Methods and compositions for treating angiopoietin-like 3 (ANGPTL3)-associated conditions

JP2025507751A5Pending Publication Date: 2026-03-06CRISPR THERAPEUTICS AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024550760
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-21
Filing Date
2023-02-28
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

It is difficult to develop safe and effective methods for treating ANGPTL3-related diseases and disorders.

Method used

Targeted editing is performed to reduce ANGPTL3 expression and protein levels by binding the guide RNA (gRNA) directed to the ANGPTL3 gene and the nucleic acid encoding the RNA guide end of the RNA into the nanoparticles.

Benefits of technology

This method can significantly reduce the levels of ANGPTL3 protein and non-HDL fatty acids, improving related metabolic and cardiovascular diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure relates to methods, compositions, and kits for treating conditions associated with angiopoietin-like 3 (ANGPTL3) by gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 315,372, filed March 1, 2022, U.S. Provisional Patent Application No. 63 / 332,234, filed April 18, 2022, U.S. Provisional Patent Application No. 63 / 352,747, filed June 16, 2022, and U.S. Provisional Patent Application No. 63 / 380,557, filed October 21, 2022, the entire contents of which are expressly incorporated herein by reference in their entireties.

[0002] Sequence Listing Reference This application is filed with a sequence listing in electronic format. The sequence listing is submitted as a file entitled 80EM-341711-WO_SeqListing, created on February 25, 2023, and having a size of 375 kilobytes. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. [Background technology]

[0003] Field The present disclosure relates generally to the fields of molecular biology and biotechnology, including gene editing.

[0004] Description of Related Art Angiopoietin-like 3 (ANGPTL3) is a member of the angiopoietin-like family of secretory factors that control lipid metabolism and are expressed primarily in the liver. ANGPTL3 dually inhibits the catalytic activity of lipoprotein lipase (LPL), which catalyzes the hydrolysis of triglycerides, and endothelial lipase (EL), which hydrolyzes high-density lipoprotein (HDL) phospholipids. ANGPTL3 is associated with a variety of conditions, including lipid metabolism disorders (e.g., hyperlipidemia).

[0005] DNA targeting using RNA guides, the DNA targeting principle of the CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) system has been widely used. CRISPR-Cas systems can be categorized into two classes: class 1 systems (such as type I, III and IV CRISPR-Cas systems) that utilize a complex of multiple Cas proteins, and class 2 systems (such as type II, V and VI CRISPR-Cas systems) that utilize a single Cas protein. Type II CRISPR-Cas-based systems have been used for genome editing and require a Cas polypeptide or its variants guided by a customizable guide RNA (gRNA) for programmable DNA targeting. Summary of the Invention [Problem to be solved by the invention]

[0006] There is a need to develop safe and effective therapies for treating ANGPTL3-associated diseases and disorders. [Means for solving the problem]

[0007] overview Disclosed herein includes methods, compositions and kits for treating ANGPTL3-related disease or disorder. In some embodiments, the method for treating ANGPTL3-related disease or disorder comprises administering to a subject (e.g., a primate subject) a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets ANGPTL3 gene, and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby treating ANGPTL3-related disease or disorder in the subject. In some embodiments, the subject is administered a plurality of nanoparticles two or more times. In some embodiments, each two of the two or more administrations are about 1 year, about 2 years, or about 5 years apart. In some embodiments, each two of the two or more administrations are about 2 weeks to about 4 weeks apart. In some embodiments, the nanoparticles are administered at a concentration of 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2.0 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 5.8 mg / kg, The subject is administered a dose of about 0.01 to 5 mg / kg [as determined by the total nucleic acid (e.g., the sum of ANGPTL3 gRNA and Cas9 mRNA)], including 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg or 5 mg / kg, or a number or range between any two of these values. In some embodiments, the nanoparticles are administered to a subject at or about a dose of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2 mg / kg or 3.0 mg / kg (determined by the sum of ANGPTL3 gRNA and SpCas9 mRNA).

[0008] ANGPTL3 expression (e.g., ANGPTL3 gene expression or NGPTL3 protein expression) in a subject can be reduced by, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60% or at least 70% after administration.The concentration of ANGPTL3 protein in a subject (e.g., in the blood or plasma of the subject) can be reduced by, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60% or at least 70% after administration.The reduction can be (a) the concentration of ANGPTL3 expression or ANGPTL3 protein in the plasma of the subject before being administered with a plurality of nanoparticles; (b) the concentration of ANGPTL3 expression or ANGPTL3 protein in one or more untreated subjects; and / or (3) the reduction in comparison with the baseline level of ANGPTL3 expression or ANGPTL3 protein concentration of a healthy subject.

[0009] The level (e.g., plasma level) of one or more of the non-high density lipoprotein (non-HDL) lipids of the subject can be reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60% or at least 70% after administration. The one or more non-HDL lipids can be triglycerides, very low density lipoproteins (VLDL), low density lipoproteins (LDL), or combinations thereof. In some embodiments, the reduction in non-HDL level is compared to (a) the non-HDL level in the plasma of the subject before administering the plurality of nanoparticles; (b) the non-HDL level in one or more untreated subjects; and / or (3) the baseline non-HDL level in healthy subjects.

[0010] In some embodiments, the concentration of apolipoprotein B (ApoB) protein in the plasma of the subject is reduced by at least 20%, at least 40%, or at least 70% after administration. In some embodiments, the reduction is compared to (a) the concentration of ApoB protein in the plasma of the subject before administration of the plurality of nanoparticles; (b) the concentration of ApoB protein in one or more untreated subjects; and / or (3) the baseline level of the concentration of ApoB protein in a healthy subject.

[0011] In some embodiments, the reduction in the concentration of ANGPTL3 protein, the level of one or more non-high density lipoprotein (non-HDL) lipids and / or the concentration of ApoB protein is at least 20%, at least 40%, or at least 70% for 3 weeks, 4 weeks, 5 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or longer after administration. In some embodiments, the reduction in the concentration of ANGPTL3 protein, the level of one or more non-high density lipoprotein (non-HDL) lipids and / or the concentration of ApoB protein by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or a number or range between any two of these values, occurs over 3 weeks, 4 weeks, 5 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 12 years, 15 years, 20 years or more following administration.

[0012] In some embodiments, the subject in need has a triglyceride level of more than 150 mg / dL. In some embodiments, the subject in need has a triglyceride level of more than 300 mg / dL, a non-high density lipoprotein (HDL) level of more than 160 mg / dL, a low density lipoprotein cholesterol (LDL-C) level of more than 100 mg / dL, an ApoB level of more than 100 mg / dL, or a combination thereof. The method can include measuring the blood levels of one or more of ANGPTL3, ApoB, triglycerides, very low density lipoprotein (VLDL), low density lipoprotein (LDL), LDL-C, HDL and non-HDL lipids in the subject before, during and / or after administration. The method can further include, for example, identifying the subject in need of treatment.

[0013] In some embodiments, the ANGPTL3-related disease or disorder is a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof. In some embodiments, one or more symptoms of the ANGPTL3-related disease or disorder in the subject are reduced or alleviated. Non-limiting examples of the ANGPTL3-related disease or disorder include obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperfattyacidemia, metabolic syndrome, and combinations thereof. The dyslipidemia can be hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, or both. In some embodiments, the ANGPTL3-related disease or disorder is familial hypercholesterolemia, familial combined hyperlipidemia, familial chylomicronemia syndrome, multifactorial chylomicronemia syndrome, elevated Lp(a), or a combination thereof. The NAFLD can be hepatic steatosis or steatohepatitis. The diabetes can be type 2 diabetes or type 2 diabetes with dyslipidemia. In some embodiments, administering a plurality of nanoparticles to a subject reduces dyslipidemia, cardiovascular risk, the likelihood of death associated with a cardiovascular event, or a combination thereof.

[0014] In some embodiments, the nucleic acid encoding RNA-guided endonuclease is the mRNA of RNA-guided endonuclease.The RNA-guided endonuclease can be, for example, Cas9 endonuclease.Non-limiting examples of Cas9 endonuclease include S.pyogenes Cas9, S.aureus Cas9, N.meningitides Cas9, S.thermophilus Cas9, S.thermophilus3Cas9, T.denticola Cas9 and their mutants.

[0015] The gRNA can be, for example, a single guide RNA (sgRNA). In some embodiments, the gRNA targets exon 1 of the ANGPTL3 gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 3-9 and 20-26. In some embodiments, the gRNA or a nucleic acid encoding the gRNA and an RNA-guided nuclease is encapsulated in a nanoparticle. The nanoparticle can be or include a lipid nanoparticle. In some embodiments, the subject is a primate subject. In some embodiments, the subject is a human.

[0016] In some embodiments, the method further comprises determining in the subject one or more levels of (i) alanine transaminase (ALT), aspartate transaminase (AST), gamma-glutamyl transferase (GGT), bilirubin, alkaline phosphatase (Alk Phos) and albumin; (ii) prothrombin time (PT), and / or (iii) partial thromboplastin time (PTT). The determining can be performed before administration, after administration, during administration, or any combination thereof. In some embodiments, the determining comprises determining (i), (ii) and / or (iii) in the subject once, twice, three times, four times or more during a desired period of time. For example, the determining can comprise determining (i), (ii) and / or (iii) once or daily by the 7th, 14th, 21st, 28th, 35th, 42nd, 49th, 56th, 63rd day after administration. In some embodiments, the determining comprises determining (i), (ii) and / or (iii) in the subject daily, weekly or monthly for at least 3 months, at least 6 months or at least 12 months after administration. In some embodiments, the plurality of nanoparticles are administered to the subject at a single dose of about 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg or 3.0 mg / kg of the nucleic acids (a) and (b).

[0017] Disclosed herein is a method for treating an ANGPTL3-associated disease or disorder in a subject in need thereof, comprising administering to the subject a plurality of nanoparticles complexed with (a) a gRNA targeting the ANGPTL3 gene (ANGPTL3 gRNA), and (b) Cas9 mRNA, at a single dose of about 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3.0 mg / kg of nucleic acids (a) and (b), thereby treating the ANGPTL3-associated disease or disorder in the subject.

[0018] In some embodiments, the method disclosed herein comprises a single administration of a plurality of nanoparticles to a subject. For example, in some embodiments, the plurality of nanoparticles is administered to a subject at a single dose of 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg or 3.0 mg / kg of RNA content of (a) guide RNA (gRNA) or nucleic acid encoding gRNA targeting ANGPTL3 gene, and (b) nucleic acid encoding RNA-guided endonuclease (e.g., Cas9). In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:3, SEQ ID NO:20 or SEQ ID NO:12. In some embodiments, the gRNA comprises a sequence of SEQ ID NO:10 or SEQ ID NO:13. In some embodiments, a single dose of the plurality of nanoparticles is complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA, and (b) about 0.5 mg / mL of Cas9 mRNA. In some embodiments, a single dose of the plurality of nanoparticles is about 58.2 mg / mL.

[0019] In some embodiments, the subject is administered an additional treatment. In some embodiments, the additional treatment comprises administering a corticosteroid, an anti-H1 antihistamine, an anti-H2 antihistamine, or any combination thereof. In some embodiments, the additional treatment is administered to the subject 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week or more before or after administering the plurality of nanoparticles to the subject. In some embodiments, the additional treatment and the plurality of nanoparticles are administered simultaneously.

[0020] The disclosure herein also includes compositions. In some embodiments, the compositions include a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) targeting the ANGPTL3 gene (ANGPTL3 gRNA) and (b) an mRNA encoding a Cas9 endonuclease, wherein the gRNA comprises a spacer sequence of SEQ ID NO: 3, SEQ ID NO: 20, or SEQ ID NO: 12. In some embodiments, the gRNA comprises a sequence of SEQ ID NO: 10 or SEQ ID NO: 13. In some embodiments, the Cas9 endonuclease is Streptococcus pyogenes Cas9 endonuclease. In some embodiments, the concentration of the plurality of nanoparticles is about 58.2 mg / mL and is complexed with about 2 mg / mL of the total nucleic acid of (a) ANGPTL3 gRNA and (b) Cas9 mRNA. In some embodiments, the concentration of the plurality of nanoparticles is about 58.2 mg / mL and is complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

[0021] In some embodiments, the Cas9 mRNA may comprise SEQ ID NO: 16. In some embodiments, two or more uracil residues of the Cas9 mRNA are N1-methylpseudouridine. In some embodiments, the Cas9 mRNA comprises the sequence of SEQ ID NO: 18. In some embodiments, the Cas9 mRNA comprises the sequence of SEQ ID NO: 19.

[0022] The disclosure herein includes a method for treating ANGPTL3-related disease or disorder in a subject in need thereof. In some embodiments, the method includes administering to the subject a guide RNA (gRNA) (ANGPTL3 gRNA) that targets the ANGPTL3 gene or a nucleic acid that encodes the gRNA, where the ANGPTL3 gRNA comprises a spacer sequence of SEQ ID NO: 20, and a plurality of nanoparticles that are complexed with Cas9 mRNA that comprises a sequence of SEQ ID NO: 16, thereby treating the ANGPTL3-related disease or disorder in the subject. The disclosure herein provides a composition for use in treating ANGPTL3-related disease or disorder. In some embodiments, the composition includes a guide RNA (gRNA) (ANGPTL3 gRNA) that targets the ANGPTL3 gene or a nucleic acid that encodes the gRNA, where the ANGPTL3 gRNA comprises a spacer sequence of SEQ ID NO: 20, and a plurality of nanoparticles that are complexed with Cas9 mRNA that comprises a sequence of SEQ ID NO: 16. In some embodiments, the ANGPTL3 gRNA comprises a space sequence of SEQ ID NO: 12. In some embodiments, the ANGPTL3 gRNA is a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO: 13. The two or more uracil residues of the Cas9 mRNA can be modified uracil residues, for example, N1-methylpseudouridine. In some embodiments, the Cas9 mRNA comprises the sequence of SEQ ID NO: 18. In some embodiments, the method comprises administering to the subject a plurality of nanoparticles at a single dose of about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, or 1 mg / kg of the total nucleic acid of (a) and (b). In some embodiments, the expression of ANGPTL3 in the subject is reduced by at least 20% after administration, the concentration of ANGPTL3 protein in the plasma of the subject is reduced by at least 20% after administration, or both.In some embodiments, the reduction is (a) the concentration of ANGPTL3 expression or ANGPTL3 protein in the plasma of the subject before the administration of the plurality of nanoparticles; (b) the concentration of ANGPTL3 expression or ANGPTL3 protein in one or more untreated subjects; and / or (3) the reduction of the baseline level of ANGPTL3 expression or ANGPTL3 protein in healthy subjects. In some embodiments, the reduction in the concentration of ANGPTL3 protein in the plasma of the subject is at least 70% one month after administration. In some embodiments, the plasma level of one or more non-high density lipoprotein (non-HDL) lipids of the subject is reduced by at least 20% after administration. In some embodiments, the one or more non-HDL lipids are triglycerides, very low density lipoprotein (VLDL), low density lipoprotein (LDL), or a combination thereof. In some embodiments, the reduction in non-HDL levels is compared to (a) the non-HDL levels in the plasma of the subject before the administration of the plurality of nanoparticles; (b) the non-HDL levels in one or more untreated subjects; and / or (3) a baseline non-HDL level in a healthy subject. In some embodiments, the reduction in plasma triglyceride levels in the subject is at least 30% at 1 month, 2 months, 3 months, 6 months or longer after administration. In some embodiments, the concentration of apolipoprotein B (ApoB) protein in the plasma of the subject is reduced by at least 20% after administration. In some embodiments, the reduction is compared to (a) the concentration of ApoB protein in the plasma of the subject before the administration of the plurality of nanoparticles; (b) the concentration of ApoB protein in one or more untreated subjects; and / or (3) the baseline level of the concentration of ApoB protein in a healthy subject. The reduction caused by the methods or compositions described herein may be, for example, for at least 4 weeks, 2 months, 6 months, 1 year, 2 years, 5 years, 10 years or more.In some embodiments, the subject in need has a triglyceride level of more than 300 mg / dL, a non-high density lipoprotein (HDL) level of more than 160 mg / dL, a low density lipoprotein cholesterol (LDL-C) level of more than 100 mg / dL, an ApoB level of more than 100 mg / dL, or a combination thereof. The ANGPTL3-related disease or disorder can be, for example, a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof. In some embodiments, the ANGPTL3-related disease or disorder is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperlipidemia, metabolic syndrome, or a combination thereof. In some embodiments, the method comprises a single administration of a plurality of nanoparticles to the subject. In some embodiments, the single dose of the plurality of nanoparticles is complexed with (a) ANGPTL3 gRNA and (b) Cas9 mRNA at a concentration of 2.0 mg / mL total RNA. In some embodiments, the total RNA comprises (a) about 1.5 mg / mL of ANGPTL3 gRNA, and (b) about 0.5 mg / mL of Cas9 mRNA. In some embodiments, the lipid nanoparticle comprises one or more of neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids. In some embodiments, the lipid nanoparticle comprises cholesterol, polyethylene glycol (PEG) lipids, or both. [Brief description of the drawings]

[0023] [Figure 1] FIG. 1 depicts a non-limiting exemplary non-human primate (NHP) study design. [Diagram 2] FIG. 2 is a graph showing the percentage change in plasma ANGPTL3 protein from baseline in Group 1 and Group 3 NHPs. [Figure 3A] 3A-3B show measurements of triglyceride levels. FIG. 3A is a graph showing plasma triglyceride levels of NHPs in Group 1 before and after treatment. FIG. 3B is a graph showing the percentage change in plasma triglyceride levels from baseline of NHPs in Group 1. [Figure 3B] Same as above. [Figure 4A] 4A-4B show non-limiting exemplary data regarding plasma triglyceride levels. FIG. 4A is a graph showing plasma triglyceride levels of NHPs in Group 3 before and after treatment. FIG. 4B is a graph showing the percentage change in plasma triglyceride levels from baseline of NHPs in Group 3. [Figure 4B] Same as above. [Figure 5A] Figures 5A-5D show non-limiting exemplary data regarding triglyceride levels. Figures 5A-5B are two graphs showing the maximum percentage change in plasma triglyceride levels of NHPs in Group 1 (Figure 5A) and Group 3 (Figure 5B). Figures 5C-5D are graphs showing the percentage change in plasma triglyceride levels from baseline at day 36 in Group 1 (Figure 5C) and Group 3 (Figure 5D). [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 6A] Figures 6A-6D are graphs showing ANGPTL3 gene editing efficiency in various organ tissues. [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 6D] Same as above. [Figure 7] FIG. 7 is a graph showing the percentage of ANGPTL3 gene editing in liver biopsies in Group 1 and Group 3 NHPs. [Figure 8A] 8A to 8E are graphs showing liver function tests of alanine aminotransferase (ALT) (FIG. 8A), alkaline phosphatase (ALP) (FIG. 8B), aspartate aminotransferase (AST) (FIG. 8C), blood albumin (ALB) (FIG. 8D), and bilirubin (TBIL) (FIG. 8E). [Figure 8B] Same as above. [Figure 8C] Same as above. [Figure 8D] Same as above. [Figure 8E] Same as above. [Figure 9] FIG. 9 depicts a non-limiting exemplary NHP study design. [Figure 10A] 10A-10D are graphs showing the percentage of ANGPTL3 gene editing in various organ tissues of NHPs treated with 0.5 mg / kg (FIG. 10A), 1.5 mg / kg (FIG. 10B), and 3.0 mg / kg CTX310 formulations (FIG. 10C). FIG. 10D shows the percentage of ANGPTL3 gene editing in various organ tissues of NHPs treated with 0.5 mg / kg, 1.5 mg / kg, and 3.0 mg / kg CTX310 formulations about 3 months after administration. [Figure 10B] Same as above. [Figure 10C] Same as above. [Figure 10D] Same as above. [Figure 11] FIG. 11 is a graph showing the percentage of ANGPTL3 gene editing in hepatocytes of NHPs treated with 0.5 mg / kg, 1.5 mg / kg and 3.0 mg / kg CTX310 formulations. [Figure 12A] 12A-12E show exemplary data regarding plasma ANGPTL3 levels. FIG. 12A is a graph showing plasma ANGPTL3 protein levels of cynomolgus monkeys treated with three different doses of CTX310 formulations (0.5, 1.5 and 3.0 mg / kg) compared to a control group. FIG. 12B is a graph showing the percentage change in plasma ANGPTL3 protein levels of cynomolgus monkeys treated with three different doses of CTX310 formulations (0.5, 1.5 and 3.0 mg / kg) compared to a control group. FIG. 12C is a graph showing the percentage change in plasma ANGPTL3 protein from baseline of cynomolgus monkeys 37 days after CTX310 treatment. FIG. 12D is a graph showing the percentage change in serum ANGPTL3 protein after CTX310 treatment. FIG. 12E is a graph showing the percentage change in plasma ANGPTL3 protein about 3 months after CTX310 treatment. [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 12D] Same as above. [Figure 12E] Same as above. [Figure 13A] Figures 13A-13I show exemplary data regarding triglyceride levels. Figures 13A-13C are graphs showing the percentage change in plasma triglyceride levels normalized to baseline in cynomolgus monkeys after treatment with three different doses of CTX310 formulations: 0.5 mg / kg (Figure 13A), 1.5 mg / kg (Figure 13B) and 3.0 mg / kg (Figure 13C). Figure 13D is a graph showing the percentage change from baseline in plasma triglyceride levels in cynomolgus monkeys 37 days after CTX310 treatment. Figure 13E is a graph showing the percentage change from baseline in serum triglyceride levels one month after CTX310 treatment. Figures 13F-H show the change in triglyceride levels as mg / dL with three different doses of CTX310 formulations: 0.5 mg / kg (Figure 13F), 1.5 mg / kg (Figure 13G), and 3.0 mg / kg (Figure 13H). Figure 13I is a graph showing the percentage change from baseline in plasma triglyceride levels in cynomolgus monkeys after approximately 3 months of CTX310 treatment. [Figure 13B] Same as above. [Figure 13C] Same as above. [Figure 13D] Same as above. [Figure 13E] Same as above. [Figure 13F] Same as above. [Figure 13G] Same as above. [Figure 13H] Same as above. [Figure 13I] Same as above. [Figure 14A] Figure 14A-B show data on the correlation between lipid levels and gene editing. Figure 14A is a plot showing the correlation between triglyceride reduction in liver and ANGPTL3 gene editing percentage. Figure 14B is a plot showing the correlation between ANGPTL3 protein reduction in liver and ANGPTL3 gene editing percentage. [Figure 14B] Same as above. [Figure 15A] 15A-C are graphs showing gene editing efficiency (FIG. 15A), ANGPTL3 protein levels (FIG. 15B), and triglyceride levels (FIG. 15C) in the livers of wild-type (WT), LDLR+ / − mice (Het), and LDLR− / − mice (Hom) treated with two exemplary lipid nanoparticles (RIV-000005 and RIV-000006) containing gRNA targeting the mouse ANGPTL3 gene. ns: not significant. [Figure 15B] Same as above. [Figure 15C] Same as above. [Figure 16A] Figures 16A-H show exemplary data regarding the LDLR pathway. Shown in Figures 16A-D are graphs showing gene editing efficiency in the liver (Figure 16A), ANGPTL3 protein levels (Figure 16B), triglyceride levels (Figure 16C) and LDL levels (Figure 16D) of wild-type (WT), LDLR+ / - mice (Het) and LDLR- / - mice (Hom) treated with three exemplary lipid nanoparticles (RIV-000004, RIV-000005 and RIV-000006) containing gRNA targeting the mouse ANGPTL3 gene. Figures 16E-H show data from LDLR mutant mice one month after administration of RIV-000005. Figure 16E shows editing in the liver, Figure 16F shows reduction in ANGPTL3 protein levels, and Figure 16G shows plasma TG levels in both male and female groups after RIV-000005 treatment compared to untreated control mice. Figure 16H shows that a modest reduction in LDL was observed in female mice administered RIV-000005 compared to control female mice, but a similar effect was not seen in male mice dosed with RIV-000005. [Figure 16B] Same as above. [Figure 16C] Same as above. [Figure 16D] Same as above. [Figure 16E] Same as above. [Figure 16F] Same as above. [Figure 16G] Same as above. [Figure 16H] Same as above. [Figure 17] FIG. 17 shows a non-limiting, exemplary design for a Phase 1 safety and tolerability clinical study for one or more ANGPTL3 gene editing nanoparticles described herein (e.g., CTX310), and how a decision can be made based on the results of the Phase 1 study to proceed to a Phase 2 clinical study. [Figure 18] FIG. 18 shows a non-limiting, exemplary design for a Phase 1 safety and tolerability clinical study for one or more ANGPTL3 gene editing nanoparticles described herein (e.g., CTX310), and how a decision may be made based on the results of the Phase 1 study to proceed to a Phase 2 clinical study. [Figure 19] FIG. 19 shows a non-limiting exemplary Phase 2 clinical study patient population based on dose escalation results (eg, 6 months post-treatment). [Figure 20A] 20A-20B show exemplary data from a non-Good Laboratory Practice (GLP) toxicity study. Shown in FIG. 20A are AST levels at about 3 months post-dosing in animals treated with the indicated dosages. Shown in FIG. 20B are bilirubin levels at about 3 months post-dosing in animals treated with the indicated dosages. [Figure 20B] Same as above. [Figure 21A] 21A-21B show exemplary data for a Good Laboratory Practice (GLP) toxicity study showing AST (FIG. 21A) and bilirubin (FIG. 21B) levels in treated animals. Data is shown for approximately 10 days before and after dosing. [Figure 21B] Same as above. [Figure 22A] Figures 22A-B show EC90 values ​​for editing in vivo (Figure 22A) and in vitro (Figure 22B) studies. [Figure 22B] Same as above. [Diagram 23] FIG. 23 shows an exemplary clinical trial study design. [Figure 24]24 shows non-limiting exemplary data showing reduction of ANGPTL3 plasma protein (ng / mL) with and without pretreatment. N=4 animals per group. Shown are the mean and SD. [Diagram 25] Figure 25 shows results from the same experiment as shown in Figure 24 as percent change in reduction of ANGPTL3 plasma protein with and without pretreatment. N=4 animals per group. Shown are the mean and SD. [Figure 26] Figure 26 shows data from 2 months after dosing. Shown is the reduction in ANGPTL3 plasma protein with and without pretreatment. N=4 animals per group. Shown is the mean and SD. [Figure 27] Figure 27 shows data from 2 months after dosing. Shown is the reduction as percent change in ANGPTL3 plasma protein with and without pretreatment. N=4 animals per group. Shown is the mean and SD. [Figure 28] FIG. 28 shows an exemplary schematic of a Phase I clinical trial design. [Figure 29] FIG. 29 shows a non-limiting, exemplary schematic of CTX310 Good Laboratory Practice (GLP) toxicity in non-human primate (NHP) study design. [Diagram 30] Figure 30 shows non-limiting exemplary data for dose-dependent reduction of ANGPTL3 total plasma protein following administration of CTX310. Data are shown in ng / mL. 0 to 1 month: 8-10 NHPs per group, 1 to 6 months: 5 NHPs per group; mean SD is shown. [Diagram 31] Figure 31 shows the data from Figure 30 as percent change. 0 to 1 month: 8-10 NHPs per group, 1 to 6 months: 5 NHPs per group; mean SD is shown. [Diagram 32] Figure 32 shows the 1 month time point of Figure 31. 8-10 NHPs per group; mean SD shown. [Diagram 33] Figure 33 shows the 6 month time point of Figure 31. 5 NHPs per group; mean SD is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] Detailed Description In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, like symbols typically indicate like components unless the context indicates otherwise. The exemplary embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments are available, and other changes can be made without departing from the spirit and scope of the subject matter presented herein. It is readily understood that the aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein and form a part of the disclosure herein.

[0025] All patents, published patent applications, other publications, and sequences from GenBank and other databases referenced herein are hereby incorporated by reference in their entirety for relevant art.

[0026] Angiopoietin-like 3 (ANGPTL3) protein is a secreted protein that controls plasma lipid levels through affecting lipoprotein lipase- and endothelial lipase-mediated hydrolysis of triglycerides and phospholipids. In humans, ANGPTL3 is a determinant of high-density lipoprotein (HDL) cholesterol levels and non-HDL levels, such as low-density lipoprotein (LDL) cholesterol, triglycerides, and very low-density lipoprotein (VLDL) cholesterol. ANGPTL3 is associated with diseases and disorders involving abnormal lipoprotein metabolism, such as dyslipidemia, hypobetalipoproteinemia, hypercholesterolemia, hypertriglyceridemia, hyperlipidemia, and coronary heart disease. ANGPTL3 may be a promising therapeutic target for the treatment of various ANGPTL3-related diseases and disorders.

[0027] The disclosure herein includes methods, compositions and kits for treating ANGPTL3-related disease or disorder in a subject (e.g., a primate).In some embodiments, the method includes administering to a primate subject in need thereof a plurality of nanoparticles complexed with (a) guide RNA (gRNA) or a nucleic acid encoding gRNA that targets ANGPTL3 gene, and (b) a nucleic acid encoding RNA-guided endonuclease, thereby treating ANGPTL3-related disease or disorder in the primate subject.

[0028] definition As used herein, the term "about" means plus or minus 5% of the indicated value.

[0029] As used herein, the term "RNA-guided endonuclease" refers to a polypeptide that can bind to an RNA (e.g., gRNA) to form a complex that is targeted to a specific DNA sequence (e.g., in a target DNA). A non-limiting example of an RNA-guided endonuclease is a Cas polypeptide (e.g., a Cas endonuclease, e.g., a Cas9 endonuclease). In some embodiments, the RNA-guided endonuclease described herein is targeted to a specific DNA sequence in a target DNA by an RNA molecule that it binds to. The RNA molecule can include a sequence that is complementary to and can hybridize to a target sequence in the target DNA, thereby allowing the targeting of the binding polypeptide to a specific location in the target DNA.

[0030] As used herein, the term "guide RNA" or "gRNA" refers to a site-specific targeting RNA that can bind to an RNA-guided endonuclease to form a complex, and direct the activity of the bound RNA-guided endonuclease (such as Cas endonuclease) to a specific target sequence within a target nucleic acid. A guide RNA can include one or more RNA molecules.

[0031] As used herein, the "secondary structure" of a nucleic acid molecule (e.g., an RNA fragment or a gRNA) refers to base-pairing interactions within the nucleic acid molecule.

[0032] As used herein, the term "target DNA" refers to DNA that includes a "target site" or "target sequence." The term "target sequence" is used herein to refer to a nucleic acid sequence present in a target DNA to which a DNA targeting sequence or segment of a gRNA (also referred to herein as a "spacer") can hybridize, provided sufficient conditions for hybridization exist. For example, the target sequence 5'-GAGCATATC-3' in the target DNA is targeted by (or can hybridize to, or is complementary to) an RNA sequence 5'-GAUAUGCUC-3'. Hybridization between a DNA targeting sequence or segment of a gRNA and a target sequence can be based, for example, on Watson-Crick base pairing rules, which allows for programming in the DNA targeting sequence or segment. A DNA targeting sequence or segment of a gRNA can be designed, for example, to hybridize with any target sequence.

[0033] As used herein, the term "Cas endonuclease" or "Cas nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR adaptive immune system.

[0034] Unless otherwise indicated, "nuclease" and "endonuclease" are used interchangeably herein to refer to enzymes that possess endonucleolytic catalytic activity for polynucleotide cleavage.

[0035] As used herein, the term "invariant region" of gRNA refers to the nucleotide sequence of gRNA that associates with RNA-guided endonuclease. In some embodiments, gRNA comprises crRNA and transactivating crRNA (tracrRNA), where crRNA and tracrRNA hybridize to each other to form a duplex. In some embodiments, crRNA comprises from 5' to 3': spacer sequence and minimal CRISPR repeat sequence (also referred to herein as "crRNA repeat sequence"); tracrRNA comprises minimal tracrRNA sequence and 3'tracrRNA sequence that is complementary to minimal CRISPR repeat sequence (also referred to herein as "tracrRNA anti-repeat sequence"). In some embodiments, invariant region of gRNA refers to the part of crRNA that is minimal CRISPR repeat sequence and tracrRNA.

[0036] As used herein, the term "donor template" refers to a nucleic acid strand that contains exogenous genetic material that can be introduced into genome (e.g., by homology directed repair) to cause targeted integration of exogenous genetic material.In some embodiments, donor template may not have a region of homology at the targeted position in DNA, and can be integrated by NHEJ-dependent end joining following cleavage at the target site.Donor template can be DNA or RNA, single-stranded or double-stranded, and can be introduced into cell in linear or circular form.

[0037] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to any length polymeric form of nucleotides, either ribonucleotides or deoxyribonucleotides. A polynucleotide may be single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrid / triple helix or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

[0038] As used herein, the term "binding" refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). During a non-covalent interaction, the macromolecules are said to be "associated" or "interacting" or "binding" (e.g., when molecule X is said to interact with molecule Y, it means that molecule X binds to molecule Y in a non-covalent manner). A binding interaction is characterized by a dissociation constant (Kd), e.g., 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M, 10 -14 M, 10 -15 The binding affinity may be characterized by a Kd of, or less than, M or a number or range between any two of these values. Kd may depend on environmental conditions, such as pH and temperature. "Affinity" refers to the strength of binding, with increased binding affinity correlating with a decreased Kd.

[0039] As used herein, the term "hybridizing" or "hybridization" refers to the pairing of substantially complementary or complementary nucleic acid sequences in two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence links with a substantially or completely complementary sequence through base pairing to form a hybridization complex. "Hybridizing" or "hybridization" can include denaturing a molecule to destroy the intramolecular structure(s) in the molecule [e.g., secondary structure(s)]. In some embodiments, denaturing a molecule includes heating a solution containing the molecule to a temperature sufficient to destroy the intramolecular structure of the molecule. In some cases, denaturing a molecule includes adjusting the pH of a solution containing the molecule to a pH sufficient to destroy the intramolecular structure of the molecule. For the purposes of hybridization, two nucleic acid sequences or segments of a sequence are "substantially complementary" when at least 80% of their individual bases are complementary to each other. In some embodiments, a splint oligonucleotide sequence is not more than about 50% identical to one of the two polynucleotides (e.g., RNA fragments) that it is designed to be complementary to. The complementary portions of each sequence may be referred to herein as "segments," and segments are substantially complementary if they have 80% or more identity.

[0040] The terms "complementary" and "complementary" mean that a nucleic acid can form hydrogen bond(s) with another nucleic acid according to the traditional Watson-Crick base pairing rules, i.e., adenine (A) pairs with thymine (U) and guanine (G) pairs with cytosine (C). Complementarity can be perfect (e.g., fully complementary) or less than perfect (e.g., partial complementarity). Perfect or complete complementarity indicates that each and every nucleic acid base of one strand can form hydrogen bonds with corresponding bases in another antiparallel nucleic acid sequence according to the Watson-Crick base pairing criteria. Partial complementarity indicates that only a portion of the contiguous residues of a nucleic acid sequence can form Watson-Crick base pairs with the same number of contiguous residues in another antiparallel nucleic acid sequence. In some embodiments, complementarity can be at least 70%, 80%, 90%, 100%, or a number or range between any two of these values. In some embodiments, the complementarity is perfect, i.e., 100%, e.g., a complementary candidate sequence segment is perfectly complementary to a candidate sequence segment, the sequence of which can be deduced from the candidate sequence segment using Watson-Crick base pairing rules.

[0041] As used herein, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to any nucleic acid that is composed of phosphodiester linkage or modified linkage, such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sultone linkage, and combinations of such linkages.The terms "nucleic acid" and "polynucleotide" also explicitly include nucleic acid that is composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0042] As used herein, the term "transfection" or "infection" refers to the introduction of a nucleic acid into a host cell, such as by contacting the cell with a liposome or nanoparticle (e.g., a lipid nanoparticle) described herein.

[0043] As used herein, "treatment" refers to clinical intervention that is performed in response to a disease, disorder or physiological condition that is indicated by a patient or that a patient is susceptible to.The purpose of treatment includes, but is not limited to, alleviating or preventing symptoms, slowing or stopping the progression or worsening of a disease, disorder or condition, and / or relieving a disease, disorder or condition."Treatment" refers to either or both of therapeutic treatment and preventive or preventive measures.Those in need of treatment include those who already suffer from a disease or disorder or undesirable physiological condition, and those who are to be prevented from a disease or disorder or undesirable physiological condition.

[0044] As used herein, the term "effective amount" or "pharmacologically effective amount" or "therapeutically effective amount" refers to an amount sufficient to effect beneficial or desired biological and / or clinical results.

[0045] As used herein, the term "pharmaceutical acceptable excipient" refers to any suitable substance that provides a pharmaceutically acceptable carrier, excipient, or diluent for administration of a compound(s) of interest to a subject. Pharmaceutically acceptable excipients can include substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable excipients, and pharmaceutically acceptable carriers.

[0046] As used herein, "subject" refers to an animal for which diagnosis, treatment or therapy is desired. In some embodiments, the subject is a mammal. As used herein, "mammal" refers to an individual belonging to the class Mammalia, including but not limited to humans, domestic and farm animals, zoo animals, sports animals and pets. Non-limiting examples of mammals include mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cows; horses; primates, such as monkeys, chimpanzees and apes, and in particular, humans. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. In some aspects, the subject has or is suspected of having an ANGPTL3-related disease or disorder.

[0047] As used herein, the term "plasma level" in the context of a molecule refers to the concentration or amount of the molecule, e.g., the number of moles or weight of the molecule present in a given volume of plasma.

[0048] ANGPTL3 is a secreted protein that controls plasma lipid levels through affecting lipoprotein lipase- and endothelial lipase-mediated hydrolysis of triglycerides and phospholipids. ANGPTL3 is associated with diseases and disorders involving abnormal lipoprotein metabolism, such as dyslipidemia, hypobetalipoproteinemia, hyperlipidemia, hypertriglyceridemia, and familial hypercholesterolemia. There is a need for novel gene therapy that can stably reduce blood ANGPTL3 protein and lipid (e.g., cholesterol, HDL, LDL, triglycerides, and non-HDL) levels over a long period of time, or can sustainably reduce ANGPTL3 protein levels. The present disclosure provides highly efficient gene editing methods and related compositions and kits that directly target the ANGPTL3 gene or its variants and sustainably reduce the expression, function, or activity of the ANGPTL3 gene. In some embodiments, the methods, compositions, and kits described herein can reduce plasma ANGPTL3 protein levels by at least 70% or more. In some embodiments, lipid levels (e.g., triglycerides) after carrying out the method can be reduced to 40mg / dL or less.The gRNA sequence used herein can also significantly minimize the number and frequency of off-target effects, thereby reducing the risk of genotoxicity.The methods, compositions and kits described herein can be used to treat ANGPTL3-related diseases or disorders in subjects.

[0049] Angiopoietin-like protein 3 (ANGPTL3) Provided herein include vectors, compositions, methods and kits for editing ANGPTL3 gene or its variant in cell genome to regulate (e.g., reduce) expression, function or activity of ANGPTL3 gene in cells.The vectors, compositions, methods and kits described herein can be particularly useful for treating ANGPTL3-related diseases and conditions, such as dyslipidemia, hypobetalipoproteinemia, familial hypercholesterolemia, hypertriglyceridemia, familial combined hyperlipidemia, familial chylomicronemia syndrome and multifactorial chylomicronemia syndrome, by sustainably reducing the levels of ANGPTL3 protein, ApoB protein and lipids, such as total cholesterol, triglycerides, LDL, HDL and / or other non-HDL, in blood.

[0050] The ANGPTL3 gene encodes the ANGPTL3 protein, a member of a family of secreted proteins that function in angiogenesis. The ANGPTL3 protein, which is primarily expressed in the liver, contains a characteristic signal peptide sequence, an N-terminal helical domain (predicted to form dimeric or trimeric coiled-coil structures) and a C-terminal globular fibrinogen homology domain. The N-terminal coiled-coil region influences plasma triglyceride levels through reversibly inhibiting the catalytic activity of lipoprotein lipase. The fibrinogen-like domain binds to the integrin αvβ3 receptor and influences angiogenesis. The short linker region between the N- and C-terminal domains functions as a furin cleavage site. In secretion, ANGPTL3 targets adipose tissue and muscle, activating lipolysis in the former and increasing the release of fatty free acids and glycerol from adipocytes, and inhibiting lipoprotein lipase in the latter, increasing triglyceride-rich lipoproteins.

[0051] ANGPTL3 acts as a dual inhibitor of lipoprotein lipase (LPL) and endothelial lipase (EL), and is considered a potent regulator of plasma triglycerides, low-density lipoprotein (LDL) cholesterol, and high-density lipoprotein (HDL) cholesterol. Experimental evidence has shown that individuals with loss-of-function mutations in the ANGPTL3 gene suffer from familial combined hypolipidemia, characterized by very low levels of apolipoprotein B, apolipoprotein A1, and their associated lipoproteins (e.g., very low-density lipoprotein, LDL, and HDL) compared with individuals without the mutation. These subjects are protected from cardiovascular events, and therefore ANGPTL3 is an important pharmacological target for reducing cardiovascular risk.

[0052] The ANGPTL3 gene (also known as ANL3, ANG-5, FHBL2 and ANGPT5) has a cytogenetic location of lp31.3 with genomic coordinates chromosome 1, forward strand, positions 62,597,520-62,606,313. The nucleotide sequence of ANGPTL3 can be found on the NCBI website, NCBI Reference Sequence: NC_000001.11. USP1 is the upstream gene of ANGPTL3 on the forward strand, and ATG4C is the downstream gene of ANGPTL3 on the forward strand. DOCK7 is a gene located on the reverse strand opposite ANGPTL3. ANGPTL3 has NCBI gene ID 27329, Uniprot ID Q9Y5C1 and Ensembl Gene ID ENSG00000132855. ANGPTL3 has 2 SNPs, 9 introns and 12 exons. Additional information about the ANGPTL3 gene, including exons, introns and exon start / stop sites, as well as information about the transcript of the ANGPTL3 gene, is described in detail in WO2018154387, the contents of which are incorporated herein by reference.

[0053] Gene editing The present disclosure includes methods, compositions and kits for editing the ANGPTL3 gene, thereby reducing the expression level of ANGPTL3 protein (e.g., plasma concentration of ANGPTL3 protein), the level of ApoB protein (e.g., plasma concentration of ApoB protein) and lipid levels (e.g., or triglycerides, LDL, HDL and non-HDL, etc.) in a subject. Gene editing (including genome editing) is a type of genetic engineering in which nucleotide(s) / nucleic acid(s) are inserted, deleted and / or replaced in a DNA sequence, such as the genome of a targeted cell. Targeted gene editing allows insertion, deletion and / or replacement at a preselected site (e.g., in a targeted gene or targeted DNA sequence) in the genome of a targeted cell. For example, when the sequence of an endogenous gene is edited by deleting, inserting or replacing nucleotide(s) / nucleic acid(s), the endogenous gene containing the affected sequence may be knocked out or knocked down due to sequence modification. Thus, targeted editing can be used to disrupt endogenous gene expression. "Targeted integration" refers to a process involving the insertion of one or more exogenous sequences with or without the deletion of endogenous sequences at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing the exogenous sequences is present.

[0054] Targeted editing can be achieved either through nuclease-independent approach or through nuclease-dependent approach. In the nuclease-independent targeted editing approach, homologous recombination is guided by the homologous sequence adjacent to the exogenous polynucleotide that is introduced into the endogenous sequence through the enzyme machinery of the host cell. The exogenous polynucleotide can introduce deletion, insertion or replacement of nucleotides into the endogenous sequence.

[0055] Alternatively, nuclease-dependent approaches can achieve high-frequency targeted editing through specific introduction of double-strand breaks (DSBs) by specific low-frequency cleavage nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ), which occurs in response to DSBs. DNA repair by NHEJ often results in random insertion or deletion (indels) of a small number of endogenous nucleotides. In contrast to NHEJ-mediated repair, repair can also occur by homology-directed repair (HDR). If a donor template containing exogenous genetic material is present adjacent to a pair of homologous arms, the exogenous genetic material is introduced into the genome by HDR, resulting in targeted integration of the exogenous genetic material.

[0056] Available endonucleases that can introduce specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; clustered regularly interspaced short palindromic repeats associated 9). Additionally, the DICE (dual integrase cassette exchange) system, which utilizes phiC31 and Bxb1 integrases, can also be used for targeted integration.

[0057] ZFN is a targeted nuclease that comprises a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that binds to DNA in a sequence-specific manner through one or more zinc fingers.Zinc finger is a domain of about 30 amino acids in the zinc finger binding domain, whose structure is stabilized through the coordination of zinc ion.Examples of zinc finger include, but are not limited to, C2H2 zinc finger, C3H zinc finger and C4 zinc finger.Designed zinc finger domain is a non-naturally occurring domain whose design / composition mainly results from rational criteria, such as the application of computerized algorithms on the processing information in database-stored information of existing ZFP design and binding data. For example, see U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536 and WO03 / 016496, the contents of which are incorporated by reference in their entirety. The selected zinc finger domain is a domain that is not found in nature, whose production mainly results from empirical processes such as phage display, interaction trap or hybrid selection. ZFNs are described in detail in U.S. Patent Nos. 7,888,121 and 7,972,854. The most recognized example of ZFN is the fusion of FokI nuclease with zinc finger DNA binding domain.

[0058] TALENs are targeted nucleases that contain a nuclease fused to a TAL effector DNA binding domain. A "transcription activator-like effector DNA binding domain", "TAL effector DNA binding domain" or "TALE DNA binding domain" is a polypeptide domain of a TAL effector protein that is responsible for binding the TAL effector protein to DNA. TAL effector proteins are secreted during infection by plant pathogens of the genus Xanthomonas. These proteins enter the nucleus of plant cells, bind to effector-specific DNA sequences via their DNA binding domain, and activate gene transcription at these sequences via their transactivation domain. TAL effector DNA binding domain specificity depends on the effector-variable number of imperfect 34 amino acid repeats, which contain polymorphisms at selected repeat positions called repeat variable-diresidues (RVDs). TALENs are described in more detail in US2011 / 0145940. The art-recognized example of a TALEN is a polypeptide fusion of FokI nuclease to a TAL effector DNA binding domain.

[0059] Additional examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wb / SPBc / TP901-1, whether used individually or in combination. Other non-limiting examples of targeted nucleases include naturally occurring and recombinant nucleases, such as CRISPR / Cas9, restriction endonucleases, meganucleases homing endonucleases, and the like.

[0060] CRISPR-Cas gene editing system and RNA-guided nucleases In some embodiments, the vectors, compositions, methods and kits described herein may be used in gene editing systems, such as the CRISPR-Cas gene editing system, to genetically edit the ANGPTL3 gene. For example, the CRISPR-Cas9 system is a defense mechanism naturally occurring in prokaryotes that has been repurposed as an RNA-guided DNA-targeting platform used for gene editing. It relies on the DNA nuclease Cas9 and two non-coding RNAs-crisprRNA (crRNA) and transactivating RNA (tracrRNA) to target cleavage of DNA. The crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing at a typically 20 nucleotide (nt) sequence in the target DNA. The CRISPR-Cas9 complex will only bind to DNA sequences that contain a sequence match to the first 20 nt of the crRNA, the single guide RNA (sgRNA), if the target sequence is followed by a specific short DNA motif (with the sequence NGG) called the protospacer adjacent motif (PAM). TracrRNA hybridizes with the 3' end of crRNA and forms an RNA duplex structure to which Cas9 endonuclease binds to form a catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA. When the CRISPR-Cas9 complex binds to DNA at the target site, two independent nuclease domains in the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, resulting in a double-stranded break (DSB) where both strands of DNA terminate with base pairs (blunt ends). The next critical step after the binding of the CRISPR-Cas9 complex to DNA at a specific target site and the formation of a site-specific DSB is the repair of the DSB. Cells use two main DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homology-directed repair (HDR). In some embodiments, the CRISPR-Cas9 gene editing system comprises an RNA-guided nuclease and one or more guide RNAs that target one or more target genes.

[0061] As described herein, an RNA-guided endonuclease may be naturally occurring or non-naturally occurring. Non-limiting examples of RNA-guided endonucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3. , Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cpf1 endonucleases and their functional derivatives. In some cases, the RNA-guided endonuclease is a Cas9 endonuclease. The Cas9 endonuclease can be, for example, from Streptococcus pyogenes (SpyCas9), Staphylococcus lugdunensis (SluCas9) or Staphylococcus aureus (SaCas9). In some embodiments, the RNA-guided endonuclease is a mutant of Cas9, including but not limited to small Cas9, dead Cas9 (dCas9) and Cas9 nickase. In some embodiments, the Cas nuclease may include RuvC or RuvC-like nuclease domain (e.g., Cpf1) and / or HNH or HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 endonuclease is Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9 or mutants thereof.

[0062] The RNA-guided endonuclease can be a small RNA-guided endonuclease.The small RNA-guided endonuclease can be engineered from a part of the RNA-guided endonuclease from any of the RNA-guided endonucleases described herein and known in the art.The small RNA-guided endonuclease can be, for example, a small Cas endonuclease.In some cases, the small RNA-guided nuclease is less than about 1,100 amino acids in length.

[0063] The RNA-guided endonuclease may be a mutant RNA-guided endonuclease. For example, the RNA-guided endonuclease may be a mutant of a naturally occurring RNA-guided endonuclease. The mutant RNA-guided endonuclease may also be a mutant RNA-guided endonuclease with altered activity compared to a naturally occurring RNA-guided endonuclease, such as altered endonuclease activity (e.g., altered or suppressed DNA endonuclease activity without substantially decreasing binding affinity to DNA). Such modifications may allow the mutant RNA-guided endonuclease to sequence-specific DNA targeting for the purpose of transcriptional regulation (e.g., activation or repression), epigenetic modification or chromatin modification by methylation, demethylation, acetylation or deacetylation, or any other modification of DNA-binding and / or DNA-modifying proteins known in the art. In some embodiments, the mutant RNA-guided endonuclease does not have DNA endonuclease activity.

[0064] The RNA-guided endonuclease can be a nickase that cleaves the complementary strand of the target DNA but has a reduced ability to cleave the non-complementary strand of the target DNA, or that cleaves the non-complementary strand of the target DNA but has a reduced ability to cleave the complementary strand of the target DNA. In some embodiments, the RNA-guided endonuclease has a reduced ability to cleave both the complementary and non-complementary strands of the target DNA.

[0065] In some embodiments, the nucleic acid encoding the RNA-guided endonuclease is administered to the subject. In some embodiments, the nucleic acid can be generated by an in vitro transcription reaction. In some embodiments, generating the in vitro transcribed RNA comprises incubating a linear DNA template with an RNA polymerase and a nucleotide mixture under conditions that allow (run-off) RNA in vitro transcription. The nucleotide mixture can be part of an in vitro transcription mix (IVT mix). In some embodiments, the RNA polymerase is T7 RNA polymerase.

[0066] The nucleotide mixture used in RNA in vitro transcription may additionally contain modified nucleotides as defined below. In some embodiments, the nucleotide mixture (e.g., the fraction of each nucleotide in the mixture) used for RNA in vitro transcription reaction can be optimized for a given RNA sequence (optimized NTP mix). Such a method is described, for example, in WO2015 / 188933. The RNA obtained by using the optimized NTP mix is, in some embodiments, characterized by reduced immunostimulatory properties.

[0067] In some embodiments, the nucleotide mixture is composed of (chemically) unmodified ribonucleoside triphosphates (NTPs) GTP, ATP, CTP and UTP. In some embodiments, the in vitro transcription may include the presence of at least one cap analog, such as the cap1 trinucleotide cap analog, m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG, m7G(5')ppp(5')(2'OMeA)pG or rn7(3'OMeG)(5')ppp(5')(2'OMeA)pG. In some embodiments, the 5'-cap structure is formed via enzymatic capping using a capping enzyme (e.g., vaccinia virus capping enzyme and / or a cap-dependent 2'-O-methyltransferase) that generates a cap0 or cap1 or cap2 structure. The 5'cap structure (cap0 or cap1) can also be added using immobilized capping enzymes and / or cap-dependent 2'-O-methyltransferases using the methods and means disclosed in WO2016 / 193226. In some embodiments, some or all of at least one (ribo)nucleoside triphosphate is replaced by a modified nucleoside triphosphate. In some embodiments, the modified nucleoside triphosphate comprises pseudouridine (ψ), N1-methylpseudouridine (m1 ψ), 5-methylcytosine or 5-methoxyuridine. In some embodiments, uracil nucleotides in the nucleotide mixture are replaced (either partially or completely) by pseudouridine (ψ) and / or N1-methylpseudouridine (m1 ψ) to obtain modified RNA. In some embodiments, the chemically modified nucleotide is pseudouridine (ψ). In some embodiments, the chemically modified nucleotide is N1-methylpseudouridine (m1ψ). In some embodiments, the nucleotide mixture comprises at least one modified nucleotide and / or at least one nucleotide analog or nucleotide derivative for incorporation into RNA. For example, the modified nucleotide as defined herein may comprise a nucleotide analog / modification, such as a backbone modification, a sugar modification, or a base modification.The backbone modification may include a modification in which the phosphate of the backbone of the nucleotide is chemically modified. The sugar modification may include a chemical modification of the sugar of the nucleotide. Furthermore, the base modification may include a chemical modification of the base portion of the nucleotide. In this context, the nucleotide analog or modification may include a nucleotide analog that is applicable to transcription and / or translation. In some embodiments, the nucleotide mixture includes at least one modified nucleotide, and / or the at least one nucleotide analog is selected from a backbone-modified nucleotide, a sugar-modified nucleotide, and / or a base-modified nucleotide, or a combination thereof.

[0068] Modified nucleosides and nucleotides that may be included in the nucleotide mixture and incorporated into RNA may be modified at the sugar moiety. For example, the 2' hydroxy group (OH) may be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxy group modifications include, but are not limited to, alkoxy or aryloxy (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycol (PEG), -O(CHCH 20)nCH2CH2OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is tethered to the 4' carbon of the same ribose sugar, for example, by a methylen bridge; and amino groups (-O-amino, where the amino group can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy. "Deoxy" modifications include hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or the amino group can be attached to the sugar through a linker, where the linker includes one or more of C, N, and O atoms. The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified RNA molecules can include, for example, nucleotides that contain arabinose as the sugar.

[0069] The phosphate backbone may be further modified in modified nucleosides and nucleotides that may be included in the nucleotide mixture and incorporated into modified in vitro transcribed RNA. The backbone phosphate group may be modified by replacing one or more oxygen atoms with various substitutes. In addition, modified nucleosides and nucleotides may also include the complete replacement of unmodified phosphate moieties with modified phosphates as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linked oxygens replaced by sulfur. Phosphate linkers may be modified by replacing the linking oxygen with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0070] The nucleotide described herein may be modified in nucleobase portion.Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine and uracil.For example, the nucleosides and nucleotides described herein may be chemically modified on the major groove surface.In some embodiments, the major groove chemical modification includes amino group, thiol group, alkyl group or halo group.

[0071] In some embodiments, the nucleotide analog / modification is 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, phosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo(lodo)-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5- Iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'- triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, xanthosine-5'-triphosphate. Base-modified nucleotides include 5-methylcytidine-5'-triphosphate,7-Deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine 1-Taurinomethyl-pseudouridine, 5-Taurinomethyl-2-thio-uridine, 1-Taurinomethyl-4-thio-uridine, 5-Methyl-uridine, 1-Methyl-pseudouridine, 4-Thio-1-methyl-pseudouridine, 2-Thio-1-methyl-pseudouridine, 1-Methyl-1-deaza-pseudouridine, 2-Thio-1-methyl-1-deaza-pseudouridine, Dihydrouridine, Dihydropseudouridine, 2-Thio-dihydrouridine, 2-Thio-dihydropseudouridine, 2-Methoxyuridine, 2-Methoxy-4 -Thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza -pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine,7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine and and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl 1-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseudouridine, 6-aza-cytidine, 2-thio-cytidine, alpha-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-u-cytidine, alpha-thio ... Lysine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, alpha-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, alpha-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytdine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine,It may include pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, alpha-thio-adenosine, 8-azido-adenosine or 7-deaza-adenosine.

[0072] The at least one modified nucleotide and / or the at least one nucleotide analogue may be 1-methyl adenosine, 2-methyl adenosine, N6-methyl adenosine, 2'-O-methyl adenosine, 2-methylthio-N6-methyl adenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl-N 6-Threonylcarbamoyl adenosine, N6-Hydroxynorvalylcarbamoyl adenosine, 2-Methylthio-N6-hydroxynorvalylcarbamoyl adenosine, Inosine, 3-Methylcytidine, 2-O-Methylcytidine, 2-Thiocytidine, N4-Acetylcytidine, Lysidine, 1-Methylguanosine, 7-Methylguanosine, 2'-O-Methylguanosine, Queuosine, Epoxyqueuosine, 7-Cyano-7-Deazaguanosine, 7-Amino The uridine may include 5-aminomethyl-7-deazaguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine', 5-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0073] In some embodiments, the chemical modification comprises pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyluridine.

[0074] In some embodiments, 100% of the uracils in the coding sequence as defined herein may have a chemical modification. In some embodiments, the chemical modification is at the 5' position of the uracil. In some embodiments, 100% of the uracils in the coding sequence (cds) of the RNA may have a chemical modification, for example, a chemical modification at the 5' position of the uracil. In other embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the uracil nucleotides in the cds have a chemical modification, for example, a chemical modification at the 5' position of the uracil nucleotide. Such modifications can reduce the stimulation of the innate immune system (after in vivo administration of the RNA containing such modified nucleotides).

[0075] As used herein, the term "cds" or "coding sequence" or "coding region" is recognized and understood by those skilled in the art and may refer to, for example, a sequence of several nucleotide triplets that can be translated into a peptide or protein. The cds of an RNA may contain at least one modified nucleotide, wherein the at least one modified nucleotide may be selected from pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine, and 5-methoxyuridine.

[0076] As used herein, the term "modified nucleotides" or "chemically modified nucleotides" can refer to all possible natural and non-natural chemical modifications of the building blocks of RNA, i.e., ribonucleotides A, G, C and U.

[0077] In various embodiments, the nucleotide mixture in the in vitro transcription reaction includes a cap analog. Thus, in some embodiments, the cap analog is cap0, cap1, cap2, a modified cap0 or modified cap1 analog, or a cap1 analog described below.

[0078] As used herein, the term "cap analog" or "5'-cap structure" may refer to the 5' structure of an RNA, particularly a guanine nucleotide located at the 5' end of an RNA, such as an mRNA. In some embodiments, the 5'-cap structure is tethered to the RNA via a 5'-5'-triphosphate linkage. In some embodiments, a "5'-cap structure" or "cap analog" is not considered to be a "modified nucleotide" or a "chemically modified nucleotide". 5'-cap structures that may be suitable include cap0 (methylation of the first nucleobase, e.g., m7GpppN), cap1 (additional methylation of the ribose of the nucleotide adjacent to m7GpppN), cap2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), cap3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), cap4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse cap analog), modARCA (e.g., phosphothioate modARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.

[0079] 5'-cap (cap0 or cap1) structures can be formed in chemical RNA synthesis using capping enzymes or in RNA in vitro transcription (co-transcriptional capping) using cap analogs. As used herein, the term "cap analog" can refer to a non-polymerizable di- or tri-nucleotide with cap function that facilitates translation or localization and / or prevents RNA degradation when incorporated at the 5' end of an RNA. Non-polymerizable means that the cap analog does not have a 5' triphosphate and is therefore only incorporated at the 5' end, and therefore cannot be extended in the 3' direction by a template-dependent polymerase (e.g., a DNA-dependent RNA polymerase). Examples of cap analogs include m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetric cap analogs (e.g., m7Gpppm7G) or anti-reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives). Further cap analogues have been previously described, for example, in WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347 and WO2013 / 059475. Further suitable cap analogues in this context are described, for example, in WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 053297, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797, the disclosures relating to cap analogues of which are incorporated herein by reference.

[0080] In some embodiments, the cap1 structure is generated using tri-nucleotide cap analogs disclosed in WO2017 / 053297, WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797. For example, any cap analog derived from the structure disclosed in claims 1-5 of WO2017 / 053297 may be suitably used to co-transcriptionally generate the cap1 structure. In some embodiments, any cap analog derived from the structure described in WO2018 / 075827 may be suitably used to co-transcriptionally generate the cap1 structure. In some embodiments, the cap1 analog is a cap1 trinucleotide cap analog. In some embodiments, the cap1 structure of the in vitro transcribed RNA is formed using co-transcriptional capping with the tri-nucleotide cap analog m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG. In some embodiments, the cap1 analog is m7G(5')ppp(5')(2'OMeA)pG.

[0081] In some embodiments, the RNA (e.g., mRNA) comprises a 5'cap structure, e.g., a cap1 structure. In some embodiments, the 5'cap structure improves the stability and / or expression of the mRNA. mRNA (e.g., produced by in vitro transcription) comprising a cap1 structure has several advantageous properties, including increased translation efficiency and reduced stimulation of the innate immune system. In some embodiments, the in vitro transcribed RNA comprises at least one coding sequence that encodes at least one peptide or protein. In some embodiments, the protein is an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is Cas9 or a derivative thereof.

[0082] The present disclosure provides an optimized mRNA encoding Streptococcus pyogenes (Cas9) endonuclease ("SpCas9 mRNA"), optionally including chemically modified nucleotides, that results in effective genome editing of a target cell population when administered with one or more gRNAs. In some embodiments, the disclosure provides an mRNA that includes: (i) a 5' untranslated region (UTR); (ii) an open reading frame (ORF) that includes a nucleotide sequence encoding a site-specific endonuclease; and (iii) a 3' untranslated region (UTR). In some embodiments, the site-specific endonuclease is a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide is a Streptococcus pyogenes-derived Cas9 (SpCas9) polypeptide. In some embodiments, the ORF further includes one or more nucleotide sequences encoding a nuclear localization signal, such as those described herein. In some embodiments, the ORF includes one or more nucleotide sequences encoding a site-specific endonuclease, such as a SpCas9 polypeptide, as well as nucleoplasmin and / or SV40 The ORF comprises a nucleotide sequence encoding at least one NLS that is an NLS. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal and / or C-terminal NLS that is operably linked to a site-specific endonuclease such as SpCas9 polypeptide. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal SV40 NLS that is operably linked to a site-specific endonuclease such as SpCas9 polypeptide, and a nucleotide sequence encoding a C-terminal nucleoplasmin NLS that is operably linked to a site-specific endonuclease such as SpCas9 polypeptide.

[0083] In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the mRNA comprises a codon-optimized sequence that comprises a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 17.

[0084] In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 16.

[0085] In some embodiments, the mRNA may contain at least one chemically modified nucleoside and / or nucleotide. In some embodiments, the chemically modified nucleoside is selected from pseudouridine, N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the chemically modified nucleoside is N1-methylpseudouridine (e.g., 1-methylpseudouridine). In some embodiments, at least about 80% or more (e.g., about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) of the uridines in the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, 100% of the uridines (e.g., uracil) in the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 16, wherein 100% of the uridines or uracils of the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 6 0, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800 or more) uridine or uracil residues are N1-methylpseudouridine.

[0086] In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that has one, two, three, four or five mismatches to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 18.

[0087] In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that has one, two, three, four or five mismatches to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence that is 100% identical to the nucleotide sequence of SEQ ID NO: 19.

[0088] In some embodiments, the disclosure provides an mRNA comprising a nucleotide sequence 100% identical to the nucleotide sequence of SEQ ID NO: 16, wherein 100% of the uridines (e.g., uracils) of the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, the disclosure provides an mRNA comprising or consisting of the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the disclosure provides an mRNA comprising or consisting of the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the mRNA may further comprise a 5'cap, such as those described herein. In some embodiments, the 5'cap is a cap-0, cap-1 or cap-2 structure. SEQ ID NO: 17 is a non-limiting exemplary parent Cas9 mRNA sequence. SEQ ID NOs: 18 and 19 are codon-optimized sequences derived from the parent Cas9 mRNA, where some u's in SEQ ID NOs: 18 and 19 are N1-methylpseudouridines.

[0089] Guide RNA (gRNA) In some embodiments, the CRISPR / Cas-mediated gene editing system used to genetically edit the ANGPTL3 gene comprises a genomic targeting nucleic acid (e.g., guide RNA) that can direct the activity of an RNA-guided endonuclease to a specific target sequence in the ANGPTL3 gene. The guide RNA comprises at least a spacer sequence that hybridizes to the target nucleic acid sequence of interest and the CRISPR repeat sequence. The gRNA can be a single-molecule guide RNA (sgRNA) or a double-molecule guide RNA. The RNA-guided endonuclease can be, for example, a Cas endonuclease, including a Cas9 endonuclease. The Cas9 endonuclease can be, for example, a SpyCas9, SaCas9 or SluCas9 endonuclease. In some embodiments, the RNA endonuclease is a Cas9 mutant. In some embodiments, the RNA-guided endonuclease is a small RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a small Cas endonuclease.

[0090] In some embodiments, the gRNA comprises from 5' to 3': crRNA and tracrRNA, where the crRNA and tracrRNA hybridize to form a duplex. In some embodiments, the crRNA comprises a spacer sequence and a crRNA repeat sequence that can target a target sequence in a target nucleic acid (e.g., a genomic DNA molecule). In some embodiments, the tracrRNA comprises a tracrRNA anti-repeat sequence and a 3' tracrRNA sequence. In some embodiments, the 3' end of the crRNA repeat sequence is linked to the 5' end of the tracrRNA anti-repeat sequence, for example, by a tetraloop, where the crRNA repeat sequence and the tracrRNA anti-repeat sequence hybridize to form an sgRNA. In some embodiments, the sgRNA comprises from 5' to 3': a spacer sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA anti-repeat sequence and a 3' tracrRNA sequence. In some embodiments, the sgRNA comprises a 5' spacer extension sequence. In some embodiments, the sgRNA comprises a 3' tracrRNA extension sequence. The 3'tracrRNA may comprise or consist of one or more stem loops, e.g., one, two, three or more stem loops.

[0091] In some embodiments, the invariant sequence of the sgRNA comprises a nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 1), or a nucleotide sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 nucleotide deletions, insertions, or substitutions compared to SEQ ID NO: 1. In some embodiments, the sgRNA is for use in conjunction with a SpyCas9 endonuclease.

[0092] The guide RNA disclosed herein can target any sequence of interest via a spacer sequence in the crRNA. The spacer sequence in the gRNA is a sequence (e.g., a 20 nucleotide sequence) that defines a target sequence (e.g., a DNA target sequence such as a genomic target sequence) of a target gene of interest (e.g., the ANGPTL3 gene). In some embodiments, the spacer sequence ranges from 15 to 30 nucleotides. For example, the spacer sequence can be, can be about, can be at least, or can be up to 10, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50 nucleotides in length, or any number or range between these values. In some embodiments, the spacer sequence contains 20 nucleotides. In some embodiments, the gRNA can hybridize to the forward strand of the target dsDNA. In some embodiments, the gRNA can hybridize to the reverse strand of the target dsDNA.

[0093] The terms "target nucleic acid", "target site" and "target sequence" may be used interchangeably throughout and may refer to any nucleic acid sequence that can be targeted by the gRNA sequence described herein. In some embodiments, the "target sequence" is adjacent to the PAM sequence and is in the target gene, which is the sequence that is modified by the RNA-guided nuclease (e.g., Cas9). The "target sequence" is in the so-called PAM strand in the "target nucleic acid", which is a double-stranded molecule containing the PAM strand and a complementary non-PAM strand. Those skilled in the art will recognize that the gRNA spacer sequence hybridizes to a complementary sequence located in the non-PAM strand of the target nucleic acid of interest. Thus, the gRNA spacer sequence is the RNA equivalent of the target sequence. The spacer of the gRNA interacts with the target nucleic acid of interest in a sequence-specific manner through hybridization (i.e., base pairing). Thereby, the nucleotide sequence of the spacer varies depending on the target sequence of the target nucleic acid of interest. In some embodiments, the target sequence of the ANGPTL3 gene is within exon 1, 2, 3, 4, 5, 6, or 7 of the ANGPTL3 gene. In some embodiments, the target sequence of the ANGPTL3 gene is within exon 1 of the ANGPTL3 gene. In some embodiments, the spacer of the gRNA binds complementarily to a target sequence located at chr1:62597719-62597738(-) (without PAM) or at chr1:62597716-62597738(-) (with PAM).

[0094] In the CRISPR / Cas system used herein, the spacer sequence is designed to hybridize to the region of the target nucleic acid located 5' of the PAM that can be recognized by the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have a mismatch. Each Cas9 enzyme has a specific PAM sequence in the target DNA that it recognizes. For example, Streptococcus pyogenes recognizes the PAM that contains the sequence 5'-NRG-3' in the target nucleic acid, where R contains either A or G, and N is any nucleotide, and N is immediately 3' of the target nucleic acid sequence that is targeted by the spacer sequence.

[0095] In some embodiments, the target nucleic acid sequence is 20 nucleotides in length. In some embodiments, the target nucleic acid is less than 20 nucleotides in length. In some embodiments, the target nucleic acid is more than 20 nucleotides in length. In some embodiments, the target nucleic acid is at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid is at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' to the first nucleotide of the PAM. For example, 5'-NNNNNNNNNNNNNNNNNNNN NRG In sequences that include -3', the target nucleic acid may be a sequence corresponding to N, where N may be any nucleotide, and the underlined NRG sequence (R is G or A) is the S. pyogenes PAM. In some embodiments, the PAM sequence used in the compositions and methods of the disclosure as a sequence recognized by SpCas9 is NGG, where N may be A, T, C, or G.

[0096] In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is about, at least, at least about, at most or at most about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. In some embodiments, the spacer sequence of the guide RNA and the target nucleic acid in the target gene are 100% complementary. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is 100% for the 6 most 5' consecutive nucleotides of the target sequence of the complementary strand of the target nucleic acid. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least 60% for about 20 consecutive nucleotides. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, for example, up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2 or up to 1 mismatch.

[0097] In some embodiments, the gRNA comprises a spacer sequence selected from SEQ ID NOs: 3-9 and 20-26 listed in Table 1. In some embodiments, the gRNA comprises a spacer sequence capable of hybridizing to a sequence selected from SEQ ID NOs: 3-9 listed in Table 1, or a sequence complementary to a sequence selected from SEQ ID NOs: 3-9.

[0098] [Table 1]

[0099] In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 3-9 and 20-26, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to any spacer of SEQ ID NOs: 3-9 and 20-26. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 3-9 and 20-26. In some embodiments, the gRNA is an sgRNA. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 3-9 and 20-26, or a variant thereof having 3 or less mismatches compared to any one of SEQ ID NOs: 3-9 and 20-26.

[0100] In some embodiments, two gRNAs comprising a spacer complementary to the target sequence of the ANGPLT3 gene are provided to the cell. In some embodiments, the gRNAs are any two gRNAs comprising a spacer selected from the group consisting of SEQ ID NO: 3-9 and SEQ ID NO: 20-26, or a variant thereof having at least 85% homology to the spacer of SEQ ID NO: 3-9 and SEQ ID NO: 20-26, or a variant having 3 or less mismatches compared to any one of SEQ ID NO: 3-9 and SEQ ID NO: 20-26.

[0101] In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to the spacer sequence of SEQ ID NO:4 or SEQ ID NO:21. In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21, or a variant thereof having 3 or fewer mismatches compared to SEQ ID NO:4 or SEQ ID NO:21. In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21.

[0102] In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:3 or SEQ ID NO:20, or a variant thereof having about, at least, or at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to the spacer sequence of SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:3 or SEQ ID NO:20, or a variant thereof having 3 or fewer mismatches compared to SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the gRNA is an sgRNA.

[0103] In some embodiments, the gRNA comprises a first gRNA comprising a spacer sequence of SEQ ID NO:3 or SEQ ID NO:20 (or a variant thereof having about, at least or at least about 85% homology to SEQ ID NO:3 or SEQ ID NO:20), and a second gRNA comprising a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21 (or a variant thereof having about, at least or at least about 85% homology to SEQ ID NO:4 or SEQ ID NO:21). The gRNA may further comprise one or more gRNAs having a spacer sequence of any one of SEQ ID NOs:5-8 and SEQ ID NOs:22-25, or a variant having about, at least or at least about 85% homology to any one of SEQ ID NOs:5-8 and SEQ ID NOs:22-25.

[0104] In some embodiments, the gRNA is a chemically modified gRNA. Various types of RNA modifications can be introduced into the gRNA to enhance stability, reduce the likelihood or extent of innate immune response, and / or enhance other properties described in the art. The gRNA described herein can include one or more modifications, including internucleoside linkages, purine pyrimidine bases, or sugars. In some embodiments, modifications are introduced into the end of the gRNA using chemical synthesis or using polymerase enzymes. Examples of modified nucleic acids and their synthesis are disclosed in WO2013 / 052523. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

[0105] In some embodiments, the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 3' and 5' ends of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 5' end of the gRNA. In some embodiments, the chemically modified gRNA comprises 3 or 4 phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA and / or 3 or 4 at the 5' end. In some embodiments, any one of the gRNAs comprising any of SEQ ID NOs: 3-9 and 20-26 may be chemically modified to comprise 4 phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA and / or 3 at the 5' end.

[0106] The number and position of phosphorothioate linkages may vary. In some embodiments, the linkages may be at the first and second, second and third, third and fourth, fourth and fifth, fifth and sixth, sixth and seventh, seventh and eighth, eighth and ninth, ninth or tenth or further positions from the 5' end of the gRNA. In some embodiments, the linkages may be at the first and second, second and third, third and fourth, fourth and fifth, fifth and sixth, sixth and seventh, seventh and eighth, eighth and ninth, ninth or tenth or further positions from the 3' end of the gRNA.

[0107] In some embodiments, the nucleotide analog / modification is 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, phosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, '-Deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate The base-modified nucleotide may include 5-methylcytidine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate.7-Deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate and pseudouridine-5'-triphosphate, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine 1-Taurinomethyl-pseudouridine, 5-Taurinomethyl-2-thio-uridine, 1-Taurinomethyl-4-thio-uridine, 5-Methyl-uridine, 1-Methyl-pseudouridine, 4-Thio-1-methyl-pseudouridine, 2-Thio-1-methyl-pseudouridine, 1-Methyl-1-deaza-pseudouridine, 2-Thio-1-methyl-1-deaza-pseudouridine, Dihydrouridine, Dihydropseudouridine, 2-Thio-dihydrouridine, 2-Thio-dihydropseudouridine, 2-Methoxyuridine, 2-Methoxy-4 -thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-de Aza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, Zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine,7-Deaza-2,6-diaminopurine, 7-Deaza-8-aza-2,6-diaminopurine, 1-Methyladenosine, N6-Methyladenosine, N6-Isopentenyladenosine, N6-(cis-Hydroxyisopentenyl)adenosine, 2-Methylthio-N6-(cis-Hydroxyisopentenyl)adenosine, N6-Glycinylcarbamoyladenosine, N6-Threonylcarbamoyladenosine, 2-Methyl Ruthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyladenine, 2-methylthio-adenine and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7 -methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1 -thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseudouridine, 6-aza-cytidine, 2-thio-cytidine, alpha-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1 -Methyl-pseudouridine, 5,6-dihydrouridine, alpha-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, alpha-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine,It may include alpha-thio-adenosine, 8-azido-adenosine or 7-deaza-adenosine.

[0108] The at least one modified nucleotide and / or the at least one nucleotide analogue may be 1-methyl adenosine, 2-methyl adenosine, N6-methyl adenosine, 2'-O-methyl adenosine, 2-methylthio-N6-methyl adenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl-N 6-Threonylcarbamoyl adenosine, N6-Hydroxynorvalylcarbamoyl adenosine, 2-Methylthio-N6-hydroxynorvalylcarbamoyl adenosine, Inosine, 3-Methylcytidine, 2-O-Methylcytidine, 2-Thiocytidine, N4-Acetylcytidine, Lysidine, 1-Methylguanosine, 7-Methylguanosine, 2'-O-Methylguanosine, Queuosine, Epoxyqueuosine, 7-Cyano-7-Deazaguanosine, 7-Amino The uridine may include 5-aminomethyl-7-deazaguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine', 5-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0109] In some embodiments, the chemical modification comprises pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine or 2'-O-methyluridine. In some embodiments, the modifications include 2'-O-methyluridine (2'OMe-rU), 2-O-methylcytidine (2'OMe-rC), 2'-O-methyladenosine (2'OMe-rA) or 2'-O-methylguanosine (2'OMe-rG).

[0110] The gRNA may comprise any number of modified nucleic acids. In some embodiments, the percentage of modified nucleic acids in the gRNA molecule is 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%. %, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74% or 75%.

[0111] For example, sequence number 20 is: * a * a *GAC CAU GUC CCA ACU GA" (SEQ ID NO: 12) (T is converted to U), where u=2'OMe-rU; a=2'OMe-rA; * = thiolated phosphate.

[0112] In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 10, wherein the RNA sequence is: 5'- u * a * a * GAC CAU GUC CCA ACU GA G UUU UAG Agc uag aaa uag cAA GUU AAA AUA AGG CUA GUC CGU UAU Caa cuu gaa aaa gug gca ccg agu cgg ugc u * u * u * u-3' (SEQ ID NO: 13), where u=2'OMe-rU; a=2'OMe-rA; c=2'OMe-rC; g=2'OMe-rG; * = thiolated phosphate. The underlined sequences correspond to the spacers.

[0113] In another example, the gRNA spacer sequence of SEQ ID NO:9 is: * u * a * CUA AAG GAA CAA CAA AA" (SEQ ID NO: 14) (T is converted to U), where u=2'OMe-rU; a=2'OMe-rA; * = thiolated phosphate.

[0114] In some embodiments, the gRNA comprises the sequence of SEQ ID NO:11: 5'- u * u * a * CUA AAG GAA CAA CAA AAG UUU UAG Agc uag aaa uag cAA GUU AAA AUA AGG CUA GUC CGU UAU CAa cuu gaa aaa gug gca ccg agu cgg ugc u * u * u * u-3' (SEQ ID NO: 15), where u=2'OMe-rU; a=2'OMe-rA; c=2'OMe-rC; g=2'OMe-rG; * = thiolated phosphate. The underlined sequences correspond to the spacers.

[0115] In some embodiments, more than one guide RNA can be used with CRISPR / Cas nuclease system. Each guide RNA can contain different targeting sequences so that CRISPR / Cas system cuts more than one target nucleic acid. In some embodiments, one or more guide RNAs can have the same or different properties, such as activity or stability in Cas9 RNP complex. When more than one guide RNA is used, each guide RNA can be encoded in the same or different vectors.

[0116] In some embodiments, the gRNA described herein can be produced by in vitro transcription (IVT), synthesis and / or chemical synthesis methods, or a combination thereof. One or more of enzymatic IVT, solid phase, liquid phase, combined synthetic method, small region synthesis and ligation methods can be utilized. In some embodiments, the gRNA is produced using IVT enzymatic synthesis method. Methods for producing polynucleotides by IVT are well known in the art and are described in WO2013 / 151666. Polynucleotide constructs and vectors can be used to in vitro transcribe the gRNA described herein.

[0117] How to Edit ANGPTL3 Provided herein is the method of using genome editing to edit ANGPTL3 by functionally knocking out or reducing the expression of ANGPTL3 gene in the genome of cells.The method can be used to treat subjects, for example, patients with ANGPTL3-related diseases or conditions.

[0118] Provided herein includes a method for treating an ANGPTL3-related disease or disorder in a subject (e.g., a primate subject) in need thereof. In some embodiments, the method includes administering to the primate subject a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA targeting the ANGPTL3 gene, and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby alleviating the ANGPTL3-related disease or disorder in the primate subject. The subject may be administered a plurality of nanoparticles for treatment two or more times, for example, twice. The two administrations of nanoparticles to the subject may be separated by a suitable period of time. In some embodiments, the suitable period of time is or is about 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, or even longer. In some embodiments, two of the two or more administrations are separated by about 2 weeks to about 2 months, for example, about 3 weeks. In some embodiments, each two of the two or more administrations are separated by about 2 weeks to about 2 months, e.g., about 3 weeks. The suitable period between two administrations may be the same or different than the suitable period between another two administrations. In some embodiments, the plurality of nanoparticles are administered to the subject at a dose of about 0.01-5 mg / kg, e.g., 0.05-2 mg / kg, 0.5-3 mg / kg, or 0.1-1 mg / kg per administration. In some embodiments, the ANGPTL3 gRNA or a nucleic acid encoding the ANGPTL3 gRNA is administered to the subject at a dose of 0.01-5 mg / kg, e.g., 0.1-1 mg / kg gRNA per administration, or at about these doses. In some embodiments, the nucleic acid encoding the RNA-guided endonuclease is administered to the subject at a dose of 0.1-5 mg / kg, e.g., 0.5-3 mg / kg, or 0.3-2 mg / kg per administration, or at about these doses. The doses may be the same or different for each administration to the subject.

[0119] In some embodiments, the gRNA targets within or near a coding sequence in the ANGPTL3 gene. In some embodiments, the gRNA targets a sequence in one of the 12 exons of the ANGPTL3 gene. In some embodiments, the gRNA targets a sequence in exon 1 of the ANGPTL3 gene. In some embodiments, the gRNA targets a sequence in exon 1 of the ANGPTL3 gene. The gRNA may include a spacer sequence that is complementary to a target sequence in exon 1 of the ANGPTL3 gene. In some embodiments, the spacer(s) is complementary to a sequence in or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases therefrom) exon 1 of the ANGPTL3 gene. In some embodiments, the spacer of the gRNA binds complementarily to the target sequence located at chr1:62597719-62597738(-) (without PAM) or chr1:62597716-62597738(-) (with PAM). The complementarity between the spacer of the gRNA and the target sequence in the ANGPTL3 gene may or may not be perfect. In some embodiments, the complementarity may be at least 70%, 80%, 90%, 100%, or a number or range between any two of these values. In some embodiments, the complementarity is perfect, i.e., 100%.

[0120] In some embodiments, the gRNA comprises a spacer sequence selected from SEQ ID NO: 3-9 and SEQ ID NO: 20-26, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to any spacer of SEQ ID NO: 3-9 and SEQ ID NO: 20-26. In some embodiments, the gRNA comprises a spacer sequence selected from SEQ ID NO: 3-9 and SEQ ID NO: 20-26, or a variant thereof having 3 or less mismatches compared to any one of SEQ ID NO: 3-9 and SEQ ID NO: 20-26. In some embodiments, the gRNA comprises a spacer sequence selected from SEQ ID NO: 3-9 and SEQ ID NO: 20-26. In some embodiments, the gRNA comprises or consists of a spacer sequence of SEQ ID NO: 12.

[0121] In some embodiments, the gRNAs used in the methods herein may include two or more gRNAs each including a spacer complementary to a target sequence of the ANGPLT3 gene (e.g., any one of SEQ ID NOs: 3 to 9 and SEQ ID NOs: 20 to 26, or a variant thereof having at least 85% homology to any one of SEQ ID NOs: 3 to 9 and SEQ ID NOs: 20 to 26, or a variant having 3 or less mismatches compared to any one of SEQ ID NOs: 3 to 9 and SEQ ID NOs: 20 to 26).

[0122] In some embodiments, the guide sequence comprises a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21. In some embodiments, the guide sequence comprises a spacer sequence of SEQ ID NO:4 or SEQ ID NO:21.

[0123] In some embodiments, the guide sequence comprises a spacer sequence of SEQ ID NO:3, SEQ ID NO:20, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to the spacer sequence of SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the guide sequence comprises a spacer sequence of SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the guide sequence comprises or consists of a spacer sequence of SEQ ID NO:12. In some embodiments, the guide sequence comprises a sequence of SEQ ID NO:10, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% homology to the sequence of SEQ ID NO:10. In some embodiments, the guide sequence comprises or consists of a sequence of SEQ ID NO:13.

[0124] The gRNAs used herein can enhance on-target activity while significantly reducing potential off-target effects (i.e., cleaving genomic DNA at undesirable locations other than the ANGPTL3 gene). In some embodiments, off-target binding is reduced by about, at least or at least about 80%, 85%, 90%, 95%, 98%, 99% or 100%.

[0125] In some embodiments, the DNA endonuclease is a Cas endonuclease as described herein or known in the art. Cas endonucleases can be naturally occurring or non-naturally occurring (e.g., recombinant or mutated). In some embodiments, the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Csel, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Csm7, Csm8, Csm9, Csm10, Csm11, Csm12, Csm13, Csm14, Csm15, Csm16, Csm17, Csm18, Csm19, Csm20, Csm21, Csm22, Csm23, Csm24, Csm25, Csm26, Csm27, Csm28, Csm29, Csm31, Csm21, Csm22, Csm23, Csm24, Csm25, Csm26, Csm27, Csm28, Csm29, Csm2 ...9, Csm21, Csm21, Csm21, Csm22, Csm23, Csm21, Csm21, Csm21, Csm21, Csm21, Csm21, Csm In some embodiments, the DNA endonuclease is selected from the group consisting of: 4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 or Cpf1 endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease or a variant thereof. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0126] In some embodiments, genetic modification of the ANGPTL3 gene results in a significant reduction in plasma ANGPTL3 protein, plasma ApoB protein, and / or lipid levels, such as triglyceride levels, in a subject (e.g., a mammal, NHP, human subject). In some embodiments, plasma ANGPTL3 protein levels are reduced by 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 102%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, , 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% or a number or range between any two of these values. In some embodiments, the methods described herein may reduce plasma ANGPTL3 protein levels by about, at least or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a number or range between any two of these values.

[0127] In some embodiments, genetic modification of the ANGPTL3 gene results in significantly reduced lipid levels (e.g., total cholesterol, triglycerides, HDL, LDL and other non-HDL lipids) in a subject (e.g., a mammal, NHP, human subject). In some embodiments, the gene editing methods described herein reduce non-HDL lipid levels (e.g., LDL, VLDL and / or triglycerides) by 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 109%, 109%, 102%, 1 , 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% or a number or range between any two of these values. In some embodiments, plasma triglyceride levels are reduced by about, at least or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a number or range between any two of these values.

[0128] In some embodiments, genetic modification of the ANGPTL3 gene results in significantly reduced plasma ApoB protein levels in a subject (e.g., a mammal, NHP, human subject). In some embodiments, plasma ApoB protein levels are reduced by 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 1 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% or a number or range reduction between any two of these values. In some embodiments, the methods described herein may reduce plasma ApoB protein levels by about, at least or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a number or range between any two of these values.

[0129] In some embodiments, plasma ANGPTL3 protein, ApoB protein and / or non-HDL lipid levels (e.g., triglycerides) in a genetically modified subject (e.g., mammal, NHP, human subject) are reduced by about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108% or more compared to a corresponding unmodified mammal. 8%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or less than or about less than the above.

[0130] In some embodiments, the concentration of ANGPTL3 protein, the level of one or more non-high density lipoprotein (non-HDL) lipids, and / or the concentration of ApoB protein in a subject (e.g., a mammal, NHP, human subject) is reduced by at least 20%, at least 40%, or at least 70% at 3 weeks, 4 weeks, 5 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or more after administration. In some embodiments, the concentration of ANGPTL3 protein, the level of one or more non-high density lipoprotein (non-HDL) lipids, and / or the concentration of ApoB protein is reduced by at least 20%, at least 40%, or at least 70% at 3 weeks, 4 weeks, 5 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or more after a single administration.

[0131] In some embodiments, the eligibility and endpoints (e.g., at 6 months) for the methods disclosed herein include: before treatment, the subject has non-HDL-C>160mg / dl, triglycerides>300mg / dL, and / or ApoB>100mg / dL, and the results of the method are determined by measuring the change in non-HDL-C (total cholesterol-HDL) from baseline, the change in triglycerides from baseline, and / or the change in ApoB from baseline. Non-HDL levels are 30mg / dL above LDL. non-HDL=LDL, VLDL, IDL, and Lp(a). In some embodiments, the subject has triglyceride levels above 300mg / dL, non-high density lipoprotein (HDL) levels above 160mg / dL, low density lipoprotein cholesterol (LDL-C) levels above 100mg / dL, ApoB levels above 100mg / dL, or combinations thereof. The method may include measuring blood levels of one or more of ANGPTL3, ApoB, triglycerides, very low density lipoprotein (VLDL), low density lipoprotein (LDL), LDL-C, HDL and non-HDL lipids in the subject before, during and / or after administration.

[0132] In some embodiments, the subject is resistant to one or more (or all) of available SOC-based treatments, including ezetimibe and / or PCSK9 inhibitors, for at least 12 weeks prior to screening. In some embodiments, HoFH subjects who are on evinacumab treatment and have not reached treatment-related target lipid goals and meet the non-HDL eligibility criteria for enrollment can be treated. The subject may have been previously treated with a PCSK9 inhibitor. In some embodiments, the subject is not treated with a PCSK9 inhibitor.

[0133] Pharmaceutical Compositions and Therapeutic Applications Provided herein includes pharmaceutical compositions for carrying out the methods disclosed herein.The compositions may include one or more gRNA(s), RNA-guided endonuclease or the nucleotide sequence encoding the RNA-guided endonuclease described herein.In some embodiments, the compositions may further include a polynucleotide (e.g., donor template) that is inserted into ANGPTL3 gene to affect the desired genetic modification of the methods disclosed herein.

[0134] In some embodiments, one or more gRNA(s) each comprise a spacer complementary to a genomic sequence within or near any exon of the ANGPTL3 gene (e.g., within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases therefrom). In some embodiments, the gRNA targets a sequence within exon 1 of the ANGPTL3 gene. The gRNA may comprise a spacer sequence complementary to a target sequence within exon 1 of the ANGPTL3 gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 3-9 and 20-26, or a variant thereof having at least 85% homology to a spacer sequence of any one of SEQ ID NOs: 3-9 and 20-26. In some embodiments, the gRNA comprises a space of SEQ ID NO:3 or SEQ ID NO:20, or a variant thereof having at least 85% homology to a spacer having a sequence of SEQ ID NO:3 or SEQ ID NO:20. In some embodiments, the gRNA comprises a spacer of SEQ ID NO:4, SEQ ID NO:21, or a variant thereof having at least 85% homology to a spacer having a sequence of SEQ ID NO:4 or SEQ ID NO:21. In some embodiments, the gRNA comprises a spacer comprising or consisting of a sequence of SEQ ID NO:12. In some embodiments, the gRNA comprises a sequence of SEQ ID NO:10, or a variant thereof having at least 85% homology to a sequence of SEQ ID NO:10. In some embodiments, the gRNA comprises or consists of a sequence of SEQ ID NO:13.

[0135] In some embodiments, the RNA-guided endonuclease is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cpf1 endonuclease or functional derivatives thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9). In some embodiments, the DNA sequence transcribed into the nucleic acid encoding the DNA endonuclease is codon optimized. In some embodiments, the nucleic acid (e.g., mRNA) encoding the DNA endonuclease comprises a 5' CAP structure and a 3' poly A tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0136] In some embodiments, one or more nucleic acid sequences and / or polypeptides may be delivered to cells, either in vitro or in vivo, via viral-based or non-viral-based delivery systems, including adenoviral vectors, adeno-associated viral (AAV) vectors, retroviral vectors, lentiviral vectors, herpes virus vectors, liposomes, lipid nanoparticles, poxviruses, naked DNA administration, plasmids, cosmids, phages, encapsulated cell technology, and the like.

[0137] In some embodiments, the compounds of the compositions disclosed herein (e.g., ANGPTL3 gRNA or a nucleic acid encoding an ANGPTL3 gRNA and a nucleic acid encoding an RNA-guided endonuclease) may be formulated in liposomes or lipid nanoparticles. In some embodiments, the compounds of the compositions are formulated in lipid nanoparticles (LNPs). LNPs are non-viral delivery systems that safely and effectively deliver nucleic acids to target organs (e.g., the liver). The term "lipid nanoparticle" refers to a nanoscale particle composed of lipids having a size measured in nanometers (e.g., 1-5,000 nm). In some embodiments, the lipids included in the lipid nanoparticles include cationic lipids and / or ionizable lipids. Any suitable cationic lipids and / or ionizable lipids known in the art may be used to formulate LNPs for delivery of gRNA and Cas endonuclease to cells. Exemplary cationic lipids include one or more amine group(s) carrying a positive charge. In some embodiments, the cationic lipid is ionizable so that it can exist positively charged or neutral depending on pH. In some embodiments, the cationic lipid of the lipid nanoparticle comprises a protonizable tertiary amine head that exhibits a positive charge at low pH. The lipid nanoparticle may further comprise one or more neutral lipids (e.g., distearoylphosphatidylcholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1,2-dipalmitoyl-sn-glycero-3-phosphorylethanolamine (DPPE), etc., as helper lipids), charged lipids, steroids, and polymer-conjugated lipids. In some embodiments, the LNP may comprise cholesterol. In some embodiments, the LNP may comprise polyethylene glycol (PEG) lipids.

[0138] Lipid nanoparticles may vary in the concentration of constituent lipids. In some embodiments, the molar percentage of ionizable lipid in the total lipid of the lipid nanoparticle is about, at least about, at least about, at most about, or at most about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or a number or range between any two of these values. In some embodiments, the molar percentage of ionizable lipid in the lipid nanoparticle is in a range between about 40-70% (e.g., about 60%). In some embodiments, the lipid nanoparticle may further comprise a helper lipid (e.g., DSPC), a sterol lipid (e.g., cholesterol), and a PEG lipid or a phospholipid PEG conjugate. In some embodiments, the molar percentage of helper lipid in the lipid nanoparticle is about 5%-20% (e.g., about 10.5%), the molar percentage of sterol lipid is about 10%-40% (e.g., about 21%), and the molar percentage of PEG lipid is about 0.5%-10% (e.g., about 8.5%).

[0139] LNP uptake into hepatocytes may be mediated by the apolipoprotein E-low density lipoprotein receptor (ApoE-LDLR) or the N-acetyl-D-galactosamine / asialoglycoprotein receptor pathway (GalNAc-ASGPR) (Sato et al., 2020, Journal of Controlled Release, 322, 217-226.). In some embodiments, the LNPs described herein for delivery of gRNA and Cas endonuclease to cells may be formulated according to the ApoE-LDLR uptake pathway. In some embodiments, the LNPs described herein for delivery of gRNA and Cas endonuclease to cells may be formulated according to the GalNAc-ASGPR uptake pathway. In some embodiments, the LNP formulations described herein may be used to treat subjects with diseases or disorders that exhibit heterozygosity (HeFH) or homozygosity (HoFH) for reduced low density lipoprotein receptor (LDLR).

[0140] In some embodiments, the lipid nanoparticle comprises N-acetylgalactosamine (GalNAc), an amino sugar derivative of galactose. In some embodiments, GalNAc is present in the LNP at a molar percentage of about, at least, at least about, at most, or at most about 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, or 6.0%. In some embodiments, GalNAc is present in the LNP at a molar percentage of about 2.5%.

[0141] In some embodiments, the concentration of the nanoparticles in the compositions disclosed herein (e.g., of total lipid) is about 58.2 mg / mL, and the nanoparticles are complexed with about 2 mg / mL of total nucleic acid of (a) ANGPTL3 gRNA and (b) Cas9 mRNA. In some embodiments, the concentration of the plurality of nanoparticles is about 58.2 mg / mL, and the nanoparticles are complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

[0142] The relative amount of total RNA [(a) ANGPTL3 gRNA or the nucleic acid encoding gRNA that targets ANGPTL3 gene, and (b) the nucleic acid encoding RNA-guided endonuclease] and total lipid in nanoparticles may vary in different embodiments.For example, nanoparticles can comprise total lipid and total RNA at a weight ratio of about 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1 or 30:1.In some embodiments, nanoparticles can comprise total lipid and total RNA at a weight ratio of about 30:1. In some embodiments, the nanoparticles may comprise total lipids and total RNA in a molar ratio of about 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, or 50:1. In some embodiments, the nanoparticles may comprise total lipids and total RNA in a molar ratio of about 40:1.

[0143] In some embodiments, the concentration of nanoparticles in a composition disclosed herein is about, at least, at least about, at most, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 mg / mL, or a number or range between any two of these values. In some embodiments, the RNA in the nanoparticles is formulated at a concentration of about, at least, at least about, up to, or up to about 50, 75, 100, 200, 400, 600, 800, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 μg / ml, or a number or range between any two of these values.

[0144] The amount in the nanoparticles (e.g., the relative amount of (a) ANGPTL3 gRNA or a nucleic acid encoding a gRNA targeting the ANGPTL3 gene, and (b) a nucleic acid encoding an RNA-guided endonuclease (e.g., an mRNA encoding a Cas protein (e.g., Cas9 mRNA)) may vary. For example, the nanoparticles may comprise a nucleic acid encoding an RNA-guided endonuclease (e.g., SpCas9 mRNA) and an ANGPTL3 gRNA in a ratio (by weight) of 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, or 5:1. In some embodiments, the nanoparticles may comprise a nucleic acid encoding an RNA-guided endonuclease and an ANGPTL3 gRNA in a ratio (by weight) of 3:1.

[0145] In some embodiments, the nanoparticles are administered to a subject at a dose of about 0.01-5 mg / kg [determined by the total nucleic acid (e.g., the sum of ANGPTL3 gRNA and Cas9 mRNA)] per dose. For example, a single dose or each dose of the nanoparticles administered to a subject may be 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2.0 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 ...9 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 2.9 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2. The nanoparticles may be complexed with total RNA (e.g., the sum of ANGPTL3 gRNA and Cas9 mRNA) at 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4.5 mg / kg or 5 mg / kg, or a number or range between any two of these values. In some embodiments, the nanoparticles are administered to a subject at or about a dose of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg or 3 mg / kg (determined by the sum of ANGPTL3 gRNA and SpCas9 mRNA).

[0146] The disclosure herein includes a composition. In some embodiments, the composition includes a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) targeting the ANGPTL3 gene (ANGPTL3 gRNA) and (b) an mRNA encoding a Cas9 endonuclease, where the gRNA includes a spacer sequence of SEQ ID NO: 3, SEQ ID NO: 20, or SEQ ID NO: 12. In some embodiments, the gRNA includes a sequence of SEQ ID NO: 10 or SEQ ID NO: 13. The Cas9 endonuclease can be Streptococcus pyogenes Cas9 endonuclease. In some embodiments, the concentration of the plurality of nanoparticles is about 58.2 mg / mL and is complexed with about 2 mg / mL of the total nucleic acid of (a) ANGPTL3 gRNA and (b) Cas9 mRNA. In some embodiments, the concentration of the plurality of nanoparticles is about 58.2 mg / mL and is complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

[0147] Non-limiting examples of dose escalation of the compositions disclosed herein (e.g., lipid nanoparticles complexed with ANGPTL3 gRNA or a nucleic acid encoding an ANGPTL3 gRNA, and a nucleic acid encoding an RNA-guided endonuclease) are provided in Table 2. The dose is determined by the sum of the ANGPTL3 gRNA and Cas9 mRNA complexed to the nanoparticle.

[0148] [Table 2]

[0149] In some embodiments, the lipid nanoparticles may have an average diameter of about, at least, at least about, at most or at most about 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, or any number or range between these values. In some embodiments, the lipid nanoparticle particle size is about 50 to about 100 nm in diameter, or about 70 to about 90 nm in diameter, or about 55 to about 95 nm in diameter.

[0150] In some embodiments, the compound of the composition described herein is encapsulated in the lipid portion of the lipid nanoparticle, or in the aqueous portion that is enveloped by some or all of the lipid portion of the lipid nanoparticle.Encapsulation can be complete encapsulation, partial encapsulation, or both.In some embodiments, nucleic acid and / or polypeptide is completely or substantially encapsulated in lipid nanoparticle (e.g., more than 90% of RNA).

[0151] In some embodiments, one or more compounds described herein are associated with a liposome or lipid nanoparticle via a covalent or non-covalent bond. In some embodiments, any compound in the composition may be contained in a liposome or lipid nanoparticle, either separately or together.

[0152] The composition described above may further comprise one or more additional reagents, such as selected from buffers, buffers for introducing polypeptides or polynucleotides into cells, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, adapters for sequencing, etc. The buffers may be stabilizing buffers, renaturing buffers, dilution buffers, etc. In some embodiments, the composition may also comprise one or more components that can be used to promote or enhance on-target binding or endonuclease cleavage of DNA, or to improve targeting specificity.

[0153] In some embodiments, any component of the composition is formulated with pharma- ceutically acceptable excipients, such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending on the specific mode of administration and dosage form. In some embodiments, the guide RNA composition is generally formulated to achieve a physiologically compatible pH, ranging from about pH 3 to about pH 11, from about pH 3 to about pH 7, depending on the formulation and route of administration. In some embodiments, the pH is adjusted to a range of about pH 5.0 to about pH 8.

[0154] Suitable excipients may include carrier molecules including large, slowly metabolized macromolecules such as, for example, proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactivated virus particles. Other exemplary excipients include antioxidants (such as, but not limited to, ascorbic acid), chelating agents (such as, but not limited to, EDTA), carbohydrates (such as, but not limited to, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (such as, but not limited to, oils, water, saline, glycerin, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[0155] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no other materials than active ingredient and water, or contain both buffers such as sodium phosphate, saline or phosphate buffered saline at physiological pH values. Aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chloride, glucose, polyethylene glycol, and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound used in the cell composition that is effective in treating a particular disorder or condition depends on the nature of the disorder or condition, and can be determined by standard clinical techniques.

[0156] As used herein, the term "stable" or "stability" refers to the ability of a compound described herein (e.g., an RNA-guided endonuclease or a nucleic acid and / or gRNA encoding an RNA-guided endonuclease) to maintain therapeutic efficacy (e.g., all or a substantial portion of its intended biological activity and / or physiochemical integrity) over an extended period of time. The stability of one or more compounds described herein (e.g., RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease and / or gRNA and nanoparticles) may be 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, or more than 3 years. The temperature of storage may vary. For example, the storage temperature can be, can be about, can be at least, or can be at least about -80° C., -65° C., -20° C., 5° C., or a number or range between any two of these values. In some embodiments, the storage temperature is at or below -65° C.

[0157] The stability of the compounds herein can be evaluated by measuring their relative intensity (e.g., relative to a reference). In some embodiments, the editing of target cells (e.g., Hep3B liver cell line) by, for example, CTX310 at various target:effector ratios can be determined. The percentage of editing can be calculated relative to a negative control (i.e., without CTX310) preparation. In some embodiments, the concentration of CTX310 is plotted against the percentage of editing determined by NGS or Sanger sequencing using a 4-parameter logistic fit to generate an intensity curve. The relative intensity of the sample is calculated relative to the reference standard.

[0158] In some embodiments, the compounds described herein (e.g., RNA-guided endonuclease or nucleic acid encoding the RNA-guided endonuclease and / or gRNA) of the composition can be delivered via transfection, such as calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, electrical nuclear transport, chemical transduction, electrotransduction, lipofectamine-mediated transfection, effectene-mediated transfection, lipid nanoparticle (LNP)-mediated transfection, or any combination thereof. In some embodiments, the composition is introduced into the cell via lipid-mediated transfection using lipid nanoparticles.

[0159] The compositions described herein can be administered to a subject in need of ANGPTL3-related conditions to treat them. Thus, the present disclosure also provides a gene therapy approach to treat ANGPTL3-related conditions in a subject by editing the ANGPTL3 gene of the subject. In some embodiments, the gene therapy approach functionally knocks out the ANGPTL3 gene in the genome of the relevant cell type (e.g., liver) in the patient. The ANGPTL3 gene of the relevant cell (e.g., liver) in the subject is edited using the materials and methods described herein, which use RNA-guided endonucleases such as Cas9 to persistently delete, insert, edit, correct, or replace a target sequence in the genome, or to insert an exogenous sequence, thereby functionally knocking out the ANGPTL3 gene. This can provide a sustained treatment for ANGPTL3-related conditions by sustainedly reducing the levels of ANGPTL3 protein, ApoB protein, and lipids such as triglycerides, LDL, VLDL, total cholesterol, HDL, non-HDL, and / or other fatty phospholipids in blood. As used herein, the term "associated" with reference to two items (e.g., ANGPTL3 and a disease / condition) indicates a relationship between the two items such that the occurrence of one item (e.g., ANGPTL3 protein levels) is accompanied by the occurrence of the other item (e.g., a disease or condition), including, but not limited to, a cause and effect relationship and a sign / symptom-disease relationship.

[0160] As described herein, in some embodiments, (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA targeting the ANGPTL3 gene, and (b) a nanoparticle (e.g., a LNP comprising an ionizable lipid) complexed with a nucleic acid encoding an RNA-guided endonuclease (e.g., Cas9 mRNA) are administered to a subject in need thereof by IV infusion. The administration may be, for example, a single dose, or two or more doses. For example, the nanoparticles may be rapidly distributed, for example, to the liver of a subject, where the nanoparticles can enter (e.g., via endocytosis) into liver cells of the subject. In some embodiments, ionizable lipid disruption of the endosome can disrupt the nanoparticles, thereby releasing a nucleic acid encoding an RNA-guided endonuclease (e.g., Cas9 mRNA) from the nanoparticle. The RNA-guided endonuclease (e.g., Cas9) is synthesized and forms an endonuclease-gRNA RNP complex to achieve gene editing. In some embodiments, endogenous DNA repair through non-homologous end joining (NHEJ) results in the introduction of an indel into the ANGPTL3 gene, resulting in a frameshift mutation that prevents the production of a functional ANGPTL3 protein. As demonstrated herein, using the methods, compositions, systems, and kits described herein, robust on-target editing of the ANGPTL3 gene can be achieved without off-target editing.

[0161] In some embodiments, a method of treating an ANGPTL3-associated disease or disorder comprises administering to a subject (e.g., a primate subject) in need thereof a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets the ANGPTL3 gene, and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby alleviating the ANGPTL3-associated disease or disorder in the primate subject.

[0162] ANGPTL3-related diseases and disorders include, but are not limited to, arteriosclerosis, atherosclerosis, cardiovascular disease, coronary heart disease, diabetes, diabetes mellitus, non-insulin-dependent diabetes mellitus, fatty liver, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, hypobetalipoproteinemia, inflammation, insulin resistance, metabolic disease, obesity, oral malignant neoplasms, lipid metabolism disorders, lip and oral cancer, dyslipidemia, metabolic syndrome X, hypotriglyceridemia, Opitz trigonocephaly syndrome, ischemic stroke, hypertriglyceridemia result, familial 2 hypobetalipoproteinemia, familial hypobetalipoproteinemia, and ischemic cerebrovascular stroke. Editing the ANGPTL3 gene using any of the methods described herein can be used to treat, prevent, and / or alleviate the symptoms of the diseases and disorders described herein.

[0163] In some embodiments, the methods and compositions described herein can be used to treat dyslipidemia, hypobetalipoproteinemia, familial hypercholesterolemia (including homozygous familial hypercholesterolemia (HoFH) and heterozygous familial hypercholesterolemia (HeFH)), hypertriglyceridemia, familial combined hyperlipidemia, familial chylomicronemia syndrome, multifactorial chylomicronemia syndrome, familial combined hyperlipidemia (FCHL), metabolic syndrome (MetS), non-alcoholic fatty liver disease (NAFLD), elevated lipoprotein (a) and total cholesterol by sustainably reducing the levels of ANGPTL3 protein and lipids such as total cholesterol, triglycerides, LDL, HDL, and / or other non-HDL in blood.In some embodiments, the methods disclosed herein include performing genetic screening on the patient.For example, for HoFH and / or HeFH, genetic screening can be performed on one or more of LDLr, APOB, and PCSK9. For FCS and / or MCS, gene screening may be performed on one or more of LPL, Apo CII, Apo V, LMF-1 and GP1HBP1. In some embodiments, the subject undergoing the ANGPTL3 gene editing treatment described herein has been genetically screened before undergoing treatment, for example, genetically screened for one or more of LDLr, APOB and PCSK9 (e.g., for the treatment of HoFH and / or HeFH), or genetically screened for one or more of LPL, Apo CII, Apo V, LMF-1 and GP1HBP1 genotypes (e.g., for the treatment of FCS and / or MCS). In some embodiments, the subject does not carry an LPL mutation, a GP1HBP1 mutation, or a combination thereof. The subject may have a monogenic, heterogenic or polygenic background.

[0164] In some embodiments, the methods, compositions and kits described herein can be used to treat dyslipidemia. Dyslipidemia is a genetic disease characterized by elevated levels of lipids in the blood, which contribute to the development of clogged arteries (atherosclerosis). These lipids include plasma cholesterol, triglycerides, or high-density lipoproteins. Dyslipidemia increases the risk of heart attack, stroke or other circulatory concerns. Current management includes lifestyle changes such as exercise and dietary modification, and the use of lipid-lowering agents such as statins. Non-statin lipid-lowering drugs include bile acid sequestrants, cholesterol absorption inhibitors, drugs for homozygous familial hypercholesterolemia, fibrates, nicotinic acid, omega-3 fatty acids and / or combination products. Treatment options usually depend on the specific lipid abnormality, but different lipid abnormalities often coexist. Treatment of children is even more challenging, as dietary changes can be difficult to implement and lipid-lowering treatments have not been proven effective.

[0165] In some embodiments, the methods, compositions and kits described herein may be used to treat hypobetalipoproteinemia. Hypobetalipoproteinemia is a genetic disease (autosomal recessive) that affects between 1 in 1000 and 1 in 3000 people worldwide. Common symptoms of hypobetalipoproteinemia include plasma levels of LDL cholesterol or apolipoprotein B below the 5th percentile, which impairs the body's ability to absorb and transport fat, and may result in retinal degeneration, neuropathy, coagulation disorders, or abnormal accumulation of fat in the liver, called hepatic steatosis. In severely affected patients, hepatic steatosis may progress to chronic liver disease (cirrhosis). Current treatments for hypobetalipoproteinemia include strict restriction of long-chain fatty acids to 15 grams per day to improve fat absorption. Short-term supplementation of medium-chain triglycerides may be effective in infants with hypobetalipoproteinemia, but the amount must be closely monitored to avoid hepatotoxicity. Another option for treating hypobetalipoproteinemia is high-dose vitamin E to prevent neurological complications. Alternatively, if elevated prothrombin times suggest vitamin K depletion, vitamin A (10,000-25,000 IU / d) supplementation may be effective.

[0166] In some embodiments, the methods, compositions and kits described herein can be used to treat familial hypercholesterolemia.Familial hypercholesterolemia ("FH") is a genetic disorder of low-density lipoprotein cholesterol, characterized by elevated cholesterol levels from birth and high risk of premature coronary heart disease.It is well known that mutations in any of three genes (LDLR, APOB and PCSK9) cause autosomal dominant FH.

[0167] In some embodiments, the methods, compositions and kits described herein can be used to treat hypertriglyceridemia.Hypertriglyceridemia is defined as an abnormal concentration of triglycerides in blood.Hypertriglyceridemia can be primary or secondary in nature.Primary hypertriglyceridemia is the result of various genetic defects that cause disorders of triglyceride metabolism.Secondary causes are acquired causes such as high-fat diet, obesity, diabetes, hypothyroidism and certain drug therapies.

[0168] In some embodiments, the target tissue for the compositions and methods described herein is liver tissue. In some embodiments, the target cell for the compositions and methods described herein is a liver cell.

[0169] In some embodiments, these pharmaceutical compositions can be administered by aerosol delivery, nasal delivery, vaginal delivery, rectal delivery, buccal delivery, oral delivery, topical delivery, external delivery, intracisternal delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous injection, subcutaneous injection, intralymph node injection, intratumoral injection, intraperitoneal injection and / or intradermal injection, or any combination thereof. Administration can be local or systemic. Systemic administration includes enteral and parenteral administration. In some embodiments, more than one administration can be used to achieve a desired level of gene expression over various interval periods, for example, daily, weekly, monthly or yearly.

[0170] These pharmaceutical compositions can be administered to subjects in need thereof in pharmacologic effective amounts.As used herein, the term "pharmacologic effective amount" refers to the amount of pharmaceutical composition that will bring about the desired therapeutic effect and / or biological or medical response of tissue, system, animal or human.Administration can cause the desired reduction in the expression of ANGPTL3 gene, such as the desired reduction in the level of ANGPTL3 protein and lipids, such as triglycerides, cholesterol and / or fatty phospholipids, in blood.

[0171] In some embodiments, the subject is administered an additional treatment. The additional treatment may include administration of a corticosteroid, an anti-H1 antihistamine, an anti-H2 antihistamine, or any combination thereof. In some embodiments, the additional treatment is administered to the subject 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week or more prior to administration of the plurality of nanoparticles to the subject. In some embodiments, the additional treatment is administered to the subject up to 2 hours prior to administration of the plurality of nanoparticles. In some embodiments, the additional treatment and the plurality of nanoparticles are administered simultaneously.

[0172] In some embodiments, the additional treatment includes one or more of hepatoprotective drugs (silymarin, polyene phosphatidylcholine, bicyclol, glycyrrhizic acid preparations, N-acetylated L-cysteine ​​(NAC) and glutathione (GSH)); anticholestasis drugs (ursodeoxycholic acid, S-adenosylmethionine, cholestyramine); immunosuppressants (glucocorticoids), and / or antihistamines. In some embodiments, antihistamines include acrivastine, azelastine, emadastine, epinastine, brompheniramine, carbinoxamine, cetirizine, chlorpheniramine, clamastine, cyproheptadine, desloratidine, diphenhydramine, naphazoline, fexofenadine, hydroxyzine, ketotifen, levociterizine, loratadine, olopatadine, and / or pharmaceutically acceptable salts thereof.In some embodiments, the corticosteroid is hydrocortisone, hydroxyl-triamcinolone, alpha-methyldexamethasone, dexamethasone-phosphate, beclomethasone dipropionate, clobetasol valerate, desonide, desoxymethasone, desoxycorticosterone acetate, dexamethasone, dichlorisone, diflorasone diacetate, diflucortolone valerate, fluadrenolone, fluclorone acetonide, fludrocortisone, flumethasone pivalate, flucinolone acetonide, fluocinonide, flucortine butyl ester. butylester), fluocortolone, fluprednidene [fluprednylidene] acetate, flurandrenolide, halcinonide, hydrocortisone acetate, hydrocortisone butyrate, methylprednisolone, triamcinolone acetonide, cortisone, cortodoxone, flucetonide, fludrocortisone, difluorosone diacetate, fluradrenolone, fludrocortisone, diflurosone diacetate diacetate, fluradrenolon acetonide, medrysone, amcinafel, amcinafide, betamethasone and its ester balance, chloroprednisone, chlorprednisone acetate, clocortelone, clescinolone, dichlorisone, diflurprednate, flucloronide, flunisolide, fluoromethalone, fluperolone, fluprednisolone, hydrocortisone valerate, hydrocortisone cyclopentylpropionate, hydrocortamate, meprednisone, paramethasone, prednisolone, prednisone, beclomethasone dipropionate, triamcinolone, or any combination thereof.In some embodiments, the corticosteroid is dexamethasone. In some embodiments, the antihistamine comprises diphenhydramine, cetirizine, famotidine, or any combination thereof.

[0173] The additional treatment (e.g., corticosteroid and / or antihistamine) may be administered orally, intramuscularly, intravenously, subcutaneously, or any combination thereof. In some embodiments, the routes of administration of the corticosteroid and the antihistamine are different. In some embodiments, the routes of administration of the corticosteroid and the antihistamine are the same. In some embodiments, the corticosteroid is administered intravenously at a dose of about, at least, or at most 10 mg. In some embodiments, the corticosteroid is administered at a dose of 10 mg or less (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0.5 mg, or any number or range between any two of these values). In some embodiments, the corticosteroid is administered at a dose of about, at least, or at most 5 to about 60 mg (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 mg, or a number or range between any two of these values). In some embodiments, the subject is administered dexamethasone intravenously at a dose of 10 mg.

[0174] In some embodiments, the antihistamine is administered at a dose of about 10 mg, about 20 mg, or about 50 mg (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 mg, or a number or range between any two of these values). In some embodiments, the subject is administered at least one of an H1-antihistamine and an H2-antihistamine. In some embodiments, the H1-antihistamine is diphenhydramine. In some embodiments, the diphenhydramine is administered intravenously at a dose of about 50 mg. In some embodiments, the H1-antihistamine is cetirizine, and cetirizine is administered orally at a dose of about 10 mg. In some embodiments, the H2-antihistamine is famotidine. In some embodiments, famotidine is administered orally or intravenously at a dose of about 20 mg.

[0175] In some embodiments, the subject in need of treatment has high levels of ANGPTL3 protein (e.g., plasma ANGPTL3 protein). A subject with high levels of ANGPTL3 includes, for example, a subject with ANGPTL3 levels higher than 90% of the human population. In some embodiments, the subject has symptoms of ANGPTL3-related disease or condition. In some embodiments, the subject does not have symptoms of ANGPTL3-related disease or condition. In some embodiments, the subject is at risk of developing ANGPTL3-related disease or condition. In some embodiments, the subject has or is suspected of developing ANGPTL3-related disease or condition.

[0176] In some embodiments, the subject has an abnormal level of ApoB protein (e.g., plasma ApoB protein). In some embodiments, the subject has a plasma ApoB level greater than 100 mg / dL (e.g., greater than about any of 100 mg / dL, 110 mg / dL, 120 mg / dL, 130 mg / dL, 140 mg / dL, 150 mg / dL, 160 mg / dL, 180 mg / dL, 200 mg / dL, 250 mg / dL, 300 mg / dL, 350 mg / dL, 400 mg / dL, 500 mg / dL, 750 mg / dL, 1000 mg / dL or higher).

[0177] In some embodiments, the subject has abnormal levels of lipids (e.g., total cholesterol, HDL, triglycerides, LDL, VLDL and other non-HDL). Diagnostic tests such as blood and urine laboratory tests can be performed to measure lipid levels. In some embodiments, the subject has a total cholesterol level greater than 200 mg / dL (e.g., greater than about any of 225 mg / dL, 250 mg / dL, 300 mg / dL, 350 mg / dL, 400 mg / dL, 500 mg / dL, 750 mg / dL, 1000 mg / dL or higher). In some embodiments, the subject has a plasma triglyceride level greater than about 150 mg / dL (e.g., greater than about any of 160 mg / dL, 180 mg / dL, 200 mg / dL, 250 mg / dL, 300 mg / dL, 350 mg / dL, 400 mg / dL, 500 mg / dL, 750 mg / dL, 1000 mg / dL or higher). In some embodiments, the subject has a plasma HDL level greater than about 60 mg / dL (e.g., greater than about 65 mg / dL, 70 mg / dL, 80 mg / dL, 90 mg / dL, 100 mg / dL, 150 mg / dL or higher). In some embodiments, the subject has a plasma VLDL level of greater than about 30 mg / dL (e.g., greater than about 35 mg / dL, 40 mg / dL, 50 mg / dL, 60 mg / dL, 70 mg / dL, 80 mg / dL, 90 mg / dL, 100 mg / dL or higher). In some embodiments, the subject has a plasma LDL level of greater than about 50 mg / dL (e.g., greater than about 60 mg / dL, 70 mg / dL, 75 mg / dL, 80 mg / dL, 90 mg / dL, 100 mg / dL, 130 mg / dL, 150 mg / dL, 200 mg / dL or higher). In some embodiments, the subject has a plasma LDL-C level greater than 100 mg / dL (e.g., greater than any of about 100 mg / dL, 110 mg / dL, 120 mg / dL, 130 mg / dL, 140 mg / dL, 150 mg / dL, 160 mg / dL, 180 mg / dL, 200 mg / dL, 250 mg / dL, 300 mg / dL, 350 mg / dL, 400 mg / dL, 500 mg / dL, 750 mg / dL, 1000 mg / dL or higher).In some embodiments, the subject has a plasma Lp(a) level greater than about 50 mg / dL (e.g., greater than about 60 mg / dL, 70 mg / dL, 80 mg / dL, 90 mg / dL, 100 mg / dL, 125 mg / dL, 150 mg / dL or higher). In some embodiments, the lipid (e.g., triglyceride and LDL) levels are blood levels of lipids. In some embodiments, the lipid (e.g., triglyceride and LDL) levels are plasma levels of lipids.

[0178] In some embodiments, the subject has one or more genetic markers (e.g., deletion, insertion, and / or mutation) in endogenous ANGPTL3 gene or its regulatory sequence, which substantially increase the expression level or activity, including functionality, of ANGPTL3 protein compared with normal healthy subjects.In some embodiments, the subject has one or more genetic mutations in genes directly or indirectly related to lipid or lipoprotein metabolism (e.g., familial hypercholesterolemia).In some embodiments, the subject is a mammal.In some embodiments, the subject is a human.

[0179] In some embodiments, the subject in need has clinical atherosclerotic cardiovascular disease (ASCVD). Clinical ASCVD is defined as a patient with a confirmed diagnosis of coronary heart disease, cardiovascular disease, stroke or peripheral artery disease. In some embodiments, the subject with ASCVD has elevated triglyceride and / or LDL cholesterol levels. In some embodiments, the subject with ASCVD with elevated triglyceride and / or LDL cholesterol levels also has type 2 diabetes, chronic kidney disease, and / or hepatic steatosis (e.g., non-alcoholic fatty liver disease).

[0180] In some embodiments, a subject in need has a blood glucose level (e.g., hemoglobin A1C, which measures the percentage of red blood cells that have sugar-coated hemoglobin) of about, at least, at least about, up to or up to about 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11%, or a number or range between any of these values. In some embodiments, the subject in need has an estimated average glucose level of about, at least, at least about, up to or up to about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350 mg / dL or any number or range between these values. In some embodiments, the subject in need has normal blood glucose levels. In some embodiments, the subject in need has prediabetes or diabetes. In some embodiments, the subject in need has a hemoglobin A1C ranging from about 5.7% to about 6.4%. In some embodiments, the subject in need has a hemoglobin A1C of about 6.5% or more.

[0181] In some embodiments, the subject in need has a body mass index (BMI) of about, at least, at least about, at most or at most about 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or any number or range between these values. In some embodiments, the subject in need has a healthy weight with a BMI ranging from about 18.5 to about 24.9. In some embodiments, the subject in need is overweight with a BMI ranging from about 25 to about 29.9. In some embodiments, the subject in need has obesity with a BMI of about 30 or more.

[0182] In some embodiments, the subject in need has an estimated glomerular filtration rate of about, at least, at least about, up to or up to about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, or any number or range between these values. In some embodiments, the subject in need has an estimated glomerular filtration rate in the range of 60-90 (i.e., mild reduction in renal function). In some embodiments, the subject in need has mild to moderate, moderate to severe, or severe reduction in renal function. For example, the subject in need has an estimated glomerular filtration rate lower than 60, e.g., in the range of 45-59, 30-44, 15-29, or less than 15.

[0183] In some embodiments, the subject in need has fatty liver disease or hepatic steatosis, including alcoholic liver disease and non-alcoholic fatty liver disease.In some embodiments, the subject in need has about, at least or at least about 5%, 6%, 7%, 8%, 9% or 10% liver fat compared to liver weight.Subject can be diagnosed as having fatty liver disease by elevated liver enzyme levels, ultrasound, magnetic resonance imaging (MRI) computed tomography (CT scan) or liver biopsy.

[0184] In some embodiments, the plasma ANGPTL3 protein level in the subject after carrying out the method is reduced by about, at least or at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or any number or range between these values.In some embodiments, the plasma ANGPTL3 protein level in the subject after carrying out the method is reduced by about, at least or at least about 75%, 80%, 90%, 95%, 98%, 99%, or more.

[0185] In some embodiments, plasma ApoB protein levels in a subject after performing the method are reduced by about, at least or at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or a number or range between any of these values. In some embodiments, plasma ApoB protein levels in a subject after performing the method are reduced by about, at least or at least about 75%, 80%, 90%, 95%, 98%, 99% or more.

[0186] In some embodiments, the compositions and methods described herein may result in a reduction in triglyceride and other non-HDL cholesterol content, which have been shown to be risk factors for cardiovascular disease.

[0187] In some embodiments, the plasma triglyceride level in the subject after performing the method is reduced to about 150 mg / dL or less (e.g., about, at most or at most about 145 mg / dL, 140 mg / dL, 130 mg / dL, 120 mg / dL, 110 mg / dL, 100 mg / dL, 90 mg / dL, 80 mg / dL, 70 mg / dL, 60 mg / dL, 50 mg / dL, 40 mg / dL, 30 mg / dL, 20 mg / dL or less). In some embodiments, the plasma triglyceride level in the subject after performing the method is reduced to about 40 mg / dL or less. In some embodiments, the plasma triglyceride level in the subject after performing the method is reduced to about 30 mg / dL or less. In some embodiments, the plasma triglyceride level in the subject after performing the method is reduced to about 20 mg / dL or less.

[0188] In some embodiments, the plasma triglyceride levels in the subject after performing the method are reduced by about, at least or at least about 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or any number or range between these values. In some embodiments, the plasma triglyceride levels in the subject after performing the method are reduced by about, at least or at least about 75%, 80%, 90%, 95%, 98%, 99%, or more.

[0189] In some embodiments, the plasma LDL level in the subject after performing the method is reduced to about, at most, or at most about 130mg / dL, 100mg / dL, 70mg / dL, 50mg / dL, or any number between these values.In some embodiments, the plasma LDL-C level in the subject after performing the method is reduced to about, at most, or at most about 90mg / dL, 80mg / dL, 70mg / dL, 60mg / dL, 50mg / dL, or any number between these values.In some embodiments, the plasma VLDL level in the subject after performing the method is reduced to about, at most, or at most about, at most, or at most about 30mg / dL, 25mg / dL, 20mg / dL, 10mg / dL, or any number between these values. In some embodiments, the total cholesterol level in the subject after performing the method is reduced to about, at most, or at most about 200 mg / dL, 175 mg / dL, 150 mg / dL, 100 mg / dL, 75 mg / dL, or a number between any two of these values.

[0190] In some embodiments, the plasma LDL level in the subject after performing the method is reduced by about, at least or at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or any number or range between these values.In some embodiments, the plasma LDL-C level in the subject after performing the method is reduced by about, at least or at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or any number or range between these values.In some embodiments, the plasma VLDL level in the subject after performing the method is reduced by about, at least or at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or any number or range between these values. In some embodiments, the total cholesterol level in the subject after performing the method is reduced by about, at least or by at least about 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or a number or range between any of these values.

[0191] In some embodiments, clinical studies are used to determine the safety and efficacy of the pharmaceutical formulations and compositions described herein.The inclusion / exclusion criteria for the studies may vary (see also Example 5 below).In some embodiments, the inclusion criteria may include one or more of the following:

[0192] 1. The subject is a human subject between the ages of 18 and 70, with a maximum weight not exceeding 100 kg.

[0193] 2. Subject is able to provide written informed consent.

[0194] 3. Subjects have a confirmed diagnosis of clinical atherosclerotic cardiovascular disease (ASCVD) with elevated TG levels above 200 mg / dl and / or elevated LDL levels above 100 mg / dl. The study population includes patients with a history of coronary heart disease, cardiovascular disease, stroke or peripheral artery disease.

[0195] 4. Subjects receiving statins should be receiving the maximum tolerated dose of the statin. If considered statin intolerant, patients should be intolerant to all doses of two different statin formulations. - Resistance to additional current standard of care (SOC) lines of treatment, including ezetimibe, PCSK9 inhibitors, etc., as determined by the investigator. - Subjects receiving statins or ezetimibe should be on a stable dose for >30 days prior to screening at the time of study entry, with no planned medication changes or dose escalation.

[0196] 5. Subjects of childbearing potential (post-menarche, with an intact uterus and at least one ovary, and less than 1 year postmenopausal) and biological male subjects must agree to use an acceptable method(s) of contraception from consent until at least 6 months after drug infusion (e.g., CTX310 infusion).

[0197] 6. Subject is willing and able to comply with scheduled visits, treatment plans, clinical tests, contraception guidelines, and other study procedures.

[0198] 7. Subject is willing to participate in an additional long-term follow-up study following completion of this study.

[0199] The exclusion criteria may include one or more of the following criteria: In some embodiments, to be eligible for enrollment in the clinical study, a subject must not meet any of the exclusion criteria listed below.

[0200] 1. Subject has a history of significant coagulopathy.

[0201] 2. The subject has a history of any illness or any clinical condition that, in the investigator's opinion, may confound the outcome of the study or pose additional risks to administering the study drug to the subject. This may include, but is not limited to, the following: history of relevant drug allergies; history of central nervous system disease; history or presence of clinically significant pathology; or history of psychiatric illness, or history of familial cancer syndromes.

[0202] 3. The subject has any previous or current malignancy or myeloproliferative disorder or significant immunodeficiency disorder.

[0203] 4. The subject is a patient with a confirmed diagnosis of homozygous familial hypercholesterolemia.

[0204] 5. Subject has the following complete blood count (CBC): normal white blood cell (WBC) <2,500 cells / mcL; hemoglobin (Hb) <11 g / dL for men and <10 g / dL for women; platelet count <100,000 / mcL.

[0205] 6. Subject has advanced liver disease, defined as: (a) aspartate transaminase (AST), alanine transaminase (ALT) greater than 3x the upper limit of normal (ULN), or direct bilirubin levels greater than 2x the ULN, or (b) baseline prothrombin time (international normalized ratio [INR]) greater than 1.5xULN, or (c) a history of cirrhosis.

[0206] 7. Subject has a left ventricular ejection fraction (LVEF) of less than 40% by echocardiogram.

[0207] 8. Subject has uncontrolled hypertension, uncontrolled arrhythmias or New York Heart Association (NYHA) class II, III and IV heart failure (HF).

[0208] 9. Subject has an acute coronary syndrome event within 24 weeks prior to Day 1.

[0209] 10. Subject has a central nervous system (CNS) seizure within 24 weeks prior to Day 1.

[0210] 11. The subject has a blood flow rate of 60 mL / min / 1.73 m 2 Have a baseline estimated glomerular filtration rate of less than

[0211] 12. Subject has undergone prior treatment with a gene therapy / editing product.

[0212] 13. Subject has a positive serology for human immunodeficiency virus-1 (HIV-1) or human immunodeficiency virus-2 (HIV-2), hepatitis B virus (HBV) (hepatitis B core antibody [HBcAb] or nucleic acid test [NAT]), or hepatitis C virus (HCV) (NAT).

[0213] 14. Subject is currently using, or has used within the 365 days prior to Day 1, any siRNA or antisense oligonucleotide molecule targeted to hepatocytes.

[0214] 15. Subject is currently using or has used within 90 days prior to Day 1 any monoclonal Ab treatment.

[0215] 16. Subject participated in another clinical study with the investigational drug / product within 30 days prior to screening or less than 5 half-lives of the investigational drug, whichever is longer, from screening.

[0216] 17. Subject has an investigator's assessment that the subject will not comply with the study procedures outlined in the protocol.

[0217] 18.The subject is a pregnant or lactating woman.

[0218] 19. The subject has nonalcoholic steatohepatitis (NASH).

[0219] The methods, systems, kits and compositions disclosed herein can be used to treat subjects with one or more of clinical atherosclerotic cardiovascular disease (ASCVD), homozygous familial hypercholesterolemia (HoFH), heterozygous familial hypercholesterolemia (HeFH), familial chylomicronemia syndrome (FCS), multifactorial chylomicronemia syndrome (MCS), familial combined hyperlipidemia (FCH or FCHL), metabolic syndrome (MetS), type 2 diabetes (T2D) and non-alcoholic fatty liver disease (NAFLD). HoFH and FCS are rare diseases. In some embodiments, the method is effective for lowering LDL, thereby treating familial hypercholesterolemia (FH). In some embodiments, the subjects are those with ASCVD and elevated triglyceride (TG) levels and / or high low-density-lipoprotein cholesterol (LDL-C) levels, including subjects who are resistant to currently available treatments (e.g., non-responders to one or more of evinacumab, inclisiran, ezetimibe and statins).

[0220] Provided herein also includes a kit for carrying out the method described herein.The kit can include a genome targeting nucleic acid (e.g., gRNA targeting ANGPTL3 gene) and an RNA-guided endonuclease (e.g., Cas9) or a nucleic acid encoding an RNA-guided endonuclease.In any of the above kits, the kit can further include a polynucleotide (e.g., donor template) that is inserted to produce desired genetic modification.The components of the kit can be in separate containers or can be combined in a single container.

[0221] Any of the kits described above may further include one or more additional reagents selected from buffers, buffers for introducing polypeptides or polynucleotides into cells, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, adapters for sequencing, etc. The buffers may be stabilizing buffers, renaturing buffers, dilution buffers, etc. The kits may also include one or more components that can be used to facilitate or enhance on-target binding or endonuclease cleavage of DNA, or to improve targeting specificity.

[0222] In some embodiments, the kit may further include instructions for using the components of the kit to carry out the methods described herein. The instructions for carrying out the methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be present in the kit as a package insert on the label of the container of the kit or its components (i.e., in association with the packaging or subpackaging). The instructions may be present as an electronically stored data file present on a suitable computer-readable storage medium, such as a CD-ROM, disk, flash drive, etc. In some cases, the actual instructions are not present in the kit, and a means may be provided for obtaining the instructions from a remote source (e.g., via the Internet). An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. Together with the instructions, this means for obtaining the instructions may be recorded on a suitable carrier. Certain aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not intended in any way to limit the scope of the disclosure. EXAMPLES

[0223] [Example 1]

[0224] Assessing ANGPTL3 gene editing efficiency in non-human primates (NHPs) This example evaluates ANGPTL3 gene editing efficiency in non-human primates (NHPs) (e.g., cynomolgus monkeys) by measuring ANGPTL3 protein and triglyceride levels before and after treatment.

[0225] A number of CRISPR-Cas9 / gRNA combinations were evaluated, and lead formulations that produced highly efficient deletion of the ANGPTL3 gene with substantially low off-target effects were tested in vivo in NHPs. Lipid nanoparticles encapsulating gRNA molecules of SEQ ID NO: 4 (e.g., SEQ ID NO: 21) and Cas9 mRNA were injected into NHPs, and plasma samples were collected hourly on the first day after dosing according to the study design shown in Figure 1.

[0226] As shown in Table 3, five groups of animals (2 animals / group) were treated with one or two doses according to the study design in FIG. 1 (see also the last column in Table 3). For example, NHPs in group 1 (Table 3) were treated with the first dose (e.g., 2 mg / kg) on ​​day 1 and the second dose (e.g., 2 mg / kg) on ​​day 22. Plasma samples were collected on days 4, 8, 15, 22, 29, and 36. NHPs in group II (Table 3) were treated with only the first dose on day 1. Plasma samples were collected on days 4, 8, 15, and 22. A sandwich enzyme-linked immunosorbent assay (ELISA) for ANGPTL3 protein was used to detect the concentration of ANGPTL3 protein in the collected plasma, and EasyRA analysis was used to analyze the lipid profile of the samples.

[0227] [Table 3]

[0228] Figure 2 is a graph showing the percentage change in plasma ANGPTL3 protein from baseline in group 1 NHPs and group 3 NHPs. The results demonstrate that NHP plasma ANGPTL3 levels are significantly reduced using Cas9 mRNA and gRNA targeting the ANGPTL3 gene. Generally, approximately 70%-90% reductions from baseline were observed in NHPs. For example, in group I, 73% and 90% reductions in ANGPTL3 protein from baseline were observed.

[0229] FIG. 3A is a graph showing plasma triglyceride levels of NHPs in group 1 before and after treatment. FIG. 3B is a graph showing the percentage change in plasma triglyceride levels from baseline of NHPs in group 1. FIG. 4A is a graph showing plasma triglyceride levels of NHPs in group 3 before and after treatment. FIG. 4B is a graph showing the percentage change in plasma triglyceride levels from baseline of NHPs in group 3. FIG. 5A-FIG. 5B are two graphs showing the maximum percentage change in plasma triglyceride levels of NHPs in group 1 (FIG. 5A) and group 3 (FIG. 5B). FIG. 5C-FIG. 5D are two graphs showing the percentage change in plasma triglyceride levels from baseline at day 36 in group I (FIG. 5C) and group 3 (FIG. 5D). A 50% and 76% reduction in triglyceride levels from baseline was observed in group 1 and about 31% in group 3 at day 36.

[0230] The results demonstrate that both ANGPTL3 protein and plasma triglyceride levels are significantly reduced using Cas9 mRNA and gRNA targeting at the ANGPTL3 gene. [Example 2]

[0231] Assessing ANGPTL3 gene editing efficiency in liver and other organ tissues In this example, ANGPTL3 gene editing efficiency (e.g., indel editing percentage) was measured in liver and other organ tissues including spleen, brain, heart, kidney, lung and testis.

[0232] Biopsies of NHP organs were performed, cells were isolated from the biopsied material, chromosomal DNA was extracted from these cells, and on-target breakage frequencies were measured by determining indel frequencies using TIDES analysis.

[0233] 6A-6D are graphs showing ANGPTL3 gene editing efficiency in various organ tissues. The results demonstrate that ANGPTL3 gene editing efficiency is significantly higher in liver than in other organ tissues. The indel frequency ranges from 30% to 65% in hepatocytes of the four NHPs examined, with substantially lower indel frequency (e.g., between 0% and 10%) in other organ cells. FIG. 7 is a graph showing the percentage of ANGPTL3 gene editing in hepatocytes of NHPs of groups I and III.

[0234] Liver function tests were also performed before and after treatment to provide information about the liver status of the NHPs. Figures 8A-8E are graphs showing liver function tests for alanine aminotransferase (ALT) (Figure 8A), alkaline phosphatase (ALP) (Figure 8B), aspartate aminotransferase (AST) (Figure 8C), blood albumin (ALB) (Figure 8D), and bilirubin (TBIL) (Figure 8E). No liver dysfunction or damage was detected after ANGPTL3 gene editing. [Example 3]

[0235] Toxicity studies of ANGPTL3 gRNA formulations In this example, toxicity studies were carried out in NHPs. Lipid nanoparticles encapsulating gRNA molecules of SEQ ID NO: 3 (ANGPTL3_T10, e.g., SEQ ID NO: 20) and Cas9 mRNA were formulated into ANGPTL3 gRNA formulations designated "CTX310". The CTX310 formulations were administered to three groups of NHPs (e.g., cynomolgus monkeys) at a single dose via 60-minute IV infusion on day 1 at dose levels of 0.5 mg / kg, 1.5 mg / kg, and 3.0 mg / kg, respectively. Each group of NHPs included 4 female and 4 male cynomolgus monkeys. Plasma samples were collected according to the study design shown in Figure 9. Interim necropsies were performed on day 37 and terminal necropsies on day 103.

[0236] Data from the CTX310 pilot toxicity study are presented along with data from the ANGPTL3 NHP study performed in Example 1.

[0237] [Table 4]

[0238] The tissue distribution of gene editing in CTX310-treated cynomolgus monkeys was also determined (see, e.g., Figures 10A-10D). Cynomolgus monkeys were IV-infused with three different doses of CTX310: 0.5 mg / kg (Figure 10A), 1.5 mg / kg (Figure 10B), and 3.0 mg / kg (Figure 10C). Four monkeys from each treatment group were sacrificed on day 37, various tissues were harvested, and editing frequencies were measured in autopsy samples using next-generation sequencing. Day 37 data for the 0.5, 1.5, and 3 mg / kg treatment cohorts are shown in Figures 10A, 10B, and 10C, respectively. Data are presented as mean ± SD. Figure 10D shows gene editing efficiency data at 3 months post-dose for each dosing cohort. The results demonstrate that ANGPTL3 gene editing efficiency is significantly higher in the liver than in other organ tissues. The editing efficiencies for 1 month (Table 10A) and 3 months (Table 10B) are also shown below.

[0239] [Table 5]

[0240] [Table 6]

[0241] Figure 11 and Table 5 below show the percentage of ANGPTL3 gene editing in hepatocytes of cynomolgus monkeys treated with 0.5, 1.5 and 3mg / kg CTX310. Efficient editing was achieved in the liver. Figure 11 shows up to 70% dose-dependent liver editing in NHP.

[0242] [Table 7]

[0243] Table 6 and Figure 12A show the plasma levels of ANGPTL3 protein in cynomolgus monkeys treated with three different doses of CTX310 (0.5, 1.5 and 3.0 mg / kg) compared with the control group.Table 7 and Figure 12B show the percentage change in plasma levels of ANGPTL3 protein from baseline in cynomolgus monkeys treated with CTX310.Baseline is the average of ANGPTL3 protein levels 13 days before treatment (day -13) and 10 days before treatment (day -10) and day 1 (before dosing).

[0244] [Table 8]

[0245] [Table 9]

[0246] Both Figures 12A and 12B demonstrate a dose-dependent reduction in plasma ANGPTL3 protein after CTX310 dosing. Approximately 56% reduction in ANGPTL3 protein from baseline was observed in cynomolgus monkeys treated with 0.5 mg / kg CTX310, and approximately 84%-89% reduction from baseline was observed in cynomolgus monkeys treated with 1.5 mg / kg and 3 mg / kg CTX310 (see, e.g., Figure 12B). Figure 12C is a graph showing the percentage change in plasma ANGPTL3 protein from baseline in cynomolgus monkeys 37 days after CTX310 treatment. Figure 12D is a graph showing the percentage change in serum ANGPTL3 protein demonstrating an approximately 90% reduction in serum ANGPTL3 protein. Figure 12E is a graph showing the percentage change in plasma ANGPTL3 protein from baseline in cynomolgus monkeys about 3 months after CTX310 treatment.

[0247] 13A-13C are graphs showing the percentage change in plasma triglyceride levels normalized to baseline in cynomolgus monkeys after CTX310 treatment with three different doses: 0.5 mg / kg (FIG. 13A), 1.5 mg / kg (FIG. 13B), and 3.0 mg / kg (FIG. 13C). The baseline is the average of the triglyceride levels 10 days before treatment (day -10) and the triglyceride levels on day 1 (pre-dosing). Table 8 and FIG. 13D show the percentage change in plasma triglyceride levels from baseline in cynomolgus monkeys on day 37 after CTX310 treatment. At day 37, a greater than 50% reduction in triglyceride levels from baseline was observed in NHPs treated with 1.5 mg / kg and 3 mg / kg CTX310 formulations. FIG. 13E is a graph showing the percentage change in serum triglyceride levels from baseline after one month of CTX310 treatment, demonstrating a >50% reduction in serum triglycerides at one month. FIG. 13F-H shows plasma triglyceride levels in mg / dL in cynomolgus monkeys after CTX310 treatment with three different doses: 0.5 mg / kg (FIG. 13F), 1.5 mg / kg (FIG. 13G), and 3.0 mg / kg (FIG. 13H). FIG. 13I is a graph showing the percentage change in triglyceride levels from baseline after three months of CTX310 treatment.

[0248] [Table 10]

[0249] Figure 14A is a plot showing the correlation between triglyceride reduction in liver and ANGPTL3 gene editing percentage. Figure 14B is a plot showing the correlation between ANGPTL3 protein reduction in liver and ANGPTL3 gene editing percentage.The results demonstrate that ANGPTL3 gene editing efficiency in liver is positively correlated with the reduction in triglyceride level and ANGPTL3 protein level.

[0250] Liver function tests were also performed before and after treatment to provide information about the liver status of the NHPs. The data show that CTX310 produces dose-dependent transient increases in ALT, AST, ALP and bilirubin. No liver dysfunction or damage was detected after dosing (e.g., 14 days after dosing) (Figures 20A-21B). The data shown in Figures 20A-20B are from a non-Good Laboratory Practice (GLP) toxicity study (shown below), and Figures 21A-21B are from a GLP toxicology study.

[0251] A non-GLP dose-ranging toxicity study was conducted for CTX310. This study includes data on safety pharmacology. A 3-month dose-ranging study was conducted to evaluate the toxicity of a single dose of CTX310 in cynomolgus monkeys (non-GLP, Table 11). Endpoints in this study included clinical findings, clinical pathology (hematology, serum chemistry, and coagulation), snapshot ECG, and histology.

[0252] [Table 11]

[0253] There were no unscheduled deaths in this study. No abnormal clinical signs or changes in body weight associated with CTX310 were observed. As shown in Figures 20A-B, a transient increase in liver enzymes (alkaline phosphatase, aspartate aminotransferase, alanine transaminase) was observed in animals treated with either 1.5 or 3.0 mg / kg CTX310 in a dose-dependent manner. This increase peaked on day 3, partially recovered on day 8, and returned to baseline levels on day 15. Bilirubin levels were elevated only in the 3.0 mg / kg group and fully recovered on day 15. TG levels were sharply elevated on day 3 in two animals in the 3.0 mg / kg group, but rapidly recovered on day 8. Both TG and total cholesterol levels were decreased in a dose-dependent manner in all animals treated with CTX310. There were no CTX310-related changes in any hematology or coagulation parameters.

[0254] ECG tracings were captured once during acclimation on day -6, then once on day 28 and once on day 79. All electrocardiograms evaluated in the study were considered qualitatively and quantitatively normal. No abnormalities in rhythm and waveform morphology were found at all dose levels based on a comparison of post-dosing mean values ​​once during acclimation on day -6, once on days 28 and 79 with control values. No CTX310-related effects on heart rate were observed at any level.

[0255] At both the interim and terminal necropsies, tissues were collected, weighed, and histopathology was evaluated. No abnormal findings in gross pathology or organ weights were observed throughout the 12-week study. There was a unique abnormal histopathology finding of minimal mixed inflammatory cell infiltrate that was present in both control and treatment groups, although more frequent in the 3 mg / kg group (1 / 4 animals in the vehicle group and 4 / 4 animals in the 3 mg / kg group). This finding was not associated with degeneration or necrosis and was therefore not considered adverse. The incidence and severity of this finding was similar at the 1-month and 3-month necropsies. A study analyzing LNP persistence after dosing found that the majority of LNP was cleared from the circulation within 1 week of dosing. [Example 4]

[0256] Effect of LDL receptor on lipid nanoparticle uptake Traditional LNP uptake into hepatocytes is mediated by the apolipoprotein E-low density lipoprotein receptor (ApoE-LDLR) or the N-acetyl-D-galactosamine / asialoglycoprotein receptor pathway (GalNAc-ASGPR). The ApoE-LDLR pathway requires the presence of LDLR in the target hepatocyte, while the GalNAc-ASGPR pathway requires the presence of GalNAc on the administered LNP. These pathways are of particular interest for LNP-based treatment of familial hypercholesterolemia, as patients with genetic disorders typically present as heterozygous (HeFH) or homozygous (HoFH) for a deletion of LDLR. Without the presence of LDLR in hepatocytes, LNP-based treatment would not be possible in these patients. Alternatively, in LDLR-deficient patients, GalNAc may be incorporated into LNP for uptake via the GalNAc-ASGPR pathway.

[0257] In this example, mice were administered various LNPs containing gRNA targeting the mouse ANGPTL3 gene to determine whether delivery of LNPs to the liver is dependent on the LDL receptor. Two LNPs (RIV-000005 and RIV-000006) were formulated to follow the GalNAc-ASGPR uptake pathway, one without GalNAc (RIV-000005) and the other with 2.5% GalNAc (RIV-000006). The third LNP (RIV-000004) was formulated with ALN-369 / DSPC / cholesterol / DMPE-PEG. RIV-000004 is known to follow the ApoE-LDLR uptake pathway and is not expected to be effective in mice with homozygous LDLR deletion. All three LNPs contain the same gRNA targeting the mouse ANGPTL3 gene and SpCas9 RNA as described herein. The editing efficiency in liver, plasma ANGPTL3 protein levels and plasma lipid levels of formulations RIV-000004, RIV-000005 and RIV-000006 were evaluated in this example.

[0258] A total of 71 female mice aged 4–5 weeks weighing between 20–25 g were used in these studies. 21 C57BL / 6J or wild-type mice (stock no. 000664), 21 B6.129S7-Ldlr tm1Her Twenty-five LDLR / J or LDLR KO mice (LDLR- / -) (stock no. 002207) and 25 LDLR heterozygous (LDLR+ / -) mice were all obtained from The Jackson Laboratory (Bar Harbor, ME). LDLR heterozygous mice were custom ordered from The Jackson Laboratory (Bar Harbor, ME) and generated by crossing C57BL / 6J or wild-type strains with LDLR KO mice.

[0259] The in vivo experimental design is summarized in Table 9.

[0260] [Table 12]

[0261] In Study 1 (see Table 9 for study design), wild-type and LDLR-deficient mice were dosed with 2 mg / kg RIV-000005 or RIV-000006. Mice were sacrificed 96 hours after dosing. Livers and plasma were collected immediately after sacrifice to determine editing efficiency, circulating mANGPTL3 levels and triglycerides.

[0262] FIG. 15A-C show wild-type (WT) and LDLR1 cells treated with two exemplary lipid nanoparticles (RIV-000005 and RIV-000006) containing gRNA targeting the mouse ANGPTL3 gene. - / -Graphs showing gene editing efficiency (FIG. 15A), Angptl3 protein levels (FIG. 15B) and triglyceride levels (FIG. 15C) in the liver of mice (Hom). Editing efficiency in the liver was determined by TIDE 96 hours after dosing (FIG. 15A). Circulating mANGPTL3 protein levels were determined by ELISA in collected plasma samples (FIG. 15B). Plasma triglycerides were determined by EasyRA in collected plasma (FIG. 15C).

[0263] Comparable editing efficiency is observed between wild-type and LDLR-deficient mice dosed with RIV-000005 or RIV-000006 (FIG. 15A). Consistent with the editing efficiency, both circulating mANGPTL3 protein and plasma triglycerides are reduced in LNP-dosed mice compared to untreated controls (FIGS. 15B-C).

[0264] As in Study 1, wild-type and LDLR-deficient mice were dosed with 1 mg / kg RIV-000005 or RIV-000006 in Study 2. An additional study group of WT and LDLR-deficient mice was dosed with RIV-000004 LNPs. Mice were sacrificed 96 hours after dosing. Livers and plasma were collected immediately after sacrifice to determine editing efficiency, circulating mANGPTL3 levels, triglycerides and LDL.

[0265] FIG. 16A-C show wild-type (WT) and LDLR1-positive mice treated with three exemplary lipid nanoparticles (RIV-000004, RIV-000005, and RIV-000006) containing gRNA targeting the mouse ANGPTL3 gene. - / -16A-C are graphs showing gene editing efficiency in liver (FIG. 16A), Angptl3 protein levels (FIG. 16B), and triglyceride levels (FIG. 16C) in mice (Hom). Liver editing efficiency in liver was determined 96 hours post-dosing by TIDE. Circulating mANGPTL3 protein levels were determined by ELISA in collected plasma samples. Plasma triglycerides were determined by EasyRA in collected plasma. No difference was detected in liver editing efficiency in wild-type and LDLR-deficient mice treated with RIV-000005 and RIV-000006 (FIG. 16A). However, editing was not observed in LDLR homozygous mice dosed with RIV-000004, suggesting that this LNP is not taken up without the presence of LDLR. The reduction in circulating mANGPTL3 and plasma triglycerides is consistent with the editing data (FIGS. 16B-C).

[0266] Plasma LDL levels were also determined for Study 2 animals and are shown in Figure 16D. LDL levels were determined using EasyRA. The dotted red line represents the EasyRA detection limit for LDL of 6 mg / dL.

[0267] Figures 16E-H show editing efficiency (Figure 16E), ANGPTL3 levels (Figure 16F), triglyceride levels (Figure 16G), and LDL levels (Figure 16H) data after 1 month in LDLR homozygous mice receiving the indicated treatments.

[0268] Wild-type mice naturally have low levels of LDL, and LDL measurements in wild-type mice were below the limit of detection (data not shown). Heterozygous deletion of LDL raises plasma LDL enough to be detected, but the levels are too low to determine differences between treatment groups. Homozygous deletion of LDLR results in a clear increase in plasma LDL levels. Homozygous mice treated with RIV-000005 had reduced plasma levels below the limit of detection. Two of three mice treated with RIV-000006 had reduced plasma LDL levels below the limit of detection, while one mouse had LDL levels consistent with untreated homozygous mice. Note that mice with high LDL levels showed similar liver editing efficiency as mice with reduced LDL levels. Consistent with the editing data, RIV-000004-treated homozygous mice did not show a reduction in plasma LDL (Figure 16D).

[0269] Together, in both studies, wild-type and LDLR-deficient mice treated with the LNP formulations described herein showed comparable hepatic mANGPTL3 editing and reduction in circulating mouse ANGPTL3 protein and plasma triglyceride levels, regardless of the presence of GalNAc.These data show that LNPs formulated to follow the GalNAc-ASGPR uptake pathway are effective in both heterozygous and homozygous LDLR-deficient settings and do not require the addition of GalNAc, while LNPs formulated to follow the ApoE-LDLR uptake pathway are not effective in mice with homozygous LDLR deletion. [Example 5]

[0270] Example inclusion and exclusion criteria for clinical studies This example describes non-limiting, illustrative criteria for the inclusion and exclusion of patients in clinical trials to determine the safety and efficacy of the pharmaceutical formulations described herein.

[0271] Inclusion criteria may include one or more of the following criteria: In some embodiments, a subject must meet all of the following criteria to be considered suitable for participation in the clinical study.

[0272] 1. Age ≥ 18 and ≤ 75 years; 2. Able to provide written informed consent; 3. Subjects diagnosed with persistent dyslipidemia defined by a documented history of elevated TG levels > 300 mg / dL and / or elevated LDL-C levels > 100 mg / dL (> 70 mg / dL for ASCVD) and / or non-HDL levels > 160 mg / dL and / or ApoB levels > 100 mg / dL; 4. Subjects receiving statins must be on a stable dose for > 30 days prior to screening and must have been refractory to standard line of treatments available through routine clinical practice, including ezetimibe and / or bempedoic acid and / or PCSK9 (alirocumab or evolocumab) and / or ANGPTL3 (evinacumab) monoclonal antibodies, for at least 26 weeks prior to screening; 5. Subjects with homozygous hypercholesterolemia and who have been treated with PCSK9-targeted interfering RNA therapy (inclissimab) or EGFR-targeted cytotoxic T cells (CTC ... 5. Subjects receiving a course of chemotherapy (including statins, ezetimibe, and / or bempedoic acid and / or PCSK9 and / or ANGPTL3 inhibitors) must be refractory to exposure for at least 365 days prior to screening; 6. Subjects receiving available standard lines of therapy, including statins, ezetimibe, and / or bempedoic acid and / or PCSK9 and / or ANGPTL3 inhibitors, must be on a stable dose for >30 days prior to screening with no planned medication or dose escalation at the time of study entry; 7. Subjects of childbearing potential (postmenarche, with an intact uterus and at least one ovary, and less than 1 year postmenopausal) and biological male subjects must agree to use an acceptable method(s) of contraception defined in the protocol from consent through at least 1 year after CTX310 infusion; 8. Willing and able to comply with scheduled visits, treatment plan, laboratory tests, contraception guidelines, and other study procedures; and 9. Willing to participate in a long-term follow-up study for up to 15 years after completion of the study.

[0273] To be eligible for enrollment in the study, subjects must not meet any of the exclusion criteria listed below: 1. FCS patients with a confirmed diagnosis of biallelic LPL or GP1HBP1 mutation; 2. Complete blood count (CBC): normal white blood cells (WBC) < 2,500 cells / mcL, hemoglobin (Hb) Men <11 g / dL, women <10 g / dL, platelet count <100,000 / mcL; 3. Evidence of liver disease: defined as aspartate transaminase, alanine transaminase >2 × upper limit of normal (ULN), or total bilirubin value >2 × ULN, or: baseline prothrombin time (international normalized ratio) >1.5 × ULN, or fibrosis score ≥2 (NAFLD activity score); 4. Current use of any hepatocyte-targeting small interfering RNA or antisense oligonucleotide molecule (or use within 365 days prior to Day 1 of inclisiran); 5. Any monoclonal antibody treatment (evolocumab , alirocumab or evinacumab) or current use within 90 days prior to Day 1; 6. Participation in another clinical study with the investigational drug / product within 30 days of screening or for less than 5 half-lives of the investigational drug, whichever is longer; 7. Cardiac left ventricular ejection fraction < 50% by echocardiogram; 8. Uncontrolled hypertension or uncontrolled arrhythmia; 9. Acute coronary syndrome event within 24 weeks prior to Day 1, 8. CNS attack within 24 weeks prior to Day 1; 10. Acute pancreatitis within 12 weeks prior to Day 1; 11. Baseline estimated glomerular filtration rate < 60 mL / min / 1.73 m 212. Diagnosis of nephrotic syndrome or albuminuria >2+ on urine dipstick; 13. Inadequate diabetic control with glycated hemoglobin (HbA1C) >10%; 14. History of alcohol or drug abuse and nonadherence to withdrawal during the study period; 15. History of significant coagulopathy; 16. Uncontrolled or untreated thyroid disease; 17. Patients receiving selective serotonin reuptake inhibitor medication or chronic systemic corticosteroid therapy; 18. Prior treatment with gene therapy / edited products; 19. Current use of niacin-based supplements or dietary supplements that may affect lipid levels in unstable doses / amounts >30 days prior to the cleaning visit;20. Positive serology for human immunodeficiency virus-1 (HIV-1) or HIV-2, Hepatitis B virus (Hepatitis B core antibody or nucleic acid test [NAT]), or Hepatitis C virus (NAT);21. History of any disease or any clinical condition that, in the investigator's opinion, may confound the results of the study or pose additional risks to administering the study drug to the subject. This may include, but is not limited to, a history of relevant drug allergies; a history of central nervous system (CNS) disease; a history or presence of a clinically significant condition; or a history of psychiatric illness, or a history of a familial cancer syndrome;22. Any previous or current malignancy or myeloproliferative disorder or significant immunodeficiency disorder;23. Pregnant or lactating female;24. Investigator's assessment that the subject will not comply with the study procedures outlined in the protocol. [Example 6]

[0274] Phase 1 research design A non-limiting exemplary design for a Phase 1 safety and tolerability clinical study for one or more ANGPTL3 gene editing nanoparticles (e.g., CTX310) described herein, and how a decision may be made based on the results of the Phase 1 study to proceed to a Phase 2 clinical study, are shown in Figures 17 and 18. In Figures 17 and 18, indications 1-4 and cohorts 1-4 explored in Phase 2 include, but are not limited to: clinical atherosclerotic cardiovascular disease (ASCVD), homozygous familial hypercholesterolemia (HoFH), heterozygous familial hypercholesterolemia (HeFH), familial chylomicronemia syndrome (FCS), multifactorial chylomicronemia syndrome (MCS), familial combined hyperlipidemia (FCH or FCHL), and metabolic syndrome (MetS), others (type 2 diabetes (T2D), nonalcoholic fatty liver disease (NAFLD)). HoFH and FCS are rare diseases. Subjects ages 18 to 75 (inclusive) with dyslipidemia with persistently high levels of TG and / or non-HDL-C [including LDL, VLDL, IDL and Lp(a)] and / or ApoB levels above the acceptable limits recommended by ACC and AHA guidelines despite maximum tolerated doses of available lipid-lowering treatments, dietary and lifestyle modifications (refractory population). Common HeFH mutations may include LDLR, ApoB, PCSK9 and LDLRAP1.

[0275] In some embodiments, the objectives include: safety evaluation of LNP-formulated CRISPR-guide RNA-Cas9 nuclease for in vivo editing of ANGPTL3 in the liver, dose-finding safety study to establish optimal biological dose (OBD) or maximum tolerated dose (MTD) for Phase 2 study, and activity evaluation by evaluating percent reduction in ANGPTL3 levels and percent reduction in lipids. Exemplary study objectives and endpoints are described in Table 13 below. A non-limiting study schematic is shown in Figure 23.

[0276] [Table 13]

[0277] As shown in Figure 23, oral steroids and / or antihistamines may be provided to the subject. Oral steroids and antihistamines are standard treatments for LNP-formulated drug Tx (Onpatro, NTLA-2001 and Verve 101) to manage inflammatory response (IR) and LFT. For follow-up, each subject is monitored for adverse events (AEs), adverse events of special interest (AESIs), and effects on lipid parameters for 12 months after infusion. For long-term follow-up, subjects may be carried forward to another follow-up study for up to 15 years.

[0278] In some cases, a phase 1 safety and tolerability clinical study of CTX310 is conducted in patients with clinical atherosclerotic cardiovascular disease (ASCVD) and elevated triglyceride (TG) levels and / or high low-density-lipoprotein cholesterol (LDL-C) levels that are resistant to available treatments (Figure 17). Clinical ASCVD is defined as a patient with a confirmed diagnosis of coronary heart disease, cardiovascular disease, stroke, or peripheral artery disease. For example, the patient has TG > 200 mg / dL, LDL-C > 100 mg / dL, or both. The patient may be between 18 and 70 years old. In some cases, a phase 1 safety and tolerability clinical study of CTX310 is conducted in patients with refractory dyslipidemia with elevated triglyceride levels and / or elevated ApoB levels and / or elevated non-HDL levels (Figure 18). For example, in some cases, patients have, or are expected to have, non-HDL-C > 160 mg / dL, TG > 300 mg / dL, ApoB > 100 mg / dL, or a combination thereof.

[0279] According to the guidelines of the Canadian Cardiology Society, the American Heart Association and the European Society of Cardiology, ApoB and non-HDL are superior markers for calculating CVD risk compared to LDL-C. The following cut-offs are proposed for inclusion, as shown in Table 14 below. Cut-offs include: TG levels >300mg / dL and / or LDL-C >100mg / dL (or >70mg / dL for ASCVD) and / or non-HDL levels >160mg / dL and / or -ApoB levels >100mg / dL.

[0280] [Table 14]

[0281] Normal TG levels are <150 mg / dL (1.7 mml / L), borderline high levels are 150-199, high 200-500, with 500 being very high. For HoFH, TG levels may be >300 and for HeFH, TG levels may be >130.

[0282] In some cases, the patient has failed one or more prior treatments with statins, ezetimibe and / or PCSK9 inhibitors. In some cases, the patient has received one or more prior treatments with statins, ezetimibe and / or PCSK9 inhibitors for at least 12 weeks prior to screening. In some cases, the patient has refractory dyslipidemia. In some cases, the subject receiving a statin is receiving the maximum tolerated dose of the statin or, if considered intolerant to statins, the subject is intolerant to all doses of two different statin formulations. Refractory: Subjects who have not reached the recommended target lipid levels despite lifestyle changes, dietary interventions and all available and available drug therapies.

[0283] Subjects receiving statins must be on a stable dose for >30 days prior to screening and must be refractory to standard line of treatments available through routine clinical practice, including statins, ezetimibe and / or bempedoic acid and / or PCSK9 (alirocumab or evolocumab) and / or ANGPTL3 (evinacumab) monoclonal antibodies, for at least 26 weeks prior to screening.

[0284] Subjects with homozygous hypercholesterolemia and receiving PCSK9-targeted interfering RNA therapy (inclisiran) must be refractory to said therapy for at least 365 days of treatment prior to screening.

[0285] In this study, a single dose escalation 3+3 will be performed. The proposed dose levels are shown in Table 2. Based on preclinical pilot toxicity, 3mg / kg was determined as the no observed adverse effect level (NOAEL). If 3mg / kg is the predicted NOAEL in a GLP study, then 1 / 3 of that dose with a 1 / 10 safety factor = 0.1mg / kg starting dose. If 1mg / kg is determined as the NOAEL in a GLP study, then 1 / 3 allometric scaling followed by approximately 3x safety factor = 0.1mg / kg starting dose.

[0286] For safety monitoring and toxicity management, a 30-day dose-limiting toxicity (DLT) acute toxicity monitoring period for escalation to the next dose level (DL) is used. This ensures that LFTs return to baseline levels before proceeding to the next patient / DL. Eligibility criteria exclude subjects based on strict liver function criteria. At screening, ALT / AST >2×upper limit of normal (ULN), or total bilirubin >2×ULN, or baseline prothrombin time (international normalized ratio) >1.5×ULN, or fibrosis score ≧2 (NAFLD activity score). LFTs and coagulation are monitored at each evaluation time point, e.g., days 1, 2, 3, 4; weeks 1, 2, 3; day 30; and days 2, 3, 6, 9, and 12. Prophylactic steroids and antihistamines are used prior to infusion to mitigate potential infusion-related reactions and elevated LFTs.

[0287] One or more endpoints of the Phase 1 study may be a 6-month endpoint (or a 3-month, 4-month, 5-month, 7-month, 8-month, 9-month, 10-month, 11-month, or 12-month endpoint), for example, an endpoint of LDL-C levels of 70 mg / dL or less. In some cases, the LDL-C level endpoint is 80 mg / dL, 75 mg / dL, 65 mg / dL, 60 mg / dL, 55 mg / dL, or 50 mg / dL or less. In some embodiments, the non-HDL endpoint is an LDL level of about, at least, or at least about greater than 20 mg / dL, 25 mg / dL, 30 mg / dL, 35 mg / dL, or 40 mg / dL. In some cases, the patient undergoes a liver biopsy 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more after treatment.

[0288] An exemplary Phase 2 patient population based on dose escalation results (eg, after 6 months of treatment) is shown in FIG. [Example 7]

[0289] Genome editing characterization Computational and experimental methods are used to evaluate the potential of CTX310 to introduce unintended genomic alterations (Table 12). Genomic sites with potential off-target editing introduced by CTX310 sgRNA are designated using homology-dependent and genome-wide homology-independent methods. Using hybrid capture followed by deep sequencing, indel formation at these candidate sites is evaluated in the intended cell type for editing, PHH, and representative cell types of tissues where significant on-target editing was observed in vivo in the NHP study, spleen and adrenal tissues, showing unintended exposure to CTX310 editing components. Importantly, the hybrid capture sequencing experiment includes a measurement of on-target editing, and samples are also evaluated for ANGPTL3 protein reduction. Off-target evaluation uses pharmacologically relevant in vitro editing conditions. Off-target sites with statistically confirmed edits are determined and presented with discussion of the potential for functional disruption of proximal genomic elements and an overall assessment of safety risks.

[0290] Chromosomal rearrangements associated with CTX310 editing will be characterized using two complementation assays: ddPCR for quantification of homologous transfers, and long-read sequencing for characterization of large insertions and deletions. Each assay will be performed on three donor lots of PHH treated with pharmacologically relevant CTX310 concentrations. An overview of the planned genomic studies is shown below in Table 12.

[0291] [Table 15]

[0292] Planned in vitro editing conditions can be selected to suit in vivo conditions in monkeys and calibrated by on-target editing (Figure 22A-B). The matching in vivo conditions are 3x allometric scaling of the highest CTX310 dose level 1 mg / kg proposed in humans, leading to a 3 mg / kg dose in monkeys. Logistic curves are fitted to the in vivo editing rate (3x CTX310 dose in monkeys) and the in vitro editing rate (CTX310 dose titration in four PHH donors). EC90 is calculated from all curves and the highest value from a PHH donor is recorded. A scaling factor c can be calculated from the in vivo data to adjust the EC90 to the desired conditions: c = (3 mg / kg) / EC90 = 2.7. The scaling factor c can be multiplied by the in vitro EC90 to derive the final in vitro CTX310 concentration, EC90 x c (0.43 ng / μL).

[0293] Tissues with the highest risk are evaluated for off-target editing. Non-intended tissues, spleen and adrenal gland, have elevated exposure to CTX310 (see Figure 10A-D and Table 10A-B). Off-target editing is evaluated in PHH, spleen primary cells and adrenal primary cells. For spleen and adrenal cells, the planned editing is predicted to achieve on-target editing that exceeds the average rate observed in monkeys at a dose of 3 mg / kg. Tissues with low rates of on-target editing have low risk for off-target editing.

[0294] We use both homology-dependent and -independent methods to identify genomic sites of potential off-target editing. For homology-dependent site designation, the human genome is searched for sites similar to the sgRNA target sequence. This includes homology distances up to four mismatches and NGG as well as seven non-canonical PAMs. For homology-independent site designation, a cell-free assay using Digenome-seq identifies cut sites with high sensitivity. The lack of chromatin means that the sites are not specific to any one cell type. DNA from three unique donors is used.

[0295] For the evaluation of off-target editing, in vitro editing is evaluated. For in vitro editing, primary human hepatocytes (PHH) and cell types derived from spleen and adrenal tissues are used. For PHH, four donors and three technical repeats of each donor, including donor-matched untreated controls, are used. Editing is performed using CTX310 LNP conditions that are specific to the tissue type and match the expected in vivo conditions. For NGS evaluation, hybrid capture is performed at the designated off-target site followed by deep sequencing. Off-target editing is confirmed in any donor if editing exceeds the untreated control by ≥ 0.2% and the t-test between treated and untreated is significant.

[0296] Structural variants and chromosomal rearrangement characterization are also evaluated. Structural variants and chromosomal rearrangements may result from on-target editing. For in vitro editing, PHH cells are edited with CTX310 at a concentration of EC90xc, conditions derived from off-target evaluation. To evaluate chromosomal rearrangements, the rate of homologous transfer (two species) is quantified using a ddPCR assay. For structural variants at on-target sites, PacBio sequencing of approximately 10 kb amplification products at the target site is used to characterize large insertions and deletions along with semi-quantitative measurement of the rate. [Example 8]

[0297] Persistence Research This example describes the study to evaluate the persistence of ANGPTL3 protein knockdown in plasma (ELISA) and ANGPTL3 disruption in liver tissue (>1 year). In some embodiments, the results are described herein after 2 months of one administration of CTX310 (e.g., LNPs that contain Cas9 sequence and gRNA for targeting ANGPTL3). In some embodiments, pretreatment with steroids and / or antihistamines is administered. Table 15 below provides an overview of the persistence studies described herein.

[0298] [Table 16]

[0299] Table 16 shows the dosing and endpoints for the persistence study. In some embodiments, pretreatment with dexamethasone, diphenhydramine and famotidine was administered. In some embodiments, 1 mg / kg dexamethasone, 0.5 mg / kg famotidine and 5 mg / kg diphenhydramine were administered the day before LNP administration and then again 30-60 minutes before LNP administration.

[0300] [Table 17]

[0301] Research purpose In some embodiments, the primary objective of the studies described herein is to determine the durability of ANGPTL3 knockdown and its effectiveness in regulating lipid levels.

[0302] In some embodiments, LFTs (e.g., AST) were observed to be elevated approximately one week after CTX310 administration, but levels returned to baseline one week later. In some embodiments, administration of CTX310 resulted in at least a 40% reduction in total cholesterol, triglyceride and HDL levels one to five weeks after administration.

[0303] As shown in Figures 24-27, ANGPTL3 levels were reduced upon administration of CTX310. The effect is specific, since administration of a control targeting a different protein involved in lipidemia did not have any effect on ANGPTL3 levels. Pretreatment with antihistamines and steroids has no effect on the activity of CTX310. A 2 mg / kg dose results in an approximately 90% reduction in plasma ANGPTL3 protein levels. A group of NHPs dosed with control targeted LNPs was used for comparison. [Example 9]

[0304] Exemplary Phase I Clinical Trial Protocol An exemplary clinical trial protocol for testing the efficacy and safety of the compositions and methods disclosed herein for treating subjects, e.g., subjects with refractory dyslipidemia, is provided in this prospective example (see FIG. 28).

[0305] CTX310 is an LNP formulation of CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-CRISPR associated protein 9) components for in vivo editing of target gene ANGPTL3. In some embodiments, the research product comprises a capped polyadenylated spacer Cas9 mRNA containing N1-methylpseudouridine and a 100 nucleotide long single guide RNA targeting the gene of interest. CTX310 is designed to utilize CRISPR-Cas9 to disrupt exon 1 of human ANGPTL3 in liver, resulting in a reduction of ANGPTL3 protein levels.

[0306] Rationale Globally, cardiovascular disease (CVD) remains the leading cause of death, and management of dyslipidemia remains fundamental for CVD prevention. As reported by the American Heart Association (AHA) in 2021, in the United States, elevated levels of low-density lipoprotein cholesterol (LDL-C; ≥ 130 mg / dL) were reported in 29% of adults between 2013 and 2016, and 38% of adults (93.9 million) had total cholesterol levels ≥ 200 mg / dL between 2015 and 2018. Dyslipidemia, including elevated levels of LDL-C (hypercholesterolemia), triglycerides (TG; hypertriglyceridemia [HTG]), or both, contributes to CVD and is associated with risk of type 2 diabetes, chronic kidney disease, and nonalcoholic fatty liver disease. Additional clinical consequences are associated with rare dyslipidemias, such as severe elevation of TG, which increases the risk of pancreatitis.

[0307] The latest recommendations of the Canadian, Australian, European and American cardiology societies emphasize the role of increased levels of non-high density lipoprotein cholesterol (non-HDL-C) and apolipoprotein B (ApoB) in assessing CVD risk rather than LDL-C and TG. Non-HDL cholesterol (i.e., total cholesterol-HDL-C) is a composite of LDL, intermediate density lipoprotein (IDL), very low density lipoprotein (VLDL) and lipoprotein(a) [Lp(a)] cholesterol. ApoB, the main structural protein in VLDL, IDL, LDL-C and Lp(a), is a highly atherogenic lipoprotein due to its retention, resulting in plaque accumulation in arterial walls over time. Although there is typically a good correlation between LDL-C and ApoB in calculating CVD risk, there is discordance between the two parameters in approximately 20% of cases. Thus, non-HDL-C (indirect) and ApoB (direct) provide a more accurate assessment of total atherogenic particle concentrations in non-fasting samples and in individuals with low LDL-C concentrations, especially at high TG concentrations. The 2021 Canadian Cardiovascular Society guidelines use either non-HDL-C or ApoB as the preferred parameters for risk assessment. The achievement of treatment targets for ApoB and non-HDL-C to accurately represent the same percentile equivalence as LDL-C for all recommended tolerance limits has been modified from previous versions of these guidelines (as tabulated in Table 17 below) to include non-HDL-C and ApoB in this study.

[0308] [Table 18]

[0309] Patients with dyslipidemia are typically treated with lipid-lowering therapy, if applicable and available, including statins, ezetimibe and proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitors, monoclonal antibodies and RNA inhibitors, and ANGPTL3 monoclonal antibodies.Despite all available treatments, only 45% of patients achieve the target lipid levels suggested by AHA and American College of Cardiology (ACC) guidelines, especially for patients with very high risk of cardiovascular events.

[0310] The methods disclosed herein include gene editing therapy utilizing CRISPR-Cas9 to specifically target and disrupt ANGPTL3, which encodes a regulator of lipoprotein metabolism expressed in the liver and has emerged as a therapeutic target for patients with mixed dyslipidemia. ANGPTL3 has been shown to inhibit lipoprotein lipase (LPL) activity, the main enzyme involved in the hydrolysis of TG-rich lipoproteins, and endothelial lipase (EL), which hydrolyzes HDL phospholipids, thereby increasing the levels of TG and other lipids. Reduction of ANGPTL3 levels has been shown to exhibit higher LPL activity, thereby reducing the levels of TG. ANGPTL3 inhibition can also result in efficient clearance of VLDL particles through activation of EL in an LDL receptor (LDLR)-independent mechanism, resulting in reduced LDL-C, non-HDL-C and ApoB levels.

[0311] ANGPTL3 was identified as a gene that is mutated in familial combined hypolipidemia, which is characterized by low fasting plasma TG levels and low LDL-C and HDL-C levels. Large-scale genetic studies in humans have shown that loss-of-function variants of ANGPTL3 have low levels of TG and LDL-C, and reduced risk of atherosclerotic cardiovascular disease (ASCVD). In addition, clinical studies targeting ANGPTL3 by lowering or inactivating it through antisense oligonucleotide or monoclonal antibody treatment have demonstrated the effectiveness of significantly reducing plasma LDL-C and TG levels in subjects with various forms of dyslipidemia.

[0312] In addition to clearing and lowering VLDL and LDL (non-HDL) cholesterol and TG, ANGPTL3 inhibition has been shown to substantially lower ApoB levels and proportionately reduce CVD risk. Together, these studies indicate that ANGPTL3 is an effective therapeutic target for lowering plasma non-HDL-C, ApoB and TG levels for patients with dyslipidemia who are unable to achieve minimally acceptable target levels of lipids with currently available treatments and remain at high risk for CVD.

[0313] In non-human primate (NHP) studies, a single dose of CTX310 produced a significant and sustained reduction in TG levels in a dose-dependent manner, and in a mouse LDLR knockout model, a mouse surrogate of CTX310 produced a significant reduction in LDL-C. Together, these rationales and preclinical data support the use of CTX310 as a one-time treatment to reduce levels of atherogenic lipids.

[0314] Mode of Administration In some embodiments, subjects receive a single intravenous (IV) infusion.

[0315] Study population The study population consists of subjects aged 18 to 75 (inclusive) with dyslipidemia with persistently high levels of TG and / or non-HDL-C, including LDL, VLDL, IDL and Lp(a), and / or ApoB, above the acceptable limits recommended by the ACC and AHA guidelines despite the maximum tolerated dose of available lipid-lowering treatment, dietary and lifestyle modifications (refractory population). In some embodiments, the Phase 1 study described herein includes subjects with the following monogenic or polygenic refractory dyslipidemia and / or hypercholesterolemia syndromes with or without ASCVD associated with HTG: familial chylomicronemia syndrome (FCS), multifactorial chylomicronemia syndrome, homozygous familial hypercholesterolemia, heterozygous familial hypercholesterolemia and other HTG / hypercholesterolemia syndromes of undetermined etiology.

[0316] The majority of subjects enrolled are expected to be of polygenic background due to the high prevalence of polygenic hypercholesterolemia and HTG.Subjects with undetermined lipid elevations are also eligible for enrollment based on the overall known benefits of lipid-lowering treatment in reducing CVD risk.Subjects are asked to continue receiving baseline lipid-lowering medication at the same dose throughout the study period until a significant beneficial effect of CTX310 (i.e., achieving target lipid goal) is observed.

[0317] Eligible participation period All subjects will be monitored in the study for safety, tolerability, pharmacokinetic (PK) and pharmacodynamic (PD) effects for 12 months after infusion. All subjects will be invited to participate in a separate long-term follow-up study upon completion or discontinuation / withdrawal.

[0318] [Table 19]

[0319] research design A single-arm, open-label, multicenter, ascending single-dose Phase 1 study is described herein that will enroll up to 24 subjects aged 18 to 70 years with dyslipidemia and elevated levels of TG (>300 mg / dL) and / or LDL-C (>100 mg / dL; >70 mg / dL for ASCVD) and / or non-HDL-C (>160 mg / dL) and / or ApoB (>100 mg / dL) that are refractory to indicated and available treatments.

[0320] Three to six subjects are enrolled at each dose level: 0.1, 0.3, 0.6 and 1 mg / kg total RNA in LNP formulation. Each subject receives a single IV dose of CTX310, and in some embodiments, is hospitalized for a minimum of 72 hours (or longer if required by local regulations or institutional practices) after CTX310 infusion, and is closely monitored after infusion for adverse events (AEs) that define dose-limiting toxicities (DLTs) during a 30-day acute safety evaluation period. In some embodiments, all subjects are premedicated with corticosteroids and antihistamines (H1 and H2 blockers) before receiving CTX310.

[0321] After CTX310 infusion, subjects will be followed for 12 months with physical examinations, regular laboratory evaluations, and assessments for AEs and effects on ANGPTL3 expression and lipid profile. After completion of this study, all subjects will be invited to participate in another long-term follow-up study for 15 years after infusion. At each dose level, all AEs, including adverse events of special interest (AESIs), will be reviewed by a Safety Review Committee (SRC) before proceeding to the next cohort. Once dose escalation is complete, a recommended dose will be determined and 3 to 6 more subjects will be enrolled at the same dose level to confirm safety and PD effects (confirmation cohort). Each subject will undergo the following stages: (1) Screening: 6 weeks, (2) Infusion of CTX310 (day 1) and acute safety evaluation period (30 days after infusion), (3) Follow-up: Each subject will be monitored for AEs, AESIs, and effects on lipid parameters for a total of 12 months after infusion. Subjects may be carried over to another long-term follow-up study for up to 15 years after infusion for long-term follow-up.

[0322] Study Procedures Administration of CTX310 In some embodiments, subjects receive a single IV infusion within 1 hour on Day 1, administered under medical supervision during the patient's inpatient care.

[0323] Additional Pre-Injection Procedures The subject is administered an additional treatment infusion regimen within 1 to 2 hours prior to administration of the study drug. In some embodiments, the regimen consists of: an IV steroid (e.g., dexamethasone 10 mg or equivalent); an IV H1 blocker (e.g., diphenhydramine 50 mg or equivalent) or an oral H1 blocker (e.g., cetirizine 10 mg or equivalent); and an IV or oral H2 blocker (e.g., famotidine 20 mg or equivalent).

[0324] CTX310 Post-Infusion Monitoring In some embodiments, after completing administration, subjects are observed as inpatients for 72 hours or longer if required by local regulations or facility practices.In some embodiments, blood and urine samples are collected for safety and clinical laboratory evaluation and PK analysis.In some embodiments, AEs and concomitant medications are recorded.Patient hospitalization for observation can be extended as necessary.

[0325] Research product preparation, handling, storage and accountability CTX310 drug product (e.g., nanoparticles containing gRNA targeting ANGPTL3 and mRNA encoding Cas9) is provided as a frozen liquid formulation consisting of 300 mM sucrose in phosphate buffered saline at a target concentration of 2.0 (±0.4) mg / mL total RNA. In some embodiments, CTX310 must be stored frozen at ≦-60° C. in glass vials until use, where it is stored on-site, thawed, and formulated immediately prior to administration.

[0326] In some embodiments, inclisiran is not administered from 60 days prior to the infusion of CTX310 until 60 days after day 1. In some embodiments, the apheresis procedure may not be performed from 14 days prior to the infusion of CTX310 until 14 days after day 1.

[0327] If a significant reduction in lipids (LDL-C or TG) is observed during the course of the study, i.e., lipid levels are reduced to desirable levels (e.g., LDL<70 mg / dL, TG<150 mg / dL or non-HDL-C<160 mg / dL), adjustments in related medications or frequency of apheresis procedures may be initiated. In some embodiments, it is expected that plans for tapering other lipid-lowering medications or apheresis procedures will be individualized for each subject depending on response to study treatment, underlying genotype, and assessment of risk factors for future cardiovascular events.

[0328] Study Procedure Below is a description of the study procedures. In addition to the assessments described herein, subjects may follow site-specific guidelines and may undergo unscheduled assessments if indicated clinically. Missed assessments will be rescheduled and performed as close as possible to the originally scheduled date, unless, in the investigator's opinion, rescheduling is not medically necessary or unsafe because it is too close to the next scheduled assessment. In this case, the missed assessment should be recorded as a protocol deviation and discontinued. For the purposes of this protocol, there is no day 0. All visit dates and windows are calculated using the day of CTX310 infusion as day 1.

[0329] Screening and Enrollment In some embodiments, records are kept of all potential subjects screened and assessed for study participation. In some embodiments, the screening period begins on the date the subject signs the Informed Consent Document (ICF) and continues through confirmation of eligibility and enrollment in the study. In some embodiments, subjects are screened to confirm study eligibility once informed consent is obtained. In some embodiments, all screening assessments should be completed within 42 days after the subject signs the ICF. A medical monitor can review the eligibility packet and verify the information provided by the site to ensure the subject is eligible for enrollment.

[0330] Injection of CTX310 In some embodiments, all subjects undergo the conditioning regimen and study treatment as described above. The acute safety assessment period is 30 days after each subject's infusion of CTX310. Following the 30-day acute safety assessment period, subjects may be followed up for an additional 11 months. In some embodiments, subjects are considered to have completed the study after completing the end-of-study (EOS) visit at 12 months. In some embodiments, completion of the study is defined as when the last subject completes the 12-month visit, is considered to have missed follow-up, withdraws consent, or dies. In some embodiments, to comply with local and regional legal regulations / guidelines for subjects receiving gene therapy, all subjects who receive CTX310 infusion and either discontinue or complete the study are asked to participate in another long-term follow-up study up to 15 years after infusion to evaluate long-term safety, durability, and effects on cardiovascular events.

[0331] Study Assessment and Procedures Demographic data including date of birth, sex, race and ethnicity may be collected. A medical history including a complete medical history of the subject's illness and response to treatment from the date of diagnosis is obtained. Cardiac and surgical histories are also obtained. A complete physical examination including general appearance, skin, neck, head, eyes, ears, nose, throat, heart, lungs, abdomen, lymph nodes, extremities and nervous system may be performed at screening, day 30 and end of study (EOS) visits and the results are documented. A simple physical examination based on symptoms may be performed at all other study visits. Any observed changes from the examination performed at screening may be recorded as an AE. Weight may also be obtained. In some embodiments, height, body mass index and waist-to-hip ratio are obtained at screening and at study completion.

[0332] In some embodiments, vital signs are recorded at each study visit and may include blood pressure, heart rate, respiratory rate, oxygen saturation by pulse oximetry, and temperature. In some embodiments, liver imaging is performed. Standard local procedures may be used for image acquisition and analysis. In some embodiments, a 3-hour fast is recommended before the subsequent imaging procedure. A liver FibroScan or MRE (depending on availability) may be performed at screening, and the results can be used to exclude patients with liver stiffness consistent with signs of fibrosis (see Exclusion Criteria). A liver MRI-proton density fat fraction or ultrasound (to assess fatty liver / steatosis) may be performed at screening and EOS visits. Baseline liver fat status and quantitative changes in hepatic steatosis may be collected in the Case Report Form (CRF) with clinically significant findings reported as medical history or AEs as appropriate.

[0333] One or more transthoracic echocardiograms (to assess left ventricular ejection fraction) may be performed. Additional echocardiograms may be obtained. In some embodiments, a 12-lead ECG is obtained. Corrected QT interval (QTc) and QRS interval are determined from the ECG. Additional ECGs may be obtained.

[0334] Test samples may be collected and analyzed. Test evaluations are listed in Tables 21 and 22.

[0335] [Table 20]

[0336] [Table 21]

[0337] immunogenicity CTX310 is composed of mRNA encoding SpCas9 encapsulated in LNPs and sgRNA targeting a gene of interest (e.g., ANGPTL3). In some embodiments, blood samples are collected and optionally stored for possible future immunogenicity evaluation (anti-drug antibodies against LNPs and Cas9).

[0338] CTX310 Pharmacokinetic Analysis In some embodiments, PK analysis of nanoparticle and Cas9 protein level is performed on collected blood samples.In some embodiments, on day 1, samples are collected within 5 minutes before infusion, and 1, 2 and 7 hours after completion of CTX310 infusion.In some embodiments, for all other time points, single samples are collected.

[0339] ANGPTL3 In some embodiments, plasma samples are obtained to monitor ANGPTL3 concentrations.

[0340] Exploratory biomarker research In some embodiments, exploratory biomarker research may be performed to identify genomic, metabolic, and / or proteomic biomarkers that may be indicative or predictive of clinical response, resistance, safety, PD activity, and / or mechanism of action of a treatment. In addition, samples collected for protocol-specific endpoints may be used for exploratory research, pending availability of excess samples.

[0341] Whole blood samples may be obtained at screening and stored in PAXgene® tubes (PreAnalytiX GmbH, Hombrechtikon, Switzerland). Plasma samples for storage are obtained at screening. Serum samples are obtained to track exploratory biomarkers (e.g., cytokines).

[0342] research supervision Safety Review Committee In some embodiments, a safety review committee (SRC) is responsible for reviewing all available safety data when the DLT observation period ends for the last subject enrolled in each cohort and making a decision regarding dose escalation or deescalation. During dose escalation, for cases where the dose is cleared in a cohort and dose escalation is possible, a decision can alternatively be made in consultation with the SRC to enroll an additional number of subjects for a total of up to 6 subjects at the current dose level to gather additional safety data. The SRC continues to meet periodically during the dose escalation phase to consider toxicity management algorithms and review individual subject cases.

[0343] Following discussion with the SRC, an independent Data Safety Monitoring Board (DSMB) may be consulted regarding any emergency safety data and may discuss possible modifications of DLT criteria or alternative dosing regimens. Based on the ongoing evaluation of benefits and risks, the SRC may stop dose escalation before the maximum tolerated dose (MTD) has been determined.

[0344] Data Safety Monitoring Board An independent Data Safety Monitoring Board (DSMB), consisting of at least three physicians and one statistician with appropriate scientific and medical expertise, will be created at the initiation of the study, with roles and responsibilities described in the DSMB charter. Throughout the study, the DSMB will review safety and efficacy data from dose escalation and approve the recommended Phase 2 dose (RP2D). In some embodiments, the DSMB will be notified of all suspected, unexpected, and serious adverse reactions associated with CTX310.

[0345] Suggested Starting Dose and Dose Escalation The following doses, shown in Table 19 below, are proposed for evaluation at four planned dose escalation levels in this study, with a minimum of three and a maximum of six evaluable subjects per dose level (DL). The initial starting dose in humans will be extrapolated from the No Observed Adverse Effect Level (NOAEL) determined in an NHP Good Laboratory Practice safety and toxicology study. The initial starting dose of 0.1 mg / kg of CTX310 refers to the total RNA dose based on a predicted NOAEL of 1 mg / kg. One-third allometric scaling from NHP to humans is based on total body surface and application of a safety factor of 3, leading to a starting dose of 0.1 mg / kg. Emerging clinical data for systemically infused LNP-related therapeutic agents demonstrates a relatively safe profile. A three-fold safety factor is proposed based on the predicted lack of liver-related AEs in humans based on nonclinical studies. Dose escalation is predicted to proceed from 0.1 to ≦1 mg / kg, with a predicted three- to two-fold increase in dose levels. In some embodiments, dose escalation decisions are made in collaboration with the investigator and SRC based on the totality of safety, tolerability, and activity data.

[0346] [Table 22]

[0347] Dosing within dose level cohorts Dose escalation will be performed using a standard 3+3 design, with 3 to 6 subjects treated at each dose level depending on the incidence of DLT.

[0348] Based on NHP studies in which transient elevations in liver function tests (LFTs) following CTX310 dosing resolved within 14 days, dosing between each subject in a cohort is adjusted for a minimum of 14 days to assess potential toxicity, or until laboratory values ​​(including LFTs) return to <2× baseline or normal levels, whichever occurs later. If the subject's safety assessment is acceptable, the next subject in the cohort may be dosed. Dose escalation may proceed when all subjects in the preceding dose cohort have completed dosing, the last subject has completed a ≧30-day safety assessment, and the cumulative safety data of all subjects treated at this dose level demonstrates an acceptable safety profile, in some embodiments as determined by SRC.

[0349] Dose-limited toxicity assessment Subjects must receive CTX310 to be evaluated for DLT. If a DLT-evaluable subject (i.e., a subject who received CTX310 and completed the 30-day DLT evaluation period) has signs or symptoms of a potential DLT, the DLT evaluation period will be extended according to a protocol-defined window to allow for improvement or resolution before announcing a DLT. A minimum of three evaluable subjects per cohort is required. An appropriate interval will be applied between the subject's current lipid-lowering treatment (i.e., monoclonal antibody and / or inhibitory RNA treatment) and CTX310 infusion to avoid overlapping toxicities. Subjects who experience a DLT will be considered evaluable. Data for all subjects who received CTX310 are part of the safety analysis set.

[0350] Dose escalation will be performed according to the following rules: (1) if 0 of 3 subjects experience a DLT, escalate to the next dose level; (2) if 1 of 3 subjects experience a DLT, extend the current dose level to 6 subjects; (3) if 1 of 6 subjects experience a DLT, escalate to the next dose level; (4) if ≥ 2 of 6 subjects experience a DLT at DL 2, 3, or 4, decrease to the previous dose level or if 6 subjects have already been tested at the previous dose level, announce the previous dose level as the MTD; (5) if ≥ 2 of 3 subjects experience a DLT at DL 2, 3, or 4, decrease to the previous dose level or if 6 subjects have already been tested at the previous dose level, announce the previous dose level as the MTD; (6) no dose escalation will be performed beyond the highest dose planned or listed for the study (see dose level table above).

[0351] The RP2D is published at or below the MTD, or alternatively, if the MTD is not achieved, at the optimal biological dose based on the analysis of secondary endpoints. At least three more subjects receive CTX310 at this dose level before the RP2D is selected (confirmation cohort). In some embodiments, all cumulative AEs occurring outside the DLT evaluation period that are evaluated as related to CTX310 are also discussed by the DSMB.

[0352] Dose-limiting toxicity: Rationale and criteria The DLT definition used herein is informed by published reports of nonclinical studies of CTX310 and clinical experience with LNP-encapsulated, CRISPR-Cas-9-based genome editing therapy. AEs that do not have a probable causal relationship to CTX310 are not considered DLTs. DLTs are graded and described according to the Common Terminology Criteria for Adverse Events (CTCAE) version 5.0. Criteria for evaluation of AEs occurring within the first 30 days after dosing to be classified as DLTs include: (1) any AE related to study drug of CTCAE grade ≥ 3, (2) any CTCAE grade 3 laboratory abnormality that persists for ≥ 7 days and is related to study drug, (3) any CTCAE grade 4 laboratory abnormality related to study drug.

[0353] Study Eligibility Inclusion criteria To be considered eligible to participate in this study, subjects must meet all inclusion criteria listed below: (1) age ≥ 18 and ≤ 70 years at the time of signing the informed consent; (2) able to provide written informed consent; (3) diagnosed with persistent dyslipidemia; fasting (and, if applicable, pre-apheresis) TG (> 300 mg / dL) and / or LDL-C (> 100 mg / dL; > 70 mg / dL for subjects with ASCVD); and / or elevated levels of non-HDL-C (>160 mg / dL) and / or ApoB (>100 mg / dL); (4) subjects have been resistant to maximally tolerated doses of standard-of-care treatments, including statins, ezetimibe, and / or bempedoic acid, icosapent ethyl, and monoclonal antibodies against PCSK9 (alirocumab or evolocumab) or ANGPTL3 (evinacumab), for at least 26 weeks prior to screening. (5) subjects with homozygous familial hypercholesterolemia and receiving PCSK9-targeting interfering RNA therapy (inclisiran) must be refractory to exposure for at least 365 days prior to screening; (6) subjects receiving available standard line of therapy, including statins, ezetimibe, and / or bempedoic acid and / or PCSK9 and / or ANGPTL3 inhibitors, must be on maximum tolerated dose and stable dose for >30 days prior to screening, with no dose escalation unplanned at the time of study entry; (7) subjects undergoing apheresis should be on a stable frequency of procedures for at least 12 weeks prior to screening, with no change in frequency unplanned at the time of study entry; (8) female subjects must be postmenopausal [e.g., in women with a uterus, amenorrhea for at least 12 consecutive months without another medical cause, or surgically infertile (i.e., documented hysterectomy, bilateral salpingectomy and / or bilateral oophorectomy at least 1 month prior to screening)];(9) All male subjects must agree to use an acceptable method of effective contraception, and their female partners must also agree to use an effective method of contraception as defined in the protocol, from the time of agreement through 12 months after CTX310 injection; (10) Are willing and able to comply with scheduled clinic visits, treatment plans, laboratory tests, contraception guidelines, and other study procedures; (11) Are willing to participate in a long-term follow-up study for up to 15 years after completion of the study.

[0354] Exclusion criteria To be eligible for enrollment in the study, subjects must not meet any of the exclusion criteria listed below: (1) FCS patients with a confirmed genotypic diagnosis of biallelic LPL or GP1HBP1 mutations; (2) evidence of liver disease [e.g., aspartate transaminase, alanine transaminase >2 × upper limit of normal (ULN), or total bilirubin value >2 × ULN, or baseline prothrombin time (international normalized ratio) >1.5 × ULN, or liver elastography measurement with FibroScan ≥7.5 kPa or liver stiffness measurement with magnetic resonance elastography >4.15 kPa]; (3) complete blood count: white blood cells <2,500 cells / μL, hemoglobin <11 g / dL for men and <10 g / dL for women; or platelet count <100,000 / μL; (4) baseline estimated glomerular filtration rate <60 mL / min / 1.73 m 2(5) diagnosis of nephrotic syndrome or albuminuria >2+ by urine dipstick; (6) inadequate diabetic control with glycated hemoglobin >9%; (7) history of alcohol or drug abuse and nonadherence to withdrawal during the study period; (8) history of significant coagulopathy; (9) uncontrolled or untreated thyroid disease (thyroid-stimulating hormone <0.1mIU / L or >10mIU / L); (10) cardiac left ventricular ejection fraction <5 by echocardiogram (11) peripheral pulse oximetry saturation <90%; (12) uncontrolled blood pressure, defined as mean systolic >160 mmHg and diastolic >90 mmHg; (13) 12-lead electrocardiogram (ECG) findings, e.g., QTc >450 ms in men and >470 ms in women at screening, and / or any other ECG findings deemed clinically significant by the investigator; (14) acute coronary syndrome event within 24 weeks prior to Day 1; (15) within 24 weeks of Day 1 (16) acute pancreatitis within 12 weeks prior to Day 1; (17) current use or use within 365 days prior to Day 1 of any hepatocyte-targeted small interfering RNA or antisense oligonucleotide molecule (except inclisiran); (18) current use or use within 90 days prior to Day 1 of any monoclonal antibody treatment (except evolocumab, alirocumab, or evinacumab); (19) participation in another clinical study with the investigational drug / product within 30 days prior to screening or <5 half-lives of the investigational drug, whichever is longer; (20) current use of selective serotonin uptake inhibitors, chronic systemic corticosteroid treatment, or anabolic agents; (21) current use of niacin-based supplements or dietary supplements that may affect lipid levels at doses / amounts that are not stable >30 days prior to the screening visit; (22) prior treatment with a gene therapy / editing product;(23) positive serology for human immunodeficiency virus type 1 (HIV-1) or HIV-2, hepatitis B virus (hepatitis B core antibody or nucleic acid test [NAT]), or hepatitis C virus (NAT); (24) history of any disease or any clinical condition that, in the investigator's opinion, may confound the results of the study or may pose additional risks to administering the study drug to the subject, including, but not limited to, history of relevant drug allergies; history of CNS disease, history or presence of any clinically significant pathology, or history of psychiatric illness, or history of a familial cancer syndrome; (25) any previous or current malignancy or myeloproliferative disorder or significant immunodeficiency disorder; (26) females of childbearing potential (postmenarchal, with an intact uterus and at least one ovary, and less than one year postmenopausal) or breastfeeding; (27) the investigator's assessment that the subject will not comply with the study procedures outlined in the protocol.

[0355] statistical methods The study will initially enroll approximately 24 subjects to provide a preliminary evaluation of the safety and efficacy of CTX310. The safety and tolerability of CTX310 will be evaluated in the safety analysis set using a narrative summary. A summary of AEs, AESIs, clinical laboratory data, and other applicable safety measures (e.g., ECG) will be provided for each dose level of CTX310 and overall. In some embodiments, the summary of AEs will focus on treatment-emergent AEs (TEAEs). The incidence of TEAEs will be summarized by organ system class and preferred term, protocol-specific severity grade, and association with CTX310. The occurrence of DLTs, serious adverse events, and AESIs will also be summarized. The summary of clinical laboratory data will include descriptive statistics of absolute values ​​and / or changes from baseline at scheduled visits for selected laboratory parameters. The occurrence of clinically significant laboratory abnormalities and other clinically significant safety abnormalities (e.g., ECG) will be summarized.

[0356] Preliminary efficacy of CTX310 will be evaluated in the full analysis set using descriptive summaries. Percentage changes in lipid concentrations, including TG, ApoB, non-HDL-C [including LDL, VLDL, IDL, and Lp(a)], and HDL-C compared to baseline over time will be summarized for each dose level using descriptive statistics. Categorical summaries based on appropriate cutoffs will be provided at selected time points, including 26 and 52 weeks post-infusion. PK and PD data will be evaluated descriptively and by exploratory modeling, where applicable.

[0357] Research objectives and hypotheses In some embodiments, the primary objective is to evaluate the safety and tolerability of single ascending doses of CTX310 in subjects with refractory dyslipidemia with elevated levels of TG and / or non-HDL-C and / or LDL-C and / or ApoB and to determine the RP2D. In some embodiments, the secondary objective is to evaluate the preliminary efficacy, PK and PD of CTX310. No formal hypothesis testing is performed.

[0358] Study Endpoints In some embodiments, primary endpoints include: incidence of AEs, including treatment-emergent adverse events (TEAEs), AESIs, and DLTs; clinically significant laboratory abnormalities; and clinically significant abnormal vital signs.

[0359] In some embodiments, secondary efficacy endpoints include: percentage change in TG, ApoB, non-HDL-C [including LDL, VLDL, IDL, and Lp(a)], and HDL-C concentrations over time compared to baseline. In some embodiments, secondary pharmacokinetic / pharmacodynamic endpoints include: percentage change in LNP plasma levels, Cas9 protein plasma levels, and ANGPTL3 concentrations over time compared to baseline.

[0360] In some embodiments, exploratory endpoints include: percentage change over time in FFA levels compared to baseline, changes in fatty liver disease, and immunogenicity of CTX310 (samples will be stored if necessary and assessed for anti-drug antibodies to LNP and Cas9).

[0361] Analysis Set In some embodiments, the following analysis sets are evaluated and used for data presentation: In some embodiments, the enrollment set includes all subjects who signed informed consent and met the inclusion / exclusion criteria. In some embodiments, the safety analysis set is a subset of the enrollment set that includes subjects who received a CTX310 infusion. The analysis of safety evaluation is based on the safety analysis set. In the safety analysis set, subjects are classified according to the CTX310 dose level they received. In some embodiments, the full analysis set (FAS) is a subset of the safety analysis set that includes subjects who received a CTX310 infusion and either underwent at least one post-baseline lipid assessment or discontinued early. Efficacy analysis is performed based on the FAS. Subjects in the FAS are classified according to the CTX310 dose level they received.

[0362] Sample size The sample size of the study is approximately 24 subjects.

[0363] interim analysis In some embodiments, no formal efficacy interim analyses are planned. Safety and efficacy data will be reviewed during the study to monitor stopping rules and provide recommendations for enrollment or protocol amendments, as appropriate.

[0364] Planned method of analysis In some embodiments, the primary analysis will be performed after all subjects have completed 26 weeks of follow-up after CTX310 infusion or have been discontinued early. The final analysis will be performed when all subjects have completed or discontinued the study. In some embodiments, tabulations will be performed for appropriate pharmacokinetic, demographic, baseline, efficacy and safety parameters. Itemized listing will be performed for all data unless otherwise specified.

[0365] Efficacy analysis The full analysis set (FAS) will be used as the analysis set for efficacy. Efficacy endpoints of percentage change in lipid concentrations including TG, ApoB, non-HDL-C [including LDL, VLDL, IDL and Lp(a)] and HDL-C compared to baseline over time will be summarized using descriptive statistics for each dose level. Categorical summaries will be provided at selected time points including 26 and 52 weeks based on appropriate cutoffs.

[0366] Safety analysis Safety analyses are performed for the safety analysis set. Summaries of AEs, AESIs, clinical laboratory data, and other applicable safety measures (e.g., ECG) are provided for each dose level of CTX310 and overall. In some embodiments, the summary of AEs focuses on TEAEs, defined as AEs that began or worsened with or after CTX310 infusion. AEs are graded according to CTCAE v5.0. The occurrence of TEAEs is summarized by system organ class and preferred term, grade, and association with CTX310. Important subsets of TEAEs, including DLTs, AESIs, grade ≧3 AEs, related AEs, and SAEs, are summarized separately. In some embodiments, the summary of clinical laboratory data includes absolute values ​​and / or descriptive statistics of changes from baseline at scheduled visits for selected laboratory parameters. The occurrence of clinically significant laboratory abnormalities and clinically significant abnormal vital signs are summarized. The occurrence of other clinically significant safety measure abnormalities (e.g., ECG) may also be summarized, if applicable.

[0367] Pharmacokinetic and pharmacodynamic analysis Plasma levels of LNP and Cas9 proteins over time are summarized using descriptive statistics. Exploratory analysis based on applicable PK models may be performed. Percentage changes in ANGPTL3 concentrations over time compared to baseline are summarized using descriptive statistics.

[0368] Biomarker analysis Where data are available, additional exploratory biomarkers including, for example, FFA levels, fatty liver disease marker(s) and immunogenicity marker(s) will be summarized using descriptive statistics. [Example 10]

[0369] ANGPTL3 GLP Toxicology Study Plasma Protein Levels Provided in this example are data showing reduced ANGPTL3 plasma protein levels in non-human primates treated with the methods and compositions disclosed herein (e.g., CTX310 pharmaceutical product comprising an sgRNA targeting ANGPTL3 and a nucleic acid encoding Cas9).

[0370] Table 23 below shows an exemplary study design (see also Figure 29).

[0371] [Table 23]

[0372] Shown in Figures 30-33 are ANGPTL3 plasma protein levels as ng / mL or % change from baseline at 0 to 6 months following administration of CTX310 to NHPs.

[0373] term In at least some of the embodiments described above, one or more elements used in one embodiment may be used interchangeably in another embodiment, except where such substitution is technically infeasible. It will be understood by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to be within the scope of the subject matter defined by the appended claims.

[0374] With respect to the use of substantially all plural and / or singular terms herein, those skilled in the art can interpret the plural to the singular and / or the singular to the plural, as appropriate to the context and / or application. Various singular / plural interchanges may be specifically set forth herein for clarity. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Any reference to "or" herein is intended to include "and / or" unless stated otherwise.

[0375] It will be understood by those skilled in the art that, in general, the terms used in this specification and in particular in the appended claims (e.g., the body of the appended claims) are generally intended as "open" terms (e.g., the term "including" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "including" should be interpreted as "including but not limited to," etc.). If a specific number of introduced claim recitations are intended, such intent will be clearly set forth in the claim, and in the absence of such recitation, it will be further understood by those skilled in the art that no such intent exists. For example, as an aid in understanding, the following appended claims may include the use of the introductory phrases "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be interpreted as meaning that the introduction of a claim recitation with the indefinite article "a" or "an" limits any particular claim that includes such an introduced claim recitation to embodiments that include only one such recitation, even if the same claim includes the introductory phrase "one or more" or "at least one" and the indefinite article "a" or "an" (e.g., "a" and / or "an" should be interpreted as meaning "at least one" or "one or more"); the same is valid for the use of definite articles used to introduce claim recitations. In addition, those skilled in the art will understand that even if a specific number of introduced claim recitations is explicitly recited, such recitation should be interpreted as meaning at least the number recited (e.g., the recitation "two recitations" alone, without other modifiers, means at least two recitations, or more than two recitations, etc.).Furthermore, when idiomatic expressions similar to "such as at least one of A, B, and C" are used, such syntax is generally intended as the meaning that one of ordinary skill in the art would understand the idiomatic expression (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together). When idiomatic expressions similar to "such as at least one of A, B, or C" are used, such syntax is generally intended as the meaning that one of ordinary skill in the art would understand the idiomatic expression (e.g., "a system having at least one of A, B, or C" includes, but is not limited to, systems having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together). Those skilled in the art will further appreciate that virtually any disjunction and / or phrase expressing two or more alternative terms should be understood to contemplate the possibility of including one of the terms, either of the terms, or both terms, whether in the description, claims, or drawings. For example, the phrase "A or B" is understood to include the possibilities of "A" or "B" or "A and B."

[0376] In addition, when features or aspects of the disclosure are described in terms of a Markush group, those of skill in the art will understand that the disclosure also is described in terms of any individual members or subgroups of members of the Markush group.

[0377] As will be understood by those skilled in the art, for any and all purposes, such as with respect to providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of these subranges. Any recited range can be easily understood as fully describing and allowing the same range to be divided into at least 2, 3, 4, 5, 10, etc. As a non-limiting example, each range discussed herein can be easily divided into a lower third, a middle third, and an upper third. As will also be understood by those skilled in the art, all terms such as "up to," "at least," "more than," "less than," etc. refer to ranges that include the numbers recited and can be subsequently divided into subranges as discussed above. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 elements refers to a group having 1, 2, or 3 elements. Similarly, a group having 1-5 elements refers to a group having 1, 2, 3, 4, or 5 elements, etc.

[0378] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those of skill in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

Claims

1. 1. A composition comprising: (a) a plurality of nanoparticles complexed with a guide RNA (gRNA) targeting the ANGPTL3 gene (ANGPTL3 gRNA); and (b) an mRNA encoding Cas9 endonuclease; and one or more pharmaceutically acceptable excipients, wherein the gRNA comprises a spacer sequence of SEQ ID NO:

12.

2. The composition described in claim 1, wherein the gRNA comprises the sequence of SEQ ID NO:

13.

3. 2. The composition of claim 1, wherein the Cas9 endonuclease is a Streptococcus pyogenes Cas9 endonuclease.

4. The composition of claim 1, wherein the plurality of nanoparticles have a concentration of about 58.2 mg / mL and are complexed with a total of about 2 mg / mL of nucleic acids of (a) ANGPTL3 gRNA and (b) Cas9 mRNA, and optionally, the plurality of nanoparticles are complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

5. 1. A composition for use in treating an angiopoietin-like 3 (ANGPTL3)-associated disease or disorder in a subject, the composition comprising: (a) a guide RNA (gRNA) or a nucleic acid encoding the gRNA that targets the ANGPTL3 gene; and (b) a plurality of nanoparticles complexed with a nucleic acid encoding a Cas9 endonuclease; (i) the gRNA comprises a spacer sequence of SEQ ID NO: 12; or (ii) the gRNA comprises a spacer sequence of SEQ ID NO: 20 and is capable of inducing an editing efficiency of greater than 50% in the liver of the subject; composition.

6. The composition described in claim 5, wherein the gRNA is a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO: 10 or SEQ ID NO:

13.

7. The composition of claim 5, wherein the Cas9 endonuclease is Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, S. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9, or a mutant thereof.

8. The composition of claim 5, wherein the plurality of nanoparticles have a concentration of about 58.2 mg / mL and are complexed with a total of about 2 mg / mL of nucleic acids of (a) ANGPTL3 gRNA and (b) Cas9 mRNA, and optionally, the plurality of nanoparticles are complexed with (a) about 1.5 mg / mL of ANGPTL3 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

9. The composition described in claim 5, wherein the ANGPTL3-related disease or disorder is a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof.

10. The composition of claim 5, wherein the ANGPTL3-related disease or disorder is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, non-alcoholic fatty liver disease (NAFLD), hyperlipidemia, metabolic syndrome, or a combination thereof, and optionally, the dyslipidemia is hyperlipidemia, the NAFLD is hepatic steatosis or steatohepatitis, the diabetes is type 2 diabetes or type 2 diabetes with dyslipidemia, and further optionally, the hyperlipidemia is hypercholesterolemia, hypertriglyceridemia, or both.

11. The composition of claim 5, wherein the composition is capable of reducing the concentration of one or more non-high density lipoprotein (non-HDL) lipids and / or the concentration of apolipoprotein B (ApoB) in the plasma of a subject by at least 20%, at least 40%, or at least 70%, and optionally the one or more non-HDL lipids are triglycerides, very low density lipoproteins (VLDL), low density lipoproteins (LDL), or combinations thereof.

12. The composition described in claim 5, wherein the composition is capable of reducing the concentration of ANGPTL3 protein in the subject's plasma by at least 50%, at least 60%, or at least 70% one month after administration.

13. The composition of claim 5, wherein the subject has a triglyceride level greater than 300 mg / dL, a non-high density lipoprotein (non-HDL) level greater than 160 mg / dL, a low-density lipoprotein cholesterol (LDL-C) level greater than 100 mg / dL, an ApoB level greater than 100 mg / dL, or a combination thereof.

14. A composition described in any one of claims 1 to 13, wherein the multiple nanoparticles are lipid nanoparticles.

15. The composition of claim 14, wherein the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-bound lipids, or optionally, the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.