-1 represents the average gene expression of hydrogenase-related genes (nuoE-hydN). [Diagram 3] Figure 3 is a graph showing hydrogen uptake over time for C. autoethanogenum (C. auto) during fermentation in the presence of syngas. After 558 hours (arrow), the cell medium was switched to 85% bottoms recycle of the fermentation broth. [Figure 4] 4 is a graph showing hydrogen uptake of SB1 over time during fermentation in the presence of syngas. At 143 hours (arrow), the cell medium was switched to 75% bottoms recycle of the fermentation broth, and at 307 hours, the percentage of bottoms recycle was increased to 89%. [Diagram 5] FIG. 5 is a graph showing acetate concentration over time in fermentation broth of C. autoethanogenum (C. auto) in the presence of syngas as described in FIG. [Figure 6] FIG. 6 is a graph showing acetate concentration over time in the fermentation broth where SB1 is in the presence of syngas as described in FIG. [Figure 7]7A and 7B are bar graphs showing the average pan-gene expression for formate dehydrogenase and hydrogenase genes in SB1 (FIG. 7A) and C. autoethanogenum (FIG. 7B). [Figure 8] FIG. 8 is a bar graph showing quantitative ethanol and acetate productivity in SB1 and C. autoethanogenum. [Figure 9] FIG. 9 is a bar graph showing the rates of CO, hydrogen, and CO2 uptake in SB1 and C. autoethanogenum. [Figure 10] Figure 10 is a schematic diagram of the Wood-Ljungdahl pathway. [Figure 11A] 11A is a schematic diagram of plasmids according to one embodiment of the invention. pSyn63 contains the intergenic (IG) region (SEQ ID NO:3) from C. autoethanogenum and the first 100 bp of nuoE cloned into plasmid pMTL83151. Plasmid pSyn64 contains the intergenic region (SEQ ID NO:2) from SB1 and the first 100 bp of nuoE. The first 100 bp of nuoE is identical in both C. autoethanogenum and SB1. [Figure 11B] Figure 11B shows a plot of the expression of the nuoE gene in pSyn63 and pSyn64 transformed into strain SB1. Plasmid pMT183151 was used as a negative control in that it does not contain the nuoE gene. Error bars represent standard deviation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] Detailed Description of the Invention As noted above, one approach to reducing the wastewater treatment costs and high water usage associated with continuous fermentation is to recycle the harvested broth back into the reactor. Acetate also produces CO, CO 2 and H 2Acetate is produced during the fermentation of ethanol and, unlike ethanol, is not efficiently removed from the fermentation broth by methods such as distillation. Thus, in the absence of microbial conversion, acetate in the medium would increase during recycling of the fermentation broth, which would lead to toxicity and reduced fermentation performance. The fermentation broth could be discarded in the event that the acetate concentration became excessive, but nutrients for the fermentation would also be lost. Furthermore, acetate represents lost revenue and an increased burden for wastewater treatment.

[0011] Figure 10 illustrates the Wood-Ljungdahl pathway and first branch hydrogenase during the production of ethanol from syngas. Hydrogenase plays two roles in the production of ethanol. First, it converts CO to ethanol via formate dehydrogenase (FDH; indicated by the arrow). 2 Secondly, it produces reduced ferredoxin as well as NADPH, which is used to convert acetate to acetaldehyde (via aldehyde oxidoreductase (AOR)) and to ethanol (via alcohol dehydrogenase (ADH)). The dotted line from NADPH to ADH is used to indicate that ADH can use NADPH or NADH (which can be produced from NADPH). Thus, hydrogen uptake is required for efficient conversion of acetate to ethanol and for efficient recycling of the removed broth. Acetate can be produced directly from the Wood-Ljungdahl pathway as shown or can be present in the recycled cell broth (bottoms recycle). THF4- refers to tetrahydrofolate.

[0012] It has been discovered that an increase in the efficiency of fermentation broth recycling can be achieved by using an acetogenic carboxydotrophic bacterium that comprises an upstream region sequence that comprises at least about 90% identity to SEQ ID NO: 2. The upstream region sequence increases expression of a hydrogenase gene cluster (e.g., a hydrogenase gene cluster that comprises at least about 90% identity to SEQ ID NO: 1) and thereby enables the acetogenic carboxydotrophic bacterium to produce more hydrogenase enzyme, which would be expected to lead to increased production of NAD(P)H and reduced ferrodoxin.

[0013] One aspect of the invention provides a method for efficient fermentation broth recycling, the method comprising: (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the hydrogenase gene cluster comprises at least about 90% identity to SEQ ID NO:1, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0014] One aspect of the invention provides a method for efficient fermentation broth recycling, the method comprising: (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2(2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0015] In one embodiment, the oxygenation product is acetic acid ("acetic acid" and "acetate" are used interchangeably herein), butyrate, butanol, propanol. In one embodiment, the product is ethanol.

[0016] In one embodiment, CO, CO 2 , and optionally H 2 The gaseous substrate comprising is a synthesis gas (syngas), such as syngas obtained by gasification of coal or refinery residues, gasification of biomass or lignocellulosic materials, or reforming of natural gas. In another embodiment, the syngas may be obtained from the gasification of municipal or industrial solid waste.

[0017] The gaseous substrate may contain at least about 1, about 2, about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 mol% CO. The gaseous substrate may contain a range of CO, such as about 20 to about 80, about 30 to about 70, or about 40 to about 60 mol% CO. Preferably, the substrate contains about 40 to about 70 mol% CO (e.g., steel mill gas or blast furnace gas), about 20 to about 30 mol% CO (e.g., basic oxygen furnace gas), or about 15 to about 45 mol% CO (e.g., synthesis gas). In some embodiments, the gaseous substrate may contain relatively low amounts of CO, such as about 1 to about 10 or about 1 to about 20 mol% CO. In some embodiments, the gaseous substrate contains no or substantially no CO (<about 1 mol%).

[0018] The gaseous substrate is optionally H 2 For example, the gaseous substrate may include about 1, about 2, about 5, about 10, about 15, about 20, or about 30 mole % H 2 In some embodiments, the gaseous substrate may comprise about 60, about 70, about 80, or about 90 mol % H 2 Such relatively high amounts of H 2 In another embodiment, the gaseous substrate may comprise H 2 Free or substantially free (< about 1 mol %) of H 2 H using electrodes 2 The polypeptide may be derived from or produced by any suitable process, including the formation of:

[0019] The gaseous substrate is CO 2 For example, the gaseous substrate can include about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, about 1 to about 4, about 1 to about 3, or about 2 to about 3 mol % CO. 2 In some embodiments, the gaseous substrate may contain less than about 20, about 15, about 10, or about 5 mol% CO. 2In another embodiment, the gaseous substrate may comprise CO 2 %.

[0020] In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises the sequence taaatacttcaccctcccatttgaatattataattgatttcccccttaaaatattagaaggaataagatattagctctaaaccaaagatttgagcctctatacttaagaaataattttaaaacatataacacatttaatttaaaattattttaattaccttatttaaaaattaaaatataaacttagtcctatttaattagggactaattattaacattaaatattatattatttttatataactatatgattaattttttaagattatattcaaaaatatgttaacagaaatta (SEQ ID NO: 3). In one aspect, the at least one acetogenic carboxydotrophic bacterium does not comprise a sequence that is about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or about 100% identical to SEQ ID NO:3.

[0021] In one aspect, at least one acetogenic carboxydotroph comprises an upstream region sequence for a hydrogenase gene cluster that comprises at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity to SEQ ID NO:2 (taatttctgctaatacatttttaaataaggtaattaaaataattttaaattaaatatgttatatgttttaaaattatttcttaagcatagaggctcaaatctttgatttagagctaatatcttattccttctaatattttaagggggaaatcaattataatattcaaatgggagggtgaagtattta).

[0022] In one aspect, the at least one acetogenic carboxydotroph comprises a hydrogenase gene cluster that comprises at least about 90% or more, about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or about 100% sequence identity to SEQ ID NO: 1. In one aspect, the at least one acetogenic carboxydotroph comprises a hydrogenase gene cluster that comprises at least about 91% or more, about 92% or more, about 93% or more, about 94% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, about 99% or more, or about 100% sequence identity to any one or more of SEQ ID NOs: 4-9. In one embodiment, the hydrogenase gene cluster comprises the genes fdhH, moeA, moeB, fdhD, nuoE, nuoF, nuoG, hydN, and / or hydrogenase-1. In another embodiment, the hydrogenase gene cluster comprises the genes nuoE, nuoF, nuoG, hydN, and / or hydrogenase-1.

[0023] As used herein, a sequence is upstream of another sequence when it is located 5' to that sequence. A sequence is considered downstream of another sequence when it is located 3' to that sequence.

[0024] Identity (e.g., percent homology) can be determined using any homology comparison software, including, for example, the BlastN software of the National Center for Biotechnology Information (NCBI). According to one embodiment of the present invention, identity is global identity, i.e., identity over the entire amino acid or nucleic acid sequence of one embodiment of the present invention, and not over a portion thereof. For example, when comparing SEQ ID NO:2 and SEQ ID NO:3, using percent identity over the entire sequence provides an accurate view of the differences between the two sequences (i.e., SEQ ID NO:2 is missing a sequence that is part of SEQ ID NO:3).

[0025] In one aspect, the hydrogenase gene cluster in the at least one acetogenic carboxydotrophic bacterium is expressed at least about 1.5-fold, at least about 1.75-fold, at least about 2-fold, at least about 2.25-fold, at least about 2.5-fold, at least about 2.75-fold, at least about 3-fold, at least about 3.25-fold, at least about 3.5-fold, at least about 3.75-fold, at least about 4-fold, at least about 4.25-fold, or at least about 5-fold more than the hydrogenase gene cluster in C. autoethanogenum is expressed under similar culture conditions.

[0026] In one aspect, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, or at least about 25% more of at least one oxygenated product is produced compared to the amount of at least one oxygenated product produced by C. autoethanogenum under similar culture conditions.

[0027] In one embodiment, at least one acetogenic carboxydotrophic bacterium is cultured in a bioreactor to produce an acetogenic carboxydotrophic bacterial culture. In one embodiment, the acetogenic carboxydotrophic bacterial culture continuously produces at least one oxygenated product for more than about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 250 hours, about 300 hours, about 400 hours, about 500 hours, about 600 hours, about 700 hours, about 800 hours, about 900 hours, about 1,000 hours, 1,100 hours, about 1,200 hours, about 1,300 hours, about 1,400 hours, about 1,500 hours, about 1,600 hours, about 1,700 hours, about 1,800 hours, about 1,900 hours, about 2,000 hours, about 2,500 hours, or about 3,000 hours.

[0028] In one aspect, the method further comprises harvesting the bioreactor broth from the bioreactor to produce a harvest broth.

[0029] In one embodiment, the method further comprises removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth. The oxygenated product may be separated or purified from the fermentation broth using any method or combination of methods known in the art, including, for example, fractional distillation, evaporation, pervaporation, gas stripping, phase separation, and extractive fermentation, including, for example, liquid-liquid extraction. In a particular embodiment, the target product is recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, separating the cells from the broth (e.g., by centrifugation or filtration), and recovering one or more oxygenated products from the fermentation broth. Alcohol may be recovered, for example, by distillation.

[0030] In one aspect, the method further comprises removing cells of the acetogenic carboxydotrophic bacterial culture from the harvest broth and / or the oxygenation product depleted harvest broth. The removal of the cells can be by any suitable means, for example, by cyclone, filtration, or centrifugation. The cells can be intact cells or the cells can be lysed and the removal can include removal of lysed cellular components.

[0031] In one embodiment, the method further comprises providing the oxygenation product depleted harvest broth to the bioreactor. Additional nutrients (e.g., vitamins and metals) may be added to the oxygenation product depleted harvest broth to replenish it prior to returning it to the bioreactor.

[0032] In one aspect, at least about 1 gram, about 2 grams, about 3 grams, about 4 grams, about 5 grams, about 6 grams, about 7 grams, about 8 grams, about 9 grams, about 10 grams, about 11 grams, about 12 grams, about 13 grams, about 14 grams, about 15 grams, or about 20 grams of at least one product is produced per liter of harvest broth.

[0033] In one aspect, a harvest broth that is greater than about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% depleted in oxygenated products is provided back to the bioreactor. In this regard, about 1% to about 30% of the harvest broth depleted in oxygenated products is provided back to the bioreactor, e.g., about 1% to about 35%, about 1% to about 40%, about 1% to about 45%, about 1% to about 50%, about 1% to about 55%, about 1% to about 60%, about 1% to about 65%, about 1% to about 70%, about 1% to about 75%, or about 1% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the harvest broth is provided back to the bioreactor. In alternative embodiments, a harvest broth that is about 50% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% depleted in oxygenated products is provided back to the bioreactor.

[0034] An aspect of the invention further provides a method for improving bottoms recycle, the method comprising: (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the hydrogenase gene cluster comprises at least about 90% identity to SEQ ID NO:1, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0035] An aspect of the invention further provides a method for improving bottoms recycle, the method comprising: (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0036] One aspect of the present invention further comprises the steps of: 2 , and optionally H 2 (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2(2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the hydrogenase gene cluster comprises at least about 90% identity to SEQ ID NO:1, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0037] One aspect of the present invention further comprises the steps of: 2 , and optionally H 2 (a) introducing into a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; and (b) providing within the bioreactor the at least one acetogenic carboxydotrophic bacterium that is capable of absorbing CO, CO 2 , and optionally H 2 to at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor produce a bioreactor broth.

[0038] In one aspect, the upstream region sequence is operably linked to the hydrogenase gene cluster. In another aspect, the upstream region sequence is operably linked to at least a first gene of the hydrogenase gene cluster. In one aspect, the upstream region sequence is a promoter. In one aspect, the upstream region sequence is a promoter operably linked to at least a first gene of the hydrogenase gene cluster.

[0039] As used herein, the term "promoter" refers to an untranscribed sequence located upstream (i.e., 5') of the translation start codon of a gene (generally within about 1 to 1000 bp, preferably 1-500 bp, especially 1-100 bp) and which controls or influences the initiation of transcription of said gene.

[0040] "Increasing efficiency", "increased efficiency" and the like include, but are not limited to, increasing the amount of oxygenate-depleted harvest broth that can be provided to a bioreactor without negatively impacting the growth of at least one acetogenic carboxydotrophic bacterium.

[0041] Typically, the cultivation is carried out in a bioreactor. The term "bioreactor" includes a cultivation / fermentation device consisting of one or more vessels, towers, or piping arrangements, such as a continuous stirred tank reactor (CSTR), immobilized cell reactor (ICR), trickle bed reactor (TBR), bubble column, gas lift fermenter, static mixer, or other vessel or other device suitable for gas-liquid contact. In certain embodiments, the bioreactor may include a first growth reactor and a second cultivation / fermentation reactor. Substrate may be provided to one or both of these reactors. As used herein, the terms "cultivation" and "fermentation" are used interchangeably. These terms encompass both the growth and product biosynthesis stages of the cultivation / fermentation process.

[0042] As used herein, "bioreactor" refers to a bioreactor assembly. A bioreactor assembly is a group of one or more vessels suitable for containing aqueous broth and microorganisms for bioconversion. The bioreactor assembly may contain associated equipment such as injectors, recycle loops, and agitators. As used herein, "providing an oxygenated product depleted outlet broth to a bioreactor" means that the oxygenated product depleted outlet broth can be added to any part of the bioreactor assembly. For example, the oxygenated product depleted outlet broth can be added to a recycle loop, to a vessel containing aqueous broth, or to any convenient location within the bioreactor assembly. The oxygenated product depleted outlet broth can be removed from one bioreactor assembly and later added to another bioreactor assembly.

[0043] Any suitable bioreactor assembly may be used in the process of this invention. The bioreactor assembly may be a bioreactor assembly used for bioconversion of syngas, or the bioreactor assembly may be separate. Bioreactor assemblies for use in the process of this invention include, but are not limited to, column reactors; bubble columns; jet loop reactors; stirred tank reactors; fluidized bed reactors; trickle bed reactors; biofilm reactors, including, but not limited to, membrane bioreactors; and static mixer reactors, including, but not limited to, pipe reactors. One or more bioreactors may be used, and when two or more bioreactors are used, they may be in parallel or continuous operation. The bioreactor assembly may include, but is not necessarily required to include, heat exchangers; solids separation unit operations such as centrifuges, settling tanks, and filters; gas / liquid separation unit operations; pumps; and devices useful for monitoring and control of the bioreactor assembly.

[0044] A separate bioreactor assembly can be integrated into a facility for bioconversion of syngas to oxygenated organic compounds, if desired, For example, if the facility contains a distillation assembly, the distillation assembly can be used to remove at least a portion of the oxygenated products and to denature the aqueous fermentation broth.

[0045] As used herein, "biomass" refers to biological material of living or recently living plants and animals and contains at least hydrogen, oxygen, and carbon. Biomass typically also contains nitrogen, phosphorus, sulfur, sodium, potassium, and trace metals. The chemical composition of biomass can vary from source to source and even within a source. Sources of biomass include, but are not limited to, harvested plants such as wood, grass clippings and yard waste, switchgrass, corn (including corn stover), hemp, sorghum, sugarcane (including bagasse); and waste materials such as garbage and municipal solid waste. Biomass does not include fossil fuels such as coal, natural gas, and oil.

[0046] Fossil carbonaceous materials, or fossil fuels, include, but are not limited to, natural gas; petroleum, lignite, and coal, including carbonaceous streams from the refining or other processing of petroleum, including, but not limited to, petroleum coke.

[0047] As used herein, "aqueous broth" or "aqueous fermentation broth" refers to a liquid water phase that may contain dissolved compounds including, but not limited to, hydrogen, carbon monoxide, and carbon dioxide.

[0048] Intermittent means from time to time, and can be at regular or irregular time intervals.

[0049] Syngas means a gas, regardless of source, that contains at least one of hydrogen and carbon monoxide and may, and usually does, contain carbon dioxide.

[0050] Syngas can be made from many carbonaceous feedstocks. These include sources of hydrocarbons such as natural gas, biogas, biomass, especially woody biomass, gas produced by reforming hydrocarbon-containing materials, peat, petroleum coke, coal, waste materials such as debris from construction and demolition, municipal solid waste, and landfill gas. Syngas is typically produced by gasifiers or reformers (steam, autothermal, or partial oxidation). Any of the aforementioned biomass sources are suitable for producing syngas. The syngas produced thereby typically contains about 10 to about 60 mol% CO, about 10 to about 25 mol% CO. 2 and about 10 to about 75, often at least about 30, and preferably between about 35 and about 65, mole percent H 2 Syngas will also contain N 2 and C.H. 4 And H 2 S and C.O.S., N.H. 3 and trace components such as HCN. Other sources of gas substrates include gases produced during petroleum and petrochemical processing as well as gases produced from industrial processes. These gases may have compositions substantially different from typical synthesis gases and may be essentially pure hydrogen or essentially pure carbon monoxide. Gas substrates may be obtained directly from gasification or from petroleum and petrochemical processing or industrial processes or by blending two or more streams. Gas substrates may also be treated to remove or change composition, including but not limited to removing components by chemical or physical sorption, membrane separation, water-gas shift, and selective reaction.

[0051] The product oxygenated organic compounds produced in the process of this invention will depend on the microorganism or combination of microorganisms used for fermentation and the conditions of fermentation.

[0052] Any suitable microorganism having the characteristics recited in the claims may be used.

[0053] The aqueous broth is maintained under anaerobic fermentation conditions, including a suitable temperature, for example, between about 25° C. and about 60° C., or in the range of about 30° C. to about 40° C. Fermentation conditions, including microbial density and aqueous fermentation broth composition, are preferably sufficient to achieve a desired conversion efficiency of hydrogen and carbon monoxide. The pH of the aqueous broth is acidic, for example, between about 4 and about 6.5.

[0054] The rate of syngas feed to the bioreactor under steady-state conditions is preferably such that the rate of carbon monoxide and hydrogen transfer to the liquid phase is consistent with the rate at which carbon monoxide and hydrogen are bioconverted. The rate at which carbon monoxide and hydrogen can be consumed will be influenced by the nature of the microorganisms, the concentration of the microorganisms in the aqueous fermentation broth, and the fermentation conditions. Since the rate of carbon monoxide and hydrogen transfer to the aqueous fermentation broth is an operational parameter, conditions that affect the rate of transfer, such as the interfacial surface area between the gas and liquid phases and the driving force, are important. Preferably, the feed gas is introduced into the bioreactor in the form of microbubbles. Often, the microbubbles have a diameter in the range of about 0.01 to about 0.5, or about 0.02 to about 0.3 millimeters.

[0055] In another aspect, the present disclosure provides a method for preparing an animal feed. Animal feed as used herein can be any suitable type of animal feed, such as, for example, aquaculture (fish feed), poultry feed, cattle feed, pig feed, bird feed, etc. In one aspect, the extracted cells are effective for use as an animal feed. In a further aspect, the present disclosure provides a method for preparing an animal feed, the method comprising: feeding a bioreactor with: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; wherein the at least one acetogenic carboxydotrophic bacterium is adapted to circulate CO, CO 2 , and H 2to at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the hydrogenase gene cluster comprises at least about 90% identity to SEQ ID NO:1, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor include creating a bioreactor broth, removing the bioreactor broth from the bioreactor to produce a removal broth, removing at least one oxygenated product from the removal broth to produce an oxygenated product-depleted removal broth, and removing cells of the acetogenic carboxydotrophic bacteria culture from the removal broth and / or the oxygenated product-depleted removal broth, wherein the removed cells are effective for use as an animal feed. In a further aspect, the present disclosure provides a method for preparing an animal feed, the method comprising: feeding to a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; wherein the at least one acetogenic carboxydotrophic bacterium is adapted to circulate CO, CO 2 , and H 2to at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprising at least a first gene, the upstream region sequence being upstream of the first gene, the upstream region sequence comprising at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor include producing a bioreactor broth, removing the bioreactor broth from the bioreactor to produce a removal broth, removing at least one oxygenated product from the removal broth to produce an oxygenated product-depleted removal broth, and removing cells of the acetogenic carboxydotrophic bacteria culture from the removal broth and / or the oxygenated product-depleted removal broth, wherein the removed cells are effective for use as an animal feed. In some embodiments, the methods of preparing animal feed are useful for producing aqueous cultures containing relatively low amounts of one or more toxic metals, such as mercury, iron, nickel, etc.

[0056] In another aspect, the disclosure provides a method for preparing a fertilizer. In one aspect, the harvested cells are effective for use as a fertilizer. In a further aspect, the disclosure provides a method for preparing a fertilizer, the method comprising: feeding a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; wherein the at least one acetogenic carboxydotrophic bacterium is adapted to circulate CO, CO 2 , and H 2to at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the hydrogenase gene cluster comprises at least about 90% identity to SEQ ID NO:1, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions in the bioreactor include creating a bioreactor broth, removing the bioreactor broth from the bioreactor to produce a removal broth, removing at least one oxygenated product from the removal broth to produce an oxygenated product depleted removal broth, and removing cells of the acetogenic carboxydotrophic bacteria culture from the removal broth and / or the oxygenated product depleted removal broth, wherein the removed cells are available for use as a fertilizer. In a further aspect, the present disclosure provides a method for preparing a fertilizer, the method comprising: feeding to a bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; wherein the at least one acetogenic carboxydotrophic bacterium is adapted to circulate CO, CO 2 , and H 2to at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster, the hydrogenase gene cluster comprising at least a first gene, the upstream region sequence being upstream of the first gene, the upstream region sequence comprising at least about 90% identity to SEQ ID NO:2; and the conditions in the bioreactor include producing a bioreactor broth, removing the bioreactor broth from the bioreactor to produce a removal broth, removing at least one oxygenated product from the removal broth to produce an oxygenated product-depleted removal broth, and removing cells of the acetogenic carboxydotrophic bacteria culture from the removal broth and / or the oxygenated product-depleted removal broth, wherein the removed cells are available for use as a fertilizer.

[0057] In one embodiment, the extracted cells are useful for landfill applications or land applications as fertilizer or animal feed. In one embodiment, the extracted cells useful for fertilizer, animal feed, landfill applications, and / or land applications contain protein, fat, carbohydrate, and / or minerals, for example, 86% protein, 2% fat, 2% minerals, 10% carbohydrate. The extracted cells can be useful for landfill applications (e.g., for Class A solids), land applications as fertilizer, or animal feed, such as aquaculture (fish feed), poultry feed, cattle feed, pig feed, etc. In the case of fish feed, advantageously, in some embodiments, the fish feed contains less total toxic metals compared to conventional fish meal.

[0058] In some embodiments, the harvested cells contain about 25 to about 50% solids by weight, such as about 25 to about 40% solids by weight. The amount of recovered solids is advantageous because it contains proteins, carbohydrates, minerals, and potentially vitamins that are nutritious for plants and animals.

[0059] The extracted cells can be used in a wet or dry state. For example, in some embodiments, the extracted cells are effective for use as a wet fertilizer. In some embodiments, the method further comprises drying the extracted cells to form a "dry cake", and the resulting dry cake is effective for use as a dry fertilizer, animal feed or fish feed, or any combination thereof. Drying the extracted cells can also be used as a means to concentrate the extracted cells. However, the extracted cells can be dried using any suitable means.

[0060] The respective compositions of animal feed and fertilizer are generally similar since they are mainly composed of microbial proteins and / or carbohydrates. In some embodiments, the animal feed and / or fertilizer contain protein (e.g., about 30% to about 90% by weight, such as about 60% to about 90% by weight), fat (e.g., about 1% to about 12% by weight, such as about 1% to about 3% by weight), carbohydrate (e.g., about 5% to about 60% by weight, such as about 15% to about 60% by weight, or about 5% to about 15% by weight), and / or minerals such as sodium, potassium, copper (e.g., about 1% to about 20% by weight, such as about 1% to about 3% by weight). For example, the animal feed and / or fertilizer may contain about 86% protein, about 2% fat, about 2% minerals, and about 10% carbohydrate.

[0061] Examples of Non-Limiting Aspects of the Disclosure

[0062] Aspects, including embodiments, of the subject matter described herein may be useful alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing, certain non-limiting aspects of the present disclosure, numbered 1 to 18, are provided below. As will be apparent to one of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or succeeding individually numbered aspects. This is intended to provide support for all such aspect combinations and is not limited to the aspect combinations explicitly provided below:

[0063] (1) A method for efficient fermentation broth recycling, comprising: (a) Into the bioreactor: (1) CO, CO 2 , and optionally H 2 A gaseous substrate containing; (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to react with CO, CO 2 , and optionally H 2 and providing conditions for converting the compound into at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

[0064] (2) The process of embodiment (1), wherein the oxygenation product is ethanol.

[0065] (3) The method of embodiment (1), wherein the at least one acetogenic carboxydotrophic bacterium does not include SEQ ID NO:3.

[0066] (4) The method of embodiment (1), wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for the hydrogenase gene cluster comprising at least about 95% identity to SEQ ID NO:2.

[0067] (5) The method of embodiment (1), wherein the hydrogenase gene cluster comprises at least about 90% sequence identity to SEQ ID NO:1.

[0068] (6) The method of embodiment (1), wherein the hydrogenase gene cluster in the at least one acetogenic carboxydotrophic bacterium is expressed at least about 1.5 times more than the hydrogenase gene cluster in Clostridium autoethanogenum is expressed under similar culture conditions.

[0069] (7) The method of embodiment (1), wherein at least one oxygenated product is produced in an amount that is at least about 5% greater than the amount of at least one product produced by Clostridium autoethanogenum under similar culture conditions.

[0070] (8) The method of embodiment (1), wherein the at least one acetogenic carboxydotrophic bacterium is cultured in a bioreactor to produce an acetogenic carboxydotrophic bacterial culture.

[0071] (9) The method of embodiment (8), wherein the acetogenic carboxydotrophic bacterial culture continuously produces at least one oxygenated product for more than about 24 hours.

[0072] (10)Further: (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth; and (f) providing said oxygenated product depleted harvest broth to a bioreactor. The method of embodiment (8), comprising:

[0073] (11) The method of embodiment (10), wherein at least about 1 gram of at least one oxygenated product is produced per liter of harvest broth.

[0074] (12) The method of embodiment (10), wherein about 80% or more of the oxygenated product depleted harvest broth is provided to the bioreactor.

[0075] (13) The method according to any one of claims 10 to 12, wherein the extracted cells are effective for use as animal feed.

[0076] (14) The method according to any one of claims 10 to 13, wherein the extracted cells are effective for use as a fertilizer.

[0077] (15) A method for improving bottoms recycling, the method comprising: (a) Into the bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to react with CO, CO 2 , and optionally H 2 and providing conditions for converting the compound into at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

[0078] (16) CO, CO 2 , and optionally H 2 ethanol, the method comprising: (a) Into the bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to react with CO, CO 2 , and optionally H 2 and providing conditions for converting the compound into at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

[0079] (17) A method for preparing an animal feed, the method comprising: (a) Into the bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; (b) causing the at least one acetogenic carboxydotrophic bacterium to react with CO, CO 2 , and H2 providing conditions for converting the above-mentioned into at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth; (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; and (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth. Including, wherein said extracted cells are effective for use as an animal feed.

[0080] (18) A method for preparing a fertilizer, the method comprising: (a) Into the bioreactor: (1) CO, CO 2 , and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; (b) causing the at least one acetogenic carboxydotrophic bacterium to react with CO, CO 2 , and H 2 providing conditions for converting the above-mentioned into at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence of a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth; (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; and (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth. Including, A method wherein said harvested cells are available for use as a fertilizer. EXAMPLES

[0081] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

[0082] Example 1 This example demonstrates that the abundance of gene expression in the hydrogenase gene cluster of SB1 differs from that of C. autoethanogenum.

[0083] SB1 and C. autoethanogenum were cultivated under identical steady-state conditions and then analyzed using RNAseq analysis to determine the levels of expression of nine genes. The genes (protein, function) are as follows: fdhH (formate dehydrogenase H, oxidoreductase), moeA (molybdopterin molybdotransferase), moeB (molybdopterin-guanine dinucleotide biosynthesis adaptor protein), fdhD (formate dehydrogenase accessory protein FdhD), nuoE (NADH-quinone oxidoreductase subunit E), nuoF (NADH-quinone oxidoreductase subunit F), nuoG (NADH-quinone oxidoreductase subunit G), hydN (electron transport protein hydN), and hydrogenase-1 (hydrogenase).

[0084] The read density derived from the RNAseq data for each organism, which is proportional to the level of gene expression, was plotted. As seen in Figures 1A and 1B, the levels of read density differ between SB1 and C. autoethanogenum. Higher values ​​on the plot represent higher levels of gene expression. Figures 2A and 2B are graphs showing the average amount of gene expression for the hydrogenase-1 gene cluster and the formate dehydrogenase gene cluster in organisms SB1 (Figure 2A) and C. autoethanogenum (Figure 2B). Formate dehydrogenase represents the average gene expression of genes involved in formate dehydrogenase (fdhH-fdhD), and hydrogenase-1 represents the average gene expression of genes involved in hydrogenase (nuoE-hydN). Figure 2A is a plot of data derived from the analysis of the data used to generate Figure 1A, and Figure 2B is a plot of data derived from the analysis of the data used to generate Figure 1B. In SB1, the average gene expression for the hydrogenase-1 gene cluster is higher than the average gene expression for the formate dehydrogenase gene cluster, whereas in C. autoethanogenum, the average gene expression is lower for the hydrogenase-1 gene cluster than for the formate dehydrogenase gene cluster.

[0085] Example 2 This example demonstrates that SB1 tolerates high levels of bottoms recycling.

[0086] SB1 was placed in a fermentation vessel in the presence of syngas and the amount of hydrogen uptake (mmol / L / Hr) was recorded. As seen in Figure 4, at 143 hours (arrow), the cell medium was switched to 75% bottoms recycle. At 307 hours (arrow), the cell medium was switched to 89% bottoms recycle. Hydrogen uptake of SB1 remained stable for at least the next 700 hours. Acetate concentration remained stable for at least the next 500 hours, as seen in Figure 6.

[0087] The data indicate that increasing bottoms recycling did not negatively impact the growth or productivity of SB1, and that SB1 can tolerate at least 89% bottoms recycling without negative impact.

[0088] Comparative Example 3 This example demonstrates that C. autoethanogenum does not tolerate 85% bottoms recycling.

[0089] C. autoethanogenum was placed in a fermentation vessel in the presence of syngas. At 558 hours, the cell medium was switched to 85% bottoms recycle.

[0090] Within 100 hours of switching to 85% bottoms recycle, hydrogen uptake (mmol / L / hr) began to decrease, as seen in Figure 3. Acetate levels began to increase, as seen in Figure 5. These data indicate a decline in C. autoethanogenum growth and productivity and poor tolerance of 85% bottoms recycle.

[0091] Example 4 SB1 and C. autoethanogenum (strain DSM 10061) were cultivated under identical steady-state conditions and then analyzed.

[0092] Direct expression comparison between C. autoethanogenum and SB1 was performed by Igenbio, Inc. (Chicago, IL) using a pan-genome approach (see Medini, et al., Current Opinion in Genetics & Development, 15(6): 589-594(2005)). ERGO TMA genome analysis and discovery system (see Overbeek et al., Nucleic Acids Research, 31(1): 164-171 (2003)) was used to identify the bidirectional best hits between C. autoethanogenum and SB1 and generate a core genome. RNA-Seq data from C. autoethanogenum and SB1 were used for analysis with the core genome containing the bidirectional best hits.

[0093] 7A and 7B are bar graphs showing the average gene expression for formate dehydrogenase and hydrogenase genes in SB1 (FIG. 7A) and C. autoethanogenum (FIG. 7B). Gene expression for genes in the formate dehydrogenase (fdhH-fdhD) and hydrogenase gene clusters (nuoE-hydN) were then averaged and plotted. In SB1, the average gene expression for the hydrogenase gene cluster is higher than the average gene expression for the formate dehydrogenase gene cluster. In C. autoethanogenum, the average gene expression is lower for the hydrogenases than for the formate dehydrogenase gene cluster. Furthermore, hydrogenase expression is higher in SB1 than in C. autoethanogenum, whereas the opposite is true for formate dehydrogenase expression.

[0094] Figure 8 shows the quantitative productivity of ethanol and acetic acid in SB1 and C. autoethanogenum. Values ​​were derived from the ethanol and acetate concentrations in the fermentation broth (measured by gas chromatography). Figure 9 shows the quantitative productivity of CO, hydrogen, and CO in SB1 and C. autoethanogenum. 2 The rates of uptake are shown. Gas uptake was measured by process mass spectrometry. CO uptake is almost identical for the two organisms, whereas hydrogen uptake is higher for SB1. CO 2Uptake is also higher for SB1 compared to C. autoethanogenum.

[0095] Example 5 This example demonstrates that the intergenic region from SB1 is sufficient for elevated expression of hydrogenase. The intergenic (IG) (upstream) region and fragments corresponding to the first 100 bp of nuoE from C. autoethanogenum (C. auto) and SB1 were amplified via PCR. nuoE is the first gene of the cluster encoding the first branching hydrogenase, and the first 100 bp of the nuoE gene from both strains are identical in sequence. The intergenic nuoE regions from C. autoethanogenum and SB1 strains were then cloned into plasmid pMTL83151 to form plasmids pSyn63 and pSyn64, respectively (FIG. 11A). The plasmids were then transformed into SB1 strain and selected using 2ug / ml thiamphenicol. Plasmid pMTL83151 was also transformed as a negative control.

[0096] Cells containing pSyn63, pSyn64, and pMTL83151 were cultured in fructose medium (Mock, et al., J. Bacteriol., 197(18): 2965-2980(2015)). Cells were washed and then cultured in the same medium in the presence of syngas as a carbon and energy source. Cells were then captured by freezing in liquid nitrogen, RNA was extracted and converted to cDNA, and nuoE expression was quantified using plasmid-specific qPCR (FIG. 11B). Expression of catP, encoding thiamphenicol resistance, was also quantified similarly and used to normalize expression. FIGS. 11A and 11B together show that the intergenic region of SB1 is sufficient for higher expression of hydrogenase genes.

[0097] These results indicate that the intergenic region from SB1 is sufficient to produce higher levels of nuoE expression than the intergenic region from C. autoethanogenum, indicating that the differences in gene expression originate from this intergenic region.

[0098] All references, including publications, patent applications, and patents, cited in this specification are herein incorporated by reference to the same extent as if each reference was individually and specifically indicated to be incorporated by reference and was set forth in its entirety herein.

[0099] Use of the terms "a" and "an" and "the" and "at least one" and similar referents in the context of describing the invention (particularly in the context of the claims below) should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Use of the term "at least one" followed by a list of one or more items (e.g., "at least one of A and B") should be construed to mean one item (A or B) selected from the listed items or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (i.e., meaning "including, but not limited to"), unless otherwise noted. The recitation of ranges of values ​​herein is intended to serve as a simple way of referring to each separate value falling within the range individually, unless otherwise indicated herein, and each separate value is incorporated herein as if it were individually recited herein. All methods described herein can be carried out in any suitable order, unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary terms (e.g., "such as") provided herein is intended merely to better clarify the invention, and does not impose limitations on the scope of the invention unless otherwise stated in the claims. No terminology in this specification should be construed as indicating any element not recited in the claims as essential to the practice of the invention.

[0100] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of these preferred embodiments may become apparent to those skilled in the art upon reading the foregoing description. The inventors expect that such variations will be utilized by those skilled in the art, and the inventors intend to carry out the invention otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

1. 1. A method for efficient fermentation broth recycling, comprising: (a) To the bioreactor: (1) CO, CO ２ , and optionally H ２ (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to circulate in the bioreactor; ２ , and optionally H ２ and providing conditions for converting said at least one oxygenated product into said at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

2. 2. The process of claim 1, wherein the oxygenation product is ethanol.

3. 2. The method of claim 1, wherein at least one acetogenic carboxydotrophic bacterium does not include SEQ ID NO:

3.

4. 2. The method of claim 1, wherein at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster that comprises at least 95% identity to SEQ ID NO:

2.

5. 2. The method of claim 1, wherein the hydrogenase gene cluster comprises at least about 90% sequence identity to SEQ ID NO:

1.

6. 2. The method of claim 1, wherein the hydrogenase gene cluster in the at least one acetogenic carboxydotrophic bacterium is expressed at least about 1.5 times more than the hydrogenase gene cluster in Clostridium autoethanogenum is expressed under similar culture conditions.

7. 2. The method of claim 1, wherein at least about 5% more of the at least one oxygenated product is produced compared to the amount of the at least one oxygenated product produced by Clostridium autoethanogenum under similar culture conditions.

8. 10. The method of claim 1, wherein at least one acetogenic carboxydotrophic bacterium is cultured in a bioreactor to produce an acetogenic carboxydotrophic bacterial culture.

9. 9. The method of claim 8, wherein the acetogenic carboxydotrophic bacterial culture continuously produces at least one oxygenated product for greater than about 24 hours.

10. moreover: (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth; and (f) providing the oxygenated product depleted harvest broth to a bioreactor. The method of claim 8 , comprising:

11. 11. The method of claim 10, wherein at least about 1 gram of the at least one oxygenated product is produced per liter of harvest broth.

12. 11. The method of claim 10, wherein about 80% or more of the oxygenated product depleted harvest broth is provided to the bioreactor.

13. The method of any one of claims 10 to 12, wherein the harvested cells are effective for use as an animal feed.

14. The method of any one of claims 10 to 13, wherein the harvested cells are available for use as a fertilizer.

15. 1. A method for improving bottoms recycling, the method comprising: (a) To the bioreactor: (1) CO, CO ２ , and optionally H ２ (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to circulate in the bioreactor; ２ , and H ２ and providing conditions for converting said at least one oxygenated product into said at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

16. CO, CO ２ , and optionally H ２ ethanol, the method comprising: (a) To the bioreactor: (1) CO, CO ２ , and optionally H ２ (2) at least one acetogenic carboxydotrophic bacterium; and (3) providing a liquid nutrient medium; and (b) causing the at least one acetogenic carboxydotrophic bacterium to circulate in the bioreactor; ２ , and optionally H ２ and providing conditions for converting said at least one oxygenated product into said at least one oxygenated product. Including, wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, The method, wherein the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth.

17. 1. A method for preparing an animal feed, the method comprising: (c) To the bioreactor: (1) CO, CO ２ , and optionally H ２ (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; (d) causing the at least one acetogenic carboxydotrophic bacterium to circulate in the bioreactor; ２ , and H ２ providing conditions for converting the above-mentioned into at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence for a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth; (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; and (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth. Including, wherein said extracted cells are effective for use as an animal feed.

18. 1. A method for preparing a fertilizer, the method comprising: (e) To the bioreactor: (1) CO, CO ２ , and optionally H ２ (2) at least one acetogenic carboxydotrophic bacterium; and (3) a liquid nutrient medium; (f) detecting in the bioreactor the presence of the at least one acetogenic carboxydotrophic bacterium and / or the presence of CO, CO ２ , and H ２ providing conditions for converting the above-mentioned into at least one oxygenated product; wherein the at least one acetogenic carboxydotrophic bacterium comprises an upstream region sequence of a hydrogenase gene cluster; The hydrogenase gene cluster comprises at least a first gene, the upstream region sequence is upstream of the first gene, the upstream region sequence comprises at least about 90% identity to SEQ ID NO:2, and the conditions within the bioreactor produce a bioreactor broth; (c) removing the bioreactor broth from the bioreactor to produce a removal broth; (d) removing at least one oxygenated product from the harvest broth to produce an oxygenated product-depleted harvest broth; and (e) harvesting cells of an acetogenic carboxydotrophic bacterial culture from said harvest broth and / or said oxygenation product depleted harvest broth. Including, A method wherein said harvested cells are available for use as a fertilizer.

Images