Schwann cell specific promoter

Abstract

The present invention relates to a Schwann cell-specific promoter and its use. More specifically, the present invention relates to an artificially modified minimal promoter that functions specifically in Schwann cells, and the artificially modified minimal promoter is derived from the MPZ (myelin protein zero or P0) promoter. The present invention also relates to a vector using the Schwann cell-specific promoter and a method for treating Schwann cell-related diseases using the same.

Description

[Technical field]

[0001] The present disclosure relates to a Schwann cell-specific promoter and uses thereof. More specifically, the present disclosure relates to an artificially modified minimal promoter that functions specifically in Schwann cells. The artificially modified minimal promoter is derived from the promoter of myelin protein zero (MPZ or P0). Additionally, the present disclosure relates to a vector using the Schwann cell-specific promoter and a method of using the same to treat a disease associated with Schwann cells. [Background technology]

[0002] Schwann cells (hereafter abbreviated as SC) or neurolemmocytes are the basic glial cells of the peripheral nervous system. Glial cells support neurons. In myelinated axons, Schwann cells form the myelin sheath. The nervous system of vertebrates is insulated by the myelin sheath, which maintains the membrane capacitance of the axon.

[0003] Charcot-Marie-Tooth (CMT) disease is a genetic disease. Charcot-Marie-Tooth (CMT) disease is a disease that gradually weakens the muscles of the hands and feet. It is caused by an abnormality in Schwann cells, which are responsible for forming the myelin sheath in the peripheral nervous system. Among the types of CMT disease, Charcot-Marie-Tooth type 1A (CMT1A) is one of the most frequent genetic diseases that occur in the peripheral nervous system.

[0004] CMT1A accounts for more than half of all CMT cases and approximately 70% of CMT1 cases, with an incidence of CMT of 1 in 2500. CMT1A causes pathological features such as muscle weakness and loss, decreased reflexes, peripheral sensory loss, limb deformities, decreased nerve conduction velocity (NCV), and hypertrophic segmental demyelination and remyelination with the formation of onion-like structures.

[0005] In recent years, gene therapy techniques have been applied to diseases caused by Schwann cell dysfunction, such as CMT1A. In addition to CMT disease, gene therapy techniques targeting Schwann cells can be applied to many other diseases related to Schwann cells, such as motor neuron disease (MND), and even diseases caused by factors other than genetic factors. Since the causes of most of these diseases are different and poorly understood, it may be beneficial to target these diseases using viral vectors. To improve the treatment outcomes of Schwann cell-associated diseases, including demyelinating neuropathies such as CMT, there is still a need to improve the methods of targeting these diseases. Summary of the Invention [Problem to be solved by the invention]

[0006] One object of the present disclosure is to provide a Schwann cell-specific promoter.

[0007] Another object of the present disclosure is to provide a Schwann cell-specific expression vector.

[0008] It is yet another object of the present disclosure to provide a method for treating a Schwann cell-related disease using a Schwann cell-specific expression vector. [Means for solving the problem]

[0009] The present disclosure provides Schwann cell-specific promoters.

[0010] The Schwann cell specific promoter may comprise a sequence selected from the following:

[0011] SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and sequences having at least 70% homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14.

[0012] The present disclosure provides Schwann cell-specific expression vectors.

[0013] The Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter; and a gene of interest.

[0014] The gene of interest may be operably linked to a Schwann cell-specific promoter.

[0015] The Schwann cell-specific promoter may comprise a sequence selected from SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and a sequence having at least 70% homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14.

[0016] The gene of interest may be a gene configured to be expressed in Schwann cells or a nucleic acid encoding a protein to be expressed in Schwann cells. Herein, the gene of interest may be a nucleic acid encoding a protein used to artificially modify a gene in Schwann cells. For example, the protein for artificially modifying a gene may be a Cas protein, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN). Herein, the Cas protein may be a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein. For example, the Cas9 protein may be a Streptococcus pyogenes Cas9 (SpCas9) protein, a Staphylococcus aureus Cas9 (SaCas9) protein, a Campylobacter jejuni Cas9 (CjCas9) protein, or a Staphylococcus auricularis Cas9 (SauriCas9) protein. In the present specification, a gene encoding a protein for artificially modifying a gene can be expressed to edit a gene associated with a disease associated with Schwann cells. By using this, the protein can induce a knockout effect on a gene associated with a disease associated with Schwann cells.

[0017] Additionally, if desired, the promoters of the present disclosure can be used to overexpress a gene of interest in Schwann cells, where the gene of interest serves the role of a gene associated with a Schwann cell-related disease.

[0018] In one example, the gene associated with a Schwann cell-related disease may be the connexin32 (Cx32) gene, the SH3 domain and tetratricopeptide repeat 2 (SH3TC2) gene, the myelin protein zero (MPZ) gene, the early growth response 2 (EGR2) gene, the ganglioside induced differentiation associated protein 1 (GDAP1) gene, the N-Myc downstream regulated 1 (NDRG1) gene, or the peripheral myelin protein 22 (PMP22) gene. To obtain a disease treatment effect, the gene can be knocked out or overexpressed as necessary.

[0019] The Schwann cell-specific expression vector may comprise a viral vector or a non-viral vector. As used herein, the viral vector may be one or more viral vectors selected from the group consisting of retroviral (retrovirus) vectors, lentiviral (lentivirus) vectors, adenoviral (adenovirus) vectors, adeno-associated viral (adeno-associated virus) vectors, vaccinia viral (vaccinia virus) vectors, poxviral (poxvirus) vectors, and herpes simplex viral (herpes simplex virus) vectors.

[0020] The Schwann cell specific expression vector may further comprise one or more regulatory / regulatory elements. Herein, the regulatory / regulatory elements may be an enhancer, an artificial intron, a polyadenylation signal, and / or a WPRE. In another example, the Schwann cell specific expression vector may comprise a polyadenylation signal. Herein, the polyadenylation signal may be synpA or SV40pA. In yet another example, the Schwann cell specific expression vector may comprise an artificial intron and a WPRE. Herein, the artificial intron may be an MVM intron, and the WPRE may be a WPRE3. In yet another example, the Schwann cell specific expression vector may comprise an artificial intron, a WPRE, and a polyadenylation signal. Herein, the artificial intron may be an MVM intron, the WPRE may be a WPRE3, and the polyadenylation signal may be synpA or SV40pA.

[0021] The present disclosure provides a composition comprising a Schwann cell-specific expression vector.

[0022] The composition may comprise a Schwann cell-specific expression vector as described above.

[0023] The present disclosure provides methods of treating diseases associated with Schwann cells.

[0024] The method may include introducing (or delivering) a composition to a subject.

[0025] The composition may comprise a Schwann cell specific expression vector. As used herein, the Schwann cell specific expression vector is as described above.

[0026] The subject may be a human or a non-human animal with a disease associated with Schwann cells. (Beneficial Effects)

[0027] The present disclosure relates to a Schwann cell specific promoter and its use. Through the technology disclosed herein, a vector comprising a Schwann cell specific promoter and its use can be provided. In addition, a pharmaceutical composition and a method for treating a disease associated with Schwann cells can be provided using a vector comprising a Schwann cell specific promoter. [Brief description of the drawings]

[0028] [Figure 1] 1 is a graph showing expression of Cas9 driven by a modified MPZ promoter in a rat Schwann cell line.

[0029] [Diagram 2] FIG. 13 is a graph showing the efficiency of targeted gene editing of pmp22-TATA by expression of Cas9 under the control of a modified MPZ promoter in a rat Schwann cell line.

[0030] [Diagram 3] 1 is a graph showing expression of Cas9 from a modified MPZ promoter in a human Schwann cell line.

[0031] [Figure 4] FIG. 13 is a graph showing gene editing efficiency of pmp22-TATA targeted by expression of Cas9 under the control of a modified MPZ promoter and expression of an optimized sgRNA vector in S16 cells.

[0032] [Diagram 5] FIG. 13 is a graph showing gene editing efficiency of pmp22-TATA targeted by expression of Cas9 under the control of a modified MPZ promoter and expression of an optimized sgRNA vector in RT4 cells.

[0033] [Figure 6]FIG. 13 is a graph showing gene editing efficiency of pmp22-TATA targeted by other polyA vectors and modified MPZ promoter-driven Cas9 expression in S16 cells.

[0034] [Figure 7] This is a graph showing the gene editing efficiency of targeted pmp22-TATA by the combination of the small SauriCas9 capable of single AAV packaging, optimized elements (Intron, WPRE), and modified MPZ promoter in RT4 cells.

[0035] [Figure 8] FIG. 13 is a graph showing the efficiency of targeted gene editing of pmp22-TATA by expression of Cas9 under the control of a modified MPZ promoter in the RT4-D6P2T cell line.

[0036] [Figure 9] FIG. 1 is a graph showing gene editing efficiency of targeted pmp22-TATA by expression of Cas9 under the control of a modified MPZ promoter in the RT4-D6P2T cell line using sgRNAs with different sequences (Table 1).

[0037] [Figure 10] FIG. 1 is a graph showing expression of tdTomato driven by a modified MPZ promoter in the RT4-D6P2T cell line.

[0038] [Figure 11] 1 is a graph showing the level of transduction of pAAV-tdTomato related vectors into the RT4-D6P2T cell line.

[0039] [Figure 12]Figures 12 and 13 are graphs showing gene editing efficiency (indels) in rat sciatic nerve, lumbar nerve, and liver after co-transfection of a vector expressing an sgRNA targeting the pmp22-TATA region (Table 1) with a vector expressing SpCas9 under the control of the EFS promoter and a vector expressing SpCas9 under the control of the IE200 promoter into the tail vein of the rat. [Figure 13] Figures 12 and 13 are graphs showing gene editing efficiency (indels) in rat sciatic nerve, lumbar nerve, and liver after co-transfection of a vector expressing an sgRNA (Table 1) targeting the pmp22-TATA region with a vector expressing SpCas9 under the control of the EFS promoter and a vector expressing SpCas9 under the control of the IE200 promoter into the tail vein of the rat. (Best Mode)

[0040] Definition of Terms

[0041] The terms used in this specification are defined as follows:

[0042] about

[0043] The term "about" as used herein means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% depending on the quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length of the referenced quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0044] vector

[0045] The term "vector" collectively refers to all substances capable of transporting genetic material into a cell, unless otherwise specified. For example, a vector may be a non-viral or viral vector that contains genetic material, i.e., a gene or nucleic acid of interest to be expressed in a cell, more specifically, a nucleic acid encoding a Cas protein of the CRISPR / Cas system, or a nucleic acid encoding a protein involved in the function of Schwann cells, but is not limited thereto. These terms include all meanings recognized by those skilled in the art and may be interpreted appropriately depending on the context.

[0046] Guide RNA

[0047] The term "guide RNA" refers to an RNA that has the function of making the CRISPR / Cas9 complex recognize a specific sequence contained in a target nucleic acid. The composition of the guide RNA may be broadly divided into 1) a scaffold portion and 2) a guide domain portion in terms of function. The scaffold portion is a portion that interacts with the Cas9 protein and binds to the Cas9 protein to form a complex. The scaffold portion is determined by the type of microorganism from which the Cas9 protein is derived. The guide domain portion is a portion that can bind complementarily to a nucleotide sequence portion of a predetermined length in the target nucleic acid. The guide domain portion is a sequence that can be artificially modified and is determined by the target nucleotide sequence of interest. In addition, these terms include all meanings recognized by those skilled in the art and may be interpreted appropriately according to the context.

[0048] Operably linked

[0049] The term "operably linked" means that a particular component is connected to another component such that the particular component is arranged in a functional relationship with the other component, thereby allowing the particular component to function as intended. For example, when a promoter sequence is operably linked to a sequence encoding protein A, the term means that the promoter is linked to the sequence encoding protein A to transcribe and / or express the sequence encoding protein A in a cell. In addition, these terms include all meanings recognized by those skilled in the art and may be interpreted appropriately depending on the context.

[0050] Modified

[0051] The term "modified" or "artificially modified" is used to distinguish modified or artificially modified substances and molecules from substances and molecules whose compositions already exist in nature. This term means that artificial modification has been made to substances and molecules whose compositions already exist in nature. For example, "artificially modified MPZ promoter" refers to an MPZ promoter obtained by artificially modifying a naturally occurring MPZ promoter. In this case, some sequences of the naturally occurring MPZ promoter may be deleted and / or replaced with other sequences, but the modification is not limited to this. In addition, these terms include all meanings recognized by those skilled in the art and may be interpreted appropriately depending on the context.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains. Methods and materials similar or equivalent to those described herein may be used in the practice or testing of this disclosure, and suitable methods and materials are described below. All publications, patents, and other references mentioned herein are incorporated by reference in their entirety. Additionally, the materials, methods, examples, and experiments are illustrative only and are not intended to be limiting.

[0053] The present disclosure will be described below.

[0054] In recent years, gene therapy techniques have been developed to treat diseases caused by Schwann cell dysfunction, such as CMT1A. Vector systems, such as viral vectors, are used in this gene therapy. The main feature of the vector system is that it contains a promoter that specifically expresses a gene or protein of interest in Schwann cells.

[0055] Currently, various researchers are developing Schwann cell-specific promoters. In particular, the MPZ promoter is used to specifically express in Schwann cells. Kleopas A. Kleopa et al. (International Patent Application Publication WO2020 / 245169) developed a viral vector containing a GJB1 gene operably linked to an MPZ promoter or a mini-MPZ promoter to treat CMT disease. In this case, as the MPZ promoter, a full-length promoter of 1.2 kb was used, or a mini-MPZ promoter containing a 410 bp partial sequence present upstream of the start codon of the MPZ gene was used. In this way, the MPZ promoter is used as a Schwann cell-specific promoter.

[0056] Generally, in gene therapy using a viral vector system, the capacity of the viral vector system is limited. The capacity may be in the range of at least 2 kb to 50 kb depending on the packaging capacity of the virus, and may vary depending on the type of virus. Therefore, in order to effectively use the limited capacity, it is necessary to use a small promoter.

[0057] Therefore, the present inventors have developed a Schwann cell-specific promoter using the MPZ promoter, which exhibits higher expression efficiency specifically in Schwann cells and has a smaller size.

[0058] 1. Schwann cell-specific promoter

[0059] In one aspect, the present disclosure relates to a Schwann cell specific promoter. A Schwann cell specific promoter is a promoter that functions specifically in Schwann cells. This means that the use of a Schwann cell specific promoter increases the expression of a gene of interest (e.g., a nucleic acid encoding a gene or protein of interest operably linked to the Schwann cell specific promoter) in Schwann cells compared to other cells. The Schwann cell specific promoter is derived from the MPZ promoter as described above. In particular, the Schwann cell specific promoter is an artificially modified promoter derived from the MPZ promoter. In this case, the MPZ promoter may be a promoter of the human or rat MPZ gene. The promoter of the rat MPZ gene (hereinafter referred to as the rat MPZ promoter) has the following nucleic acid sequence: GTTCCAGAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCC-3' (SEQ ID NO: 1).

[0060]

[0061] More specifically, the Schwann cell-specific promoter may be an artificially modified MPZ promoter in which some nucleotide sequences of the MPZ promoter are deleted.

[0062] The Schwann cell specific promoter may be an artificially modified MPZ promoter in which some nucleotide sequences at the 5' end of the MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5' end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, 300 to 400 bp, 400 to 500 bp, 500 to 600 bp, 600 to 700 bp, 700 to 800 bp, or 800 to 900 bp. In this case, the sequence length of the artificially modified MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp.

[0063] The Schwann cell specific promoter may be an artificially modified MPZ promoter in which some nucleotide sequences at the 3' end of the MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 3' end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, 300 to 400 bp, 400 to 500 bp, 500 to 600 bp, 600 to 700 bp, 700 to 800 bp, or 800 to 900 bp. In this case, the sequence length of the artificially modified MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp.

[0064] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0065] A Schwann cell specific promoter may comprise a transcription start site (TSS).

[0066] The Schwann cell-specific promoter may further include an intronic enhancer (IE) at the 5' end. In this case, the IE may include Egr2 and Sox10 binding sites. The IE may be a region containing the Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp.

[0067] The Schwann cell-specific promoter may further include an intron enhancer (IE) at the 3' end. In this case, the IE may include Egr2 and Sox10 binding sites. The IE may be a region containing the Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp.

[0068] 1-1. Schwann cell-specific promoter (1)

[0069] In one embodiment, the Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter have been deleted.

[0070] The Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences at the 5'-end of the rat MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified rat MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified rat MPZ promoter may be in the range of 200 to 300 bp.

[0071] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0072] A Schwann cell specific promoter may include a transcription start site (TSS).

[0073] In another embodiment, the Schwann cell specific promoter may comprise the 300 bp long nucleotide sequence shown in SEQ ID NO:3: 5'-GCCTCACCCCACCCCAACATTCCAACCTAGGGTAGGGGGAGGTCAGTATACACAAAGCCCTCTGTGTAAGGGGTGGTATGTGTCCCCCCACCCCCCTACCCAGAGTATACAATGCCCCTTCTGCTCCATGCCCCTGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCC-3' (SEQ ID NO:3). Alternatively, the Schwann cell-specific promoter may comprise a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:3, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0074] In yet another embodiment, the Schwann cell specific promoter may comprise a 200 bp long nucleotide sequence as set forth in SEQ ID NO: 4: 5'-CAGAGTATACAATGCCCCTTCTGCTCCATGCCCCTGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCC-3' (SEQ ID NO: 4). Alternatively, the Schwann cell specific promoter may comprise a nucleotide sequence having at least 70% or more, e.g., 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence as set forth in SEQ ID NO: 4.

[0075] In yet another embodiment, the Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted.

[0076] The Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences at the 5'-end of the human MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified human MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified human MPZ promoter may be in the range of 200 to 300 bp.

[0077] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0078] A Schwann cell specific promoter may include a transcription start site (TSS).

[0079] In yet another embodiment, the Schwann cell specific promoter may comprise the 300 bp long nucleotide sequence set forth in SEQ ID NO:5: 5'-GTCCCTCTCCCTCACCACCCCCCACAACATTCCAGCCTGGGGCAGGGGGAGGCCAGTGGACACAAAGCCCTCTGTGTATGGGGTGGTATGTGTCCCCCCACCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCCCTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAG-3' (SEQ ID NO:5). Alternatively, the Schwann cell-specific promoter may comprise a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:5, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0080] In yet another embodiment, the Schwann cell specific promoter may comprise a 200 bp long nucleotide sequence as set forth in SEQ ID NO: 6: 5'-CCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCCCTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAG-3' (SEQ ID NO: 6). Alternatively, the Schwann cell specific promoter may comprise a nucleotide sequence having at least 70% or more, e.g., 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence as set forth in SEQ ID NO: 6.

[0081] 1-2. Schwann cell-specific promoter (2)

[0082] In one embodiment, the Schwann cell-specific promoter comprises an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter have been deleted, and comprises an IE located at the 5' end of the artificially modified rat MPZ promoter.

[0083] The Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences at the 5'-end of the rat MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified rat MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified rat MPZ promoter may be in the range of 200 to 300 bp.

[0084] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0085] A Schwann cell specific promoter may include a transcription start site (TSS).

[0086] The IE may include Egr2 and Sox10 binding sites. The IE may be a region including Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp. Preferably, the sequence length of the IE may be in the range of 100 to 200 bp, more preferably, the sequence length of the IE may be 117 bp. In another embodiment, the IE may include the 117 bp long nucleotide sequence shown in SEQ ID NO: 7: 5'-GACAATGAGACTTTGTTTGGTCGCCTCCTCCTAAAGAACAGAAAAGTCTATAATTGTTCCTCCCCAGAGCCAGCCCACACACATAGACTGCCTGGGATGACTCTCCCTGTGTGGGCG-3' (SEQ ID NO: 7). Alternatively, the IE may comprise a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence set forth in SEQ ID NO:7, for example, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100% sequence identity or similarity.

[0087] In another embodiment, the Schwann cell specific promoter may be in a form in which an IE having a 117 bp nucleotide sequence as shown in SEQ ID NO: 7 is connected to the 5' end of an artificially modified rat MPZ promoter having a 300 bp nucleotide sequence as shown in SEQ ID NO: 3, and the Schwann cell specific promoter is ... CATTCCAACCTAGGGTAGGGGGAGGTCAGTATACACAAAGCCCTCTGTGTAAGGGGTGGTATGTGTCCCCCCACCCCCCTACCCAGAGTATACAATGCCCCTTCTGCTCCATGCCCCTGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCC-3' (SEQ ID NO: 8). In this case, the sequence length of the Schwann cell-specific promoter may be 417 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:8, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0088] In another embodiment, the Schwann cell specific promoter may be in a form in which an IE having a 117 bp nucleotide sequence as shown in SEQ ID NO: 7 is connected to the 5' end of an artificially modified rat MPZ promoter having a 200 bp nucleotide sequence as shown in SEQ ID NO: 4, and the Schwann cell specific promoter may include the nucleotide sequence as shown in SEQ ID NO: 9: 5'-GACAATGAGACTTTGTTTGGTCGCCTCCTCCTAAAGAACAGAAAAGTCTATAATTGTTCCTCCCCAGAGCCAGCCCACACACATAGACTGCCTGGGATGACTCTCCCTGTGTGGGCGCAGAGTATACAATGCCCCTTCTGCTCCATGCCCCTGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCC-3' (SEQ ID NO: 9). In this case, the sequence length of the Schwann cell-specific promoter may be 317 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, to the nucleotide sequence shown in SEQ ID NO:9.

[0089] In another embodiment, the Schwann cell-specific promoter comprises an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter have been deleted, and comprises an IE located at the 5' end of the artificially modified human MPZ promoter.

[0090] The Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences at the 5'-end of the human MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified human MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified human MPZ promoter may be in the range of 200 to 300 bp.

[0091] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0092] A Schwann cell specific promoter may include a transcription start site (TSS).

[0093] The IE may include Egr2 and Sox10 binding sites. The IE may be a region including Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp. Preferably, the sequence length of the IE may be in the range of 100 to 200 bp, more preferably, the sequence length of the IE may be 123 bp. In yet another embodiment, the IE may include the 123 bp long nucleotide sequence shown in SEQ ID NO: 10: 5'-GACAATGGAACTTTGTTTGGTTGCCACCTCCCCCTCCTGTAGAACAAAAAGGTCTACAGTTGCCCCTCCCTGGGGCCAGCCCACACACATAGTCTCTCTGGAATGACCTTCCTTGTGTGGGTA-3' (SEQ ID NO: 10). Alternatively, the IE may comprise a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence set forth in SEQ ID NO:10, for example, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100% sequence identity or similarity.

[0094] In another embodiment, the Schwann cell specific promoter may be a form in which an IE having a 123 bp nucleotide sequence as shown in SEQ ID NO: 10 is connected to the 5' end of an artificially modified human MPZ promoter having a 300 bp nucleotide sequence as shown in SEQ ID NO: 5, and the Schwann cell specific promoter is a nucleotide sequence as shown in SEQ ID NO: 11: 5'-GACAATGGAACTTTGTTTGGTTGCCACCTCCCCCTCCTGTAGAACAAAAAGGTCTACAGTTGCCCCTCCCTGGGGCCAGCCCACACACATAGTCTCTCTGGAATGACCTTCCTTGTGTGGGTAGTCCCTCTCCCTCA CCACCCCCCACAACATTCCAGCCTGGGGCAGGGGGAGGCCAGTGGACACAAAGCCCTCTGTGTATGGGGTGGTATGTGTCCCCCCACCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCCCTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAG-3' (SEQ ID NO: 11). In this case, the sequence length of the Schwann cell-specific promoter may be 423 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:11, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0095] In another embodiment, the Schwann cell specific promoter may be in a form in which an IE having a 123 bp nucleotide sequence as shown in SEQ ID NO: 10 is connected to the 5' end of an artificially modified human MPZ promoter having a 200 bp nucleotide sequence as shown in SEQ ID NO: 6, and the Schwann cell specific promoter may include the nucleotide sequence as shown in SEQ ID NO: 12: 5'-GACAATGGAACTTTGTTTGGTTGCCACCTCCCCCTCCTGTAGAACAAAAAGGTCTACAGTTGCCCCTCCCTGGGGCCAGCCCACACACATAGTCTCTCTGGAATGACCTTCCTTGTGTGGGTACCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCCCTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAG-3' (SEQ ID NO: 12). In this case, the sequence length of the Schwann cell-specific promoter may be 323 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, to the nucleotide sequence shown in SEQ ID NO: 12.

[0096] 1-3. Schwann cell-specific promoter (3)

[0097] In one embodiment, the Schwann cell-specific promoter comprises an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter have been deleted, and comprises an IE located at the 3' end of the artificially modified rat MPZ promoter.

[0098] The Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences at the 5'-end of the rat MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified rat MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified rat MPZ promoter may be in the range of 200 to 300 bp.

[0099] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0100] A Schwann cell specific promoter may include a transcription start site (TSS).

[0101] The IE may include Egr2 and Sox10 binding sites. The IE may be a region containing Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp. Preferably, the sequence length of the IE may be in the range of 100 to 200 bp, and more preferably, the sequence length of the IE may be 117 bp. In another embodiment, the IE may be a nucleotide sequence having a length of 117 bp as shown in SEQ ID NO: 7. Alternatively, the IE may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 7.

[0102] In another embodiment, the Schwann cell specific promoter may be a form in which an IE having a 117 bp nucleotide sequence as shown in SEQ ID NO: 7 is connected to the 3' end of an artificially modified rat MPZ promoter having a 300 bp nucleotide sequence as shown in SEQ ID NO: 3, and the Schwann cell specific promoter is a nucleotide sequence as shown in SEQ ID NO: 13: 5'-GCCTCACCCCACCCCAACATTCCAACCTAGGGTAGGGGGAGGTCAGTATACACAAAGCCCTCTGTGTAAGGGGTGGTATGTGTCCCCCCACCCCCCTACCCAGAGTATACAATGCCCCTTCTGCTCCATGCCCC TGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCCGACAATGAGACTTTGTTTGGTCGCCTCCTCCTAAAGAACAGAAAAGTCTATAATTGTTCCTCCCCAGAGCCAGCCCACACACATAGACTGCCTGGGATGACTCTCCCTGTGTGGGCG-3' (SEQ ID NO: 13). In this case, the sequence length of the Schwann cell-specific promoter may be 417 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:13, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0103] In another embodiment, the Schwann cell specific promoter may be in a form in which an IE having a 117 bp nucleotide sequence as shown in SEQ ID NO: 7 is connected to the 3' end of an artificially modified rat MPZ promoter having a 200 bp nucleotide sequence as shown in SEQ ID NO: 4, and the Schwann cell specific promoter may include the nucleotide sequence as shown in SEQ ID NO: 14: 5'-CAGAGTATACAATGCCCCTTCTGCTCCATGCCCCTGCCACCCTCCCCACCACCTCTCAATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGATTTTAAGCAGGTTCCAGAAAACACCACTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACGCTCTGGGCCGACAATGAGACTTTGTTTGGTCGCCTCCTCCTAAAGAACAGAAAAGTCTATAATTGTTCCTCCCCAGAGCCAGCCCACACACATAGACTGCCTGGGATGACTCTCCCTGTGTGGGCG-3' (SEQ ID NO: 14). In this case, the sequence length of the Schwann cell-specific promoter may be 317 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, to the nucleotide sequence shown in SEQ ID NO: 14.

[0104] In one embodiment, the Schwann cell-specific promoter comprises an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter have been deleted, and comprises an IE located at the 3' end of the artificially modified human MPZ promoter.

[0105] The Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences at the 5'-end of the human MPZ promoter are deleted. In this case, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 1-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-600 bp, 600-700 bp, 700-800 bp, or 800-900 bp. Preferably, the deleted nucleotide sequence at the 5'-end of the MPZ promoter may be a nucleotide sequence having a length in the range of 800-900 bp. In this case, the sequence length of the artificially modified human MPZ promoter may be in the range of 100 to 1000 bp, 100 to 900 bp, 100 to 800 bp, 100 to 700 bp, 100 to 600 bp, 100 to 500 bp, 100 to 400 bp, 100 to 300 bp, or 100 to 200 bp. Preferably, the sequence length of the artificially modified human MPZ promoter may be in the range of 200 to 300 bp.

[0106] The Schwann cell-specific promoter may contain a TATA box or a CAAT box.

[0107] A Schwann cell specific promoter may include a transcription start site (TSS).

[0108] The IE may include Egr2 and Sox10 binding sites. The IE may be a region containing Egr2 and Sox10 binding sites present in the intron 1 region of the MPZ gene. The sequence length of the IE may be in the range of 1 to 100 bp, 100 to 200 bp, 200 to 300 bp, or 300 to 400 bp. Preferably, the sequence length of the IE may be in the range of 100 to 200 bp, and more preferably, the sequence length of the IE may be 123 bp. In yet another embodiment, the IE may be a nucleotide sequence having a length of 123 bp as shown in SEQ ID NO: 10. Alternatively, the IE may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 10.

[0109] In another embodiment, the Schwann cell specific promoter may be a form in which an IE having a 123 bp nucleotide sequence as shown in SEQ ID NO: 10 is connected to the 3' end of an artificially modified human MPZ promoter having a 300 bp nucleotide sequence as shown in SEQ ID NO: 5, and the Schwann cell specific promoter is a nucleotide sequence as shown in SEQ ID NO: 15: 5'-GTCCCTCTCCCTCACCACCCCCCACAACATTCCAGCCTGGGGCAGGGGGAGGCCAGTGGACACAAAGCCCTCTGTGTATGGGGTGGTATGTGTCCCCCCACCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCC CTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAGGACAATGGAACTTTGTTTGGTTGCCACCTCCCCCTCCTGTAGAACAAAAAGGTCTACAGTTGCCCCTCCCTGGGGCCAGCCCACACACATAGTCTCTCTGGAATGACCTTCCTTGTGTGGGTA-3' (SEQ ID NO: 15). In this case, the sequence length of the Schwann cell-specific promoter may be 423 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO:15, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity.

[0110] In another embodiment, the Schwann cell specific promoter may be in a form in which an IE having a 123 bp nucleotide sequence as shown in SEQ ID NO: 10 is connected to the 3' end of an artificially modified human MPZ promoter having a 200 bp nucleotide sequence as shown in SEQ ID NO: 6, and the Schwann cell specific promoter may consist of the nucleotide sequence as shown in SEQ ID NO: 16: 5'-CCCCTCCACCCAGACTATACAATGCCCCTTCTGCTCCCTGCACTCTGCCCCCCTCCCCACCACCTCTCAACTGCACATGCCAGGCTGCAATTGGTTACTGGCTGAGGACAGCCCCCTCATGCTGGGGCCCTAGGGGATTTTAAGCAGGTTCCAGGAACCCCCCGTTCAGTTCCTGGTCCCCCACTTTCTCAACCCCACAGGACAATGGAACTTTGTTTGGTTGCCACCTCCCCCTCCTGTAGAACAAAAAGGTCTACAGTTGCCCCTCCCTGGGGCCAGCCCACACACATAGTCTCTCTGGAATGACCTTCCTTGTGTGGGTA-3' (SEQ ID NO: 16). In this case, the sequence length of the Schwann cell-specific promoter may be 323 bp. Alternatively, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more sequence identity or similarity, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%, to the nucleotide sequence shown in SEQ ID NO: 16.

[0111] 1-4. Advantages of Schwann cell-specific promoter 1-Short length and high expression rate

[0112] The Schwann cell specific promoters of the present disclosure have the advantage of being shorter in length than known MPZ promoters, which is seen in the fact that shorter promoters have a size advantage over longer promoters when placed into a vector to drive gene expression.

[0113] Additionally, the Schwann cell-specific promoter has the advantage of having a higher expression rate than the known MPZ promoter. In the experiment of Experimental Example 1, the high expression rate of the Schwann cell-specific promoter was confirmed. In other words, the Schwann cell-specific promoter of the present disclosure shows a higher expression rate, even though the length of the Schwann cell-specific promoter is shorter than that of the known MPZ promoter.

[0114] In another embodiment, it is useful to put all the constructs that a user wants to introduce into one vector. In this case, the size constraints of general expression cassettes (particularly promoter sequences) are generally important. For example, Schwann cell-specific promoters are advantageous over the larger MPZ promoters because the size of the promoters is relatively compact. This makes Schwann cell-specific promoters more efficient when used in vectors with limited size.

[0115] In yet another embodiment, the known MPZ promoter may be a promoter of the human or rat MPZ gene. Sequences in the range of 1000-1200 bp in length are generally used for known MPZ promoters.

[0116] In yet another embodiment, the length of the Schwann cell-specific promoter having a sequence selected from SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; and a sequence having at least 90% homology with one of SEQ ID NOs:3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, and 16 is in the range of 200 to 420 bp. The length of the Schwann cell-specific promoter may be 50% or less of the length of the known MPZ promoter. Specifically, when the length of the Schwann cell-specific promoter is 200 bp, 300 bp, or 317 bp, the length may correspond to 30% or less of the length of the known MPZ promoter.

[0117] In yet another embodiment, a Schwann cell-specific promoter having a sequence selected from SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; and a sequence having at least 90% homology with one of SEQ ID NOs:3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, and 16, shows a higher expression level than the known MPZ promoter, despite being at least half the length of the known MPZ promoter. In yet another embodiment, it was confirmed through Experimental Examples 1-4 that the Schwann cell-specific promoter can achieve an expression rate of a target protein that is approximately 1.5 to 2 times higher than the known MPZ promoter.

[0118] Thus, when there are size constraints on the vector, a Schwann cell-specific promoter having a sequence selected from SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; and a sequence having at least 90% homology to one of SEQ ID NOs:3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, and 16 may be used more efficiently than the known MPZ promoter.

[0119] 1-5. Advantages of Schwann cell-specific promoters 2-Specific expression in Schwann cells

[0120] The promoter of the present disclosure has the advantage (characteristic) of being able to specifically express a target protein in Schwann cells, i.e., a Schwann cell-specific promoter is a promoter that induces significant expression in Schwann cells and induces low or no expression in non-Schwann cells.

[0121] In one embodiment, a vector may be injected systemically to express a gene of interest in the body, where the gene of interest needs to be specifically expressed in a particular type of tissue or cell.

[0122] Expressing a gene of interest in tissues or cells other than those intended for specific expression of the gene may increase the possibility of unpredictable side effects contrary to the desired effect of gene expression, in other words, it is necessary to use promoters that better selectively express the gene of interest in specific tissues or cells.

[0123] For example, when a promoter is used to specifically express a gene of interest in Schwann cells, the Schwann cell-specific promoters of the present disclosure are more effective than promoters that are non-specific for Schwann cells.

[0124] In another embodiment, a composition comprising a vector for expressing a gene of interest may be used as gene therapy. In yet another embodiment of the method of treatment using gene therapy in vivo, gene therapy is directly applied to the subject's body to express a gene of interest in a specific tissue or cell. In this case, the vector passes through the blood in the body and passes through tissues such as the liver in addition to the target tissue. Therefore, for effective gene therapy, it is preferable for gene therapy to show low gene expression in tissues other than the target tissue (e.g., liver) and show the most effective expression specifically in the target tissue. The promoter of the present disclosure is a Schwann cell-specific promoter that can effectively express a gene of interest in nervous system tissue.

[0125] In yet another embodiment, when a gene of interest is specifically expressed in Schwann cells using the promoter described later in this disclosure, the protein expression rate in Schwann cells is higher than known Schwann cell-specific promoters and the protein expression rate in non-Schwann cells is relatively lower than known Schwann cell-specific promoters.

[0126] A Schwann cell-specific promoter having a sequence selected from SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; or a sequence having at least 90% homology to one of SEQ ID NOs:3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, and 16.

[0127] However, the examples of Schwann cell specific promoters disclosed above are illustrative only and not limiting.

[0128] 2. Schwann cell-specific expression vector

[0129] In one aspect, the present disclosure relates to a Schwann cell-specific expression vector. The Schwann cell-specific expression vector comprises a Schwann cell-specific promoter. The Schwann cell-specific promoter is the same as the promoter described above in section "1. Schwann cell-specific promoter" and has the same properties and structure as each of the components described in the same section. The Schwann cell-specific expression vector refers to a vector that is specifically expressed in Schwann cells. This means that the Schwann cell-specific promoter contained in the Schwann cell-specific expression vector causes the vector to function specifically in Schwann cells.

[0130] More specifically, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a gene of interest.

[0131] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as each of the constructs described in that section.

[0132] The gene of interest can be a gene adapted for expression in Schwann cells, or a nucleic acid encoding a protein of interest adapted for expression in Schwann cells.

[0133] The Schwann cell-specific expression vector may further optionally contain a regulatory / control element, where the regulatory / control component may be operably linked to the gene of interest contained in the vector, and the regulatory / control component may include, but is not limited to, an enhancer, an artificial intron, a termination signal, a polyadenylation signal, a Kozak consensus sequence, an internal ribosome entry site (IRES), a WPRE, a splice acceptor, a 2A sequence, and / or an origin of replication.

[0134] The Schwann cell-specific expression vector may be a viral vector or a non-viral vector. In the present specification, the viral vector may be one or more viral vectors selected from the group consisting of retroviral (retrovirus) vectors, lentiviral (lentivirus) vectors, adenoviral (adenovirus) vectors, adeno-associated viral (adeno-associated virus) vectors, vaccinia viral (vaccinia virus) vectors, poxviral (poxvirus) vectors, and herpes simplex viral (herpes simplex virus) vectors. In this case, the non-viral vector may be, but is not limited to, a plasmid, a phage, naked DNA, a DNA complex, an mRNA (transcript), or a PCR amplicon. For example, the plasmid may be any one selected from the group consisting of the pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19.

[0135] 2-1. Example of Schwann cell-specific expression vector (1)

[0136] In one embodiment, a Schwann cell specific expression vector may comprise a Schwann cell specific promoter and a gene of interest. The gene of interest may be operably linked to a Schwann cell-specific promoter.

[0137] The Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted. In another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 3 or 4. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO: 3 or 4.

[0138] The Schwann cell-specific promoter may include an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted, and may include an IE located at the 5' end of the artificially modified rat MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 8 or 9. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 8 or 9.

[0139] The Schwann cell-specific promoter may include an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted, and may include an IE located at the 3' end of the artificially modified rat MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 13 or 14. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 13 or 14.

[0140] The gene of interest may be a gene associated with a Schwann cell-related disease. For example, genes associated with Schwann cell-related diseases may be, but are not limited to, the connexin 32 (Cx32) gene, the SH3 domain and tetratricopeptide repeats 2 (SH3TC2) gene, the myelin protein zero (MPZ) gene, the early growth response 2 (EGR2) gene, the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene, the N-Myc downstream regulated 1 (NDRG1) gene, or the peripheral myelin protein 22 (PMP22) gene.

[0141] The gene of interest may be a nucleic acid encoding a protein for artificially modifying a gene in Schwann cells. For example, the protein for artificially modifying a gene may be, but is not limited to, a Cas protein, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN). In this specification, the Cas protein may be, but is not limited to, a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein.

[0142] The Schwann cell-specific expression vector may be a viral vector. As used herein, the viral vector may be one or more viral vectors selected from the group consisting of retroviral (retrovirus) vectors, lentiviral (lentivirus) vectors, adenoviral (adenovirus) vectors, adeno-associated viral (adeno-associated virus) vectors, vaccinia viral (vaccinia virus) vectors, poxviral (poxvirus) vectors, and herpes simplex viral (herpes simplex virus) vectors.

[0143] In yet another embodiment, the Schwann cell specific expression vector may comprise a Schwann cell specific promoter and a nucleic acid encoding a Cas9 protein. The nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell specific promoter. In this case, the Schwann cell specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3 or 4. In this case, the Cas9 protein may be a Streptococcus pyogenes Cas9 (SpCas9) protein, a Staphylococcus aureus Cas9 (SaCas9) protein, a Campylobacter jejuni Cas9 (CjCas9) protein, or a Staphylococcus auricularis Cas9 (SauriCas9) protein. In this case, the Schwann cell specific expression vector may be an adeno-associated virus vector (AAV vector).

[0144] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. In this case, the nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 8 or 9. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 (CjCas9) protein, or a SauriCas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0145] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. In this case, the nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 13 or 14. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 (CjCas9) protein, or a SauriCas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0146] 2-2. Example of Schwann cell-specific expression vector (2)

[0147] In one embodiment, a Schwann cell specific expression vector may comprise a Schwann cell specific promoter and a gene of interest. The gene of interest may be operably linked to a Schwann cell-specific promoter.

[0148] The Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted. In another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 5 or 6. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO: 5 or 6.

[0149] The Schwann cell-specific promoter may include an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted, and may include an IE located at the 5' end of the artificially modified human MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 11 or 12. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 11 or 12.

[0150] The Schwann cell-specific promoter may include an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted, and may include an IE located at the 3' end of the artificially modified human MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 15 or 16. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 15 or 16.

[0151] The target gene can be a gene associated with a Schwann cell-related disease.For example, the gene associated with a Schwann cell-related disease can be, but is not limited to, Cx32 gene, SH3TC2 gene, MPZ gene, EGR2 gene, GDAP1 gene, NDRG1 gene, or PMP22 gene.

[0152] The gene of interest may be a nucleic acid that encodes a protein for artificially modifying genes in Schwann cells.For example, the protein used for artificially modifying genes may be, but is not limited to, a Cas protein, a ZFN, or a TALEN.In this specification, the Cas protein may be, but is not limited to, a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein.

[0153] The Schwann cell-specific expression vector may be a viral vector, which may be one or more selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a vaccinia viral vector, a pox viral vector, and a herpes simplex viral vector.

[0154] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. In this case, the nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 5 or 6. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0155] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. In this case, the nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 11 or 12. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0156] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. In this case, the nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 15 or 16. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0157] 2-3. Example of Schwann cell-specific expression vector (3)

[0158] In one embodiment, a Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a gene of interest, and regulatory / control elements. In this case, the gene of interest may be operably linked to a Schwann cell-specific promoter.

[0159] The Schwann cell-specific promoter may be an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted. In another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 3 or 4. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO: 3 or 4.

[0160] The Schwann cell-specific promoter may include an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted, and may include an IE located at the 5' end of the artificially modified rat MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 8 or 9. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 8 or 9.

[0161] The Schwann cell-specific promoter may include an artificially modified rat MPZ promoter in which some nucleotide sequences of the rat MPZ promoter are deleted, and may include an IE located at the 3' end of the artificially modified rat MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 13 or 14. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 13 or 14.

[0162] The target gene can be a gene associated with a Schwann cell-related disease.For example, the gene associated with a Schwann cell-related disease can be, but is not limited to, Cx32 gene, SH3TC2 gene, MPZ gene, EGR2 gene, GDAP1 gene, NDRG1 gene, or PMP22 gene.

[0163] The gene of interest may be a nucleic acid that encodes a protein for artificially modifying genes in Schwann cells.For example, the protein used for artificially modifying genes may be, but is not limited to, a Cas protein, a ZFN, or a TALEN.In this specification, the Cas protein may be, but is not limited to, a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein.

[0164] The regulatory / control element may be a polyadenylation signal, a Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), and / or an artificial intron.

[0165] In this case, the polyadenylation signal may be, but is not limited to, a bovine growth hormone polyadenylation (BGHA) signal, a synthetic polyadenylation (synpA) signal, or a simian virus 40 polyadenylation (SV40pA) signal. In yet another embodiment, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17: 5'-tgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagatgtgggaggttttttaaa-3' (SEQ ID NO: 17). In yet another embodiment, SV40pA may have the nucleotide sequence set forth in SEQ ID NO: 18: 5'-AAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGG-3' (SEQ ID NO: 18).

[0166] In this case, the WPRE may have one or more elements selected from gamma, alpha, and beta elements. In yet another embodiment, the WPRE may be a WPRE3 comprising gamma and alpha elements, and the WPRE3 may have the nucleotide sequence set forth in SEQ ID NO: 19: 5'-AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGT-3' (SEQ ID NO: 19). In yet another embodiment, the WPRE may comprise gamma, alpha, and beta elements.In this case, the WPRE may have the nucleotide sequence shown in SEQ ID NO:20: 5'--3' (SEQ ID NO:20).

[0167] In this case, the artificial intron may be used to improve the expression of the gene of interest in the Schwann cell-specific expression vector. In yet another embodiment, the artificial intron may be a minute virus of mice (MVM) intron. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21: 5'-AAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGG-3' (SEQ ID NO: 21).

[0168] The Schwann cell-specific expression vector may be a viral vector, which may be one or more viral vectors selected from the group consisting of retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, vaccinia viral vectors, pox viral vectors, and herpes simplex viral vectors.

[0169] In yet another embodiment, the Schwann cell specific expression vector may comprise a Schwann cell specific promoter, a nucleic acid encoding a Cas9 protein, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell specific promoter. In this case, the Schwann cell specific promoter may have a nucleotide sequence as set forth in SEQ ID NO: 3, 4, 8, 9, 13, or 14. Herein, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. Herein, the polyadenylation signal may be synpA or SV40pA. In yet another embodiment, the SV40pA may have a nucleotide sequence as set forth in SEQ ID NO: 17. In yet another embodiment, the synpA may have a nucleotide sequence as set forth in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell specific expression vector may be an adeno-associated virus vector (AAV vector).

[0170] In yet another embodiment, the Schwann cell-specific expression vector may include a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, and a WPRE. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have a nucleotide sequence as shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0171] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, and an artificial intron. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the artificial intron may be an MVM intron. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0172] In yet another embodiment, the Schwann cell specific expression vector may comprise a Schwann cell specific promoter, a nucleic acid encoding a Cas9 protein, a WPRE, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell specific promoter. In this case, the Schwann cell specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this case, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the polyadenylation signal may be synpA or SV40pA. In yet another embodiment, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, the synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the WPRE may be WPRE3. In this case, WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, WPRE may be located between the nucleic acid encoding the Cas9 protein and the polyadenylation signal. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0173] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this case, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the polyadenylation signal may be synpA or SV40pA. In this case, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, the synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0174] In yet another embodiment, the Schwann cell-specific expression vector may include a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, and a WPRE. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0175] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, a WPRE, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 3, 4, 8, 9, 13, or 14. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding a Cas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding a Cas9 protein. In the present specification, the polyadenylation signal may be synpA or SV40pA. In this case, SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the WPRE. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0176] 2-4. Example of Schwann cell-specific expression vector (4)

[0177] In one embodiment, a Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a gene of interest, and regulatory / control elements. In this case, the gene of interest may be operably linked to a Schwann cell-specific promoter.

[0178] The Schwann cell-specific promoter may be an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted. In another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 5 or 6. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or similarity to the nucleotide sequence shown in SEQ ID NO: 5 or 6.

[0179] The Schwann cell-specific promoter may include an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted, and may include an IE located at the 5' end of the artificially modified human MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 11 or 12. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 11 or 12.

[0180] The Schwann cell-specific promoter may include an artificially modified human MPZ promoter in which some nucleotide sequences of the human MPZ promoter are deleted, and may include an IE located at the 3' end of the artificially modified human MPZ promoter. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence shown in SEQ ID NO: 15 or 16. In yet another embodiment, the Schwann cell-specific promoter may have a nucleotide sequence having at least 70% or more, for example, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100% sequence identity or sequence similarity to the nucleotide sequence shown in SEQ ID NO: 15 or 16.

[0181] The target gene can be a gene associated with a Schwann cell-related disease.For example, the gene associated with a Schwann cell-related disease can be, but is not limited to, Cx32 gene, SH3TC2 gene, MPZ gene, EGR2 gene, GDAP1 gene, NDRG1 gene, or PMP22 gene.

[0182] The gene of interest may be a nucleic acid encoding a protein used to artificially modify genes in Schwann cells.For example, the protein used to artificially modify genes may be, but is not limited to, a Cas protein, a ZFN, or a TALEN.In this specification, the Cas protein may be, but is not limited to, a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein.

[0183] The regulatory / control elements may be a polyadenylation signal, a WPRE, and / or an artificial intron.

[0184] In this case, the polyadenylation signal may be, but is not limited to, a bovine growth hormone polyadenylation signal, a synthetic polyadenylation signal, or a simian virus 40 polyadenylation signal. In this case, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, the synpA may have the nucleotide sequence shown in SEQ ID NO: 18.

[0185] In this case, the WPRE may have one or more elements selected from gamma, alpha, and beta elements. In yet another embodiment, the WPRE may be a WPRE3 that includes gamma and alpha elements, and the WPRE3 may have a nucleotide sequence as set forth in SEQ ID NO: 19. In yet another embodiment, the WPRE may include gamma, alpha, and beta elements. In this case, the WPRE may have a nucleotide sequence as set forth in SEQ ID NO: 20.

[0186] In this case, the artificial intron can be used to improve the expression of the gene of interest in the Schwann cell-specific expression vector. In yet another embodiment, the artificial intron can be a minute virus of mouse (MVM) intron. In this case, the MVM intron can have the nucleotide sequence shown in SEQ ID NO:21.

[0187] The Schwann cell-specific expression vector may be a viral vector, which may be one or more vectors selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a vaccinia viral vector, a pox viral vector, and a herpes simplex viral vector.

[0188] In yet another embodiment, the Schwann cell specific expression vector may comprise a Schwann cell specific promoter, a nucleic acid encoding a Cas9 protein, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell specific promoter. In this case, the Schwann cell specific promoter may have a nucleotide sequence as set forth in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this specification, the polyadenylation signal may be synpA or SV40pA. In yet another embodiment, the SV40pA may have a nucleotide sequence as set forth in SEQ ID NO: 17. In yet another embodiment, the synpA may have a nucleotide sequence as set forth in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell specific expression vector may be an adeno-associated virus vector (AAV vector).

[0189] In yet another embodiment, the Schwann cell-specific expression vector may include a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, and a WPRE. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have a nucleotide sequence as shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have a nucleotide sequence as shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0190] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, and an artificial intron. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the artificial intron may be an MVM intron. In this case, the MVM may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0191] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, a WPRE, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this case, the Cas9 protein may comprise a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the polyadenylation signal may comprise synpA or SV40pA. In this case, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, the synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the WPRE may be WPRE3. In this case, WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, WPRE may be located between the nucleic acid encoding the Cas9 protein and the polyadenylation signal. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0192] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may comprise a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this specification, the polyadenylation signal may be synpA or SV40pA. In this case, the SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, the synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0193] In yet another embodiment, the Schwann cell-specific expression vector may include a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, and a WPRE. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may be a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding the Cas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding the Cas9 protein. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0194] In yet another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, an artificial intron, a WPRE, and a polyadenylation signal. In this case, the nucleic acid encoding a Cas9 protein may be operably linked to the Schwann cell-specific promoter. In this case, the Schwann cell-specific promoter may have the nucleotide sequence shown in SEQ ID NO: 5, 6, 11, 12, 15, or 16. In this specification, the Cas9 protein may include a SpCas9 protein, a SaCas9 protein, a CjCas9 protein, or a SauriCas9 protein. In this case, the MVM intron may have the nucleotide sequence shown in SEQ ID NO: 21. In this case, the MVM intron may be located between the Schwann cell-specific promoter and the nucleic acid encoding a Cas9 protein. In this case, the WPRE may be a WPRE3. In this case, the WPRE3 may have the nucleotide sequence shown in SEQ ID NO: 19. In this case, the WPRE may be located at the 3' end of the nucleic acid encoding a Cas9 protein. In the present specification, the polyadenylation signal may be synpA or SV40pA. In this case, SV40pA may have the nucleotide sequence shown in SEQ ID NO: 17. In yet another embodiment, synpA may have the nucleotide sequence shown in SEQ ID NO: 18. In this case, the polyadenylation signal may be located at the 3' end of the WPRE. In this case, the Schwann cell-specific expression vector may be an adeno-associated virus vector (AAV vector).

[0195] However, the above disclosed examples of Schwann cell-specific expression vectors are illustrative only and not limiting.

[0196] 3. Method for Schwann cell-specific expression of a protein of interest

[0197] One aspect disclosed in the present disclosure relates to a method for expressing a target protein in Schwann cells, in which a Schwann cell-specific expression vector is used. More specifically, the method is a method for expressing a target protein in Schwann cells by introducing (or transfecting) a Schwann cell-specific expression vector containing a nucleic acid (or a target gene) encoding a target protein into Schwann cells. In this case, the Schwann cells may be human Schwann cells or non-human animal Schwann cells. The method may be performed in vitro, ex vivo, or in vivo. In this case, in vivo may refer to the environment of a human body or a non-human animal body containing Schwann cells. The Schwann cell-specific expression vector is the same as the expression vector described above in Section "2. Schwann cell-specific expression vector" and has the same properties and structure as each of the components described in the same section.

[0198] 3-1. Example of a method for specifically expressing a target protein in Schwann cells (1)

[0199] In one embodiment, the method may be a method of expressing a protein of interest in Schwann cells, which may include treatment with or introduction of a Schwann cell-specific expression vector into Schwann cells.

[0200] In another embodiment, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter and a nucleic acid encoding a protein of interest (or gene of interest). In this case, the gene of interest may be operably linked to a Schwann cell-specific promoter.

[0201] The Schwann cell-specific expression vector is the same as the expression vector described above in Section "2. Schwann cell-specific expression vector" and has the same properties and structure as the configuration described in that section. The Schwann cell-specific promoter is the same as the promoter described above in Section "1. Schwann cell-specific promoter" and has the same properties and structure as the configuration described in that section. The target gene is the same as the gene described above in Section "2. Schwann cell-specific expression vector" and has the same properties and structure as the configuration described in that section.

[0202] The Schwann cells may be human Schwann cells or non-human animal Schwann cells.

[0203] The Schwann cells may be Schwann cells obtained from a human or non-human animal.

[0204] The Schwann cells may be Schwann cells present in a human body or in a non-human animal body.

[0205] Treatment with or introduction of Schwann cell specific expression vectors into Schwann cells may be performed using, but is not limited to, electroporation, gene gun, sonoporation, magnetofection, nanoparticles, and / or temporary cell compression or compression. Treatment with or introduction of Schwann cell specific expression vectors into Schwann cells may also be performed using, but is not limited to, cationic liposome, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, and / or nanoparticle-mediated diffusion transport (see Panyam et al., Adv Drug Deliv Rev. 2012 Sep 13. pii: S0169-409X (12) 00283-9. doi: 10.1016 / j.addr.2012.09.023).

[0206] Treatment with a Schwann cell-specific expression vector, or introduction of a Schwann cell-specific expression vector into Schwann cells, may be carried out in vitro, ex vivo, or in vivo.

[0207] The expression of the protein of interest in Schwann cells may be a result of treatment with the Schwann cell-specific expression vector or introduction of the Schwann cell-specific expression vector into the Schwann cells, and the expression of the protein of interest in the Schwann cells may be significantly increased compared to before treatment with the Schwann cell-specific expression vector.

[0208] In yet another embodiment, the method may be a method for expressing a protein of interest in Schwann cells. The method may include treatment with a Schwann cell-specific expression vector or introduction of a Schwann cell-specific expression vector into the Schwann cells. The Schwann cell-specific expression vector may include a Schwann cell-specific promoter and a nucleic acid encoding a Cas9 protein. The nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. The Schwann cell-specific expression vector may be selected from among the several embodiments described above in Sections "2-1. Example of Schwann cell-specific expression vector (1)" and "2-2. Example of Schwann cell-specific expression vector (2)". The Schwann cells may be human Schwann cells. The method may be performed in vitro, ex vivo, or in vivo. The method may further include treatment with a guide RNA or a nucleic acid encoding a guide RNA or introduction of a guide RNA or a nucleic acid encoding a guide RNA into the Schwann cells.

[0209] 3-2. Example of a method for specifically expressing a target protein in Schwann cells (2)

[0210] In one embodiment, the method may be a method of expressing a protein of interest in Schwann cells, which may include treatment with or introduction of a Schwann cell-specific expression vector into the Schwann cells.

[0211] In this case, the Schwann cell-specific expression vector may comprise a Schwann cell-specific promoter, a nucleic acid encoding a protein of interest (or a gene of interest), and a regulatory / control element. In this case, the gene of interest may be operably linked to a Schwann cell-specific promoter.

[0212] The Schwann cell-specific expression vector is the same as the expression vector described above in Section "2. Schwann cell-specific expression vector" and has the same properties and structure as the configuration described in that section. The Schwann cell-specific promoter is the same as the promoter described above in Section "1. Schwann cell-specific promoter" and has the same properties and structure as the configuration described in that section. The target gene and regulatory / control elements are the same as the gene and regulatory / control elements described above in Section "2. Schwann cell-specific expression vector" and have the same properties and structure as the configuration described in that section.

[0213] The Schwann cells may be human Schwann cells or non-human animal Schwann cells.

[0214] The Schwann cells may be Schwann cells obtained from a human or non-human animal.

[0215] The Schwann cells may be Schwann cells present in the human body or in the body of a non-human animal.

[0216] Treatment with or introduction of Schwann cell specific expression vectors into Schwann cells may be performed using, but is not limited to, electroporation, gene gun, sonoporation, magnetofection, nanoparticles, and / or temporary cell compression or compression. Treatment with or introduction of Schwann cell specific expression vectors into Schwann cells may also be performed using, but is not limited to, cationic liposome, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, and / or nanoparticle-mediated diffusional transport (see Panyam et al., Adv Drug Deliv Rev. 2012 Sep 13. pii: S0169-409X (12) 00283-9. doi: 10.1016 / j.addr.2012.09.023).

[0217] Treatment with a Schwann cell-specific expression vector, or introduction of a Schwann cell-specific expression vector into Schwann cells, may be carried out in vitro, ex vivo, or in vivo.

[0218] The expression of the protein of interest in Schwann cells may be a result of treatment with the Schwann cell-specific expression vector or introduction of the Schwann cell-specific expression vector into the Schwann cells, and the expression of the protein of interest in the Schwann cells may be significantly increased compared to before treatment with the Schwann cell-specific expression vector.

[0219] In yet another embodiment, the method may be a method for expressing a protein of interest in Schwann cells. The method may include treatment with a Schwann cell-specific expression vector or introduction of a Schwann cell-specific expression vector into the Schwann cells. The Schwann cell-specific expression vector may include a Schwann cell-specific promoter, a nucleic acid encoding a Cas9 protein, and a regulatory / control element. The nucleic acid encoding the Cas9 protein may be operably linked to the Schwann cell-specific promoter. The Schwann cell-specific expression vector may be selected from among the several embodiments described above in Sections "2-3. Example of Schwann cell-specific expression vector (3)" and "2-4. Example of Schwann cell-specific expression vector (4)". The Schwann cells may be human Schwann cells. The method may be performed in vitro, ex vivo, or in vivo. The method may further include treatment with a guide RNA or a nucleic acid encoding a guide RNA or introduction of a guide RNA or a nucleic acid encoding a guide RNA into the Schwann cells.

[0220] However, the above disclosed examples of methods for Schwann cell-specific expression of a protein of interest are merely examples and are not limiting.

[0221] 4. Use in treating Schwann cell-related disorders

[0222] 4-1.Composition

[0223] One aspect disclosed in the present disclosure relates to a composition for treating a disease associated with Schwann cells. The composition includes a Schwann cell-specific expression vector. The Schwann cell-specific expression vector is the same as the expression vector described above in section "2. Schwann cell-specific expression vector" and has the same properties and structure as the configuration described in the same section. The Schwann cell-specific expression vector may include a gene associated with a disease associated with Schwann cells and / or a nucleic acid encoding a protein for artificially modifying a gene in Schwann cells as a gene of interest. Thus, the composition may be used to treat a disease associated with Schwann cells by using a nucleic acid encoding a gene associated with a disease associated with Schwann cells and / or a protein for artificially modifying a gene in Schwann cells.

[0224] More specifically, the composition may comprise a Schwann cell-specific expression vector comprising:

[0225] Schwann cell-specific promoter; and

[0226] Target gene.

[0227] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as the configuration described in that section.

[0228] In this case, in one embodiment, the gene of interest may be a nucleic acid encoding a protein used to artificially modify genes in Schwann cells. For example, the protein used to artificially modify genes may be, but is not limited to, a Cas protein, a ZFN, or a TALEN. In this specification, the Cas protein may be, but is not limited to, a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein. This may be used to achieve a knockout effect on genes associated with Schwann cell-related diseases.

[0229] Additionally, if desired, the promoters of the present disclosure may be used to overexpress a gene of interest in Schwann cells, where the gene of interest serves a role as a gene associated with a Schwann cell-related disease.

[0230] The gene associated with a Schwann cell-related disease may be the connexin 32 (Cx32) gene, the SH3 domain and tetratricopeptide repeat 2 (SH3TC2) gene, the myelin protein zero (MPZ) gene, the early growth response 2 (EGR2) gene, the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene, the N-Myc downstream regulated 1 (NDRG1) gene, or the peripheral myelin protein 22 (PMP22) gene. To obtain a disease treatment effect, the gene may be knocked out or overexpressed as necessary.

[0231] The Schwann cell-specific expression vector may further comprise a regulatory / regulatory element. In this case, the regulatory / regulatory component may be operably linked to the gene of interest contained in the vector. The regulatory / regulatory component may be, but is not limited to, an enhancer, an artificial intron, a termination signal, a polyadenylation signal, a Kozak consensus sequence, an internal ribosome entry site (IRES), a splice acceptor, a 2A sequence, and / or an origin of replication.

[0232] When the Schwann cell-specific expression vector comprises a nucleic acid encoding a protein for artificially modifying a gene in Schwann cells, the composition may further comprise a guide RNA or a nucleic acid encoding a guide RNA. In this case, the guide RNA may target a gene causing a disease associated with Schwann cells. In another embodiment, the guide RNA may comprise a scaffold portion from which the polyT portion is removed. In yet another embodiment, the guide domain of the guide RNA may be a sequence that binds to a partial sequence of the pmp22 gene.

[0233] 4-1-1. Composition example (1)

[0234] In one embodiment, the composition may comprise a Schwann cell specific expression vector comprising:

[0235] Schwann cell-specific promoter; and

[0236] A nucleic acid encoding a Cas9 protein.

[0237] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as the configuration described in that section.

[0238] The composition may further comprise a guide RNA or a nucleic acid encoding a guide RNA.

[0239] In another embodiment, the composition may include one Schwann cell-specific expression vector selected from the several embodiments described above in Sections "2-1. Example of Schwann cell-specific expression vector (1)" and "2-2. Example of Schwann cell-specific expression vector (2)". In this case, the composition may further include a guide RNA or a nucleic acid encoding the guide RNA. In yet another embodiment, the guide RNA may include a scaffold portion from which the polyT portion has been removed. In yet another embodiment, the guide domain of the guide RNA may be a sequence that binds to a partial sequence of the pmp22 gene.

[0240] 4-1-2. Composition example (2)

[0241] In one embodiment, the composition may comprise a Schwann cell specific expression vector comprising:

[0242] Schwann cell-specific promoter;

[0243] A nucleic acid encoding a Cas9 protein; and

[0244] Regulatory / control elements.

[0245] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as the configuration described in that section.

[0246] The composition may further comprise a guide RNA or a nucleic acid encoding a guide RNA.

[0247] In another embodiment, the composition may include one Schwann cell-specific expression vector selected from the several embodiments described above in Sections "2-3. Example of Schwann cell-specific expression vector (3)" and "2-4. Example of Schwann cell-specific expression vector (4)". In this case, the composition may further include a guide RNA or a nucleic acid encoding the guide RNA. In yet another embodiment, the guide RNA may include a scaffold portion from which the polyT portion has been removed. In yet another embodiment, the guide domain of the guide RNA may be a sequence that binds to a partial sequence of the pmp22 gene.

[0248] 4-2. Treatment method

[0249] One aspect disclosed in the present disclosure relates to a method for treating a disease associated with Schwann cells, in which a composition comprising a Schwann cell-specific expression vector is used. The Schwann cell-specific expression vector is the same as the expression vector described above in section "2. Schwann cell-specific expression vector" and has the same properties and structure as the configuration described in the same section. The Schwann cell-specific expression vector may comprise, as a gene of interest contained in the vector, a gene associated with a disease associated with Schwann cells and / or a nucleic acid encoding a protein for artificially modifying a gene in Schwann cells. Thus, the composition may be used to treat a disease associated with Schwann cells.

[0250] The method may include introducing (or administering) a composition to a subject.

[0251] In this case, the subject may be a human or a non-human animal having a Schwann cell-associated disease. The composition is the same as the composition described above in Section "4-1. Composition" and has the same properties and structure as the composition described in the same section. For example, the Schwann cell-associated disease may include, but is not limited to, Charcot-Marie-Tooth (CMT) disease or motor neuron disease (MND).

[0252] In this case, the introduction (or administration) of the composition to the subject may be performed by injection, transfusion, implantation, or transplantation. In this case, the introduction (or administration) of the composition to the subject may be performed through any one of administration routes selected from subretinal, subcutaneous, intradermal, intraocular, intravitreal, intratumoral, intranodal, intramedullary, intramuscular, intravenous, intralymphatic, and intraperitoneal administration routes.

[0253] 4-2-1. Treatment method example (1)

[0254] In one embodiment, a method of treatment may include introducing or administering a composition to a subject.

[0255] The composition may then comprise a Schwann cell specific expression vector comprising:

[0256] Schwann cell-specific promoter; and

[0257] A nucleic acid encoding a Cas9 protein.

[0258] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as the configuration described in that section.

[0259] The composition may further comprise a guide RNA or a nucleic acid encoding the guide RNA. In another embodiment, the guide RNA may comprise a scaffold portion from which the polyT portion is removed. In yet another embodiment, the guide domain of the guide RNA may be a sequence that binds to a partial sequence of the pmp22 gene.

[0260] The subject may be a human or a non-human animal with a disease associated with Schwann cells.

[0261] In yet another embodiment, the treatment method may include introducing (administering) a composition to a subject having a Schwann cell-associated disease. In this case, the composition may include one Schwann cell-specific expression vector selected from the embodiments described above in Sections "2-1. Example of Schwann cell-specific expression vector (1)" and "2-2. Example of Schwann cell-specific expression vector (2)". In this case, the composition may further include a guide RNA or a nucleic acid encoding the guide RNA. In this case, the Schwann cell-associated disease may be Charcot-Marie-Tooth (CMT) disease.

[0262] 4-2-2. Treatment method example (2)

[0263] In one embodiment, a method of treatment may include introducing or administering a composition to a subject.

[0264] The composition may then comprise a Schwann cell specific expression vector comprising:

[0265] Schwann cell-specific promoter;

[0266] A nucleic acid encoding a Cas9 protein; and

[0267] Regulatory / control elements.

[0268] The Schwann cell specific promoter is the same as the promoter described above in section "1. Schwann cell specific promoter" and has the same properties and structure as the configuration described in that section.

[0269] The composition may further comprise a guide RNA or a nucleic acid encoding the guide RNA. In another embodiment, the guide RNA may comprise a scaffold portion from which the polyT portion is removed. In yet another embodiment, the guide domain of the guide RNA may be a sequence that binds to a partial sequence of the pmp22 gene.

[0270] The subject may be a human or a non-human animal with a Schwann cell-associated disorder.

[0271] In yet another embodiment, the treatment method may include introducing (administering) a composition to a subject having a Schwann cell-associated disease. In this case, the composition may include one Schwann cell-specific expression vector selected from the embodiments described above in Sections "2-3. Example of Schwann cell-specific expression vector (3)" and "2-4. Example of Schwann cell-specific expression vector (4)". In this case, the composition may further include a guide RNA or a nucleic acid encoding the guide RNA. In this case, the Schwann cell-associated disease may be Charcot-Marie-Tooth (CMT) disease.

[0272] However, the above disclosed examples of compositions and methods of treatment are illustrative only and not limiting.

[0273] Hereinafter, possible embodiments of the present disclosure provided herein are listed. The following embodiments provided in this paragraph are merely examples of the disclosure. Therefore, the invention provided herein cannot be interpreted as being limited to the following examples. The brief description provided with the example number is merely for the convenience of distinguishing each example, and cannot be interpreted as a limitation on the disclosure disclosed herein.

[0274] Possible examples of disclosure

[0275] Schwann cell specific promoter

[0276] Example 1, Schwann cell-specific promoter

[0277] A Schwann cell-specific promoter, which is an artificial or modified promoter having a sequence length in the range of 300 to 500 bp.

[0278] Example 2, Limiting the length of the promoter

[0279] The Schwann cell-specific promoter described in Example 1, wherein the sequence length of the Schwann cell-specific promoter is in the range of 300 to 350 bp.

[0280] Example 3, MPZ promoter derived

[0281] The Schwann cell specific promoter described in either one of Examples 1 and 2, which is a modified version of the known human or rat MPZ promoter.

[0282] Example 4. Limitations of MPZ promoter modifications

[0283] The Schwann cell-specific promoter is an artificially modified Schwann cell-specific promoter in which some nucleotide sequences of a known human or rat MPZ promoter have been deleted or an IE sequence has been added to either end (5' and 3') of a known human or rat MPZ promoter, a Schwann cell-specific promoter described in any one of Examples 1 to 3.

[0284] Example 5, Restriction to TATA box, CAAT box, or TSS

[0285] The Schwann cell specific promoter of any one of Examples 1 to 4, wherein the Schwann cell specific promoter comprises a TATA box, a CAAT box, or a transcription start site (TSS).

[0286] Example 6. Promoter sequence restriction (short form)

[0287] The Schwann cell specific promoter is a Schwann cell specific promoter according to any one of Examples 1 to 5, having a sequence selected from the following:

[0288] SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; and sequences having at least 90% homology to one of SEQ ID NOs:3, 4, 5, and 6.

[0289] Example 7, Limiting sequence length to 300 bp

[0290] The Schwann cell specific promoter according to Example 6 has the sequence shown in SEQ ID NO:3 or a sequence having at least 90% homology to SEQ ID NO:3.

[0291] Example 8, Adding IE to a promoter

[0292] The Schwann cell specific promoter of any one of Examples 1 to 7, wherein the Schwann cell specific promoter further comprises an intronic enhancer (IE) at the 3' or 5' end.

[0293] Example 9, Limitation of IE Array

[0294] A Schwann cell-specific promoter according to Example 8, wherein the sequence of the IE is the sequence shown in SEQ ID NO:7 or a sequence having at least 90% homology to SEQ ID NO:7.

[0295] Example 10, Array restriction (IE additional form)

[0296] The Schwann cell specific promoter is a Schwann cell specific promoter according to any one of Examples 8 and 9, which consists of a sequence selected from:

[0297] SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:11; SEQ ID NO:12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; and sequences having at least 90% homology to one of SEQ ID NOs:8, 9, 11, 12, 13, 14, 15, and 16.

[0298] Example 11, Limiting sequence length to 417 bp 1

[0299] The Schwann cell-specific promoter according to Example 10, which consists of the sequence shown in SEQ ID NO:8 or a sequence having at least 90% homology to SEQ ID NO:8.

[0300] Example 12, Limiting sequence length to 417 bp 2

[0301] The Schwann cell-specific promoter according to Example 10, which consists of the sequence shown in SEQ ID NO:9 or a sequence having at least 90% homology to SEQ ID NO:9.

[0302] Example 13, Limiting sequence length to 317 bp

[0303] The Schwann cell-specific promoter according to Example 10, which consists of the sequence shown in SEQ ID NO:13 or a sequence having at least 90% homology to SEQ ID NO:13.

[0304] Example 14, Emphasizing the difference in length by three times

[0305] 14. The Schwann cell specific promoter of any one of Examples 7 to 13, wherein the length of the Schwann cell specific promoter is at least one-third the length of the known MPZ promoter.

[0306] Schwann cell-specific expression vector

[0307] Example 15. Inclusion of a Schwann cell specific promoter

[0308] A Schwann cell specific expression vector comprising a Schwann cell specific promoter according to any one of Examples 1 to 14.

[0309] Example 16. Inclusion of a gene of interest

[0310] The Schwann cell-specific expression vector of Example 15, further comprising a gene of interest, the gene of interest being operably linked to a Schwann cell-specific promoter.

[0311] Example 17. Definition of target gene (treatment of Schwann cell-related diseases)

[0312] The Schwann cell-specific expression vector of Example 16, wherein the gene of interest is a gene associated with the treatment of a disease associated with Schwann cells.

[0313] Example 18: Definition of Schwann cell-related diseases

[0314] The Schwann cell-specific expression vector described in Example 17, wherein the gene associated with a Schwann cell-related disease is the connexin 32 (Cx32) gene, the SH3 domain and tetratricopeptide repeats 2 (SH3TC2) gene, the myelin protein zero (MPZ) gene, the early growth response 2 (EGR2) gene, the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene, the N-Myc downstream regulated 1 (NDRG1) gene, or the peripheral myelin protein 22 (PMP22) gene.

[0315] Example 19: Limitation of target gene (protein for artificially modifying genes)

[0316] The Schwann cell-specific expression vector described in Example 16, wherein the target gene is a gene encoding a protein for artificially modifying genes in Schwann cells.

[0317] Example 20: Restriction of proteins for artificially modifying genes

[0318] The Schwann cell-specific expression vector of Example 19, wherein the protein for artificially modifying a gene is a Cas9 protein, a Cas12a1 (Cpf1) protein, a Cas12f1 protein, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN).

[0319] Example 21. Inclusion of Regulatory / Control Elements

[0320] The Schwann cell specific expression of any one of Examples 15 to 20, wherein the Schwann cell specific expression vector further comprises a regulatory / control element.

[0321] Example 22. Examples of regulatory / control elements

[0322] The Schwann cell-specific expression vector of Example 21, wherein the regulatory / control elements include one or more selected from a polyadenylation signal, a Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE), and an artificial intron.

[0323] Example 23. Definition of polyadenylation signals

[0324] The Schwann cell-specific expression vector of Example 22, wherein the polyadenylation signal is the bovine growth hormone polyadenylation (BGHA) signal, a synthetic polyadenylation (synpA) signal, or a simian virus 40 polyadenylation (SV40pA) signal.

[0325] Example 24. Restriction of SV40pA and synpA sequences

[0326] A Schwann cell-specific expression vector as described in Example 23, wherein SV40pA has any one selected from SEQ ID NO: 17 and a nucleotide sequence having at least 90% homology to SEQ ID NO: 17, or synpA has any one selected from SEQ ID NO: 18 and a nucleotide sequence having at least 90% homology to SEQ ID NO: 18.

[0327] Example 25, Limitations of WRPE

[0328] The Schwann cell-specific expression vector of Example 22, wherein the WPRE comprises one or more selected from gamma, alpha, and beta elements.

[0329] Example 26, Restriction of WRPE sequence

[0330] The Schwann cell-specific expression vector described in Example 25, wherein the WPRE has a nucleotide sequence selected from SEQ ID NO:19; SEQ ID NO:20; and a nucleotide sequence having at least 90% homology to SEQ ID NO:19 or SEQ ID NO:20.

[0331] Example 27, Limitation of artificial introns

[0332] The Schwann cell-specific expression vector of Example 22, wherein the artificial intron is for improving expression of a gene of interest in the Schwann cell-specific expression vector.

[0333] Example 28: Restriction of artificial intron sequences

[0334] 28. A Schwann cell-specific expression vector according to Example 27, wherein the artificial intron has a nucleotide sequence selected from the nucleotide sequence of SEQ ID NO: 21 and a nucleotide sequence having at least 90% homology with SEQ ID NO: 21.

[0335] Example 29, Vector Restriction

[0336] The Schwann cell-specific expression vector of any one of Examples 15 to 28, wherein the Schwann cell-specific expression vector is a viral vector.

[0337] Example 30, Limitation of vector types

[0338] The Schwann cell-specific expression vector described in Example 29, wherein the viral vector is a viral vector selected from the group consisting of a retroviral (retrovirus) vector, a lentiviral (lentivirus) vector, an adenoviral (adenovirus) vector, an adeno-associated viral (adeno-associated virus) vector, a vaccinia viral (vaccinia virus) vector, a poxviral (poxvirus) vector, and a herpes simplex viral (herpes simplex virus) vector.

[0339] Compositions Comprising Schwann Cell-Specific Expression Vectors

[0340] Example 31. A composition comprising a Schwann cell-specific expression vector

[0341] A composition comprising a Schwann cell-specific expression vector according to any one of Examples 15 to 30.

[0342] Example 32: Composition for artificially modifying genes

[0343] The composition of Example 31, wherein the gene of interest is a nucleic acid encoding a Cas9 protein, a Cas12a1 (Cpf1) protein, a Cas12f1 protein, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN).

[0344] Example 33, Addition of guide RNA

[0345] The composition of Example 32, wherein the composition further comprises a guide RNA or a nucleic acid encoding the guide RNA.

[0346] Example 34. Properties of the guide RNA

[0347] The composition of Example 33, wherein the guide RNA targets a gene that causes a Schwann cell-associated disease.

[0348] Example 35: Limitation of target genes

[0349] The composition described in Example 34, wherein the gene causing a Schwann cell-associated disease is the connexin 32 (Cx32) gene, the SH3 domain and tetratricopeptide repeats 2 (SH3TC2) gene, the myelin protein zero (MPZ) gene, the early growth response 2 (EGR2) gene, the ganglioside-induced differentiation-associated protein 1 (GDAP1) gene, the N-Myc downstream regulated 1 (NDRG1) gene, or the peripheral myelin protein 22 (PMP22) gene.

[0350] Example 36, Addition of a carrier

[0351] The composition of any one of Examples 31 to 34, wherein the composition comprises a pharma- ceutically acceptable carrier comprising one or more selected from the group consisting of binders (e.g., lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose, or gelatin); excipients (e.g., dicalcium phosphate); disintegrants (e.g., corn starch or sweet potato starch); lubricants (e.g., magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax); sweeteners; flavorings; syrups; liquid carriers (e.g., fatty oils); sterile aqueous solutions; propylene glycol; polyethylene glycol; injectable esters (e.g., ethyl oleate); suspensions; emulsions; lyophilized formulations; topical formulations; stabilizers; buffers; animal oils; vegetable oils; waxes; paraffins; starches; tragacanth; cellulose derivatives; polyethylene glycol; silicones; bentonite; silica; talc; zinc oxide; and mixtures thereof.

[0352] Example 37: Composition for treatment

[0353] The composition according to any one of Examples 31 to 36, which is used or intended to treat a disease associated with Schwann cells.

[0354] Method for specifically expressing a gene or protein of interest in Schwann cells

[0355] Example 38. Methods using Schwann cell-specific expression vectors

[0356] A method for specifically expressing a gene or protein of interest in Schwann cells using a Schwann cell-specific expression vector according to any one of Examples 15 to 30.

[0357] Example 39, Addition of a method for delivering a vector to a cell

[0358] A method for specifically expressing a gene or protein of interest in Schwann cells according to Example 38, comprising introducing or delivering a Schwann cell-specific expression vector into Schwann cells.

[0359] Example 40: Limitation of delivery method

[0360] The method for specifically expressing a target gene or target protein in Schwann cells described in Example 39, wherein the method for introducing or delivering a Schwann cell-specific expression vector into Schwann cells is carried out by a cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation method, lipofection method, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, nanoparticle-mediated diffusional transport, electroporation method, gene gun, sonoporation, magnetofection method, nanoparticle method, and / or temporary cell compression or compression method.

[0361] Example 41, Schwann cell restriction

[0362] A method for specifically expressing a gene or protein of interest in a Schwann cell according to any one of Examples 38 to 40, wherein the Schwann cell is a human Schwann cell or a non-human animal Schwann cell.

[0363] Example 42: Limitations of experimental environments such as in vivo

[0364] A method for specifically expressing a gene or protein of interest in Schwann cells described in any one of Examples 38 to 41, wherein introducing or delivering a Schwann cell-specific expression vector to Schwann cells is carried out in vitro, ex vivo, or in vivo.

[0365] Use in treating Schwann cell-related disorders

[0366] Example 43, Treatment Method

[0367] A method for treating a Schwann cell-associated disease, comprising introducing (or administering) to a subject a composition according to any one of Examples 31 to 37.

[0368] Example 44: Limitation of administration method

[0369] The method for treating a Schwann cell-associated disease described in Example 44, wherein the introduction (or administration) of the composition to the subject is carried out by a method such as injection, transfusion, implantation, or transplantation.

[0370] Example 45: Limitation of administration route

[0371] The method for treating a Schwann cell-associated disease described in any one of Examples 43 and 44, wherein the administration of the composition to the subject is carried out by any administration route selected from the following administration routes: subretinal, subcutaneous, intradermal, intraocular, intravitreal, intratumoral, intranodal, intramedullary, intramuscular, intravenous, intralymphatic, or intraperitoneal.

[0372] Example 46, Limitation of disease

[0373] The method for treating a Schwann cell associated disease according to any one of Examples 43 to 45, wherein the Schwann cell associated disease is Charcot-Marie-Tooth (CMT) disease or motor neuron disease (MND).

[0374] Form of disclosure

[0375] The present disclosure will be described in detail below through experimental examples.

[0376] It will be apparent to those skilled in the art that these experimental examples are merely intended to further illustrate the present disclosure, and the scope of the present disclosure is not limited by these experimental examples.

[0377] Experimental Example

[0378] Experimental Method

[0379] 1. Plasmid Generation

[0380] pAAV-SpCas9-related vectors were constructed by cloning using Gibson assembly. The vectors were constructed by placing the codon-optimized SpCas9 or SauriCas9 sequence and the target promoter sequence (SEQ ID NOs: 3, 7, 8, 13, and 32) between the inverted tandem repeats (ITRs) of AAV2 or AAV9, respectively, upstream of Cas9. The promoter sequences compared included variations such as the 300 bp mini MPZ promoter (sMPZ promoter, SEQ ID NO: 3); a promoter in which a 117 bp egr2 / sox10 binding site (intronic enhancer or IE, SEQ ID NO: 7) was added upstream of the sMPZ promoter (SEQ ID NO: 8); a promoter in which a 117 bp egr2 / sox10 binding site was added downstream of the sMPZ promoter (SEQ ID NO: 13); a promoter in which part of the 5' end of the sMPZ promoter was replaced with an IE (SEQ ID NO: 9); or the EFS promoter (non-Schwann cell specific), previously known to have high expression in all tissues.

[0381] Based on the constructed vector, a vector containing synpA and sv40pA instead of BGHA was further constructed using Gibson assembly. The EPS promoter had the following nucleic acid sequence: 5'-GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG-3' (SEQ ID NO: 32).

[0382] A pAAV-U6-sgRNA vector was constructed carrying the U6 promoter and sgRNA (unmodified or sf-modified) sequences between inverted tandem repeats (ITRs). SpCas9-specific guide RNAs of pmp22-TATA (guide RNA 1 or guide RNA 2 in Table 1) were generated by oligo cloning using the BspQI site.

[0383] To test SauriCas9, a single vector was constructed in the form of pAAV-SauriCas9-U6-sgRNA vector, which contains both SauriCas9 and sgRNA sequences placed between the ITRs. In these vectors, each of the promoters to be compared was placed upstream of SauriCas9, an mvm intron was placed between each of the promoters and the SauriCas9 sequence, and a WPRE-short was placed between SauriCas9 and sv40pA. The sgRNA backbone was used as the backbone for the proven active Staphylococcus aureus Cas9 (SaCas9). The pmp22-TATA SauriCas9-specific guide RNA (Table 1) was produced by oligo cloning using the BspQI site.

[0384] In addition, pAAV-tdTomato-related vectors were constructed by cloning using Gibson assembly. The vectors were constructed by placing the codon-optimized tdTomato sequence and each of the target promoter sequences to be compared (SEQ ID NO: 1, 3, and 9) between the inverted tandem repeats (ITR) of AAV9. Each of the target promoter sequences to be compared was placed upstream of tdTomato. The target promoter sequences to be compared included variations such as a 300 bp small MPZ promoter (sMPZ promoter, SEQ ID NO: 3); a promoter in which the 5'-end portion of the sMPZ promoter was replaced with IE (SEQ ID NO: 9); and a known MPZ promoter (SEQ ID NO: 1). tdTomato had the following nucleic acid sequence: TGAACTTCGAGGACGGCGGTCTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACGCTGATCTACAAGGTGAAGATGCGCGGCACCAACTTCCCCCCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACCAG GCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGACCATCTACATGGCCAAGAAGCCCGTGCAACTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAGCGCTCCGAGGGCCGCCACCACCTGTTCCTGTACGGCATGGACGAGCTGTACAAGTAG-3' (SEQ ID NO: 33).

[0385] [Table 1]

[0386] 2. Cell Culture and CRISPR / Cas9 (or tdTomato) Transfection

[0387] Human Schwann-like cell lines (sNF02.2) (CRL-2885, ATCC), S16 cell line (CRL-2941, ATCC), and RT4 cell line (CRL2768, ATCC) were maintained by weekly subculture in Dulbecco's Modified Eagle Medium (DMEM) (WelGene) supplemented with 10% fetal bovine serum (WelGene) and 1X penicillin / streptomycin (WelGene).

[0388] pAAV-SpCas9-related vector and pAAV-U6-sgRNA-related vector were co-transfected into human Schwann-like cells (sNF02.2) at a concentration of 0.1 pmol each. 1.5 × 10 5 Transfection was performed by placing 1000 cells in 1000 ml of ...

[0389] pAAV-SpCas9-related vector and pAAV-U6-sgRNA-related vector were co-transfected into S16 cells at a concentration of 0.1 pmol each. 1.5 × 10 5 Transfection was performed by plating 1000 x 100 cells. Three days after transfection, cell pellets were obtained and RNA was extracted using the Quick DNA / RNA Miniprep Kit (ZYMO RESEARCH).

[0390] pAAV-SpCas9-related vector and pAAV-U6-sgRNA-related vector were co-transfected into RT4-D6P2T cells at a concentration of 0.1 pmol each. 1.5 × 10 5Transfection was performed by plating 1000 x 100 cells. Three days after transfection, cell pellets were obtained and RNA was extracted using the Quick DNA / RNA Miniprep Kit (ZYMO RESEARCH).

[0391] RT4-D6P2T cells were plated in a 12-well plate at 5 x 10 cells per well. 5 AAV stock was thawed and plated at a cell density of 1 x 10 per cell. 4 A total of 100 μl of AAV was diluted to 1 × 10 per cell. 4 The genomic DNA was then extracted and the on-target sites were then amplified by PCR. For next-generation sequencing, PCR was further performed by attaching specific adapters and TruSeq HT Dual Index primers to the sequencing primers. After that, the activity of guide RNA1 (SEQ ID NO: 22) and guide RNA2 (SEQ ID NO: 34) was evaluated through quantitative analysis of insertion or deletion (indel) at the on-target genomic location by using paired sequencing reads.

[0392] RT4-D6P2T cell suspension: 6.25 x 10 5 The cells were prepared at a cell density of 10 cells / ml and 800 ul of the cell suspension was inoculated into each well. The cells were 5 × 10 cells per well (12-well plate). 5 The cells were distributed and cultured at a cell density of 1 × 10 6 The cells were transfected with 100 μl of pAAV-tdTomato-related vector at a concentration of 1 × 10 per cell. 6The cells were treated at a density of 10000 gc and then cultured. DNA and RNA were extracted from the cultured cells using Quick DNA / RNA Miniprep Kit (ZYMO RESEARCH). Alternatively, the cultured cells were placed in a 1.5 mL tube and then centrifuged at 9000 rpm for 2 minutes at a temperature of 4 ° C. The supernatant from the centrifugation was removed and 1 mL of FACS buffer was added to wash the cells. The cells were centrifuged at 9000 rpm for 2 minutes at a temperature of 4 ° C. The supernatant was aspirated and resuspended in 300 ul of FACS buffer. Analysis was then performed on a FACS device. pAAV-SpCas9-related vector and pAAV-U6-sgRNA-related vector were co-transfected into RT4 cells at a concentration of 0.1 pmol each. Alternatively, pAAV-SauriCas9-U6-sgRNA-related vector was transfected into RT4 cells at a concentration of 0.2 pmol. 2 × 10 under the conditions of 10 μl tip, 1400 V, 20 ms, and 2 pulses 5 Transfection was performed by plating 1000 cells. Three days after transfection, cell pellets were obtained and DNA and RNA were extracted using the Quick DNA / RNA Miniprep Kit (ZYMO RESEARCH).

[0393] The pAAV-SpCas9-related vector and the pAAV-U6-sgRNA-related vector were mixed at a ratio of 1:1 to obtain a total of 1 × 10 14 The drug was administered at a dose of 1000 mg / kg to the tail vein of anesthetized experimental animals (rats). After 4 weeks, the experimental animals (rats) were sacrificed, and their livers, sciatic nerves, and lumbar nerves were then harvested. DNA and RNA were extracted from them using the Quick DNA / RNA Miniprep Kit (ZYMO RESEARCH).

[0394] 3. Real-time PCR (qRT-PCR)

[0395] The extracted RNA was adjusted to a total amount of 100–1000 ng, and then the RNA was used to produce cDNA using a cDNA Reverse Transcription kit (Thermo Fisher). qRT-PCR was performed on a QuantStudio3 instrument using 10–15 ng of cDNA with SYBR Green Master Mix according to the manufacturer's protocol (Thermo Fisher). The C values ​​were used to calculate the expression level of SpCas9, and hGAPDH and rGAPDH were used as internal controls. The primers used are shown in Table 2.

[0396] [Table 2]

[0397] 4. Indel Analysis (Targeted Deep Sequencing)

[0398] The sites on the targets were amplified using extracted genomic DNA and primers (Table 3), and then barcodes were generated for each sample by further PCR using illumine TrueSeq adapters (Illumina). Each sample was purified using a PCR purification kit (Intronbio). After pooling the samples in equimolar ratios, paired sequencing was performed using Miseq and TrueSeq (HT) dual index systems (Illumina) to generate sequencing reads. The generated reads were analyzed using the Cas9-Analyzer tool in CRISPR / RGEN Tools (www.rgenome.net) to quantitatively calculate insertion or deletion (indel) reads at the genomic locations on the targets. This allowed us to compare and evaluate the efficiency of vector-mediated gene editing.

[0399] [Table 3]

[0400] 5. Statistics

[0401] Student's t-test was used for statistical analysis, and significant differences were indicated with * meaning p<0.05, ** meaning p<0.01, and *** meaning p<0.001.

[0402] Experimental Results

[0403] Experimental Example 1. Effect of modified MPZ promoter in rat Schwann cell line and rat Schwann-like cell line

[0404] Experimental Example 1-1. Effect on rat Schwann cell line - S16 cells

[0405] To modify the small MPZ promoter (sMPZ, SEQ ID NO: 3) containing the transcription start site (TSS) and TATA box of the rat MPZ gene, a vector expressing SpCas9 according to a promoter (IE-sMPZ, SEQ ID NO: 8) in which a 117-bp intron enhancer (IE, SEQ ID NO: 7) was added upstream of the sMPZ promoter; a vector expressing SpCas9 according to a promoter (sMPZ-IE, SEQ ID NO: 13) in which an IE was added downstream of the sMPZ promoter; and a vector expressing SpCas9 according to a promoter (IE200, SEQ ID NO: 9) in which the 5'-end portion of the sMPZ promoter was replaced with an IE were constructed. The IE was placed in the first intron of the MPZ gene as the main egr2 / sox10 binding site. Then, a vector expressing an sgRNA (guide RNA 1 shown in Table 1) targeting the pmp22-TATA region was co-transfected into S16 cells, a Schwann cell line, and the expression and gene editing efficiency of SpCas9 were then tested.

[0406] The results are shown in Figures 1 and 2.

[0407] FIG. 1 shows the results of confirming Cas9 expression after co-transfection of pAAV-SpCas9-BHGA expression vector and pAAV-U6-sgRNA expression vector into S16 cells (N=3-4). FIG. 2 shows the results of verifying gene editing efficiency (B) of pmp22-TATA target after co-transfection of pAAV-SpCas9-BHGA expression vector and pAAV-U6-sgRNA expression vector into S16 cells (N=3-4). In this case, NT means non-transfection; sMPZ means small MPZ core promoter (SEQ ID NO: 3); IE means intron enhancer (SEQ ID NO: 7); IE200 means modified promoter (SEQ ID NO: 9); IE-sMPZ means modified promoter (SEQ ID NO: 8); and sMPZ-IE means modified promoter (SEQ ID NO: 13). *, p<0.05 vs sMPZ; **, p<0.01 vs sMPZ.

[0408] As shown in FIG. 1, in cells transfected with the sMPZ promoter vector, the IE200 vector, the IE-sMPZ vector, and the sMPZ-IE promoter vector, the expression of SpCas9 and the occurrence of indels at the pmp22-TATA target site were confirmed. In other words, all promoters disclosed herein can effectively express target genes. In particular, in cells transfected with the IE200, IE-sMPZ, and sMPZ-IE promoter vectors, the expression of SpCas9 was approximately 2 to 4 times higher than that in cells transfected with the sMPZ promoter vector (FIG. 1).

[0409] Furthermore, the gene editing effect mediated by the expressed SpCas9 increased the number of indels occurring at the pmp22-TATA target site by more than two-fold (Figure 2).

[0410] Experimental Example 1-2. Effect on rat Schwann-like cells - RT4-D6P2T cells

[0411] The present inventors confirmed the effectiveness of the promoter of the present disclosure using RT4-D6P2T, another Schwann-like cell line, in addition to the S16 cells used in Experimental Example 1-1.

[0412] A vector expressing SpCas9 under the control of the sMPZ promoter, IE200 promoter, IE-sMPZ promoter, and sMPZ-IE promoter, and a vector expressing an sgRNA (guide RNA 1 shown in Table 1) targeting the pmp22-TATA region were co-transfected into RT4-D6P2T cells, a Schwann-like cell line. Gene editing efficiency was then tested.

[0413] The results are shown in Figure 8. Figure 8 shows the results of verifying the gene editing efficiency of the pmp22-TATA target after co-transfection of the pAAV-SpCas9-BHGA expression vector and the pAAV-U6-sgRNA expression vector into RT4-D6P2T cells. In this case, NT means non-transfection; rMPZ means small MPZ core promoter (SEQ ID NO: 3); IE means intron enhancer (SEQ ID NO: 7); IE200 means modified promoter (SEQ ID NO: 9); IE-sMPZ means modified promoter (SEQ ID NO: 8); and sMPZ-IE means modified promoter (SEQ ID NO: 13). ** or *** means that the gene editing efficiency in sMpz300 was significantly different from the gene editing efficiency in IE200, IE-sMpz, and sMpz-IE.

[0414] As a result of the experiment, indels were observed in the pmp22-TATA target site in cells transfected with the sMPZ promoter vector, IE200 vector, IE-sMPZ vector, and sMPZ-IE promoter vector. In particular, it was confirmed that in cells transfected with the IE200, IE-sMPZ, and sMPZ-IE promoter vectors, more than twice as many indels were generated in the pmp22-TATA target site compared to cells transfected with the sMPZ promoter vector. This experimental result indicates that the promoter of the present disclosure may effectively express target proteins in Schwann cells and Schwann-like cells.

[0415] Experimental Example 1-3. Use of guide RNAs with target sequences of different lengths

[0416] The inventors utilized SpCas9 and guide RNA expressed under the control of the IE200 promoter. In this way, the inventors confirmed the gene editing efficiency for target sequences of different lengths and whether the expressed CRISPR system functioned properly.

[0417] Finally, a vector expressing SpCas9 under the control of the IE200 promoter and a vector expressing sgRNA targeting the pmp22-TATA region (guide RNA1 or guide RNA2 shown in Table 1) were co-transfected into RT4-D6P2T cells, a Schwann-like cell line. Gene editing efficiency was then tested. At this time, guide RNA1 had a 20-nucleotide guide domain (a sequence that binds to a partial sequence of the pmp22 gene), and guide RNA2 had a 19-nucleotide guide domain (a sequence that binds to a partial sequence of the pmp22 gene).

[0418] The results are shown in Figure 9. Figure 9 shows the results of verifying the gene editing efficiency of the pmp22-TATA target after co-transfection of the pAAV-SpCas9-BHGA expression vector and the pAAV-U6-sgRNA expression vector into RT4-D6P2T cells. In this case, IE200 was the modified promoter (SEQ ID NO: 9). IE200 + guide RNA 1 refers to the case after co-transfection of the pAAV-SpCas9-BHGA expression vector for IE200 and the pAAV-U6-sgRNA expression vector for guide RNA 1. IE200 + guide RNA 2 refers to the case after co-transfection of the pAAV-SpCas9-BHGA expression vector for IE200 and the pAAV-U6-sgRNA expression vector for guide RNA 2.

[0419] As a result of the experiment, similar levels of gene editing efficiency were observed when using guide RNA1 and guide RNA2, indicating that the expressed CRISPR system functioned effectively (Figure 9).

[0420] The results of this experiment demonstrated that SpCas9 expressed under the control of the modified MPZ promoter of the present disclosure effectively carried out its gene editing function.

[0421] Experimental Example 1-4. Expression rate of tdTomato (fluorescent protein)

[0422] The present inventors also attempted to confirm the expression level of a fluorescent protein as a target protein.

[0423] Vectors expressing tdTomato under the control of the sMPZ promoter (300 bp), the IE200 promoter (317 bp), and the known MPZ promoter (1000 bp) were transfected into RT4-D6P2T cells, a Schwann-like cell line, and the expression level (fluorescence intensity) of tdTomato was examined.

[0424] The results are shown in Figures 10 and 11. Figure 10 shows the results of the expression amount (fluorescence intensity) of the fluorescent protein (tdTomato) after transfection of the pAAV-tdTomato expression vector into RT4-D6P2T cells. In this case, MPZ1000 means MPZ promoter (SEQ ID NO: 1); MPZ300 means small MPZ core promoter (SEQ ID NO: 3); and IE200 means modified promoter (SEQ ID NO: 9). *** means that the expression rate in MPZ1000 was significantly different from the gene editing efficiency in IE200 and Mpz300. Figure 11 shows the results of confirming uniform cell transformation after transfection of the pAAV-tdTomato expression vector into RT4-D6P2T cells. In this case, MPZ1000 means MPZ promoter (SEQ ID NO: 1); MPZ300 means small MPZ core promoter (SEQ ID NO: 3); and IE200 means modified promoter (SEQ ID NO: 9).

[0425] As shown in Figure 11, known MPZ promoters were transformed into cells with similar efficiency to the sMPZ promoter and IE200 promoter of the present disclosure, where vg means vector genome and dg means diploid genome.

[0426] As shown in FIG. 10, the sMPZ promoter and IE200 promoter of the present disclosure showed higher efficiency in expressing fluorescent proteins than the known MPZ promoter. In general, it was expected that the use of a known MPZ promoter with a length of 1000 bp would result in higher expression efficiency of the target protein. However, as a result of the experiment, it was confirmed that the promoter of the present disclosure, which is about one-third the length of the known MPZ promoter, showed much higher efficiency in expressing fluorescent proteins. In particular, the IE200 promoter showed more than twice the expression amount of the target protein compared to the known MPZ promoter.

[0427] The experimental results demonstrated that the Schwann cell-specific promoter disclosed herein can significantly enhance expression of a target protein in Schwann cells with much higher efficiency than the known MPZ promoter, despite being much shorter in length than the known MPZ promoter.

[0428] Experimental Example 2. Effect of modified MPZ promoter in human Schwann cell line

[0429] The present inventors sought to confirm the effect of the Schwann cell-specific promoter of the present disclosure in human Schwann cells.

[0430] Cas9 expression was verified after co-transfection of the pAAV-SpCas9-BHGA expression vector and the pAAV-U6-sgRNA expression vector into the human Schwann cell line, sNF02.2.

[0431] The results are shown in Figure 3. Figure 3 shows the results of examining Cas9 expression after co-transfection of pAAV-SpCas9-BHGA expression vector and pAAV-U6-sgRNA expression vector into sNF02.2, a human Schwann cell line. Cas9 expression is expressed as an average value (N=3). Here, NT means non-transfection; sMPZ means small MPZ core promoter (SEQ ID NO: 3); IE200 means modified promoter (SEQ ID NO: 9); IE-sMPZ means modified promoter (SEQ ID NO: 8); and sMPZ-IE means modified promoter (SEQ ID NO: 13).

[0432] As shown in Figure 3, it was confirmed that the Schwann cell-specific promoter of the present disclosure effectively expressed SpCas9 in NF02.2 cells. In particular, it was confirmed that the IE200 promoter induced the highest SpCas9 expression rate among the three modified promoters of the present disclosure (Figure 3).

[0433] This experimental result indicates that the promoter of the present disclosure can also effectively express a target protein in human Schwann cells, which suggests that the Schwann cell-specific promoter of the present disclosure can be used for purposes such as human gene editing and disease treatment.

[0434] Example 3. Further modifications to the expression system

[0435] The present inventors focused on the experiment to confirm the gene editing effect by using the modified MPZ promoter to activate the CRISPR system. In this process, further modified elements were explored to improve the expression efficiency of Cas9 protein or gRNA.

[0436] Experimental Example 3-1. Example 1 of an optimized further expression system: Addition of polyA to the target protein

[0437] The present inventor also tried to check the effect of modified MPZ promoter in other types of vectors with smaller size. Considering the packaging capacity of AAV vector, synthetic polyA (synpA, 49bp) or simian virus 40 polyA (sv40pA, 104bp, SEQ ID NO: 17) based vectors with smaller size than bovine growth hormone polyA (BGHA, 225bp) were used, and then gene editing efficiency in these vectors was evaluated.

[0438] The results are shown in Figure 6. Figure 6 shows the results of verifying the gene editing efficiency of pmp22-TATA targeting after co-transfection of pAAV-SpCas9 expression vector and pAAV-U6-sgRNA expression vector into S16 cells (N=3). In this case, NT means non-transfection; sMPZ means small MPZ core promoter (SEQ ID NO: 3); IE200 means modified promoter (SEQ ID NO: 9); synpA means synthetic polyA (49bp, SEQ ID NO: 18); and sv40pA means Simian Virus 40 polyA (104bp, SEQ ID NO: 17). ***, p<0.001 vs sMPZ_synpA.

[0439] Using vectors based on synthetic polyA (synpA, 49 bp) or simian virus 40 polyA (sv40pA, 104 bp, SEQ ID NO: 17), we observed increased efficiency of Cas9 expression by the IE200 promoter in S16 cells (Figure 6). This experimental result indicates that the Schwann cell-specific promoters disclosed herein may be suitable for use in small vectors.

[0440] Experimental Example 3-2. Example 2 of an optimized further expression system: Addition of a WPRE (artificial intron) to a target protein

[0441] Next, we additionally tested the effect of IE200 in RT4 cells using a SauriCas9-based vector, which is smaller than SpCas9 and can be produced as a single AAV.

[0442] The results are shown in Figure 7. Figure 7 shows the results of verifying the gene editing efficiency of pmp22-TATA targeting after transfection of a single pAAV-Sauri-Cas9-U6-sgRNA expression vector into RT4 cells (N=3). In this case, NT means non-transfection; sMPZ means small MPZ core promoter (SEQ ID NO: 3); IE200 means modified promoter (SEQ ID NO: 9); and MW means mvm intron + WPRE-short. ***, p<0.001 vs sMPZ-MW.

[0443] Compared with the sMPZ vector using sMPZ to express SauriCas9, the gene editing efficiency of pmp22-TATA targeted by SauriCas9 was increased when the sMPZ-MW vector with added optimization elements such as mvm intron and WPRE was used, as shown in Table 1. This result shows that the gene editing efficiency was significantly increased in the vector combining these optimization elements and the modified MPZ promoter (Figure 7). In particular, this shows that the IE200 promoter showed superior efficiency to other modified MPZ promoters even when used in combination with various optimization elements. This also demonstrates that the modified MPZ promoter can express all types of Cas9 applicable to dual AAV or single AAV in Schwann cells.

[0444] Experimental Example 3-3. Specific Example 3 of an Optimized Expression System: gRNA Expression Vector with PolyT Removed

[0445] Further validation was performed using IE200, which is the most efficient and smallest among the modified promoters, and therefore more compatible with AAV. In particular, studies were performed to confirm the further improvement effect of using IE200 in combination with other optimized elements for gene editing. Vectors such as sf modified vectors were created by removing polyT from the sgRNA scaffold to improve sgRNA expression driven by the U6 promoter, and then the vectors were co-transfected into S16 cells for these experiments.

[0446] The results are shown in Figures 4 and 5. Figure 4 shows the results of verifying the gene editing efficiency of targeted pmp22-TATA after co-transfection of pAAV-SpCas9-BHGA expression vector and pAAV-U6-sf modified-sgRNA expression vector into S16 cells (N=3-6). Figure 5 shows the results of verifying the gene editing efficiency of targeted pmp22-TATA after co-transfection of pAAV-SpCas9-BHGA expression vector and pAAV-U6-sf modified-sgRNA expression vector into RT4 cells (N=3-6). In this case, NT means non-transfection; sMPZ means small MPZ core promoter (SEQ ID NO: 3); IE200 means modified promoter (SEQ ID NO: 9); and Sf modification means scaffold modification of sgRNA backbone. *, p<0.05 vs sMPZ (Figures 4 and 5) or sMPZ+sf modification (Figure 4); **, p<0.01 vs sMPZ (Figures 4 and 5) or sMPZ+sf modification (Figure 4); ***, p<0.001 vs sMPZ+sf modification (Figure 4).

[0447] As a result, we confirmed that the use of the IE200 promoter in combination with the sf-modified vector further increased gene editing efficiency under various dosage conditions (Figure 4). This additional effect was also confirmed in RT4 cells, another type of rat Schwann cell (Figure 5).

[0448] Experimental Example 4. Effect of modified MPZ promoter in experimental animals (rats)

[0449] Furthermore, the present inventors attempted to confirm through animal experiments whether the promoter of the present disclosure has a more specific effect on Schwann cells, in other words, whether the CRISPR composition administered intravenously can pass through tissues such as the liver and show more specific expression in neural tissues.

[0450] After anesthetizing the experimental animal (SD rat) with an anesthetic, the reflex symptoms were checked to confirm whether the animal was anesthetized. The anesthetized animal was then placed in a calibration frame. A vector expressing sgRNA (guide RNA 1 in Table 1) targeting the pmp22-TATA region was co-transfected into the tail vein of the experimental animal (rat) together with a vector expressing SpCas9 under the control of the EFS promoter and a vector expressing SpCas9 under the control of the IE200 promoter.

[0451] After 4 weeks, the animals were sacrificed and the liver, sciatic nerves containing Schwann cells, and lumbar nerves containing Schwann cells were harvested. Genomic DNA was then prepared from the harvested tissues and cells to test the gene editing efficiency.

[0452] The results are shown in Figures 12 and 13. Figure 12 shows the results of verifying the gene editing efficiency of pmp22-TATA targeting in the sciatic nerve and lumbar nerve after injecting the pAAV-SpCas9-BHGA expression vector and the pAAV-U6-sgRNA expression vector into the tail vein of a rat. In this case, EFS was the EFS promoter (SEQ ID NO: 32); IE200 was the modified promoter (SEQ ID NO: 9). Figure 13 shows the results of verifying the gene editing efficiency of pmp22-TATA targeting in the liver after injecting the pAAV-SpCas9-BHGA expression vector and the pAAV-U6-sgRNA expression vector into the tail vein of a rat. In this case, EFS was the EFS promoter (SEQ ID NO: 32); IE200 was the modified promoter (SEQ ID NO: 9).

[0453] The present inventors attempted to confirm whether the modified MPZ promoter specifically expresses a target protein in neurons. In particular, hepatocytes, among cells other than neurons, were used as a control to confirm specific expression in neurons. This is because the present inventors considered the fact that in the case of intravenous injection, most of the administered substance must pass through liver tissue in a systemic administration system.

[0454] Therefore, since the vector was injected from the tail vein of rats in Experimental Example 6, it was expected that most of the injected vector would migrate to the liver. Therefore, it was expected that Cas9 expression and indel efficiency in the liver would be sufficient even when a promoter specific to nerve cells was used.

[0455] Therefore, the present inventors attempted to determine whether the indel efficiency of the modified MPZ promoter in neuronal cells is higher than that of other promoters compared to liver cells, thereby confirming whether the promoter of the present disclosure is more specific to neuronal cells.At this time, the EFS promoter, which is known to have high expression rate in all tissues, was used as a promoter to compare with the modified MPZ promoter.

[0456] As a result, the EFS promoter showed nearly 45% gene editing efficiency in liver tissue (Figure 13) and approximately 10% gene editing efficiency in neural cells (Figure 12). In other words, neural cells showed only about one-fifth the effect compared to liver cells.

[0457] In contrast, when the modified MPZ promoter of the present disclosure, IE200, was used, the gene editing efficiency in liver tissue was about 15% (FIG. 13), and the efficiency in neurons was about 6%-8% (FIG. 12). That is, neurons showed about half the efficiency compared to liver cells. In other words, this means that the modified MPZ promoter of the present disclosure expressed the target protein more specifically in neurons.

[0458] These results indicate that the use of the modified MPZ promoter is preferable over other promoters when gene editing is required specifically in neural cells. [Industrial Applicability]

[0459] The present disclosure relates to an artificially engineered minimal promoter that specifically functions in Schwann cells. The artificially engineered minimal promoter is derived from the promoter of myelin protein zero (MPZ or P0).

[0460] [Item 1] SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and sequences having at least 90% or more homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14. A Schwann cell-specific promoter having a sequence selected from: [Item 2] Schwann cell-specific promoter; and Target gene Equipped with The Schwann cell specific promoter has a sequence selected from the group consisting of SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and a sequence having at least 90% or more homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14, the gene of interest is a gene adapted for expression in Schwann cells or a nucleic acid encoding a protein adapted for expression in Schwann cells; The gene of interest is operably linked to the Schwann cell-specific promoter. Schwann cell-specific expression vectors. [Item 3] The Schwann cell-specific expression vector is a viral vector or a non-viral vector; Item 2. A Schwann cell-specific expression vector according to item 2. [Item 4] The viral vector is one or more viral vectors selected from the group consisting of retroviral (retrovirus) vectors, lentiviral (lentivirus) vectors, adenoviral (adenovirus) vectors, adeno-associated viral (adeno-associated virus) vectors, vaccinia viral (vaccinia virus) vectors, poxviral (poxvirus) vectors, and herpes simplex viral (herpes simplex virus) vectors. Item 3. A Schwann cell-specific expression vector according to item 3. [Item 5] The Schwann cell-specific expression vector further comprises one or more regulatory / control elements. Item 2. A Schwann cell-specific expression vector according to item 2. [Item 6] The regulatory / control element is an enhancer, an artificial intron, a polyadenylation signal, and / or a WPRE; Item 5. A Schwann cell-specific expression vector according to item 5. [Item 7] The Schwann cell-specific expression vector comprises the polyadenylation signal, The polyadenylation signal is synpA or SV40pA. Item 7. The Schwann cell-specific expression vector according to item 6. [Item 8] The Schwann cell-specific expression vector comprises the artificial intron and the WPRE, The artificial intron is an MVM intron, The WPRE is WPRE3. Item 7. The Schwann cell-specific expression vector according to item 6. [Item 9] The Schwann cell-specific expression vector comprises the artificial intron, the WPRE, and the polyadenylation signal, The artificial intron is an MVM intron, the WPRE is WPRE3, The polyadenylation signal is synpA or SV40pA. Item 7. The Schwann cell-specific expression vector according to item 6. [Item 10] The gene of interest is a nucleic acid encoding a protein used to engineer genes in Schwann cells. Item 2. A Schwann cell-specific expression vector according to item 2. [Item 11] The protein for artificially manipulating genes is a Cas protein; 11. The Schwann cell-specific expression vector according to item 10. [Item 12] The Cas protein is a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein; Item 12. The Schwann cell-specific expression vector according to item 11. [Item 13] the Cas9 protein is a Streptococcus pyogenes Cas9 (SpCas9) protein, a Staphylococcus aureus Cas9 (SaCas9) protein, a Campylobacter jejuni Cas9 (CjCas9) protein, or a Staphylococcus auricularis Cas9 (SauriCas9) protein; Item 13. The Schwann cell-specific expression vector according to item 12. [Item 14] The target gene is a gene associated with treating a Schwann cell-related disease. Item 2. A Schwann cell-specific expression vector according to item 2. [Item 15] The gene associated with treating the Schwann cell-related disease is the Cx32 (connexin 32) gene, the SH3TC2 (SH3 domain and tetratricopeptide repeats 2) gene, the MPZ (myelin protein zero) gene, the EGR2 (early growth response 2) gene, the GDAP1 (ganglioside-induced differentiation-associated protein 1) gene, the NDRG1 (N-Myc downstream regulated 1) gene, or the PMP22 (peripheral myelin protein 22) gene; Item 15. The Schwann cell-specific expression vector according to item 14. [Item 16] A composition comprising the expression vector according to item 10, The expression vector comprises a nucleic acid encoding a Cas9 protein, The composition further comprises a guide RNA or a nucleic acid encoding the guide RNA. composition. [Item 17] the guide RNA targets a gene that causes a Schwann cell-associated disease; The gene causing the Schwann cell-related disease is the Cx32 (connexin 32) gene, the SH3TC2 (SH3 domain and tetratricopeptide repeats 2) gene, the MPZ (myelin protein zero) gene, the EGR2 (early growth response 2) gene, the GDAP1 (ganglioside-induced differentiation-associated protein 1) gene, the NDRG1 (N-Myc downstream regulated 1) gene, or the PMP22 (peripheral myelin protein 22) gene; Item 17. The composition according to item 16.

Claims

1. SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and sequences having at least 90% or more homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14. A Schwann cell-specific promoter having a sequence selected from:

2. Schwann cell specific promoter; and Target gene Equipped with The Schwann cell specific promoter has a sequence selected from the group consisting of SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO:13; SEQ ID NO:14; and a sequence having at least 90% or more homology to one of SEQ ID NOs:3, 4, 8, 9, 13, and 14, the gene of interest is a gene adapted for expression in Schwann cells or a nucleic acid encoding a protein adapted for expression in Schwann cells; The gene of interest is operably linked to the Schwann cell-specific promoter. Schwann cell-specific expression vectors.

3. The Schwann cell-specific expression vector is a viral vector or a non-viral vector; The Schwann cell-specific expression vector according to claim 2.

4. The viral vectors include retroviral (retrovirus) vectors, lentiviral (lentivirus) vectors, adenoviral (adenovirus) vectors, adeno-associated viral (adeno-associated virus) vectors, vaccinia viral (vaccinia virus) vectors, poxviral (poxvirus) vectors, and herpes simplex viral (herpes simplex one or more viral vectors selected from the group consisting of The Schwann cell-specific expression vector according to claim 3 .

5. The Schwann cell-specific expression vector further comprises one or more regulatory / control elements. The Schwann cell-specific expression vector according to claim 2.

6. The regulatory / control element is an enhancer, an artificial intron, a polyadenylation signal, and / or a WPRE; The Schwann cell-specific expression vector according to claim 5 .

7. The Schwann cell-specific expression vector comprises the polyadenylation signal, The polyadenylation signal is synpA or SV40pA. The Schwann cell-specific expression vector according to claim 6.

8. The Schwann cell-specific expression vector comprises the artificial intron and the WPRE, The artificial intron is an MVM intron, The WPRE is WPRE3; The Schwann cell-specific expression vector according to claim 6.

9. The Schwann cell-specific expression vector comprises the artificial intron, the WPRE, and the polyadenylation signal, The artificial intron is an MVM intron, The WPRE is WPRE3, The polyadenylation signal is synpA or SV40pA. The Schwann cell-specific expression vector according to claim 6.

10. The gene of interest is a nucleic acid encoding a protein used to engineer genes in Schwann cells. The Schwann cell-specific expression vector according to claim 2.

11. The protein for artificially manipulating genes is a Cas protein; The Schwann cell-specific expression vector according to claim 10.

12. The Cas protein is a Cas9 protein, a Cas12a1 (Cpf1) protein, or a Cas12f1 protein; The Schwann cell-specific expression vector of claim 11.

13. The Cas9 protein is a Streptococcus pyogenes Cas9 (SpCas9) protein, a Staphylococcus aureus Cas9 (SaCas9) protein, a Campylobacter jejuni Cas9 (CjCas9) protein, or a Staphylococcus auricularis Cas9 (SauriCas9) protein; The Schwann cell-specific expression vector of claim 12.

14. The gene of interest is a gene associated with treating a Schwann cell-related disease. The Schwann cell-specific expression vector according to claim 2.

15. The gene associated with treating the Schwann cell-related disease is the Cx32 (connexin 32) gene, the SH3TC2 (SH3 domain and tetratricopeptide repeats 2) gene, the MPZ (myelin protein zero) gene, the EGR2 (early growth response 2) gene, the GDP1 (ganglioside-induced differentiation-associated protein 1) gene, the NDRG1 (N-Myc downregulation 1) gene, or the PMP22 (peripheral myelin protein 22) gene; The Schwann cell-specific expression vector of claim 14.

16. A composition comprising the expression vector of claim 10, The expression vector comprises a nucleic acid encoding a Cas9 protein, The composition further comprises a guide RNA or a nucleic acid encoding the guide RNA. composition.

17. The guide RNA targets a gene that causes a Schwann cell-related disease, The gene causing the Schwann cell-related disease is the Cx32 (connexin 32) gene, the SH3TC2 (SH3 domain and tetratricopeptide repeats 2) gene, the MPZ (myelin protein zero) gene, the EGR2 (early growth response 2) gene, the GDP1 (ganglioside-induced differentiation-associated protein 1) gene, the NDRG1 (N-Myc downregulation 1) gene, or the PMP22 (peripheral myelin protein 22) gene; 17. The composition of claim 16.

Images