Allele-specific splice-switching oligonucleotides targeting pseudoexons

Abstract

The present invention relates to a method for identifying splice-switching oligonucleotides (SSOs) that, when bound to a pre-mRNA in the region +9 to +39 downstream relative to the 5' splice site of a pseudoexon, are capable of modulating the expression of a target protein in a cell by promoting the incorporation of this pseudoexon into the mature mRNA. The present invention also relates to SSOs obtained by this method and their uses. In particular, the present invention relates to allele-specific splice-switching oligonucleotides (SSOs). Figure 1A is published together with the abstract.

Description

[Technical field]

[0001] The present invention relates to allele-specific splice-switching oligonucleotides (SSOs) capable of activating splicing of pseudoexons. In particular, SSOs can promote the inclusion of pseudoexons in mRNA transcripts of genes, for example in an allele-specific manner, thereby inhibiting expression of functional gene products. In another aspect, the present invention relates to methods for identifying pseudoexons that can be incorporated into mature mRNAs using SSOs. [Background technology]

[0002] Newly synthesized eukaryotic mRNA molecules, also called primary transcripts or pre-mRNAs, are generated in the nucleus and are processed prior to or during transport to the cytoplasm for translation. Pre-mRNA processing includes the addition of a 5' methylated cap and a poly(A) strand of approximately 200-250 nucleotides to the 3' end of the transcript.

[0003] Another step in mRNA processing is splicing of pre-mRNA, which is part of the maturation of 90-95% of mammalian mRNAs. Introns (or intervening sequences) are regions of the primary transcript that are not included in the coding sequence of the mature mRNA. Exons are regions of the primary transcript that remain in the mature mRNA when it reaches the cytoplasm. Exons are joined together to form the mature mRNA sequence. Splicing occurs between splice sites, which join together to form splice junctions. The splice site at the 5' end of an intron is often called the "5' splice site" or "splice donor site," and the splice site at the 3' end of an intron is often called the "3' splice site" or "splice acceptor site." In splicing, the 3' end of the upstream exon joins the 5' end of the downstream exon. Thus, the unspliced ​​RNA (or pre-mRNA) has an exon / intron splice site at the 5' end of the intron and an intron / exon splice site at the 3' end of the intron. After the intron is deleted, the exons are adjacent at what are sometimes called exon / exon junctions or boundaries in the mature mRNA. Alternative splicing is defined as the splicing of different combinations of exons or exon fragments together, often resulting in multiple mature mRNA transcripts expressed from a single gene.

[0004] Splicing of precursor mRNA (pre-mRNA) is an essential step in eukaryotic gene expression, where introns are removed and the coding parts of genes are spliced ​​together to form functional mRNA by the activity of the spliceosome. It is well established that pre-mRNA splicing is a highly regulated process and mutations can affect splicing and generate aberrant transcripts. Correct mRNA splicing depends on regulatory sequences, which are recognized by different spliceosome factors and splicing regulators. Splicing regulators either stimulate or repress exon recognition and splicing by sequence-specific binding to splicing regulator sequences such as splicing enhancers and splicing silencers. Pre-mRNA splicing in eukaryotes is often associated with extensive alternative splicing to enrich the proteome. Alternative selection of splice sites allows eukaryotes to regulate cell-type specific gene expression, contributing to functional diversification. Alternative splicing is a highly regulated process influenced by splicing control proteins, such as SR proteins or hnRNPs, which recognize splicing control sequences, such as exonic splicing enhancers (ESEs) and exonic splicing silencers (ESSs) within exons, and intronic splicing enhancers (ISEs) and intronic splicing silencers (ISSs) within introns.

[0005] It is well known that exon mutations can often either create or remove existing splicing regulatory sequences other than splice site sequences, leading to RNA missplicing and resulting in disease. However, it is difficult to predict which mutations will affect splicing because not all exons are critically dependent on splicing regulatory elements other than splice sites, and as a result, only a limited number of exons are susceptible to mutations in splicing regulatory sequences outside splice sites. Summary of the Invention

[0006] The present invention relates to the identification of sequence parameters of genes containing pseudo-exons, which can be used to determine whether the pseudo-exon can be incorporated into a mature mRNA using a splice-switching oligonucleotide (SSO). The incorporation of a pseudo-exon can be used, for example, to inactivate, destroy or modify the function of a functional product expressed from the gene by incorporating the pseudo-exon into the mature mRNA (see also Example 1 and the corresponding figures and figure legends for further information). The present invention also relates to (medical) applications of such SSOs.

[0007] In one method of the present invention, the inventors have identified a number of SNPs within the SSO binding region that allow for allele-specific targeting. Allele-specific SSO can be used to preferentially target disease-causing pre-mRNAs (from disease-causing alleles) without affecting (or having a lesser effect on) pre-mRNAs from "normally functioning" alleles. (See Example 13.)

[0008] In another method of the present invention, the inventors identified SNPs within the splice site sequences of pseudoexons, allowing allele-specific incorporation of the pseudoexons into the mature RNA of only the disease-causing gene (and not into other "normal" genes on other alleles). In other words, allele-specific targeting is possible when the MaxEnt score of the splice site in the disease-causing gene is increased compared to other alleles (see Examples 15-16).

[0009] Example 2 shows that the parameters identified are essential to identify activatable pseudoexons (Table 1) and inactivatable pseudoexons (Table 2).

[0010] Example 3 presents data relating to SMAD2 (see also Example 11).

[0011] Example 12 presents data relating to RNF115.

[0012] Examples 4-11 and 13-14 provide further examples of specific genes that contain pseudoexons where the pseudoexons can be activated (incorporated into the mature mRNA).

[0013] Examples 13, 15 and 16 demonstrate allele-specific targeting.

[0014] It is therefore an object of the present invention to provide sequence parameters (criteria) that allow identifying the binding site of an SSO for the incorporation of a pseudoexon into a mature mRNA.

[0015] Another object of the present invention is to provide an SSO that can promote the incorporation of pseudoexons into mature mRNA in vivo, thereby inactivating, disrupting or altering the native function of a gene.

[0016] Thus, one aspect of the invention relates to a method for identifying an SSO that, when bound to a pre-mRNA in the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon described above, is capable of regulating the expression and / or function of a target protein in a cell by promoting incorporation of the pseudoexon into the mature mRNA, the method comprising: a) providing, in the form of a database or other storage means, one or more gene sequences that include one or more identified pseudoexons; b) determining, for one or more gene sequences, whether a pseudoexon meets the following criteria: Pseudoexon length <160nt, Pseudoexon length >30nt, The last 3 nt of the pseudoexon is different from TAG. the donor splice site has a MaxEnt score ≥ 4.33; the donor splice site has a MaxEnt score ≦10.06, and the acceptor splice site has a MaxEnt score ≧3.63; c) determining whether the sequence region +9 to +39 downstream of the 5' splice site of the pseudoexon (3) described above for one or more gene sequences meets the following criteria: Total number of pyrimidines ≤ 20, Total number of thymidine bases ≤ 12, Total number of thymidine bases ≥ 4; Total number of guanine bases ≤ 12, Maximum length of thymidine polymer ≤ 4; Maximum length of pyrimidine polymer ≦10; · minimum length of purine polymer ≥ 3; a maximum number of guanine polymers of at least 3 nt length ≦2; If one or more gene sequences satisfy the criteria according to points b) and c), then this region +9 to +39 downstream relative to the 5' splice site of this pseudoexon (3) is considered as a target for an SSO that can hybridize in vivo to a pre-mRNA (2) of said gene within the region +9 to +39 downstream relative to the 5' splice site of this pseudoexon (3), and this pseudoexon (3) becomes part of the mature mRNA to a greater extent than the corresponding pre-mRNA that is not contacted by the SSO (1); and Optionally producing the SSO as described above, optionally for use as a pharmaceutical.

[0017] The present invention also relates to a specifically identified SSO for use as a pharmaceutical. Accordingly, another aspect of the present invention relates to a composition comprising a splice-switching oligonucleotide (SSO) for use as a pharmaceutical, the composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, and 137 to 201, or o a nucleic acid comprising one, two or three substitutions compared to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, 137 to 201, or o a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 106, 1-26, 79-105, 107-125, 137-201; or - an SSO selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 127 to 136 and 202 to 216, or o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 127 to 136 and SEQ ID NOs: 202 to 216; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127-136 and 202-216; The SSO is complementary or substantially complementary to a target pre-mRNA (encoding a protein that causes or affects a functional disorder), the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o 3' splice site at the 5' end, o 5' splice site at the 3' end Including, the SSO is complementary or substantially complementary to a target pre-RNA in the region +9 to +39 downstream of the 5' splice site of the pseudoexon; When the above-mentioned SSO hybridizes in vivo to a pre-mRNA within the region +9 to +39 downstream relative to the 5' splice site of this pseudoexon, this pseudoexon becomes part of the mature mRNA to a greater extent compared to the corresponding pre-mRNA not in contact with the SSO.

[0018] In yet another aspect, the present invention provides a method for producing a composition comprising: - a composition comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, and 137 to 201, or o a nucleic acid comprising one, two or three substitutions compared to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, 137 to 201, or o a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 106, 1-26, 79-105, 107-125, 137-201; or - a composition comprising an SSO selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 127 to 136 and 202 to 216, or - a nucleic acid comprising one, two or three substitutions when compared with any of SEQ ID NOs: 127 to 136 and SEQ ID NOs: 202 to 216, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127 to 136 and SEQ ID NOs: 202 to 216.

[0019] A further aspect of the invention relates to a composition comprising a splice-switching oligonucleotide (SSO) for use as a medicament, the composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 217 to 294; o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 217-294, or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 217-294; or - an SSO selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 295 to 367, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 295 to 367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 295-367; the SSO is complementary or substantially complementary to a target pre-mRNA, the target pre-mRNA comprising a functionally nullifying pseudoexon; - Disabling pseudoexons o 3' splice site at the 5' end, o 5' splice site at the 3' end, Including, The SSO described above is complementary or substantially complementary to the target pre-mRNA in the region +9 to +39 downstream relative to the 5' splice site of this pseudoexon.

[0020] The present invention can also be used to identify subjects eligible for allele-specific SSO-based pseudoexon inclusion therapy. Thus, one aspect of the present invention relates to a method for identifying subjects who may be eligible for allele-specific SSO-based pseudoexon inclusion therapy of a dysfunctional or disease-causing gene, the method comprising: - determining the presence or absence of heterozygosity in a pseudoexon of a dysfunctional or disease-causing gene in a biological sample from the subject; If the subject is heterozygous for a sequence variation (SNP) at the 5' splice site and / or 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site, the subject may be eligible for allele-specific SSO-based pseudoexon inclusion therapy; or If the subject is not heterozygous for the 5' splice site and / or 3' splice site sequence variants (SNPs) of the function-neutralizing pseudoexon, the subject may not be eligible for allele-specific SSO-based pseudoexon inclusion therapy; The SSO is complementary or substantially complementary to a target pre-mRNA of a dysfunctional or disease-causing gene, the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o 3' splice site at the 5' end, o 5' splice site at the 3' end Includes.

[0021] A further aspect of the invention relates to a method for identifying a subject potentially eligible for SSO-based pseudoexon inclusion therapy of a dysfunctional or disease-causing gene, the method comprising: - determining in a biological sample from the subject the presence or absence of a SNP in a pseudoexon of a dysfunctional or disease-causing gene that enables SSO-based pseudoexon inclusion therapy; If the subject has a sequence variation (SNP) at the 5' splice site and / or the 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site, the subject may be eligible for SSO-based pseudoexon inclusion therapy; or If the subject does not have a sequence variant (SNP) at the 5' splice site and / or 3' splice site of the functionally-neutralizing pseudoexon, the subject may not be eligible for SSO-based pseudoexon inclusion therapy; o the SSO is complementary or substantially complementary to a target pre-mRNA of a dysfunctional or disease-causing gene, the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o 3' splice site at the 5' end, o 5' splice site at the 3' end Includes. [Brief description of the drawings]

[0022] [Figure 1] FIG. 1 shows a schematic diagram of gene expression control by SSO according to the present invention. FIG. 1A) Sweet Spot region is identified in the intronic part of pre-mRNA as the region +9 to +39 downstream for the 5' splice site of pseudoexon according to the criteria described in the present invention. FIG. 1B) By using SSO complementary to the Sweet Spot region of pseudoexon that meets the criteria, it is possible to activate and increase the inclusion of pseudoexon in mRNA transcript. Inclusion of pseudoexon in mRNA regulates gene expression at either mRNA or protein level by mislocalization, destabilization, degradation or alteration of mRNA or protein function. [Diagram 2]Figure 2 shows a schematic of how RNA-seq data are used to detect spliced ​​double junctions in vivo to empirically detect pseudoexons contained at low levels in endogenous transcripts. After mapping to the human genome, reads are filtered to retain only fragments containing at least two splicing junctions. Splicing junctions across fragments are then assembled into exon structures, resulting in unmapped gaps between reads within fragments of up to 100 bp. Exons are then classified using known exon annotations to identify pseudoexons contained within introns. New pseudoexons that may be candidates for activation by SSO binding to Sweet Spot regions can be identified by 14 criteria, and pseudoexons with strong therapeutic relevance can then be identified in genes where downregulation or alteration of expression of functional gene products is medically relevant. [Diagram 3] Figure 3 shows that inclusion of the LINGO2 pseudoexon inhibits glioblastoma cell growth and proliferation. (A) RT-PCR analysis of LINGO2 pseudoexon splicing in U251 cells transfected with LINGO2 pseudoexon +11 SSO and non-targeting SSO control. The upper band contains the pseudoexon that is activated by transfection of +11 SSO. (B) IncuCyte® cell proliferation assay shows the growth curves of U251 cells transfected with LINGO2 +11 SSO and non-targeting SSO control at different concentrations (cell confluency versus time post-transfection). Transfection of +11 SSO inhibits growth in a dose-dependent manner. [Figure 4]Figure 4 shows that inclusion of the TAF2 pseudoexon inhibits lung cancer cell growth and proliferation. (A) RT-PCR analysis of TAF2 pseudoexon splicing in NCI-H358 cells transfected with TAF2 pseudoexon +11 SSO and non-targeting SSO control. The upper band contains the pseudoexon that is activated by transfection of +11 SSO. (B) IncuCyte® cell proliferation assay showing growth curves (cell confluency versus time post-transfection) of NCI-H358 cells transfected with TAF2 pseudoexon +11 SSO and non-targeting SSO control. Transfection of +11 SSO inhibits growth. (C) Bar graph of WST-1 cell viability and proliferation assay showing absorbance at 450 nm as an indicator of cell viability of NCI-H358 lung cancer cells transfected with TAF2 pseudoexon +11 SSO and non-targeting SSO control. Transfection of +11 SSO reduces cell viability. [Diagram 5]Figure 5 shows optimization of TRPM7 SSOs targeting the Sweet Spot region. (A+B) RT-PCR analysis of TRPM7 pseudoexon splicing in (A) HeLa and (B) U251 cells transfected with 20 nM TRPM7 +9, +10, +11, +12, +13 SSOs, including control, transfection of non-targeting control SSOs with or without (UTR) transfection reagent (RNAiMAX), and untransfected cells. The upper band contains the pseudoexon and its amount increases with transfection of +9 to +13 SSOs. (C) Bar graph of IncuCyte® cell proliferation assay showing relative cell numbers 68 hours after transfection with TRPM7 pseudoexon +13 SSO and TRPM7 siRNA (KD), including control, transfection with non-targeting control SSO, and untransfected cells with or without transfection reagent (RNAiMAX) (UTR). Transfection with +13 SSO inhibits growth. Student's t-test, *p<0.05, **p<0.01, and ***p<0.001. [Figure 6]Figure 6 shows optimization of HIF1A SSO targeting the Sweet Spot region. (A) RT-PCR analysis of HIF1A pseudoexon splicing in U251 cells transfected with HIF1A pseudoexon +9, +10, +11, +12, and +13 SSOs. The middle band contains the pseudoexon, with transfection with +10 SSO being the most efficient. Pseudoexon inclusion levels were quantified using a Fragment Analyzer (Advanced Analytical Technologies). (B) WST-1 assay showing absorbance as an indicator of growth and proliferation of U251 cells transfected with 20 nM HIF1A pseudoexon +10 SSO and non-targeting SSO control under normoxic (N) or hypoxic (H) conditions. Student's t-test, *p<0.05, **p<0.01, and ***p<0.001. (C) Western blot of proteins extracted from PANC-1 cells transfected with 20 nM HIF1A pseudoexon +10 SSO, non-targeting SSO control and untransfected cells (UT) under normoxic or hypoxic conditions, using HIF-1α and β-actin specific antibodies as loading controls. HIF-1α protein is absent under normoxic conditions but is produced under hypoxic conditions in the control. Under hypoxic conditions, HIF-1α protein translation is reduced by +10 SSO. [Figure 7]Figure 7 shows that inclusion of RNF115 pseudoexon reduces RNF115 protein levels and inhibits proliferation of lung adenocarcinoma cells. (A) RT-PCR analysis of RNF115 pseudoexon splicing in NCI-H23 cells transfected with RNF115 pseudoexon +11 SSO and non-targeting SSO control. The upper band contains the pseudoexon that is activated by transfection of +11 SSO. (B) WST-1 assay shows proliferation of NCI-H23 cells transfected with RNF115 +11 SSO and non-targeting SSO control at different times. Transfection of +11 SSO inhibits growth in a dose-dependent manner. (C) Western blot of proteins extracted from NCI-H23 cells transfected with 5, 10, and 20 nM RNF115 pseudoexon +11 SSO, non-targeting SSO control, and untransfected cells (UT). RNF115-specific, β-catenin, and β-actin-specific antibodies were used as loading controls. Protein levels of RNF115 and β-catenin are decreased by the +11 SSO. [Figure 8]Figure 8 shows that inclusion of the SMAD2 pseudoexon reduces hepatic stellate cell fibrosis. (A) RT-PCR analysis of SMAD2 pseudoexon splicing in HeLa cells transfected with SMAD2 +11 SSO and non-targeting SSO control. The upper band contains the pseudoexon activated by transfection with +11 SSO. (B) RT-PCR analysis of SMAD2 pseudoexon splicing in LX-2 hepatic stellate cells transfected with SMAD2 +11 SSO and non-targeting SSO control. (C) Western blotting analysis of proteins from HepG2 hepatocytes transfected with SMAD2 SSO, non-targeting control SSO, or non-transfected (UTR) HepG2 cells stimulated with (+) or without (-) TGFβ 16 hours prior to protein harvest. Transfection with +11 SSO reduces SMAD2 and phosphorylated SMAD2 during TGFβ stimulation. (D) LX-2 hepatic stellate cells were transfected with SMAD2 +11 SSO or non-targeting SSO control and stimulated with TGFβ for 72 h. Phase contrast images of cells were taken and the number of differentiated cells was counted with ImageJ. Reduction of SMAD2 by +11 SSO reduces myofibroblast formation during TGFβ stimulation of fibrosis. [Figure 9]Figure 9 shows SSO-mediated LRRK2 pseudoexon inclusion. (A) Schematic of the results of induced LRRK2 pseudoexon inclusion. Inclusion of a 54 nt pseudoexon from LRRK2 intron 47 introduces 18 amino acids into the WD40 domain of the translated LRRK2 protein, and inclusion of an 82 nt pseudoexon with the same 5' splice site results in a frameshift and inserts a premature stop codon that targets the transcript for degradation by nonsense-mediated mRNA decay (NMD). (B) RT-PCR analysis of LRRK2 pseudoexon splicing in HeLa and U251 cells transfected with LRRK2 pseudoexon +11 SSO and a non-targeting SSO control (ctrl SSO). The upper band contains the pseudoexon, which is activated for inclusion into mRNA by transfection of +11 SSO. UT; untransfected. [Figure 10]FIG. 10 shows that the potential for SSO-mediated activation of the LRRK2 pseudoexon, chr12:40322690-40322887(+), depends on the presence of a common SNP, rs10878372 A / G, at the pseudoexon 5' splice site, which allows for G allele-specific activation of the pseudoexon. (A) Schematic of SSO treatment targeting the Sweet Spot region of the LRRK2 pseudoexon in the A allele. The pseudoexon 5' splice site (AGAgtagat) (SEQ ID NO: 368) has a low MaxEnt score of -4.26. SSO treatment does not induce inclusion of the pseudoexon from the A allele, and a normal mRNA transcript is generated that can be translated into a functional protein. This is shown by RT-PCR analysis of LRRK2 pseudoexon splicing in A549 cells (homozygous for the A allele) transfected with the LRRK2 pseudoexon +11 SSO (5'-CAGACUACCAGACAUCUGACUAGAA-3') (SEQ ID NO: 333) and the non-targeting SSO control (ctrl SSO) (5'-GCUCAAUAUGCUACUGCCAUGCUUG-3') SEQ ID NO: 126), where no band with pseudoexon inclusion can be detected on the agarose gel. (B) Schematic of SSO treatment targeting the Sweet Spot region of the LRRK2 pseudoexon of the G allele. The pseudoexon 5' splice site (AGAgtaggt) (SEQ ID NO: 369) has a high MaxEnt score of 4.84. SSO treatment induces pseudoexon inclusion from the G allele, which introduces several in-frame premature stop codons that target the mRNA transcript for degradation by nonsense-mediated mRNA decay (NMD) and / or translate a truncated protein.This is shown by RT-PCR analysis of LRRK2 pseudoexon splicing in LX-2 cells (heterozygous for the G allele) transfected with the LRRK2 pseudoexon +11 SSO (5'-CAGACUACCAGACAUCUGACUAGAA-3') (SEQ ID NO: 333) and a non-targeting SSO control (ctrl SSO) (5'-GCUCAAUAUGCUACUGCCAUGCUUG-3') (SEQ ID NO: 126), where the upper band on the agarose gel indicates inclusion of the pseudoexon. G allele-specific pseudoexon activation allows downregulation of the hyperactive LRRK2 disease allele when the identified SNP (G) and dominant pathogenic mutation are located in the same allele, with minimal or no effect on the wild type. Ψ; pseudoexon, WT; wild type, MUT; mutant. [Figure 11]Figure 11 shows that pseudoexon activation mediated by SSO targeting the Sweet Spot region (+9 to +39 nt downstream of the 5' splice site) depends on the strength of the 3' and 5' splice sites of the pseudoexon. SNPs located at the 23mer 3' splice site (-20 to +3 nt of the intron-exon boundary) or the 9mer 5' splice site (-3 to +6 nt of the exon-intron boundary) affect the strength of a given splice site (altering the MaxEnt score) and can be exploited for allele-specific pseudoexon activation, because such SNPs can be functional targets of otherwise unresponsive pseudoexon SSO treatment, thereby allele-specific inclusion or increased inclusion of a given pseudoexon in the mature mRNA. (A) In alleles with low-scoring MaxEnt score SNP variants at the pseudoexon 3' or 5' splice site, SSO-mediated activation of the pseudoexon is not possible or is only possible to a low extent. A normal mRNA transcript is generated and translated into a functional protein. (B) The SNP variant reinforces the pseudoexon 3' splice site (increasing the MaxEnt score), allowing SSO-mediated activation of the pseudoexon from an allele with a high-scoring MaxEnt score SNP variant at the specific 3' splice site. (C) The SNP variant reinforces the pseudoexon 5' splice site (increasing the MaxEnt score), allowing SSO-mediated activation of the pseudoexon from an allele with a specific 5' splice site to a high MaxEnt score SNP variant. In both cases, inclusion of the pseudoexon can target the mRNA transcript for degradation by nonsense-mediated mRNA decay (NMD) or translation of a truncated nonfunctional protein is achieved, thereby regulating gene expression. Allele-specific pseudoexon activation in heterozygotes allows downregulation of the disease allele with minimal or no effect on the wild type when the identified SNP variant with a high MaxEnt score and the pathogenic mutation are located on the same allele. Pseudoexons are activated from both alleles in homozygotes for SNP variants with a high MaxEnt score.* indicates the potential location of a SNP affecting the strength of the pseudoexon 3' or 5' splice site. Ψ; pseudoexon, WT; wild type, MUT; mutant. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The present invention will now be described in further detail.

[0024] definition Before describing the present invention in further detail, the following terms and conventions will first be defined.

[0025] Pseudoexon (PE) In the context of the present invention, the term "pseudoexon" or "PE" relates to an exon-like sequence that is present within an intronic region but is normally ignored by the spliceosome machinery. Thus, pseudoexons do not become part of the mature mRNA under normal splicing conditions, or only at low levels. Thus, pseudoexons are intronic sequences that are adjacent to 3' and 5' splice sites, but are often not annotated due to their low abundance in mRNA transcripts. Moreover, when included, pseudoexons disrupt or significantly alter the function of the normal transcript or protein.

[0026] Disabling pseudoexons In the context of the present invention, the term "function-neutralizing pseudoexon" relates to a situation in which the presence of a pseudoexon in a mature mRNA results in inactivation, reduced activity, reduced transcription and / or altered function of a protein expressed from the mRNA (compared to a mature mRNA lacking the pseudoexon).

[0027] Exonic splicing enhancers (ESEs) As used herein, the term "Exonic Splicing Enhancer" or "Exon Splicing Enhancer" or "ESE" refers to a nucleotide sequence that, when present in an exon, stimulates the incorporation of this exon into the final spliced ​​mRNA during pre-mRNA splicing, by being accessible for the binding of nuclear splicing control proteins and / or by forming a secondary structure in or part of the pre-mRNA.

[0028] Exon splicing silencer (ESS) The term "Exonic Splicing Silencer" or "Exon Splicing Silencer" or "ESS" as used herein refers to a nucleotide sequence that is present in an exon and prevents this exon from being included in the final spliced ​​mRNA during pre-mRNA splicing, if it is accessible for binding of nuclear splicing control proteins and / or by forming a secondary structure in or part of the pre-mRNA.

[0029] Intronic splicing enhancer (ISE) The term "Intronic Splicing Enhancer" or "Intron Splicing Enhancer" or "ISE" as used herein refers to a nucleotide sequence that is present in an intron and stimulates the inclusion of an exon into the final spliced ​​mRNA during pre-mRNA splicing, if it is accessible for the binding of nuclear splicing control proteins and / or by forming a secondary structure of, or part of, the pre-mRNA.

[0030] Intronic splicing silencer (ISS) As used herein, the term "Intronic Splicing Silencer" or "Intron Splicing Silencer" or "ISS" refers to a nucleotide sequence that is present in an intron and that inhibits the inclusion of an exon into the final spliced ​​mRNA during pre-mRNA splicing, if it is accessible for the binding of nuclear splicing regulatory proteins and / or by forming a secondary structure of, or part of, the pre-mRNA.

[0031] Splice Site The splice site at the 5' end of an intron is often referred to as the "5' splice site" or "splice donor site," and the splice site at the 3' end of an intron is often referred to as the "3' splice site" or "splice acceptor site."

[0032] Nonsense-mediated mRNA decay (NMD) "Nonsense-mediated mRNA decay" or "NMD" is a surveillance pathway present in all eukaryotes. Its main function is to reduce errors in gene expression by eliminating mRNA transcripts that contain premature termination codons (PTCs). In the context of the present invention, the introduction of a pseudoexon can induce NMD if a PTC is present in the introduced pseudoexon or if the pseudoexon alters the reading frame of the mature transcript.

[0033] nucleotide As used herein, "nucleotide" refers to a nucleoside that further comprises a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by a phosphate bond, and thus include, but are not limited to, "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0034] Nucleic acid bases As used herein, "nucleobase" refers to a group of atoms that can be attached to a sugar moiety to form a nucleoside that can be incorporated into an oligonucleotide, and which can be linked to a complementary natural nucleobase of another oligonucleotide or nucleic acid. The nucleobase can be naturally occurring or modified.

[0035] Unmodified nucleobases As used herein, the term "unmodified nucleobase" or "natural nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA, i.e., the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0036] Modified Nucleobases As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase.

[0037] Modified Nucleosides As used herein, "modified nucleoside" means a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. Modified nucleosides include modified sugar moieties and / or modified nucleobases.

[0038] Constrained ethyl nucleosides (cEt) As used herein, "constrained ethyl nucleoside" or "cEt" means a nucleoside that includes a bicyclic sugar moiety containing a 4'-CH(CH3)-0-2' bridge.

[0039] Locked Nucleoside (LNA) As used herein, "locked nucleic acid nucleoside" or "LNA" means a nucleoside that includes a bicyclic sugar moiety containing a 4'-CH2-0-2' bridge.

[0040] 2'-Substituted Nucleosides As used herein, "2'-substituted nucleoside" means a nucleoside that includes a substituent at the 2' position other than H or OH. Unless otherwise specified, 2'-substituted nucleosides are not bicyclic nucleosides.

[0041] 2'-Deoxynucleosides As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H-furanosyl sugar moiety found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (e.g., uracil).

[0042] Oligonucleotides As used herein, "oligonucleotide" refers to a compound that includes a plurality of linked nucleosides. In certain embodiments, an oligonucleotide includes one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0043] terminal group As used herein, "terminal group" refers to one or more atoms attached to either or both of the 3' or 5' ends of an oligonucleotide. In certain embodiments, the terminal group is a conjugate group. In certain embodiments, the terminal group comprises one or more terminal nucleosides.

[0044] Conjugated Group As used herein, "conjugate group" refers to an atom or group of atoms attached to an oligonucleotide or oligomeric compound. In general, a conjugate group modifies one or more properties of the compound to which it is attached, including, but not limited to, pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and / or clearance properties.

[0045] Conjugated Linking Groups As used herein, "conjugated linking group" means any atom or group of atoms used to attach a conjugated group to an oligonucleotide or oligomeric compound.

[0046] Splice-switching oligonucleotides (SSOs) As used herein, "splice-switching oligonucleotide" or "SSO" refers to a compound comprising or consisting of an oligonucleotide, at least a portion of which is complementary to and hybridizable with a target nucleic acid, and which effects at least one change in the splicing pattern of a target pre-mRNA.

[0047] Splice-switching oligonucleotides are also called splice-switching antisense oligomers (SSOs).

[0048] mRNA As used herein, "mRNA" means an RNA molecule that encodes a protein.

[0049] Pre-mRNA As used herein, "pre-mRNA" refers to an RNA transcript that has not been fully processed into mRNA. A pre-mRNA contains one or more introns.

[0050] Target pre-mRNA As used herein, the term "target pre-mRNA" refers to a nucleic acid molecule to which an SSO hybridizes.

[0051] Alteration of the splicing pattern of target pre-mRNA As used herein, "alteration of the splicing pattern of a target pre-mRNA" refers to an alteration in the pre-mRNA splicing process, e.g., resulting in the insertion of a corresponding proportion of a pseudoexon or part thereof into the generated mRNA when compared to a reference nucleotide sequence of the target pre-mRNA.

[0052] Transcripts As used herein, "transcript" refers to an RNA molecule transcribed from DNA. Transcripts include, but are not limited to, mRNA, pre-mRNA, and partially processed RNA.

[0053] Target and be targeted by As used herein, "targeting" or "targeted to" refers to binding of an SSO to a particular target nucleic acid molecule or to a particular region of a target nucleic acid molecule. An SSO targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0054] Nucleobase Complementarity and Complementarity As used herein, "nucleobase complementarity" or "complementarity" in reference to a nucleobase refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, a complementary nucleobase refers to a nucleobase of an SSO that can base pair with a nucleobase of a target nucleic acid. For example, if a nucleobase at a particular position of an SSO can hydrogen bond with a nucleobase at a particular position of a target nucleic acid, the hydrogen bond position between an oligonucleotide and a target nucleic acid is considered to be complementary in that nucleobase pair. Nucleobases that contain certain modifications can maintain the ability to pair with the corresponding nucleobase, and thus nucleobase complementarity is still possible.

[0055] As used herein, "complementary" with respect to an oligomeric compound (e.g., linked nucleosides, oligonucleotides, or nucleic acids) refers to the ability of that oligomeric compound or a region thereof to hybridize with another oligomeric compound or a region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at every nucleoside. Rather, some mismatching is tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary. In another embodiment, the oligomeric compound contains up to 3 mismatches, such as up to 2 or 1 mismatch. It is preferred that there are no mismatches.

[0056] Hybridization As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an SSO with its target nucleic acid). Although not limited to a particular mechanism, the most common pairing mechanisms include hydrogen bonding, Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0057] motif As used herein, "motif" refers to a pattern of chemical modifications in an oligomeric compound or region thereof. A motif may be defined by modifications in particular nucleosides and / or particular linkage groups of an oligomeric compound.

[0058] As used herein, "nucleoside motif" refers to a pattern of nucleoside modifications in an oligomeric compound or region thereof. The linkages of such oligomeric compounds may be modified or unmodified. Unless otherwise indicated, motifs that describe only nucleosides herein are intended to be nucleoside motifs. Thus, in such cases, the linkages are not limited.

[0059] As used herein, "glycomotif" refers to the pattern of sugar modifications in an oligomeric compound or region thereof.

[0060] As used herein, "linkage motif" refers to a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such oligomeric compounds may be modified or unmodified. Unless otherwise indicated, motifs that describe only the linkage herein are intended to be linkage motifs. Thus, in such cases, the nucleosides are not limited.

[0061] Modification Type As used herein, "type of modification" with respect to a nucleoside or a "type" of nucleoside refers to the chemical modification of the nucleoside and includes modified and unmodified nucleosides. Thus, unless otherwise specified, a "nucleoside having a first type of modification" can be an unmodified nucleoside.

[0062] Differently modified As used herein, "differently modified" refers to chemical modifications or chemical substituents that are different from each other, including the absence of modifications. Thus, for example, MOE nucleosides and unmodified DNA nucleosides are "differently modified" even though the DNA nucleoside is unmodified. Similarly, DNA and RNA are "differently modified" even though both are naturally occurring unmodified nucleosides. Nucleosides that contain the same but different nucleobases are not differently modified. For example, a nucleoside that contains a 2'-OMe modified sugar and an unmodified adenine nucleobase is not differently modified from a nucleoside that contains a 2'-OMe modified sugar and an unmodified thymine nucleobase.

[0063] MaxEnt Score The MaxEnt score is a score known to those skilled in the art that considers adjacent and non-adjacent dependencies between positions within a splice site and uses the maximum entropy principle to identify optimal splice sites. A high score indicates a high probability of a functionally strong splice site, whereas a low-scoring splice site may be functional through activation by splicing factors bound to the pre-mRNA at ESE or ISE motifs. Similarly, a high-scoring splice site may be functionally repressed by nearby or overlapping ESS or ISS motifs that bind inhibitory splicing factors.

[0064] The MaxEnt score according to the invention is determined using the program "MaxEntScan" version 20-04-2004. Using this software it is possible to determine: 5' splice site score (http: / / hollywood.mit.edu / burgelab / maxent / Xmaxentscan_scoreseq.html), and 3' splice site score (http: / / hollywood.mit.edu / burgelab / maxent / Xmaxentscan_scoreseq_acc.html).

[0065] The determination of MaxEnt scores is explained in further detail in Gene Yeo and Christopher B Burge (J Comput Biol.) 2004;11(2-3):377-94).

[0066] The MaxEnt score is a specific value that can only be determined in one way.

[0067] Although inclusion of the MaxEnt score significantly improves overall predictability and is preferred, in certain embodiments of the invention the MaxEnt score is optional.

[0068] Identifying pseudoexons Pseudoexons are identified with precise genomic coordinates of 3' and 5' splice sites using a double-junction approach, in which RNA-seq fragments are filtered and only those with evidence of at least two splice junctions are retained. Exon coordinates can be extracted from the mapped reads, leaving a fixed length gap in the middle of the fragment for which there is no direct alignment. Exons supported by splice junctions at both ends of the same fragment are classified by comparison with known gene annotations, and new pseudoexons can be identified as exons that overlap introns but not existing exons.

[0069] The "Sweet Spot region" is defined as the region downstream of the 5' splice site of the pseudoexon from +9 to +39, including both positions. Pseudoexons that can be activated by SSO binding to regions within the Sweet Spot region are identified by the following parameters: Pseudo-exon parameters / criteria: Pseudoexon length <160 nt, Pseudoexon length >30nt, The last 3 nt of the pseudoexon is different from TAG. the donor splice site has a MaxEnt score ≥ 4.33; the donor splice site has a MaxEnt score ≦10.06, and the acceptor splice site has a MaxEnt score ≧3.63; Parameters / criteria for the sequence region +9 to +39 downstream of the 5' splice site of the pseudoexon: Total number of pyrimidines ≤ 20, Total number of thymidine bases ≤ 12, Total number of thymidine bases ≥ 4, Total number of guanine bases ≤ 12, Maximum length of thymidine polymer ≤ 4; Maximum length of pyrimidine polymer ≦10; A minimum length of purine polymer ≥ 3, and Maximum number of guanine polymers of at least 3 nt in length ≤ 2.

[0070] In an RNA sequence, the presence of uracil may be considered equivalent to the presence of thymidine at the same position in the corresponding DNA sequence. Therefore, the presence of thymidine in a DNA sequence is also considered equivalent to uracil at the same position in the corresponding RNA sequence. Therefore, the criteria for covering sequences containing thymidine and pyrimidine are the same as the corresponding criteria for sequences containing uracil and pyrimidine when the sequence being analyzed is an RNA sequence.

[0071] Identifying sequences and generating SSOs As outlined above, the present invention relates to the identification of sequence parameters of genes containing pseudoexons, which can be used to determine whether it is possible (with high probability) to incorporate the pseudoexon into a mature mRNA using a splice-switching oligonucleotide (SSO) (see also Example 1 and corresponding figures). Thus, one aspect of the present invention is a method for identifying an SSO capable of regulating expression of a target protein in a cell by binding to a pre-mRNA in the region +9 to +39 downstream relative to the 5' splice site of said pseudoexon and promoting the incorporation of the pseudoexon into the mature mRNA, the method comprising: a) providing one or more gene sequences containing one or more identified pseudoexons; b) determining, for one or more gene sequences, whether the pseudoexon meets the following criteria: Pseudoexon length <160nt, Pseudoexon length >30nt, The last 3 nt of the pseudoexon is different from TAG. the donor splice site has a MaxEnt score ≥ 4.33; the donor splice site has a MaxEnt score ≦10.06, and the acceptor splice site has a MaxEnt score ≥ 3.63; c) determining whether, for one or more gene sequences, the sequence region +9 to +39 downstream relative to the 5' splice site of said pseudoexon (3) meets the following criteria: Total number of pyrimidines ≤ 20, Total number of thymidine bases ≤ 12, Total number of thymidine bases ≥ 4; Total number of guanine bases ≤ 12, Maximum length of thymidine polymer ≤ 4; Maximum length of pyrimidine polymer ≦10; The maximum length of the purine polymer is ≥ 3, and a maximum number of guanine polymers of at least 3 nt in length ≦2; If one or more gene sequences satisfy the criteria according to points b) and c), the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon is considered as a target for an SSO that can hybridize in vivo to pre-mRNA (2) of the gene within the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon (3), so that the pseudoexon (3) becomes part of the mature mRNA to a greater extent than the corresponding pre-mRNA that is not in contact with the SSO (1); and and optionally purifying said SSO, optionally for use as a pharmaceutical.

[0072] As outlined in Example 2, the selection parameters (criteria) involved allow to distinguish between genes that can use SSO (Table 1 in Example 2) and genes that cannot incorporate SSO into pseudoexons (Table 2 in Example 2).

[0073] In one embodiment, the invention is computer implemented (optionally excluding the optional step of generating said SSO for use as a pharmaceutical product).

[0074] In another embodiment, the one or more gene sequences containing the one or more identified pseudoexons are provided in the form of a database or other digital storage means.

[0075] In one embodiment, the one or more gene sequences containing one or more identified pseudoexons are gene sequences that include disease-causing genes, such as genes encoding dominant negative proteins characterized by increased expression of the gene or altered function of the gene.

[0076] In another embodiment, the pseudoexon is present in a gene in which a reduction in the level of a normal functional gene product would be of therapeutic benefit, such as genes associated with cancer, diabetes, inflammation, neurodegeneration or neurological disorders, tissue degeneration, tissue fibrosis and sclerosis, metabolic diseases, chronic liver diseases, and inherited retinal dystrophies (IRDs).

[0077] In yet another embodiment, the one or more genetic sequences comprising one or more identified pseudoexons are genetic sequences comprising disease-causing genes, such as genes encoding proteins that cause / enhance / affect diseases such as cancer, diabetes, inflammation, neurodegeneration or neurological disorders, tissue degeneration, tissue fibrosis and sclerosis, metabolic diseases, chronic liver diseases, and inherited retinal dystrophies (IRDs). The cause of the disease may be enhanced expression.

[0078] In yet another embodiment, the one or more gene sequences that contain one or more identified pseudoexons are not the only gene sequences known to cause a genetic disease.

[0079] In a preferred embodiment, an SSO is generated for a specified region +9 to +39 downstream relative to the 5' splice site of the pseudoexon, which region meets the criteria outlined above. Examples 3 to 10 provide specific examples of the effect of SSO on a specified target sequence.

[0080] In one embodiment, the generated SSO comprises a sequence complementary or substantially complementary within the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon (3), for example within the region +11 to +35 downstream relative to the 5' splice site. In the Examples section (Examples 2-8), an SSO complementary to positions +11 to +35 was used (25 nt in length). In Examples 9 and 10, the specific optimization of the target region of the SSO is further optimized for two genes, HIF1A and TRPM7. In Examples 3 and 13, the specific optimization of the target region of the SSO is further optimized for two genes, SMAD2 and LRRK2.

[0081] In another embodiment, the generated SSO comprises a sequence substantially complementary to the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon (3) and contains up to three mismatches, e.g., up to two mismatches, or e.g., up to one mismatch.

[0082] In one embodiment, the generated SSO comprises a sequence complementary to a region +9 to +39 downstream relative to the 5' splice site of the pseudoexon (3), such as a region +11 to +35 downstream relative to the 5' splice site. In the examples, SSOs targeting positions +1 to +35 were tested.

[0083] In one embodiment the region of complementarity is in the range of 9 to 31 nucleotides, such as 15 to 30, such as 15 to 25, or such as 9 to 15, or such as 15 to 30, such as 20 to 25. For example, if LNA or other high binding nucleotides are used, the length of the SSO may be in the shorter range.

[0084] SSOs can regulate the expression of target proteins in different ways. Thus, in one embodiment, SSOs are hybridized to pre-mRNA in vivo, resulting in: - a reduction in the level of mRNA encoding a functional protein (4) and / or - a decrease in the expression of a functional protein (6), and / or - loss of function of a functional protein (5), and / or - a new function of the functional protein (6), and / or - protein mislocalization, - Mislocalization of mRNAs encoding functional proteins occurs.

[0085] In yet another embodiment, one or more gene sequences from step a) cause a disorder or condition characterized by increased expression or altered function of a gene. In one embodiment, the disorder or condition is an autosomal dominant negative disorder.

[0086] In yet another embodiment, one or more gene sequences from step a) are therapeutically beneficial when the level of a normal functional gene product is decreased, hi one embodiment, the disorder or condition is not directly associated with a disease-causing gene.

[0087] In one embodiment, the SSO has a length in the range of 9 to 100 nucleotides, for example 9 to 50 nucleotides, preferably in the range of 9 to 40 nucleotides, more preferably in the range of 15 to 31 nucleotides or 15 to 25 nucleotides.

[0088] In one embodiment, the SSO comprises a sequence that is complementary or substantially complementary to a polynucleotide of a pre-mRNA, the length of the sequence being 9 to 31 nucleotides, such as 15 to 25 nucleotides, preferably the sequence is complementary in the range of 9 to 31 nucleotides, such as 9 to 20 nucleotides, or such as 20 to 31 nucleotides, such as 25 to 31 nucleotides.

[0089] In a preferred embodiment, the generated SSO comprises one or more artificial nucleotides, such as sugar-modified nucleotides.

[0090] In another preferred embodiment, the SSO does not mediate RNAse H-mediated degradation of mRNA in vivo.

[0091] In one embodiment, at least one modified sugar moiety is a 2'-substituted sugar moiety.

[0092] In one embodiment, the 2'-substituted sugar moiety has a 2'-substitution selected from the group consisting of 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O-methoxyethyl (2'-MOE).

[0093] In one embodiment, the 2'-substitution of at least one of said 2'-substituted sugar moieties is 2'-O-methoxyethyl (2'-MOE).

[0094] In one embodiment, at least one modified sugar moiety is a bicyclic sugar moiety.

[0095] In one embodiment, at least one bicyclic sugar moiety is a locked nucleic acid (LNA) or constrained ethyl (cEt) nucleoside.

[0096] In one embodiment, at least one sugar moiety is a sugar substitute.

[0097] In one embodiment, at least one sugar surrogate is a morpholino.

[0098] In one embodiment, at least one morpholino is a modified morpholino.

[0099] In one embodiment, the SSO comprises at least one internucleoside N3' to P5' phosphoramidate diester linkage.

[0100] In one embodiment, the modified oligonucleotide contains at least one phosphorothioate internucleoside linkage.

[0101] In one embodiment, all internucleoside linkages are phosphorothioate.

[0102] In one embodiment, the SSO is conjugated to a delivery element selected from the group consisting of Gal-Nac, (poly)unsaturated fatty acids (such as oleoyl, linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, α-tocopherol (α-TP), cholesterol, squalene (SQ), unbranched fatty acids (such as lauroyl, myristoyl, palmitoyl, stearoyl and docosanoyl), and cell penetrating peptides.

[0103] In one embodiment, the one or more genetic sequences comprising the one or more identified pseudoexons are involved in a disease or disorder selected from the group consisting of cancer, an inflammatory disease, a neurodegenerative or neurological disease, a metabolic disease, a chronic liver disease, and an inherited retinal dystrophies (IRDs).

[0104] In one embodiment, the chronic liver disease is non-alcoholic fatty liver disease.

[0105] In one embodiment, the cancer is selected from the group consisting of brain cancer, glioblastoma, lung cancer, colon cancer, skin cancer, pancreatic cancer, bladder cancer, liver cancer, breast cancer, eye cancer, and prostate cancer.

[0106] In yet another embodiment, the cancer is a hematological cancer such as selected from the group consisting of multiple myeloma, acute myeloblastic leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, and chronic lymphocytic leukemia.

[0107] As outlined in the Examples section, the inventors have identified multiple clinically relevant genes that contain pseudoexons that can be incorporated into the mature mRNA, thereby inactivating / inhibiting / altering the function of the expressed (disease-causing) protein.

[0108] Thus, in one embodiment, the SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 106 (RNF115), 1 to 26, 79 to 105, 107 to 125 and 137 to 201, or - a nucleic acid which comprises one, two or three substitutions compared to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, 137 to 201, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, 137 to 201.

[0109] In a preferred embodiment, the generated SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 79 to 100, or - a nucleic acid which comprises one, two or three substitutions when compared to any of SEQ ID NOs: 79 to 100, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 79 to 100.

[0110] In a more preferred embodiment, the generated SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 79 to 85, or - a nucleic acid which comprises one, two or three substitutions when compared with any of SEQ ID NOs: 79 to 85, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 79 to 85.

[0111] Based on the gene sequence data provided in the Examples section, one skilled in the art can easily translate this information into a specific SSO sequence, for example by using the underlined sections of the table and designing a complementary SSO thereto.

[0112] In one embodiment, the SSO is selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 127 to 136, or - a nucleic acid which comprises one, two or three substitutions compared to any of SEQ ID NOs: 127 to 136, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127 to 136.

[0113] Preferably, the nucleic acid is SEQ ID NO: 127 or 128 or 133 or 136. As shown in Examples 9 and 10, these SSOs are optimized in the Sweet Spot region. Therefore, by shifting the binding region, for example, by one or two positions, the efficiency can be surprisingly further improved. More preferably, the nucleic acid is SEQ ID NO: 128 or 136.

[0114] In another preferred embodiment, the SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO: 21 (targeting SMAD2), SEQ ID NO: 106 (targeting RNF115) and SEQ ID NOs: 141, 142, 158 and 159 (targeting LRRK2); o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 21, 106, 141, 142, 158 and 159, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 21, 106, 141, 142, 158 and 159.

[0115] Example 3 provides data regarding SMAD2 targeting (see also Example 11).

[0116] Example 12 presents data on RNF115 targeting.

[0117] Example 13 provides data regarding LRRK2 targeting, including allele-specific targeting.

[0118] In yet another preferred embodiment, the SSO is complementary or substantially complementary to a region within a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 100, 114, 118, 150 and 151; o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 100, 114, 118, 150, 151, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 100, 114, 118, 150 and 151.

[0119] In yet another preferred embodiment, the SSO is complementary or substantially complementary to a region within a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 12, 24 or 26; o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 12, 24 or 26, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 12, 24 or 26.

[0120] As outlined in the Examples section, different genes have already been targeted using the selection criteria described in the present invention (Example 2, Table 1) or have been identified as target sequences using the selection criteria described in the present invention (Example 8, Table 3, Example 11, Tables 6-7). Thus, in one embodiment, the generated SSOs are complementary or substantially complementary to the SEQ ID NOs as outlined in Tables 1, 3, 6, and 7 (Sweet Spot region).

[0121] The genes listed in Table 1 or Table 3 or Tables 6-7 may be particularly preferred in relation to certain diseases, as outlined below. Again, the sweet spots of SSO are outlined in Table 1, Table 3, and Tables 6-7. Table 2 shows pseudo-exon sequences that do not meet the criteria described in the present invention and are not functional sites of SSO.

[0122] Out of frame cancer (NMD): The following genes may be related to targets relevant for cancer therapy: TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, ORC1, TAF2, HIF1A, TRPM7, CPPS1, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB, and DBI.

[0123] Thus, in one embodiment, the generated SSO is complementary or substantially complementary to the sequence numbers outlined in Tables 1 and 3 and Tables 6-7, and the genes are selected from the group consisting of TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, ORC1, TAF2, HIF1A, TRPM7, CPPS1, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB and DBI, and is used in the treatment of cancer. In a preferred embodiment, the gene is RNF115 (see Example 12).

[0124] Cancer in Frame: The following genes may be related to targets relevant for cancer therapy: ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2 and SMC1A, DDR2, STAG2, TRPM7, LINGO2, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1 and FLT1.

[0125] Thus, in one embodiment, the generated SSO is complementary or substantially complementary to the sequence numbers outlined in Tables 1 and 3 and Tables 6-7, and the genes are selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, DDR2, STAG2, TRPM7, LINGO2, SMC1A, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1 and FLT1, and is used in the treatment of cancer.

[0126] Neurological disorders (outside the frame): The following genes may be related to targets implicated in neurological diseases: ROCK1, HTT, OGA, TMEM97, PICALM, LRRK2, UBAP2L, SMC1A, TTBK2.

[0127] Thus, in one embodiment, the generated SS is complementary or substantially complementary to the sequence numbers outlined in Tables 1, 3, and 6-7, and the gene is selected from the group consisting of ROCK1, HTT, OGA, TMEM97, PICALM, LRRK2, UBAP2L, SMC1A, and TTBK2, and is used to treat neurological disorders. In a preferred embodiment, the gene is LRRK2 (see Example 13).

[0128] In even more preferred embodiments, the neurological disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, and spinal muscular atrophy.

[0129] Neurodegeneration is the progressive loss of neuronal structure or function, including neuronal death. Many neurodegenerative diseases, including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease, and prion diseases, develop as a result of the neurodegenerative process.

[0130] Neurological disorders (in frame): The following genes may be related to targets implicated in neurological diseases: ROCK1, E2F3, SLC2A13, ASIC1, TRPM7, LINGO2, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7, and CLCN1.

[0131] Thus, in one embodiment, the generated SSO is complementary or substantially complementary to the sequence numbers outlined in Tables 1, 3, and 6-7, and the genes are selected from the group consisting of ROCK1, E2F3, SLC2A13, TRPM7, LINGO2, ASIC1, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7, and CLCN1, and is used for the treatment of a neurological disorder.

[0132] In yet a further preferred embodiment, the neurological disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, and spinal muscular atrophy.

[0133] Diabetes: The following genes may be related to targets related to diabetes: TXNRD1 (diabetes), DYRK1A (diabetes), TRPM7 (diabetes), PHLPP1 (diabetes and obesity).

[0134] Thus, in one embodiment, the generated SSO is complementary or substantially complementary to the SEQ ID NOs outlined in Tables 1 and 3 and Tables 6-7, and the gene is selected from the group consisting of TXNRD1, DYRK1A, TRPM7, and PHLPP1, and is used to treat diabetes. In a preferred embodiment, the diabetes is selected from type 1 diabetes and type 2 diabetes.

[0135] In another embodiment, the generated SSO is complementary or substantially complementary to the SEQ ID NOs outlined in Tables 1, 3, and 6-7, and the genes are selected from the group consisting of LINGO2, SMAD2, ORC1, DDR2, STAG2, TRPM7, HIF1A, HTT, TAF2, CSPP1, RN115, LRRK2, UBAB2L, LRP6, MELK, and KNTC1. All 16 of these genes contain pseudoexons that match all the criteria, and all are activated by SSOs located within the Sweet Spot region (see Tables 1, 3, and 6-7), and have high therapeutic potential.

[0136] In one embodiment, the method is computer-implemented. The invention can therefore be implemented by hardware, software, firmware or any combination of these. The invention or some of its features can also be implemented as software running on one or more data processors and / or digital signal processors.

[0137] The individual elements of the embodiments of the invention may be physically, functionally and logically implemented in any suitable way, such as in a single unit, in multiple units or as part of separate functional units The invention may be implemented in a single unit or physically and functionally distributed between different units and processors.

[0138] As mentioned above, SSO may contain one or more mismatches. The advantage of introducing such mismatches is that it allows allele-specific targeting. This may be relevant when one wants to target only one allele of a gene.

[0139] Particular SSOs that target the pre-mRNAs of the listed genes are listed in Tables 4, 5, and 8. Thus, in one embodiment, the SSO is selected from the SSOs listed in Tables 4, 5, and 8.

[0140] Compositions for use The SSOs identified by the methods of the invention can be used as pharmaceuticals for the treatment of different diseases. Accordingly, another aspect of the invention relates to a composition comprising a splice-switching oligonucleotide (SSO) complementary or substantially complementary to a target pre-mRNA (e.g., encoding a protein causing or affecting a functional disorder), the target pre-mRNA (2) comprising a function-disabling pseudoexon, - Disabling pseudoexons o A 3' splice site at the 5' end, and o 5' splice site at the 3' end, Including, the SSO is complementary or substantially complementary to the target pre-mRNA in the region +9 to +39 downstream of the 5' splice site of the pseudoexon; When this SSO hybridizes in vivo to a pre-mRNA within the region +9 to +39 downstream of the 5' splice site of the pseudoexon, the pseudoexon becomes part of the mature mRNA to a greater extent than the corresponding pre-mRNA not in contact with the SSO. Used as a medicine.

[0141] Thus, SSOs regulate the expression of target proteins by promoting the incorporation of pseudoexons into mature mRNAs. The regulation induced by the SSO may affect the target protein in different ways. Thus, in one embodiment, hybridization of the SSO to the pre-mRNA results in: - the level of mRNA encoding a functional protein is reduced, and / or - decreased expression of a functional protein, and / or - loss of function of a functional protein, and / or - a new function arises for the functional protein, and / or - protein mislocalization occurs, and / or - Mislocalization of mRNAs encoding functional proteins occurs.

[0142] In one embodiment, the composition is used to treat a human subject having a disease or condition characterized by increased expression or altered function of a functional protein that causes or affects the disorder, or in which decreased expression of a functional gene product would be therapeutically beneficial.

[0143] In one embodiment, the SSO comprises a sequence complementary or substantially complementary to a polynucleotide within a pre-mRNA characterized by the parameters described herein.

[0144] In one embodiment, the SSO comprising a sequence substantially complementary to a polynucleotide in the pre-mRNA comprises up to three mismatches, such as up to two mismatches, or up to one mismatch.

[0145] In one embodiment, the SSO comprises a sequence that is complementary to a polynucleotide within the pre-mRNA according to defined criteria.

[0146] In one embodiment, the region from +9 to +39 relative to the 5' splice site of this pseudoexon comprises a splicing control site.

[0147] In yet another embodiment, the splicing control site is an intronic splicing silencer (ISS) site.

[0148] In one embodiment, the SSO has a length in the range of 9 to 100 nucleotides, such as 9 to 50 nucleotides, preferably in the range of 9 to 40 nucleotides, more preferably in the range of 9 to 31 nucleotides or 9 to 25 nucleotides.

[0149] In one embodiment, the SSO comprises a sequence complementary or substantially complementary to a polynucleotide in a pre-mRNA as defined above, which sequence has a length in the range of 9 to 31 nucleotides, such as 9 to 20 nucleotides, preferably the sequence is complementary in the range of 9 to 31 nucleotides, such as 9 to 20 nucleotides, or for example 20 to 31 nucleotides, such as 25 to 31 nucleotides.

[0150] In one embodiment, the SSO comprises one or more artificial nucleotides, such as sugar-modified nucleotides.

[0151] In one embodiment, the oligonucleotide does not mediate RNase H mediated degradation of mRNA.

[0152] In one embodiment, at least one modified sugar moiety is a 2'-substituted sugar moiety.

[0153] In one embodiment, the 2'-substituted sugar moiety described above has a 2'-substitution selected from the group consisting of 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O-methoxyethyl (2'-MOE).

[0154] In one embodiment, the 2'-substitution of at least one of the above-mentioned 2'-substituted sugar moieties is 2'-O-methoxyethyl (2'-MOE).

[0155] In one embodiment, at least one modified sugar moiety is a bicyclic sugar moiety.

[0156] In one embodiment, at least one bicyclic sugar moiety is a locked nucleic acid (LNA) or constrained ethyl (cEt) nucleoside.

[0157] In one embodiment, at least one sugar moiety is a sugar substitute.

[0158] In one embodiment, said at least one sugar surrogate is a morpholino.

[0159] In one embodiment, the at least one morpholino is a modified morpholino.

[0160] In one embodiment, the SSO comprises at least one internucleoside N3' to P5' phosphoramidate diester linkage.

[0161] In one embodiment, the modified oligonucleotide contains at least one phosphorothioate internucleoside linkage.

[0162] In one embodiment, all internucleoside linkages are phosphorothioate.

[0163] In the Examples section, the SSOs tested were phosphorothioate RNA oligonucleotides 25 nt long with 2'-O-methyl modifications on each sugar moiety.

[0164] In one embodiment, the SSO is conjugated to a delivery element selected from the group consisting of Gal-Nac, (poly)unsaturated fatty acids (such as oleoyl, linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, α-tocopherol (α-TP), cholesterol, squalene (SQ), unbranched fatty acids (such as lauroyl, myristoyl, palmitoyl, stearoyl and docosanoyl), and cell penetrating peptides.

[0165] The composition may be used to treat certain diseases. Thus, in one embodiment, the composition is for use in the treatment or alleviation of a disease selected from the group consisting of cancer, an inflammatory disease, a neurodegenerative or neurological disease, a metabolic disease, a chronic liver disease, and an inherited retinal dystrophies (IRDs).

[0166] In one embodiment, the disease is cancer and the gene sequences are: ROCK1, TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, E2F3, LRIG2, HSPG2, SLC 2A1, KNTC1, FDFT1, SMC1A, HIF1A, CSPP1, TRPM7, DDR2, STAG2, ORC1, TAF2, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, ZNF558, PMPCB, DBI, RAP1GDS, BUD1, CD44, CDKL5, ZNF558, RBPJ, EFEMP1 and FLT1; or the disease is an inflammatory disease and the gene sequence is selected from the group consisting of DDR2, TRPM7, SMAD2, and LRP6; or the disease is a neurodegenerative or neurological disease and the gene sequence is selected from the group consisting of ROCK1, OGA, TMEM97, PICALM, E2F3, SLC2A13, ASIC1, TRPM7, LRIG2, LRRK2, UBAP2L, SMC1A, TTBK2, ATXN7, CLCN1; or - the disease is a chronic liver disease and the gene sequence is selected from the group consisting of SMAD2 and TRPM7, DDR2, HIF1A, and ROCK1, RAP1GDS1; or - the disease is diabetes and the gene sequence is selected from the group consisting of TXNRD1, DYRK1A, TRPM7 and PHLPP1.

[0167] Sweet Spot target sequences of some SSOs are provided in the Examples section (Tables 1 and 3 and Tables 6 and 7). Thus, in one embodiment, a composition for the above uses comprises an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, and 137 to 201, or o a nucleic acid comprising one, two or three substitutions compared to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, 137 to 201, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 106, 1-26, 79-105, 107-125, 137-201.

[0168] In a preferred embodiment, the composition for the above uses comprises an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 79 to 100, or - a nucleic acid which comprises one, two or three substitutions when compared to any of SEQ ID NOs: 79 to 100, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 79 to 100.

[0169] In a more preferred embodiment, the composition for the above uses comprises an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 79 to 85, or - a nucleic acid which comprises one, two or three substitutions when compared with any of SEQ ID NOs: 79 to 85, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 79 to 85.

[0170] In one embodiment, the SSO is selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 127 to 136, or - a nucleic acid which comprises one, two or three substitutions compared to any of SEQ ID NOs: 127 to 136, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127 to 136.

[0171] In yet another preferred embodiment, the SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 100, 114, 118, 150 and 151 o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 100, 114, 118, 150, 151, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 100, 114, 118, 150 and 151.

[0172] In yet another preferred embodiment, the SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 12, 24 or 26; o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 12, 24 or 26, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 12, 24 or 26.

[0173] Preferably, the SSO is SEQ ID NO: 128 or 136. As shown in Examples 9 and 10, these SSOs are optimized in the Sweet Spot region. Therefore, by shifting the binding region by, for example, one or two positions, the efficiency can be surprisingly further improved.

[0174] Compositions for other uses In yet another aspect, the present invention relates to a composition for use as a medicament, the composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 79, 1 to 26, or 80 to 125; or o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 79, or 1-26, or 80-125; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 79, or 1-26, or 80-125; or - an SSO selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 127 to 136, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 127 to 136; or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127-136.

[0175] Preferably, the SSO is SEQ ID NO: 128 or 136. As shown in Examples 9 and 10, these SSOs are optimized in the Sweet Spot region. Therefore, by shifting the binding region by, for example, one or two positions, the efficiency can be surprisingly further improved.

[0176] As shown in Examples 9 and 10, SSOs targeting TRPM7 and HIF1A have been optimized within the Sweet Spot region.

[0177] Similarly, optimization data for SMAD2 and LRRK2 are presented in Examples 3 and 13, respectively.

[0178] Thus, by shifting the binding region by one or a few positions, a surprising further increase in efficiency is achieved.

[0179] As described above and in the Examples section, different genes have already been targeted using the selection criteria described in the present invention (Tables 1 and 6) or have been identified as target sequences using the selection criteria described in the present invention (Tables 3 and 7). Thus, in one embodiment, the SSO is complementary or substantially complementary to a region in the nucleic acid to the sequences outlined in Tables 1, 3, 6, and 7 (Sweet Spot regions).

[0180] In one embodiment, the SSO is complementary or substantially complementary to the sequence numbers outlined in Tables 1 and 3, and the genes are selected from the group consisting of TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, HIF1A, CSPP1, TAF2, ORC1, THOC2, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB, and DBI, and is used in the treatment of cancer.

[0181] In another embodiment, the SSO is complementary or substantially complementary to a sequence outlined in Tables 1 and 3, 6 and 7, and the gene is selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, SMC1A, DDR2, LINGO2, TRPM7, STAG2, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1, FLT1, and is used to treat cancer.

[0182] In yet another embodiment, the SSO is complementary or substantially complementary to the sequence numbers outlined in Tables 1 and 3 and Tables 6 and 7, and the gene is selected from the group consisting of ROCK1, OGA, TMEM97, PICALM, LRRK2, UBAP2L, SMC1A and TTBK2, and is used for the treatment of a neurological disorder.

[0183] In even more preferred embodiments, the neurological disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, and spinal muscular atrophy.

[0184] Neurodegeneration is the progressive loss of neuronal structure or function, including neuronal death. Many neurodegenerative diseases, including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease, and prion diseases, develop as a result of the neurodegenerative process.

[0185] In one embodiment, the SSO is complementary or substantially complementary to a sequence number outlined in Tables 1 and 3 and Tables 6 and 7 and is selected from the group consisting of ROCK1, E2F3, SLC2A13, LINGO2, TRPM7, ASIC1, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7 and CLCN1 and is used for the treatment of a neurological disorder.

[0186] In yet a further preferred embodiment, the neurological disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease, and spinal muscular atrophy.

[0187] In one embodiment, the SSO is complementary or substantially complementary to the SEQ ID NOs outlined in Tables 1 and 3 and Tables 6 and 7, and the gene is selected from the group consisting of TXNRD1, DYRK1A, TRPM7 and PHLPP1, and is used for the treatment of diabetes. In a preferred embodiment, the diabetes is selected from type 1 diabetes and type 2 diabetes.

[0188] In another embodiment, the SSO is complementary or substantially complementary to the SEQ ID NOs outlined in Tables 1 and 3 and Tables 6 and 7, and the genes are selected from the group consisting of LINGO2, SMAD2, ORC1, DDR2, STAG2, TRPM7, HIF1A, HTT, TAF2, CSPP1, RN115, LRRK2, UBAB2L, LRP6, MELK, and KNTC1. All 16 of these genes contain pseudoexons that match all the criteria, and all are activated by SSOs located within the Sweet Spot region (see Tables 1, 3, 6-7), and have high therapeutic potential.

[0189] composition In yet another aspect, the present invention provides a method for producing a composition comprising: - a composition comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125, and 137 to 201, or o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 106, 1 to 26, 79 to 105, 107 to 125 and 137 to 201; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 106, 1-26, 79-105, 107-125, and 137-201; or - a composition comprising an SSO selected from the group consisting of: - a nucleic acid according to any one of SEQ ID NOs: 127 to 136 and 202 to 216, or - a nucleic acid comprising one, two or three substitutions when compared with any of SEQ ID NOs: 127 to 136 and SEQ ID NOs: 202 to 216, or - a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 127 to 136 and SEQ ID NOs: 202 to 216.

[0190] In one aspect, the SSO is selected from the group of SSOs listed in Table 4 (see Example 9), Table 5 (see Example 10), and Table 8 (see Example 11).

[0191] The composition may be used, for example, as a medicament as outlined above, for the treatment of a range of diseases as outlined above.

[0192] In another aspect, the present invention relates to a composition comprising a splice-switching oligonucleotide (SSO), the composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 217 to 294; o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 217-294; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 217-294; or - an SSO selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 295 to 367, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 295 to 367; or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 295-367.

[0193] Allele-specific targeting – Sweet Spot region SNPs By using the method described in the present invention, the inventors identified a SNP within the Sweet Spot region of LRRK2 pre-mRNA (see also Example 13).

[0194] By carefully designing the SSO, it is conceivable that such allele-specific SSOs could be used to preferentially target disease-causing pre-mRNAs (those from disease-causing alleles), while pre-mRNAs from "normal" alleles are unaffected (or less affected).

[0195] By using such methods, it is possible to maintain normal RNA levels and normal gene function.

[0196] As seen in Example 13, SEQ ID NOs: 141 and 142 target one SNP-specific allele, and SEQ ID NOs: 158 and 159 target another SNP-specific allele.

[0197] Thus, in one embodiment, a composition described herein is administered to a subject who is heterozygous in the pre-mRNA region targeted by the SSO, such that the SSO has increased binding affinity to the pre-mRNA of one of the alleles, e.g., increasing splice switching activity in said allele.

[0198] In another embodiment, the pre-mRNA encodes LRRK2.

[0199] In yet another embodiment, the pre-mRNA encodes LRRK2 and the subject is heterozygous at position rs17444202.

[0200] In yet another embodiment, the pre-mRNA encodes LRRK2 and the subject is heterozygous for a disease causing a mutation in LRRK2.

[0201] In yet another embodiment, the SSO is complementary or substantially complementary to a region within a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 141, 142, 158 and 159, or o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NOs: 141, 142, 158 and 159, or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 141, 142, 158 and 159; or - the SSO is selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 208 to 216, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 208 to 216; or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 208-216.

[0202] In one embodiment, the SSO promotes the inclusion of pseudoexons in the disease-causing allele to a greater extent than other alleles, or may result in a greater presence of normal mRNA, and thus increases the binding affinity of the SSO to the pre-mRNA of the disease-causing allele.

[0203] A further aspect of the invention relates to a method for identifying a subject who may be eligible for allele-specific targeting of a dysfunctional LRRK2 allele, the method comprising: - determining the allelic status of LRRK2 in a DNA sample from the subject, If the subject is heterozygous for rs17444202, then the subject is eligible for allele-specific treatment according to the present invention; or If the subject is not heterozygous for rs17444202, the subject is not eligible for allele-specific treatment according to the present invention.

[0204] As outlined further below, a subject may be homozygous for a SNP, in which case both alleles may contain the SNP, facilitating inclusion of a pseudoexon, which may be less desirable but may be a better option if no treatment is an option.

[0205] Allelic status can be determined by Sanger sequencing or next generation sequencing (NGS) or mutation-specific assays such as ARMS or Taq-man.

[0206] Allele-specific targeting – splice site SNPs The inventors have identified a wide range of SNPs present at splice sites of pseudoexons. If the SNP is present in one or both alleles, then a subject carrying such a SNP may be eligible for allele-specific SSO treatment (if the subject contains the SNP only in the allele carrying the disease-causing gene) or if the subject is homozygous for the SNP and therefore carries the SNP in both alleles. In other words, the inventors have identified SNPs that increase the MaxEnt score of the splice site, thereby allowing (or improving) the inclusion of the pseudoexon when treated with the corresponding SSO targeting this pseudoexon. See also Examples 15-16. Thus, one aspect of the present invention relates to a composition comprising a splice-switching oligonucleotide (SSO) for use as a medicament, the composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 217 to 294; o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 217-294; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 217-294; or - an SSO selected from the group consisting of: o a nucleic acid according to any one of SEQ ID NOs: 295 to 367, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 295 to 367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 295-367; the SSO is complementary or substantially complementary to a target pre-mRNA, the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o A 3' splice site at the 5' end, and o 5' splice site at the 3' end Including, This SSO is complementary or substantially complementary to the target pre-RNA in the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon described above.

[0207] As shown in Example 16, a wide range of SNPs have been identified that enable SSO-based pseudoexon inclusion therapy.

[0208] In one embodiment, the SSO is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid according to any of SEQ ID NOs: 217; o a nucleic acid comprising one or two or three substitutions when compared to any of SEQ ID NO: 217, or o A nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO: 217.

[0209] Example 15 shows that SSO targeting SEQ ID NO:217 can directly include a pseudo-exon into the mature mRNA if a specific SNP is present.

[0210] In one embodiment, the composition is used to treat a human subject having a disease or condition characterized by increased expression or altered function of a functional protein that causes or affects the disorder, or in which decreased expression of a functional gene product would be therapeutically beneficial.

[0211] In another embodiment, the SSO described above comprises a sequence substantially complementary to a polynucleotide in the pre-mRNA and comprises up to three mismatches, such as up to two mismatches, or, for example, up to one mismatch.

[0212] In a further embodiment, said SSO has a length in the range of 9 to 100 nucleotides, such as 9 to 50 nucleotides, preferably in the range of 9 to 40 nucleotides, more preferably in the range of 9 to 31 nucleotides or 9 to 25 nucleotides.

[0213] In yet another embodiment, the above-mentioned SSO comprises a sequence complementary or substantially complementary to a polynucleotide within the pre-mRNA as defined above, the length of said sequence being between 9 and 31 nucleotides, such as between 9 and 20 nucleotides, preferably the sequence is complementary in the range of between 9 and 31 nucleotides, such as between 9 and 20 nucleotides, or between 20 and 31 nucleotides, such as between 25 and 31 nucleotides.

[0214] In one embodiment, the SSO described above comprises one or more artificial nucleotides, such as sugar-modified nucleotides.

[0215] In one embodiment, the oligonucleotide does not mediate RNase H mediated degradation of mRNA.

[0216] In one embodiment, at least one modified sugar moiety is a 2'-substituted sugar moiety.

[0217] In one embodiment, the 2'-substituted sugar moiety described above has a 2'-substitution selected from the group consisting of 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O-methoxyethyl (2'-MOE).

[0218] In one embodiment, the composition is used to treat or alleviate a disease selected from the group consisting of cancer, an inflammatory disease, a neurodegenerative or neurological disease, a metabolic disease, a chronic liver disease, and an inherited retinal dystrophy (IRD).

[0219] As shown in Example 15, the presence of a SNP can cause the SSO to promote inclusion of a function-neutralizing pseudoexon to a greater extent in the disease-causing allele compared to other alleles. Thus, in one embodiment, the composition is administered to a subject who is heterozygous for a sequence variation (SNP) in the pre-mRNA targeted by the SSO, whereby the SSO promotes inclusion of a function-neutralizing pseudoexon to a greater extent in the disease-causing allele compared to other alleles.

[0220] The subject may be homozygous. In such a case, both the "healthy gene" and the disease gene are subject to the inclusion of the pseudoexon. Of course, the subject may carry two disease genes, one in each allele. Thus, in one embodiment, the composition is administered to a subject who is homozygous for a SNP mutation (SNP) in the pre-mRNA targeted by the SSO.

[0221] In one embodiment, the subject is heterozygous for a sequence variation (SNP) at the 5' splice site and / or the 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site.

[0222] In one embodiment, the SNP is a point mutation, eg, an insertion of 1-20 nucleotides at the SNP position, or, eg, a deletion of 1-20 nucleotides at the SNP position.

[0223] In one embodiment the insertion is from 1 to 10 nucleotides, such as from 1 to 5 nucleotides, such as from 2 to 4 nucleotides or from 2 to 3 nucleotides, in another embodiment the deletion is from 1 to 10 nucleotides, such as from 1 to 5 nucleotides, such as from 2 to 4 nucleotides or from 2 to 3 nucleotides.

[0224] In another embodiment, the SNP is located at a (23mer) 3' splice site (-20 to +3 nt of the intron-exon boundary) or a (9mer) 5' splice site (-3 to +6 nt of the exon-intron boundary).

[0225] In yet another embodiment, heterozygosity of a disease-causing gene, when contacted with an SSO, increases the inclusion of pseudoexons into mature mRNA from one allele to a greater extent than the corresponding (normally functioning) gene on the other allele.

[0226] In another embodiment, heterozygosity of a disease-causing gene increases the MaxEnt score of the splice site of the pseudoexon of the disease-causing gene compared to the corresponding (normally functioning) gene on the other allele. As outlined above, the MaxEnt score is a defined number calculated by a specific algorithm.

[0227] In a related embodiment, heterozygosity for a disease-causing gene results in a higher MaxEnt score for the splice site of a pseudoexon in the disease-causing gene compared to the corresponding (normally functioning) gene on the other allele.

[0228] In yet another embodiment, the splice site of a pseudoexon in an allele of a disease-causing gene has a higher MaxEnt score compared to the corresponding splice site of the (normally functioning) gene on the other allele.

[0229] There is a database that uniquely identifies SNPs by ID. Thus, in one embodiment, the subject has a SNP on a disease-causing allele selected from the group of SNP IDs listed in Table 9. Also, the SNP may be present on both alleles. Thus, in one embodiment, the subject carries a SNP on both alleles selected from the group of SNP IDs listed in Table 9.

[0230] In a more particular embodiment, the subject carries a SNP within a disease-causing allele selected from the group of SNPs set forth in Table 9, and the SSO targets the corresponding Sweet Spot Seq set forth in Table 9.

[0231] In one embodiment, the corresponding SSO is selected from Table 10.

[0232] In one embodiment, the pre-mRNA encodes LRRK2. See also Examples 15 and 16.

[0233] In yet another embodiment, the pre-mRNA encodes LRRK2 and the subject has a high MaxEnt score "G allele" of SNP rs10878372 in a disease-causing LRRK2 allele.

[0234] In one embodiment, the pre-mRNA encodes LRRK2 and the subject is heterozygous for a disease-causing mutation in LRRK2.

[0235] It is understood that the targeted pseudoexon may be located in a gene located on the X or Y chromosome, in which case the male subject cannot be considered to be either heterozygous or homozygous since he or she only contains a single X and Y chromosome, however, such subjects can still be treated according to the present invention.

[0236] As outlined throughout this application, the present invention also relates to compositions, such as pharmaceutical compositions, comprising an SSO according to the present invention.

[0237] Methods for identifying subjects eligible for allele-specific SSO-based pseudoexon inclusion therapy The present invention can also be used to identify subjects who are eligible for allele-specific SSO-based pseudoexon inclusion therapy. Thus, one aspect of the present invention relates to a method for identifying subjects who may be eligible for allele-specific SSO-based pseudoexon inclusion therapy of a dysfunctional or disease-causing gene, the method comprising: - determining in a biological sample from the subject the presence or absence of heterozygosity at a pseudoexon of the dysfunctional or disease-causing gene; If the subject is heterozygous for a sequence variation (SNP) at the 5' splice site and / or 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site, the subject may be eligible for allele-specific SSO-based pseudoexon inclusion therapy; or If the subject is not heterozygous for the 5' splice site and / or 3' splice site sequence variants (SNPs) of the function-neutralizing pseudoexon, the subject may not be eligible for allele-specific SSO-based pseudoexon inclusion therapy; The SSO is complementary or substantially complementary to a target pre-mRNA of a dysfunctional or disease-causing gene, the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o A 3' splice site at the 5' end, and o 5' splice site at the 3' end Includes.

[0238] As outlined in Examples 15 and 16, in certain cases, SSO will only work if the subject carries the SNP, for example according to Table 9.

[0239] In one embodiment, as a result of the allele-specific SSO-based pseudo-exon inclusion process described above, the SSO hybridizes to a pre-mRNA in vivo, and this pseudo-exon of the dysfunctional or disease-causing gene becomes part of the mature mRNA to a greater extent than the corresponding pre-mRNA not contacted by the SSO.

[0240] In another embodiment, the allele-specific SSO-based pseudoexon inclusion process described above results in the SSO hybridizing to a pre-mRNA in vivo, and the pseudoexon becoming part of the mature mRNA to a greater extent in alleles harboring dysfunctional or disease-causing genes compared to corresponding pre-mRNAs not contacted by the SSO.

[0241] In yet another embodiment, heterozygosity for a sequence variant (SNP) at the 5' splice site and / or 3' splice site of the pseudoexon in the pre-mRNA targeted by the SSO promotes inclusion of the function-neutralizing pseudoexon to a greater extent on the disease-causing allele compared to the other allele when contacted with the SSO.

[0242] In one embodiment, the heterozygosity of the sequence variation (SNP) is at the 5' splice site and / or the 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site.

[0243] In one embodiment, the heterozygosity of a sequence variation (SNP) in a disease-causing gene is a point mutation (SNP), an insertion of 1 to 20 nucleotides, or a deletion of 1 to 20 nucleotides, preferably a point mutation.

[0244] In one embodiment, the disease-causing gene, when contacted with an SSO, exhibits a greater increase in inclusion of pseudoexons than the corresponding (normally functioning) gene on the other allele.

[0245] In one embodiment, heterozygosity for a sequence variant (SNP) in a disease-causing gene increases the MaxEnt score of the splice site compared to the corresponding splice site of the (normally functioning) gene on the other allele.

[0246] In one embodiment, heterozygosity for a sequence variant (SNP) in a disease-causing gene results in a higher MaxEnt score for the splice site compared to the corresponding splice site of the (normally functioning) gene on the other allele.

[0247] In one embodiment, heterozygosity for a sequence variant (SNP) in a disease-causing gene is at a splice site of a pseudoexon in the disease-causing gene, resulting in a higher MaxEnt score compared to the corresponding splice site of the (normally functioning) gene on the other allele.

[0248] In one embodiment, where the SSO described above hybridizes to pre-mRNA in vivo, the allele-specific SSO-based pseudoexon inclusion therapy includes therapy using an SSO that hybridizes in vivo to pre-mRNA of an allele that carries a disease-causing allele to a greater extent compared to an allele that does not carry the disease-causing allele.

[0249] In one embodiment, said SSO is complementary or substantially complementary to the target pre-RNA in the region +9 to +39 downstream relative to the 5' splice site of said pseudoexon.

[0250] In one embodiment, the target sequence of the above-mentioned SSO is located in a gene selected from the group consisting of LRRK2, LMN1B, and ATXN2.

[0251] In one embodiment, the subject carries a SNP in a disease-causing allele selected from the group of SNP IDs set forth in Table 9.

[0252] In one embodiment, the subject carries a SNP in both alleles selected from the group of SNP IDs set forth in Table 9.

[0253] In one embodiment, the allelic status is determined by a method selected from the group consisting of Sanger sequencing, next generation sequencing (NGS), etc., and mutation-specific assays such as ARMS and Taq-man. The skilled artisan may find other suitable methods for determining the allelic status.

[0254] As noted above, the subject may be homozygous or heterozygous for the SNP (or the SNP may be linked to the X or Y chromosome). Thus, yet another aspect of the invention relates to a method of identifying subjects who may be eligible for SSO-based pseudoexon inclusion therapy of a dysfunctional or disease-causing gene, comprising: - determining in a biological sample from the subject the presence or absence of a SNP in a pseudoexon of a dysfunctional or disease-causing gene that enables SSO-based pseudoexon inclusion therapy; If the subject has a sequence variation (SNP) at the 5' splice site and / or the 3' splice site of the function-neutralizing pseudoexon, preferably at the 5' splice site, the subject may be eligible for SSO-based pseudoexon inclusion therapy; or If the subject does not have a sequence variant (SNP) at the 5' splice site and / or 3' splice site of the functionally-neutralizing pseudoexon, the subject may not be eligible for SSO-based pseudoexon inclusion therapy; The SSO is complementary or substantially complementary to a target pre-mRNA of a dysfunctional or disease-causing gene, the target pre-mRNA containing a function-disabling pseudoexon; - Disabling pseudoexons o A 3' splice site at the 5' end, and o 5' splice site at the 3' end Includes.

[0255] In one embodiment, the subject is either heterozygous for the SNP, or homozygous for the SNP, or the SNP is associated with the X or Y chromosome, preferably heterozygous.

[0256] Computer implementation In one aspect, the present invention relates to a computer program product adapted to enable a computer system comprising at least one computer having connected data storage means to control a method according to one or more aspects of the present invention, e.g. a computer program product comprising instructions which, when executed by a computer, cause the computer to carry out the steps of the method of the present invention.

[0257] This aspect of the invention is particularly, but not exclusively, advantageous in that the invention may be embodied by a computer program product which, when downloaded or uploaded into a computer system, enables the computer system to carry out the operations of the apparatus / system aspects of the invention. Such a computer program product may be provided on any type of computer readable medium or over a network.

[0258] Each individual aspect of the invention can be combined with any of the other aspects and embodiments. These and other aspects of the invention will become apparent from the following description with reference to the described embodiments.

[0259] Although the present invention has been described with reference to certain embodiments, it should not be construed as being limited to the examples presented. The scope of the present invention should be interpreted in the light of the appended claims. In the context of the claims, the term "comprises" or "comprises" does not exclude other possible elements or steps. Furthermore, references such as "a" or "an" should not be interpreted as excluding a plural form. The use of reference signs in the claims for elements shown in the figures should also not be interpreted as limiting the scope of the present invention. Moreover, individual features recited in different claims may be combined to advantage, and the fact that these features are recited in different claims does not exclude that a combination of features is not possible or advantageous.

[0260] All patent and non-patent literature cited in this application is hereby incorporated by reference in its entirety.

[0261] The invention is further illustrated by the following non-limiting examples. EXAMPLES

[0262] Example 1 - General Description of the Invention The figures and corresponding figure legends outline the basic principles of the invention. Pseudoexons are intronic sequences flanked by 3' and 5' splice sites. Pseudoexons are not usually recognized because they are usually low in abundance in mRNA transcripts and because mRNAs containing pseudoexons are often degraded by nonsense-mediated mRNA decay (NMD). Sweet Spot regions are defined as the region from +9 to +39 nucleotides downstream of the 5' splice site of a pseudoexon according to the criteria described in this application (see, for example, Example 2). By using SSOs complementary to the Sweet Spot region of pseudoexons that meet the criteria, the inclusion of pseudoexons in mRNA transcripts can be activated and increased. Inclusion of pseudoexons in mRNAs regulates gene expression at either the mRNA or protein level by mislocalization, destabilization and degradation, or alteration of protein function. 5'ss; 5' splice site, 3'ss; 3' splice site, SSO; splice shifting oligonucleotide.

[0263] Figure 2 shows how RNA sequencing data can be used to detect spliced ​​double junctions in vivo to empirically detect pseudoexons contained in endogenous transcripts at low levels.

[0264] After mapping to the human genome, the reads are filtered to retain only fragments that contain at least two splice junctions. The splice junctions across the fragments are then assembled into exon structures, leaving unmapped gaps between the reads within fragments of up to 100 bp. Exons are then classified using known exon annotations to identify pseudoexons contained within introns. Pseudoexons that may be candidates for activation by SSOs that bind to Sweet Spot regions can be identified by the criteria described in the present invention, and then highly therapeutically relevant pseudoexons can be identified in genes where downregulation or modification of the expression of functional gene products is medically relevant. SSOs can then be generated using standard synthetic methods.

[0265] Example 2 - Identifying Selection Parameters for SSO Research Objective Directly targeting specific genes as part of inhibiting disease-related disease-causing mRNAs or proteins. By activating pseudoexons within a target gene of interest, the resulting mRNA product is either degraded via the NMD pathway, mislocalized, destabilized, or translated into a protein that is nonfunctional or has an unstable, mislocalized, or altered function. We aimed to include pseudoexons in the mRNA transcript of a target gene using splice-switching antisense oligonucleotides (SSOs). This strategy is superior to existing therapies that target multiple proteins because the risk of off-target effects is minimized when using sequence-specific SSOs modified to increase stability and binding specificity to target sequences within the primary RNA transcript. We therefore aimed to identify pseudoexons that can be activated so that they are spliced ​​into mRNA by using SSOs that bind to the +9 to +39 region (called the Sweet Spot region) downstream of the pseudoexon donor site (5' splice site) and to establish criteria to distinguish these pseudoexons from inactive pseudoexons.

[0266] Materials and Methods We used publicly available RNA sequencing data (Geuvadis, E-MTAB-2836, E-MTAB-513, GSE52946 and GSE124439) and mapped them with STAR after trimming adapter contamination and low-quality bases with bbduk. HeLa cells were seeded in 12-well plates and forward transfected at 60% confluence with 20 or 40 nM 2'-O-methyl SSO with a fully phosphorothioate backbone using Lipofectamine RNAiMAX (Invitrogen). Non-binding ctrl SSO (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO: 126) was used as a control. After 48 hours, RNA was isolated using Trizol (Invitrogen) and chloroform, followed by precipitation with isopropanol. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using a high-capacity cDNA kit (Applied Biosystems). Primers were designed to cover at least one inter-exon junction of adjacent exons flanking the pseudoexon of interest. PCR was performed using TEMPase Hot Start DNA polymerase (Amplicon) and 1 μl of cDNA per reaction. Each primer was used at 0.5 pmol / μl. PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel at 80 V for 1 h.

[0267] The sweet spot region is located at +9 to +39 of the 5' splice site of the pseudoexon.

[0268] All SSOs were 25-nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modifications on each sugar moiety (LGC Biosearch Technologies). SSOs were used targeting positions +11 to +35 (relative to the 5' splice site of the pseudoexon) within the Sweet Spot region of the gene. Thus, the SSOs bind within the Sweet Spot.

[0269] result To identify pseudoexons across multiple tissues, we collected public RNA sequencing data representing many different cell types. After mapping to the human genome, we filtered for all reads for fragments containing at least two splice junctions. We then mapped splice junctions across the entire fragment, allowing for unmapped gaps between reads within the fragment of up to 100 bp. From this, we compiled a non-degenerate list of fully spliced ​​exons, from which we extracted unknown exons contained within introns. By using this double-junction approach, we were able to identify fully spliced ​​pseudoexons, even when expressed at very low levels. We tested 78 SSOs targeting Sweet Spot regions +11 to +35 downstream of randomly selected pseudoexons identified in the RNA sequencing data. Twenty-six of these SSOs were able to increase the inclusion of pseudoexons in the mRNA transcripts of the target genes (Table 1 below), while the remaining 52 SSOs had no effect on the inclusion of pseudoexons (Table 2 below).

[0270] [Table 1A]

[0271] [Table 1B]

[0272] [Table 2A]

[0273] [Table 2B]

[0274] [Table 2C]

[0275] [Table 2D]

[0276] Based on these results, we established a set of criteria that must be met for pseudoexons to be included by SSO targeting the Sweet Spot region. Using these criteria, we selected new targets for pseudoexon inclusion in disease-causing genes if the inclusion of the pseudoexon has high potential for therapeutic use in human diseases.

[0277] standard: For pseudoexons: Pseudoexon length <160nt, Pseudoexon length >30nt, The last 3 nt of the pseudoexon is different from TAG. the donor splice site has a MaxEnt score ≥ 4.33; the donor splice site has a MaxEnt score ≦10.06, and The acceptor splice site has a MaxEnt score ≧3.63.

[0278] In the case of +9 to +39 of the gene sequence downstream of the 5' splice site of the pseudoexon (3) mentioned above Total number of pyrimidines ≤ 20, Total number of thymidine bases ≤ 12, Total number of thymidine bases ≥ 4; Total number of guanine bases ≤ 12, Maximum length of thymidine polymer ≤ 4; Maximum length of pyrimidine polymer ≦10; A minimum length of purine polymer ≥ 3, and Maximum number of guanine polymers at least 3 nt long ≤ 2.

[0279] conclusion Pseudoexons within target genes of interest can be activated as a mechanism for downregulation of disease-causing proteins. By screening pseudoexons based on the criteria we established, new target candidates can be selected, enabling the discovery of new therapeutic agents.

[0280] Example 3 - SMAD2 Research Objective Chronic liver disease is characterized by hepatic inflammation and fibrosis. We aimed to investigate the presence of pseudoexons in the TGF-β / Smad signaling pathway ( Inagaki et al., 2007 ), which is important for tissue fibrosis, through in silico analysis and in vivo experiments.

[0281] Materials and Methods We used a novel double-junction approach to identify fragments with fully spliced ​​pseudoexons in publicly available RNA-seq data from the GEUVADIS consortium. HeLa, LX-2, and HepG2 cells were seeded in 12-well plates and forward transfected at 60% confluence with 40 nM SSO using Lipofectamine RNAiMAX (Invitrogen). The SSO (targeting SEQ ID NO: 21, the specific targeting sequence is underlined in SEQ ID NO: 21 in Table 1) was a 25 nt long phosphorothioate RNA oligonucleotide with 2'-O-methyl modifications at each sugar moiety (LGC Biosearch Technologies). (See also the table in Example 2). The SSO is complementary to positions +11 to +35 (relative to the 5' splice site of the pseudoexon) within the Sweet Spot region of the SMAD2 gene (SEQ ID NO: 21). Thus, the SSO binds within the Sweet Spot. To determine the optimal SSO targeting the Sweet Spot region, several SSOs were tested using 25 nt long SSOs (sequence numbers 202 to 207 listed in Table 8 of Example 11) targeting the Sweet Spot region from positions +9 to +14 downstream of the 5'ss of PE.

[0282] A non-binding SSO with similar modifications (5'-GCUCAAUAUGCUACUGCCAUGCUUG-3') (SEQ ID NO: 126) was used as a negative control. For TGFβ stimulation experiments, cells were stimulated with 10 ng / ml TGFβ (R&D systems) for 16 h before harvesting RNA and protein. After 48 h, RNA was isolated using Trizol (Invitrogen) and chloroform, then precipitated with isopropanol. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using a high capacity cDNA kit (Applied Biosystems). Primers were designed to cover at least one inter-exon junction of adjacent exons flanking the pseudoexon of interest. PCR was performed using TEMPase Hot Start DNA polymerase (Amplicon) and 1 μl of cDNA per reaction. 0.5 pmol / μl of each primer was used. PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel for 1 h at 80 V. To preserve phosphorylated proteins, proteins were extracted by lysing cells with okadaic acid, benzonase treated, denatured proteins were separated on 4-12% NuPage SDS-Page gels and analyzed by Western blotting using antibodies against SMAD2, phospho-SMAD2 and actin as controls. To study myofibroblast formation, LX-2 cells were grown in 96-well plates transfected with 20 nM SSO and incubated in an IncuCyte instrument to capture images every 4 h. Images were analyzed with ImageJ by creating a mask of spheroid (differentiated) cells.

[0283] result By examining fragments with a completely spliced ​​pseudoexon, we identified a pseudoexon located within intron 5 of the SMAD2 gene, encoding the signaling protein Mothers against decapentaplegic homolog2, involved in the TGF-β / Smad pathway. Inclusion of the pseudoexon in the mature mRNA results in a frameshift, inserting 46 nt into the coding region. A stop codon (UAA) is also located within the pseudoexon, which may activate the NMD pathway and lead to transcript degradation.

[0284] Transfection of SSOs (SEQ ID NOs: 202-207 listed in Example 11, Table 8) all mediated inclusion of the pseudoexon, with SSO targeting from +11 and +12 showing optimal mediation of pseudoexon inclusion into the SMAD2 transcript (results not shown).

[0285] Transfection of HeLa cells with an SSO complementary to positions +11 to +35 downstream of the 5' splice site resulted in up to 90% inclusion of the pseudoexon (Figure 8A). Transfection of the same SSO into LX-2 hepatic stellate cells resulted in even higher inclusion of the pseudoexon at lower concentrations of SSO (Figure 8B). Protein levels in HepG2 cells showed a significant decrease in SMAD2 protein and, under TGFβ stimulation, a decrease in phosphorylated SMAD2 (Figure 8C). TGFβ stimulation of LX-2 cells led to differentiation of the cells into myofibroblasts, and transfection of the +11 SSO reduced this differentiation (Figure 8D).

[0286] conclusion Using specific SSOs, the normal function of the SMAD2 gene can be reduced by up to 90%, increasing the inclusion of pseudoexons and disrupting the function of the normal gene product by transcript degradation or expression of a truncated non-functional protein. This is associated with liver fibrosis and other diseases associated with increased TGF-β activity, of which SMAD2 is a positive regulator (Sysa et al., 2009). Furthermore, downregulation of SMAD2 can reduce glioma growth (Papachristodoulou et al., 2019). Inagaki Y et al. Gut.2007 Feb;56(2):284-92.doi:10.1136 / gut.2005.088690 Sysa P et al., 2009 Sep;28(9):425-34.doi:10.1089 / dna.2009.0884 Papachristodoulou A et al., Clin Cancer Res.2019 Dec 1;25(23):7189-7201.doi:10.1158 / 1078-0432.CCR-17-3024

[0287] Example 4 - ORC1 Research Objective Origin recognition complex (ORC) genes are involved in DNA replication and are highly expressed in hepatocellular carcinoma tumors (Wang et al., 2020). Low ORC1 expression consistently shows better prognosis compared with high ORC1 expression (Wang et al., 2020), while knockdown of ORC1 sensitizes cancer cells and makes them vulnerable to other anti-cancer treatments (Zimmerman et al., 2013). We aimed to investigate the presence of pseudoexons in the ORC1 gene that could be used to downregulate the expression of ORC1 gene through in silico analysis and in vivo experiments.

[0288] Materials and Methods We used a novel double-junction approach to identify fragments with fully spliced ​​pseudoexons in publicly available RNA-seq data from the GEUVADIS consortium. HeLa cells were seeded in 12-well plates and forward transfected at 60% confluence with 40 nM SSO using Lipofectamine RNAiMAX (Invitrogen).

[0289] The SSO (targeting SEQ ID NO: 18, the specific target sequence is underlined in SEQ ID NO: 18 in Table 1) was a 25 nt long phosphorothioate RNA oligonucleotide (LGC Biosearch Technologies) with 2'-O-methyl modifications on each sugar moiety. (See also Table in Example 2). The SSO is complementary to positions +11 to +35 (relative to the 5' splice site of the pseudoexon) within the Sweet Spot region of the ORC1 gene. Thus, the SSO binds within the Sweet Spot.

[0290] A non-binding SSO with a similar modification (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO: 126) was used as a negative control. After 48 hours, RNA was isolated using Trizol (Invitrogen) and chloroform, then precipitated with isopropanol. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using a high capacity cDNA kit (Applied Biosystems). Primers were designed to cover at least one inter-exon junction of adjacent exons flanking the pseudoexon of interest. PCR was performed using TEMPase Hot Start DNA polymerase (Amplicon) and 1 μl of cDNA per reaction. Each primer was used at 0.5 pmol / μl. PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel at 80 V for 1 hour.

[0291] result To examine fragments with fully spliced ​​pseudoexons, we used a double-splicing approach and identified a pseudoexon within intron 5 of the ORC1 gene, resulting in a 62-nt insertion and frameshift in the pre-mRNA. Transfection of HeLa cells with an SSO complementary to positions +11 to +35 downstream of the 5′ splice site resulted in up to 45% more pseudoexons (data not shown).

[0292] conclusion Normal expression of the ORC1 gene product can be reduced by up to 45% using certain SSOs, leading to increased inclusion of pseudoexons that disrupt the function of the normal gene product. Thus, SSO-mediated downregulation of ORC1 expression may serve to enhance the anticancer effects of other drugs. Wang XK et al., J Cancer.2020 Jan 20;11(7):1869-1882.doi:10.7150 / jca.39163 Zimmerman, KM et al. Mol Cancer Res, 2013.11(4):p.370-80.

[0293] Example 5 -LINGO2 Research Objective LINGO2 (leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 2) is highly expressed in many tissues, including intestinal tissue, brain, and neurons (such as cortical neurons and dorsal root ganglion (DRG) neurons) (Guillemain et al., 2020). LINGO2 expression is increased in gastric cancer, which is associated with poor prognosis, and downregulation of LINGO2 reduces gastric cancer cell proliferation (Jo et al., 2019). LINGO2 also negatively regulates motor neuron survival and motor neuron axon length.

[0294] This suggests that knocking down or altering LINGO2 expression may be a novel therapeutic approach for treating neurological disorders and cancer.

[0295] Materials and Methods: To analyze the publicly available RNA-seq data, we used the analysis pipeline (Figure 2). HeLa cells were cultured in RPMI and transfected with 20 nM SSO using Lipofectamine. After 24 h, cells were harvested and RNA was purified. RT-PCR was performed and the resulting products were visualized on a 2% agarose gel. For IncuCyte experiments, U251 cells were grown in 96-well plates transfected with 5, 10, 20 or 40 nM SSO, incubated in the IncuCyte instrument and images were taken every 4 h.

[0296] result: Based on the high expression of LINGO2 in neurons and brain, we speculated that SSO-based activation of PE could be used to treat glioblastoma. By using an SSO targeting the Sweet Spot region described in SEQ ID NO:15 (the specific target sequence is underlined in SEQ ID NO:15 in Table 1), we demonstrated high levels of inclusion of the hr9:28370208-28370262(-) LINGO2 pseudoexon into U251 glioblastoma cells (Figure 3A). This pseudoexon introduces 55 bp between exons 3 and 4 of the pseudoexon mRNA. We investigated U251 glioblastoma cells with this SSO and observed a dose-dependent decrease in the growth and proliferation of U251 glioblastoma cells resulting from SSO treatment (Figure 3B).

[0297] conclusion Thus, provided herein are methods of treating cancer, such as gastric cancer or glioblastoma, or promoting motor neuron survival and motor neuron axon growth by contacting human cells, such as cancer cells or neuronal cells, with an SSO that causes a pseudoexon to be included in the LINGO2 mRNA.

[0298] Example 6 -TAF2 Research Objective The TAF2 gene expresses Tata-box binding protein-associated factor 2, a subunit of the transcription factor II D complex that is involved in binding to promoter sequences and initiating transcription (Martinez et al., 1998). TAF2 shows copy number gain or mRNA overexpression in 73% of high-grade serous ovarian cancers (HGSC) (Ribeiro et al., 2014) and is important in cancer.

[0299] Materials and Methods: The analysis pipeline (Figure 2) was used to analyze the publicly available RNA-seq data. NCI-H358 lung cancer cells were cultured in RPMI and transfected with 20 nM SSO using lipofectamine. After 24 h, cells were harvested and RNA was purified. RT-PCR was performed and the resulting products were visualized on a 2% agarose gel. WST-1 assays were performed 48 h post-transfection. For IncuCyte experiments, NCI-H358 lung cancer cells were grown in 96-well plates transfected with 10 nM SSO, incubated in the IncuCyte instrument, and images were taken every 4 h.

[0300] result: Inclusion of the chr8:119779073-119779146(-) TAF2 pseudoexon introduces 73 bp between exons 17 and 18 of the mRNA, generating a shifted reading frame with a premature stop codon in exon 18. TAF2 mRNA transcripts containing this pseudoexon are targets of nonsense-mediated mRNA decay (NMD), and increased inclusion of the pseudoexon induced by SSO treatment reduces TAF2 mRNA expression. Furthermore, translation of the pseudoexon-containing transcript produces a severely truncated protein that lacks normal TAF2 function.

[0301] By using an SSO targeting the TAF2 Sweet Spot region as set forth in SEQ ID NO:23 (the specific target sequence is underlined in SEQ ID NO:23 in Table 1), we demonstrated high-level inclusion of the chr8:119779073-119779146(-) TAF2 pseudoexon in NCI-H358 lung cancer cells (Figure 4A). When this SSO was used to investigate NCI-H358 lung cancer cells, we observed a decrease in the growth and proliferation of NCI-H358 lung cancer cells by incucyte assay (Figure 4B) and WST-1 assay (Figure 4C).

[0302] conclusion Using SSOs targeting TAF2 pseudoexons increases pseudoexon inclusion and reduces cancer cell proliferation, so SSOs targeting TAF2 pseudoexons may be candidates for future anticancer treatments.

[0303] Example 7 - HTT Research Objective HTT encodes the huntingtin protein and is associated with the autosomal dominant neurodegenerative disorder Huntington's disease, which is caused by an unstable expansion of a CAG trinucleotide repeat within the HTT gene, leading to the translation of a cytotoxic mutant protein with an abnormal polyglutamine tract. Downregulation of HTT has been investigated as a potential strategy in the treatment of Huntington's disease by reducing the levels of mutant huntingtin.

[0304] Inclusion of the chr4:3102605-3102748(+) HHT pseudoexon introduces 143 bp between exon 3 and exon 4 of the mRNA containing an in-frame premature stop codon. HTT mRNA transcripts containing this pseudoexon are targets of nonsense-mediated decay (NMD), and increased inclusion of the pseudoexon induced by SSO treatment reduces HTT mRNA expression. Huntington's disease is an autosomal dominant disorder caused by an expansion of a dominant-negative trinucleotide repeat in the HTT mRNA. Inclusion of the PE reduces the levels of the dominant-negative mRNA and can therefore be used as a treatment.

[0305] Materials and Methods We analyzed the publicly available RNA-seq data using our analysis pipeline (Figure 2). HeLa cells were grown in RPMI and transfected with 20 nM SSO using Lipofectamine. After 24 h, cells were harvested and RNA was purified. RT-PCR was performed and the resulting products were visualized on a 2% agarose gel.

[0306] result By using an SSO targeting the Sweet Spot region set forth in SEQ ID NO:14 (the specific target sequence is underlined in SEQ ID NO:14 in Table 1), we demonstrated high-level inclusion of the chr4:3102605-3102748(+)HHT pseudoexon in HeLa cells, which triggered degradation of HTT mRNA by the NMD system (data not shown).

[0307] conclusion Using SSO targeting the HTT pseudoexon increases pseudoexon inclusion, making it suitable for downregulation of dominant-negative mRNAs that cause Huntington's disease.

[0308] Example 8 - Further related targets The following additional Sweet Spot sequences were identified using the criteria described in this invention (see, e.g., Example 2): These targets are therefore highly likely to be functional targets of the SSO, allowing incorporation of pseudoexons into the mature mRNA.

[0309] [Table 3A]

[0310] [Table 3B]

[0311] [Table 3C]

[0312] [Table 3D]

[0313] Further description of the target gene: ROCK1: ROCK1 encodes a Rho-associated serine / threonine kinase. The signaling pathway of ROCK1 is associated with the development of metabolic diseases and several neurodegenerative disorders, such as Huntington's disease, Parkinson's disease, and Alzheimer's disease, and is a promising target for treating neurodegenerative diseases by suppressing its function (Koch et al., 2018). Inhibition of ROCK1 is a potent target for the treatment of chronic ophthalmic diseases (Moshifar et al., 2018). Hepatic ROCK1 is a proposed target for the treatment of nonalcoholic fatty liver disease and hepatocellular carcinoma (Huang et al., 2018; Wu et al., 2021).

[0314] Inclusion of the chr18:21022445-21022564(-) ROCK1 pseudoexon introduces 120 bp containing an in-frame premature stop codon into the mRNA between exons 11 and 12. mRNA transcripts containing this pseudoexon are predicted to be targeted by nonsense-mediated decay, and increased pseudoexon inclusion reduces gene expression.

[0315] Inclusion of the chr18:21017021-21017098(-) ROCK1 pseudoexon introduces 78 bp into the mRNA between exons 12 and 13. Upon protein translation, this introduces 26 amino acids into the amino acid sequence, potentially decreasing gene expression by disrupting or altering the function of the native protein. Sweet Spots for ROCK1 SSO targeting are shown in Tables 3 and 6. Koch JC,Tatenhorst L,Roser AE,Saal KA,Tonges L,Lingor P.ROCK inhibition in models of neurodegeneration and its potential for clinical translation.Pharmacol Ther.2018 Sep;189:1-21.Moshirfar M,Parker L,Birdsong OC,Ronquillo,Homezh, DJ,Homezh,TJ AT,Hoopes PCS.Use of Rho kinase Inhibitors in Ophthalmology:A Review of the Literature.Med Hypothesis Discov Innov Ophthalmol.2018 Fall;7(3):101-111.Huang H,Lee SH,Sousa-Lima I,Kim SS,Hwang, WM, WM, YK, YC, WM MC,Seo JA,Shibata M,Cho H,Belew GD,Bhin J,Desai BN,Ryu MJ,Shong M,Li P,Meng H,Chung BH,Hwang D,Kim MS,Park KS,Macedo MP,White M,Jones J,Kim YB. Invest.2018 Dec 3;128(12):5335-5350.Wu Hら(2021)Biochemical PharmacologyVolume 184,February 2021,114353.(https: / / doi.org / 10.1016 / j.bcp.202353.1)

[0316] OGA O-GlcNAc glycosylation of proteins is an important post-translational regulatory modification. This process is dynamic, and the protein O-GlcNAcase, encoded by the OGA gene, is responsible for removing the group again.

[0317] OGA inhibitors prevent cognitive decline and reduce the number of amyloid plaques in animal models of Alzheimer's disease (AD) (Yuzwa, Shan et al., 2014), and reduce the amount of pathological tau in the brain (Graham, Gray et al., 2014; Hastings, Wang et al., 2017). Furthermore, inhibition of OGA reduces the cellular internalization of preformed α-synuclein fibrils, which may be a therapeutic strategy for Parkinson's disease (PD) (Tavassoly, Yue et al., 2021).

[0318] The insertion of chr10:101795374-101795480(-) and chr10:101795365-101795480(-) pseudoexons located in OGA intron 10 introduces a premature stop codon that targets the resulting transcript for degradation by the NMD pathway. By functionally mimicking OGA inhibition, SSO-mediated downregulation of OGA may be a promising approach for several neurological disorders, including AD and PD. The sweet spots of OGA SSO targeting are shown in Tables 3 and 6. Graham, DL, et al. 2 Neuropharmacology 79:307-313. Hastings, N.B., et al., 2017. Mol Neurodegener 12(1):39. Tavassoly, O., et al., 2021. FEBS J 288(2):452-470. Yuzwa, SA, et al., 2014. Mol Neurodegener 9:42.

[0319] TMEM97 Transmembrane protein 97 (TMEM97), also known as the sigma-2 receptor, plays a key role in cholesterol homeostasis. TMEM97 has been shown to be overexpressed in several cancers, and suppressing its expression inhibits the proliferation and metastasis of glioma cancer cells (Qiu, Sun et al. 2015). TMEM97 is also involved in the pathology of neurodegenerative diseases such as Alzheimer's disease, and its inhibition may be a potential therapeutic approach (Riad, Lengyel-Zhand et al. 2020). Inhibition of TMEM97 has also been proposed as a potential treatment for type C Niemann-Pick disease (Ebrahimi-Fakhari, Wahlster et al. 2016).

[0320] SSO-mediated inclusion of the chr17:28320422-28320470(+) pseudoexon into TMEM97 intron 1 introduces a premature stop codon that targets the resulting transcript for degradation by the NMD pathway, downregulating TMEM97 gene expression. The sweet spots of TMEM97 SSO targeting are shown in Tables 3 and 6. Ebrahimi-Fakhari, D., et al., 2016. Hum Mol Genet 25(16):3588-3599. Qiu, G., et al. 2015. Tumor Biol 36(10):8231-8238. Riad, A., et al. 2020. Mol Neurobiol 57(9):3803-3813.

[0321] TXNRD1 Thioredoxin reductase 1, encoded by TXNRD1, is associated with poor prognosis in hepatocellular carcinoma (HCC) patients (Fu et al., 2017). In HCC tissues and cells, TXNRD1 is overexpressed and positively correlated with increased clinical stage and shorter survival (Fu et al., 2107). It has also been found to be mutated in several cancers, including HCC (Jia et al., 2020). Therefore, TXNRD1 is a promising therapeutic target for targeted downregulation.

[0322] Transcripts containing a 158 nt-long pseudoexon located in intron 4 of the reference transcript would be subject to degradation by the NMD system due to the introduction of a frameshift and the resulting premature stop codon. It could also lead to the generation of a severely truncated protein lacking active site amino acids required for reductase activity. In either scenario, the presence of the pseudoexon in the transcript would result in a complete loss of function of the gene product. The sweet spots of TXNRD1 targeting are shown in Tables 3 and 6. Fu B, et al., Biomed Res Int. 2017;2017:4698167. doi:10.1155 / 2017 / 4698167. Jia Y, et al. Mol Clin Oncol.2020 Dec;13(6):83.doi:10.3892 / mco.2020.2153.

[0323] SLC7A11 The solute carrier SLC7A11 is a member of the Xc-cystine / glutamate transporter system and encodes xCT, a marker of poor prognosis that is overexpressed in many cancers (reviewed by Lin et al., 2020). In glioblastoma, SLC7A11 leads to increased glutamate secretion and neuronal cell death (Savaskan et al., 2008). Inhibition of xCT reduces neuronal cell death and edema and prolongs survival in glioma-bearing rats (Savaskan et al., 2008). Upregulation of SLC7A11 also has important cytoprotective effects in KRAS mutant cells by increasing intracellular antioxidant glutathione levels (Lim et al., 2019), and knockdown of SLC7A11 significantly impairs tumor xenograft growth (Lim et al., 2019). SLC7A11 is a potential therapeutic target for both KRAS-driven tumors, which are generally highly resistant to therapy, and many other cancers, including gliomas. Although several xCT inhibitors exist, they are less specific than SSO-mediated SLC7A11 downregulation and may cause significantly more side effects when used in clinical settings compared to SSO-based treatments.

[0324] Inclusion of a 56-nt pseudoexon located in intron 6 would result in a frameshift and a resulting premature stop codon, generating transcripts susceptible to NMD that could be downregulated or could result in the expression of a truncated, non-functional protein.

[0325] The sweet spots of SLC7A11 SSO targeting are shown in Tables 3 and 6.

[0326] Therefore, SLC7A11 knockdown therapy with SSO represents a promising treatment for several cancers, with greater specificity and fewer side effects than current protein inhibitors. Lin W, et al., Am J Cancer Res.2020 Oct 1;10(10):3106-3126. Savaskan NE, et al. Nat Med.2008 Jun;14(6):629-32.doi:10.1038 / nm1772. Lim JKM, et al. Mol Cell Oncol.2019 Nov 10;7(1):1654814.doi:10.1080 / 23723556.2019.1654814. Lim JKM, et al., Proc Natl Acad Sci US A.2019 May 7;116(19):9433-9442.doi:10.1073 / pnas.1821323116.

[0327] cancer Known oncogenes STAT5B (de Araujo, Erdogan et al., 2019), MCCC2 (Chen, Zhang et al., 2021), UBAP2L (Li, Wang et al., 2018), SMYD2 (Li, Zhou et al., 2018), YBX1 (Xu, Li et al., 2017), PTPN11 (Chan, Kalaitzidis et al., 2008), DIAPH3 (Rong, Gao et al., 2020), COPS3 (Zhang, Yan et al., 2018), SNX5 (Zhou, Huang et al., 2020) and ZYG11A (Wang, Sun et al., 2016) all contain out-of-frame PEs. Thus, inclusion of these PEs results in degradation of oncogenic mRNAs via NMD or generation of non-functional tumor proteins, making them suitable for treatment with Sweet Spot SSOs that activate the inclusion SSO as a cancer treatment. Chan, G., et al., 2008. Cancer Metastasis Rev 27(2):179-192. Chen, et al., 2021.Cancer Cell Int 21(1):22. de Araujo, ED, et al., 2019. Nat Commun10(1):2517. Li, LX, et al. 2018. Cell Death Dis 9(3):326. Li, Q., et al., 2018. Med Sci Monit 24:7109-7118. Namour, F., et al., 2012. Drugs RD 12(3):141-163. Rong, Y., et al., 2020. J Cell Mol Med.doi:10.1111 / jcmm.16196 Wang, X., et al., 2016. Oncotarget 7(7):8029-8042. Xu, L., et al. 2018. J Exp Clin Cancer Res 37(1):135. Zhou, Q., et al., 2020. Oncogene 39(10):2140-2155.

[0328] Example 9 -HIF1A Research Objective Hypoxia-inducible factors (HIFs) are transcription factors that are activated when oxygen levels drop or in response to other environmental changes. HIF-1α contributes to tumor progression in cancer by promoting signaling for angiogenesis, the formation of new blood vessels from already active vessels, cell invasiveness, metastasis, and recruitment of immune suppressive cells to the tumor environment (Tatrai et al., 2014). Previous studies have shown that knockdown of HIF-1α can reduce tumor burden and cancer cell migration, and because activation of oncogenes is highly correlated with the risk of metastasis, HIF-1α may be a target for anticancer therapy (Dai et al., 2011).

[0329] Materials and Methods The analytical pipeline (Figure 2) was used to analyze the publicly available RNA-seq data. Panc-1 cells were cultured in RPMI and transfected with 40 nM SSO using lipofectamine. After 24 h, cells were harvested and RNA was purified. RT-PCR was performed and the resulting products were visualized on a 2% agarose gel. To determine the optimal SSO targeting the Sweet Spot region, several SSOs were tested employing 25 nt long SSOs targeting the Sweet Spot region at positions +9 to +13 downstream of the 5'ss of PE. This showed that SSO targeting from +10 (sequence number 128) was superior in mediating the inclusion of pseudoexons into HIF1A transcripts. For hypoxia experiments, transfected Panc-1 or U251 cells were first cultured in normoxia for 48 h and then transferred to a hypoxic chamber for 24 h. To measure cell proliferation, viability, and cytotoxicity at the optimal +10 SSO, WST-1 assays were performed on cells under normoxic and hypoxic conditions. For protein extraction, cell lysates were flash frozen at -80°C to limit time in normoxic conditions. Protein lysates were benzonase treated, and denatured proteins were separated on 4-12% Nupage SDS gels and analyzed by Western blotting using antibodies against HIF1α and β-actin as controls.

[0330] SSO: All SSOs were 25-nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modifications on each sugar moiety (LGC Biosearch Technologies). The SSOs were used targeting different positions within the Sweet Spot region of the gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs bind within the Sweet Spot.

[0331] [Table 4]

[0332] result: Using our analysis pipeline (Figure 2), we analyzed publicly available RNA-seq data and identified a 34-nt pseudoexon (chr14:61724198-61724230(+)) between exons 4 and 5 of HIF1A. The pseudoexon causes a frameshift and introduces a stop codon (UAA) in exon 5. To determine the optimal SSO targeting the Sweet Spot region, we tested several SSOs using 25-nt-long SSOs targeting the Sweet Spot region at positions +9 to +13 downstream of the 5'ss of PE. This showed that SSO targeting from +10 was superior in mediating the inclusion of the pseudoexon into the HIF1A transcript. Transfection of U251 glioblastoma cells with the +10 SSO resulted in up to 60% inclusion of the pseudoexon (Figure 6A). Under normoxic conditions, HIF-1α is degraded by hydroxylation, so to examine the effect of SSO on protein levels, we subjected Panc-1 cells to hypoxia and extracted proteins, which showed that +10 SSO efficiently reduced HIF1A protein levels (Figure 6B). In WST-1 assays, U251 cells grown under hypoxic conditions had lower viability when treated with +10 SSO than with ctrl SSO (Figure 6C).

[0333] conclusion It can be observed that the binding site within the binding region of HIF1A can be optimized. The best SSO was "HIF1A+10" (SEQ ID NO: 128).

[0334] Example 10 - TRPM7 Research Objective TRPM7 belongs to the protein superfamily Transient Receptor Potential (TRP), which is responsible for the movement of different ions across membranes. TRP proteins act as sensors and transducers, and when activated, they trigger the transmembrane flow of ions to regulate related pathways and various physiological responses (Liu et al., 2014). TRPM7 is cleaved by caspases, which separates the kinase domain from the membrane pore. Studies have shown that TRPM7 is highly expressed in brain tissues, and dysregulation of this channel is involved in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), Parkinson's dementia, and Alzheimer's disease. TRPM7 has been found to play a key role in neuronal cell death in cases of ischemia by mediating Ca2+ influx, causing calcium overload, leading to oxidative stress, nitric oxide production, and cell death (Leng et al., 2015; Sun et al., 2009). Knockdown of TRPM7 suppresses the delayed neuronal cell death characteristic of Alzheimer's disease, Huntington's disease, Parkinson's disease, and stroke patients. This suggests that knockdown of TRPM7 may be a new therapeutic approach for neurological diseases. TRPM7 also plays an important role in several types of cancer, including glioblastoma multiforme (GBM), retinoblastoma, nasopharyngeal carcinoma, leukemia, gastric cancer, prostate cancer, pancreatic cancer, breast cancer, and head and neck cancer, and is overexpressed in pancreatic and lung cancer cells. Finally, TRPM7 plays a role in diabetes, kidney disease, and inflammatory diseases.

[0335] Materials and Methods To analyze the publicly available RNA-seq data, we used the analysis pipeline (Figure 2). HeLa and U251 cells were cultured in RPMI and transfected with 20 nM or 40 nM SSO using Lipofectamine. After 24 h, cells were harvested and RNA was purified. RT-PCR was performed and the resulting products were visualized on a 2% agarose gel. For IncuCyte experiments, U251 cells were grown in 96-well plates transfected with 20 nM and 40 nM SSO, incubated in the IncuCyte instrument and images were taken every 4 h. A small SSO walk was performed using a 25 nt long SSO targeting the Sweet Spot region from +9 to +13 positions downstream of the 5'ss of PE.

[0336] SSO: All SSOs were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modifications on each sugar moiety (LGC Biosearch Technologies). The SSOs were used targeting different positions within the Sweet Spot region of the gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs bind within the Sweet Spot (see Table 5).

[0337] [Table 5]

[0338] result: Using our analysis pipeline (Figure 2), we identified a 60-nt pseudoexon (chr15:50588192-50588250(-)) located between exons 27 and 28 of TRPM7. The pseudoexon introduces 20 amino acids in the region of the cleavage site between the channel and kinase domains of the TRMP7 protein. To determine the optimal SSO targeting the Sweet Spot region, we tested several 25-nt-long SSOs targeting the Sweet Spot region located at positions +9 to +13 downstream of the 5'ss of PE (Figure 5A and B). This indicated that SSO targeting from +13 was superior in mediating the inclusion of the pseudoexon into the TRPM7 transcript. Transfection of HeLa cells or U251 glioblastoma cells with the optimal +13-targeting SSO resulted in increased inclusion of the pseudoexon and reduced growth and proliferation of the cancer cells (Figure 5C).

[0339] conclusion Normal expression of the TRPM7 protein is most efficiently reduced by using an SSO that binds from position +13 and mediates high levels of pseudoexon inclusion.

[0340] References: Tatrai E, et al. Oncotarget 2017,8:44498-44510. Dai Y, et al. International Journal of Radiation Oncology*Biology*Physics 2011,81:521-528. Liu M, et al. Cell Signal 2014,26:2773-2781. Leng TD, et al. CNS Neurosci Ther 2015,21:252-261. Sun HS, et al., Nat Neurosci 2009,12:1300-1307.

[0341] Example 11 - Further relevant targets experimentally verified The following Sweet Spot sequences were identified in disease-associated genes using the criteria described in this invention (see, e.g., Example 2) and demonstrated by functional studies to be targets for SSO, allowing incorporation of pseudoexons into mature mRNA.

[0342] Materials and Methods Publicly available RNA sequencing data (Geuvadis, E-MTAB-2836, E-MTAB-513, GSE52946, and GSE124439) were used and mapped with STAR after trimming of adapter contamination and low-quality bases with bbduk. HeLa cells were seeded in 12-well plates and forward transfected at 60% confluence with 20 or 40 nM 2'-O-methyl SSO with a fully phosphorothioate backbone using Lipofectamine RNAiMAX (Invitrogen). Non-binding ctrl SSO (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO: 126) was used as a control. After 48 hours, RNA was isolated using Trizol (Invitrogen) and chloroform, followed by precipitation with isopropanol. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using a high-capacity cDNA kit (Applied Biosystems). Primers were designed to cover at least one interexon junction of adjacent exons flanking the pseudoexon of interest. PCR was performed using TEMPase Hot Start DNA polymerase (Amplicon) and 1 μl of cDNA per reaction. Each primer was used at 0.5 pmol / μl. PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel at 80 V for 1 h.

[0343] The sweet spot region is located at +9 to +39 of the 5' splice site of the pseudoexon.

[0344] All SSOs were 25-nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modifications on each sugar moiety (LGC Biosearch Technologies). SSOs were used targeting positions +11 to +35 (relative to the 5' splice site of the pseudoexon) within the Sweet Spot region of the gene. Thus, the SSOs bind within the Sweet Spot.

[0345] result Using the double splicing method, we further identified 46 fully spliced ​​pseudoexons and tested SSOs targeting Sweet Spot regions +11 to +35 downstream of the selected pseudoexons identified in the RNA sequencing data (Table 6). All of these selected 46 SSOs were able to increase the inclusion of the pseudoexons in the mRNA transcripts of the target genes (Table 6 below).

[0346] Table 6: Forty-six pseudoexons matched all of the criteria and were all activated by SSOs located in the Sweet Spot region, which was annotated by genomic sequence (DNA).

[0347] [Table 6A]

[0348] [Table 6B]

[0349] [Table 6C]

[0350] In Table 6, the Sweet Spots of SEQ ID NOs: 141 and 142 correspond to the major allele (C) of rs17444202. The Sweet Spots of SEQ ID NOs: 158 and 159 correspond to the minor allele (T) of rs17444202.

[0351] SEQ ID NOs: 160-180 in Table 7 are further pseudoexons of genes (genes listed in Tables 1 and 6) in which at least one other pseudoexon has already been activated by SSO targeting the Sweet Spot. SEQ ID NOs: 181-201 in Table 7 are additional Sweet Spot sequences identified using the criteria described in the present invention (see, for example, Example 2). Thus, these targets are highly likely to be functional targets of SSO, allowing incorporation of the pseudoexon into the mature mRNA.

[0352] [Table 7A]

[0353] [Table 7B]

[0354] [Table 7C]

[0355] [Table 8]

[0356] Example 12 - RNF115 RNF115 (Ring Finger Protein 115), formerly known as Breast Cancer Associated 2 (BCA2), is a RING-finger E3 ubiquitin that mediates substrate polyubiquitination. RNF115 causes ubiquitination and proteasomal degradation of the tumor suppressor p21 in breast cancer (Wang et al., 2013). In lung cancer, RNF115 also functions as an oncogene that regulates the Wnt / β-catenin pathway through ubiquitination of adenomatous polyposis (APC) and increases proliferation (Wu et al., 2021).

[0357] RNF115 is associated with breast cancer: RNF115 is overexpressed in more than 50% of invasive breast cancers, and its upregulation correlates with estrogen receptor positive (ER+) status and poor prognosis.

[0358] Therefore, inhibiting the activity of RNF115 inhibits β-catenin and functions to suppress cancers such as lung and breast cancer.

[0359] We aimed to investigate the presence of pseudoexons in the RNF115 gene that could be used to downregulate RNF115 gene expression through in silico analysis and in vivo experiments.

[0360] Materials and Methods We used a novel double-junction approach to identify fragments with fully spliced ​​pseudoexons in publicly available RNA-seq data from the GEUVADIS consortium, E-MTAB-2836, E-MTAB-513, GSE52946, and GSE124439. HeLa and NCI-H23 lung cancer cells were seeded in 12-well plates and forward transfected at 60% confluence with SSO at 5 nM, 10 nM, or 20 nM using Lipofectamine RNAiMAX (Invitrogen).

[0361] The SSO (targeted against SEQ ID NO: 106, the specific target sequence is underlined in SEQ ID NO: 106 in Tables 3 and 6) was a 25 nt long phosphorothioate RNA oligonucleotide with 2'-O-methyl modifications on each sugar moiety (LGC Biosearch Technologies). The SSO is complementary to positions +11 to +35 (relative to the 5' splice site of the pseudoexon) within the Sweet Spot region of the RNF115 gene. Thus, the SSO binds within the Sweet Spot.

[0362] Unbound SSO with a similar modification (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO:126) was used as a negative control. After 48 h, RNA was isolated using Trizol (Invitrogen) and chloroform, then precipitated with isopropanol. Complementary DNA (cDNA) was synthesized from 500 ng of RNA using a high capacity cDNA kit (Applied Biosystems). Primers were designed to cover at least one inter-exon junction of adjacent exons flanking the pseudoexon of interest. PCR was performed using TEMPase Hot Start DNA polymerase (Amplicon) and 1 μl of cDNA per reaction. 0.5 pmol / μl of each primer was used. PCR products were resolved on a 2% Seakem LE (Lonza) TBE agarose gel at 80 V for 1 h. Protein was harvested for Western blotting after 72 h and denatured proteins were analyzed by NuPAGE at 4–12%. Separation was performed on SDS gels. Western blot analysis was performed using antibodies against RNF115 (ab187642, Abcam), β-catenin (#9587, Cell Signaling Technology), and β-actin (ab8229, Abcam) for control.

[0363] To measure cell proliferation, viability, and cytotoxicity with the optimal +11 SSO, NCI-H23 cells were reverse transfected with SSO at a concentration gradient and WST-1 assay (Roche) was performed on the cells 48 h post-transfection.

[0364] result We used a double splicing approach to search for fragments with completely spliced ​​pseudoexons and identified a pseudoexon within intron 3 of the RNF115 gene.

[0365] Inclusion of the chr1:145784178-145784251 RNF115 pseudoexon introduces 74 bp between exons 3 and 4 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein (only 84 amino acids) lacking functional domains. This truncated protein may function as a decoy by binding to substrates, inhibiting polyubiquitination, and suppressing cancer (Tables 3 and 6).

[0366] Transfection of NCI-H23 cancer cells with a complementary SSO (sequence number 106) at positions +11 to +35 downstream of the 5′ splice site resulted in pseudoexon inclusion up to >90% ( Fig. 7A ).

[0367] The proliferation of NCI-H23 cancer cells is inhibited by treatment through SSO-mediated downregulation, as shown by WST-1 assay (Figure 7B). Furthermore, RNF115 protein levels are significantly decreased after treatment of NCI-H23 lung cancer cells, as shown by Western blotting (Figure 7C). The reduction in the level of functional RNF115 caused a reduction in the level of β-catenin, as shown by Western blotting (Figure 7C).

[0368] conclusion Normal expression of the RNF115 gene product is reduced by at least 90% using a specific SSO, leading to increased inclusion of the pseudoexon and disruption of normal gene product function, thereby suppressing the expression of β-actin and proliferation of lung cancer cells that exhibit SSO-based activation of the RNF115 pseudoexon, thus acting to suppress cancer.

[0369] Similarly, inclusion of the chr1:145794075-145794196 RNF115 pseudoexon introduces 122 bp between exons 1 and 2 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein lacking functional domains. This truncated protein may function as a decoy by binding to substrates and inhibiting polyubiquitination to suppress cancer (Table 7).

[0370] Similarly, inclusion of the chr1:145784114-145784251 RNF115 pseudoexon introduces 138 bp between exons 3 and 4 of the mRNA. This results in a premature stop codon just 12 codons downstream of glutamic acid 73, leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein (only 84 amino acids) lacking functional domains. This truncated protein may function as a decoy by binding to substrates and inhibiting polyubiquitination to suppress cancer (Table 7).

[0371] Similarly, inclusion of the chr1 145780774-145780881 RNF115 pseudoexon introduces 108 bp between exons 3 and 4 of the mRNA. This results in a premature stop codon just 24 codons downstream of glutamic acid 73, leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein (only 96 amino acids) lacking functional domains. This truncated protein may function as a decoy by binding to substrates, inhibiting polyubiquitination and suppressing cancer (Table 7).

[0372] Similarly, inclusion of the chr1145759390-145759535 RNF115 pseudoexon introduces 146 bp between exons 4 and 5 of the mRNA. This results in a reading frameshift after glycine 143, resulting in a premature stop codon 94 codons downstream, leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein (226 amino acids) lacking functional domains. This truncated protein may function as a decoy by binding to substrates and inhibiting polyubiquitination to suppress cancer (Table 7).

[0373] Wang Z, Nie Z, Chen W, Zhou Z, Kong Q, Seth AK, et al. (2013) RNF115 / BCA2 E3 ubiquitin ligase promotes breast cancer cell proliferation through targeting p21Waf1 / Cip1 for ubiquitin-mediated degradation.Neoplasia.15(9):1028-35.

[0374] Wu XT,Wang YH,Cai XY,Dong Y,Cui Q,Zhou YN,Yang XW,Lu WF,Zhang M. (2021)RNF115 promotes lung adenocarcinoma through Wnt / β-catenin pathway activation by mediating APC ubiquitination.Cancer Metab.9(1):7.

[0375] Example 13 -LRRK2 Research Objective Parkinson's disease is a progressive neurodegenerative disorder characterized by the loss of dopaminergic neurons that affects motor control. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are responsible for a common risk factor associated with Parkinson's disease (Alessi & Sammler, 2018). Dominantly inherited and sporadic pathogenic mutations in LRRK2 cause hyperactivation of the LRRK2 kinase, and downregulation of LRRK2 gene expression is a potential therapeutic strategy.

[0376] Materials and Methods The analysis pipeline (Figure 2) was used to identify fragments with fully spliced ​​pseudoexons in the public RNA-seq data. HeLa and U251 cells were reverse transfected with 20 nM SSO (targeting SEQ ID NO: 141 and SEQ ID NO: 142, specific target sequences are underlined in Table 6 SEQ ID NO: 141 and SEQ ID NO: 142) using Lipofectamine RNAiMAX (Invitrogen). A non-targeting SSO (5'-GCUCAAUAUGCUACUGCCCAUGCUUG-3') (SEQ ID NO: 126) was used as a negative control. Cells were harvested after 48 hours using Trizol (Invitrogen) and RNA was extracted using chloroform and isopropanol. Complementary DNA (cDNA) was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), and PCR was performed using TEMPase Hot Start DNA Polymerase (Ampliqon) with primers for LRRK2 exons 47 and 48. PCR products were separated on 1.5% SeaKem LE (Lonza) TBE agarose gels.

[0377] result Using our analytical pipeline (Figure 2), we identified two LRRK2 pseudoexons that can be activated by SSOs targeting the Sweet Spot. The two pseudoexons, chr12:40362438-40362491(+) and chr12:40362410-40362491(+), are located within intron 47 and have the same 5' splice site. Transfection of HeLa and U251 cells with complementary SSOs at positions +11 to +35 downstream of the 5' splice site (SEQ ID NO:215) resulted in increased inclusion of both pseudoexons located between exons 47 and 48 of the LRRK2 mRNA transcript (Figure 9). The chr12:40362438-40362491(+) LRRK2 pseudoexon is 54 nt in length, and inclusion of the pseudoexon introduces 18 amino acids into the WD40 domain of the translated LRRK2 protein. The chr12:40362410-40362491(+)LRRK2 pseudoexon is 82 nt in length, and inclusion of the pseudoexon results in a frameshift and insertion of a premature stop codon, targeting the transcript for degradation by nonsense-mediated mRNA decay.

[0378] Surprisingly, the identified Sweet Spot sequence carried the SNP, rs17444202. Therefore, SSOs targeting either SEQ ID NO: 141 and 142, which correspond to the major allele of rs17444202, or SEQ ID NO: 158 and 159, which correspond to the minor allele of rs17444202, were used (see Table 6 in Example 11). In addition, SSOs with additional mismatches were used to preferentially target either the major or minor allele. All SSOs induced the insertion of chr12:40362438-40362491(+)LRRK2 pseudoexon and chr12:40362410-40362491(+)LRRK2 pseudoexon (results not shown). The sequences of the SSOs used are listed in Table 8 in Example 11 with SEQ ID NO: 208-216.

[0379] conclusion The normal and hyperactive functions of LRRK2 are reduced by using specific SSOs targeting the sweet spot, inducing the inclusion of pseudoexons, thereby reducing the expression and activity of the normal LRRK2 gene product. Insertion of pseudoexons, which introduce amino acids into the translated sequence, potentially reduces gene expression by disrupting protein function or alters normal protein function. Inclusion of pseudoexons, which cause a frameshift with the insertion of a premature stop codon, reduces gene expression by degradation of the transcript or translation of a truncated, non-functional protein.

[0380] Without being bound by theory, by identifying SNPs in the Sweet Spot region, allele-specific targeting (or at least allele-preferential targeting) can be achieved by screening the subject's SNP status before selecting an SSO and initiating treatment. Reference: Alessi, DR & Sammler E (2018) Science,360(6384):36-37.DOI:10.1126 / science.aar5683

[0381] Example 14 - LRP6 LRP6 (LDL receptor-related protein 6) is a member of the low-density lipoprotein (LDL) receptor gene family. LRP6 functions as a receptor and coreceptor for Wnt in the Wnt / β-catenin signaling cascade and plays a role in controlling cell differentiation, proliferation, and migration. It is also involved in glucose and lipid metabolism signaling. Inhibition of LRP6 may be a therapeutic option for cancers such as breast cancer, liver cancer, and colon cancer, as well as metabolic and neurodegenerative diseases (reviewed by Jeong and Jho 2021).

[0382] Inclusion of the chr12:12149294-12149360(-) LRP6 pseudoexon introduces 67 bp between exons 13 and 14 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein (only 1006 amino acids) lacking the transmembrane and cytoplasmic domains. This truncated protein may function as a decoy receptor for Wnt proteins, thereby inhibiting Wnt signaling and suppressing cancer and other diseases. (Table 6 - Functionally Validated)

[0383] Similarly, inclusion of the chr12:12184211-12184244(-) LRP6 pseudoexon introduces 34 bp between exons 4 and 5 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein lacking the transmembrane and cytoplasmic domains. This truncated protein may function as a decoy receptor for Wnt proteins, thereby inhibiting Wnt signaling and suppressing cancer and other diseases (Table 7).

[0384] Similarly, inclusion of the chr12:12212260-12212305(-) LRP6 pseudoexon introduces 46 bp between exons 1 and 2 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein lacking the transmembrane and cytoplasmic domains. This truncated protein may function as a decoy receptor for Wnt proteins, thereby inhibiting Wnt signaling and suppressing cancer and other diseases (Table 7).

[0385] Similarly, inclusion of the chr12:12197784-12197878(-) LRP6 pseudoexon introduces 95 bp between exons 3 and 4 of the mRNA. This results in a shift in the reading frame, generating a premature stop codon and leading to degradation by the NMD system. It also leads to the generation of a severely truncated protein lacking the transmembrane and cytoplasmic domains. This truncated protein may function as a decoy receptor for Wnt proteins, thereby inhibiting Wnt signaling and suppressing cancer and other diseases (Table 7).

[0386] Example 15 -LRRK2-SNPs Research Objective Parkinson's disease is a progressive neurodegenerative disorder characterized by loss of dopaminergic neurons that affects motor control. Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are responsible for common risk factors associated with Parkinson's disease (Alessi & Sammler, 2018). Dominantly inherited and sporadic pathogenic mutations in LRRK2 cause hyperactivation of the LRRK2 kinase, and downregulation of LRRK2 gene expression is a potential therapeutic strategy. Allele-specific targeting is particularly promising for downregulation of hyperactive disease alleles with minimal or no effect on the wild type.

[0387] Materials and Methods RNA-seq analysis was used to identify fragments with pseudoexons that were fully contained in proprietary and publicly available RNA-seq data, and the dbSNP database (https: / / www.ncbi.nlm.nih.gov / SNP) was used to identify SNPs that enhance 3' or 5' splice sites (increase MaxEnt score). Such SNPs allow otherwise unresponsive pseudoexons to be functionally targeted for SSO treatment, resulting in inclusion or increased inclusion of a given pseudoexon in the mature mRNA.

[0388] A549 cells were reverse transfected and LX-2 cells were transfected with 30 nM SSO (5'-CAGACUACCAGACAUCUGACUAGAA-3') (SEQ ID NO: 333) (targeting SEQ ID NO: 217, specific target sequence is underlined in SEQ ID NO: 217 in Table 9) using Lipofectamine RNAiMAX (Invitrogen). Non-targeting SSO (5'-GCUCAAUAUGCUACUGCCCAUGCUUG-3') (SEQ ID NO: 126) was used as a negative control. A549 cells were harvested 48 hours post-transfection and LX-2 cells were harvested 24 hours post-transfection using Trizol (Invitrogen). RNA was extracted using chloroform and isopropanol, complementary DNA (cDNA) was synthesized using a High-Capacity cDNA reverse transcription kit (Applied Biosystems), and PCR was performed with primers for LRRK2 exons 37 and 38–39 using TEMPase Hot Start DNA polymerase (Ampliqon). PCR products were separated on 1.5% SeaKem LE (Lonza) TBE agarose gels.

[0389] result We identified a pseudoexon (chr12:40322690-40322887(+)) in intron 37 of the LRRK2 gene. The common SNP rs10878372A / G increased the strength of the pseudoexon 5' splice site (frequency: A=0.77 / G=0.23, 1000Genomes European population), changing the MaxEnt score to -4.26 for the "A allele" and 4.84 for the "G allele". This pseudoexon can be activated by SSO targeting only the Sweet Spot region of the gene allele carrying the identified SNP (G allele). This allows G allele-specific activation of the pseudoexon in heterozygotes (equal to 35% of the 1000Genomes European population) and activation of the pseudoexon from both alleles in individuals homozygous for the G allele, whereas SSO does not activate the pseudoexon in individuals homozygous for the A allele.

[0390] Transfection of A549 and LX-2 cells with an SSO (SEQ ID NO: 217) complementary to positions +11 to +35 downstream of the 5' splice site increased inclusion of the LRRK2 pseudoexon in LX-2 cells heterozygous for the rs10878372 A / G SNP and did not affect inclusion of the pseudoexon in A549 cells homozygous for the A allele (compare Figures 10A and 10B). Inclusion of the LRRK2 pseudoexon introduces 198 nt between exons 37 and 38 of the mature mRNA, which includes several in-frame premature translation stop codons.

[0391] conclusion Using an SSO targeting the sweet spot region reduces LRRK2 activity and function, inducing the inclusion of a pseudoexon, thereby reducing expression of the LRRK2 gene allele carrying the SNP(G) identified for allele-specific targeting. Inclusion of the pseudoexon introducing an in-frame premature stop codon reduces gene expression through degradation of the transcript or translation of a truncated, non-functional protein.

[0392] By identifying a SNP that reinforces the 3' or 5' splice site of the pseudoexon and inducing inclusion of the pseudoexon, making the pseudoexon the functional target of SSO therapy, allele-specific targeting (or at least allele-preferential targeting) can be performed by screening subjects who carry a particular SNP and a dominant pathogenic mutation in the same allele before initiating therapy. Reference: Alessi, DR & Sammler E (2018) Science,360(6384):36-37.DOI:10.1126 / science.aar5683

[0393] Example 16 Research Objective In many autosomal dominant diseases, allele-specific downregulation of expression from only the disease-causing (mutated) allele is preferred because the mutant allele produces a protein with a dominant-negative effect that interferes with the normal protein produced from the wild-type allele. Similarly, in diseases caused by gene duplication, allele-specific downregulation of only one allele is preferred because the disease pathology is gene dosage sensitive. Activation of splicing of pseudoexons that introduce premature stop codons into transcripts from mutant or overexpressed alleles reduces gene expression by degradation of the mutant transcript or translation of a truncated non-functional protein.

[0394] SNPs at the 3' splice site of a 23mer (-20 to +3 nt of the intron-exon boundary) or at the 5' splice site of a 9mer (-3 to +6 nt of the exon-intron boundary) affect the strength of a given splice site (change the MaxEnt score). This can be exploited for allele-specific pseudoexon activation, because such high MaxEnt score SNP variants can functionally target otherwise unresponsive pseudoexons for SSO therapy, thereby allowing allele-specific inclusion or increased inclusion of a given pseudoexon in the mature mRNA transcript. The principle of the invention is illustrated in FIG. 11.

[0395] Therefore, allele-specific targeting (or at least allele-preferential targeting) can be performed by screening subjects with specific high MaxEnt score SNP variants before initiating treatment with an SSO that binds to the Sweet Spot.

[0396] Materials and Methods RNA-seq analysis was used to identify fragments with pseudoexons that were fully contained in proprietary and publicly available RNA-seq data, and the dbSNP database (https: / / www.ncbi.nlm.nih.gov / SNP) was used to identify SNPs that enhance (increase MaxEnt score) 3' or 5' splice sites. As shown in Example 15, such high MaxEnt score SNP variants can make otherwise unresponsive pseudoexons functional targets for SSO treatment, resulting in inclusion or increased inclusion of a given pseudoexon in the mature mRNA.

[0397] result We identified the following additional examples of targeted pseudoexons where allele-specific activation by SSO binding to the Sweet Spot region is determined by SNP variation in the splice site sequence (Table 9).

[0398] [Table 9A]

[0399]

Table 9B

[0400]

Table 9C

[0401]

Table 9D

[0402]

Table 9E

[0403]

Table 9F

[0404] [Table 10A]

[0405]

Table 10B

[0406] Selection example LMN1B: Lamin B1 is encoded by the LMNB1 gene. Overexpression of lamin B1 causes progressive central nervous system demyelination, leading to autosomal dominant adult-onset demyelinating leukodystrophy (ADLD) (Giorgio et al., 2015; Giorgio et al., 2019). ADLD is an inherited, progressive, fatal disorder affecting myelin in the central nervous system (CNS). Allele-specific downregulation of one of the LMNB1 alleles may be a suitable and promising therapeutic option for ADLD (Giorgio et al., 2019).

[0407] Furthermore, LMNB1 expression is increased in cancer and correlates with cancer stage and patient prognosis. Downregulation of LMNB1 reduces cancer cell proliferation and migration, and tumor growth. Therefore, downregulation of LMNB1 is also a promising therapeutic strategy in cancer (Li et al., 2022).

[0408] We identified a pseudoexon in intron 1 of the LMNB1 gene, chr5:126804263-126804357(+). The strength of the pseudoexon 5' splice site is determined by a common SNP, rs30485331-- / insTT (frequency: --=0.80 / insTT=0.2, 1000Genomes European population). The insTT variant changes the MaxEnt score of the -- allele to 7.10 and the MaxEnt score of the insTT allele to -20.37 (low MaxEnt score SNP variant). This pseudoexon can be activated by SSO targeting the Sweet Spot region only in gene alleles that do not carry the identified SNP (insTT allele). This allows allele-specific activation of pseudoexons in heterozygotes (=32% of the 1000Genomes European population) and activation of pseudoexons from both alleles in individuals homozygous for the -- allele (high MaxEnt score SNP variant), whereas SSO does not activate pseudoexons in individuals homozygous for the insTT allele (low MaxEnt score SNP variant).

[0409] Inclusion of the chr5:126804263-126804357(+) LMNB1 pseudoexon introduces 95 bp between exon 1 and exon 2 of the mRNA. This introduces an in-frame premature stop codon into the mRNA transcript. Therefore, LMNB1 mRNA transcripts with this pseudoexon inclusion are predicted to be targeted by nonsense-mediated decay, and increased pseudoexon inclusion would result in decreased LMNB1 gene expression. The sweet spots of LMNB1 SSO targeting are shown in Table 9.

[0410] References: Giorgio E,Robyr D,Spielmann M,Ferrero E,Di Gregorio E,Imperiale D,Vaula G,Stamoulis G,Santoni F,Atzori C,Gasparini L,Ferrera D,Canale C,Guipponi M,Pennacchio LA,Antonarakis SE,Brussino A,Brusco AA large genomic deletion leads to enhancer adoption by the lamin B1 gene: a second path to autosomal dominant adult-onset demyelinating leukodystrophy(ADLD).Hum Mol Genet.2015 Jun 1;24(11):3143-54.doi:10.1093 / hmg / ddv065.Epub 2015 Feb 20.PMID:25701871;PMCID:PMC4424952. Giorgio E, Lorenzati M, Rivetti di Val Cervo P, Brussino A, Cernigoj M, Della Sala E, Bartoletti Stella A, Ferrero M, Caiazzo M, Capellari S, Cortelli P, Conti L, Cattaneo E, Buffo A, Brusco A. Allele-specific silencing as treatment for gene duplication disorders: proof-of-principle in autosomal dominant leukodystrophy. Brain. 2019 Jul 1;142(7):1905-1920. doi:10.1093 / brain / awz139. PMID:31143934. Li J, Sun Z, Cui Y, Qin L, Wu F, Li Y, Du N, Li X. Knockdown of LMNB1 Inhibits the Proliferation of Lung Adenocarcinoma Cells by Inducing DNA Damage and Cell Senescence. Front Oncol. 2022 May 31;12:913740.doi:10.3389 / fonc.2022.913740.PMID:35712471;PMCID:PMC9194513.

[0411] ATXN2: Ataxin-2 is encoded by the ATXN2 gene. Spinocerebellar ataxia 2 (SCA2) is an autosomal dominant lethal disease caused by an expansion of >32 CAG repeats in one ATXN2 allele (Laffita-Mesa et al., 2021). Alleles with moderate (>29 CAG / CAA repeats) expansions in ATXN2 increase the risk of many other neurological diseases. Reducing ATXN2 expression in mice with amyotrophic lateral sclerosis (ALS) extends survival, suggesting that reducing ATXN2 disease allele expression may be relevant for the treatment of both ALS and SCA2 (Laffita-Mesa et al., 2021).

[0412] Therefore, allele-specific downregulation of one of the ATXN2 disease-associated alleles may be a suitable therapeutic option for SCA2, ALS, and other neurodegenerative diseases.

[0413] We identified a pseudoexon in intron 14 of the ATXN2 gene, chr12:111505733-111505834(-). The strength of the pseudoexon 5' splice site is determined by a common SNP, rs10849953 A / G (frequency: A=0.58 / G=0.42, 1000Genomes Japanese population). The G variant changes the MaxEnt score of the A allele to -1.34 and the MaxEnt score of the G allele to 6.84 (high MaxEnt score SNP variant). Thus, this pseudoexon can be activated by SSO targeting only the Sweet Spot region in the allele of the gene carrying the identified SNP (G allele). This allows allele-specific activation of pseudoexons in heterozygotes (49% of the 1000Genomes Japanese population) and activation of pseudoexons from both alleles in individuals homozygous for the G allele, but SSO does not activate pseudoexons in individuals homozygous for the A allele (low MaxEnt score SNP variants).

[0414] Inclusion of chr12:111505733-111505834(-) The ATXN2 pseudoexon introduces 102 bp between exon 14 and exon 15 of the mRNA, which introduces an in-frame premature stop codon into the mRNA transcript. Therefore, ATXN2 mRNA transcripts with inclusion of this pseudoexon are predicted to be targeted by nonsense-mediated decay, and increased inclusion of the pseudoexon would result in decreased ATXN2 gene expression. The sweet spots of ATXN2SSO targeting are shown in Table 9.

[0415] Reference: Laffita-Mesa JM, Paucar M, Svenningsson P.Ataxin-2 gene: a powerful modulator of neurological disorders.Curr Opin Neurol.2021 Aug 1;34(4):578-588.doi:10.1097 / WCO.0000000000000959.PMID:34010218;PMCID:PMC8279897.

Claims

1. A composition comprising a splice-switching oligonucleotide (SSO), the composition comprising: - the group consisting of o a nucleic acid set forth in any of SEQ ID NOs: 217-294; o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 217-294, or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 217-294 an SSO that is complementary or substantially complementary to a region within a nucleic acid selected from or - the group consisting of o a nucleic acid of any of SEQ ID NOs: 295-367, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 295-367, or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 295-367 SSO selected from A composition comprising:

2. The composition described in claim 1, which is a pharmaceutical composition.

3. The SSO is a group consisting of the following: o a nucleic acid set forth in SEQ ID NO: 217; o a nucleic acid comprising one, two or three substitutions when compared to SEQ ID NO: 217, or o a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 217 2. The composition of claim 1, wherein the composition is complementary or substantially complementary to a region within a nucleic acid selected from:

4. 1. A composition comprising a splice-switching oligonucleotide (SSO) for use as a pharmaceutical, said composition comprising: - comprising an SSO that is complementary or substantially complementary to a region in a nucleic acid selected from the group consisting of: o a nucleic acid set forth in any of SEQ ID NOs: 217-294; o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 217-294, or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 217-294; or - comprising an SSO selected from the group consisting of: o a nucleic acid set forth in any of SEQ ID NOs: 295-367, or o a nucleic acid comprising one, two or three substitutions when compared to any of SEQ ID NOs: 295-367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NOs: 295-367; the SSO is complementary or substantially complementary to a target pre-mRNA, the target pre-mRNA comprising a function-disabling pseudoexon; - the function-disabling pseudo-exon is o a 3' splice site at the 5' end, and o a 5' splice site at the 3' end; Including, the SSO is complementary or substantially complementary to a target pre-RNA in the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon; The composition is used to treat a human subject having a disease or condition characterized by increased expression or altered function of a functional protein that causes or contributes to the disorder, or in which decreased expression of a functional gene product is therapeutically beneficial. composition.

5. The composition for use of claim 4 , wherein the SSO comprises one or more artificial nucleotides.

6. The composition for use of claim 4 , wherein the oligonucleotide does not mediate RNAse H-mediated degradation of mRNA.

7. 5. The composition for use according to claim 4 for use in the treatment or alleviation of a disease selected from the group consisting of cancer, inflammatory diseases, neurodegenerative or neurological diseases, metabolic diseases, chronic liver diseases, and inherited retinal dystrophies (IRDs).

8. the composition is administered to a subject heterozygous for a sequence variation (SNP) in the pre-mRNA targeted by the SSO, whereby the SSO promotes inclusion of a function-disabling pseudoexon to a greater extent in the disease-causing allele compared to the other allele; or The composition is administered to a subject who is homozygous for the SNP mutation (SNP) in the pre-mRNA targeted by the SSO. A composition for use according to claim 4.

9. 5. The composition for use according to claim 4, wherein the subject is heterozygous for a sequence variation (SNP) in the 5' splice site and / or the 3' splice site.

10. 5. The composition for use of claim 4, wherein the subject carries a SNP in a disease-causing allele selected from the group of SNP IDs set forth in Table 9.

11. The composition for use according to claim 4, wherein the pre-mRNA encodes LRRK2.

12. The composition for use according to claim 4, wherein the pre-mRNA encodes LRRK2 and the subject carries a high-scoring MaxEnt score "G allele" of SNP rs10878372 in the disease-causing LRRK2 allele.

13. 5. The composition for use of claim 4, wherein the pre-mRNA encodes LRRK2 and the subject is heterozygous for a disease-causing mutation in LRRK2.

14. 1. A method for identifying a subject who may be eligible for allele-specific SSO-based pseudo-exon inclusion therapy of a dysfunctional or disease-causing gene, the method comprising: determining the presence or absence of heterozygosity in a pseudoexon of said dysfunctional or disease-causing gene in a biological sample from said subject; If the subject is heterozygous for a sequence variation (SNP) at the 5' splice site and / or the 3' splice site, the subject is likely eligible for allele-specific SSO-based pseudoexon inclusion therapy; or If the subject is not heterozygous for the 5' splice site and / or 3' splice site sequence variant (SNP) of the function-disabling pseudoexon, the subject is likely not eligible for allele-specific SSO-based pseudoexon inclusion therapy; the SSO is complementary or substantially complementary to a target pre-mRNA of the dysfunctional or disease-causing gene, the target pre-mRNA comprising a function-disabling pseudoexon; - the function-disabling pseudo-exon is o a 3' splice site at the 5' end, and o a 5' splice site at the 3' end; A method comprising:

15. 15. The method of claim 14, wherein the allele-specific SSO-based pseudoexon inclusion therapy results in the SSO hybridizing to the pre-mRNA in vivo, and the pseudoexon of the dysfunctional or disease-causing gene becoming part of the mature mRNA to a greater extent than a corresponding pre-mRNA not contacted with the SSO.

16. 15. The method of claim 14, wherein the allele-specific SSO-based pseudoexon inclusion therapy results in the SSO hybridizing to a pre-mRNA in vivo, and the pseudoexon becoming part of the mature mRNA to a greater extent in the allele carrying the dysfunctional or disease-causing gene compared to a corresponding pre-mRNA not contacted by the SSO.

17. 15. The method of claim 14, wherein the heterozygosity for a sequence variation (SNP) at the 5' splice site and / or 3' splice site of the pseudoexon in the pre-mRNA targeted by the SSO promotes inclusion of the function-disabling pseudoexon in the disease-causing gene to a greater extent than other alleles when contacted with the SSO.

18. 15. The method of claim 14, wherein the heterozygosity of sequence variations (SNPs) is at the 5' splice site and / or the 3' splice site of the function-disabling pseudoexon.

19. 15. The method of claim 14, wherein the heterozygosity of a sequence variation (SNP) in the disease-causing gene increases inclusion of the pseudoexon to a greater extent when contacted with the SSO than the corresponding (normally functioning) gene on the other allele.

20. 15. The method of claim 14, wherein the SSO is complementary or substantially complementary to the target pre-mRNA in the region +9 to +39 downstream relative to the 5' splice site of the pseudoexon.

21. 15. The method of claim 14, wherein the target sequence of the SSO is located in a gene selected from the group consisting of LRRK2, LMN1B, and ATXN2.

22. 15. The method of claim 14, wherein the subject carries a SNP in a disease-causing allele selected from the group of SNP IDs set forth in Table 9.

23. 15. The method of claim 14, wherein the subject carries a SNP in both alleles selected from the group of SNP IDs set forth in Table 9.

Images