A method for producing circular RNA using a dumbbell structure

Abstract

The present invention relates to a circular RNA precursor that forms a dumbbell-shaped secondary structure, and the circular RNA precursor of the present invention does not require a DNA splint even though T4 RNA ligase 2 (Rnl2) is used in the production of circular RNA, and furthermore, circular RNA can be produced more efficiently than when using a DNA splint. In addition, while the production of circular RNA using ribozymes requires the final removal of the ribozymes, the present invention does not require an additional RNA removal step. In addition, the circular RNA precursor of the present invention can be produced from a circular RNA containing a gene encoding a protein in the GOI, and can be used as a gene therapy agent for the purpose of protein expression.

Description

[Technical field]

[0001] The present invention relates to a dumbbell-shaped circular RNA precursor that enables circular RNA production using T4 RNA ligase 2 without a DNA splint, and a method for producing circular RNA using the same. [Background technology]

[0002] Since the coronavirus disease 2019 (COVID-19), an infectious disease caused by SARS-CoV-2 that was first identified in Wuhan, China in 2019, spread worldwide, the development of vaccine therapeutics using messenger RNA (mRNA) has become more active. mRNA is easily degraded in the body and has a relatively short half-life, so in order to overcome this limitation, research has been conducted on improving safety by adding a poly(A) tail to mRNA.

[0003] Meanwhile, circular RNA (circRNA) is a single-stranded transcript linked by a covalent bond, and exists very stably in vivo due to its structural characteristic of having no 5' or 3' ends. In response to this, many studies have been conducted to utilize circRNA to overcome the low safety margin of mRNA, and in the same vein, US10,953,033 discloses circRNA for the purpose of in vivo gene expression based on the structural characteristics of circRNA.

[0004] In eukaryotes, circRNAs are generated from mRNAs via back-splicing, and it is known that T4 RNA ligase 1 (Rnl1), T4 RNA ligase 2 (Rnl2), or group 1 intron ribozymes are used to produce circRNAs in vitro. CircRNAs intended for protein expression have the problem of being relatively large in size, low efficiency of circRNA production, and problems with circRNA isolation and purification.

[0005] T4 RNA ligase 2 (Rnl2) is an enzyme that ligates the 3'- and 5'-ends of double-stranded RNA or double-stranded RNA / DNA hybrids. When producing circRNA, it is common to use a DNA splint that can complementarily bind to both ends of single-stranded RNA.

[0006] The inventors conducted intensive research into methods for improving the production efficiency and reducing problems with separation and purification in the production of circRNA for protein expression, and completed the present invention. Summary of the Invention [Problem to be solved by the invention]

[0007] The technical problem to be achieved by the present invention is to provide a circRNA precursor that can be circularized without a DNA splint in circRNA production using T4 RNA ligase 2, and a method for efficiently producing circRNA using the same.

[0008] However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those of ordinary skill in the art from the following description. [Means for solving the problem]

[0009] To solve the above problems, the present invention provides circular RNA precursors that are circularized by Rnl2 even in the absence of a DNA splint.

[0010] The circular RNA precursor of the present invention has the following structure:

[0011] 5'-3'DumbBell Sense sequence(3'DB SS)-GOI(gene of interest)-3'DumbBell Antisense sequence(3'DB AS)-3'.

[0012] Furthermore, the circular RNA precursor of the present invention can have the following structure:

[0013] 5'-5'DumbBell Antisense sequence(5'DB AS)-5'DumbBell Sense sequence(5'DB SS)-3'DumbBell Sense sequence(3'DB SS)-GOI-3'DumbBell Antisense sequence(3'DB AS)-3'.

[0014] In one embodiment of the present invention, the 3' DB AS region has a sequence that is reverse complementary to the 3' DB SS region, and the 3' DB AS region and the 3' DB SS region form a base pair. The region in which the 3' DB AS region and the 3' DB SS region form a base pair is named 3' Dumbbell (3' DB).

[0015] In another embodiment of the present invention, the 3' DBSS region may have a length of 10 to 29 nt.

[0016] In another embodiment of the present invention, the 5' DB AS region has a reverse complementary sequence to the 5' DB SS region, and the 5' DB AS region and the 5' DB SS region form a base pair, and the region in which the 5' DB AS region and the 5' DB SS region form a base pair is named 5' Dumbbell (5' DB).

[0017] In another embodiment of the present invention, the 5' DBSS region may have a length of 3 to 15 nt.

[0018] In another embodiment of the present invention, the total length of the 3'DB and 5'DB may be 30 bp or less.

[0019] In another embodiment of the present invention, the length of the GOI region may be 500 to 5500 nt.

[0020] In another embodiment of the present invention, the GOI region may further comprise an IRES for protein expression.

[0021] The present invention also provides an expression vector capable of expressing the circular RNA precursor.

[0022] In one embodiment of the present invention, the expression vector may include a gene encoding the circular RNA precursor and a promoter linked to enable in vitro transcription (IVT), a process of synthesizing RNA in vitro using RNA polymerase, NTPs, and various cofactors with DNA as a template.

[0023] In addition, a method for producing circular RNA with high efficiency using the circular RNA precursor and Rnl2 is provided, the method comprising the steps of:

[0024] (1) A step of inducing in vitro transcription of the expression vector of claim 6 under conditions of GTP:GMP=1:5-10.

[0025] (2) After the transcription induction step, a step of treating with DNase I in vitro.

[0026] (3) Adding Rnl2 in vitro to induce ligation.

[0027] As one embodiment of the present invention, the method may further comprise a step of treating RppH in vitro after carrying out step (2).

[0028] In another embodiment of the invention, the method may further include a heating step just before step (3), which includes heating the test tube to 80°C for 3 minutes and cooling at 6°C per minute until the test tube cools to 26°C.

[0029] In another embodiment of the present invention, the step (3) may be carried out at 25° C. for 1 hour or more.

[0030] In another embodiment of the present invention, the method may further comprise the step of (4) treating with RNase R in vitro after step (3).

[0031] In another embodiment of the present invention, the method may further include a step of treating the nucleic acid with poly(A) polymerase in vitro immediately before step (4). Effect of the Invention

[0032] The circular RNA precursor of the present invention does not require a DNA splint when producing circular RNA, even though T4 RNA ligase 2 (Rnl2) is used, and furthermore, circular RNA can be produced more efficiently than when using a DNA splint. Furthermore, while circular RNA production using ribozymes requires the final removal of the ribozymes, the present invention does not require an additional RNA removal step. In addition, the circular RNA precursor of the present invention can be produced from circular RNA containing a gene encoding a protein in the GOI, and can be used as a gene therapy agent for protein expression. [Brief description of the drawings]

[0033] [Figure 1] FIG. 1 is a simplified schematic diagram of the expression of dumbbell-shaped circular RNA precursors of the present invention and the process of circular RNA production and purification by Rnl2. [Diagram 2]The figures show the DNA sequences and structures expressing dumbbell circular RNA precursors of various structures. Figure 2A shows the wild type DB gene, Figure 2B shows the 3'DB gene, Figure 2C shows the 5'DB gene, Figure 2D shows the 5'3'DB deletion gene, Figure 2E shows the 3'DB-M1 gene, Figure 2F shows the 3'DB-M2 gene, Figure 2G shows the 3'DB-M3 gene, Figure 2H shows the DB-M1 gene, Figure 2I shows the DB-M2 gene, and Figure 2J shows the DB-M3 gene sequences. Figure 2K shows the 271nt DB-M3 gene, Figure 2L shows the 997nt DB-M3 gene, Figure 2M shows the 2300nt DB-M3 gene, Figure 2N shows the 3004nt DB-M3 gene, Figure 2O shows the 4000nt DB-M3 gene, and Figure 2P shows the 5002nt DB-M3 gene. [Diagram 3] This result confirmed that the 3' dumbbell region in the dumbbell-structured circular RNA precursor is essential for ligation by Rnl2. [Figure 4] To confirm the effect of the length of the 3'DB region on the efficiency of circular RNA production, the circularization efficiency of circular RNA mutant precursors (3'DB-M) designed with different lengths of the 3'DB region and different GC ratios was examined using Rnl2. Figure 4A shows the design of 3'DB and 3'DB mutant precursors (3'DB-M), and Figure 4B shows the results of examining the circularization efficiency of each circular RNA precursor after ligation to Rnl2. [Diagram 5] Figure 5A shows a design diagram of circular RNA mutant precursors (DB-M) with different lengths of 5' DB region to confirm the effect of the length of the 5' DB region on the efficiency of circular RNA production, and Figure 5B shows the results of confirming the circularization efficiency of each mutant precursor by Rnl2. [Figure 6] The results are ascertained for the length of the gene that can be inserted into the circular RNA. FIG. 6A shows the results of electrophoresis on a formaldehyde agarose gel, and FIG. 6B shows the results of electrophoresis on an EX 2% agarose gel. [Figure 7] This shows the results of confirming the circularization efficiency of circular RNA precursors depending on the ratio of GTP and GMP during IVT. [Figure 8]The results show the efficiency of circularizing circular RNA precursors according to the heat treatment temperature, time, and cooling conditions of the heating step before Rnl2 treatment. [Figure 9] The results show the efficiency of circularizing a circular RNA precursor depending on ligation temperature and time conditions. [Figure 10] This shows the results of confirming the circularization efficiency of circular RNA precursors with or without an RppH treatment step prior to ligation induction. [Figure 11] The results of IVT and circularization induction of DB-WT under various conditions were confirmed. [Figure 12] The results of IVT and circularization induction of 3'DB under various conditions were confirmed. [Figure 13] FIG. 13 shows a comparison of the circularization efficiency of circular RNA production using a dumbbell-structured circular RNA precursor and circular RNA production using a DNA splint.

[0034] [Best Mode for Carrying Out the Invention] The present inventors have developed a dumbbell-shaped circular RNA precursor that can be circularized by T4 RNA ligase 2 without a DNA splint in order to produce circular RNA for the purpose of expressing proteins in cells as a gene therapy agent, and have developed and completed various mutant precursors to improve the circularization efficiency of the circular RNA precursor.

[0035] T4 RNA ligase 2 (Rnl2) can ligate the 3'-end and 5'-end of double-stranded RNA. We designed and constructed a self-hybridizing circular RNA precursor that can form a dumbbell structure by complementary binding to the 5'-end and 3'-end of the RNA interior, and confirmed that the RNA precursor can be circularized by Rnl2 even without a DNA splint.

[0036] The "circular RNA precursor" provided by the present invention is a RNA precursor whose both ends are self-hybridized with their interiors to form a secondary structure shaped like a dumbbell, and is therefore interchangeably referred to as "dumbbell-structured circular RNA precursor," "self-hybridized circular RNA precursor," and "dumbbell circular RNA precursor."

[0037] In this specification, the dsRNA (double strand RNA) region formed by complementary binding of the 5' end of the circular RNA precursor to the interior of the RNA is named the "5' DB region," and the dsRNA region formed by complementary binding of the 3' end to the interior of the RNA is named the "3' DB region."

[0038] In the present specification, when referring to a region that forms dsRNA without distinguishing between the 5' DB region and the 3' DB region, it is described as "DB region".

[0039] Meanwhile, the secondary structure of RNA is variable depending on the binding strength between bases and environmental conditions. In this specification, the DB region refers to a region where three or more nucleotides are complementary bound, i.e., a dsRNA region of 3 bp or more.

[0040] In the present invention, it is preferable that the DB region is composed of three or more nucleotides that are continuously complementary to each other to form base pairs, but this does not exclude the case where the DB region contains one or two nucleotides that do not form base pairs, as long as the binding strength is maintained by increasing the length of the DB region.

[0041] In this specification, the RNA sequences constituting the 5' DB region are respectively named "5' DB sense sequence (5' DB SS)" and "5' DB antisense sequence (5' DB AS)", and the RNA sequences constituting the 3' DB region are respectively named "3' DB sense sequence (3' DB SS)" and "3' DB antisense sequence (3' DB AS)".

[0042] The circular RNA precursor of the present invention may further comprise random nucleotides of 1 to 19 nt in length such that a loop is formed between the 5' DB SS and the 5' DB AS.

[0043] The circular RNA precursor of the present invention comprises a gene of interest (GOI) between the 3'DB SS and 3'DB AS, and the GOI may further comprise an IRES for protein expression and may further comprise a UTR region for improving translation efficiency.

[0044] Meanwhile, the effects of the 5'DB region and 3'DB region on the circularization efficiency of the circular RNA precursor that forms a dumbbell structure by self-hybridization of the present invention were confirmed. Specifically, the previously designed circular RNA precursor with a dumbbell structure has a 5'DB region of 13 bp length and a 3'DB region of 19 bp length, and the circular RNA precursor is named "DB-WT" in this specification. Based on the DB-WT, a 3' dumbbell circular RNA precursor without a 5'DB region (hereinafter named "3'DB"), a 5' dumbbell circular RNA precursor without a 3'DB region (hereinafter named "5'DB"), and a 5' and 3' dumbbell deletion precursor that does not form a dumbbell structure (hereinafter named "5'3'DB deletion") were designed, and ligation by Rnl2 was induced. As a result, it was confirmed that the 3'DB region is essential for ligation by Rnl2, but the 5'DB region is not.

[0045] In response to this, the present inventors provide a circular RNA precursor that does not have a 5'DB region and contains only a 3'DB region. In this case, the 3' end of the circular RNA precursor of the present invention is also self-hybridized with its internal region, and the terms "dumbbell-shaped circular RNA precursor" and "self-hybridized circular RNA precursor" are used herein to include a circular RNA precursor that contains only a 3'DB region.

[0046] Long dsRNA is recognized as a foreign substance in cells, and activates the STING pathway to induce cellular immune responses. Therefore, circular RNAs that induce cellular immune responses are not suitable for use as gene therapy agents. Previous studies have shown that dsRNAs of 40 bp or more are recognized by TLR3 and induce immune responses (Schlee et al, Nature Review, https: / / www.nature.com / articles / nri.2016.78). It is also known that dsRNAs of 30 bp or more activate the phosphorylation enzyme PKR to induce immune responses, while dsRNAs of 25 bp or less do not activate PKR (Lemaire et al, 2009, JMB, https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2570377 / , Manche et al, 1992, MCB, https: / / pubmed.ncbi.nlm.nih.gov / 1357546 / ). DB-WT contains a total of 32 bp of DB region including a 13 bp 5' DB region and a 19 bp 3' DB region. The present inventors searched for a circular RNA precursor structure that exhibits suitable circularization efficiency while decreasing the length of the DB region so as not to induce an immune response in cells.

[0047] As a specific experimental example, three types of circular RNA mutant precursors (hereinafter referred to as "3'DB-M") were prepared based on 3'DB, with different lengths and GC contents of the 3'DB region. The three types of 3'DB-M were designed as shown in Table 3, and the circularization efficiency by Rnl2 was confirmed by comparing the three types of 3'DB-M with 3'DB. It was confirmed that the shorter the 3'DB region, the lower the circularization efficiency, and that the GC content of the 3'DB region has a negligible effect on the circularization efficiency. Therefore, the longer the 3'DB region is, within the range that does not induce cellular immune responses, the higher the circularization efficiency.

[0048] Next, we set the length of the 3'DB region to 19 bp in DB-WT and reduced the length of the 5'DB region to create three types of circular RNA mutant precursors (hereinafter named "DB-M"). As a result, we confirmed that there was no significant difference in circularization efficiency when the 5'DB region was 5 bp long compared to when it was 13 bp long. In this way, we provide a 5'DB region with a 5 bp length and a 3'DB region with a 19 bp length in a circular RNA precursor that can generate circular RNA with high efficiency while minimizing the possibility of inducing a cellular immune response.

[0049] The dumbbell-shaped circular RNA structure of the present invention can produce circular RNA containing genes of up to about 6,000 nt or more in length, but in terms of production efficiency, the length of the gene contained in the circular RNA structure is preferably 200 to 5,500 nt, and more preferably 500 to 3,500 nt.

[0050] The present inventors have developed a method for increasing the efficiency of circular RNA production when producing circular RNA using the dumbbell-structured circular RNA precursor of the present invention.

[0051] In a specific experiment, GMP was added to perform IVT to induce ligation by T4 RNA ligase 2 without the RppH treatment step, and an excellent circular RNA production yield was confirmed at a GTP:GMP ratio of 1:1 to 10. Therefore, the present inventors can provide a method for producing circular RNA by performing IVT at the above GTP:GMP ratio, eliminating the RppH treatment step.

[0052] In addition, the present invention induces ligation to Rnl2 through the formation of a secondary structure in a circular RNA precursor, and attempts to induce the intended ligation by adding a heating step before Rnl2 treatment. In this case, it has been confirmed that the efficiency of circular RNA production can be improved by adding a heating step in which heat treatment is performed at 80°C for 3 minutes and then cooled to 26°C at a rate of 6°C per minute.

[0053] Furthermore, it was confirmed that the ligation temperature condition was 25°C, the ligation reaction time was sufficient for 1 hour, and the circular RNA yield could be further increased by adding an RppH treatment step. However, the increase in circular RNA production yield by RppH treatment was obtained more effectively with 3'DB than with DB-WT, confirming that when the safety of the 5'DB region is increased, the secondary structure of the circular RNA precursor makes it difficult for RppH to access the 5' end. Even after circular RNA purification, the job band was confirmed to be darker in DB-WT than in 3'DB, which is thought to be due to the fact that when the safety of the 5'DB region is high, the secondary structure of the precursor that does not circularize makes it difficult for the enzyme to access the end.

[0054] On the other hand, the inventors have found that when the dumbbell-structured circular RNA precursor of the present invention is used, a higher efficiency of circular RNA production can be achieved than with splint ligation, and it is expected that the circular RNA precursor of the present invention will be useful in producing circular RNA using Rnl2.

[0055] In the present invention, circular RNA precursors include the natural ribonucleotides adenosine, guanosine, cytosine, and uracil, and may also include non-natural ribonucleotides.

[0056] The present invention provides a cassette, gene delivery system, and vector for expressing the above-mentioned dumbbell-structured circular RNA precursor, and in describing the circular RNA precursor and the gene encoding it in this specification, it is obvious to those skilled in the art that thymine in the gene corresponds to uracil in the circular RNA precursor. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0057] Hereinafter, the embodiments will be described in detail with reference to the accompanying drawings. However, since various modifications can be made to the embodiments, the scope of the patent application is not limited or restricted by these embodiments. It should be understood that all modifications, equivalents, or alternatives to the embodiments are included in the scope of the patent.

[0058] The terms used in the examples are merely used for the purpose of explanation and should not be construed as limiting. A singular expression includes a plural expression unless the context clearly indicates otherwise. In this specification, the terms "include" or "have" are intended to specify the presence of the features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, and should not be understood to preclude the presence or additional possibility of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0059] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments belong. Terms defined in commonly used dictionaries, etc., should be interpreted as being consistent with the meaning they have in the context of the relevant art, and should not be interpreted as ideal or overly formal unless expressly defined in this application.

[0060] In addition, in the description with reference to the accompanying drawings, the same components are denoted by the same reference numerals regardless of the drawing numerals, and duplicated description thereof will be omitted. In describing the embodiments, if it is determined that a detailed description of related publicly known technology may unnecessarily obscure the gist of the embodiments, the detailed description thereof will be omitted. EXAMPLES

[0061] [Experimental Method] 1. Preparation of DNA template for expression of dumbbell-shaped circular RNA precursor 1-1.Wild type dumbbell circular RNA precursor (DB-WT) To generate pUC-Dumbbell (DB), we first synthesized a T7 RNA polymerase promoter, dumbbell, IRES, and RLuc poly A sequence (Integrated DNA Technologies) and cloned them into the pUCIDT vector. Then, pUC-DB was linearized by treating it with SpeI restriction enzyme. The DB gene contains a 13-nt long 5'DumbBell Antisense sequence (5'DB AS) and a 5'DumbBell Sense sequence (5'DB SS) at the 5' end and a 19-nt long 3'DumbBell Sense sequence (3'DB SS) at the 3' end, and a 19-nt long 3'DumbBell Antisense sequence (3'DB AS) at the 3' end (Figure 2A).

[0062] 1-2. 3' dumbbell circular RNA precursor (3'DB) pUC-DB was used as a template, and 5'-GCGCT GTTTAAAC TAATACGACTCACTATAGGAAAAAATCGAGGGTCTCCCCTAGTTG-3' (sense: SEQ ID NO: 1) and 5'- GCGCTGCGATCGC PCR was performed using the primer CCATTTTGCTGTATTCAA-3' (antisense: SEQ ID NO: 2), and the amplified product was joined to the PmeI / AsisI fragment of pUC-DB. The underlined sequences in each of the sense and antisense primers represent the PmeI and AsiSI recognition sites, respectively. PCR was performed using the Advantage-HF2 PCR kit (Clonetech) to prepare pUC-3'DB.

[0063] In addition, pUC-3'DB was linearized by digestion with SpeI. The 3'DB gene contains a 19-nt long 3'DB SS together with a 2-nt long 5'DB SS and 5'DB AS at the 5' end, and a 19-nt long 3'DB AS at the 3' end (FIG. 2B).

[0064] 1-3.5' dumbbell circular RNA precursor (5'DB) pUC-DB was digested with SalI to obtain a 5' dumbbell DNA fragment. The 5' DB gene contains only 13 nt long 5' DB SS and 5' DB AS at the 5' end (FIG. 2C).

[0065] 1-4.5' and 3' dumbbell deletion precursor (5'3'DB deletion) The 5'- and 3'-dumbbell deleted DNA fragments were obtained by cleaving pUC-3'DB with SalI. The 5'- and 3'-DB deleted genes do not contain sequences forming dumbbells at either end (FIG. 2D).

[0066] 1-5. 3' dumbbell circular RNA mutant precursor (3'DB-M) To prepare the 3'DB mutant, the length of the 5'loop and the 3'DB region were shortened, and the GC ratio in the 3'DB region was changed to 47%, 50%, and 70%. The 5'loop refers to a region that does not form a base pair between the 5'DB SS and the 5'DB AS.

[0067] 3'DB mutant 1 (3'DB-M1) was synthesized by cloning 5-CTTTGTT TAAACTAATACGACTCACTATAGGAAAAATCCCTAGTTGTTGTGTGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 3) and 5'-TG ACTAGT The PCR product was obtained using the primer TGTTGTGTGG GTCGACTTTTGTTTTTTGTTTTTTTTTTTTGTTT-3' (antisense: SEQ ID NO: 4) (FIG. 2E). The underlined sequence in the primer is the site recognized by SpeI.

[0068] 3'DB mutant 2 (3'DB-M2) was synthesized by cloning 5'-CTTTGTTTAAACTAATACGACTCACTATAGGAAAAATCCCTAGTTGTGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 5) and 5'-TG ACTAGTThe PCR product was obtained using the primer TGTGGGTCGACTTTTGTTTTTTGTTTTTTTTTTGTT-3' (antisense: SEQ ID NO: 6) (Figure 2F). The underlined sequence in the primer is the site recognized by SpeI.

[0069] 3'DB mutant 3 (3'DB-M3) was synthesized by cloning 5'-CTTTGTTTAAACTAATACGACTCAC TATAGGAAAAATCCCTAGTCGCGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 7) and 5'-TG ACTAGT The PCR product was obtained using the primer CGCGGGTCGACTTTTGTTTTTTGTTTTTTTTTTTTGTTT-3' (antisense: SEQ ID NO: 8) (Figure 2G). The underlined sequence in the primer is the site recognized by SpeI.

[0070] 1-6. Dumbbell circular RNA mutant precursor (DB-M) The DB mutant was generated by reducing the 13 bp long 5' DB region in the DB gene from 11 bp to 2 bp.

[0071] DB Mutant 1 (DB-M1) was obtained from the PCR amplification product using pUC-3'DB as a template and the primers 5'-TAATACGACTCACTATAGGGAGACCCTC AAAAATCGAGGGTCTCCCCTAGTTGTTG-3' (sense: SEQ ID NO: 9) and 5'-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3' (antisense: SEQ ID NO: 10) (Figure 2H). DB Mutant 1 has a 5'DB region length of 11 bp.

[0072] DB variant 2 (DB-M2) was obtained from the PCR amplification product using pUC-3’DB as a template and 5’-TAATACGACTCACTATAGGGAGACCAAAAATCGAGGGTCTCCCCTAGTTGTTG-3’ (sense: SEQ ID NO: 11) and 5’-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3’ (antisense: SEQ ID NO: 12) primers (Figure 2I). DB variant 2 has an 8-bp length in the 5’DB region.

[0073] DB variant 3 (DB-M3) was obtained from the PCR amplification product using pUC-3’DB as a template and 5’-TAATACGACTCACTATAGGGAGAAAAATCGAGGGCCTCCCCTAGTTGTTG-3’ (sense: SEQ ID NO: 13) and 5’-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3’ (antisense: SEQ ID NO: 14) primers (Figure 2J). DB variant 3 has a 5-bp length in the 5’DB region.

[0074] 1-7. Circular RNA precursors with different GOI lengths Circular RNA precursors were prepared with different genes inserted into the GOI. The DNA fragments encoding each circular RNA precursor were amplified by the PCR method using the primers shown in Table 1 below, and the amplified DNA products are as shown in Figures 2K - P. The lengths of the 5’ and 3’DB regions in each circular RNA precursor were made such that their total is 24 bp.

[0075]

Table 1

[0076] 2. In vitro transcription (IVT) and purification Circular RNA precursors were synthesized from linearized DNA plasmids or PCR amplified products by in vitro transcription using T7 RNA polymerase (200 U, Roche) under the conditions of rATP, rCTP, rUTP, and rGTP (5 mM each, Roche), rGMP (25 mM, Sigma), RNase inhibitor (0.2 U, Thermo Scientific), MgCl2 (25 mM, Sigma), and DTT (10 mM, Thermo Scientific) at 37°C for 3 hours. After completion of transcription, DNA templates were removed by treatment with DNase I (4.5 U, Thermo Scientific) at 37°C for 20 minutes. After DNase I treatment, RNA was column purified using Monarch RNA cleanup kit (New England Biolabs).

[0077] In some experiments, RNA purification was followed by treatment with RppH (0.5 U, New England Biolabs) for 30 min at 37°C.

[0078] 3. RNA ligation by T4 RNA ligase 2 treatment The RNA was heat-treated at 80°C for 3 minutes, cooled to 26°C by 6°C per minute, and then treated with T4 RNA ligase 2 and reacted at 25°C for 1 hour. The RNA was then column purified.

[0079] 4. Splint Ligation A linear RNA with the same sequence as the 3'DB circular RNA precursor except for the 19 nt sequence at the 3' end was designed to prepare a linear circular RNA precursor to be ligated using a DNA splint. Before ligation, 2 uM of RNA and 2 uM of DNA splint were heat-treated at 80°C for 3 minutes and cooled to 26°C in 6°C increments over 1 minute.

[0080] Three types of DNA splints of 30nt, 60nt, and 90nt in length were used, and the specific information is shown in Table 2 below.

[0081] [Table 2]

[0082] After ligation, the DNA splint was removed by treatment with DNase I (2.4 U, Thermo Scientific) at 37°C for 20 min, and then the RNA was purified using a column.

[0083] 5.Poly A tailing E. coli Poly(a) polymerase (0.5 U, New England Biolabs) and ATP (1 mM, New England Biolabs) were added after the ligation step for 1 h at 37°C, and the remaining RNA was column purified.

[0084] 6.RNase R Treatment RNA was heat-treated at 65°C for 5 min, chilled on ice for 3 min, and then treated with RNase R for 15 min at 37°C. Circular RNA was isolated via column purification and quantified with a Nanodrop 2000c (Thermo Scientific) spectrophotometer.

[0085] 7. Electrophoresis RNA samples were mixed with formamide loading buffer (Biosesang), denatured at 65°C for 10 min, and chilled on ice for 3 min, then transferred to a 1% agarose gel and separated at 100 V for 120 min in MOPS buffer.

[0086] In some experiments, RNA was separated by preparing 2% E-gel EX agarose gels (Invitrogen) using the E-gel EX 1-2% program on an E-gel Power Snap device. A 1kb(+)RNA ladder (Thermo Scientific) was used as a standard. Bands were visualized using an Azure 600 gel doc system (Azure Biosystems).

[0087] [Experimental Results] 1. Confirmation of circularization of various dumbbell-shaped circular RNA precursors using T4 RNA ligase 2 T4 RNA ligase 2 (Rnl2) is an enzyme that ligates the 3'- and 5'-ends of double-stranded RNA or double-stranded RNA / DNA hybrids. To produce circular RNA using Rnl2, a DNA fragment (DNA splint) that can complementarily bind to parts of both ends of a single-stranded RNA is used.

[0088] As diagrammed in Figure 1, the inventors designed and constructed circular RNA structures that could be circularized by Rnl2 without a DNA splint by positioning regions capable of complementary binding to each other at the ends of single-stranded RNA.

[0089] The first circular RNA precursor was designed to have a 13 bp long 5' DB region and a 19 bp long 3' DB region. This circular RNA precursor was named wild type circular RNA precursor and is represented as "DB-WT".

[0090] To confirm the effect of the presence or absence and length of the 5'DB region and 3'DB region on the circularization efficiency, we designed and constructed a 3' dumbbell circular RNA precursor without a 5'DB region, a 5' dumbbell circular RNA precursor without a 3'DB region, and a 5' and 3' dumbbell deletion precursor that does not form a dumbbell structure. These precursors are referred to as "3'DB", "5'DB", and "5'3'DB deletion".

[0091] The above four RNA precursors were expressed in vitro, and then treated with RppH to convert the 5'-ends to monophosphates, followed by treatment with T4 RNA ligase 2 (Rnl2) to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove by-products not joined by Rnl2, and the samples were loaded onto an agarose gel and electrophoresed to confirm the generation of circular RNA. The results are shown in Figure 3.

[0092] As can be seen in lane 9 of 5'3'DB deletion and 5'DB, all RNA was removed by RNase R treatment, despite the 1-hour Rnl2 treatment. In other words, 5'3'DB deletion and 5'DB confirmed that circular RNA was not formed by Rnl2.

[0093] In the case of 3'DB, no band was observed in lane 9 0 h after Rnl2 treatment, but after 1 h of ligation induction, a clear circular RNA band was observed in lane 9, and two bands were observed in lane 7 due to circular RNA formation.

[0094] In the case of DB-WT, a band was observed in lane 9 both before (0 h) and after (1 h) ligation induction. The observation of a band in lane 9 before ligation induction is believed to be the result of incomplete linear RNA degradation by RNase R due to the characteristics of the RNA dumbbell structure. In addition, structural characteristics of DB-WT prevent RppH from acting well, resulting in low circularization efficiency, and no clear circular RNA band was observed in lane 7 after ligation induction.

[0095] 2.3' Confirmation of circularization efficiency by shortening the DB region length To improve the efficiency of circularization by Rnl2, we designed and constructed mutants of 3'DB circular RNA precursors with different lengths of 3'DB region, 5'loop length, and GC content of the 3'DB region. The lengths of the 3'DB region, 5'loop length, and GC content of the 3'DB region of the 3'DB and each mutant are shown in Table 3 below, and a simplified schematic diagram of the above four types of circular RNA precursors is shown in Figure 4A.

[0096] [Table 3]

[0097] The above three 3'DB circular RNA mutant precursors were expressed in vitro and then treated with T4 RNA ligase 2 (Rnl2) to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove by-products not joined by Rnl2, and the samples were loaded onto an agarose gel and electrophoresed to confirm the generation of circular RNA (Figure 4B). 5'3'DB deletion was used as a negative control, and 3'DB was used as a positive control.

[0098] As shown in Figure 4B, when the circularization efficiency of each circular RNA precursor was confirmed from the lane 6 band density, the circularization efficiency was found to be highest in the following order: 3'DB, 3'DB-M1, 3'DB-M3, and 3'DB-M2. Although 3'DB-M3 produced more circular RNA than 3'DB-M2, the value was not significant. From the above results, it was found that the length of the 3'DB region is more important than the GC content of the 3'DB region for the circularization efficiency.

[0099] 3. Confirmation of circularization efficiency by shortening the length of the 5' DB region On the other hand, dsRNAs longer than 30 nt in cells have a high risk of inducing cellular immune responses due to the activation of PKR. Therefore, in order to use circular RNA as a gene therapy agent, it is preferable that the region that forms a double strand is less than 30 nt, and the shorter the better. Therefore, the inventors shortened the length of the 5'DB region in DB-WT and designed the DB circular RNA mutant precursor (DB-M) (Figure 5A).

[0100] The DNA encoding the precursor was expressed in vitro and then treated with Rnl2 to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove by-products not ligated by Rnl2, and the samples were loaded onto an agarose gel and electrophoresed to confirm the generation of circular RNA (Figure 5B). As a result, the circularization efficiency of 3'DB was only 50% compared to DB-WT, while the circularization efficiency of the three DB-Ms was not significantly different from that of DB-WT. From the above results, it can be seen that DB-M3 is the most suitable circular RNA precursor with the highest circularization efficiency without inducing an immune response when introduced into cells.

[0101] 4. Confirmation of maximum circular RNA length To confirm whether circular RNA precursors can be used for protein expression in cells, the inventors designed circular RNA precursors based on DB-M3 with different gene sizes to be inserted, expressed them in vitro, and then subjected them to Rnl2 treatment, poly(A) tailing and RNase R treatment. Then, they were electrophoresed on formaldehyde agarose gel and EX 2% gel to confirm circular RNA formation and its efficiency.

[0102] The results of electrophoresis on a formaldehyde agarose gel are shown in FIG. 6A, and the results of electrophoresis on an EX 2% agarose gel are shown in FIG. 6B.

[0103] In the case of the 271nt-long RNA precursor, no double band was observed in the formaldehyde agarose gel, but a clear band was confirmed even after RNase R treatment. In addition, an upwardly shifting band was confirmed in the EX agarose 2% agarose gel. From the above results, it was found that the 271nt-long circular RNA precursor forms circular RNA.

[0104] For RNA precursors of 997 nt, 2308 nt, and 3004 nt in length, a clear doublet band was observed in formaldehyde agarose gels and an upwardly migrating band was observed in EX 2% agarose gels, confirming that the circular RNA precursors were well spliced ​​to the circular RNA.

[0105] In the case of the 4000nt and 5002nt long RNA precursors, no clear doublet band was observed in the formaldehyde agarose gel, but a band migrating above the RNA size was clearly observed in the EX 2% agarose gel.

[0106] To confirm the circularization efficiency of circular RNA precursors of each length, the circular RNA bands observed on an EX 2% agarose gel were quantified and the circularization efficiency (ligation efficiency) was calculated according to the following formula 1.

[0107] [Formula 1] Ligation efficiency (%) = Circular band quantitative value / (Circular band quantitative value + Linear band quantitative value)*100

[0108] As a result, circular RNA precursors from 271 nt to 5002 nt were circularized by Rnl2 to generate circular RNAs, and the circularization efficiency was higher for smaller RNA sizes, but the circular RNA precursor of the present invention could be inserted into genes up to about 5000 nt in length. Specifically, the circularization efficiency was about 90% for the 271 nt length and about 20% for the 5002 nt length.

[0109] 5. Optimization of the circular RNA production method 5-1.GTP:GMP ratio In order for both ends of RNA to be joined by T4 RNA ligase 2, the 5' end must be monophosphate. RppH is usually used for this purpose. We induced in vitro transcription by adding GMP, and then in vitro transcribed 3'DB with different ratios and amounts of GTP and GMP to induce ligation, and confirmed the circularization efficiency (Figure 7).

[0110] As a result, when the GTP:GMP ratio was 1:5, the circularization efficiency was about 50%, and when the GMP ratio was higher than this, the circular RNA production increased slightly. Considering the total rNTP usage and circularization efficiency, it was confirmed that the GTP:GMP ratio of 1:5 is suitable.

[0111] 5-2. Heating conditions In order to induce the transcript to form the intended secondary structure after in vitro transcription, a heating step is added before ligation. We tried to confirm whether there was a difference in circularization efficiency depending on the conditions of the heating step. We compared the circularization efficiency of a heating treatment in which the transcript was heated at 65°C for 3 minutes and cooled on ice for 3 minutes with that of a heating treatment in which the transcript was cooled to 26°C at 80°C for 3 minutes at a rate of 6°C per minute. As a result, as shown in Figure 8, it was confirmed that the heating treatment condition of 80°C for 3 minutes at a rate of 6°C per minute to 26°C was superior in circularization efficiency to the results of the former condition (Figures 11 and 12).

[0112] 5-3. Ligation reaction conditions The circularization efficiency according to temperature and time conditions was confirmed in the ligation reaction induction step. Specifically, the ligation temperature conditions were set to 25°C or 37°C, and the degree of circular RNA formation was confirmed by bands after 1, 4, 8, or 12 hours under the temperature conditions (Figure 9). As a result, sufficient circular RNA bands could be confirmed by ligation induction at 25°C for 1 hour. As a result of inducing the reaction at 37°C, the circular RNA bands were weak. Even when ligation was induced for more than 1 hour, no significant increase in circularization efficiency could be confirmed.

[0113] 5-4.RppH treatment On the other hand, to increase the efficiency of ligation induction by Rnl2, IVT was performed under various GTP:GMP conditions, and an additional step of RppH treatment was performed to confirm the circularization efficiency. As a result, when ligation induction by Rnl2 was performed after RppH treatment, the circularization efficiency was higher than when RppH treatment was not performed (Figure 10).

[0114] 5-5. Confirm circularization with DB-WT and 3'DB Circular RNA was produced under the optimal circular RNA production conditions confirmed in 5-1 to 5-4 above using DB-WT and 3'DB circular RNA precursors circularized by Rnl2, and its efficiency was confirmed. After performing an IVT experiment under conditions in which only GTP was added without GMP, RppH was treated to convert the 5' end to a monophosphate to compare the two different circularization methods. The experimental results using DB-WT are shown in Figure 11, and the experimental results using 3'DB are shown in Figure 12.

[0115] As previously confirmed, DB-WT and 3'DB were joined by Rnl2 to generate circular RNA. On the other hand, DB-WT produced circular RNA less efficiently than 3'DB despite RppH treatment under conditions where only GTP was added. This is thought to be because RppH could not operate properly in DB-WT due to its secondary structure. In addition, in the case of DB-WT, the linear RNA band was not completely removed in lane 6 after poly(A) tailing and RNase R treatment due to the secondary structure, but in the case of 3'DB, no linear RNA was observed after the above purification.

[0116] 6. Comparison of circularization efficiency with splint ligation We attempted to confirm the efficiency of circular RNA production using DB-M3 and DNA splints. The circularization production conditions were set to the optimal conditions confirmed in 5-1 to 5-4 above, and the circular RNA precursor used in splint ligation was DB-M3 with 19 nt nucleotides deleted from the 3' end. DNA splints of 30, 60, or 91 nt in length were used. As a result, as can be seen in Figure 13, it was found that DB-M3 had a better circularization efficiency by Rnl2 than the three types of DNA splints.

[0117] As described above, although the embodiments have been described with reference to limited drawings, those having ordinary skill in the art may apply various technical modifications and variations based on the above. For example, the described techniques may be performed in a different order from that described, and / or the components of the described systems, structures, devices, circuits, etc. may be combined or combined in a different manner from that described, or may be replaced or substituted by other components or equivalents to achieve suitable results.

[0118] Therefore, other embodiments, examples, and equivalents to the claims are also within the scope of the following claims. [Industrial Applicability]

[0119] The present invention can be utilized for producing circular RNA.

Claims

1. A circular RNA precursor comprising: The structure has the structure 5'-3' DumbBell Sense sequence (3' DB SS)-GOI-3' DumbBell Antisense sequence (3' DB AS)-3', The 3'DB AS region is composed of a sequence reverse-complementary to the 3'DB SS region, the 3'DB SS region has a length of 10 to 29 nt; The circular RNA precursor is circularized by Rnl2 without a DNA splint.

2. The construct comprises nucleotides extending in the 5' direction of the 3' DBSS region, The region consisting of the extended nucleotides comprises a 5' DumbBell Antisense sequence (5' DB AS)-5' DumbBell Sense sequence (5' DB SS) structure, The 5'DB AS region is a reverse complementary sequence to the 5'DB SS region; The circular RNA precursor of claim 1, wherein the 5'DB SS region is 3 to 15 nt in length.

3. The circular RNA precursor of claim 2, wherein the 5'DB AS region and the 5'DB SS region are linked by 1 to 19 random nucleotides.

4. The circular RNA precursor of claim 1, wherein the GOI region is 500-5500 nt in length.

5. The circular RNA precursor of claim 1, wherein the GOI comprises an IRES.

6. An expression vector capable of expressing the circular RNA precursor according to any one of claims 1 to 5.

7. The expression vector of claim 6 , further comprising a promoter operably linked to a gene encoding the circular RNA precursor.

8. (1) inducing in vitro transcription of the expression vector of claim 6 under conditions of GTP:GMP=1:5-10; (2) after completion of the transcription induction step, treating the plasmid with DNase I in vitro; (3) adding Rnl2 in vitro to induce ligation.

9. The method for producing circular RNA according to claim 8, further comprising the step of treating RppH in vitro after carrying out step (2).

10. The method further comprises a heating step immediately prior to step (3); The method for producing circular RNA according to claim 8, wherein the heating step is heating to 80°C for 3 minutes and cooling at 6°C per minute until the temperature reaches 26°C.

11. The method for producing circular RNA according to claim 8, wherein the step (3) is carried out at 25°C for 1 hour or more.

12. The method for producing circular RNA according to claim 8, further comprising the step of (4) treating with RNase R in vitro after the step (3).

13. The method for producing circular RNA according to claim 12, further comprising a step of treating with poly(A) polymerase in vitro immediately before step (4).

Images