Circular RNA for targeted inhibition of fish rhabdovirus replication, and preparation method and application thereof

Abstract

The invention relates to circular RNA for targeted inhibition of fish rhabdovirus replication and a preparation method and application of the circular RNA, the circular RNA is SCRV-circRNA-1, the nucleotide sequence of the circular RNA is shown as SEQ ID NO: 1, and the circular RNA is prepared by cyclizing linear SCRV-circRNA-1 through T4 RNA ligase 1 and then removing residual linear RNA in a reaction system through RNase R enzyme. The SCRV-circRNA-1 and the SCRV-N protein have relatively strong binding capacity, can effectively inhibit the replication of the SCRV virus, and can be used for preparing fish rhabdovirus vaccines, antiviral drugs and other biological immune products in the field of aquaculture.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a circular RNA for targeted inhibition of fish rhabdovirus replication, and a preparation method and application thereof. Background Art

[0002] Fish rhabdoviruses are a class of pathogens that seriously harm farmed fish. They belong to the Rhabdoviridae family and have a single-stranded negative-sense RNA genome. These viruses pose a serious threat to a variety of farmed fish with their rapid transmission ability and high mortality rate. There are many types of fish rhabdoviruses, including but not limited to Siniperca chuatsi Rhabdovirus (SCRV), Infectious Pancreatic Necrosis Virus (IPNV), Viral Hemorrhagic Septicemia Virus (VHSV), etc. These viruses have their own characteristics in genome structure, host range, and pathological symptoms caused, but what they have in common is that they can spread rapidly in fish and cause significant economic losses.

[0003] Fish rhabdoviruses are usually sensitive to environmental factors, such as temperature and pH, which affect the stability and infectivity of the virus. They can induce metabolic reprogramming of host cells to meet the needs of viral replication and trigger a series of immune responses in the host. Viral diseases caused by fish rhabdoviruses have caused serious economic losses to aquaculture fish. Therefore, the development of effective prevention and control measures, such as vaccines, antiviral drugs and biological immune products, is crucial to ensure the sustainable development of aquaculture.

[0004] In recent years, circular RNA (circRNA), as a new type of non-coding RNA molecule, has shown important roles in regulating gene expression, participating in RNA-protein interactions, and serving as a disease marker. CircRNA has a unique closed circular structure and exhibits higher stability and longer half-life in cells compared to linear RNA. Summary of the invention

[0005] The present invention aims to solve the above problems and provides a circular RNA for inhibiting the replication of fish rhabdovirus and a preparation method and application thereof.

[0006] The present invention adopts the following technical scheme: a circular RNA that targets and inhibits the replication of fish rhabdovirus, wherein the circular RNA is SCRV-circRNA-1, and its nucleotide sequence is shown in SEQ ID NO:1.

[0007] A method for preparing circular RNA for inhibiting the replication of fish rhabdovirus, characterized in that it comprises the following steps: (1) Analyze the viral SCRV genome sequence and design primers SCRV-circRNA-1-F and SCRV-circRNA-1-R for annealing to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template are used for T7 RNA transcription to obtain linear RNA, which is then purified by ethanol precipitation. (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain SCRV-circRNA-1.

[0008] Furthermore, in the step (1), the nucleotide sequence of the primer SCRV-circRNA-1-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the primer SCRV-circRNA-1-R is shown in SEQ ID NO: 3.

[0009] The application of a circular RNA that targets and inhibits the replication of fish rhabdovirus can reduce the SCRV virus titer and mRNA expression level during post-exposure and pre-exposure prevention.

[0010] The application of circular RNA for targeted inhibition of fish rhabdovirus replication is used in the preparation of vaccines and antiviral drugs for fish rhabdovirus SCRV.

[0011] SCRV-circRNA-1-F: 5'-AACACCAAATCATCAGGA-3', SCRV-circRNA-1-R: 5'-ACAGAGATAGCGGACCAC-3'.

[0012] SCRV virus enters the cytoplasm through endocytosis and releases infectious negative-strand ribonucleoprotein (RNP) complexes, which are composed of negative-strand leader RNA, N protein and P protein, to initiate the transcription and replication stages of the viral life cycle. RNA polymerase recognizes the negative-strand RNP complex and starts primary transcription, and produces six different types of RNA, including an uncapped positive-strand leader RNA and five mRNAs, which are translated into N, P, M, G and L proteins respectively. The synthesized initial N and P proteins can bind to the newly transcribed positive-strand leader RNA to form a new positive-strand RNP complex, which is specifically used for the replication of the viral genome. During the replication process, the N protein plays a key role in packaging the full-length negative-sense genomic RNA into a new RNP complex, while the P protein acts as a cofactor of the L protein to assist in scanning and processing the RNA template to ensure accuracy and efficiency. Therefore, the correct formation of the RNP complex is essential for the correct replication and transcription of the SCRV virus. In the present invention, a circular RNA molecule capable of binding to SCRV-N protein was initially designed, and then optimized by Alphafold3 software and verified by interaction experiments such as RNA-pulldown. Finally, a circular RNA molecule with strong binding ability to SCRV-N protein was designed, which was named SCRV-circRNA-1. The RNA pulldown molecular interaction experiment proved that SCRV-circRNA-1 had a strong binding ability with SCRV-N protein.

[0013] The advantages of the present invention are as follows: the circular RNA molecule SCRV-circRNA-1 prepared by the present invention has a strong binding ability with the SCRV-N protein. The SCRV-circRNA-1 can significantly reduce the virus titer by more than 90% in cell culture and reduce the SCRV virus mRNA level in both SCRV post-exposure treatment and pre-exposure prevention. It can be used in the preparation of fish rhabdovirus vaccines, antiviral drugs and other biological immune products in aquaculture, providing a new disease prevention and control technical means for the fish farming industry, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the cyclization process of SCRV-circRNA-1 of the present invention.

[0015] Figure 2 Schematic diagram of the direct interaction between SCRV-circRNA-1 and SCRV-N protein of the present invention.

[0016] Figure 3 This is a gel electrophoresis analysis diagram of SCRV-circRNA-1 and linear RNA of the present invention.

[0017] Figure 4 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on the treatment after SCRV virus exposure.

[0018] Figure 5 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on pre-exposure prevention of SCRV virus.

[0019] Figure 6 This is the effect of the SCRV-circRNA-1 of the present invention on the expression level of SCRV virus mRNA during post-exposure treatment.

[0020] Figure 7 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on the expression level of SCRV virus mRNA during pre-exposure prevention.

[0021] Figure 8 Schematic diagram of SCRV-circRNA-1 stability detection of the present invention. DETAILED DESCRIPTION

[0022] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the present invention is further described below in conjunction with specific embodiments. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0023] Carp epithelial cells (EPC cells) were grown in cell culture medium at 5% CO 2 , cultured in a constant temperature incubator at 28°C. Medium 199 medium (Invitrogen) containing 10% fetal bovine serum, 100 U / ml penicillin and 100 mg / ml streptomycin was used as the cell culture medium for EPC cells; medium 199 medium containing only 2% fetal bovine serum was used as the cell maintenance medium during virus culture.

[0024] The Siniperca chuatsi Rhabdovirus (SCRV) of the present invention is stored in the National Aquatic Animal Pathogen Bank.

[0025] Example 1: Preparation of SCRV-circRNA-1: The nucleotide sequence is GGGACGAGAAAAAAGAAACCAAUAUACAGAUUAUCAAGAUUAUUGGAUUUCUUUUCUCUCGACAUUCAAAAUGUAAGCUUGGUACCGAGCUCGG.

[0026] (1) First, primer SCRV-circRNA-1-F, whose sequence is shown in SEQ ID NO:2, and primer SCRV-circRNA-1-R, whose sequence is shown in SEQ ID NO:3, are annealed to form a double-stranded DNA template. The specific steps are as follows: SCRV-circRNA-1-F 10 μL (100 μM), SCRV-circRNA-1-R 10 μL (100 μM), annealed according to the following procedure, 95°C for 5 min, 94°C-46°C (cooling at a rate of 1°C / min), 46°C-26°C (cooling at a rate of 2°C / min), stored at 4°C, and T7 RNA polymerase and the DNA template annealed above are used to perform T7 RNA transcription of linear RNA. The specific steps are as follows: DNA template 1 μg, T7 transcription buffer 2 μL, NTP mixture (10 mM) 4 μL, T7 RNA polymerase (1 kU / μl) 0.1 μL, add nuclease-free pure water to 20 μL, and incubate at 37°C for 120 minutes; (2) After the reaction is completed, the transcribed linear RNA is purified by ethanol precipitation. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate (pH 5.2) or 20 μL of 5M ammonium acetate and mix thoroughly; add an equal volume of phenol / chloroform mixture (1:1) to extract once (vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant), and then extract with chloroform 1-2 times (vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to obtain the supernatant). Precipitate the RNA with double volume of anhydrous ethanol and incubate at -20°C for at least 30 minutes. Then centrifuge at 14000g at 4°C for 5-10 minutes to precipitate the RNA. Discard the supernatant, wash the precipitate with 500 μL of pre-cooled 70% ethanol, and resuspend and dissolve the RNA with 20 μL of nuclease-free pure water; (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 µM linear RNA, 2 µL T4 RNA ligase buffer, 1 µL 1 mM ATP, and 1 µL T4 RNA ligase 1, add nuclease-free pure water to 20 µL, incubate at 37 °C for 1 hour, and purify the circularized RNA using the ethanol precipitation method mentioned above.

[0027] (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system, take 20 μL of the above purified RNA, 3 μL of RNase R enzyme buffer, add nuclease-free pure water to 30 μL, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified SCRV-circRNA-1.

[0028] The process of SCRV-circRNA-1 from linear to circular Figure 1 As shown by Figure 1 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1 (SEQ ID NO: 4, AAGCUUGGUACCGAGCUCGG) and the linker sequence 2 (GGGACG). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 It can be seen from the gel electrophoresis diagram that after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after the RNase R treatment, and the concentration is similar to the RNA concentration before the RNase R treatment, indicating that the circular RNA has been successfully synthesized in the present invention.

[0029] Depend on Figure 2 It can be seen that the SCRV-circRNA-1 prepared by the present invention has a strong binding ability with the SCRV-N protein. Therefore, it can be seen that SCRV-circRNA-1 has the potential to target and inhibit the replication of SCRV virus.

[0030] Example 2: Effect of SCRV-circRNA-1 on SCRV virus titer during post-exposure treatment and pre-exposure prevention: 1. Effect of post-exposure therapy on viral titer: EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium (without adding double antibody) to a cell density of 2.5×10 5 cells / ml, forming a cell suspension, adding the above cell suspension to a 12-well cell culture plate at 1 ml / well, and then adding the SCRV virus solution to the cell culture plate containing the EPC cell suspension at MOI = 0.01 / well, and setting a negative control at the same time, placing it in a cell culture incubator for culture at a temperature of 40 °C. 2 The volume content is 5% and the temperature is 28°C.

[0031] After 24 hours of culture, the cells were discarded and washed with sterile PBS, and then 1 ml of cell culture medium was added per well. The synthesized SCRV-circRNA-1 was then transfected into the EPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific). After 48 hours of transfection, the cell supernatant of each well was collected. Cell maintenance medium was used to maintain the cells for 10 min. 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 107 , 10 8 Serially dilute the cell supernatant obtained in the previous step by multiple times to obtain gradient concentration virus dilution solutions; EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium (without adding double antibody) to a cell density of 2.5×10 5 The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well and the cell culture plate was placed in a cell culture incubator with CO 2 The volume content was 5% and the temperature was 28°C. After the cells were cultured for 24 hours, the medium in the 96-well cell culture plate was removed and the 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by multiple dilution were added to the cell culture plates containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded, and the virus titer was calculated.

[0032] The results are as follows Figure 4 It is knowable.

[0033] 2. Effect on virus titer in pre-exposure prophylaxis: Take EPC cells in the logarithmic growth phase. Digest the cells with trypsin and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator. 2 The volume content is 5% and the temperature is 28°C.

[0034] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml / well of cell culture medium was added. The synthesized SCRV-circRNA-1 was transfected into the above EPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher). After 24 hours of transfection, the supernatant in the above cell culture plate was discarded and rinsed with sterile PBS. The SCRV virus venom was added to the cell culture plate with EPC cells at MOI = 0.01 / well, and a negative control was set up and placed in CO 2 Cultured in an incubator, CO 2 CO in the incubator 2The volume content was 5% and the temperature was 28°C. After culturing for 48 hours, the cell supernatant of each well was collected and the cell maintenance medium was used at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The cell supernatant obtained by multiple dilutions was used to obtain virus dilutions with gradient concentrations; EPC cells in the logarithmic growth phase were taken and digested with trypsin solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well and the cell culture plate was placed in a cell culture incubator with CO 2 The volume content was 5% and the temperature was 28°C. After the cells were cultured for 24 hours, the medium in the 96-well cell culture plate was removed and the 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by serial dilution were added to the cell culture plate containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded, and the virus titer was calculated. The results are as follows Figure 5 shown.

[0035] In order to verify the effect of SCRV-circRNA-1 in inhibiting viral replication, we first detected the therapeutic effect of SCRV-circRNA-1 on cells after SCRV virus exposure. Figure 4 It can be seen that compared with the control group, the SCRV virus titer in cells transfected with SCRV-circRNA-1 was significantly reduced, with the virus titer reduced by more than 90%. At the same time, the preventive effect of SCRV-circRNA-1 before SCRV virus exposure was also tested, and it was found that it could also significantly reduce the virus titer. Figure 5 It can be seen that the SCRV virus titer was reduced by about 90% compared with the control group.

[0036] In summary, SCRV-circRNA-1 is suitable for post-exposure treatment and pre-exposure prevention of fish rhabdoviruses, and can significantly reduce the virus titer in cell culture by more than 90%.

[0037] Example 3: Effect of SCRV-circRNA-1 on SCRV virus mRNA expression level: 1. Effect of SCRV-circRNA-1 on SCRV virus mRNA expression during post-exposure therapy: EPC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well, and then the SCRV virus solution was added to the cell culture plate containing the EPC cell suspension at MOI = 0.01 / well. A negative control was set up at the same time and placed in a cell culture incubator for culture. The cell culture incubator was set at 4 °C. 2 The volume content is 5% and the temperature is 28°C.

[0038] After the above cells were cultured for 24 hours, the supernatant in the cell culture plate was discarded, the plates were rinsed once with sterile PBS, and then cell culture medium was added at 1 ml / well; the synthesized SCRV-circRNA-1 was then transfected into the above EPC cells.

[0039] After 48 hours of cell transfection, the supernatant in the cell culture plate was discarded and rinsed with sterile PBS; then 1 ml of Trizol lysis solution was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozyme). The mRNA level of the SCRV virus N gene was then detected using a universal high-sensitivity dye quantitative PCR detection kit and primers (SCRV-N-RT-1F: 5'-AACACCAAATCATCAGGA-3', SCRV-N-RT-1R: 5'-ACAGAGATAGCGGACCAC-3').

[0040] The results are as follows Figure 6 shown.

[0041] 2. Effect of SCRV-circRNA-1 on SCRV virus mRNA expression in pre-exposure prophylaxis: Take EPC cells in the logarithmic growth phase, digest the cells with the corresponding digestion solution, and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator. 2 The volume content is 5% and the temperature is 28°C.

[0042] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml / well of cell culture medium was added. The synthesized SCRV-circRNA-1 was transfected into the above EPC cells. After 24 hours of transfection, the supernatant in the cell culture plate was discarded and rinsed with sterile PBS. The SCRV virus venom was added to the cell culture plate with EPC cells at MOI = 0.01 / well, and a negative control was set up and placed in CO 2 Cultured in an incubator, CO 2 CO in the incubator 2 The volume content is 5% and the temperature is 28°C.

[0043] After the cells were cultured for 48 hours, the supernatant in the cell culture plate was discarded and the cells were rinsed with sterile PBS; then 1 ml of Trizol lysis solution was added to each well for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using an efficient second-generation full-length cDNA single-strand synthesis kit (Novozymes). The mRNA level of the SCRV virus N gene was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (SCRV-N-RT-1F: 5'-AACACCAAATCATCAGGA-3', SCRV-N-RT-1R: 5'-ACAGAGATAGCGGACCAC-3'). The results are as follows: Figure 7 shown.

[0044] Depend on Figure 6 It can be seen that in the treatment after SCRV virus exposure, SCRV-circRNA-1 significantly reduced the level of SCRV virus mRNA (N gene), and the mRNA expression of SCRV-N gene in cells transfected with SCRV-circRNA-1 was reduced by about 80% compared with the control group.

[0045] Depend on Figure 7 It can be seen that in pre-exposure prevention of SCRV virus, SCRV-circRNA-1 can also significantly reduce the level of SCRV virus mRNA (N gene). The mRNA level of SCRV-N gene in cells transfected with SCRV-circRNA-1 was reduced by more than 90% compared with the control.

[0046] In summary, SCRV-circRNA-1 has excellent therapeutic effects after SCRV virus exposure and preventive effects before exposure, and both have the ability to significantly reduce SCRV virus mRNA levels, further confirming the therapeutic potential of SCRV-circRNA-1 in controlling SCRV virus replication.

[0047] Therefore, the SCRV-circRNA-1 in the present invention can be used in the preparation of fish rhabdovirus vaccines, antiviral drugs and other biological immune products in aquaculture. SCRV-circRNA-1 can inhibit the replication and proliferation of SCRV virus by specifically binding to fish rhabdovirus SCRV, effectively blocking the spread of SCRV in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish viral diseases caused by SCRV virus infection, and effectively protecting the healthy breeding of a variety of economically farmed fish, thereby significantly improving the yield and economic benefits of fish breeding.

[0048] In addition, since the circular RNA can greatly reduce the outbreak of fish viral diseases, it can also reduce the occurrence of late complications such as bacterial diseases caused by viral diseases. The treatment of bacterial diseases mainly relies on the large-scale use of antibiotics, and the use of antibiotics will bring many negative problems. Therefore, since the occurrence of fish viral diseases is reduced, the risk of bacterial disease outbreaks is reduced, and the use of antibiotics is reduced, which has important practical and social significance for protecting the ecological environment, reducing drug residues, and reducing the risk of the emergence of drug-resistant strains.

[0049] Example 4: Detection of SCRV-circRNA-1 stability: Detection method: Take EPC cells in the logarithmic growth phase. Digest the cells with the corresponding digestion solution and then dilute them with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and placed in a cell culture incubator. 2 The volume content is 5% and the temperature is 28°C.

[0050] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The synthesized SCRV-circRNA-1 was transfected into the above EPC cells, and 5 replicate wells were transfected. After 24 hours, 36 hours, 48 ​​hours, 60 hours and 72 hours of transfection, the cells in each well were selected, the supernatant in the well was discarded, rinsed with sterile PBS, and then 1 ml of Trizol lysis solution was added for lysis at room temperature for 10 minutes, and then RNA was extracted using a total RNA extraction kit (Kangwei Century).

[0051] Total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozyme). Then, the level of SCRV-circRNA-1 was detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (SCRV-circRNA-1-RT-1F: 5'-GGGACGAGAAAAAAGAAAC-3', SCRV-circRNA-1-RT-1R: 5'-CCGAGCTCGGTACCAAGCTT-3'). The results are shown in Figure 8 shown.

[0052] Depend on Figure 8 The results show that the relative levels of synthesized SCRV-circRNA-1 were detected after 24h, 36h, 48h, 60h and 72h of transfection into EPC cells. SCRV-circRNA-1 showed almost no degradation trend within 48h of transfection, began to degrade after 60h of transfection, and degraded by about 40%-50% after 72h of transfection. Therefore, it can be seen that the half-life of SCRV-circRNA-1 in EPC cells is about 72h, which has good stability.

[0053] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A circular RNA that targets and inhibits the replication of fish rhabdovirus, characterized in that: The circular RNA is SCRV-circRNA-1, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. The method for preparing circular RNA for inhibiting the replication of fish rhabdovirus according to claim 1, characterized in that: The steps include: (1) Analyzing the virus SCRV, primers SCRV-circRNA-1-F and primer SCRV-circRNA-1-R were designed for annealing to form a double-stranded DNA template, and T7 RNA polymerase and the double-stranded DNA template were used for T7 RNA transcription to obtain linear RNA, which was purified by ethanol precipitation. The nucleotide sequence of primer SCRV-circRNA-1-F is shown in SEQ ID NO:2, and the nucleotide sequence of primer SCRV-circRNA-1-R is shown in SEQ ID NO:3; (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it; (3) RNase R was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain SCRV-circRNA-1.

3. Use of the circular RNA for targeted inhibition of fish rhabdovirus replication as claimed in claim 1 in the preparation of vaccines and antiviral drugs for fish rhabdovirus SCRV.

Images