Oncolytic viruses and methods of use

Abstract

Disclosed herein are nucleic acid viruses for use in the treatment of cancer.

Description

[Background technology]

[0001] Cancer is the second leading cause of mortality worldwide, and the overall incidence of cancer is increasing. Thus, there is an unmet need for new therapeutic approaches that can affect the course of the disease. [Technical field]

[0002] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Application No. 63 / 312,782, filed February 22, 2022, which is incorporated by reference in its entirety.

[0003] INCORPORATION BY REFERENCE TO SEQUENCE LISTING This application is filed with an electronic format Sequence Listing. The Sequence Listing was created on February 21, 2023, is provided as a file entitled 61771-701601.xml, and is 357,386 bytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety. Summary of the Invention

[0004] In one aspect, the present specification provides a virus that addresses the need for new therapeutic approaches to cancer.Method of use includes administering the virus to a patient with cancer, so that the virus inhibits cell division, inhibits cell proliferation, and / or induces cell death of cancerous cells.In some cases, the virus that has one or more anti-cancer effects is an oncolytic virus.

[0005] In one aspect, provided herein is a method of treating cancer, the method comprising administering a recombinant Zika virus to a subject in need of cancer treatment. Further aspects include recombinant Zika viruses and nucleic acid compositions.

[0006] In some embodiments, the recombinant Zika virus produces higher levels of subgenomic flavivirus RNA (sfRNA) in the subject's cancer cells than wild-type Zika virus, hi some embodiments, the higher levels of sfRNA are at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0007] In some embodiments, the cancer is a brain cancer, a retinal cancer, a testicular cancer, or a prostate cancer. In some embodiments, the cancer is a CNS cancer. In some embodiments, the cancer is a brain cancer. In some specific embodiments, the brain tumor is an astrocytoma, an oligodendroglioma, an ependymoma, a meningioma, a schwannoma, a craniopharyngioma, a germinoma, a pineocytoma, or a combination thereof. In some embodiments, the cancer is a breast cancer. In some embodiments, the cancer is a colon cancer. In some embodiments, the cancer is a prostate cancer.

[0008] In some embodiments, the recombinant Zika virus is produced from the nucleic acid compositions described herein.

[0009] In some embodiments, the recombinant Zika virus is produced from a nucleic acid composition that includes a polynucleotide encoding a Zika virus capsid protein (ancC / C) or a derivative of Zika virus ancC / C, a polynucleotide encoding a Zika virus membrane protein (prM / M) or a derivative of Zika virus prM / M, a polynucleotide encoding a Zika virus envelope protein (E) or a derivative of Zika virus E, or any combination thereof. In some embodiments, the nucleic acid composition includes a polynucleotide encoding a Zika virus ancC / C or a derivative of Zika virus ancC / C, a polynucleotide encoding a Zika virus prM / M or a derivative of Zika virus prM / M, and a polynucleotide encoding a Zika virus E or a derivative of Zika virus E. In some embodiments, the polynucleotide encoding a Zika virus ancC / C or a derivative of Zika virus ancC / C, the polynucleotide encoding a Zika virus prM / M or a derivative of Zika virus prM / M, and the polynucleotide encoding a Zika virus E or a derivative of Zika virus E are expressed on one or more separate nucleic acids. In some embodiments, the polynucleotide encoding a derivative of Zika virus ancC / C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus ancC / C. In some embodiments, the Zika virus ancC / C or a derivative of Zika virus ancC / C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 1. In some embodiments, a polynucleotide encoding a derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to a wild-type Zika virus prM / M.In some embodiments, the Zika virus prM / M or a derivative of Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 2. In some embodiments, a polynucleotide encoding a derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. In some embodiments, the polynucleotide encoding E is translated into wild-type Zika virus E. In some embodiments, the Zika virus E or a derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 3.

[0010] In some embodiments, the nucleic acid composition comprises a 5' untranslated region (5'UTR) of a Zika virus. In some embodiments, the 5' untranslated region (5'UTR) of a Zika virus comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 4 or Table 12. In some embodiments, the nucleic acid composition comprises a 3' untranslated region (3'UTR) of a Zika virus. In some embodiments, the 3' untranslated region (3'UTR) of Zika virus comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 4 or Table 13.

[0011] In some embodiments, the nucleic acid composition does not include a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i)-(vii). In other embodiments, the nucleic acid composition includes a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i)-(vii). In some embodiments, NS1 is Zika virus NS1, NS2A is Zika virus NS2A, NS2B is Zika virus NS2B, NS3 is Zika virus NS3, NS4A is Zika virus NS4A, NS4B is Zika virus NS4B, or NS5 is Zika virus NS5, or any combination of two or more thereof.

[0012] In some embodiments, the components of the nucleic acid composition include African Zika virus components, Asian Zika virus components, or Brazilian Zika virus components, or combinations thereof. In one specific embodiment, the Zika virus is the African MR766 strain.

[0013] In some embodiments, the nucleic acid composition is expressed on one or more separate nucleic acids. In some embodiments, the nucleic acid composition comprises one or more expression control elements in operable linkage that confer expression of the nucleic acid composition in vitro or in vivo. In some embodiments, the expression control element is a promoter that drives expression of the nucleic acid composition in vitro. In specific embodiments, the promoter is T7, T3, SP6, or any phage promoter.

[0014] In some embodiments, the expression control element is a promoter that drives expression of the nucleic acid composition in a target cell. In some specific embodiments, the promoter is a CMV, SV40 or any eukaryotic promoter.

[0015] In some embodiments, the target cell is a neuron, or a non-neuronal cell, Vero, COS, CHO, CHLA, C6 / 36, HeLa, HEK, HepG2, In some embodiments, the target cell is an oligodendrocyte, a microglia, or an astrocyte.

[0016] In some embodiments, a recombinant Zika virus is generated from expressing a nucleic acid composition described herein in a producer cell, and the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0017] In some embodiments, the second Zika virus is a wild type Zika virus. In some embodiments, the wild type Zika virus is an African, Asian and Brazilian strain. In other embodiments, the second Zika virus is a modified Zika virus. In some specific embodiments, the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms. In some specific embodiments, the one or more microRNA-based gene silencing mechanisms control viral replication.

[0018] In some embodiments, a recombinant Zika virus is generated from expressing a nucleic acid composition described herein in a producer cell without infection with a second Zika virus, wherein the recombinant Zika virus comprises Zika virus ancC / C or a derivative of Zika virus ancC / C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E. In some embodiments, the producer cell is a Vero E6 or C6 / 36 cell.

[0019] In some embodiments, the recombinant Zika virus is replication competent. In other embodiments, the recombinant Zika virus is replication incompetent without reducing vector titer. In some embodiments, the recombinant Zika virus has reduced insertional mutagenesis. In other embodiments, the recombinant Zika virus has a reduced immune response.

[0020] Non-limiting examples of nucleic acid compositions provided herein include a regulatory polynucleotide that is complementary to a Zika virus 5' untranslated region (5'UTR), and a Zika virus 3' untranslated region (3'UTR), and the regulatory polynucleotide is selected from the group consisting of (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 6A or Table 6B, or (iii) (i) and (ii). In some embodiments, the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof. In some embodiments, the 5'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous or identical to SEQ ID NO: 239 (AGTTGTTACTGTTGCTGACTCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAGGTTTTATTTGGATTTGGAAACGAGAGTTTCTGGTC).In some embodiments, the 3'UTR is SEQ ID NO:241 (TAAGCACCAATCTTAATGTTGTCAGGCCTGCTAGTCAGCCACAGCTTGGGGAAAGCTGTGCAGCCTGTGACCCCCCCAGGAGAAGCTGGGAAACCAAGCCTATAGTCAGGCCGAGAACGCCATGGCACGGAAGAAGCCATGCTGCCTGTGAGCCCCTCAGAGGACACTGAGTCAAAAAAAACCCCACGCGCTTGGGAGGCGCAGGATGGGAAAAGAAGGTGGCGACCTTCCCCACCCTTCAATCTGGGGCCTGAAC In some embodiments, the 5'UTR is selected from a Zika virus in Table 12 and the 3'UTR is selected from a Zika virus in Table 13. In some embodiments, the regulatory polynucleotide is expressed in non-cancer cells, and optionally the regulatory polynucleotide has higher expression in non-cancer cells compared to the cancer cells of the subject.In some embodiments, the regulatory polynucleotide is a microRNA.In some embodiments, the sequence complementary to the regulatory polynucleotide is 9 nucleotides to 22 nucleotides in length, and optionally is about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0021] Non-limiting examples of nucleic acid compositions provided herein include (a) a Zika virus 5' untranslated region (5'UTR); (b) a polynucleotide encoding at least one Zika virus structural protein selected from a capsid protein (ancC / C), a membrane protein (prM / M) and an envelope protein (E), and / or a polynucleotide encoding at least one Zika virus nonstructural protein selected from NS1, NS2A, NS2B, NS3, NS4A, the 2k peptide, NS4B and NS5; (c) a Zika virus 3' untranslated region (3'UTR); and (d) a sequence complementary to a regulatory polynucleotide, wherein (i) the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, wherein the polynucleotide encoding at least one Zika virus nonstructural protein comprises a polynucleotide encoding the 2k peptide, and wherein the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide. and / or (iv) the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein.

[0022] In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, the polynucleotide encoding at least one Zika virus nonstructural protein comprises a polynucleotide encoding a 2k peptide, and the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide. In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, the polynucleotide encoding at least one Zika virus nonstructural protein comprises a polynucleotide encoding NS4A and a polynucleotide encoding NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding NS4A and the polynucleotide encoding NS4B. In some embodiments, the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus nonstructural protein. In some embodiments, the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and a polynucleotide encoding at least one Zika virus structural protein and / or a polynucleotide encoding at least one Zika virus nonstructural protein.

[0023] In some embodiments, the 5'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous or identical to SEQ ID NO: 239. In some embodiments, the 3'UTR is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous or identical to SEQ ID NO: 241. In some embodiments, the 5'UTR is selected from a Zika virus in Table 12 and the 3'UTR is selected from a Zika virus in Table 13. In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus structural protein, the nucleic acid comprising a polynucleotide encoding at least one Zika virus structural protein comprises a polynucleotide encoding a capsid protein (ancC / C), a polynucleotide encoding a membrane protein (prM / M), and a polynucleotide encoding an envelope protein (E). In some embodiments, the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, the polynucleotide encoding at least one Zika virus nonstructural protein comprises a polynucleotide encoding NS1, a polynucleotide encoding NS2A, a polynucleotide encoding NS2B, a polynucleotide encoding NS3, a polynucleotide encoding NS4A, a polynucleotide encoding a 2k peptide, a polynucleotide encoding NS4B, and a polynucleotide encoding NS5. In some embodiments, the regulatory polynucleotide is expressed in a non-cancer cell, and optionally, the regulatory polynucleotide has a higher expression in the non-cancer cell compared to the cancer cell of the subject. In some embodiments, the regulatory polynucleotide is a microRNA.In some embodiments, the sequence complementary to the regulatory polynucleotide is between 9 and 22 nucleotides in length, optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0024] In some embodiments, a recombinant Zika virus is produced from a nucleic acid composition described herein. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

[0025] Non-limiting examples of recombinant Zika viruses provided herein include a polynucleotide complementary to a regulatory polynucleotide, wherein the regulatory polynucleotide comprises (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 6A or Table 6B, or (iii) both (i) and (ii). In some embodiments, the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCGGTCA, or a combination of two or more thereof. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

[0026] Non-limiting exemplary methods herein include a method of treating cancer in a subject in need thereof, the method comprising administering a recombinant Zika virus to the subject. In some embodiments, the recombinant Zika virus is a recombinant Zika virus provided herein. In some embodiments, the cancer is a central nervous system (CNS) cancer. In some embodiments, the CNS cancer is a brain tumor. In some embodiments, the brain tumor is an astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germinoma, or pineocytoma. In some embodiments, the cancer is a breast cancer, prostate cancer, colon cancer, retinal cancer, or testicular cancer. In some embodiments, the recombinant Zika virus does not infect and / or replicate in non-cancer cells of the subject, or the recombinant Zika virus infects and / or replicates less in non-cancer cells of the subject compared to cancer cells of the subject. [Brief description of the drawings]

[0027] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also referred to herein as "Figure" and "FIG."). [Figure 1A] Exemplary recombinant Zika virus structural features and DNA / RNA elements for transcription and viral genome processing are shown in Figure 1A, which shows an unmodified Zika virus flanked by a ribozyme and a promoter. [Figure 1B] Exemplary recombinant Zika virus structural features and DNA / RNA elements for transcription and viral genome processing are shown. Figure 1B shows a recombinant Zika virus with a miRNA target inserted into the 2k region. [Figure 1C]Exemplary recombinant Zika virus structural features and DNA / RNA elements for transcription and viral genome processing are shown. Figure 1C shows a recombinant Zika virus with a miRNA target inserted between the 5'UTR and the coding sequence. [Figure 1D] Exemplary recombinant Zika virus structural features and DNA / RNA elements for transcription and viral genome processing are shown. Figure ID shows a recombinant Zika virus with a miRNA target inserted between the coding sequence and the 3'UTR. [Figure 1E] Representative images highlighting the exemplary 2k and 3'UTR modifications of Figures 1B and 1D. Figure 1E shows the nucleotide and amino acid sequences in NS4A (black) (SEQ ID NO:24 and SEQ ID NO:25) and the 2k region (SEQ ID NO:223, SEQ ID NO:224). [Figure 1F] Representative images highlighting the exemplary 2k and 3'UTR modifications of Figure 1B and Figure 1D. Figure 1F shows the insertion of miR-1225-5p target sequence (miRNA target 13). In Figure 1F, the miR-1225-5p target sequence (miRNA target 13) flanked by EcoT221 (or AvaIII) sites was inserted into the 2k region, resulting in a modified 2k region (SEQ ID NO:26, SEQ ID NO:27) containing a first 2k region (SEQ ID NO:228, SEQ ID NO:229) and a second 2k region (SEQ ID NO:230 and SEQ ID NO:231). [Figure 1G] Representative images highlighting the exemplary 2k and 3'UTR modifications of Figure 1B and Figure 1D. In Figure 1G, miR-1225-5p target sequence (miRNA target 16) was inserted at the junction of NS5 (SEQ ID NO: 232, 233) and 3'UTR (SEQ ID NO: 234, 235), with the target sequence flanked by MluI sites. Insertion of miR-1225-5p resulted in modified sequence (SEQ ID NO: 239, 240). [Figure 1H] 1 shows the location of a polyprotein according to an embodiment of the present disclosure relative to the endoplasmic reticulum membrane and its cleavage sites. [Figure 1IA]1 provides an exemplary schematic of the proposed mechanism of action of an exemplary oncolytic Zika virus comprising an exogenous polynucleotide provided herein. [Figure 1IB] 1 provides an exemplary schematic of the proposed mechanism of action of an exemplary oncolytic Zika virus comprising an exogenous polynucleotide provided herein. [Figure 2A] The expression profile of miRNAs in normal and tumor tissues is shown in Figure 2. Figure 2A shows that miR219a-2-3p is highly expressed in neural progenitor cells and low / zero expressed in CNS tumor cell lines (glioblastoma, medulloblastoma and ATRT) and other non-tumor cell lines. [Figure 2B] Figure 2B shows the expression profile of miRNA in normal and tumor tissues. For miR219a-5p, high expression in neural progenitor cells and low / zero expression in CNS tumor cell lines (glioblastoma, medulloblastoma and ATRT) and other non-tumor cell lines are shown. [Figure 2C] The expression profile of miRNAs in normal and tumor tissues is shown in Figure 2C. For miR129a-5p, high expression is shown in neural progenitor cells and certain medulloblastoma cells (Daoy, CHLA06), and low / zero expression is shown in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT) and other non-tumor cell lines. [Figure 2D] Figure 2 shows the expression profile of miRNAs in normal and tumor tissues. Figure 2D shows low / zero expression of miR4298 (SEQ ID NO: 10) in all cell lines. [Figure 2E] The expression profile of miRNAs in normal and tumor tissues is shown in Figure 2E. For miR377-3p, high expression in normal cells and glioblastoma cell lines (U251), moderate expression in medulloblastoma cells (Daoy, CHLA06), and low / zero expression in CNS tumor cell lines (glioblastoma, medulloblastoma, and ATRT). [Figure 2F]Expression profiles of miRNAs in normal and tumor tissues are shown. Figure 2F shows that miR1225-5p is highly expressed in normal cell lines (Vero) and medulloblastoma cell lines (Daoy), moderately expressed in glioblastoma cell lines (HCB151, U138), and low / zero expression in all other cell lines. [Figure 3A] Exemplary exogenous miRNA target sequences (or seed-complementary target sequences) inserted into a recombinant Zika virus genome. FIG. 3A shows exemplary exogenous miR219a-2-3p target sequences (or seed-complementary target sequences) (CTTAACACC (miRNA target 12), CCGACCTGT (miRNA target 13), TTAACACCG (miRNA target 14)), which are complementary to miR-219a-2-ep (SEQ ID NO: 13), inserted into exemplary 2k, 5'UTR, or 3'UTR modified locations of a recombinant Zika virus genome. In one modification, miRNA target 12 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 31). In one modification, miRNA target 13 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 32). In one modification, miRNA target 12 was inserted adjacent to the 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 33), and in one modification, miRNA target 14 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 34). [Figure 3B]Exemplary exogenous miRNA target sequences (or seed complementary target sequences) inserted into the recombinant Zika virus genome. FIG. 3B shows exemplary exogenous miR219a-2-5p target sequences (or seed complementary target sequences) (CTAACAGGT (miRNA target 4), TAACAGGTT (miRNA target 5), ACTAACAGG (miRNA target 6)) that are complementary to miR-219a-5p (SEQ ID NO: 9) and inserted into exemplary 2k, 5'UTR, or 3'UTR modified locations of the recombinant Zika virus genome. In one modification, miRNA target 4 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 36). In one modification, miRNA target 5 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 37). In one modification, miRNA target 6 was inserted adjacent to the 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 38), and in one modification, miRNA target 4 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 39). [Figure 3C] Exemplary exogenous miRNA target sequences (or seed complementary target sequences) inserted into the recombinant Zika virus genome. FIG. 3C shows exemplary exogenous miR-129-5p target sequences (or seed complementary target sequences) (AAAAACGCC (miRNA target 1), AAACGCCAG (miRNA target 2)), which are complementary to miR-129-5p (SEQ ID NO: 8), inserted into or adjacent to exemplary 2k, 5'UTR or 3'UTR modified positions of the recombinant Zika virus genome (SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43). In one modification, miRNA target 1 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 40). In one modification, miRNA target 2 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 41). In one modification, miRNA target 1 was inserted adjacent to the 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 42). In one modification, miRNA target 1 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 43). [Figure 3D] Exemplary exogenous miRNA target sequences (or seed complementary target sequences) inserted into a recombinant Zika virus genome. FIG. 3D shows exemplary exogenous miR1225-5p target sequences (or seed complementary target sequences) (CACCCATGC (miRNA target 8), ACCCATGCC (miRNA target 10), CCCATGCCG (miRNA target 9) that are complementary to miR1225-5p (SEQ ID NO: 11) and inserted into or adjacent to exemplary 2k, 5'UTR, or 3'UTR modified locations of a recombinant Zika virus genome. In one modification, miRNA target 8 is inserted into the 2k region. , flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 45). In one modification, miRNA target 10 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 46). In one modification, miRNA target 9 was inserted adjacent to the 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 47). In one modification, miRNA target 10 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 48). [Figure 3E] FIG. 3E shows an exemplary exogenous miRNA target sequence (or seed complementary target sequence) inserted into a recombinant Zika virus genome. FIG. 3E shows an exemplary miR377-3p target sequence (or seed complementary target sequence) (AGTGTGTTT (miRNA target 11)), which is complementary to miR377-3p ((SEQ ID NO: 12)), inserted into or adjacent to the example 2k, 5'UTR or 3'UTR modified positions of the recombinant Zika virus genome. In one modification, miRNA target 11 was inserted into the 2k region and flanked by AvaIII sites to obtain a modified 2k region (SEQ ID NO: 49). In one modification, miRNA target 11 was inserted adjacent to the 5'UTR region and flanked by BsiWI sites (SEQ ID NO: 50). In one modification, miRNA target 11 was inserted adjacent to the 3'UTR region and flanked by MluI sites (SEQ ID NO: 51). [Figure 4A]Figure 4A shows the generation and efficacy of an exemplary recombinant Zika virus (oZIKV_0P) (pCC1-ZIKV_0P, Table 8, Table 9B) in cancer cell lines. Figure 4A shows the recombinant Zika virus derived from in vitro transcription and Vero cell transfection. [Figure 4B] Figure 4B shows the generation and efficacy of an exemplary recombinant Zika virus (oZIKV_0P) (pCC1-ZIKV_0P, Table 8, Table 9B) in cancer cell lines. Figure 4B shows the recombinant Zika virus oncolytic efficacy in medulloblastoma cell lines 48 hours after infection. [Figure 5A] Figure 5B shows the cytotoxicity of recombinant Zika virus (oZIKV_0P) (pCC1-ZIKV_0P, Table 8, Table 9B) in glioblastoma and medulloblastoma cell lines. Figure 5A shows the reduction in viability of glioblastoma cells (U138MG, U251MG, and U343MG cell lines) and medulloblastoma cells (ONS-76 and Daoy cell lines) after recombinant Zika virus infection at MOI 2 when compared to the control (CT). [Figure 5B] Figure 5B shows the cytotoxicity of recombinant Zika virus (oZIKV_0P) (pCC1-ZIKV_0P, Table 8, Table 9B) in glioblastoma and medulloblastoma cell lines. Figure 5B shows a comparison of infection of recombinant Zika virus oZIKV_0P compared to African wild-type Zika virus in medulloblastoma cells (Daoy). [Figure 6] Representative Zika replicon plasmids (pReps) containing the T7 promoter, hammerhead ribozyme, 5' UTR, enhanced green fluorescent protein coding region ("EGFP"), portions of the ZIKV genome (last 60 bases of NS4A, first 60 bases of NS4B) flanking HA (hemagglutinin), luciferase coding region ("Nluc"), 3' UTR, HDV ribozyme, multiple cloning site (MCS), bGH poly(A) signal, and recombinant Zika viruses containing the ZIKV genome (NS4A, NS4B) are shown. miRNA target sequences can be located within the pReps or the recombinant Zika viruses. [Figure 7A]Proof of concept of miRNA regulation in target sequences inserted into the dicareplicon plasmid pRep. Figure 7A shows the results of NanoLuc reporter assay of Vero cells carrying pRep with different miRNA targets inserted. Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequences (miRNA target 1, miRNA target 2). [Figure 7B] Proof-of-concept of miRNA regulation at the target sequence inserted into the dicareplicon plasmid pRep is shown. Figure 7B shows the construct map of the pRep construct used in the NanoLuc reporter assay with miRNA target sequence (Figure 7B: pRep-129-5p-BsiWi-1c containing miR129-5p(1c) target sequence, see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequence (miRNA target 1, miRNA target 2) designed. [Figure 7C] Proof-of-concept of miRNA regulation at the target sequence inserted into the dicareplicon plasmid pRep is shown. Figure 7C shows the construct map of the pRep construct used in the NanoLuc reporter assay with miRNA target sequence (Figure 7C: pRep-129-5p-BsiWI-1e containing miR129-5p(1e) target sequence, see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequence (miRNA target 1, miRNA target 2) designed. [Figure 7D]Proof-of-concept of miRNA regulation at target sequences inserted into the dicareplicon plasmid pRep is shown. Figure 7D shows the construct map of the pRep construct used in the NanoLuc reporter assay with miRNA target sequences (Figure 7D: pRep-219a-2-3p-BsiWI-2b containing miR219a-2-3p(2b) target sequence, see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequences (miRNA target 1, miRNA target 2) designed. [Figure 7E] Proof-of-concept of miRNA regulation at the target sequence inserted into the dicareplicon plasmid pRep is shown. Figure 7E shows the construct map of the pRep construct used in the NanoLuc reporter assay with miRNA target sequence (Figure 7E: pRep-377-3p-BsiWI-4c containing miR377-5p(4c) target sequence, see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequence (miRNA target 1, miRNA target 2) designed. [Figure 7F] Proof-of-concept of miRNA regulation at the target sequence inserted into the dicareplicon plasmid pRep is shown. Figure 7F shows the construct map of the pRep construct used in the NanoLuc reporter assay with miRNA target sequence (Figure 7F: pRep-377-3p-BsiWI-4e containing miR377-5p(4e) target sequence, see Tables 7 and 9A-9B for construct details). Overexpression of miR-129-5p reduced NanoLuc expression, confirming the inhibitory mechanism in pRep with the corresponding miRNA target sequence (miRNA target 1, miRNA target 2) designed. [Figure 8]The results of NanoLuc reporter assay of CHLA cells harboring pReps with different miRNA targets inserted are shown (see the legend of Figures 7A-7F for details of pRep constructs). Overexpression of miRNAs reduced NanoLuc expression in all pREPs, confirming the inhibitory mechanism in all designed pREPs. [Figure 9] A representative plasmid, pCC1-ZIKV-0P, containing the 5'UTR, ZIKV genome, ribozyme (e.g., hammerhead and HDV), T7 promoter, and 3'UTR is shown. [Figure 10] 1 shows an exemplary plasmid with a miRNA target inserted adjacent to the 5′UTR region using BsiWI sites. [Figure 11] An exemplary plasmid with a miRNA target inserted adjacent to the 5'UTR region using BsiWI and XhoI sites is shown. [Figure 12] An exemplary plasmid with an exogenous miRNA target sequence inserted into the 2k region is shown using the AarI site (SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54). The exogenous polynucleotide sequence (SEQ ID NO:226, 227) contains two restriction sites at the 5' and 3' ends. [Figure 13] A representative image of the plasmid pCC1-ZIKV-2P harboring ZIKV genomic components, ribozymes (e.g., hammerhead and HDV), the 5'UTR, a T7 promoter near the 3'UTR, and the miRNA target 219a-2-3p inserted into the 2k region is shown. [Figure 14] A representative image of the plasmid pCC1-ZIKV-3P harboring the ZIKV genomic components, a ribozyme (e.g., hammerhead, HDV), a T7 promoter near the 5'UTR, the 3'UTR, and the miRNA target miR129-5p inserted between NS5 and the 3'UTR is shown. [Figure 15]A representative image of the plasmid pCC1-ZIKV-5P-T7 harboring the ZIKV genomic components, a ribozyme (e.g., hammerhead, HDV), a T7 promoter next to the 5'UTR, the 3'UTR, and the miRNA target miR-1225 inserted between the 5'UTR and ancC is shown. [Figure 16] Shown are images of RNA gel electrophoresis of samples analyzed with the T7-HIGH kit (first three wells from the left), samples pretreated with DNase and the HiScribe™ T7 ARCA mRNA kit (three wells from the right), RNA ladder in the leftmost column. Bands confirm the efficiency of in vitro transcription with the production of expressed amounts of RNA. [Figure 17] A comparison of the concentration of ZIKV copies (copies / μL) produced at various time points in the cell pellet and supernatant is shown. The graph confirms that the beginning and end of the ZIKV genome are of equal amount, confirming that the entire ZIKV genome is present after in vitro transcription. [Figure 18] Micrographs of Vero cell cultures transfected with modified ZIKV RNA (TI_14, TI_15, TI_16, TI_17, TI_18) over the course of days 1, 4, 5, and 6 post-infection are shown. Cytopathic effects (*) were observed in all RNA samples (TI 14-18) 5-6 days after reinfection, confirming active virus production. [Figure 19] Antigen test results of the supernatants of Vero cells transfected with modified ZIKV RNA (pCC1-ZIKV-0P “0p”, pCC1-ZIKV-2P-T7 “2p”, and pCC1-ZIKV-3P-T7 “3p”), showing the presence of Zika virus in the supernatants, respectively. [Figure 20A]The results of cell viability tests of CHLA-06-ATRT cells 3 days (FIG. 20A) and 5 days (FIG. 20B) after infection with wild-type or recombinant Zika viruses (oZIKV_4 (pCC1-ZIKV-0P), oZIKV_16 (pCC1-ZIKV-0P), oZIKV_5 (pCC1-ZIKV-2P-T7), oZIKV_14 (pCC1-ZIKV-2P-T7), oZIKV_17 (pCC1-ZIKV-2P-T7), oZIKV_6 (pCC1-ZIKV-3P-T7), oZIKV_15 (pCC1-ZIKV-2P-T7), oZIKV_18 (pCC1-ZIKV-2P-T7), see Table 10). Four recombinant viruses (oZIKV_4, oZIKV_14, oZIKV_17, oZIKV_18) retained their oncolytic effect in CHLA cell lines 5 days after infection. [Figure 20B] The results of cell viability tests of CHLA-06-ATRT cells 3 days (FIG. 20A) and 5 days (FIG. 20B) after infection with wild-type or recombinant Zika viruses (oZIKV_4 (pCC1-ZIKV-0P), oZIKV_16 (pCC1-ZIKV-0P), oZIKV_5 (pCC1-ZIKV-2P-T7), oZIKV_14 (pCC1-ZIKV-2P-T7), oZIKV_17 (pCC1-ZIKV-2P-T7), oZIKV_6 (pCC1-ZIKV-3P-T7), oZIKV_15 (pCC1-ZIKV-2P-T7), oZIKV_18 (pCC1-ZIKV-2P-T7), see Table 10). Four recombinant viruses (oZIKV_4, oZIKV_14, oZIKV_17, oZIKV_18) retained their oncolytic effect in CHLA cell lines 5 days after infection. [Figure 21]Micrographs of neural progenitor cells (NPCs) are shown as a model for testing the safety of recombinant Zika viruses (oZIKV_4, oZIKV_14, oZIKV_17, oZIKV_18) in non-tumor cells. NPC cells were transfected with wild-type and recombinant Zika viruses, and cell cultures were imaged 5 days after infection. Results show that oZIKV_14 and oZIKV_18 recombinant viruses exhibited oncolytic effects on CHLA tumor cells (Figures 20A-20B), but little or no cytotoxic effects on normal NPCs (Figures 21-22B). NPCs transfected with wild-type Zika and oZIKV_17 had reduced viability in tumor cells. In contrast, two recombinant Zika viruses, oZIKV_14 and oZIKV_18, demonstrate that these recombinant viruses enable survival of NPC cells (i.e., are safe in normal cells). [Figure 22A] Neurosphere analysis of NPCs transfected with wild-type Zika virus and recombinant Zika virus is shown, where the area (FIG. 22A) and perimeter (FIG. 22B) of neurospheres were measured 5 days after infection. [Figure 22B] Neurosphere analysis of NPCs transfected with wild-type Zika virus and recombinant Zika virus is shown, where the area (FIG. 22A) and perimeter (FIG. 22B) of neurospheres were measured 5 days after infection. [Diagram 23] The results of cell viability assays of medulloblastoma cells (Daoy) and ATRT cells (CHLA) infected with recombinant Zika virus carrying miRNA target insert (oZIKV_14) after miRNA modulation by cell transfection 24 hours prior to viral infection are shown. These results show that inhibition of oZIKV_14 replication after miR-219a-2-3p overexpression by target sequence ligation confirms the functionality of the inhibitory mechanism of the recombinant virus. [Figure 24]Cell viability assay of human cerebral microvessel (hCMEC) cells infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type Zika virus at MOI 5, 3 days after infection. Relative viability was not decreased after oZIKV_14 infection, confirming the safety of the recombinant virus oZIKV_14 in normal cerebral microvessel cell lines compared to wild-type ZIKV. Samples are statistically different from mock by ANOVA multiple comparisons, ap<0.0001. [Diagram 25] Results of cell viability assay of microglial cells (hMC3) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 at 3 days post-infection. Both oZIKV_14 and wild-type virus reduced the relative viability in microglial cell lines after infection, confirming the immune response after cell infection. Samples were statistically different from MOCK by ANOVA multiple comparisons when ap<0.0001, bp<0.0009. [Figure 26] Figure 1 shows the results of cell viability assays of testicular cells (Hs1.Tes) infected with recombinant Zika virus carrying miRNA target inserts (oZIKV14) and wild-type ZIKA virus at day 3 post-infection at MOIs of 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, and 0.002. Both oZIKV_14 and wild-type virus reduced the relative viability in testicular cell lines after infection. [Figure 27]Figure 1 shows the results of cell viability assay of medulloblastoma cells (Daoy) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002, and 3 days post-infection. Both oZIKV_14 and wild-type virus reduced the relative viability in Daoy cell line after infection, confirming the oncolytic effect in medulloblastoma cell line. Samples are statistically different from MOCK by ANOVA multiple comparisons when ap<0.0001. [Figure 28] Results of cell viability assays of medulloblastoma cells (ONS) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI of 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, and 0.002 at 3 days post-infection. Both oZIKV_14 and wild-type virus reduced the relative viability in ONS cell lines after infection, confirming their oncolytic effect in medulloblastoma cell lines. Samples were statistically different from MOCK by ANOVA multiple comparisons at ap<0.0001. [Figure 29] Figure 1 shows the results of cell viability assay of ATRT cells (CHLA-06-ATRT) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 at 3 days post-infection. Both oZIKV_14 and wild-type virus decreased the relative viability in CHLA-06-ATRT cell line after infection, confirming the oncolytic effect in medulloblastoma cell line. Samples were statistically different from MOCK by ANOVA multiple comparisons when ap<0.0001. [Diagram 30]Figure 1 shows the results of cell viability assays of glioblastoma cells (U138 and LN18) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5 and MOI 1.667, 3 days after infection. oZIKV_14 reduced the relative viability at the lowest MOI (virus concentration) in both glioblastoma cell lines after infection when compared to wild-type ZIKV, confirming the best oncolytic effect of oZIKV_14. Samples were statistically different from MOCK by ANOVA multiple comparisons, ap<0.0001, dp<0.05. [Diagram 31] Figure 1 shows the results of cell viability assay of prostate tumor cells (DU-145) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 at 3 days post-infection. Both oZIKV_14 and wild-type virus reduced the relative viability in DU-145 cell line after infection, confirming the oncolytic effect in prostate tumor cell line. Samples were statistically different from MOCK by ANOVA multiple comparisons when ap<0.0001. [Diagram 32] Results of cell viability assays of triple-negative breast tumor cells (MDA-MB-231) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at day 3 post-infection at MOIs of 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, and 0.002 are shown. Both oZIKV_14 and wild-type viruses reduced the relative viability in MDA-MB-231 cell lines after infection, confirming their oncolytic effect in triple-negative breast tumor cell lines. Samples were statistically different from MOCK by ANOVA multiple comparisons if ap<0.0001, bp<0.0009, and cp<0.009. [Diagram 33]Figure 1 shows the results of cell viability assay of colon tumor cells (hCT-8) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, 0.002 at 3 days post-infection. Both oZIKV_14 and wild-type virus did not reduce the relative viability in hCT-8 cell line after infection, confirming their oncolytic effect in colon tumor cell line. Samples are statistically different from mock by ANOVA multiple comparisons if ap<0.0001, cp<0.009, dp<0.05. [Diagram 34] Results of cell viability assays of luminal breast tumor cells (MCF7) infected with recombinant Zika virus carrying miRNA target insert (oZIKV14) and wild-type ZIKA virus at MOI of 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, and 0.002, 3 days after infection. Both oZIKV_14 and wild-type virus did not reduce relative viability in MCF7 cell lines after infection, confirming their oncolytic effects in luminal breast tumor cell lines. Samples were statistically different from MOCK by ANOVA multiple comparisons, with ap<0.0001, bp<0.0009, cp<0.009, and dp<0.05. [Diagram 35] Figure 1 shows the oncolytic effect of oZIKV14 on the development of central nervous system tumors and their metastases in the spinal cord. Control = animals receiving intracerebroventricular (icv) vehicle injection, zika = animals receiving icv Zika virus (6x103 PFU). T0 = images showing the presence and location of tumors before injection, T1 = images of the same animals 1 week after injection, T2 = images of the same animals 2 weeks after injection. Injection of oZIKV_14 caused partial and complete remission of brain and metastatic tumors, confirming the in vivo efficacy of oZIKV_14 against CNS tumors. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] In one aspect, a virus is provided that inhibits cell division, cell proliferation, and / or induces cell death in cancerous cells, referred to in some embodiments as an oncolytic virus. A non-limiting example of an oncolytic virus is a recombinant Zika virus as described herein. Another aspect of the present disclosure relates to a method of cancer treatment comprising administering a recombinant Zika virus as described herein. In some embodiments, the oncolytic virus does not replicate in non-cancerous cells. In some embodiments, the oncolytic virus does not inhibit cell division, cell proliferation, and / or induces cell death in non-cancerous cells. In some embodiments, the non-cancerous cells express microRNA (miRNA) and the oncolytic virus includes a target for the miRNA so that the miRNA can bind to the target. The cancerous cells may not express the miRNA or may express less miRNA than the non-cancerous cells. A non-limiting example of a non-cancerous cell is a neuron. Further provided are nucleic acids and constructs for the preparation of viruses, such as the oncolytic viruses herein.

[0029] Before the present method and composition are described, it should be understood that the present disclosure is not limited to the specific method or composition described, and therefore may vary.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art.All publications mentioned herein are incorporated by reference to disclose and describe in connection with the method and / or material in which the publication is cited.It is understood that the present disclosure supersedes any disclosure of the incorporated publication in the event of any discrepancy.

[0030] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the disclosure. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0031] When a range of values ​​is given, each intermediate value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, is also specifically disclosed, unless otherwise indicated. Each smaller range between the stated values ​​or intermediate values ​​in the stated range is included herein. The upper and lower limits of these smaller ranges can be independently included or excluded within the range, and each range in which any of the limits is included within the smaller range, none of the limits is included within the smaller range, or none of the limits is included within the smaller range, is also included herein, subject to the specifically excluded limit in the stated range. When a stated range includes one or both of the limits, ranges excluding either or both of the included limits are also included.

[0032] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation for the actual given value. When a particular value is described in this application and claims, unless otherwise stated, the term "about" should be assumed to mean an acceptable error range for the particular value, such as ±10% of the value modified by the term "about."

[0033] The terms "individual," "patient," or "subject" may be used interchangeably. None of the terms require or are limited to a situation characterized by the supervision (e.g., continuous or intermittent) of a medical professional (e.g., a physician, registered nurse, nurse practitioner, physician assistant, ward staff, or hospice staff). In some embodiments, a patient, subject, or individual may be under the supervision of a medical professional. The term "subject" may refer to an animal, including, but not limited to, a primate (e.g., a human), cow, sheep, goat, horse, dog, cat, rabbit, rat, or mouse. The terms "subject" and "patient" are used interchangeably herein with respect to a mammalian subject, such as, for example, a human subject.

[0034] The terms "heterologous nucleic acid sequence" or "exogenous nucleic acid sequence" or "transgenes" as used herein with reference to a particular virus may refer to a nucleic acid sequence derived from a source other than the particular virus.

[0035] As referred to herein, "inhibiting," "reducing," or "prevention," or any variation of these terms, can include any measurable decrease or complete inhibition to achieve a desired result.

[0036] A "promoter" as used herein may be a control sequence, which is a region of a nucleic acid sequence where the initiation and rate of transcription are controlled. In certain embodiments, a promoter may contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, may bind. The terms "operatively positioned," "operatively linked," "under control," and "under transcriptional control" may mean that the promoter is in the correct functional location and / or orientation relative to a nucleic acid sequence to control the transcription initiation and / or expression of that sequence. In certain embodiments, a promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0037] Percent sequence identity (%) to a reference polypeptide or polynucleotide sequence is the percentage of amino acid or nucleotide residues in a candidate sequence that are identical to the amino acid or nucleotide residues in the reference polypeptide or polynucleotide sequence, without considering any conservative substitutions as part of the sequence identity, after aligning the sequences and introducing gaps as necessary to achieve the maximum sequence identity percentage. Alignment for the purpose of determining percent amino acid sequence identity can be achieved in a variety of known ways, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences can be determined, including the algorithm required to achieve maximum alignment over the entire length of the sequences being compared. However, for the purposes of this specification, % amino acid or polynucleotide sequence identity values ​​are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc., and the source code has been submitted with user documentation to the USCopyright Office, Washington DC, 20559, which is registered under US Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or can be compiled from the source code. The ALIGN-2 program must be compiled for use on UNIX operating systems, including Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0038] In the context of using ALIGN-2 for comparison of amino acid or polynucleotide sequences, the % amino acid or polynucleotide sequence identity of a given sequence A to a given sequence B, or to a given sequence B (which can alternatively be said to have or contain a particular % sequence identity to a given sequence B, or to a given sequence B) is hereinafter calculated as 100 times the fraction X / Y, where X is the number of residues scored as identical matches by the sequence alignment program ALIGN-2 in the alignment of A and B in that program, and Y is the total number of residues in B. It will be understood that if the length of sequence A is not equal to the length of sequence B, the % sequence identity of A to B is not equal to the % sequence identity of B to A. Unless otherwise stated, all % sequence identity values ​​used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

[0039] The terms "treat," "treating," and "treatment" include alleviating or abrogating a disorder, disease, or condition, or one or more symptoms associated with a disorder, disease, or condition, or reducing or eradicating the cause of the disorder, disease, or condition itself. Desirable effects of treatment may include, but are not limited to, prevention of disease onset or recurrence, alleviation of symptoms, reduction of any direct or indirect pathological consequences of a disease, prevention of metastasis, reduction in the rate of disease progression, improvement or palliation of the disease state, and remission or improved prognosis.

[0040] The term "therapeutically effective amount" may refer to an amount of a compound that, upon administration, may be sufficient to prevent the progression of, or alleviate to some extent, one or more of the symptoms of the disorder, disease, or condition being treated. The term "therapeutically effective amount" may also refer to an amount of a compound sufficient to elicit the biological or medical response in a cell, tissue, system, animal, or human that is desired by a researcher, veterinarian, physician, or clinician.

[0041] A "pharmacologically acceptable carrier", "pharmacologically acceptable excipient", "physiologically acceptable carrier", or "physiologically acceptable excipient" may refer to a pharma- ceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, excipient, diluent, solvent, or encapsulating material. An ingredient may be "pharmacologically acceptable" in the sense of being compatible with the other ingredients of a pharmaceutical formulation. It may also be suitable for use in contact with the tissues or organs of humans and animals without undue toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit / risk ratio. Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins: Philadelphia,PA,2005;Handbook of Pharmaceutical Excipients,5th Edition,Rowe et al.,Eds.,The Pharmaceutical Press and the American Pharmaceutical Association:2005;and Handbook of Pharmaceutical Additives,3rd Edition,Ash and Ash Eds.,Gower Publishing Company:2007;Pharmaceutical Preformulation and Formulation,nd See Edition, Gibson Ed., CRC Press LLC: Boca Raton, FL, 2004.

[0042] The term "pharmaceutical composition" may refer to a mixture of a compound disclosed herein with other chemical components, such as diluents or carriers. A pharmaceutical composition can facilitate administration of a compound to an organism. There are multiple techniques of administering a compound in the art, including but not limited to oral, injection, aerosol, parenteral, and topical administration. A pharmaceutical composition can also be obtained by reacting a compound with an inorganic or organic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like.

[0043] As used herein, "anti-cancer agent" may refer to a drug or therapy that can adversely affect cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the rate of proliferation of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing blood supply to tumors or cancer cells, promoting immune response to cancer cells or tumors, preventing or inhibiting the progression of cancer, or prolonging the lifespan of subjects with cancer.Non-limiting examples of anti-cancer agents may include biological agents (biotherapy), chemotherapy agents, and radiation therapy agents.

[0044] The term "oncolytic" as used herein may refer to the killing of cancer or tumor cells by an agent through direct lysis of the cells by stimulating an immune response against the cells, apoptosis, expression of toxic proteins, autophagy, and halting protein synthesis, inducing anti-tumor immunity, or any combination thereof. Direct lysis of an agent-infected cancer or tumor cell may be the result of viral replication within the cell. In certain instances, the term "oncolytic" may kill cancer or tumor cells without lysis of the cells.

[0045] The term "oncolytic virus" as used herein may refer to a virus that preferentially infects and kills tumor cells. It is understood that under certain non-limiting circumstances, oncolytic viruses may promote anti-tumor responses through dual mechanisms that rely not only on the selective killing of tumor cells but also on the stimulation of host anti-tumor immune responses.

[0046] In some embodiments, a "derivative" of a polypeptide or polynucleotide as used herein refers to a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the polypeptide or polynucleotide, respectively. In some embodiments, a "derivative" of a polypeptide or polynucleotide as used herein refers to a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the polypeptide or polynucleotide, respectively. In some embodiments, a "derivative" of a polypeptide or polynucleotide, as used herein, refers to a sequence that has or has not more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid or nucleotide substitutions, insertions, or deletions compared to the polypeptide or polynucleotide, respectively.

[0047] Oncolytic viruses and nucleic acid compositions In one aspect, provided herein is a method of treating Zika virus and cancer, comprising administering a Zika virus to a subject in need of cancer treatment. In some embodiments, the Zika virus is a recombinant Zika virus. In some embodiments, the Zika virus is produced from a nucleic acid composition described herein.

[0048] In some embodiments, the Zika virus herein has selectivity for cells undergoing cell division, such as cancerous cells, and is therefore useful for killing the cancer cells and / or inhibiting tumor growth. Thus, the oncolytic viruses provided herein are not limited to viruses that have a lytic effect on cancerous cells, but instead include any virus that acts on cancer cells to inhibit cell growth, block cell growth, block cell replication, block cell replication, cause cell death, or any combination thereof. The oncolytic virus may be a clinical isolate of the virus, or a clone or recombinant virus derived or engineered from it.

[0049] In some embodiments, the Zika viruses described herein have a tropism for cells of the central nervous system. As a non-limiting example, the Zika virus has a tropism for cells of the central nervous system, such as brain tumor cells.

[0050] In another embodiment, compositions are provided that include one or more portions of Zika virus. For example, such portions of the virus include nucleic acid (e.g., nucleic acid encoding Zika virus or a portion thereof) and viral proteins. Non-limiting examples of viral proteins include capsid proteins, membrane proteins, non-structural proteins, and envelope proteins. Non-limiting examples of viral nucleic acids include protein-coding sequences and non-protein-coding sequences.

[0051] In some embodiments, nucleic acid compositions are provided that encode a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 1. In some embodiments, nucleic acid compositions are provided that encode a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 2. In some embodiments, nucleic acid compositions are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 3. In some embodiments, nucleic acid compositions are provided that encode a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 4. In some embodiments, nucleic acid compositions are provided that include sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 5. In some embodiments, nucleic acid compositions are provided that include sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 6A. In some embodiments, nucleic acid compositions are provided that comprise a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence complementary to one or more sequences in Table 6B.In some embodiments, nucleic acid compositions are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs of Table 8. In some embodiments, nucleic acid compositions are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs of Table 9A. In some embodiments, nucleic acid compositions are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 9B. In some embodiments, nucleic acid compositions are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs in Table 10. In some embodiments, nucleic acid compositions are provided that include a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of a Zika virus from Table 12. In some embodiments, nucleic acid compositions are provided that include a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of a Zika virus from Table 13.

[0052] In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 1. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 2. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 3. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 4. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 5. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 6A. In some embodiments, recombinant Zika viruses are provided that contain a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence complementary to one or more sequences in Table 6B.In some embodiments, recombinant Zika viruses are provided that contain sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs of Table 8. In some embodiments, recombinant Zika viruses are provided that contain sequences at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs of Table 9A. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences in Table 9B. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more recombinant Zika virus constructs in Table 10. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of a Zika virus from Table 12. In some embodiments, recombinant Zika viruses are provided that include a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to one or more sequences of a Zika virus from Table 13.

[0053] In some embodiments, the recombinant Zika viruses described herein include nucleic acid sequences derived from the Zika virus genome, for example, by mutation, insertion, and / or deletion of one or more nucleic acid bases. Insertions include nucleic acid sequences encoding one or more proteins. Insertions also include promoters, such as promoters inducible in mammalian cells. Deletions include removal of coding sequences that allow the virus to replicate. Thus, in some cases, the recombinant Zika viruses described herein represent viruses that have been modified by the introduction of heterologous nucleic acids or proteins and / or alterations of native nucleic acid sequences.

[0054] In some embodiments, the recombinant Zika virus described herein includes one or more molecules, such as exogenous nucleic acids, that confer an enhanced level of tumor cell specificity to the virus. In this way, the virus is targeted to a specific tumor type using tumor cell specific molecules or biomarkers. In some embodiments, the recombinant Zika virus includes an exogenous nucleic acid that is complementary to a miRNA. The miRNA may be expressed in non-tumor cells and may not be expressed in tumor cells. The miRNA may be expressed more in non-tumor cells than in tumor cells, for example, the miRNA is expressed at least two-fold more in non-tumor cells than in tumor cells. A non-limiting example of a non-tumor cell is a neuron. In some embodiments, the recombinant Zika virus is an oncolytic Zika virus that has oncolytic activity, and the recombinant Zika virus retains oncolytic activity with the exogenous nucleic acid. For example, if the exogenous nucleic acid is inserted into a polynucleotide encoding a 2k protein, the 2k protein is still expressed and the Zika virus retains oncolytic activity. As another example, if an exogenous nucleic acid is inserted between the 5'UTR and a polynucleotide encoding the ancC / C protein, the ancC / C protein will still be expressed and the Zika virus will retain oncolytic activity. As another example, if an exogenous nucleic acid is inserted between the 3'UTR and a polynucleotide encoding the nonstructural protein NS5, the NS5 protein will still be expressed and the Zika virus will retain oncolytic activity.

[0055] In some embodiments, the recombinant Zika virus described herein comprises a nucleic acid sequence encoding a polypeptide heterologous to the virus, and the polypeptide is expressible under an inducible promoter. Thus, the virus can also be an expression vector in which the polypeptide can be expressed. For example, the recombinant Zika virus described herein comprises an expressible suicide gene, such as CMV, under an inducible promoter. The method of cancer treatment involving the recombinant Zika virus described herein optionally includes inducing the expression of the suicide gene to kill or otherwise prevent the proliferation of the virus. Thus, viral infection can be controlled by the physician according to the needs of the patient.

[0056] In some embodiments, the recombinant Zika virus described herein comprises a genetic modification that affects the expression of a viral gene. For example, a mutation in a virulence gene that contributes to the pathogenicity of the virus to the host organism is such that the expression of the gene is significantly reduced or the gene product is rendered non-functional or its ability to function is significantly reduced. In some cases, the genetic modification impairs the ability of the virus to replicate or replicate in non-cancerous or non-dividing cells.

[0057] In some embodiments, the recombinant Zika virus described herein comprises at least one viral protein required for viral replication under the control of a tumor-specific promoter. In some embodiments, a gene encoding a cytotoxic agent is placed under the control of a tumor-specific promoter. For example, cytotoxic agents include toxins, prodrugs, cytokines, and chemokines.

[0058] In some cases, the recombinant Zika virus described herein comprises at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 500, 1000, 5000, 10000, or 11000 nucleobases of a wild-type Zika genome. These nucleobases do not necessarily have 100% sequence identity with the wild-type Zika virus and can vary, for example, the identity is at least about 80%, 85%, 90%, 95%, or 98%. In some cases, the portion refers to a region of the virus that encodes one or more proteins. Additionally or alternatively, the portion refers to a region of the virus that does not encode a protein.

[0059] Provided herein are nucleic acid compositions comprising the genome of a recombinant Zika virus described herein. Another aspect relates to a host cell comprising a recombinant Zika virus described herein.

[0060] In some embodiments, the recombinant Zika viruses may exhibit enhanced intratumor and intertumor spread, enhanced immune evasion, enhanced tumor-specific replication, and / or enhanced tumor-targeted delivery. In some embodiments, the recombinant Zika viruses described herein exhibit enhanced intratumor and intertumor spread, enhanced immune evasion, enhanced tumor-specific replication, and enhanced tumor-targeted delivery.

[0061] Zika virus produces highly abundant non-coding RNAs known as subgenomic flavivirus RNAs (sfRNAs) in infected cells. In some embodiments, the recombinant Zika virus produces higher levels of sfRNAs than wild-type Zika virus in the subject's cancer cells. In some embodiments, the higher levels of sfRNAs are at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0062] In some embodiments, the recombinant Zika virus described herein comprises a 3'UTR to increase sfRNA production, e.g., as a result of a longer stall of exoribonuclease XRN1 in cancer cells. In some embodiments, the recombinant Zika virus described herein comprises a 5'UTR to increase sfRNA production, e.g., as a result of a longer stall of exoribonuclease XRN1 in cancer cells. In some embodiments, the recombinant Zika virus described herein comprises a 5'UTR and a 3'UTR to increase sfRNA production, e.g., as a result of a longer stall of exoribonuclease XRN1 in cancer cells.

[0063] In some embodiments, the method of administering the recombinant Zika virus further comprises administering to a subject in need thereof extra exoribonuclease-resistant sfRNA.

[0064] In some embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding a Zika virus capsid protein C or a derivative of Zika virus C, a polynucleotide encoding a Zika virus membrane protein (prM / M) or a derivative of Zika virus prM / M, a polynucleotide encoding a Zika virus envelope protein (E) or a derivative of Zika virus E, or any combination thereof. Non-limiting examples of sequences include those in Tables 5 and 9B.

[0065] In certain embodiments, the recombinant Zika virus is produced from a nucleic acid composition that includes a polynucleotide encoding only Zika virus C or a derivative of Zika virus C. Thus, in some embodiments, the recombinant Zika virus described herein is generated from expressing such a nucleic acid composition in a producer cell, which is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0066] In certain embodiments, recombinant Zika viruses are produced from nucleic acid compositions that include polynucleotides that encode only Zika virus prM / M or a derivative of Zika virus prM / M. Thus, in some embodiments, recombinant Zika viruses described herein are generated from expressing such nucleic acid compositions in a producer cell, which is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0067] In certain embodiments, recombinant Zika viruses are produced from nucleic acid compositions that include polynucleotides encoding only Zika virus E or a derivative of Zika virus E. Thus, in some embodiments, recombinant Zika viruses described herein are generated from expressing such nucleic acid compositions in a producer cell, which is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0068] In certain embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding Zika virus C or a derivative of Zika virus C and a polynucleotide encoding only Zika virus prM / M or a derivative of Zika virus prM / M. Thus, in some embodiments, the recombinant Zika virus described herein is generated from expressing such a nucleic acid composition in a producer cell, which is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0069] In certain embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding Zika virus C or a derivative of Zika virus C and a polynucleotide encoding only Zika virus E or a derivative of Zika virus E. Thus, in some embodiments, the recombinant Zika virus described herein is generated from expressing such a nucleic acid composition in a producer cell, where the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0070] In certain embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding Zika virus prM / M or a derivative of Zika virus prM / M, and a polynucleotide encoding Zika virus E or a derivative of Zika virus E alone. Thus, in some embodiments, the recombinant Zika virus described herein is generated from expressing such a nucleic acid composition in a producer cell, which is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0071] In some embodiments, the nucleic acid compositions herein include a polynucleotide encoding Zika virus C, a polynucleotide encoding Zika virus prM / M, and a polynucleotide encoding Zika virus E. When three structural proteins are expressed as nucleic acid compositions described herein, in some embodiments, the structural proteins may be expressed in one nucleic acid. When three structural proteins are expressed as nucleic acid compositions described herein, in other embodiments, the structural proteins may be expressed in one or more nucleic acids.

[0072] In some embodiments, a polynucleotide encoding a derivative of Zika virus C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to a wild-type Zika virus C. In some embodiments, the Zika virus C or derivative of Zika virus C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 1.

[0073] [Table 1]

[0074] In some embodiments, a polynucleotide encoding a derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to a wild-type Zika virus prM / M. In some embodiments, the Zika virus prM / M or a derivative of Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 2.

[0075] [Table 2]

[0076] In some embodiments, the polynucleotide encoding a derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. In some embodiments, the polynucleotide encoding E is translated into wild-type Zika virus E. In some embodiments, the Zika virus E or derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 3.

[0077] [Table 3]

[0078] In some embodiments, the nucleic acid composition comprises a 5' untranslated region (5'UTR) of a Zika virus. In some embodiments, the nucleic acid composition comprises a 3' untranslated region (3'UTR) of a Zika virus. Non-limiting examples include untranslated regions from the viruses disclosed in Tables 4 and 12-13. In some embodiments, the 5' untranslated region (5'UTR) of a Zika virus comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 4 or Table 12.

[0079] [Table 4]

[0080] [Table 5-1]

[0081] [Table 5-2]

[0082] [Table 5-3]

[0083] [Table 5-4]

[0084] [Table 5-5]

[0085] [Table 5-6]

[0086]

Table 5-7

[0087]

Table 5-8

[0088]

Table 5-9

[0089]

Table 5-10

[0090]

Table 6-1

[0091]

Table 6-2

[0092]

Table 6-3

[0093]

Table 6-4

[0094]

Table 6-5

[0095]

Table 6-6

[0096]

Table 6-7

[0097] [Table 6-8]

[0098] [Table 6-9]

[0099] [Table 6-10]

[0100] In some embodiments, the nucleic acid composition does not include a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i)-(vii). In other embodiments, the nucleic acid composition includes a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i)-(vii). Non-limiting examples of nonstructural proteins include those in Tables 5 and 9B. In some embodiments, the nucleic acid does not include a polynucleotide encoding a 2k peptide. In some embodiments, the nucleic acid includes a polynucleotide encoding a 2k peptide. In some embodiments, the nucleic acid compositions comprise sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 5.

[0101] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS1 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS2A protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS2B protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS3 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS4A protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS4B protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding an NS5 protein. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding a 2k peptide.

[0102] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS2A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1 and NS5.

[0103] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A and NS5.

[0104] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B and NS5.

[0105] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS3 and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS3 and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS3 and NS5.

[0106] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS4A and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS4A and NS5.

[0107] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS4B and NS5.

[0108] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2A, and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2A, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2A, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2A, and NS5.

[0109] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS2B, and NS5.

[0110] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS3, and NS5.

[0111] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS1, NS4A, and NS5.

[0112] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS1, NS4B, and NS5.

[0113] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS2B, and NS5.

[0114] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS3, and NS5.

[0115] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2A, NS4A, and NS5.

[0116] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2A, NS4B, and NS5.

[0117] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS2B, NS3, and NS5.

[0118] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS4A, and NS5.

[0119] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS2B, NS4B, and NS5.

[0120] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS3, and NS4A, and NS5.

[0121] In certain embodiments, the nucleic acid composition comprises polynucleotides encoding NS3, NS4B, and NS5.

[0122] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding NS4A, NS4B, and NS5.

[0123] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2A, and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2A, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2A, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2A, and NS5.

[0124] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1, NS2B, and NS5.

[0125] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS1, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS1, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS1, NS3, and NS5.

[0126] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS1, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS1, NS4A, and NS5.

[0127] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS1, NS4B, and NS5.

[0128] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A, NS2B, and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A, NS2B, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A, NS2B, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A, NS2B, and NS5.

[0129] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2A, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2A, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2A, NS3, and NS5.

[0130] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2A, NS4A, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2A, NS4A, and NS5.

[0131] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS2A, NS4B, and NS5.

[0132] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2B, NS3, and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2B, NS3, and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS2B, NS3, and NS5.

[0133] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS2B, NS4A, and NS5.

[0134] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS2B, NS4B, and NS5.

[0135] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS3 and NS4A, and NS5.

[0136] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS3, NS4B, and NS5.

[0137] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS4A, NS4B, and NS5.

[0138] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS2A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1 and NS5.

[0139] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A and NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A and NS5.

[0140] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2B and NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2B and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2B and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2B and NS5.

[0141] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS3 and NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS3 and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS3 and NS5.

[0142] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS4A and NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except NS4A and NS5.

[0143] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all of the NS proteins except for NS4B and NS5.

[0144] In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS1. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS2B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS3. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS4A. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS4B. In certain embodiments, the nucleic acid composition comprises a polynucleotide encoding all NS proteins except NS5.

[0145] In some embodiments, NS1 is Zika virus NS1. In some embodiments, NS2A is Zika virus NS2A. In some embodiments, NS2B is Zika virus NS2B. In some embodiments, NS3 is Zika virus NS3. In some embodiments, NS4A is Zika virus NS4A. In some embodiments, NS4B is Zika virus NS4B. In some embodiments, NS5 is Zika virus NS5.

[0146] In some embodiments, the components of the nucleic acid composition include an African Zika virus component, an Asian Zika virus component, or a Brazilian Zika virus component, or a combination of two or more thereof. In one embodiment, the Zika virus is the African MR766 strain.

[0147] In some embodiments, the components of the nucleic acid composition are expressed on one or more separate nucleic acids. In some embodiments, the nucleic acid composition comprises one or more expression control elements in operable linkage that confer expression of the nucleic acid composition in vitro or in vivo. In some embodiments, the expression control element is a promoter that drives expression of the nucleic acid composition in vitro, and in certain embodiments, the promoter is a T7, T3, SP6, or any phage promoter.

[0148] In some embodiments, the expression control element is a promoter that drives expression of the nucleic acid composition in a target cell. In some embodiments, the promoter is a CMV, SV40, or any eukaryotic promoter.

[0149] In some embodiments, the target cell is a neuron, or a non-neuronal cell, Vero, COS, CHO, C6 / 36, HeLa, HEK, HepG2, In some embodiments, the target cell is an oligodendrocyte, a microglia, or an astrocyte.

[0150] In some embodiments, a recombinant Zika virus is generated from expressing a nucleic acid composition described herein in a producer cell, and the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus.

[0151] In some embodiments, the second Zika virus used in the further infection is a wild type Zika virus. In some embodiments, the wild type Zika virus is an African, Asian or Brazilian strain. In other embodiments, the second Zika virus used in the further infection is a modified Zika virus. In some specific embodiments, the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms. In some specific embodiments, the one or more microRNA-based gene silencing mechanisms control viral replication.

[0152] In some embodiments, the recombinant Zika virus is produced by expressing the nucleic acid composition in a producer cell. In some embodiments, it is produced without infection with a second Zika virus. In some embodiments, the Zika virus C or a derivative of Zika virus C, the Zika virus prM / M or a derivative of Zika virus prM / M, and the Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus or Zika virus-like particle. In some embodiments, the producer cell is a Vero E6 or C6 / 36 cell.

[0153] In some embodiments, the recombinant Zika virus is replication competent. In other embodiments, the recombinant Zika virus is replication incompetent without reducing vector titer. In some embodiments, the recombinant Zika virus has reduced insertional mutagenesis. In other embodiments, the recombinant Zika virus has a reduced immune response.

[0154] Some embodiments of the present disclosure may include a recombinant Zika virus that may include modifications in the genome of the virus. In some embodiments, the recombinant Zika virus may include at least one modification in the genome of the virus. In some embodiments, the recombinant Zika virus may include at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or more modifications in the genome of the virus. The modification of the viral genome may include a mutation, deletion, or both of a viral gene. The deletion of a viral gene may include a partial or complete deletion of a viral gene. It should be noted that as used herein, "partial deletion" or "mutation" may refer to a partial deletion or mutation, respectively, of an endogenous viral gene in situ. Alternatively, they can refer to the replacement of an endogenous viral gene with an identical exogenous nucleic acid that either lacks a portion of the gene (a "partial deletion") or has one or more nucleotide changes in the gene (a "mutation").

[0155] One method of generating recombinant Zika virus as described herein includes introducing the viral genome or a portion thereof into a cell, in whole or in part, for example, in two or more fragments that assemble into the desired viral genome or a portion thereof in the cell. Non-limiting methods include cloning and amplifying nucleic acid fragments covering the genome of the virus or a portion thereof. Nucleic acid fragments or the entire viral genome can also be produced de novo. A promoter sequence, such as a cytomegalovirus (CMV) promoter, can be inserted at the end of the first fragment. For recombinant Zika virus with a heterologous nucleic acid sequence, this sequence is fused or adjacent to one of the fragments. In one method for producing oncolytic virus, the amplified fragment is introduced into a cell, for example, by electroporation, and the cell is then transferred to growth medium. Cell supernatants are then collected and stored or used to infect cells from which clarified virus is obtained from culture supernatants.

[0156] Any suitable method is useful for generating genetic modifications in the recombinant Zika viruses described herein, including mutagenesis, polymerase chain reaction, homologous recombination, or any other genetic engineering technique available in the art. Mutagenesis includes modification of nucleotide sequences, single genes, or blocks of genes, including removal, addition, and / or substitution of single or multiple nucleotide bases. In some cases, genetic modification includes the use of recombinant genetic techniques to delete or replace at least a portion of a native viral sequence. For example, a polynucleotide replaces part or all of a region of the native viral sequence of interest. Additionally or alternatively, a polynucleotide is inserted into the native viral sequence. This inserted polynucleotide can be functional, for example, encoding a suicide protein, a therapeutic agent, and / or a reporter protein. Exemplary non-limiting polynucleotides encoding reporter proteins include green fluorescent protein, enhanced green fluorescent protein, β-galactosidase, luciferase, and HSV-tk.

[0157] Exogenous Polynucleotides In some embodiments, a recombinant Zika virus comprising an exogenous polynucleotide is disclosed herein. The exogenous polynucleotide may be a target of a regulatory polynucleotide, for example, the exogenous polynucleotide target is at least 80% complementary to the regulatory polynucleotide. The target may be at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the regulatory polynucleotide. An exemplary regulatory polynucleotide is a ribonucleic acid (RNA) molecule. For example, the RNA is a microRNA or miRNA, and the oncolytic virus comprises a target of the miRNA ("target miRNA" or "target sequence"). Non-limiting examples of exogenous polynucleotides that are targets of miRNAs are provided in column 3 of Table 6A. Non-limiting examples of miRNAs are shown in Table 6B and column 2 of Table 6A. In some embodiments, the exogenous polynucleotide is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence in column 3 of Table 6A or a complementary sequence in Table 6B. In some embodiments, the exogenous polynucleotide anneals to a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence in column 2 of Table 6A. In some embodiments, the exogenous polynucleotide anneals to a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a complementary sequence of Table 6B. In some embodiments, the exogenous polynucleotide comprises about 6 bases, about 9 bases, about 12 bases, about 15 bases, or about 18 bases.

[0158] The exogenous polynucleotide can be disposed within the oncolytic virus such that the oncolytic virus containing the exogenous polynucleotide retains oncolytic activity. The retained oncolytic activity can be measured by in vitro or in vivo assays. The retained oncolytic activity can be at least 50%, 60%, 70%, 80%, 90%, or 100% of the oncolytic activity of the oncolytic virus without the exogenous polynucleotide.

[0159] In some embodiments, the exogenous polynucleotide comprises a miRNA target (e.g., the target anneals to the miRNA), and the miRNA is expressed in non-tumor cells but is less expressed or not expressed in tumor cells. In exemplary embodiments, an oncolytic virus comprising a miRNA target has less or no viral activity in non-tumor cells compared to viral activity in tumor cells. In exemplary embodiments, an oncolytic virus comprising a miRNA target has less or no viral activity in non-tumor cells compared to oncolytic viruses not comprising a miRNA target. In exemplary embodiments, an oncolytic virus comprising a miRNA target replicates less or no in non-tumor cells compared to replication in tumor cells. In exemplary embodiments, an oncolytic virus comprising a miRNA target replicates less or no in non-tumor cells compared to replication in tumor cells. In exemplary embodiments, an oncolytic virus comprising a miRNA target replicates less or no in non-tumor cells compared to oncolytic viruses not comprising a miRNA target. Non-limiting examples of miRNAs are provided in column 2 of Table 6A. Non-limiting examples of miRNA targets are provided in column 3 of Table 6A. Non-limiting examples of miRNAs, from which miRNA targets can be obtained, are provided in Table 6B.

[0160] In some embodiments, the exogenous polynucleotide is inserted into the non-translated region of the oncolytic virus. As an example, the exogenous polynucleotide is inserted into the region between the coding sequence and the 3'UTR (e.g., as shown in FIG. 1D). As another example, the exogenous polynucleotide is inserted into the region between the 5'UTR and the coding sequence (e.g., as shown in FIG. 1C). In some embodiments, the exogenous polynucleotide is inserted into the coding sequence of a nonstructural protein (e.g., as shown in FIG. 1B). In some embodiments, the exogenous polynucleotide is inserted between the coding sequence of a nonstructural protein and the 3'UTR (e.g., as shown in FIG. 1G). A non-limiting example provides for the insertion of a polynucleotide sequence in the 2k coding sequence (e.g., as shown in FIG. 1F).

[0161] A non-limiting example of an oncolytic virus is shown in FIG. 1IA. In this figure, the exogenous polynucleotide is a miRNA target located adjacent to the 3'UTR region of the viral genetic material. However, the exogenous polynucleotide can be a target of a non-miRNA polynucleotide, such as an alternative regulatory polynucleotide. The exogenous polynucleotide can also be located elsewhere, for example, as shown in FIG. 1B or 1C. In this exemplary figure, the miRNA target contributes to selective tropism and specific replication in a particular tissue. In some embodiments, the exogenous polynucleotide is a target (e.g., at least 80% complementary) of a miRNA that is highly expressed in normal tissues, such as neurons, and lowly expressed in tumor cells. Thus, the presence of the exogenous polynucleotide allows the replication of the modified oncolytic virus in neoplastic cells. When endogenously expressed miRNA targets the exogenous polynucleotide sequence in the virus, miRNA silencing of the modified oncolytic virus in non-neoplastic cells is achieved. Tumor cell lines that do not endogenously express miRNAs allow viral replication by not targeting exogenous polynucleotide sequences. This mechanism of action is shown in Figures 1IA-1IB.

[0162] regulatory area In some embodiments, the recombinant Zika virus, such as the oncolytic virus described herein, comprises one or more ribozymes. Ribozymes are self-cleaving RNAs. Small ribozyme motifs fall into four main types: hammerhead, hairpin, Varkud satellite (VS), and hepatitis delta virus (HDV). In some embodiments, the recombinant Zika virus comprises a hammerhead ribozyme. In some embodiments, the recombinant Zika virus comprises a HDV ribozyme.

[0163] In some embodiments, the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding one or more ribozymes. In some embodiments, the polynucleotide encodes a ribozyme upstream of the 5'UTR. In some embodiments, the ribozyme upstream of the 5'UTR is a hammerhead ribozyme. In some embodiments, the polynucleotide encodes a ribozyme downstream of the 3'UTR. In some embodiments, the ribozyme downstream of the 3'UTR is an HDV ribozyme.

[0164] How to use In one aspect, disclosed herein is an oncolytic virus for treating or preventing one or more diseases, disorders, and / or symptoms of cancer. The method of use includes contacting a cancerous cell with an effective amount of a recombinant Zika virus as described herein. The contacting can be performed in vitro (e.g., in biochemical and / or cellular assays), in vivo in a non-human animal, and in vivo in a mammal, including a human. In some cases, the contacting includes bringing the cancer cell into sufficient proximity with a composition comprising a recombinant Zika virus as described herein such that the composition has an effect on the cancer cell. The contacting includes physical interactions between the composition and the cancer cell, as well as interactions that do not require physical interaction. The contacting includes administering an effective amount of the composition to a subject comprising the cancer cell such that the composition inhibits the growth, division, and / or induces cancer cell death. In some embodiments, contact by administration includes intravenous administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration, subcutaneous administration, transdermal delivery, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation, intracerebral administration, intranasal administration, oral administration, pulmonary administration, impregnation of a catheter, and direct injection into a tissue or tumor of a subject.

[0165] Subjects are animals such as humans, other higher primates, lower primates, and animals of veterinary importance, such as dogs, cats, horses, sheep, goats, and cows. Subjects also include animals for use in research, such as mice, rats, and other rodents.

[0166] Methods for treating cancer in a subject are provided, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a recombinant Zika virus as described herein. An effective or therapeutically effective amount of a composition is an amount sufficient to achieve a desired therapeutic and / or prophylactic effect, e.g., an amount that results in the prevention or reduction of symptoms associated with cancer. The amount of the composition administered to a subject may depend on the type and severity of cancer and individual characteristics, such as general health, age, sex, weight, and resistance to drugs. In some embodiments, an effective amount of an oncolytic virus is administered to a subject with cancer in an amount sufficient to induce tumor lysis, destruction or lysis of cancer cells, slowing, inhibiting, and / or reducing tumor growth or size, including in certain cases eradicating the tumor. In some embodiments, an effective amount of an oncolytic virus is administered to a subject with cancer in an amount sufficient to attenuate or stop the division of cancer cells.

[0167] Treatment of cancer includes cure (i.e., prevention or delay of recurrence) and / or improvement, cure and / or maintenance of its associated symptoms. For example, a subject is successfully treated with cancer after being administered a therapeutic amount of a composition described herein, and the subject shows observable and / or measurable reduction or absence of one or more signs and symptoms of cancer, such as a reduction in the number of cancer cells or absence of cancer cells, a reduction in tumor size, inhibition (i.e., delaying to some extent and preferably stopping) of tumor metastasis, inhibition to some extent of tumor growth, increased length of remission and / or some alleviation of one or more symptoms associated with the particular cancer, reduced morbidity and mortality, and improved quality of life issues. Treatment also includes preventing cancer from worsening, slowing the rate of progression, and / or preventing cancer from recurring after initial elimination. Appropriate doses and treatment regimens may vary depending on the particular oncolytic virus used, the mode of delivery of the oncolytic virus, and whether it is used alone or in combination with one or more other oncolytic viruses.

[0168] In some embodiments, the methods include administering a recombinant Zika virus described herein to a subject having a tumor such that tumor cell growth or proliferation is inhibited. In some cases, tumor growth or proliferation is reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%, including inhibition of tumor cell division and / or induction of tumor cell death.

[0169] In some embodiments, the method includes administering a recombinant Zika virus described herein to a subject having a tumor such that tumor cell progression (e.g., tumor formation, tumor growth and proliferation, invasion and metastasis) is inhibited. In some cases, inhibiting tumor progression refers to inhibiting the initiation, growth, proliferation, or spread of a tumor, and includes, but is not limited to, the following effects: inhibition of cell growth in the tumor, (2) inhibition to some degree of tumor growth, including slowing or complete halt of growth, (3) reduction in tumor cell count, (4) reduction in tumor size, (5) inhibition (i.e., reduction, slowing or complete halt) of tumor cell invasion into adjacent peripheral organs and / or tissues, (6) inhibition (i.e., reduction, slowing or complete halt) of metastasis, (7) increased survival time of a patient or patient population after treatment of the tumor, and / or (8) reduction in mortality rate of a patient or patient population at a given time point after treatment of the tumor. In some cases, tumor progression is reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.

[0170] In some embodiments, a therapeutic benefit is achieved following administration of a recombinant Zika virus described herein. A therapeutic benefit includes anything that promotes or enhances the health of a subject with respect to the medical treatment of a disease in a subject, including the treatment of pre-cancer, cancer, and hyperproliferative diseases. For example, extending any period of a subject's life, reducing or delaying the onset of neoplasia of a disease, reducing hyperproliferation, reducing tumor growth, delaying metastasis, slowing the rate of cancer or tumor cell proliferation, and reducing pain in a subject that may be due to the disease in a subject.

[0171] Administration of the pharmaceutical composition to a subject is by means of which the recombinant Zika virus contained therein, as described herein, contacts the target cells. The specific route will depend on certain variables, such as the cancer cells, and can be determined by one of skill in the art. Suitable methods of administering compositions, including the pharmaceutical composition of the present invention, to a patient include any in vivo administration route suitable for delivering the virus to a patient. Exemplary methods of in vivo administration include, but are not limited to, intravenous administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration (e.g., into the carotid artery), subcutaneous administration, transdermal delivery, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation (e.g., aerosol), intracerebral, intranasal, oral, intrapulmonary administration, catheter impregnation, and direct injection into tissue. In embodiments where the target cells are in or near a tumor, the preferred route of administration is by direct injection into the tumor or tissue surrounding the tumor.

[0172] Various routes of administration are contemplated for various tumor types. If a separate tumor mass or solid tumor can be identified, various direct, local and regional approaches can be taken. For example, the composition is injected directly into the tumor. The tumor bed can be treated before, during or after resection and / or other treatment. After resection or other treatment, the adenovirus is generally delivered by a catheter that has access to the tumor or residual tumor site after surgery. Methods of treating cancer include treatment of the tumor as well as treatment of the area near or surrounding the tumor. This includes the body cavity in which the tumor resides, as well as cells and tissues adjacent to the tumor.

[0173] In some embodiments, the recombinant Zika viruses described herein may be suitable for systemic delivery.

[0174] In some embodiments, the recombinant Zika viruses described herein may be capable of immune evasion.

[0175] In some embodiments, systemic delivery can include oral administration, parenteral administration, intranasal administration, sublingual administration, rectal administration, transdermal administration, or any combination thereof.

[0176] In some embodiments, parenteral delivery may include intravenous infusion.

[0177] In some embodiments, the recombinant Zika viruses described herein may be suitable for intratumoral delivery.

[0178] In some embodiments, a method of treating cancer can include administering to a subject a therapeutically effective amount of a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, and the method can further include administration of an additional therapy.

[0179] In some embodiments, the additional therapy may include chemotherapy, radiation, oncolytic virotherapy with an additional virus, treatment with an immunomodulatory protein, CAR T cell therapy (chimeric antigen receptor T cell therapy), anti-cancer drugs, or any combination thereof.

[0180] Another aspect of the disclosure provides a method of producing a toxic effect in a cancer cell, the method comprising administering to the cancer cell a therapeutically effective amount of a recombinant Zika virus disclosed herein. In some embodiments, the cancer cell can be present in a subject. In some embodiments, the subject can be in need of a method of producing a toxic effect in a cancer cell.

[0181] Another aspect of the disclosure provides a method of treating cancer in a subject, the method comprising administering a recombinant Zika virus disclosed herein or a pharmaceutical composition comprising the recombinant Zika virus, in combination with a chemotherapeutic prodrug.

[0182] Another aspect of the present disclosure provides a method of treating cancer in a subject, the method comprising: (i) administering a recombinant Zika virus disclosed herein or a pharmaceutical composition comprising the recombinant Zika virus; (ii) assaying viral titer in a first and a second biological sample isolated from the subject, where the first biological sample may comprise cancer cells and the second biological sample may comprise non-cancerous cells; and (iii) if the viral titer is equal to or greater in the second sample than in the first sample, administering a chemotherapeutic prodrug, where administering the chemotherapeutic prodrug results in inhibition of replication of the recombinant Zika virus in the subject.

[0183] Another aspect of the present disclosure provides a method of treating cancer in a subject, the method comprising: (i) administering a recombinant Zika virus described herein or a pharmaceutical composition comprising the recombinant Zika virus; (ii) assaying viral titer in a first and a second biological sample isolated from the subject, where the first biological sample may comprise cancer cells and the second biological sample may comprise non-cancerous cells; and (iii) if the viral titer is equal to or greater in the second sample than in the first sample, administering a chemotherapeutic prodrug, where administering the chemotherapeutic prodrug results in inhibition of replication of the recombinant Zika virus described herein in the subject.

[0184] In some embodiments, a method of treating cancer in a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, where the recombinant Zika virus or pharmaceutical composition may be administered as a bolus injection or a slow infusion.

[0185] In some embodiments, the method of treating cancer in a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need of cancer treatment, where the subject may be a human. In some embodiments, the method of treating cancer in a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need of cancer treatment, where the subject has been diagnosed with cancer prior to administration of the recombinant Zika virus or pharmaceutical composition. In some embodiments, the method of treating cancer in a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need of cancer treatment, where the subject has been diagnosed with cancer prior to administration of the recombinant Zika virus or pharmaceutical composition. In some embodiments, the method of treating cancer in a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, in combination with an additional therapy, to a subject in need of cancer treatment, where the subject has been diagnosed with cancer or a tumor prior to administration of the recombinant Zika virus or pharmaceutical composition or additional therapy. In some embodiments, a method of treating a subject may include administering a recombinant Zika virus disclosed herein, or a pharmaceutical composition disclosed herein, in combination with an additional therapy to a subject in need of treatment for cancer, wherein prior to administration of the recombinant Zika virus or pharmaceutical composition or additional therapy, the subject has been diagnosed with a tumor.

[0186] The present disclosure provides methods for treating a subject by administration of one or more recombinant Zika viruses disclosed herein. "Individual" or "subject", used interchangeably herein, refers to a human or non-human subject. Non-limiting examples of non-human subjects include non-human primates, dogs, cats, mice, rats, guinea pigs, rabbits, pigs, poultry, horses, cows, goats, sheep, whales, and the like. In some embodiments, the subject is a human.

[0187] A method of producing a toxic effect in a cancer cell is provided, comprising administering to the cancer cell a therapeutically effective amount of a recombinant Zika virus described herein or a pharmaceutical composition containing the recombinant Zika virus. The present disclosure further provides a method of inhibiting at least one of the growth and proliferation of a second cancer cell, comprising administering to a first cancer cell the recombinant Zika virus described above, such that the first cancer cell is infected with the virus. Thus, in some embodiments of the method disclosed herein, it is contemplated that administering to a first cancer cell a therapeutically effective amount of a recombinant Zika virus described herein or a pharmaceutical composition containing the recombinant Zika virus may not infect all cancer or tumor cells, and may inhibit the proliferation of non-infected cells without directly infecting them.

[0188] In some examples, cancer cells or tumors may be contacted with a therapeutically effective dose of a recombinant Zika virus or a pharmaceutical composition containing the recombinant Zika virus described herein to induce oncolysis, kill cells, inhibit growth, inhibit metastasis, reduce tumor size, or otherwise reverse or reduce the malignant phenotype of tumor cells using the methods and compositions of the present disclosure. In certain embodiments, an effective amount of a recombinant Zika virus of the present disclosure, such as a recombinant Zika virus or a pharmaceutical composition thereof described herein, may include an amount sufficient to induce oncolysis, destruction or lysis of cancer cells, or inhibition or reduction in the growth or size of cancer cells. Reducing the growth of cancer cells may be indicated, for example, by cell death, a slowing of the rate of replication or growth of tumors containing the cells, or an increased survival time of subjects bearing the cancer cells.

[0189] In some embodiments, a method of treating a subject having cancer or a tumor is provided, comprising administering to the subject an effective amount of the modified virus described above. In such a method, the effective amount may comprise an amount that reduces the growth rate or spread of the cancer or extends the subject's survival time. The present disclosure provides a method of reducing tumor growth, comprising administering to the tumor an effective amount of the recombinant Zika virus described above. In certain embodiments, the effective amount of the modified virus or pharmaceutical composition thereof may comprise an amount sufficient to induce a slowdown, inhibition or reduction in tumor growth or size, including tumor eradication. Reducing tumor growth may be indicated, for example, by a slowdown in growth rate or an extension in the survival time of the subject having the tumor.

[0190] The present disclosure also provides a method of determining the infectivity or anti-tumor activity of a recombinant Zika virus described herein, or the amount of tumor-specific viral replication, comprising: (i) administering to a subject a therapeutically effective amount of a recombinant Zika virus described herein or a pharmaceutical composition according to the present disclosure, which further expresses a luciferase reporter gene, alone or in combination with an additional therapy; (ii) obtaining a first biological sample from the subject immediately after administration of the virus and determining the level of luciferase reporter in the first biological sample; (iii) obtaining a second biological sample from the subject after administration in step (ii); and (iii) detecting the level of luciferase reporter in the second biological sample, wherein the recombinant Zika virus described herein is determined to be infective, indicative of anti-tumor activity, and indicative of tumor-specific viral replication if the level of luciferase is higher in step (iii) than in step (ii). The second biological sample is taken about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 12 hours, about 15 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 1 month, or about 2 months after administration in step (i). In some embodiments, the above method may further comprise detecting one or more assay cytokine levels, e.g., levels of IL-2, IL-7, IL-8, IL-10, IFN-γ, GM-CSF, TNF-α, IL-6, IL-4, IL-5, and IL-13, in a plasma sample taken from the subject after administering to the subject a therapeutically effective amount of a recombinant Zika virus of the present disclosure, such as a recombinant Zika virus described herein or a pharmaceutical composition comprising same. In some embodiments of the present disclosure, the increase in luciferase bioluminescence between steps (ii) and (iv) above is higher for the recombinant Zika virus described herein compared to an otherwise identical virus that does not contain the modification in the recombinant Zika virus.Other exemplary techniques for detecting and monitoring the viral load following administration of a recombinant Zika virus include real-time quantitative PCR.

[0191] Further provided in accordance with the present disclosure are methods for monitoring the pharmacokinetics following administration of a therapeutically effective amount of a recombinant Zika virus described herein, such as a recombinant Zika virus described herein or a pharmaceutical composition containing a Zika virus described herein. An exemplary method for monitoring pharmacokinetics includes the steps of: (i) administering to a subject a therapeutically effective amount of a recombinant Zika virus described herein or a pharmaceutical composition comprising same, alone or in combination with an additional therapy; and (ii) obtaining a biological sample from the subject at one or more time points selected from about 15 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 75 minutes, about 90 minutes, about 120 minutes, about 180 minutes, and about 240 minutes, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 12 hours, about 15 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 1 month, and about 2 months after administration in step (i). (iii) detecting the amount of viral genome (or a reporter gene inserted in the viral genome, such as luciferase) in the biological sample taken at the above time points. In some examples, the viral genome copies / mL may be highest in the sample taken at 15 minutes, and the sample taken at 240 minutes may not contain a detectable amount of viral genome. Thus, in some examples, a viral peak may be observed at about 15 minutes after administration, and the majority of the virus may be cleared from the subject's system after about 240 minutes (or 4 hours). In some cases, a first viral peak may be observed about 15 minutes after administration, and a second viral peak may be observed in the biological sample taken at a subsequent time point, for example, about 30 minutes, about 45 minutes, about 60 minutes, or about 90 minutes. The biological sample may be blood in an exemplary embodiment, and the amount of viral genome / mL may be determined by quantitative PCR or other suitable techniques.In some examples, a first viral peak may be observed about 15 minutes after administration and a second viral peak may be observed about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 12 hours, about 15 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 1 month, or up to about 2 months after administration of a recombinant Zika virus of the present disclosure.

[0192] In some examples, tumor-selective replication of the recombinant Zika virus described herein can be measured by the use of a reporter gene, such as a luciferase gene. In some embodiments, a luciferase gene can be inserted into the genome of the virus and tumor cells can be infected with the virus. Bioluminescence in the infected tumor cells can be measured to monitor tumor-selective replication. Some examples show an increase in luciferase reporter bioluminescence in a recombinant Zika virus of the present disclosure compared to an increase in luciferase reporter bioluminescence in an otherwise identical Zika virus that does not contain the modification in the recombinant Zika virus.

[0193] Manufacturing method The recombinant Zika virus of the present disclosure can be produced by methods known to those skilled in the art. In certain embodiments, the recombinant Zika virus can be grown in suitable host cells, such as HeLa cells, HEK293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells or Vero cells, isolated from the host cells, and stored under conditions that promote viral stability and integrity, thereby minimizing loss of infectivity over time. In certain exemplary methods, the recombinant Zika virus is grown in host cells using cell stacks, roller bottles, or perfusion bioreactors. In some examples, downstream methods for purification of the recombinant Zika virus can include filtration (e.g., depth filtration, tangential flow filtration, or a combination thereof), ultracentrifugation, or chromatographic capture. The recombinant Zika virus can be preserved by freezing or drying, such as, for example, lyophilization. In certain embodiments, prior to administration, the preserved recombinant Zika virus described herein can be reconstituted (if dried for storage) and diluted in a pharma- ceutically acceptable carrier for administration.

[0194] Some embodiments provide that the recombinant Zika viruses described herein exhibit higher titers in HeLa cells, HEK293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells, and Vero cells compared to otherwise identical viruses that do not include modifications in the recombinant Zika viruses. In certain examples, higher titers in HeLa cells, HEK293 cells, Aedes albopictus clone C6 / 36 cells, CHO cells, and Vero cells are seen with the recombinant Zika viruses described herein.

[0195] cancer As used herein, cancer is a class of diseases characterized by uncontrolled cell proliferation. Cancer includes any type of hyperproliferative growth, hyperplastic growth, neoplastic growth, cancerous growth or carcinogenic process, metastatic tissues or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness.

[0196] In some embodiments, the compositions provided herein, when administered to a patient with cancer, prevent and / or attenuate tumor cell growth. In some embodiments, the compositions provided herein, when administered to a patient with cancer, prevent and / or attenuate tumor cell invasion. In some embodiments, the compositions provided herein, when administered to a patient with cancer, prevent and / or attenuate tumor cell metastasis. In some embodiments, the compositions provided herein are oncolytic viruses that include or are derived from Zika viruses. In some embodiments, the compositions provided herein are oncolytic viruses that include recombinant Zika viruses.

[0197] The types of cancer include, but are not limited to, solid tumors at any stage of disease, with or without metastasis, such as tumors of the bladder, intestine, brain, breast, endometrium, heart, kidney, lung, liver, uterus, lymphatic tissue (lymphoma), ovary, pancreas or other endocrine organs (thyroid), prostate, retina, testes, skin (melanoma or basal cell carcinoma), and hematological tumors (such as leukemia and lymphoma). In some embodiments, the cancer comprises a brain tumor. Non-limiting examples of tumors treatable with the compositions provided herein include adenoma, hemangiosarcoma, astrocytoma, epithelial carcinoma, germinoma, glioblastoma, glioma, hamartoma, hemangioendothelioma, hemangiosarcoma, hematoma, hepatoblastoma, leukemia, lymphoma, medulloblastoma, melanoma, neuroblastoma, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma, and teratoma. Gliomas refer to tumors originating from the glia of the brain or spinal cord. Gliomas originate from glial cell types such as astrocytes and oligodendrogliomas, and thus gliomas include astrocytomas and oligodendrogliomas, as well as anaplastic gliomas, glioblastomas, and ependymomas. Additional brain tumors include meningiomas, ependymomas, pineal region tumors, choroid plexus tumors, neuroepithelial tumors, embryonal tumors, peripheral neuroblastomas, tumors of the cranial nerves, tumors of the hemopoietic system, germ cell tumors, and tumors of the sellar region.

[0198] In an embodiment of the present disclosure, a method of treating a hyperproliferative disease, such as cancer or tumor, by delivery of a recombinant Zika virus is contemplated.Cancers that can be treated by the recombinant Zika virus described herein include, but are not limited to, melanoma, hepatocellular carcinoma, breast cancer, lung cancer, peritoneal cancer, prostate cancer, bladder cancer, ovarian cancer, leukemia, lymphoma, renal carcinoma, pancreatic cancer, epithelial cancer, gastric cancer, colon cancer, duodenal cancer, pancreatic adenocarcinoma, mesothelioma, glioblastoma multiforme, astrocytoma, multiple myeloma, prostate cancer, hepatocellular carcinoma, cholangiosarcoma, pancreatic adenocarcinoma, head and neck squamous cell carcinoma, colorectal cancer, intestinal-type gastric adenocarcinoma, cervical squamous cell carcinoma, osteosarcoma, epithelial ovarian cancer, acute lymphoblastic lymphoma, myeloproliferative neoplasms, and sarcomas.

[0199] Cancer cells that may be treated by the methods of the present disclosure include cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal, gingiva, head, kidney, liver, lung, nasopharynx, cervix, ovary, prostate, skin, stomach, testis, tongue, or uterus. Further, the cancer may be specifically classified into the following histological types: neoplasm, malignant, carcinoma, carcinoma, undifferentiated, giant cell carcinoma and spindle cell carcinoma, small cell carcinoma, papillary carcinoma, squamous cell carcinoma, lymphoepithelial carcinoma, basal cell carcinoma, pyromatrix carcinoma, transitional cell carcinoma, papillary transitional cell carcinoma, adenocarcinoma, gastrinoma, malignant, cholangiocarcinoma, hepatocellular carcinoma, combination of hepatocellular carcinoma and cholangiocarcinoma, trabecular adenocarcinoma, adenoid cystic carcinoma, adenocarcinoma in adenomatous polyps, adenocarcinoma, familial polyposis coli, solid tumor, carcinoid tumor, malignant, branchio-alveolar adenocarcinoma, papillary adenocarcinoma, chromophobe carcinoma, eosinophilic carcinoma, oxyphilic adenocarcinoma, eosinophil ... adenocarcinoma, basophilic carcinoma, clear cell adenocarcinoma, granular cell carcinoma, follicular adenocarcinoma, papillary and follicular adenocarcinoma, nonencapsulating sclerosing carcinoma, adrenal cortical carcinoma, endometrial carcinoma, skin adnexal carcinoma, apocrine adenocarcinoma, sebaceous gland carcinoma, ceruminous adenocarcinoma, mucoepidermoid carcinoma, cystadenocarcinoma, papillary cystadenocarcinoma, papillary serous cystadenocarcinoma, mucinous cystadenocarcinoma, mucinous adenocarcinoma, signet ring cell carcinoma, infiltrating duct carcinoma, medullary carcinoma, lobular carcinoma, inflammatory carcinoma, Paget's disease,mammary, acinar cell carcinoma of the pancreas, adenosquamous carcinoma, adenocarcinoma with squamous metaplasia, thymoma, malignant, ovarian stromal tumor, malignant sarcoma, malignant, granulosa cell tumor, malignant male germ cell tumor, malignant, sertoli cell carcinoma, Leydig cell tumor, malignant, lipid cell tumor, malignant, paraganglioma, malignant, extramammary paraganglioma, malignant, pheochromocytoma, angiosarcoma, malignant melanoma, amelanotic melanoma, superficial spreading melanoma, malignant melanoma in giant pigmented nevus, epithelioid cell melanoma, blue nevus, malignant, sarcoma, fibrosarcoma, fibrous histiocytoma, malignant, myxosarcoma, liposarcoma, leiomyosarcoma, rhabdomyosarcoma, embryonal rhabdomyosarcoma, alveolar rhabdomyosarcoma, stromal sarcoma, malignant mixed tumor, müllerian mixed tumor, nephroblastoma, hepatoblastoma, carcinosarcoma, mesenchymoma, malignant, malignant Brenner tumor, phyllodes tumor, malignant, synovial sarcoma, malignant mesothelioma, dysgerminoma, embryonal carcinoma, teratoma, malignant, ovarioma, malignant, choriocarcinoma, mesonephroma, malignant, hemangiosarcoma, hemangioendothelioma, malignant, Kaposi's sarcoma, hemangiopericytoma, malignant, lymphangiosarcoma, osteosarcoma, juxtacortical osteosarcoma, chondrosarcoma, chondroblastoma, malignant mesenchymal chondrosarcoma chondrosarcoma, giant cell tumor of bone, Ewing's sarcoma, odontogenic tumor, malignant, ameloblastic odontosarcoma, ameloblastoma, malignantmalignant, ameloblastic fibrosarcoma, pinealoma, malignant, chordoma, malignant glioma, ependymoma, astrocytoma, protoplasmic astrocytoma, fibrillary astrocytoma, astroblastoma, glioblastoma, oligodendroglioma, oligodendroblastoma, primitive neuroectodermal, cerebellar sarcoma, ganglioneuroblastoma, neuroblastoma, retinoblastoma, olfactory neurogenic tumor, meningioma, malignant, neurofibrosarcoma, neurilemmoma, malignant malignant, malignant granular cell tumor, malignant lymphoma, Hodgkin's disease, Hodgkin, paragranuloma, malignant lymphoma, small lymphocytic, malignant lymphoma, large cell, diffuse, malignant lymphoma, follicular, mycosis fungoides, other certain non-Hodgkin's lymphoma, malignant histiocytosis, multiple myeloma, mast cell sarcoma, immunoproliferative small intestinal disease, leukemia, lymphocytic leukemia, plasma cell leukemia, erythroleukemia, lymphosarcoma cell leukemia, myeloid leukemia, basophilic leukemia, eosinophilic leukemia, monocytic leukemia, mast cell leukemia, megakaryoblastic leukemia, myeloid sarcoma, and hairy cell leukemia. In some cases, solid cancers that are metastatic can be treated with the recombinant Zika virus of the present disclosure, which is advantageous for systemic delivery. In some cases, solid cancers that are inaccessible or difficult to access, such as for the purpose of intratumoral delivery of therapeutic agents, may be treated using the recombinant Zika viruses of the present disclosure that are favorable for systemic delivery. Cancers associated with increased expression of free fatty acids may in some instances be treated using the recombinant Zika viruses of the present disclosure that are favorable for systemic delivery and form increased amounts of EEV.

[0200] The present disclosure also contemplates a method for inhibiting or preventing the local invasiveness or metastasis, or both, of any type of primary cancer. For example, the primary cancer can be melanoma, non-small cell lung, small cell lung, lung, liver cancer, retinoblastoma, astrocytoma, glioblastoma, gum, tongue, leukemia, neuroblastoma, head, neck, breast, pancreas, prostate, kidney, bone, testicular, ovarian, mesothelioma, cervical, gastrointestinal, lymphoma, brain, colon, or bladder. In certain embodiments, the primary cancer can be lung cancer. For example, the lung cancer can be non-small cell lung cancer. Furthermore, the present disclosure can be used to prevent cancer or treat pre-cancer or pre-malignant cells, including metaplasias, dysplasias, and hyperplasias. It may also be used to inhibit unwanted but benign cells such as squamous metaplasia, dysplasia, benign prostate hyperplasia cells, hyperplastic lesions, etc. In some embodiments, the progression to cancer or to more severe forms of cancer may be halted, interrupted or delayed by the disclosed methods including the recombinant Zika viruses discussed herein.

[0201] In some embodiments, the cancer is a brain tumor, a retinal cancer, a testicular cancer, or a prostate cancer. In some specific embodiments, the brain tumor is an astrocytoma, an oligodendroglioma, an ependymoma, a meningioma, a schwannoma, a craniopharyngioma, a germinoma, a pinealocytoma, or a combination thereof.

[0202] Medication and Treatment Regimens The frequency of administration of pharmaceutical compositions containing a recombinant Zika virus provided herein can vary based on the method being performed, the physical characteristics of the subject, the severity of the cancer, the type of cancer, and the formulation and means used to administer the composition.

[0203] The duration of treatment can be determined by the attending physician based on the condition being treated. The duration of administration often varies depending on several factors. Exemplary factors include, but are not limited to, the patient's response, the severity of symptoms, and the type of cancer. Under some conditions, treatment continues for several days, weeks, or months. Under other conditions, complete treatment is achieved by administering one, two, or three doses of the pharmaceutical composition over the entire course of treatment. In certain embodiments, complete treatment can be achieved with a single dose of the pharmaceutical composition.

[0204] In certain embodiments in which a patient's condition improves, the dose of a recombinant Zika virus or pharmaceutical composition thereof described herein administered may be temporarily reduced or temporarily suspended (i.e., a "drug holiday") for a specific period of time.

[0205] In certain embodiments, the dose of the composition administered is temporarily reduced or temporarily suspended for a particular period of time (ie, "drug diversion").

[0206] In some embodiments, once improvement of the patient's condition has occurred, a maintenance dose is administered as needed. Thereafter, in certain embodiments, the dose or frequency of administration, or both, is reduced as a function of symptoms to a level at which improvement of the disease, disorder, or condition is maintained. However, in certain embodiments, the patient requires intermittent treatment on a long-term basis upon recurrence of symptoms.

[0207] The amount of recombinant Zika virus provided herein will vary depending on factors such as the particular virus, the disease state and its severity, the identity of the subject requiring treatment (e.g., weight, sex), etc., but may nevertheless be determined according to the particular circumstances surrounding the case. In some embodiments, the desired dose is conveniently presented in a single dose or in divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, e.g., as two, three, four or more subdoses per day.

[0208] In some embodiments, administration of the recombinant Zika virus provided herein is titer dependent, and the titer of the recombinant Zika virus is about 10 5 PFU / mL~about 10 10 PFU / mL.

[0209] In some embodiments, the amount of recombinant Zika virus of the present disclosure administered to a subject can be about 103 to 1012 infectious viral particles or plaque*forming units (PFU).

[0210] In some embodiments, the recombinant Zika virus of the disclosure comprises from about 10 viral particles / dose to about 10 14 It may be administered in a dose that may contain viral particles / dose.

[0211] In some embodiments, the recombinant Zika virus of the present disclosure is capable of infecting about 10 PFU / kg to about 10 14 It may be administered in a dose that may contain PFU / kg.

[0212] In some embodiments, the recombinant Zika virus of the present disclosure is capable of producing about 10 viral particles / kg to about 10 14 It may be administered in a dose that may contain viral particles / kg.

[0213] Pharmaceutical Compositions and Formulations Provided herein is a recombinant Zika virus formulated into a pharmaceutical composition. The pharmaceutical composition is formulated in a conventional manner using one or more pharma- ceutical acceptable inactive ingredients that facilitate the processing of the active agent into a medicament that can be used medicament. A summary of the pharmaceutical compositions described herein can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins, 1999), which are incorporated herein by reference for such disclosure. For some virus delivery methods, the pharma- ceutically acceptable vehicle should be selected from known pharma- ceutically acceptable vehicles for delivery and one in which the virus is stable.

[0214] Further provided herein are pharmaceutical compositions that include pharma- ceutically acceptable inactive ingredients, other medicinal or pharmaceutical agents, carriers, adjuvants, preservatives, stabilizers, wetting agents, or emulsifiers, solution promoters, salts, buffers, excipients, binders, fillers, suspending agents, flavoring agents, sweetening agents, disintegration agents, dispersing agents, surfactants, lubricants, coloring agents, diluents, solubilizers, wetting agents, plasticizers, permeation enhancers, antifoaming agents, antioxidants, preservatives, or combinations thereof.

[0215] Another aspect of the present disclosure provides a pharmaceutical composition comprising a recombinant Zika virus as described herein. In some embodiments, the pharmaceutical composition may include a solubilizer and an excipient. In some embodiments, the excipient may include one or more of a buffer, a stabilizer, an antioxidant, a binder, a diluent, a dispersant, a rate controlling agent, a lubricant, a glidant, a disintegrant, a plasticizer, a preservative, or any combination thereof. In some embodiments, the excipient may include disodium hydrogen phosphate dihydrate, sodium dihydrogen phosphate dihydrate, sodium chloride, myo-inositol, sorbitol, or any combination thereof. In some embodiments, the pharmaceutical composition does not include a preservative. In some embodiments, the pharmaceutical composition may include one or more of a preservative, a diluent, and a carrier. In some embodiments, the pharmaceutical composition may include an additional active ingredient or a salt thereof. In some embodiments, the solubilizer may be sterile water. In some embodiments, the pharmaceutical composition may include an additional active ingredient, which may be an additional oncolytic virus.

[0216] Another aspect of the present disclosure provides a method of enhancing the therapeutic effect of an oncolytic virus upon systemic delivery of the virus to a subject, the method comprising systemic administration of a recombinant Zika virus disclosed herein, a recombinant Zika virus described herein, or a pharmaceutical composition disclosed herein.

[0217] The pharmaceutical compositions containing the modified virus, which is a recombinant Zika virus described herein, can be prepared as a solution, a dispersion in glycerol, liquid polyethylene glycol, in oil, in a solid dosage form, as an inhalable dosage form, as an intranasal dosage form, as a liposomal formulation, as a dosage form containing nanoparticles, as a dosage form containing microparticles, as a polymeric dosage form, or any combination thereof. In some embodiments, the pharmaceutical compositions described herein can include stabilizers and buffers. In some embodiments, the pharmaceutical compositions described herein can include solubilizing agents such as sterile water, Tris buffer, etc. In some embodiments, the pharmaceutical compositions described herein can include excipients. The excipients can be those excipients described in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986). Non-limiting examples of suitable excipients can include buffers, preservatives, stabilizers, binders, compression agents, lubricants, chelating agents, dispersion enhancers, disintegrants, flavoring agents, sweetening agents, and coloring agents.

[0218] In some embodiments, the excipient may be a buffering agent. In some embodiments, the excipient may include a preservative. Non-limiting examples of suitable preservatives may include antioxidants and antimicrobial agents. In some embodiments, the pharmaceutical compositions described herein may include a binder as an excipient. In some embodiments, the pharmaceutical compositions described herein may include a lubricant as an excipient. In some embodiments, the pharmaceutical formulation may include a dispersion enhancer as an excipient. In some embodiments, the pharmaceutical compositions described herein may include a disintegrant as an excipient. In some examples, the pharmaceutical compositions described herein may include a chelating agent.

[0219] Also contemplated are combination products comprising one or more of the recombinant Zika viruses described herein.

[0220] Under normal conditions of storage and use, the pharmaceutical compositions described herein may contain a preservative to prevent the growth of microorganisms. In certain instances, the pharmaceutical compositions described herein may be free of preservatives. Pharmaceutical forms suitable for injectable use may include sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Prevention of the action of microorganisms may be brought about by various antibacterial and antifungal agents.

[0221] For parenteral administration in aqueous solution, for example, the liquid dosage form may be suitably buffered as necessary, and the liquid diluent may be made isotonic with sufficient saline or glucose. The liquid dosage form is particularly suitable for intravenous, intramuscular, subcutaneous, intratumoral, and intraperitoneal administration. In this regard, the sterile aqueous medium that may be used will be known to those skilled in the art in light of the present disclosure. For example, one dose may be dissolved in 1 mL to 20 mL of isotonic NaCl solution, added to 100 mL to 1000 mL of fluid, such as sodium bicarbonate buffered saline, or injected into the proposed injection site.

[0222] In certain embodiments, a sterile injectable solution can be prepared by incorporating a recombinant Zika virus according to the present disclosure, a recombinant Zika virus described herein, or a pharmaceutical composition containing the recombinant Zika virus in the required amount in an appropriate solvent with various other ingredients as enumerated above, as needed, followed by filtered sterilization. In general, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. The compositions disclosed herein can be formulated in neutral or salt forms. When formulated, the pharmaceutical compositions can be administered in a manner compatible with the dosage formulation, and in an amount that is therapeutically effective.

[0223] In certain embodiments, the pharmaceutical composition of the present disclosure may include an effective amount of the recombinant virus disclosed herein in combination with a pharma- ceutically acceptable carrier. "Pharmaceutically acceptable" as used herein includes any carrier that does not interfere with the effectiveness of the biological activity of the active ingredient and / or is not toxic to the patient to whom it is administered. Non-limiting examples of suitable pharmaceutical carriers include phosphate buffered saline, emulsions such as oil / water emulsions, various types of wetting agents, and sterile solutions. Further non-limiting examples of pharma- ceutically compatible carriers may include gels, bioabsorbable matrix materials, implantable elements containing the recombinant Zika virus, or any other suitable vehicle, delivery or distribution means or material. Such carriers may be formulated by conventional methods and administered to a subject in an effective amount.

[0224] kit In one aspect of the disclosure, provided herein is a kit that includes one or more reagents or devices for carrying out the methods disclosed herein. In some embodiments, the kit includes a recombinant Zika virus provided herein. In some embodiments, the kit includes a means for administering the recombinant Zika virus provided herein.

[0225] In some embodiments, the kit includes suitable instructions for carrying out the method of the kit. The instructions may provide information for carrying out any of the methods disclosed herein, regardless of whether the method can be carried out using only the reagents provided in the kit. The kits and instructions may require additional reagents or systems.

[0226] Kits and articles of manufacture are also described herein for use in the therapeutic applications described herein. In some embodiments, such kits include carriers, packages, or containers that are compartmentalized to receive one or more containers, such as vials, tubes, each of which contains one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials, such as glass or plastic. The articles of manufacture provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material suitable for the selected formulation and intended mode of administration and treatment. The containers optionally have a sterile access port (e.g., the container is an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). Such kits optionally include the composition and a dentifying description or label or instructions regarding its use in the methods described herein.

[0227] The kit will typically include one or more additional containers, each containing one or more of a variety of materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of the recombinant Zika viruses described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes, carriers, packaging, containers, vial and / or tube labels listing contents and / or instructions for use, and package inserts containing instructions for use. Typically, a set of instructions will also be included.

[0228] In some embodiments, the label is on or attached to the container. The label may be on the container when letters, numbers or other characters forming the label are attached, molded or etched onto the container itself; the label may be attached to the container when present within a receptacle or carrier that holds the container, e.g., as a package insert. The label may be used to indicate that the contents are to be used for a particular therapeutic application. The label may also indicate instructions for use of the contents, such as in the methods described herein.

[0229] In certain embodiments, pharmaceutical compositions comprising a recombinant Zika virus provided herein and any additional active agent are provided in a pack or dispenser device that can contain one or more unit dosage forms. The pack can comprise metal or plastic foil, such as, for example, a blister pack. The pack or dispenser device can be accompanied by instructions for administration. The pack or dispenser can also bear a notice associated with the container in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects approval by the government agency of the drug form for human or veterinary administration. Such notice can be, for example, a label approved for prescription drugs by the US Food and Drug Administration, or an approved product insert. Compositions containing a recombinant Zika virus described herein formulated in a compatible pharmaceutical carrier can also be prepared, placed in an appropriate container, and labeled for treatment of an indicated disease.

[0230] Non-Limiting Numbered Embodiments (1) A method for treating cancer, comprising administering a recombinant Zika virus to a subject in need of cancer treatment. (2) The method of embodiment 1, wherein the recombinant Zika virus produces a higher level of subgenomic flavivirus RNA (sfRNA) in the cancer cells of the subject than wild-type Zika virus. (3) The method of embodiment 1, wherein the higher level of sfRNA is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% higher. (4) The method of embodiment 1-3, wherein the cancer is brain cancer, retinal cancer, testicular cancer, breast cancer, or prostate cancer. (5) The method of embodiment 4, wherein the brain tumor is astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germinoma, pinealocytoma, or a combination thereof. (6) The method of any one of the preceding claims, wherein the recombinant Zika virus is produced from a nucleic acid composition comprising a polynucleotide encoding Zika virus capsid protein ancC / C or a derivative of Zika virus ancC / , a polynucleotide encoding Zika virus membrane protein (prM / M) or a derivative of Zika virus prM / M, a polynucleotide encoding Zika virus envelope protein E or a derivative of Zika virus E, or any combination thereof. (7) The method of any one of the preceding claims, wherein the nucleic acid composition comprises a polynucleotide encoding Zika virus ancC / C or a derivative of Zika virus ancC / C, a polynucleotide encoding Zika virus prM / M or a derivative of Zika virus prM / M, and a polynucleotide encoding Zika virus E or a derivative of Zika virus E. (8) The method of embodiment 7, wherein the polynucleotide encoding the Zika virus ancC / C or a derivative of Zika virus ancC / C, the polynucleotide encoding the Zika virus prM / M or a derivative of Zika virus prM / M, and the polynucleotide encoding the Zika virus E or a derivative of Zika virus E are expressed on one or more separate nucleic acids.(9) The method of any one of embodiments 6 to 8, wherein the polynucleotide encoding the derivative of Zika virus ancC / C comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus ancC / C. (10) The method of embodiment 9, wherein the Zika virus ancC / C or the derivative of Zika virus ancC / C comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence in Table 1. (11) The method of any one of embodiments 6 to 8, wherein the polynucleotide encoding the derivative of Zika virus prM / M comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus prM / M. (12) The method of embodiment 11, wherein the Zika virus prM / M or a derivative of Zika virus prM / M comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 2. (13) The method of any one of embodiments 6 to 8, wherein the polynucleotide encoding the derivative of Zika virus E comprises at least one substitution, at least one deletion, and / or at least one insertion compared to wild-type Zika virus E. (14) The method of embodiment 13, wherein the polynucleotide encoding E is translated into wild-type Zika virus E. (15) The method of embodiment 13 or 14, wherein the Zika virus E or derivative of Zika virus E comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 3. (16) The method of embodiment 6 to 15, wherein the nucleic acid composition further comprises a 5' untranslated region (5'UTR) of Zika virus. (17) The method of embodiment 6 to 16, wherein the nucleic acid composition further comprises a 3' untranslated region (3'UTR) of Zika virus.(18) The method of any one of embodiments 6 to 17, wherein the nucleic acid composition does not include a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i) to (vii). (19) The method of any one of embodiments 6 to 17, wherein the nucleic acid composition includes a polynucleotide encoding one or more nonstructural (NS) proteins selected from (i) NS1, (ii) NS2A, (iii) NS2B, (iv) NS3, (v) NS4A, (vi) NS4B, (vii) NS5, or (viii) two or more of (i) to (vii). (20) The method of one of embodiments 18-19, wherein NS1 is Zika virus NS1, NS2A is Zika virus NS2A, NS2B is Zika virus NS2B, NS3 is Zika virus NS3, NS4A is Zika virus NS4A, NS4B is Zika virus NS4B, or NS5 is Zika virus NS5, or any combination of two or more thereof. (21) The method of one of embodiments 6-20, wherein the components of the nucleic acid composition include African Zika virus components, Asian Zika virus components, or Brazilian Zika virus components, or combinations thereof. (22) The method of embodiment 21, wherein the Zika virus is African MR766 strain. (23) The method of one of embodiments 6-22, wherein the components of the nucleic acid composition are expressed on one or more separate nucleic acids. (24) The method of one of embodiments 6-23, wherein the nucleic acid further comprises in operable linkage one or more expression control elements that confer expression of the nucleic acid composition in vitro or in vivo. (25) The method of embodiment 24, wherein the expression control element is a promoter driving the expression of the nucleic acid composition in vitro. (26) The method of embodiment 25, wherein the promoter is T7, T3, SP6 or any phage promoter. (27) The method of embodiment 24, wherein the expression control element is a promoter driving the expression of the nucleic acid composition in a target cell. (28) The method of embodiment 27, wherein the promoter is CMV, SV40 or any eukaryotic promoter.(29) The method of embodiment 27, wherein the target cell is a neuron, or a non-neuronal cell, Vero, CHLA, COS, CHO, C6 / 36, HeLa, HEK, or HepG2. (30) The method of embodiment 27, wherein the target cell is an oligodendrocyte, a microglia, or an astrocyte. (31) The method of any one of embodiments 6 to 30, wherein the recombinant Zika virus is generated from expressing the nucleic acid composition described herein in a producer cell, and the producer cell is further infected with a second Zika virus such that Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus. (32) The method of embodiment 31, wherein the second Zika virus is a wild-type Zika virus. (33) The method of embodiment 32, wherein the wild-type Zika virus is an African, Asian, or Brazilian strain. (34) The method of embodiment 31, wherein the second Zika virus is a modified Zika virus. (35) The method of embodiment 34, wherein the modified Zika virus comprises one or more microRNA-based gene silencing mechanisms. (36) The one or more microRNA-based gene silencing mechanisms control viral replication. The method of embodiment 35. (37) The method of one of embodiments 6-30, wherein the recombinant Zika virus is generated from expressing the nucleic acid composition in a producer cell without infection with a second Zika virus, wherein Zika virus C or a derivative of Zika virus C, Zika virus prM / M or a derivative of Zika virus prM / M, and Zika virus E or a derivative of Zika virus E are present in the recombinant Zika virus or Zika virus-like particle. (38) The method of one of embodiments 31-37, wherein the producer cell is a Vero E6 or C6 / 36 cell. (39) The method of one of embodiments 6-38, wherein the recombinant Zika virus is replication-competent. (40) The method of any one of embodiments 6 to 38, wherein the recombinant Zika virus is replication-incompetent without reducing vector titer or inhibiting expression of the exogenous polynucleotide.(41) The method of any one of embodiments 6 to 40, wherein the recombinant Zika virus has reduced insertional mutagenesis. (42) The method of any one of embodiments 6 to 41, wherein the recombinant Zika virus has reduced immune response. (43) The method of embodiment 2, wherein the recombinant Zika virus produces a higher level of subgenomic flavivirus RNA (sfRNA) in the cancer cells of the subject than wild-type Zika virus due to the presence of a microRNA (miRNA) of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or a combination thereof. (44) The method of any one of embodiments 1 to 43, wherein the recombinant Zika virus comprises an exogenous polynucleotide. (45) The method of embodiment 44, wherein the exogenous polynucleotide anneals to a miRNA present in the subject. (46) The method of embodiment 45, wherein the miRNA is present in a non-cancerous cell of the subject. (47) The method of embodiment 45 or embodiment 46, wherein the miRNA is selected from Table 6B. (48) The method of any one of embodiments 45-47, wherein the exogenous polynucleotide is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence in Table 6A. (49) The method of any one of embodiments 45-47, wherein the exogenous polynucleotide comprises a sequence, which is at least 70% identical to a complementary sequence of a miRNA sequence in Table 6B. (50) The method of any one of embodiments 44-49, wherein the Zika virus comprises a nucleic acid encoding a 2k protein, and the exogenous polynucleotide is located within the nucleic acid encoding the 2k protein. (51) The method of any one of embodiments 6 to 49, wherein the Zika virus comprises a 5'UTR and a sequence encoding one or more structural proteins, and the exogenous polynucleotide is located between the 5'UTR and the sequence encoding one or more structural proteins. (52) The method of any one of embodiments 44 to 49, wherein the Zika virus comprises a 5'UTR and the exogenous polynucleotide is located downstream of the 5'UTR.(53) The method of any one of embodiments 44 to 49, wherein the Zika virus comprises a 3'UTR and a sequence encoding one or more nonstructural proteins, and the exogenous polynucleotide is located between the 3'UTR and the sequence encoding one or more structural proteins. (54) The method of any one of embodiments 44 to 49, wherein the Zika virus comprises a 3'UTR and the exogenous polynucleotide is located upstream of the 5'UTR. (55) The method of embodiment 54, wherein the exogenous polynucleotide is located between the coding region of a wild-type Zika virus and the 3'UTR. (56) The method according to any one of embodiments 16 to 55, wherein the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 6 or SEQ ID NO: 239. (57) The method according to any one of embodiments 17 to 55, wherein the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NO: 7, SEQ ID NO: 241 or SEQ ID NO: 244. (58) The method of any one of embodiments 44 to 55, wherein the sequence encoding one or more nonstructural proteins comprises a sequence at least 70% identical to any one of SEQ ID NO: 240, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 248, or SEQ ID NO: 249. (59) The method of any one of embodiments 44 to 55, wherein the Zika virus further comprises a non-coding region. (60) The method of embodiment 59, wherein the non-coding region comprises a sequence at least 70% identical to any one of SEQ ID NO: 238, SEQ ID NO: 242, SEQ ID NO: 246, or ACTGAT. (61) The method of any one of embodiments 44 to 60, wherein the Zika virus further comprises at least one ribozyme. (62) The method of embodiment 60, wherein the at least one ribozyme comprises hammerhead, HDV, or a combination thereof. (63) The method of embodiment 44, wherein the recombinant Zika virus comprises at least one copy of the exogenous polynucleotide. (64) The method of any one of embodiments 1 to 63, wherein the step of administering to a subject in need thereof comprises introducing the recombinant Zika virus via intracerebroventricular injection; (65) The method of any one of embodiments 1 to 63, wherein the subject is a mammal. EXAMPLES

[0231] Example 1: Design and generation of recombinant Zika virus particles Recombinant Zika virus genome was cloned into a plasmid. Viral RNA was produced by in vitro transcription. Viral RNA was transfected into Vero cells. Recombinant Zika virus was produced and released into the culture supernatant. As shown in Figure 4A and Figure 4B, recombinant Zika virus derived from in vitro transcription and Vero cell transfection maintained its oncolytic effect in medulloblastoma cell lines 48 hours after infection. An example of engineered Zika virus was generated from a Brazilian Zika virus strain. Viral RNA was designed according to genome sequences deposited in the MH882527.1 (ZIKV-17) and KU365780.1 (ZIKV-IEC) databases. ZIKV viral genome containing 10,806 base pairs was obtained through a DNA synthesis service (GenScript). In addition to the complete ZIKV genome, the virus was designed to contain the following additional items to increase the efficiency of the modified virus generation process: (a) a hammerhead ribozyme upstream of the 5'UTR, (b) an HDV ribozyme downstream of the 3'UTR, and (c) a T7 promoter: Figure 1A is an exemplary schematic of this construct, which was cloned into the bacmid pCC1, totaling 21.8 kb.

[0232] The T7 promoter allows in vitro transcription (RNA synthesis in a tube) from plasmid DNA. This method was thought to increase the quality of the final product by avoiding possible viral mutations and attenuation after successive infections. Another eukaryotic promoter, CMV, was also considered in the genetic engineering strategy to increase the RNA production efficiency during in vitro transcription. In this way, the production of active virus concentrates is performed from the in vitro transcription of a linearized plasmid and the transfection (insertion) of this RNA into Vero cells or another lineage of interest.

[0233] When the ribozyme is transfected (inserted) into a cell, it allows the automatic cleavage of the viral RNA, automatically releasing the ZIKV RNA. When the viral RNA comes into contact with the host cell's translation machinery, a polyprotein is produced, which is cleaved to produce structural proteins that become part of the viral particle, and non-structural proteins that are involved in genome viral replication.

[0234] After replication, encapsidation occurs and modified and active Zika virus is released. The efficiency of this process is first confirmed by the clear observation of a cytopathic effect (destruction or damage of cells, confirming the presence of viral activity). Analysis of the presence of Zika NS1 protein is also performed by a chromatographic test. Other analytical tests are then performed, such as titration of active viral particles (PFU) and copies of viral RNA (RT-qPCR).

[0235] Genetically engineered (or recombinant) viruses have also been designed to allow for the insertion of exogenous sequences into the virus without altering the oncolytic capabilities of the virus. Exemplary viruses are shown in Figures 1B-1D, where exogenous nucleotides are inserted into the coding region of the 2k protein (Figure 1B), after the 5'UTR but before the coding sequence (Figure 1C), and before the 3'UTR but after the coding sequence (Figure 1D).

[0236] Figures 1E-1G provide exemplary schematics of engineered viruses with exogenous polynucleotides located within the 2k coding sequence and before the 3'UTR (Figure 1G). Figure 3A provides an example of the design of miRNA target insert sequences and restriction sites for miR-219a-2-3p in three exemplary modification regions (2k, 5'UTR, and 3'UTR). Additional miRNA targets were also tested for miR-219a-5p, miR-129-5p, miR-1225-5p, and miR-377-p, respectively, as shown in Figures 3B-3E.

[0237] An initial set of miRNAs of interest were identified according to their expression levels in different patient tissues, and the initial miRNA sequences are shown in Tables 6A-6B. The miRNAs were inserted into reporter plasmids and expression analysis was performed in seven glioblastoma cell lines (A172, C343, HCB151, U138, U251, U87, LN18), five CNS embryonal tumor cell lines (medulloblastoma: HDM03, Daoy, P13, ATRT: CHLA06 and P7), three normal human lines (mesenchymal: M12 and M10; neural progenitor cells: NPC), and Vero cells, the kidney epithelial cells from African green monkeys used to produce the modified viruses. As shown in Figures 2A-2F, the expression levels of each miRNA using TaqMan RT-qPCR in various tumor cell lines show the survival rates of targets miR-219a-2-3p, miR-219a-5p, miR-129-5p, and miR-377-3p (Table 6A), which have target sequences in recombinant Zika virus. The target sequences of these four miRNAs were then inserted into a model plasmid. miR-1225-5p was included as a negative control. Further details are provided in Example 3.

[0238] [Table 7]

[0239] [Table 8-1]

[0240] [Table 8-2]

[0241] [Table 8-3]

[0242] [Table 8-4]

[0243] Example 2: Oncolytic effects in medulloblastoma and glioblastoma cells after infection with recombinant Zika virus particles The oncolytic effect was evaluated in both glioblastoma and medulloblastoma cell lines in vitro. Briefly, the cell viability of medulloblastoma and glioblastoma cell lines U138MG, U251MG, U343MG, ONS-76, Daoy with or without recombinant Zika virus particles was measured by cell proliferation kinetics assay using xCELLigence Real-Time cell system (Agilent). As shown in Figure 5A, the viability of glioblastoma cells (U138MG, U251MG and U343MG cell lines) and medulloblastoma cells (ONS-76 and Daoy cell lines) was inhibited after recombinant Zika virus infection at MOI2 when compared to the control (CT). As shown in Figure 5B, infection with recombinant Zika virus (oZIKV-0p) induced a higher oncolytic effect in Daoy medulloblastoma cell line when compared to African wild-type Zika virus infection.

[0244] Example 3. Oncolytic effect of recombinant Zika particles Confirmation of inhibition of RNA replication and translation following insertion of miRNA sequences

[0245] Model assays were performed to confirm the inhibition of RNA replication and translation after insertion of the miRNA target sequence. These assays used a small reporter plasmid instead of the entire ZIKV genome, which is a model system for the ZIKV genome for previous studies of modifying viruses containing the entire ZIKV genome. The modified region containing the miRNA target sequence was inserted using a reporter plasmid containing several structures of ZIKV (5'UTR, Capsid, 3'UTR) (Figure 6).

[0246] After selecting the desired miRNA sequences for the assay, plasmid constructs carrying recombinant Zika virus proteins were synthesized. Figure 6 shows a representative construct of a replicon plasmid (pRep) carrying parts of the ZIKV genome (NS4B, 2k, NS4A) and a reporter sequence (NanoLuciferase, or "NanoLuc"). A BswiI site was introduced into pRep to replace HA (hemagglutinin), which was done by fusion PCR (overlap extension PCR). The region between the T7 promoter and HA (middle of the 2k region), as well as the 3'UTR, were amplified. No unique restriction sites existed within this region, so an amplicon (2.2 kb) was required. High-fidelity Taq polymerase was used to minimize mutations. In this vector, targets were directly cloned. For each target sequence, a pair of oligos was designed that partially complemented each other to reconstruct the target sequence (miRNA seed) and the cleaved restriction site. The resulting constructs are shown in Table 7. The integration of the miRNA target (or seed) insert was confirmed by sequencing. Some plasmids showed more than one copy of the insert of interest. All mutations were tested in cells to evaluate the relationship between the copy number present in the plasmid and the regulatory effect of the miRNA.

[0247] [Table 9]

[0248] After generating the plasmid containing the target sequence, transfection was performed in Vero and CHLA cells to observe the inhibition of plasmid expression via the NanoLuc reporter gene. To confirm the inhibitory effect of the inserted sequence and observe the reversal of the effect, as shown in Figures 7 and 8, miRNA expression modulation (overexpression and inhibition of endogenous miRNA) was performed. Translation-silenced clones were detected in Vero (1d / 1c) and CHLA06 (4c), indicating that some sequences may silence the entire ZIKV genome (pCC1_clone), since mimentic miRNAs could indeed inhibit NanoLuc translation by pairing with the inserted target sequence (Figures 7 and 8). Furthermore, absolute silencing in clone 1c was observed, since the luminescence difference was not significant compared to the baseline of non-transfected cells (Figure 7). Thus, the 1c clone showed approximately 100% efficiency.

[0249] In the CHLA-06-ATRT tumor cell line, transfection of a control miRNA altered the translation of NanoLuc even in the empty pRep, preventing analysis of the results, but comparison of NanoLuc translation after miRNA overexpression with the miRNA control shows upregulation in all clones (Figure 8).

[0250] To confirm its efficiency, a second assay was performed on CHLA-06-ATRT with transfection of miRNA inhibitors. The aim was to inhibit endogenous miRNAs in cells and thus observe increased NanoLuc translation. As shown in Figure 8, inhibition of endogenous miRNAs had the effect of increasing NanoLuc translation when compared to the control. Thus, the effect of inhibiting miR-129-5p target sequence was confirmed. Among the miR-129-5p clones (1c and 1e), the one with the strongest regulatory effect was 1c, which had only one copy of the target sequence.

[0251] Generating several oZIKV candidates

[0252] A representative plasmid containing the ZIKV genome, ribozyme, and T7 promoter in 2000 base pairs of the 5'UTR was created that has the entire ZIKV genome in a low copy plasmid (PCC1-ZIKVBR). The miRNA target was inserted into the 5'UTR region of the different plasmids using the BsiWI site (Figure 10), a combination of BsiWI and XhoI (Figure 11), and the AarI site (Figure 12). Different pCC1-ZIKV constructs were synthesized with at least the T7 promoter, hammerhead ribozyme, miRNA target insert, a region of the ZIKV genome (whole or part), and the 3'UTR. The constructs are generally shown in Table 8. Figure 13 is a representative image of plasmid 013 (Table 8) with the entire ZIKV genome, a ribozyme at its end, an 800 base pair T7 promoter from the 5'UTR, and modifications inserted into the 2k region. Figure 14 is a representative image of plasmid 014 with the entire ZIKV genome, a ribozyme at its end, an 800 base pair T7 promoter from the 5'UTR, and modifications inserted into the 3'UTR. Figure 15 is a representative image of plasmid 017 with the entire ZIKV genome, a ribozyme at its end, a T7 promoter next to the 5'UTR, and modifications inserted into the 5'UTR.

[0253] [Table 10]

[0254] [Table 11-1]

[0255] [Table 11-2]

[0256] [Table 12-1]

[0257]

Table 12-2

[0258]

Table 12-3

[0259]

Table 12-4

[0260]

Table 12-5

[0261]

Table 12-6

[0262]

Table 12-7

[0263]

Table 12-8

[0264]

Table 12-9

[0265]

Table 12-10

[0266]

Table 12-11

[0267]

Table 12-12

[0268]

Table 12-13

[0269]

Table 12-14

[0270]

Table 12-15

[0271]

Table 12-16

[0272]

Table 12-17

[0273]

Table 12-18

[0274]

Table 12-19

[0275]

Table 12-20

[0276]

Table 12-21

[0277]

Table 12-22

[0278]

Table 12-23

[0279]

Table 12-24

[0280]

Table 12-25

[0281]

Table 12-26

[0282]

Table 12-27

[0283]

Table 12-28

[0284]

Table 12-29

[0285]

Table 12-30

[0286]

Table 12-31

[0287]

Table 12-32

[0288]

Table 12-33

[0289]

Table 12-34

[0290]

Table 12-35

[0291]

Table 12-36

[0292]

Table 12-37

[0293]

Table 12-38

[0294]

Table 12-39

[0295]

Table 12-40

[0296]

Table 12-41

[0297]

Table 12-42

[0298]

Table 12-43

[0299]

Table 12-44

[0300]

Table 12-45

[0301]

Table 12-46

[0302]

Table 12-47

[0303]

Table 12-48

[0304]

Table 12-49

[0305]

Table 12-50

[0306]

Table 12-51

[0307] [Table 12-52]

[0308] [Table 12-53]

[0309] [Table 12-54]

[0310] Viral RNA was produced by in vitro transcription. Viral RNA was transfected into Vero cells via electroporation according to the scheme in Figure 4A. Recombinant Zika virus was produced and released into the culture supernatant. RNA transcripts produced and released into the supernatant were analyzed and visualized using RNA electrophoresis. Analysis was performed using the T7-HIGH kit (New England), and samples were pretreated with DNase and HiScribe* T7 ARCA mRNA kit (with tailing, ThermoFisher) as shown in Figure 16. RT-qPCR was performed to compare the amount of ZIKV genome viral copies produced at various time intervals, as shown in Figure 17. The amount of ZIKV copies / μL in the cell pellet and the supernatant was compared. The amount of ZIKV copies / μL in the Vero cell pellet was quantified 24 hours, 48 ​​hours, 72 hours, and 96 hours after transfection. The amount of ZIKV copies in the supernatant was quantified 24 hours and 72 hours after transfection. Total RNA (start (black) and end (grey)) was observed in the culture supernatant.

[0311] Viral RNA transfection was performed using Lipofectamine (CMV promoter) in combination with electroporation, with initial RNA amounts ranging from about 10 μg to about 35 μg. After virus concentration, the cultures were reinfected into additional T25s, allowing the observation of virus production (Figure 18).

[0312] As shown in Figure 18, Vero cells transfected with modified ZIKV RNA were observed at 1, 4, 5, and 6 days post-infection (DPI). Images marked with (*) show obvious cytotoxic effects of ZIKV RNA on the cell population. Cells transfected with samples TI_15 (pCC1-ZIKV-3P-T7), TI_16 (pCC1-ZIKV-0P-T7), TI_17 (pCC1-ZIKV-2P-T7), and TI_18 (pCC1-ZIKV-3P-T7) showed cell death after 5 DPI, whereas cells transfected with TI_14 showed cell death after 6 DPI. During the course of establishing the in vitro transcription protocol, 24 RNA products were produced. All the produced RNAs were transfected, resulting in the production of eight modified viruses so far. Figure 18 shows the course of virus production compared to the negative control. For all RNAs tested (TI_14, TI_15, TI_16, TI_17, TI_18), it was possible to observe a cytopathic effect (production of infectious virus) four days after reinfection.

[0313] To confirm the presence of the virus, a chromatography test was used to identify the ZIKV NS1 protein in the culture supernatant. As shown in Figure 19, two positive bars (one control "C" and one test "T") indicated the presence of ZIKV in the supernatant.

[0314] Oncolytic effect and safety in normal cells

[0315] Viral safety was tested in neural progenitor cells (NPCs) derived from iPS human cells. A Go / No-go phenotypic test using tumor cell lines to examine oncolytic effects was used to determine viral safety. After tumor and non-tumor virus infection, supernatant samples were collected and viral replication was assessed by quantifying RNA copy amount using RT-qPCR, and Virus Spread by Plaque Assay (PFU) was performed to quantify infectious viral load. The results are shown in Tables 10 and 11.

[0316] [Table 13] Different recombinant Zika virus constructs and their effect on cell titers

[0317] [Table 14]

[0318] Oncolytic effect – tumor cell lines

[0319] Cell viability tests were performed to confirm the oncolytic effect of the eight modified viruses. After viral infection of the tumor cell line CHLA-06-ATRT, cells were tested 3 DPI (Figure 20A) and 5 DPI (Figure 20B). Figure 20A shows the results of a luciferase-based, ATP-dependent assay (CELLTITER GLOR 2.0 Cell Viability Assay, PROMEGA). As shown in Figure 20B, different recombinant Zika virus particles had various effects on cell viability, as assessed using a trypan blue exclusion test. The results confirmed the oncolytic effect of several samples, including ZIKV_4, ZIKV_14, ZIKV_17, and ZIKV_18. The recombinant Zika viruses ZIKV_4 and ZIKV_18 showed higher oncolytic effect when compared to the wild-type virus.

[0320] safety

[0321] As shown in FIG. 21, after the oncolytic effects of several recombinant Zika viruses were examined, the safety of using these recombinant Zika viruses was tested in NPC cells. Compared with the control (MOCK) in which NPC was imaged at 5 DPI, ZIKV_4 and ZIKV_18 strains did not show obvious cytotoxic effects on NPC. As a second control, wild-type Zika virus showed cytotoxic effects on NPC. Recombinant Zika virus ZIKV_17 had obvious cytotoxic effects on NPC, but the extent was lower than that of wild-type Zika virus. Thus, ZIKV_4 and ZIKV_18 strains showed oncolytic effects on CHLA tumor cells, but showed little cytotoxic effects on normal NPC.

[0322] Neurosphere analysis of wild type and recombinant Zika virus transfected NPCs was performed as shown in Figure 22. Figure 22A shows the measured neurosphere area of ​​different NPCs and Figure 22B shows the perimeter of different NPCs.

[0323] Regulation of miRNA: Replication inhibitor systems

[0324] Based on the miRNA expression profile of cell lines and infection / safety of Zika candidates, we tested the efficacy of selective inhibition mechanism based on microRNA regulation to control viral replication. To do so, we overexpressed the corresponding miRNAs and observed viral inhibition and increased tumor cell viability. Figure 23 shows that ZIKV_14 is oncolytic in tumor cells and safe in NPCs (comparable to MOCK) and can be regulated by overexpression of miR-219a-2-3p. Figure 23 shows cell viability analysis after viral infection in Daoy and CHLA cells with miRNA overexpression of recombinant ZIKV14 virus in relative comparison to negative control. These results indicate that ZIKV_14 is oncolytic and safe in NPCs.

[0325] Example 4: Action spectrum of recombinant ZIKA virus Using the same assay as above, we tested the viability of tumor and non-tumor cells after ZIKV 14 infection with a virus concentration curve of MOI 5, 1.667, 0.556, 0.185, 0.062, 0.021, 0.007, and 0.002. The tumor cell lines tested were hCMEC, Hs1.Tes, Daoy, ONS, ATRT, glioblastoma, prostate, triple-negative breast tumor cells, colon tumor cells, and luminal breast tumor cells. Cells were cultured in 96-well plates at 2x10 3Cells were plated at an initial seeding density of 100 cells / well. After 24 hours, wild-type ZIKA virus, recombinant ZIKA virus, or MOCK was added to the cells in a final volume of 20 μL. Cells were incubated at room temperature for 30 minutes, after which wild-type ZIKA virus, recombinant ZIKA virus, or MOCK was removed and replaced with 100 μL of fresh medium. Viable cells were measured after 3 DPI using the CELLTITER GLOR 2.0 Cell Viability Assay (PROMEGA). Eight replicates of each cell line were performed.

[0326] The results of the assay are shown in Figures 24-34. Figure 24 shows that the recombinant ZIKA virus (ZIKV14) did not reduce cell viability in cerebral microvessels (hCMEC cell line) compared to wild-type ZIKV, indicating the safety of ZIKV14. Figure 25 shows the ability of the recombinant ZIKA virus (ZIKV14) and wild-type ZIKV to reduce cell viability in microglia (hMC3 cell line). Figure 26 shows that the recombinant ZIKA virus (ZIKV14) and wild-type ZIKV did not reduce cell viability in testicular cancer (Hs1.Tes cell line). Figure 30 shows that the oncolytic effect of ZIKV14 was more efficient in glioblastoma cell lines (U138 and LN18) when compared to ZIKV wild-type. Figures 27-29 show that recombinant Zika virus (ZIKV14) infection reduced cell viability compared to wild-type ZIKV in embryonal CNS tumors, medulloblastoma (DAOY and ONS) and ATRT (CHLA-06-ATRT). Figures 31-34 show that ZIKV14 and wild-type ZIKV infection reduced viability in prostate cancer (DU-145 cell line) (Figure 31) and triple-negative breast cancer (MDA-MB-231 cell line) (Figure 32), but were not oncolytic in MCF7 cell line (luminal breast cancer) (Figure 34) and hCT-8 cell line (colon tumor) (Figure 33).

[0327] Example 5: Mouse model ZIKV_14 was validated in in vivo models of nervous system tumors (orthotopic and metastatic). Figure 35 shows that the modified Zika virus (ZIKV14) was able to stabilize tumor growth, reduce tumor incidence, and even eradicate tumor sites. Furthermore, the modified Zika virus was able to inhibit the development of neuraxial metastases as well as eliminate existing tumor metastases (Figure 35). Briefly, Balb / c nude mice were administered tumor cells that either metastasized to the neuraxis or did not. In the control group, mice received intracerebroventricular administration (icv) of MOCK or wild-type Zika virus. Other mice were injected with ZIKV14 icv (6 × 10 3 PFU) and monitored. Images were taken before treatment (T0), 7 days after treatment (T1), and 14 days after treatment with recombinant ZIKV14 (T2).

[0328] [Table 15-1]

[0329] [Table 15-2]

[0330] [Table 15-3]

[0331] [Table 15-4]

[0332] [Table 15-5]

[0333] [Table 15-6]

[0334] [Table 15-7]

[0335] The foregoing merely illustrates the principles of the present disclosure. It will be understood that those skilled in the art can devise various arrangements that embody the principles of the present invention and are within its spirit and scope, although not expressly described or shown herein. Furthermore, all examples and conditions described herein are intended primarily to aid the reader in understanding the principles of the present disclosure and the concepts contributed by the inventors to further develop the art, and are not intended to be limited to such specifically described examples and conditions. Furthermore, all descriptions herein of the principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Furthermore, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements that perform the same function regardless of structure, are developed. Thus, the scope of the present disclosure is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present disclosure is embodied by the appended claims.

Claims

1. 1. A nucleic acid comprising a Zika virus 5' untranslated region (5'UTR), a sequence complementary to a regulatory polynucleotide, and a Zika virus 3' untranslated region (3'UTR), wherein the regulatory polynucleotide is (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p, (ii) a sequence at least 80% identical to a sequence in Table 6A or Table 6B, or (iii) a nucleic acid comprising (i) and (ii).

2. 2. The nucleic acid of claim 1, wherein the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCCGGTCA, or a combination of two or more thereof.

3. 3. The nucleic acid of claim 1 or claim 2, wherein the 5'UTR is at least 80% homologous or identical to SEQ ID NO: 239 (AGTTGTTACTGTTGCTGACTCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAGGTTTTATTGGATTTGGAAACGAGAGTTTCTGGTC).

4. The 3'UTR is SEQ ID NO: 241 (TAAGCACCAATCTTAATGTTGTCAGGCCTGCTAGTCAGCCACA GCTTGGGGAAAGCTGTGCAGCCTGTGACCCCCCCAGGAGAAGCTGGGAAACCAAGCCTATA GTCAGGCCGAGAACGCCATGGCACGGAAGAAGCCATGCTGCCTGTGAGCCCCTCAGAGGA CACTGAGTCAAAAAACCCCACGCGCTTGGAGGCGCAGGATGGGAAAAGAAGGTGGCGACCT 2. The nucleic acid of claim 1, which is at least 80% homologous or identical to the sequence of the amino acid sequence of claim 1, wherein the amino acid sequence is a nucleotide sequence selected from the group consisting of TCCCCACCCTTCAATCTGGGGCCTGAACTGGAGATCAGCTGTGGATCTCCAGAAGAGGACTAGTGGTTAGAGGAGACCCCCCGGAAAACGCAAAACAGCATATTGACGCTGGGAAAGACCAGAGACTCCATGAGTTTCCACCACGCTGGCCGCCAGGCACAGATCGCCGAATAGCGGCGGCCGGTGTGGGGGAAATCCATGGGTCT.

5. 3. The nucleic acid of claim 1 or claim 2, wherein the 5'UTR is selected from a Zika virus in Table 12 and the 3'UTR is selected from a Zika virus in Table 13.

6. 2. The nucleic acid of claim 1, wherein the regulatory polynucleotide is expressed in non-cancer cells, and optionally, the regulatory polynucleotide has higher expression in non-cancer cells compared to cancer cells of the subject.

7. The nucleic acid of claim 1 , wherein the regulatory polynucleotide is a microRNA.

8. 2. The nucleic acid of claim 1, wherein the sequence complementary to the regulatory polynucleotide is 9 to 22 nucleotides in length, and optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

9. A nucleic acid, (a) the Zika virus 5' untranslated region (5'UTR); (b) a polynucleotide encoding at least one Zika virus structural protein selected from a capsid protein (ancC / C), a membrane protein (prM / M), and an envelope protein (E), and / or a polynucleotide encoding at least one Zika virus nonstructural protein selected from NS1, NS2A, NS2B, NS3, NS4A, 2k peptide, NS4B, and NS5; (c) the Zika virus 3' untranslated region (3'UTR); and (d) a sequence complementary to the regulatory polynucleotide; where: (i) the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, wherein the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding the 2k peptide, and the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide; (ii) the nucleic acid comprises a polynucleotide encoding at least one Zika virus nonstructural protein, wherein the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding the NS4A and a polynucleotide encoding the NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding the NS4A and the polynucleotide encoding the NS4B; (iii) the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus nonstructural protein; and / or (iv) a nucleic acid, wherein the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding at least one Zika virus structural protein and / or the polynucleotide encoding at least one Zika virus nonstructural protein.

10. 10. The nucleic acid of claim 9, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus nonstructural protein, the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding the 2k peptide, and the sequence complementary to the regulatory polynucleotide is located within the polynucleotide encoding the 2k peptide.

11. 10. The nucleic acid of claim 9, wherein the nucleic acid comprises the polynucleotide encoding at least one Zika virus nonstructural protein, the polynucleotide encoding the at least one Zika virus nonstructural protein comprising a polynucleotide encoding the NS4A and a polynucleotide encoding the NS4B, and the sequence complementary to the regulatory polynucleotide is located between the polynucleotide encoding the NS4A and the polynucleotide encoding the NS4B.

12. 10. The nucleic acid of claim 9, wherein the sequence complementary to the regulatory polynucleotide is located between the 5'UTR and the polynucleotide encoding the at least one Zika virus structural protein and / or the polynucleotide encoding the at least one Zika virus nonstructural protein.

13. 10. The nucleic acid of claim 9, wherein the sequence complementary to the regulatory polynucleotide is located between the 3'UTR and the polynucleotide encoding the at least one Zika virus structural protein and / or the polynucleotide encoding the at least one Zika virus nonstructural protein.

14. 14. The nucleic acid of any one of claims 9 to 13, wherein the 5'UTR is at least 80% homologous or identical to SEQ ID NO:

239.

15. 10. The nucleic acid of claim 9, wherein the 3'UTR is at least 80% homologous or identical to SEQ ID NO:

241.

16. 10. The nucleic acid of claim 9, wherein the 5'UTR is selected from a Zika virus in Table 12 and the 3'UTR is selected from a Zika virus in Table 13.

17. 10. The nucleic acid of claim 9, wherein the nucleic acid comprises the polynucleotide encoding the at least one Zika virus structural protein, and the nucleic acid comprising the polynucleotide encoding the at least one Zika virus structural protein comprises a polynucleotide encoding the capsid protein (ancC / C), a polynucleotide encoding the membrane protein (prM / M), and a polynucleotide encoding the envelope protein (E).

18. 10. The nucleic acid of claim 9, wherein the nucleic acid comprises the polynucleotide encoding the at least one Zika virus nonstructural protein, and the polynucleotide encoding the at least one Zika virus nonstructural protein comprises a polynucleotide encoding the NS1, a polynucleotide encoding the NS2A, a polynucleotide encoding the NS2B, a polynucleotide encoding the NS3, a polynucleotide encoding the NS4A, a polynucleotide encoding the 2k peptide, a polynucleotide encoding the NS4B, and a polynucleotide encoding the NS5.

19. 10. The nucleic acid of claim 9, wherein the regulatory polynucleotide is expressed in non-cancer cells, and optionally, the regulatory polynucleotide has higher expression in non-cancer cells compared to cancer cells of the subject.

20. The nucleic acid of claim 9 , wherein the regulatory polynucleotide is a microRNA.

21. 10. The nucleic acid of claim 9, wherein the sequence complementary to the regulatory polynucleotide is 9 to 22 nucleotides in length, and optionally about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

22. 10. A recombinant Zika virus produced from the nucleic acid of claim 1 or 9.

23. 23. The recombinant Zika virus of claim 22, wherein the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

24. 1. A recombinant Zika virus comprising a polynucleotide complementary to a regulatory polynucleotide, wherein the regulatory polynucleotide comprises (i) miR-219a-2-3p, hsa-miR-377-3p, hsa-miR-1225-5p, hsa-miR-4298, hsa-miR-219a-5p, or hsa-miR-129-5p; (ii) a sequence at least 80% identical to a sequence in Table 6A or Table 6B; or (iii) (i) and (ii).

25. 25. The recombinant Zika virus of claim 24, wherein the sequence complementary to the regulatory polynucleotide comprises CCGACCTGT, AAAACGCC, AAACGCCAG, GGCGTTTT, CTAACAGGT, TAACAGGTT, ACTAACAGG, ACCCTGTCC, CACCCATGC, CCCATGCCG, ACCCATGCC, AGTGTGTTT, CTTAACACC, TTAACACCG, CTTAACAGC, or TGCCCGGTCA, or a combination of two or more thereof.

26. 26. The recombinant Zika virus of claim 24 or claim 25, wherein the recombinant Zika virus is an oncolytic Zika virus having oncolytic activity.

27. 23. A pharmaceutical composition for use in a method of treating cancer in a subject in need thereof, the method comprising administering to the subject the recombinant Zika virus of claim 22.

28. 28. The method of claim 27, wherein the cancer is a central nervous system (CNS) cancer.

29. 29. The method of claim 28, wherein the CNS cancer is a brain tumor.

30. 30. The method of claim 29, wherein the brain tumor is an astrocytoma, oligodendroglioma, ependymoma, meningioma, schwannoma, craniopharyngioma, germinoma, or pinealocytoma.

31. 28. The method of claim 27, wherein the cancer is breast cancer, prostate cancer, colon cancer, retinal cancer, or testicular cancer.

32. 28. The method of claim 27, wherein the recombinant Zika virus does not infect and / or replicate in non-cancerous cells of the subject, or wherein the recombinant Zika virus infects and / or replicates less in non-cancerous cells of the subject compared to cancerous cells of the subject.

Images