Methods and Compositions for the Treatment and Prevention of Fibrosis
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-03-03
- Publication Date
- 2026-03-10
AI Technical Summary
Current treatments for fibrotic diseases, such as systemic sclerosis, are limited in effectiveness, with no FDA-approved therapies for dermal fibrosis and only two approved therapeutics for pulmonary fibrosis that only slow disease progression.
Development of isolated antibodies or antigen-binding fragments that specifically bind to epiregulin, inhibiting its activity and interaction with the ErbB receptor, thereby reducing epiregulin-induced proliferation of fibroblasts and addressing fibrotic changes in cells.
The use of these epiregulin inhibitors effectively inhibits fibrotic processes, offering a potential therapeutic approach for treating or preventing fibrotic diseases by reversing or preventing pathological changes associated with fibrosis.
Smart Images

Figure 00000090_0000 
Figure 00000090_0001 
Figure 00000090_0002
Abstract
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 316,704, filed March 4, 2022, and U.S. Provisional Patent Application No. 63 / 316,691, filed March 4, 2022, each of which is incorporated by reference in its entirety into this application for all purposes. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant No. AR007016 awarded by the National Institutes of Health. The United States Government has certain rights in this invention. [Technical field]
[0003] The present invention relates to methods and compositions that involve the use of inhibitors of epiregulin activity, which involves inhibiting the activity of epiregulin in a cell and reversing or preventing one or more changes in the cell that result from a disease or disorder, such as a fibrotic disease or disorder. Also disclosed are methods and compositions useful for treating or preventing a fibrotic disease or disorder in a subject, for example, comprising inhibitors of epiregulin activity. The present invention further provides kits that include compositions useful for carrying out the invention. [Background technology]
[0004] Pathologic fibrosis is a common final outcome of most human chronic inflammatory diseases and is estimated to be responsible for approximately half of all human deaths worldwide (1). Despite the critical importance of fibrosis in wound healing, there is a large unmet medical need to identify effective antifibrotic therapies, and drug development remains hindered by the inability to precisely identify the dysregulated molecular circuitry that drives fibrosis. Systemic sclerosis (SSc) is the prototypical human fibrotic disease, most commonly affecting the skin, but may also affect the lungs, kidneys, gastrointestinal tract, and heart. There are no Food and Drug Administration (FDA)-approved therapies for SSc skin fibrosis, and only two approved therapeutics exist for SSc pulmonary fibrosis (nintedanib (2) and tocilizumab (3)), but these only slow disease progression, not reverse it.
[0005] Receptor tyrosine kinases (RTKs), such as platelet-derived growth factor receptor α (PDGFRα) (4) and fibroblast growth factor receptor 3 (FGFR3) (5), play important roles in fibrosis because their activation in fibroblasts leads to overexpression of extracellular matrix (ECM) gene products. The epidermal growth factor receptor (EGFR), a member of the ErbB family of RTKs, is expressed primarily by epidermal keratinocytes and is highly activated in solid tumors, such as lung and breast cancers (6). In a recently identified SSc skin disease gene expression signature (Scleroderma Skin Severity Score / 4S), EGFR ligand expression correlated with dermal fibrosis severity (7). However, direct EGFR inhibition showed inconsistent results when tested in various mouse models of fibrosis. EGFR inhibition was reported to prevent fibrosis in the skin, liver, and kidney (8-10) but exacerbated pulmonary fibrosis (11). These contradictory findings support the idea that up to now unexplored signaling circuits and regulatory feedback loops, such as those described between fibroblasts and macrophages in vitro, may play a central role in SSc-associated fibrosis.
[0006] Several studies have utilized single-cell RNA sequencing (scRNA-Seq) to elucidate the lineage and origin of fibroblast populations in healthy and fibrotic skin (13-17). Recent attention has also been focused on the observation that innate immunity plays a key role in fibrosis (18), with key signals coming from unique subsets of monocytes (19) and plasmacytoid dendritic cells (20). Skin biopsies from scleroderma patients have been shown to express CD14 +Dermal infiltration of mononuclear cells, plasmacytoid dendritic cells, and type 2 innate lymphocytes (21-23) and clustering near these cells are fibroblasts that overexpress collagen genes in scleroderma (24, 25). These findings suggest that myeloid immune cells promote fibroblast collagen production by mechanisms that remain to be described. Summary of the Invention [Problem to be solved by the invention]
[0007] As noted in the Background section above, there is a high need in the art for effective antifibrotic therapies for patients with SSc and other fibrotic diseases and disorders. The present application addresses these and other needs. [Means for solving the problem]
[0008] In one aspect, the disclosure provides an isolated antibody, or antigen-binding fragment thereof, capable of specifically binding to epiregulin.
[0009] In some embodiments, the isolated antibody or antigen-binding fragment may specifically bind to an epiregulin epidermal growth factor (EGF)-like domain.
[0010] In some embodiments, the epiregulin can be human epiregulin.
[0011] In some embodiments, the isolated antibody or antigen-binding fragment is about 1×10 -9 K under M D In some embodiments, the isolated antibody or antigen-binding fragment may specifically bind epiregulin at about 1×10 -10 K under M D In some embodiments, the isolated antibody or antigen-binding fragment may specifically bind epiregulin at about 3.8×10 -11 K of MD In some embodiments, the K D can be determined using a biolayer interference assay.
[0012] In some embodiments, the isolated antibody or antigen-binding fragment may neutralize epiregulin.
[0013] In some embodiments, the isolated antibody or antigen-binding fragment may inhibit the interaction of epiregulin with an ErbB receptor.
[0014] In some embodiments, the ErbB receptor may be the epidermal growth factor receptor (EGFR).
[0015] In some embodiments, the isolated antibody or antigen-binding fragment may inhibit epiregulin-induced proliferation of fibroblasts.
[0016] In some embodiments, the isolated antibody or antigen-binding fragment has an IC of less than about 100 nM. 50 In some embodiments, the isolated antibody or antigen-binding fragment may inhibit epiregulin-induced proliferation of fibroblasts at an IC of less than about 10 nM. 50 In some embodiments, the isolated antibody or antigen-binding fragment may inhibit epiregulin-induced proliferation of fibroblasts at an IC 50 may inhibit epiregulin-induced proliferation of fibroblasts.
[0017] In some embodiments, the isolated antibody or antigen-binding fragment is unable to specifically bind to mouse epiregulin.
[0018] In some embodiments, the isolated antibody or antigen-binding fragment is not capable of specifically binding to one or more other human EGFR ligands.
[0019] In some embodiments, the one or more other EGFR ligands may be transforming growth factor alpha (TGFA), betacellulin (BTC), heparin-binding EGF-like growth factor (HB-EGF), epigen (EPGN), epidermal growth factor (EGF), and / or amphiregulin (AREG).
[0020] In some embodiments of any of the antibodies or antigen-binding fragments disclosed herein, the antibody or antigen-binding fragment may comprise: three heavy chain complementarity determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (VH), which may comprise the amino acid sequence of SEQ ID NO:1, or a sequence having at least 80% identity thereto; and / or three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (VL), which may comprise the amino acid sequence of SEQ ID NO:6, or a sequence having at least 80% identity thereto.
[0021] In some embodiments, the isolated antibody or antigen-binding fragment may comprise: three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a VH, which may comprise the amino acid sequence of SEQ ID NO:1; and / or three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a VL, which may comprise the amino acid sequence of SEQ ID NO:6.
[0022] In some embodiments, the isolated antibody or antigen-binding fragment may comprise: an HCDR1 that may comprise the amino acid sequence of SEQ ID NO:2, an HCDR2 that may comprise the amino acid sequence of SEQ ID NO:3, and / or an HCDR3 that may comprise the amino acid sequence of SEQ ID NO:4; and / or an LCDR1 that may comprise the amino acid sequence of SEQ ID NO:7, an LCDR2 that may comprise the amino acid sequence of SEQ ID NO:8, and / or an LCDR3 that may comprise the amino acid sequence of SEQ ID NO:9.
[0023] In some embodiments, the isolated antibody or antigen-binding fragment may comprise: a VH, which may comprise the amino acid sequence of SEQ ID NO:1, or a sequence having at least 80% identity thereto; and / or a VL, which may comprise the amino acid sequence of SEQ ID NO:6, or a sequence having at least 80% identity thereto.
[0024] In some embodiments, the isolated antibody or antigen-binding fragment may comprise: a VH, which may comprise the amino acid sequence of SEQ ID NO:1; and / or a VL, which may comprise the amino acid sequence of SEQ ID NO:6.
[0025] In some embodiments, the antibody or antigen-binding fragment may be a human antibody, a monoclonal antibody, a humanized antibody, a single chain antibody, a Fab, a Fab', a F(ab')2, an Fv, or a scFv.
[0026] In some embodiments, the antibody may be a humanized antibody.
[0027] In some embodiments, the antibody or antigen-binding fragment may be of the IgG1, IgG2, IgG3, or IgG4 isotype.
[0028] In another aspect, the disclosure provides an isolated antibody, or antigen-binding fragment thereof, that competes with any of the antibodies or antigen-binding fragments disclosed herein for binding to epiregulin.
[0029] In another aspect, the disclosure provides an isolated antibody or antigen-binding fragment thereof that binds to the same epitope as any of the antibodies or antigen-binding fragments disclosed herein.
[0030] In another aspect, the disclosure provides an isolated polypeptide encoding any of the isolated antibodies or antigen-binding fragments disclosed herein.
[0031] In some embodiments, the isolated polypeptide may comprise: a nucleotide sequence of SEQ ID NO:5 encoding a VH, or a sequence having at least 80% identity to said sequence; and / or a nucleotide sequence of SEQ ID NO:10 encoding a VL, or a sequence having at least 80% identity to said sequence.
[0032] In some embodiments, the isolated polypeptide may comprise the nucleotide sequence of SEQ ID NO:5 encoding the VH and / or the nucleotide sequence of SEQ ID NO:10 encoding the VL.
[0033] In another aspect, the disclosure provides a vector, which may include any of the polynucleotides disclosed herein.
[0034] In another aspect, the disclosure provides a host cell expressing any of the isolated antibodies or antigen-binding fragments disclosed herein, which may comprise any of the polynucleotides disclosed herein or any of the vectors disclosed herein.
[0035] In some embodiments, the cell may be a hybridoma.
[0036] In some embodiments, the antibody or antigen-binding fragment may be recombinantly produced.
[0037] In another aspect, the disclosure provides a method of producing an isolated antibody or antigen-binding fragment disclosed herein, the method may comprise culturing any of the host cells disclosed herein and isolating any of the antibodies or antigen-binding fragments disclosed herein.
[0038] In another aspect, the disclosure provides a chimeric antigen receptor (CAR), which may include: an extracellular domain, which may include an antigen binding moiety that specifically binds epiregulin; a transmembrane domain; and a cytoplasmic domain, which may include one or more signaling domains.
[0039] In some embodiments, the antigen-binding portion that specifically binds to epiregulin may comprise any of the antibodies or antigen-binding fragments disclosed herein.
[0040] In another aspect, the present disclosure provides an immune cell, which may comprise any of the CARs disclosed herein on the cell surface.
[0041] In some embodiments, the immune cell may be a T cell or a natural killer (NK) cell.
[0042] In another aspect, the disclosure provides a pharmaceutical composition, which may include any of the antibodies or antigen-binding fragments thereof disclosed herein, any of the polynucleotides disclosed herein, any of the vectors disclosed herein, or any of the CARs disclosed herein, or any of the immune cells disclosed herein, and a pharma- ceutically acceptable carrier or diluent.
[0043] In some embodiments, the pharmaceutical composition may further comprise one or more additional therapeutic agents.
[0044] In some embodiments, the one or more additional therapeutic agents can be selected from mycophenolate mofetil, nintedanib, tocilizumab, pirfenidone, rituximab, corticosteroids (e.g., prednisone), methotrexate, and cyclophosphamide, or combinations thereof.
[0045] In another aspect, the disclosure provides kits, which may include (i) any of the isolated antibodies or antigen-binding fragments disclosed herein, any of the polynucleotides disclosed herein, any of the vectors disclosed herein, or any of the CARs disclosed herein, or any of the immune cells disclosed herein, and / or (ii) packaging therefor.
[0046] In one aspect, the disclosure provides a method of inhibiting the activity of epiregulin in a cell, comprising contacting the cell with an effective amount of an epiregulin inhibitor.
[0047] In some embodiments, the disclosure provides a method of inhibiting the activity of epiregulin in a cell, the method may comprise contacting the cell with an effective amount of any of the antibodies or antigen-binding fragments disclosed herein, or any of the CARs disclosed herein, any of the immune cells disclosed herein, or any other epiregulin inhibitors disclosed herein.
[0048] In some embodiments, the activity of epiregulin may be the interaction of epiregulin with an ErbB receptor.
[0049] In some embodiments, the ErbB receptor may be an EGFR receptor.
[0050] In some embodiments of any of the methods disclosed above, the cells may be fibroblasts or pericytes.
[0051] In some embodiments, the epiregulin inhibitor may inhibit epiregulin-induced proliferation of the fibroblasts.
[0052] In another aspect, the disclosure provides a method of reversing or preventing one or more changes in a cell resulting from fibrosis, comprising contacting the cell with an effective amount of an epiregulin inhibitor.
[0053] In some embodiments, the disclosure provides a method of reversing or preventing one or more changes in a cell that result from fibrosis, the method may comprise contacting the cell with an effective amount of any of the antibodies or antigen-binding fragments disclosed herein, or any of the CARs disclosed herein, or any of the immune cells disclosed herein, or any other epiregulin inhibitors disclosed herein.
[0054] In some embodiments, the one or more changes resulting from fibrosis include, but are not limited to, for example: (1) increased expression of epiregulin (EREG); (2) increased expression of type I collagen alpha 1 chain (COL1A1); (3) increased expression of type IV collagen alpha 1 chain (COL4A1); (4) increased expression of type VI collagen alpha 1 chain (COL6A1); (5) increased expression of tenascin-C (TNC); (6) increased expression of fibronectin extra domain A (FN EDA (7) increased expression of monocyte chemoattractant protein-1 (MCP-1); (8) increased expression of tissue inhibitor of metalloproteinase 1 (TIMP-1), or a combination thereof.
[0055] In some embodiments, the cells may be fibroblasts or pericytes.
[0056] In some embodiments, the cells may be human cells.
[0057] In another aspect, the disclosure provides a method of treating or preventing a fibrotic disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an epiregulin inhibitor.
[0058] In some embodiments, the disclosure provides a method of treating or preventing a fibrotic disease or disorder in a subject in need thereof, which may comprise administering to the subject a therapeutically effective amount of any of the antibodies or antigen-binding fragments disclosed herein, any of the polynucleotides disclosed herein, any of the vectors disclosed herein, or any of the CARs disclosed herein, any of the immune cells disclosed herein, or any of the other epiregulin inhibitors disclosed herein.
[0059] In some embodiments, administration of the epiregulin inhibitor (eg, an antibody or antigen-binding fragment) can result in reversal of the fibrotic disease or disorder.
[0060] In some embodiments, the epiregulin inhibitor (eg, an antibody or antigen-binding fragment) may be administered to the subject after onset of the fibrotic disease or disorder.
[0061] In some embodiments, the epiregulin inhibitor (eg, an antibody or antigen-binding fragment) may be administered to the subject prior to the onset of the fibrotic disease or disorder.
[0062] In some embodiments, the fibrotic disease or disorder can be scleroderma, interstitial lung disease, gastrointestinal fibrosis, cardiac fibrosis, dermal fibrosis, sclerosing myxedema, nephrogenic systemic fibrosis (nephrogenic fibrosing dermopathy), chronic graft-versus-host disease, sclerosing graft-versus-host disease, bronchiolitis obliterans syndrome, keloid scarring, or long COVID syndrome, or a combination thereof.
[0063] In some embodiments, the scleroderma can be systemic scleroderma.
[0064] In some embodiments, the scleroderma can be localized scleroderma (morphea).
[0065] In some embodiments, the interstitial lung disease can be idiopathic pulmonary fibrosis.
[0066] In some embodiments, the skin fibrosis is associated with systemic sclerosis or sclerosing graft-versus-host disease.
[0067] In some embodiments, any of the above methods of treating or preventing a fibrotic disease or disorder in a subject may further comprise one or more additional therapeutic agents.
[0068] In some embodiments, the one or more additional therapeutic agents may be, for example, but not limited to, mycophenolate mofetil, nintedanib, tocilizumab, pirfenidone, rituximab, corticosteroids (e.g., prednisone), methotrexate, UVA or UVB phototherapy, extracorporeal photopheresis, stem cell transplantation, and cyclophosphamide, or combinations thereof.
[0069] In some embodiments of any of the above methods of treating or preventing a fibrotic disease or disorder in a subject, the subject may be a human.
[0070] In any of the above embodiments or aspects, the epiregulin inhibitor may be an antibody or antigen-binding fragment, a small molecule, a decoy receptor, a CAR modified cell, an aptamer, an alternative scaffold, or a combination thereof.
[0071] In some embodiments, the antibody or antigen-binding fragment may be anti-human epiregulin antibody AF1195, or anti-mouse / human epiregulin antibody Clone #189611.
[0072] In some embodiments, the decoy receptor may be a soluble ErbB receptor.
[0073] In some embodiments, the decoy receptor may be a soluble EGFR.
[0074] In some embodiments, the CAR modified cells are capable of destroying or killing epiregulin-expressing dendritic cells.
[0075] In some embodiments, the CAR modified cells may be CAR-T cells. [Brief description of the drawings]
[0076] [Figure 1] FIG. 1 shows the workflow for immunization of Alloy mice that generated positive titers against recombinant human epiregulin (rhEreg) protein. [Diagram 2] Three mice of each Alloy mouse strain were immunized with recombinant epiregulin protein and epiregulin antibody titers were measured 35 days later. [Diagram 3] 1 shows hybridoma library generation and cloning from epiregulin-immunized Alloy Mix mice. [Figure 4] 1 shows the heavy and light chain sequences of humanized epiregulin neutralizing antibody 1 (hEreg NAb1). [Diagram 5] 13 shows that hEreg NAb1 inhibits human epiregulin-induced proliferation of human fibroblasts. [Figure 6] 1 shows that hEreg NAb1 inhibits full-length epiregulin protein. [Figure 7] 1 shows that hEreg NAb1 has low cross-reactivity with mouse epiregulin. [Figure 8] 1 shows that humanized epiregulin antibodies do not neutralize other EGFR ligands. [Figure 9A] 9A-9I show that EGFR activation marks pathogenic fibroblasts in SSc skin and lung. Uniform Manifold Approximation and Projection (UMAP) embedding of scRNA-seq data from five diffuse cutaneous SSc patients and five healthy controls. [Figure 9B] Continued from Figure 9A [Figure 9C] Heatmap of significantly upregulated collagen gene expression in SSc fibroblasts (Fib) and pericytes (PC). [Figure 9D] Gene ontology processes identified by upregulated SSc genes in fibroblast (Fib) and pericyte (PC) clusters. [Figure 9E] EGFR expression in UMAP embedded data, clustered similarly to (Figure 9A). [Figure 9F] Heatmap of significantly upregulated genes in SSc EGFR-expressing fibroblasts compared to SSc EGFR-negative fibroblasts and healthy control fibroblasts. [Figure 9G] t-distributed stochastic neighbor embedding (t-SNE) plot of gene expression in SSc versus healthy fibroblasts. [Figure 9H] SSc skin and lungs, as well as healthy skin and lungs, were stained with Y1068 antibody against phosphorylated EGFR. [Figure 9I] Number of pEGFR+ cells in each condition (n=3 slides each, 10 high power fields (hpf) per slide). [Figure 10A] 10A-10G show that epiregulin+ dendritic cells accumulate in human skin and lung fibrosis. Sankey diagrams of enriched receptor-ligand pairs in SSc skin and at least two lung scRNA-Seq datasets. [Figure 10B] Plots of CellPhoneDB ranks (adjusted p-values) of interactions of EREG, AREG, and HBEGF with EGFR in skin scRNA-Seq data (SSc skin 2(15)), keloid skin (14), and pulmonary fibrosis studies (SSc lung 1(41), 2(42), 3(33)). [Figure 10C] Epiregulin expression in UMAP embedded data using the same clusters as in Figure 9A. [Figure 10D]Heatmap of dendritic cell marker expression contrasting SSCs and healthy epiregulin-expressing bone marrow APCs (positive) compared with epiregulin- cells (negative). [Figure 10E] Photomicrographs of dermis and lung from SSc and healthy subject samples stained with an antibody against epiregulin. Arrows indicate positive cells. [Figure 10F] Number of epiregulin+ cells in SSc dermis and lung (n=3 slides each, 10 high power fields (hpf) per slide). [Figure 10G] Immunofluorescence of SSc and healthy skin and lung stained for phosphorylated EGFR (pEGFR) and epiregulin (Ereg). [Figure 11A] 11A-11G show that epiregulin has a distinct expression pattern during mouse skin and lung fibrosis. B6 mice were subcutaneously injected with 0.2 mg of bleomycin (BLM), and 3 weeks later, the skin was stained with hematoxylin and eosin. [Figure 11B] B6 mice were subcutaneously injected with 0.2 mg of bleomycin (BLM), and 3 weeks later, the skin was stained with trichrome stain. [Figure 11C] Immunofluorescence images from the same skin using CD34 and CD45 antibodies. [Figure 11D] Hydroxyproline content in the skin at different time points after subcutaneous bleomycin (BLM) injection (n=3 per group). [Figure 11E] Heatmap of the mean log2 (fold change in expression) of ECM genes and EGFR ligands at different time points after subcutaneous bleomycin injection. [Figure 11F] Bulk RNA sequencing of dendritic cells isolated from fibrotic skin of Mgl2DTReGFPpANeo mice 3 weeks after subcutaneous bleomycin injection compared to PBS controls (n=3 per group). [Figure 11G] Relative expression of epiregulin at different time points after intratracheal bleomycin administration to B6 mice. [Figure 12A]12A-12K show that epiregulin inhibition reduces mouse and human dermal fibrosis. Cohorts of B6 and Ereg− / − mice were injected subcutaneously with bleomycin (BLM) and analyzed for skin thickness 35 days later. [Figure 12B] Cohorts of B6 and Ereg− / − mice were injected subcutaneously with bleomycin (BLM) and analyzed for skin thickness 35 days later. [Figure 12C] A typical organizational structure is shown. [Figure 12D] Twenty-one days after bleomycin injection, mice began treatment with epiregulin antibody and were compared to PBS-treated controls (NT) for 2 weeks. [Figure 12E] After euthanasia, the skin was analyzed for dermal thickness. [Figure 12F] After euthanasia, the skin was analyzed for hydroxyproline. [Figure 12G] After euthanasia, the skin was analyzed for gene expression. [Figure 12H] After euthanasia, the skin was analyzed for gene expression. [Figure 12I] After euthanasia, the skin was analyzed for histology, with hematoxylin and eosin staining (top), trichrome staining (middle), and pEGFR immunohistochemistry (IHC) (bottom). [Figure 12J] Adjacent punch biopsies from the forearm of a patient with diffuse cutaneous SSc were cultured for 9 days in medium alone (NT) or with the addition of epiregulin neutralizing antibody (Ereg Ab). The inset shows a further magnification of dermal collagen. [Figure 12K] Skin explant medium was analyzed for pro-COL1A1 secretion by enzyme-linked immunosorbent assay (ELISA). [Figure 13A] 13A-13I show that epiregulin inhibition reduces mouse and human pulmonary fibrosis. Ten days after intratracheal bleomycin administration, mice began a 2-week treatment with epiregulin antibody and were then euthanized. [Figure 13B] Lungs were analyzed for histology. [Figure 13C] Lungs were analyzed for the modified Ashcroft score. [Figure 13D] Lungs were analyzed for hydroxyproline. [Figure 13E] Lungs were analyzed for epiregulin gene expression. [Figure 13F] Fresh lung tissue from a deceased familial idiopathic pulmonary fibrosis donor was processed for histological staining and showed fibroblast nest formation and hyperplasia of alveolar type II epithelial cells, as indicated by arrows (upper panel, hematoxylin and eosin (H&E), lower panel, trichrome, scale bar 50 μm). [Figure 13G] Relative expression of genes indicated. [Figure 13H] Relative expression of the indicated genes [Figure 13I] Protein secretion of the indicated genes measured by ELISA. [Figure 14A] 14A-14I show that type I interferon induces EGFR-NOTCH circuitry between EREG+DCs and fibroblasts. Fold change in epiregulin expression when THP-1 monocytes were incubated with each of the indicated cytokines. [Figure 14B] Fold change in epiregulin expression from freshly isolated peripheral blood CD14+ monocytes after incubation with IFNα2. [Figure 14C] Fold change in epiregulin expression from CD1c+ dendritic cell precursors following incubation with IFNα2. [Figure 14D] Fold change in epiregulin expression from cultured human bone marrow-derived dendritic cells (BMDCs) after incubation with IFNα2. [Figure 14E] Fold change in expression of NOTCH ligands, receptors, and target genes by human foreskin fibroblasts (HFFs) incubated with recombinant epiregulin (rEreg) (n=5). [Figure 14F]Relative expression of epiregulin by BMDCs primed with IFNα2 prior to exposure to the NOTCH ligand DLL4 ( n = 3–4 per time point in each group). [Figure 14G] Relative expression of EGFR ligands by HFF (n=3) [Figure 14H] Changes in extracellular matrix (ECM) gene expression when HFFs were incubated with medium alone (NT) or with epiregulin neutralizing antibody (Ereg Ab) [Figure 14I] A model for the epiregulin-NOTCH circuit between monocyte-derived DC3s and fibroblasts. [Figure 15A] Figures 15A-15F show that inhibition of type I interferon-EGFR-NOTCH axis prevents fibrosis in vivo. B6 mice were subcutaneously injected with bleomycin followed by intraperitoneal injections of Ifnar1 blocking antibody (Ifnar1 Ab), isotype control antibody (iso), or PBS (NT) at 2 weeks. [Figure 15B] At week 3, the skin was analyzed for histology. [Figure 15C] At week 3, the skin was analyzed for dermal thickness. [Figure 15D] At week 3, the skin was analyzed for hydroxyproline. [Figure 15E] At week 3, skin was analyzed for gene expression. [Figure 15F] At week 3, the skin was analyzed for gene expression. [Figure 16A] 16A-16D show cell cluster signature genes and immunostaining of SSc skin. Major cell clusters and signature genes. Heatmap of gene expression log2 (fold change) of the top 10 upregulated genes per cluster in aggregated scRNA-Seq data of healthy controls and SSc samples. [Figure 16B] Major cellular clusters and signature genes. Heatmap of log2 (fold change) gene expression of the top 10 upregulated genes per cluster in aggregated scRNA-Seq data of healthy controls and SSc samples. [Figure 16C] Healthy and SSc skin and lungs were stained with a rabbit IgG isotype control antibody and compared to the signal shown in Figure 9H for anti-human pEGFR. [Figure 16D] Immunostaining of SSc and healthy skin with pEGFR and the mesenchymal marker vimentin (magnification 20x, scale bar 100 μm). [Figure 17A] 17A-17C show low magnification images of healthy and SSc skin and lungs stained with hematoxylin and eosin (H&E) for histology. [Figure 17B] Healthy and SSc skin and lungs were stained with pEGFR Tyr-1068 for histology. [Figure 17C] Healthy and SSc skin and lungs were stained with epiregulin for histology. [Figure 18A] 18A-18D show EREG DC marker expression and immunophenotypic analysis. Diagram of enriched receptor-ligand growth factor pairs in SSc skin. [Figure 18B] Relative expression of epidermal growth factor (EGF), factor alpha (TGFA), betacellulin (BTC), EREG, amphiregulin (AREG), heparin-binding epidermal growth factor (EGF)-like growth factor (HBEGF), and epigen (EPGN) from whole tissues of healthy and SSc frozen skin (n=3 per group). [Figure 18C] Peripheral blood mononuclear cells (PBMCs) isolated from healthy participants were stained for epiregulin along with adaptive and myeloid cell markers and analyzed by FACS. [Figure 18D] Quantification of DC subsets by QCD141+ staining between cDC2, which includes all CD1c+ cells, and epiregulin+ cells, which includes cDC1. [Figure 19A] 19A-19C show that Ereg− / − mice develop skin fibrosis similar to wild-type mice. [Figure 19B]As shown in (FIG. 19A), a cohort of B6 and Ereg− / − mice was injected subcutaneously with bleomycin and analyzed for hydroxyproline 21 days later. [Figure 19C] As shown in (FIG. 19A), a cohort of B6 and Ereg− / − mice was injected subcutaneously with bleomycin and analyzed for histology 21 days later. [Figure 20] We show that the NOTCH ligand nephroblastoma overexpressed (NOV) induces epiregulin expression in BMDCs. [Figure 21A] Figures 21A-21C show that hEreg NAb1 reduces fibrosis markers in sclerosing GvHD skin explants. Paired skin biopsies from the right arm and left abdomen of two sGvHD patients were incubated with 2.5 mg / ml hEreg NAb1 or isotype control IgG1 antibody for 10 days. Patient fibrotic skin. [Figure 21B] The medium was changed every 48 hours and the levels of fibrous protein markers in the supernatants were quantified by ELISA (Abcam kits ab213831, ab210966, ab219046, ab187394, ab179886). [Figure 21C] Continued from Figure 21B. [Figure 22A] 22A-22B show analysis of EREG expression in SSc compared to healthy controls and compared to modified Rodnan Skin Score (mRSS). The results show that the number of EREG+ cells is increased in SSc skin compared to healthy controls. [Figure 22B] The results show that EREG expression showed a significant positive correlation with disease severity by modified Rodnan Skin Score (mRSS). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0077] Figures 1 and 2 show the workflow for immunization of Alloy mice that generated positive titers against recombinant human epiregulin protein. Three mice of each Alloy mouse strain were immunized with recombinant epiregulin protein and epiregulin antibody titers were measured 35 days later. Titers obtained from the individual mixed and B6 mouse strains are circled.
[0078] FIG. 3 shows hybridoma library generation and cloning from epiregulin-immunized Alloy Mix mice. Supernatants from the hybridoma library show epiregulin-binding antibodies by enzyme-linked immunosorbent assay (ELISA). One line shows results from a 1 / 1000 dilution of immunized mouse serum, and another line shows results from undiluted hybridoma library supernatant. Hybridoma cells were plated individually, which resulted in five wells with supernatants containing epiregulin-binding antibodies by ELISA. These are highlighted and labeled M1-M5.
[0079] Figure 4 shows the heavy and light chain sequences of humanized epiregulin neutralizing antibody 1 (hEreg NAb1). Complementarity determining regions 1-3 (CDR1-3) are shown in bold.
[0080] Figure 5 shows that hEreg NAb1 inhibits human epiregulin-induced proliferation of human fibroblasts. Human foreskin fibroblasts (HFFs) were incubated with recombinant human epiregulin (rhEreg) in Dulbecco's modified Eagle medium (DMEM) containing 1% fetal bovine serum (FBS). n=3 per rhEreg concentration (left panel). HFFs were incubated with a commercial rat anti-human / mouse epiregulin antibody (center panel) or hEreg NAb1 (right panel) in medium containing 100 ng / ml rhEreg. n=4 (center panel), n=6 (right panel) per antibody concentration. Data points represent the mean and standard error, which were fitted by interpolation from a sigmoidal standard curve. Proliferation was measured by green fluorescent protein (GFP) fluorescence on day 3 using the CyQUANT Direct Cell Proliferation Assay (Invitrogen) on a Synergy HTX plate reader (Biotek).
[0081] Figure 6 shows that hEreg NAb1 inhibits full-length epiregulin protein. HFFs were incubated with increasing concentrations of hEreg NAb1 in the absence of exogenous epidermal growth factor receptor (EGFR) ligand.
[0082] Figure 7 shows that hEreg NAb1 has low cross-reactivity with mouse epiregulin. HFFs were incubated with recombinant mouse epiregulin (rmEreg) for 3 days (left panel). HFFs were incubated with rat anti-human / mouse epiregulin antibody (middle panel) or hEreg NAb1 (right panel) in medium containing 100 ng / ml rmEreg. n=4 (middle panel), n=6 (right panel) per antibody concentration. Data points represent the mean and standard error, which were fitted by interpolation from a sigmoidal standard curve.
[0083] Figure 8 shows that humanized epiregulin antibodies do not neutralize other EGFR ligands. HFFs were quantified after 3 days of incubation with 5 mg / ml hEreg NAb1 alone, and with 0.1 ng / ml, 1 ng / ml, and 10 ng / ml recombinant EGFR ligand.
[0084] Figures 9A-9I show that EGFR activation marks pathogenic fibroblasts in SSc skin and lung. (Figures 9A-9B) Uniform Manifold Approximation and Projection (UMAP) embedding of scRNA-seq data from five diffuse cutaneous SSc patients and five healthy controls. (Figure 9C) Heatmap of significantly upregulated collagen gene expression in SSc fibroblasts (Fib) and pericytes (PC). (Figure 9D) Gene Ontology processes identified by upregulated SSc genes in fibroblast (Fib) and pericyte (PC) clusters. (Figure 9E) Expression of EGFR in UMAP embedded data, clustered as in (Figure 9A). (Figure 9F) Heatmap of significantly upregulated genes in SSc EGFR-expressing fibroblasts compared to SSc EGFR-negative fibroblasts and healthy control fibroblasts. (Fig. 9G) t-distributed stochastic neighbor embedding (t-SNE) plot of gene expression in SSc versus healthy fibroblasts. (Fig. 9H) SSc skin and lungs and healthy skin and lungs were stained with an antibody against phosphorylated EGFR at Y1068. Images are 40x magnification, and scale bars are 40 μm. (Fig. 9I) Number of pEGFR+ cells in each condition (n=3 slides each, 10 high power fields (hpf) per slide). Heatmaps in (Fig. 9C and Fig. 9F) are log2 (fold change) with *=P<0.05, **=P<0.01, ***=P<0.001 and adjusted using Benjamini-Hochberg correction for multiple testing. (FIG. 1I) Data are means ± SD analyzed by unpaired two-tailed Student's t test (ns, not significant; *P<0.05; ****P<0.0001).
[0085] 10A to 10G show epiregulin +We show that dendritic cells accumulate in human skin and lung fibrosis. (Fig. 10A) Sankey diagram of enriched receptor-ligand pairs in SSc skin and at least two lung scRNA-Seq datasets. Ribbon width is proportional to 1 / (rank of skin SSc data). (Fig. 10B) Plot of CellPhoneDB rank (adjusted p-value) of EREG, AREG, and HBEGF interactions with EGFR in skin scRNA-Seq data (SSc skin 2(15)), keloid skin (14), and lung fibrosis studies (SSc lung 1(41), 2(42), 3(33)). For each sample, data are shown in the order HBEGF, AREG, EREG. Dotted line indicates rank=0.05. (Fig. 10C) Epiregulin expression in UMAP embedded data using the same clusters as in Fig. 9A. (Fig. 10D) Epiregulin - Heatmap of dendritic cell marker expression contrasting SSCs and healthy epiregulin-expressing bone marrow APCs (positive) compared to healthy cells (negative). (FIG. 10E) Photomicrographs of dermis and lung from SSc and healthy subject samples stained with an antibody against epiregulin. Arrows indicate positive cells. (FIG. 10F) Epiregulin in SSc dermis and lung. + Cell counts (n=3 slides each, 10 high power fields (hpf) per slide). (FIG. 10G) Immunofluorescence of SSc and healthy skin and lung stained for phosphorylated EGFR (pEGFR) and epiregulin (Ereg). Dashed lines represent areas of fibrotic dermis. Image magnification is 40x, scale bar is 40 μm. Data are mean ± SD (***P<0.001, ****P<0.0001) analyzed by unpaired two-tailed Student's t-test.
[0086] Figures 11A-11G show that epiregulin has distinct expression patterns during mouse skin and lung fibrosis. (Figures 11A-11C) B6 mice were subcutaneously injected with 0.2 mg bleomycin (BLM), and 3 weeks later, the skin was stained with hematoxylin and eosin (Figure 11A) and trichrome (Figure 11B). In the histology, the epidermis (epi), dermis (dermis), and dermal white adipose tissue (DWAT) are highlighted. (Figure 11C) Immunofluorescence images from the same skin using CD34 and CD45 antibodies. (Figure 11D) Hydroxyproline content of skin at different time points after subcutaneous bleomycin injection (n=3 per group). (Figure 11E) Heatmap of the mean log2 (fold change in expression) of ECM genes and EGFR ligands at different time points after subcutaneous bleomycin injection. n=3 per time point. (FIG. 11F) Mgl2 3 weeks after subcutaneous bleomycin injection compared to PBS control DTReGFPpANeo Bulk RNA sequencing of dendritic cells isolated from mouse fibrotic skin (n=3 per group). (FIG. 11G) Relative expression of epiregulin at different time points after intratracheal bleomycin administration in B6 mice. Data are mean ± SD (*P<0.05, **P<0.01) analyzed by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (FIG. 11D, FIG. 11E, and FIG. 11G).
[0087] 12A-12K show that epiregulin inhibition reduces mouse and human dermal fibrosis. (FIGS. 12A-12C) As shown in (FIG. 12A), B6 and Eregulin inhibition attenuate dermal fibrosis in mice and humans. - / -Cohorts of mice were injected subcutaneously with bleomycin and analyzed for skin thickness (Figure 12B) 35 days later. Representative histology is shown in (Figure 12C). (Figures 12D-12K) As shown in (Figure 12D), 21 days after bleomycin injection, mice began treatment with epiregulin antibody and compared to PBS-treated controls (NT) for 2 weeks. After euthanasia, skin was analyzed for dermal thickness (Figure 12E), hydroxyproline (Figure 12F), gene expression (Figures 12G-12H), and histology (Figure 12I), where hematoxylin and eosin staining is shown at the top, trichrome staining is shown at the middle, and pEGFR immunohistochemistry (IHC) is shown at the bottom. n=8 (PBS), 11 (BLM), and 12 (Ereg Ab). (Fig. 12J) Adjacent punch biopsies from the forearm of a patient with diffuse cutaneous SSc were cultured for 9 days in medium alone (NT) or with the addition of an epiregulin neutralizing antibody (Ereg Ab). The inset shows a further magnification of dermal collagen. (Fig. 12K) Skin explant medium was analyzed for pro-COL1A1 secretion by enzyme-linked immunosorbent assay (ELISA). Histology and immunohistochemistry (IHC) images are at 20x and 40x magnification, respectively. Data are mean ± SD (ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001) analyzed by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (Fig. 12B and Fig. 12E-12H) and paired two-tailed Student's t-test (Fig. 12K).
[0088] Figures 13A-13I show that epiregulin inhibition reduces mouse and human pulmonary fibrosis. (Figures 13A-13E) As shown in (Figure 13A), 10 days after intratracheal bleomycin administration, mice began 2 weeks of treatment with epiregulin antibody and were then euthanized. Lungs were analyzed for histology (Figure 13B), modified Ashcroft score (Figure 13C), hydroxyproline (Figure 13D), and epiregulin gene expression (Figure 13E). n=6 (PBS), 11 (BLM), and 7 (Ereg Ab). (Figure 13B) Histology images are at 10x magnification, scale bar 200 μm, and IHC images are at 40x magnification, scale bar 40 μm. (Fig. 13F-13I) Fresh lung tissues excised from deceased familial idiopathic pulmonary fibrosis donors were processed for histological staining and showed fibroblast nest formation and hyperplasia of alveolar type II epithelial cells as indicated by arrows (upper panel, hematoxylin and eosin (H&E), lower panel, trichrome, scale bar 50 μm). The same tissues were cut into cubes and cultured for 10 days in the presence of multi-kinase inhibitor nintedanib 0.1 μM (Nin), Alk5 inhibitor A-1544033 (IN-1130) 10 μM (Alk5i), epiregulin antibody 2.5 μg / ml (Ereg Ab), or untreated vehicle control (NT). (Fig. 13G-13I) Relative expression of indicated genes. n=4 per group. (Fig. 13I) Protein secretion of indicated genes measured by ELISA. n=8 per group. ELISA samples with weak signals and qPCR outliers identified by Grubbs test with α = 0.05 were excluded. Data are means ± SD (ns, not significant; *P < 0.05, **P < 0.01, ****P < 0.0001) analyzed by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (Figures 13C-13E) and Dunnett's multiple comparison test (Figures 13G-13I).
[0089] 14A to 14I show that type I interferon inhibits EREG. +Figure 14A shows that THP-1 monocytes induce EGFR-NOTCH circuitry between DCs and fibroblasts. (Figure 14A) Fold change in epiregulin expression upon incubation with each of the indicated cytokines. (Figure 14B-14D) Freshly isolated peripheral blood CD14 cells after incubation with IFNα2. + Monocytes (Figure 14B), and CD1c + Fold change in expression of epiregulin from dendritic cell precursors (Figure 14C) or cultured human bone marrow-derived dendritic cells (BMDCs) (Figure 14D). (Figure 14E) Fold change in expression of NOTCH ligands, receptors, and target genes by human foreskin fibroblasts (HFFs) incubated with recombinant epiregulin (rEreg) (n=5). (Figure 14F) Relative expression of epiregulin by BMDCs primed with IFNα2 prior to exposure to the NOTCH ligand DLL4 (n=3-4 per time point in each group). Statistics compare each group ± DLL4. (Figure 14G) Relative expression of EGFR ligands by HFFs (n=3). Fewer than 3 points of genes were below detectable levels. (FIG. 14H) Changes in extracellular matrix (ECM) gene expression when HFFs were incubated with medium alone (NT) or with an epiregulin neutralizing antibody (Ereg Ab). EDA refers to the extra domain A-containing isoform of fibronectin (n=5). (FIG. 14I) Model of the epiregulin-NOTCH circuit between monocyte-derived DC3 and fibroblasts. Data are mean ± SD (ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001) analyzed by unpaired two-tailed Student's t-test (FIG. 14A-14F and FIG. 14H) and one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (FIG. 14G).
[0090] Figures 15A-15F show that inhibition of type I interferon-EGFR-NOTCH axis prevents fibrosis in vivo. As shown in (Figure 15A), B6 mice were subcutaneously injected with bleomycin followed by intraperitoneal injection of Ifnar1 blocking antibody (Ifnar1 Ab), isotype control antibody (iso), or PBS (NT) at week 2. At week 3, skin was analyzed for histology (Figure 15B), dermal thickness (Figure 15C), hydroxyproline (Figure 15D), and gene expression (Figures 15E-15F). Data were compiled from two separate experiments, which were combined for clarity, as no significant differences were found between the NT and iso control groups. Data are means ± SD (ns, not significant; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001) analyzed by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (Figures 15C-15F).
[0091] Figures 16A-16D show cell cluster signature genes and immunostaining of SSc skin. (Figures 16A-16B) Major cell clusters and signature genes. Heatmap of log2 (fold change) gene expression of the top 10 upregulated genes per cluster in aggregated scRNA-Seq data of healthy control and SSc samples. (Figure 16C) Healthy and SSc skin and lung were stained with rabbit IgG isotype control antibody and compared to the signal shown in Figure 9H for anti-human pEGFR. (Figure 16D) Immunostaining of SSc and healthy skin with pEGFR and mesenchymal marker vimentin (magnification 20x, scale bar 100 μm).
[0092] Figures 17A-17C show low magnification images of healthy and SSc skin and lungs. Healthy and SSc skin and lungs were stained for histology with hematoxylin and eosin (H&E) (Figure 17A), pEGFR Tyr-1068 (Figure 17B), and epiregulin (Figure 17C). Dashed boxes label the location of the high magnification images of skin shown in Figures 9 and 10. Slides were imaged with a Keyence BZ-X800 microscope at 10x magnification and stitched using the same software. Scale bars are 500 μm.
[0093] Figures 18A-18D show EREG DC marker expression and immunophenotypic analysis. (Figure 18A) Diagram of enriched receptor-ligand growth factor pairs in SSc skin. (Figure 18B) Relative expression of epidermal growth factor (EGF), factor alpha (TGFA), betacellulin (BTC), EREG, amphiregulin (AREG), heparin-binding epidermal growth factor (EGF)-like growth factor (HBEGF), and epigen (EPGN) from healthy and SSc frozen skin whole tissue (n=3 per group). (Figure 18C) Peripheral blood mononuclear cells (PBMCs) isolated from healthy participants were stained for epiregulin along with adaptive and myeloid cell markers and analyzed by FACS. Gating revealed live CD45 + cells, followed by epiregulin + lin - (CD3 / CD20 / CD66b / NKp46) cells are shown, excluding T cells, B cells, granulocytes, and NK cells. Data are representative from two healthy participants. (Figure 18D) QCD141 + Staining revealed that all CD1c + cDC2 containing cells and epiregulin containing cDC1 + Quantification of DC subsets among cells. Data are means ± SD (ns, not significant, *P<0.05, ****P<0.0001) analyzed by unpaired two-tailed Student's t test (Figure 18B) and one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (Figure 18D).
[0094] 19A to 19C show Ereg - / - As shown in FIG. 19A, B6 and Ereg mice develop dermal fibrosis similar to wild-type mice. - / - Cohorts of mice were injected subcutaneously with bleomycin and analyzed 21 days later for hydroxyproline (Figure 19B) and histology (Figure 19C).
[0095] Figure 20 shows that NOTCH ligand nephroblastoma overexpressed (NOV) induces epiregulin expression in BMDCs. Relative expression of epiregulin by BMDCs treated with IFNα2 prior to exposure to the NOTCH ligand NOV (n=3-4 per time point in each group).
[0096] Figures 21A-21C show that hEreg NAb1 reduces fibrosis markers in sclerosing GvHD skin explants. Paired skin biopsies from the right arm and left flank of two sGvHD patients were incubated with 2.5 mg / ml of hEreg NAb1 or isotype control IgG1 antibody for 10 days. (Figure 21A) Fibrotic skin of the patient. (Figures 21B-21C) Media was changed every 48 hours and levels of fibrotic protein markers in the supernatants were quantified by ELISA (Abcam kits ab213831, ab210966, ab219046, ab187394, ab179886).
[0097] 22A-22B show analysis of EREG expression in SSc compared to healthy controls and compared to modified Rodnan Skin Score (mRSS). The results show that the number of EREG+ cells in SSc skin is increased compared to healthy controls (FIG. 22A), and EREG expression showed a significant positive correlation with disease severity by modified Rodnan Skin Score (mRSS) (FIG. 22B).
[0098] Systemic sclerosis (SSc / scleroderma) is an autoimmune disease that causes fibrosis of the skin and internal organs. The molecular signals that drive persistent fibrosis are not fully understood. This disclosure is driven by the hypothesis that immune-mesenchymal signaling circuits underlie SSc-associated skin and lung fibrosis, and that targeting specific ligands could prevent RTK activation in pathogenic fibroblasts, providing an effective and tolerable therapeutic approach compared to current limited options. Through single-cell RNA sequencing (ssRNA-Seq) analysis of skin and lung tissues from patients with diffuse cutaneous SSc, epidermal growth factor receptor (EGFR) activation was identified as a marker of pathogenic fibroblasts in both organs. Examination of ligand-receptor enrichment identified dendritic cell-derived epiregulin as a central driver of fibroblast EGFR activation. In mouse models and patient explants, epiregulin was essential for the persistence of skin and lung fibrosis, which could be reversed by epiregulin gene deletion or neutralizing antibodies. Mechanistically, epiregulin expression indicates an induced state of DC3 mediated by type I interferon, which drives a multicellular circuit in which EGFR induces NOTCH signaling and excessive extracellular matrix production. The scientific findings disclosed herein reveal that epiregulin is a key signal that maintains skin and lung fibrosis in SSc and other fibrotic diseases.
[0099] Accordingly, some of the disclosure are: methods that include the use of one or more inhibitors of epiregulin activity, which involves inhibiting the activity of epiregulin in a cell and reversing or preventing one or more changes in the cell associated with a disease or disorder, e.g., a fibrotic disease or disorder; and compositions, e.g., comprising one or more inhibitors of epiregulin activity, that inhibit the activity of epiregulin in a cell and reverse or prevent one or more changes in the cell associated with a disease or disorder, e.g., a fibrotic disease or disorder. Also disclosed are methods and compositions useful for treating or preventing a fibrotic disease or disorder in a subject, comprising, e.g., the antibodies, one or more inhibitors of epiregulin activity, and antigen-binding fragments disclosed herein.
[0100] definition Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Additionally, any methods or materials similar or equivalent to those described herein can be used in the practice of this application. For purposes of this application, the following terms are defined:
[0101] It is understood that the term "comprising" as used herein to describe embodiments of the present application includes embodiments "consisting of" and / or "consisting essentially of."
[0102] The term "antibody" refers to all immunoglobulin isotypes (e.g., IgG, IgA, IgE, IgM, IgD, and IgY), including the various monomeric, polymeric, and chimeric forms, unless otherwise specified. Specifically included within the term "antibody" are polyclonal antibodies, monoclonal antibodies (mAbs), and antibody-like polypeptides, such as chimeric and humanized antibodies. Immunoglobulin molecules may be of any class (e.g., IgG1, IgG2, IgG3, IgG4, IgM1, IgM2, IgA1, and IgA2) or subclass.
[0103] The term "antigen-binding fragment" refers to any protein structure that may exhibit binding affinity to a particular antigen. Antigen-binding fragments include those produced by any known technique, such as enzymatic cleavage, peptide synthesis, and recombinant techniques. Some antigen-binding fragments consist of a portion of an intact antibody that retains the antigen-binding specificity of the parent antibody molecule. For example, an antigen-binding fragment may contain at least one variable region (heavy or light chain variable region) or one or more complementarity determining regions (CDRs) of an antibody known to bind to a particular antigen. Examples of suitable antigen-binding fragments include, but are not limited to: single chain molecules such as Fab, F(ab')2, Fc, Fabc, Fv molecules, scFv, and disulfide-linked Fv (sdFv); intrabodies; diabodies; minibodies; linear antibodies; single domain antibodies such as sdAb (VL or VH); camelid nanobodies (VHH domains); multispecific antibodies formed from antibody fragments; individual antibody light chains; individual antibody heavy chains; chimeric fusions of antibody chains or CDRs with other proteins; protein fragments. a polymer scaffold; a heavy chain monomer or dimer; a light chain monomer or dimer; a dimer consisting of one heavy chain and one light chain; a monovalent fragment consisting of the VL, VH, CL and CH1 domains; or a monovalent antibody as described in WO2007059782, which is incorporated herein by reference in its entirety; a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; an Fd fragment consisting essentially of the VH and CH1 domains; a dAb fragment; or isolated CDRs. All antibody isotypes can be used to generate antigen-binding fragments. Furthermore, antigen-binding fragments may include non-antibody protein frameworks, such as protein scaffolds, into which polypeptide segments can be conveniently incorporated in an orientation that confers affinity for a given antigen of interest. The phrase "an antibody or antigen-binding fragment thereof" can be used to indicate that a given antigen-binding fragment incorporates one or more amino acid segments of the antibody referred to in the phrase.
[0104] The term "epitope" refers to an antigenic determinant that interacts with a specific antigen-binding site, known as the paratope, in the variable region of an antibody molecule. A single antigen may have more than one epitope. Thus, different antibodies may bind to different regions of an antigen, resulting in different biological effects. The term "epitope" also refers to a site on an antigen to which B and / or T cells respond. It also refers to the region of an antigen to which an antibody binds. Epitopes may be defined as structural or functional. Functional epitopes are generally a subset of structural epitopes, and have residues that directly contribute to the affinity of the interaction. Epitopes may be conformational, i.e., composed of non-linear amino acids. In certain embodiments, epitopes may include determinants that are chemically active surface groups of molecules, such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups, and in certain embodiments may have specific three-dimensional structural characteristics, and / or specific charge characteristics.
[0105] The terms "polypeptide" or "peptide" are used herein to encompass all kinds of natural and synthetic proteins, including protein fragments of any length, fusion proteins, and modified proteins, including but not limited to glycoproteins, as well as other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, pegylation, biotinylation, etc.).
[0106] The term "percent (%) sequence identity" or "homology" with respect to polypeptide and nucleotide sequences described herein is defined as the percentage of amino acid or nucleic acid residues in a candidate sequence that are identical to the amino acid or nucleic acid residues in a reference sequence to which the sequences are compared after alignment of the sequences. In some cases, conservative substitutions are considered part of the sequence identity. Alignment to determine percent amino acid sequence identity can be accomplished in a variety of ways within the skill of the art, for example using publicly available software such as BLAST, BLAST-2, ALIGN, Megalign (DNASTAR), or MUSCLE software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein, % amino acid sequence identity values are generated using the sequence comparison computer program MUSCLE (Edgar, RC, Nucleic Acids Research 32(5):1792-1797, 2004; Edgar, RC, BMC Bioinformatics 5(1):113, 2004; each of which is incorporated by reference in its entirety for all purposes.
[0107] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a cell surface receptor that includes an extracellular antigen binding domain, a transmembrane domain, and a cytoplasmic domain that includes a lymphocyte activation domain and optionally one or more costimulatory signaling domains, all in a combination not found on a single receptor in nature. This includes, but is not limited to, receptors whose extracellular and cytoplasmic domains are not found together on a single receptor protein in nature. The chimeric antigen receptors of the present disclosure can be used with lymphocytes, such as T cells and natural killer (NK) cells.
[0108] The terms "T cell" and "T lymphocyte" are used interchangeably and synonymously herein. Non-limiting examples of T cells include naive T lymphocytes, thymocytes, mature T lymphocytes, immature T lymphocytes, activated T lymphocytes, or resting T lymphocytes. T cells may be T helper (Th) cells, such as T helper 1 (Th1) cells or T helper 2 (Th2) cells. T cells may be cytotoxic T cells (CTL; CD8+ T cells), helper T cells (HTL; CD4+ T cells), CD4+ T cells, CD4+CD8+ T cells, tumor-infiltrating cytotoxic T cells (TIL; CD8+ T cells), or any other subclass of T cells. Further exemplary T cell populations include memory T cells and naive T cells. Also included are "NKT cells," which consist of a specialized population of T cells that express the semi-invariant αβ T cell receptor and various molecular markers commonly associated with natural killer cells (NK cells), such as NK1.1. - and NK1.1 + , and CD4 - , CD4 + , CD8 - , and CD8 +NKT cells include T cell receptors (TCRs) on NKT cells that are unique in that they recognize glycolipid antigens presented by major histocompatibility complex I (MHC-I)-like molecules CD Id. They also include "gamma-delta T cells (γδ T cells)," which can refer to a specialized subset of T cells that have a unique TCR on their surface, and unlike most T cells whose TCRs are composed of two glycoprotein chains called α- and β-TCR chains, the TCR of γδ T cells is composed of γ- and δ-chains. γδ T cells can contribute to immune surveillance and immune regulation, and can be an important source of IL-17 to induce potent CD8+ cytotoxic T cell responses. They also include "regulatory T cells" or "Tregs," which refer to T cells that suppress aberrant or excessive immune responses and contribute to immune tolerance. Tregs are generally transcription factor Foxp3-positive CD4+ T cells, and may also include transcription factor Foxp3-negative regulatory T cells, which are IL-10-producing CD4+ T cells.
[0109] As used herein, the term "host cell" may be any type of cell, such as a primary cell, a cultured cell, or a cell from a cell line. In specific embodiments, the term "host cell" refers to a cell that has been transfected with a nucleic acid molecule, and the progeny or potential progeny of such a cell. The progeny of such a cell may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in subsequent generations, or due to integration of the nucleic acid molecule into the host cell genome.
[0110] As used herein, the terms "specifically binds, binds specifically," "specifically recognizes," and "is specific for," or derivatives thereof, when used in the context of an antibody or antibody fragment, mean that the antibody or antibody fragment forms a complex with an antigen (e.g., epiregulin) that is relatively stable under physiological conditions. In certain embodiments, specific binding determines the presence of a target in the presence of a heterogeneous population of molecules, including biological molecules (e.g., cell surface receptors). For example, an antibody that specifically recognizes a target (which may be an epitope) is an antibody that binds to this target with higher affinity, higher avidity, more readily, and / or with a longer duration than it binds to other molecules. In some embodiments, the extent of binding of an antibody to unrelated molecules is less than about 10% of the binding of the antibody to the target, as measured, for example, by radioimmunoassay (RIA). In some embodiments, the dissociation constant (K D ) is ≦10 -5 M, ≦10 -6 M, ≦10 -7 M, ≦10 -8 M, ≦10 -9 M, ≦10 -10 M, ≦10 -11 M or ≦10 -12 In some embodiments, the antibody specifically binds to an epitope on a protein that is conserved among proteins from various species. In some embodiments, specific binding may include, but does not necessarily include, exclusive binding. The binding specificity of an antibody or antigen-binding domain can be determined by methods known in the art. Such methods include, but are not limited to, Western blot, ELISA, RIA, ECL, IRMA, EIA, BIACORE™ Biolayer Interference Assay, and peptide scan.
[0111] As used herein, the term "inhibit" means to decrease an activity, response, condition, disease, or other biological parameter. This includes, but is not limited to, the complete elimination of the activity, response, condition, or disease. This may include a decrease in the activity, response, condition, or disease, for example, by 10%, as compared to the original or control level. Thus, the decrease may be, for example, a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount in between, as compared to the original or control level.
[0112] As used herein, "treatment" or "treating" is an approach to obtain beneficial or desired results, including clinical results. For purposes of this application, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviation of one or more symptoms resulting from a disease or disorder; reduction in the extent of a disease or disorder; stabilization of a disease or disorder (e.g., preventing or slowing the progression of a disease or disorder); preventing or slowing the recurrence of a disease or disorder; slowing or decelerating the progression of a disease or disorder; improving the disease or disorder status; providing remission (partial or complete) of a disease or disorder; reducing the dose of one or more other drugs required to treat a disease or disorder; improving quality of life; and / or prolonging survival. "Treatment" also encompasses reversal of one or more pathological consequences of a disease or disorder. As used herein, the term "reversal" or "reverse" in the context of one or more pathological consequences of a disease or disorder may refer to a complete reversal of one or more pathological consequences of a disease or disorder (e.g., a complete return to a non-disease state), a partial reversal of said one or more pathological consequences (e.g., a reduction in the severity of said one or more pathological consequences by any amount). The methods of the present application contemplate any one or more of these modes of treatment. The benefit to the subject being treated is statistically significant or at least perceptible to the patient or physician.
[0113] The term "fibrosis" is known in the art and is used herein to refer to the formation or development or accumulation of excess extracellular matrix within an organ or tissue as a repair or reactive process, as opposed to the formation of healthy tissue as a normal component of the organ or tissue.
[0114] As used herein, the term "effective amount" refers to an amount of an agent or composition sufficient to treat a specified condition, disorder, medical condition, or disease, e.g., ameliorate, alleviate, reduce, and / or delay one or more of its symptoms (e.g., clinical or subclinical symptoms). For therapeutic applications, beneficial or desired results include, for example, reducing one or more symptoms (biochemical, histological, and / or behavioral) caused by the disease (including its complications and intermediate pathological phenotypes that appear during the progression of the disease); improving the quality of life of people affected by the disease; reducing the dose of other drugs required to treat the disease; enhancing the effect of another drug; delaying the progression of the disease; and / or extending the survival of the patient. An effective amount can be administered in one or more administrations. It is noted that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective when administered individually. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular agent or agents employed, the mode of administration, and the like.
[0115] As used herein, the term "simultaneous administration" means that the first and second therapies in a combination therapy are administered with a time interval of about 15 minutes or less, such as about 10 minutes or less, about 5 minutes or less, or about 1 minute or less. When the first and second therapies are administered simultaneously, the first and second therapies can be contained in the same composition (e.g., a composition that includes both the first and second therapies) or can be contained in separate compositions (e.g., the first therapy in one composition and the second therapy in another composition).
[0116] As used herein, the term "sequential administration" means that the first and second therapies in a combination therapy are administered at intervals of more than about 15 minutes, such as more than about 20 minutes, more than about 30 minutes, more than about 40 minutes, more than about 50 minutes, more than about 60 minutes, or even longer. Either the first or second therapy may be administered first. The first and second therapies are contained in separate compositions, which may be contained in the same package or kit, or in different packages or kits.
[0117] As used herein, the term "concurrent administration" means that the administration of a first therapy and a second therapy in a combination therapy overlap with each other.
[0118] As used herein, "pharmacologically acceptable" or "pharmacologically compatible" means a material that is not biologically undesirable or otherwise undesirable, e.g., that can be incorporated into a pharmaceutical composition administered to a patient and does not cause any significant undesirable biological effects or interact in a deleterious manner with any other components of the composition in which it is contained. A pharma-ceutically acceptable carrier or excipient preferably meets required toxicological and manufacturing testing standards and / or is included in an inactive ingredients guide prepared by the U.S. Food and Drug Administration or other state / federal government or is listed in the U.S. Pharmacopeia or other generally recognized pharmacopoeias for use in mammals, more particularly humans.
[0119] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle used in the administration of a compound. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water or aqueous solutions, saline solutions, and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including, but not limited to, one or more of a binder (for compressed tablets), a glidant, an encapsulating agent, a flavoring agent, and a coloring agent. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin, which is incorporated herein by reference in its entirety for all purposes.
[0120] The terms "subject," "individual," and "patient" are used interchangeably herein to refer to a mammal, including, but not limited to, a human, bovine, equine, feline, canine, rodent, or primate. In some embodiments, the subject is a human. In certain preferred embodiments, the subject is a human.
[0121] In this specification, the term "about" attached to a value or parameter includes (and describes) a variation that is directed to the value or parameter itself. For example, a statement "about X" includes a statement of "X". In certain embodiments, a range can be within a magnitude of a given value or range, preferably within 50%, more preferably within 20%, even more preferably within 10%, and even more preferably within 5%. The acceptable variation encompassed by the terms "about" or "approximately" depends on the particular system under study and can be readily appreciated by one of ordinary skill in the art.
[0122] As used herein, the term "about XY" has the same meaning as "about X to about Y."
[0123] As used in this specification and the appended claims, the singular forms "a," "an," or "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein and / or that will become apparent to those of skill in the art upon reading this disclosure. As will be apparent to one of skill in the art, a subject being evaluated, selected for treatment, and / or receiving treatment is a subject in need of such activity.
[0124] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of statistical analysis, molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques can be found, for example, in Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Bonifacino et al. eds. Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, NJ; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. Science, John Wiley and Sons, Inc.: Hoboken, NJ; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ. Additional techniques are described, for example, in U.S. Patent No. 7,912,698, and U.S. Patent Publication Nos. 2011 / 0202322 and 2011 / 0307437, each of which is incorporated by reference in its entirety for all purposes.
[0125] The terms and expressions employed are used as terms of description rather than of limitation, and the use of such terms and expressions does not exclude equivalents of the features illustrated and described or portions thereof, but allows various modifications within the scope of the claimed technology.
[0126] Epiregulin inhibitors Inhibition of epiregulin activity can be achieved by any method known to those skilled in the art. Examples of methods for inhibiting epiregulin activity include, but are not limited to, reducing the expression of endogenous epiregulin gene, reducing the expression of epiregulin mRNA, and inhibiting the activity of epiregulin protein. Thus, an epiregulin inhibitor can be a compound or composition that reduces the expression of epiregulin gene, a compound or composition that reduces epiregulin mRNA half-life, stability and / or expression, or a compound or composition that inhibits the function of epiregulin protein. Non-limiting examples of epiregulin inhibitors that can be used according to the present disclosure include antibodies or antigen-binding fragments, small molecules, decoy receptors (e.g., soluble receptors), CAR-modified cells (e.g., CAR-T cells), aptamers, alternative scaffolds, polypeptides, nucleic acids, siRNAs, ribozymes, antisense molecules, peptidomimetics, or any combination thereof.
[0127] Epiregulin inhibition may be achieved directly or indirectly. For example, epiregulin can be directly inhibited by a compound or composition that directly interacts with the epiregulin protein, such as an antibody or a soluble epiregulin receptor. Alternatively, epiregulin can be indirectly inhibited by a compound or composition that inhibits the epiregulin receptor, an epiregulin downstream effector, or an upstream regulator that upregulates epiregulin expression.
[0128] Reducing the expression of endogenous epiregulin gene includes providing a specific inhibitor of epiregulin gene expression. Reducing the expression of epiregulin mRNA or epiregulin protein includes reducing the half-life or stability of epiregulin mRNA, or reducing the expression of epiregulin mRNA. Methods for reducing epiregulin expression include, but are not limited to, using siRNA; microRNA; antibodies; soluble receptors; antisense nucleic acids; ribozymes; expression vectors encoding transdominant negative variants; peptides; small molecules; other specific inhibitors of epiregulin gene, mRNA, and protein expression; and combinations thereof.
[0129] Antibodies and antigen-binding fragments In one embodiment, the epiregulin inhibitor is an antibody or antigen-binding fragment. It will be understood by those skilled in the art that an antibody includes any immunoglobulin molecule capable of specifically binding to an epitope present on a target molecule, whether from a natural or recombinant source. In the present disclosure, the target molecule may be epiregulin, an epiregulin receptor, an epiregulin downstream effector, or a fragment thereof. In one aspect of the present disclosure, epiregulin is directly inhibited by an antibody or antigen-binding fragment that specifically binds to an epitope on epiregulin. In another aspect, epiregulin is indirectly inhibited by an antibody or antigen-binding fragment that specifically binds to an epitope on the epiregulin receptor. In yet another aspect, the effect of epiregulin is blocked by an antibody or antigen-binding fragment that specifically binds to an epitope on a downstream effector, such as an extracellular matrix (ECM) protein, a protease, an antiprotease, a transcription factor, a fibrogenic cytokine, or an apoptosis regulator.
[0130] In some embodiments, described herein are isolated antibodies, or antigen-binding fragments thereof, that specifically bind to epiregulin. In some embodiments, the epiregulin is human epiregulin. In some embodiments, the isolated antibodies or antigen-binding fragments specifically described herein bind to the epidermal growth factor (EGF)-like domain of epiregulin.
[0131] In some embodiments, the isolated antibodies or antigen-binding fragments described herein bind with high affinity, e.g., about 1×10, as determined by, e.g., biolayer interference assays, surface plasmon resonance, or KinExA assays as practiced by one of skill in the art. -8 M, for example, but not limited to, about 1-9.9 (or any range or value therein, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9) x 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M, 10 -14 M, 10 -15 M, any of the ranges or values of K D In some embodiments, the K D is 1×10 -9 In some embodiments, the K D x10 -10 In some embodiments, the K D is about 1 x 10 -11 , 2×10 -11 , 3×10 -11 , 4×10 -11 , 5×10 -11 , 6×10 -11 , 7×10 -11 , 8×10 -11 , 9×10 -11 , 1×10 -10 , 2×10 -10 , 3×10 -10 , 4×10 -10 , 5×10 -10 , 6×10 -10 , 7×10 -10 , 8×10-10 , or 9 x 10 -10 M. An example of K D is about 3.8 x 10 -11 Equal to M.
[0132] Methods for testing an antibody for its ability to bind to a target peptide or any portion thereof are known in the art and include any antibody-antigen binding assay, such as, for example, biolayer interference assays, radioimmunoassays (RIA), Western blots, enzyme-linked immunosorbent assays (ELISA), immunoprecipitation, and competitive inhibition assays. In some embodiments, the K D Values are determined using a Biolayer Interference Assay.
[0133] In some embodiments, the isolated antibody or antigen-binding fragment described herein is an epiregulin neutralizing antibody or antigen-binding fragment. In some embodiments, the isolated antibody or antigen-binding fragment described herein inhibits the activity of epiregulin. In some embodiments, the isolated antibody or antigen-binding fragment described herein inhibits the interaction of epiregulin with an ErbB receptor. In some embodiments, the ErbB receptor is epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), HER3, and / or HER4. In some embodiments, the ErbB receptor is EGFR.
[0134] In some embodiments, the isolated antibodies or antigen-binding fragments described herein inhibit epiregulin-induced proliferation of fibroblasts. In some embodiments, the isolated antibodies or antigen-binding fragments described herein have an IC of less than about 100 nM, such as, but not limited to, about 90 nM, 80 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2.5 nM, 2 nM, 1.5 nM, 1 nM, 0.5 nM, 0.2 nM, or 0.1 nM. 50In some embodiments, the isolated antibody or antigen-binding fragment described herein has an IC of less than about 10 nM. 50 and inhibits epiregulin-induced proliferation of fibroblasts. 50 is about 10 nM or less. 50 is equal to approximately 1.8 nM.
[0135] In some embodiments, the isolated antibody or antigen-binding fragment described herein does not specifically bind to mouse epiregulin.
[0136] In some embodiments, the isolated antibody or antigen-binding fragment described herein does not specifically bind to one or more other human EGFR ligands, hi some embodiments, the one or more other EGFR ligands are transforming growth factor alpha (TGFA), betacellulin (BTC), heparin-binding EGF-like growth factor (HB-EGF), epigen (EPGN), epidermal growth factor (EGF), and / or amphiregulin (AREG).
[0137] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO:1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0138] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (VH) encoded by the nucleotide sequence of SEQ ID NO:5, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0139] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises an HCDR1 comprising the amino acid sequence GGSISSSGYY (SEQ ID NO:2), an HCDR2 comprising the amino acid sequence FYYSGNT (SEQ ID NO:3), and / or an HCDR3 comprising the amino acid sequence ARHPFNWNDHYHYMDV (SEQ ID NO:4).
[0140] Amino acid sequence of the hEreg NAb1 heavy chain variable region (VH). HCDR sequences are underlined and in bold. TIFF2025509220000001.tif32169
[0141] Nucleotide sequence encoding the hEreg NAb1 heavy chain variable region (VH). CACCTGCAACTGCAGGAGTCGGGCCCAGGACTGGTGAAGTCTTCGGAGACCCTGTCCCTCACCTGCTCTGTCTCTGGTGGCTCCATCAGCAGTAGTGGTTACTACTGGGGCTGGATCCGCCAGCCCCAGGAAGGGCCTGGAGTGGATTGGGAGTTTCTATTATAGTGGGAACACCTACTACAACCCG TCCCTCAAGAGTCGAGTCACCATATCCGCAGACACGTCCAAGAGCCAGTACTCCCTGAAGCTGAGTTCTGTGACCGCCGCAGACACGGCTGTGTATTATTGTGCGAGACATCCGTTCAACTGGAACGACCACTATCACTACATGGACGTCTGGGGCAACGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 5)
[0142] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO:6, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0143] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (VL) encoded by the nucleotide sequence of SEQ ID NO: 10, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0144] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises an LCDR1 comprising the amino acid sequence QSISNY (SEQ ID NO:7), an LCDR2 comprising the amino acid sequence AAS (SEQ ID NO:8), and / or an LCDR3 comprising the amino acid sequence QQSYITSIT (SEQ ID NO:9).
[0145] Amino acid sequence of the hEreg NAb1 light chain variable region (VL). The LCDR sequence is underlined and in bold. TIFF2025509220000002.tif28169
[0146] Nucleotide sequence encoding the hEreg NAb1 light chain variable region (VL). GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTGGGAGACAGCGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAACTATTTAAATTGGTATCAGAAGAAACCAGGGAAAGCCCCTAAGGTCCTGATCTATGCTGCATCCAGTTTGCA AAGTGGAGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGAACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACATAACCTCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAA (SEQ ID NO: 10)
[0147] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a VH comprising the amino acid sequence of SEQ ID NO:1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto; and / or three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a VL comprising the amino acid sequence of SEQ ID NO:6 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0148] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a VH comprising the amino acid sequence of SEQ ID NO:1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto; and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a VL comprising the amino acid sequence of SEQ ID NO:6, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0149] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a VH comprising the amino acid sequence of SEQ ID NO:1; and / or three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a VL comprising the amino acid sequence of SEQ ID NO:6.
[0150] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: three heavy chain CDRs (HCDR1, HCDR2, and HCDR3) contained within a VH comprising the amino acid sequence of SEQ ID NO:1; and three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a VL comprising the amino acid sequence of SEQ ID NO:6.
[0151] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: an HCDR1 comprising the amino acid sequence of SEQ ID NO:2, an HCDR2 comprising the amino acid sequence of SEQ ID NO:3, and / or an HCDR3 comprising the amino acid sequence of SEQ ID NO:4; and / or an LCDR1 comprising the amino acid sequence of SEQ ID NO:7, an LCDR2 comprising the amino acid sequence of SEQ ID NO:8, and / or an LCDR3 comprising the amino acid sequence of SEQ ID NO:9.
[0152] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: an HCDR1 comprising the amino acid sequence of SEQ ID NO:2, an HCDR2 comprising the amino acid sequence of SEQ ID NO:3, and an HCDR3 comprising the amino acid sequence of SEQ ID NO:4; and an LCDR1 comprising the amino acid sequence of SEQ ID NO:7, an LCDR2 comprising the amino acid sequence of SEQ ID NO:8, and an LCDR3 comprising the amino acid sequence of SEQ ID NO:9.
[0153] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: a VH comprising the amino acid sequence of SEQ ID NO:1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto; and / or a VL comprising the amino acid sequence of SEQ ID NO:6, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0154] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises: a VH comprising the amino acid sequence of SEQ ID NO:1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto; and a VL comprising the amino acid sequence of SEQ ID NO:6, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0155] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises a VH comprising the amino acid sequence of SEQ ID NO:1, and / or a VL comprising the amino acid sequence of SEQ ID NO:6.
[0156] In some embodiments, the isolated antibody or antigen-binding fragment described herein comprises a VH comprising the amino acid sequence of SEQ ID NO:1, and a VL comprising the amino acid sequence of SEQ ID NO:6.
[0157] In some embodiments, the isolated antibody or antigen-binding fragment described herein is a human antibody, a monoclonal antibody, a humanized antibody, a single chain antibody, a Fab, a Fab', a F(ab')2, an Fv, or a scFv.
[0158] Those skilled in the art will understand that the exact definition of CDR boundaries and lengths vary among different classification and numbering systems. Thus, CDRs may be referred to by Kabat, Chothia, Contact, or some other boundary definition. Although the boundaries are different, each of these systems has some overlap in the so-called "hypervariable regions" components within the variable sequences. Thus, CDR definitions according to these systems may differ in length and boundary regions with respect to the adjacent framework regions. See, e.g., Kabat et al., NIH Publication No. 91-3242 (1991); Chothia et al., J. Mol. Biol. 196:901 (1987); and MacCallum et al., J. Mol. Biol. 262:732 (1996) (each of which is incorporated herein by reference in its entirety).
[0159] Typically, CDRs form loop structures that can be classified as canonical structures. The term "canonical structure" refers to the main-chain conformation adopted by antigen-binding (CDR) loops. Comparative structural studies have shown that five of the six antigen-binding loops have a limited repertoire of available conformations. Each canonical structure can be characterized by the torsion angles of the polypeptide backbone. Corresponding loops between antibodies therefore have very similar three-dimensional structures, despite the high variability of amino acid sequences in most parts of these loops (Chothia et al., J. Mol. Biol. 196:901 (1987); Chothia et al., "Conformations of Immunoglobulin Hypervariable Regions," Nature. 342:877 (1989); Martin and Thornton, J. Mol. Biol. 263:800 (1996); each of the above references is incorporated herein by reference in its entirety). Furthermore, there is a relationship between the loop structure adopted and the amino acid sequence surrounding it: the conformation of a particular canonical class is determined by the length of the loop and the amino acid residues that are located at key positions within the loop and within the conserved framework (i.e., outside the loop). Thus, assignment to a particular canonical class can be made based on the presence of these key amino acid residues.
[0160] Also disclosed herein are isolated antibodies or antigen-binding fragments thereof that compete with the anti-epiregulin antibodies or antigen-binding fragments described herein for binding to epiregulin. As used herein, the term "compete" or "cross-compete" means that an antibody or antigen-binding fragment thereof binds to an antigen and inhibits or blocks the binding of another antibody or antigen-binding fragment thereof. This term also includes bidirectional competition between two antibodies (a first antibody that binds and blocks the binding of a second antibody, and vice versa). In some embodiments, the competing antibody and the anti-epiregulin antibody described herein may bind to the same epitope. Alternatively, the competing antibody and the anti-epiregulin antibody described herein may bind to different, but overlapping, epitopes, such that the binding of one antibody inhibits or blocks the binding of the second antibody, for example, by steric hindrance. Cross-competition between antibodies can be measured by methods known in the art, for example, by real-time label-free biolayer interference assay. Cross-competition between two antibodies can be expressed as the binding of the second antibody less than the background signal due to self-self binding (where the first antibody and the second antibody are the same antibody). Cross-competition between two antibodies can be expressed, for example, as the % binding of the second antibody less than the background self-self binding (where the first antibody and the second antibody are the same antibody).
[0161] Also disclosed herein are isolated antibodies, or antigen-binding fragments thereof, that bind to the same epitope as the anti-epiregulin antibodies or antigen-binding fragments described herein.
[0162] Without wishing to be bound by theory, when the epiregulin inhibitor used in the compositions and methods described herein is a polyclonal antibody, the antibody can be generated by inoculating a suitable animal with a peptide comprising epiregulin, epiregulin receptor, epiregulin downstream effector, or a fragment thereof. These polypeptides or fragments thereof can be obtained by any method known in the art, including chemical synthesis and biological synthesis. Antibodies produced in the inoculated animal that specifically bind to epiregulin, epiregulin receptor, epiregulin downstream effector, or a fragment thereof are then isolated from body fluids taken from the animal. Antibodies may be generated in this manner in multiple non-human mammals, including but not limited to goats, sheep, horses, camels, rabbits, and donkeys. Methods for generating polyclonal antibodies are known in the art and are described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY).
[0163] Monoclonal antibodies against epiregulin, epiregulin receptor, epiregulin downstream effectors, or fragments thereof may be prepared using any known monoclonal antibody preparation procedure, such as those described in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and Tuszynski et al. (1988, Blood, 72:109-115). Human monoclonal antibodies may be prepared by the methods described in U.S. Patent Publication No. 2003 / 0224490. Monoclonal antibodies against an antigen can be generated from mice inoculated with the antigen using standard procedures in the art. Nucleic acids encoding monoclonal antibodies obtained using such procedures can be cloned and sequenced using techniques available in the art, such as those described in Wright et al. (1992, Critical Rev. in Immunol. 12(3, 4):125-168) and references cited therein.
[0164] When the antibody used in the disclosed method is a biologically active antibody fragment or synthetic antibody capable of targeting epiregulin, epiregulin receptor, epiregulin downstream effector, or fragments thereof, the antibody is prepared as follows: A nucleic acid encoding the desired antibody or fragment thereof is cloned into a suitable vector. The vector is transfected into a cell suitable for producing large amounts of the antibody or fragment thereof. The antibody is then produced by expressing DNA encoding the desired antibody in the cell. Nucleic acids encoding the desired peptide can be cloned and sequenced using techniques available in the art, for example, as described in Wright et al. (1992, Critical Rev. in Immunol. 12(3, 4):125-168) and references cited therein. Alternatively, the desired antibody or fragment thereof can be synthesized in large quantities using chemical synthesis techniques. If the amino acid sequence of the antibody is known, the desired antibody can be chemically synthesized using methods known in the art, as described elsewhere herein.
[0165] A non-limiting example of an antibody or antigen-binding fragment that can be used in accordance with the present disclosure includes anti-human epiregulin antibody AF1195, available from R&D Biosciences. Another non-limiting example of an antibody or antigen-binding fragment that can be used in accordance with the present disclosure includes anti-mouse / human epiregulin antibody Clone #189611 (MAB1068), available from R&D Biosciences.
[0166] In some embodiments, the isolated antibody or antigen-binding fragment described herein is a humanized antibody. The disclosure also includes the use of humanized antibodies that specifically react with an epitope present on a target molecule (e.g., epiregulin). Humanized forms of non-human (e.g., murine) antibodies include chimeric immunoglobulins, immunoglobulin chains, or fragments thereof that contain minimal sequence derived from the non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibodies) in which the CDRs of the recipient antibody have been replaced with residues from the CDRs of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some examples, Fv framework residues of the human immunoglobulin are replaced with corresponding non-human residues. Humanized antibodies may also include residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody will contain substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are of a human immunoglobulin consensus sequence. Optimally, the humanized antibody will also contain at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
[0167] Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Antibody humanization techniques generally involve the use of recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule. Humanization can essentially be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Thus, humanized forms of non-human antibodies (or fragments thereof) are chimeric antibodies or fragments in which substantially less than an entire human variable domain is replaced by the corresponding sequence from the non-human species. In practice, humanized antibodies are typically those in which some CDR residues and possibly some framework residues are substituted with residues from equivalent sites in rodent antibodies.
[0168] The choice of human variable domains, both light and heavy, used in the construction of a humanized antibody is crucial to reduce antigenicity. According to the "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence that is closest to the rodent one is then accepted as the human framework for the humanized antibody. Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies.
[0169] It is further important that antibodies be humanized while retaining high affinity for the antigen and other favorable biological properties. To achieve this goal, humanized antibodies are preferably prepared by a process of analysis of parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commercially available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays allows analysis of the possible role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., analysis of residues that influence the ability of the candidate immunoglobulin to bind to an antigen. In this way, framework residues can be selected and combined from the consensus and import sequences to achieve the desired antibody characteristic, such as improved affinity for one or more target antigens. In general, the CDR residues are directly and most substantially involved in influencing antigen binding.
[0170] The antibodies or antigen-binding fragments described herein include variants with single or multiple amino acid substitutions, deletions, or additions that retain the biological properties (e.g., binding affinity or immune effector activity) of the described antibodies or antigen-binding fragments.
[0171] These variants include: (i) variants in which one or more amino acid residues are replaced with a conserved or non-conserved amino acid; (ii) variants in which one or more amino acids are added to or deleted from the polypeptide; (iii) variants in which one or more amino acids include a substituent; and (iv) variants in which the described antibodies or antigen-binding fragments are fused or conjugated to another peptide or polypeptide (e.g., a fusion partner, a protein tag) or other chemical moiety that can confer useful properties to the antibody or antigen-binding fragment, such as an antibody epitope, a polyhistidine sequence, a biotin moiety, etc. The antibodies or antigen-binding fragments described herein may include variants in which an amino acid residue from one species is replaced with the corresponding residue from another species, either at a conserved or non-conserved position. In other embodiments, an amino acid residue at a non-conserved position is replaced with a conserved or non-conserved residue. Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, e.g., their hydrophobicity, hydrophilicity, charge, size, etc.
[0172] The amino acid substitutions may be conservative, meaning that the replaced amino acid has similar chemical properties as the original amino acid. A person skilled in the art will understand which amino acids share similar chemical properties. For example, the following groups of amino acids share similar chemical properties such as size, charge, and polarity: Group I (Ala, Ser, Thr, Pro, Gly); Group II (Asp, Asn, Glu, Gln); Group III (His, Arg, Lys); Group IV (Met, Leu, Ile, Val, Cys); Group V (Phe, Thy, Trp).
[0173] Thus, embodiments of the antibodies or antigen-binding fragments can include variants having about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even higher sequence identity to the depicted antibodies or antigen-binding fragments.
[0174] The antibodies or antigen-binding fragments described herein may be any one of a variety of antibody isotypes, such as IgM, IgD, IgG, IgA, and IgE. In some embodiments, the antibody isotype is an IgG1, IgG2, IgG3, or IgG4 isotype. In some embodiments, the antibody isotype is an IgA1 or IgA2. The specificity of an antibody or antigen-binding fragment thereof is determined primarily by the amino acid sequence and arrangement of the CDRs. Thus, the CDRs of one isotype can be transferred to another isotype without changing the antigen specificity. Alternatively, there are established techniques for switching a hybridoma from producing one antibody isotype to producing another antibody isotype without changing the antigen specificity (isotype switching). Thus, such antibody isotypes are within the scope of the described antibodies or antigen-binding fragments.
[0175] Those skilled in the art will further appreciate that the present disclosure encompasses the use of antibodies derived from Camelidae species. That is, the present disclosure includes, but is not limited to, the use of antibodies derived from Camelidae species. As is known in the art, Camelidae antibodies differ from most other mammalian antibodies in that they contain only heavy chains with complete and diverse antigen-binding capabilities, without any light chains (Hamers-Casterman et al., 1993, Nature, 363:446-448). Such heavy chain antibodies are useful in that they are smaller than conventional mammalian antibodies, more soluble than conventional antibodies, and more stable than some other antibodies. Camelidae species include, but are not limited to, Old World Camelidae, such as C. bactrianus and C. dromedarius. Camelidae further include, but are not limited to, New World Camelidae, including llamas, alpacas, vicuñas, and guanacos. The production of polyclonal sera from camelid species is generally similar to the production of polyclonal sera from other animals such as sheep, donkey, goat, horse, mouse, chicken, rat, etc. Armed with this disclosure and the methods detailed therein, one skilled in the art can prepare high titer antibodies from camelid species. By way of example, the production of antibodies in mammals is detailed in references such as Harlow et al. (1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, NY).
[0176] V isolated from other sources, such as animals with heavy chain disease H Proteins (Seligmann et al., 1979, Immunological Rev. 48:145-167, incorporated herein by reference in its entirety) are also useful in the compositions and methods of the present disclosure. The present disclosure further includes variable heavy chain immunoglobulins produced from mice and other mammals, as detailed in (1989, Nature 341:544-546, incorporated herein by reference in its entirety). Briefly, V HThe gene is isolated from mouse spleen specimens and expressed in E. coli. The present disclosure encompasses the use of such heavy chain immunoglobulins in the compositions and methods detailed herein.
[0177] Antibodies useful as epiregulin inhibitors of the present disclosure can also be obtained from a phage antibody library. To generate a phage antibody library, a cDNA library is first obtained from mRNA isolated from a cell (e.g., a hybridoma) expressing a desired protein (e.g., a desired antibody) expressed on the surface of a phage. A cDNA copy of this mRNA is generated using reverse transcriptase. cDNAs specifying immunoglobulin fragments are obtained by PCR, and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library containing DNA specifying immunoglobulin genes. Procedures for generating a bacteriophage library containing heterologous DNA are known in the art and are described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
[0178] Bacteriophage encoding a desired antibody can be engineered to display proteins on its surface that are available for binding to the corresponding binding protein, e.g., the antigen to which the antibody is directed. Thus, when bacteriophage expressing a particular antibody are incubated in the presence of a cell expressing the corresponding antigen, the bacteriophage will bind to the cell. Bacteriophage that do not express the antibody will not bind to the cell. Such panning techniques are known in the art and are described, for example, in Wright et al. (supra).
[0179] A process such as the one described above has been developed for the production of human antibodies using M13 bacteriophage display (Burton et al., 1994, Adv. Immunol. 57:191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody-producing cells. The mRNA encodes rearranged immunoglobulin genes, and so does the cDNA. The amplified cDNA is cloned into an M13 expression vector, creating a library of phages that express human Fab fragments on their surface. Phages displaying the antibody of interest are selected by antigen binding and propagated in bacteria to produce soluble human Fab immunoglobulins. Thus, in contrast to conventional monoclonal antibody synthesis, in this procedure the DNA encoding the human immunoglobulin is immortalized, rather than the cells expressing the human immunoglobulin.
[0180] The above procedure describes the generation of phages encoding the Fab portion of an antibody molecule. However, the present disclosure should not be construed as being limited to the generation of phages encoding Fab antibodies only. Rather, phages encoding single chain antibodies (scFv / phage antibody libraries) are also included in the present disclosure. Fab molecules contain an entire Ig light chain, i.e., both the variable and constant regions of the light chain, but only the variable region and the first constant region domain (CH1) of the heavy chain. Single chain antibody molecules contain a single chain of protein, including an Ig Fv fragment. An Ig Fv fragment contains only the variable regions of the heavy and light chains of an antibody, and does not contain the constant region. Phage libraries containing scFv DNA can be generated according to the procedure described in Marks et al., 1991, J. Mol. Biol. 222:581-597. Panning of the phages thus generated for isolation of the desired antibodies is performed in a similar manner as described for the phage libraries containing Fab DNA.
[0181] The present disclosure is also intended to include synthetic phage display libraries in which heavy and light chain variable regions can be synthesized to include nearly every possible specificity (Barbas, 1995, Nature Medicine 1:837-839; de Kruif et al., 1995, J. Mol. Biol. 248:97-105).
[0182] Also disclosed are isolated polypeptides encoding the antibodies or antigen-binding fragments described herein that specifically bind epiregulin. The isolated polypeptides capable of encoding the variable domain segments provided herein can be included in the same vector or different vectors to generate the antibodies or antigen-binding fragments.
[0183] In some embodiments, an isolated polypeptide encoding an antibody or antigen-binding fragment described herein comprises a nucleotide sequence encoding the VH of SEQ ID NO:5, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0184] In some embodiments, an isolated polypeptide encoding an antibody or antigen-binding fragment described herein comprises a nucleotide sequence encoding the VL of SEQ ID NO: 10, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0185] In some embodiments, an isolated polypeptide encoding an antibody or antigen-binding fragment described herein comprises: a nucleotide sequence of SEQ ID NO:5 encoding a VH, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto; and / or a nucleotide sequence of SEQ ID NO:10 encoding a VL, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0186] In some embodiments, an isolated polypeptide encoding an antibody or antigen-binding fragment described herein comprises: a nucleotide sequence of SEQ ID NO:5 encoding a VH, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to said sequence; and a nucleotide sequence of SEQ ID NO:10 encoding a VL, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to said sequence.
[0187] In some embodiments, the isolated polypeptide encoding the antibody or antigen-binding fragment described herein comprises: a nucleotide sequence of SEQ ID NO:5 encoding the VH; and / or a nucleotide sequence of SEQ ID NO:10 encoding the VL.
[0188] In some embodiments, the isolated polypeptide encoding the antibody or antigen-binding fragment described herein comprises: a nucleotide sequence of SEQ ID NO:5 encoding the VH; and a nucleotide sequence of SEQ ID NO:10 encoding the VL.
[0189] Also disclosed are vectors comprising a polynucleotide encoding the antibodies or antigen-binding fragments described herein.
[0190] Also disclosed are host cells expressing the recombinant antibodies or antigen-binding fragments described herein. Such host cells may comprise the polynucleotides or vectors described above. In some embodiments, the host cells are hybridomas. In some embodiments, the antibodies or antigen-binding fragments are recombinantly produced.
[0191] The antibodies of the disclosure can be produced, for example, in host cell transfectomas (a type of hybridoma) using a combination of recombinant DNA technology and gene transfection techniques as known in the art (e.g., Morrison, S. (1985) Science 229:1202).
[0192] For example, to express an antibody or antibody fragment thereof, polynucleotides encoding a portion or the entire light and heavy chains can be obtained by standard molecular biology techniques (e.g., PCR amplification or cDNA cloning using a hybridoma expressing the antibody of interest) and inserted into an expression vector such that the gene is operably linked to transcriptional and translational control sequences. In this context, the term "operatively linked" is intended to mean that the antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector perform their intended function of regulating the transcription and translation of the antibody gene. The expression vector and expression control sequences are selected to be compatible with the expression host cell used. The antibody light chain gene and the antibody heavy chain gene can be inserted into separate vectors or, typically, both genes are inserted into the same expression vector. The antibody gene is inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and the vector, or blunt end ligation if no restriction sites are present). The light and heavy chain variable regions of the described antibodies can be used to generate full-length antibody genes of any antibody isotype by inserting them into an expression vector already encoding the heavy and light chain constant regions of the desired isotype such that the VH segment is operably linked to one or more CH segments in the vector and the VL segment is operably linked to a CL segment in the vector. Additionally, or alternatively, the recombinant expression vector can encode a signal peptide that facilitates secretion of the antibody chain from a host cell. The antibody chain gene can be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene. The signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).
[0193] In addition to the antibody chain genes, the recombinant expression vectors of the disclosure carry regulatory sequences that control the expression of the antibody chain genes in a host cell. The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain genes. Such regulatory sequences are described, for example, in Goeddel (Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, CA (1990)). One of ordinary skill in the art will appreciate that the design of the expression vector, including the selection of regulatory sequences, can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. Preferred regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and / or enhancers derived from cytomegalovirus (CMV), simian virus 40 (SV40), adenovirus (e.g., the adenovirus major late promoter (AdMLP)), and polyoma. Alternatively, non-viral regulatory sequences such as the ubiquitin promoter or the β-globin promoter can be used.Furthermore, regulatory elements composed of sequences from different sources can be used, such as the SRD promoter system, which contains sequences from the SV40 early promoter and the long terminal repeat of human T-cell leukemia virus type 1 (Takebe, Y. et al. (1988) MoI. Cell. Biol. 8:466-472).
[0194] In addition to the antibody chain genes and regulatory sequences, the recombinant expression vectors of the disclosure may carry additional sequences, such as sequences that regulate replication of the vector in a host cell (e.g., origins of replication) and selectable marker genes. The selectable marker gene facilitates selection of a host cell into which the vector has been introduced (see, e.g., U.S. Pat. No. 4,399,216, U.S. Pat. No. 4,634,665, and U.S. Pat. No. 5,179,017). For example, typically the selectable marker gene confers resistance to drugs, such as G418, hygromycin, or methotrexate, on the host cell into which the vector has been introduced. Preferred selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr- host cells with methotrexate selection / amplification) and the neo gene (for G418 selection).
[0195] For expression of the light and heavy chains, one or more expression vectors encoding the heavy and light chains are transfected into a host cell by standard techniques. The various forms of the term "transfection" are intended to encompass a variety of techniques commonly used for the introduction of exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection, and the like. Although the antibodies of the present disclosure can theoretically be expressed in prokaryotic or eukaryotic host cells, expression of the antibodies in eukaryotic host cells, most preferably mammalian host cells, is most preferred, since such eukaryotic cells, particularly mammalian cells, are more likely than prokaryotic cells to assemble and secrete properly folded, immunologically active antibodies. It has been reported that expression of antibody genes by prokaryotic cells is ineffective for producing high yields of active antibodies (Boss, MA and Wood, CR (1985) Immunology Today 6:12-13).
[0196] Suitable mammalian host cells for expression of the recombinant antibodies of the present disclosure include Chinese Hamster Ovary (CHO) cells (including dhfr-CHO cells, described in Urlaub and Chasin, (1980) Proc. Natl. Acad, Sci. USA 77:4216-4220, e.g., used with a DHFR selection marker as described in RJ Kaufman and PA Sharp (1982) Mol. Biol. 759:601-621), NSO myeloma cells, COS cells, and SP2 cells. Another expression system particularly suitable for use with NSO myeloma cells is the GS gene expression system disclosed in WO 87 / 04462, WO 89 / 01036, and EP 0338841 WO. Once a recombinant expression vector encoding the antibody genes is introduced into a mammalian host cell, the antibody is produced by culturing the host cells for a period of time sufficient to express the antibody within the host cells, or more preferably, for a period of time sufficient to secrete the antibody into the culture medium in which the host cells are grown. The antibody can be recovered from the culture medium using standard protein purification methods.
[0197] After expression, whole antibodies, dimers derived therefrom, individual light and heavy chains, antibody fragments, or other forms of antibodies can be purified according to standard procedures known in the art, including, but not limited to, ammonium sulfate precipitation, use of affinity columns, conventional column chromatography, gel electrophoresis, and the like (see generally, R. Scopes, "Protein Purification", Springer-Verlag, NY (1982)). After purification, the antibodies can be used to practice the methods of the present disclosure or to prepare pharmaceutical compositions useful for practicing the methods of the present disclosure.
[0198] The antibodies or antigen-binding fragments of the present disclosure can be assayed for immunospecific binding by any method known in the art. Immunoassays that can be used include, but are not limited to, Western blots, radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays, to name just a few. Such assays are conventional and well known in the art (see, for example, Current Protocols in Molecular Biology, (Ausubel et al., eds.), Greene Publishing Associates and Wiley-Interscience, New York (2002)). Exemplary immunoassays are briefly described below (but are in no way intended to be limiting).
[0199] Immunoprecipitation protocols generally include the following steps: dissolve a population of cells in a lysis buffer, such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15M NaCl, pH 7.2 and 0.01M sodium phosphate, 1% trasylol) supplemented with protein phosphatase and / or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate); add an antibody of interest to the cell lysate; incubate at 4°C for a period of time (e.g., 14 hours); add protein A and / or protein G sepharose beads to the cell lysate; incubate at 4°C for about 1 hour or more; wash the beads in lysis buffer; and resuspend the beads in SDS / sample buffer. The ability of an antibody of interest to immunoprecipitate a particular antigen can be evaluated, for example, by Western blot analysis. One of skill in the art, given the present disclosure, would be knowledgeable as to the parameters that can be modified to increase binding of the antibody to the antigen and reduce background (e.g., pre-clearing the cell lysate with sepharose beads). Additional immunoprecipitation protocols are provided in Current Protocols in Molecular Biology, (Ausubel et al., eds.), Greene Publishing Associates and Wiley-Interscience, New York (2002).
[0200] Western blot analysis generally involves the steps of: preparing a protein sample; electrophoresing the protein sample in a polyacrylamide gel (e.g., about 8-20% SDS-PAGE depending on the molecular weight of the antigen); transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF, or nylon; blocking the membrane in a blocking solution (e.g., PBS containing about 3% BSA or nonfat milk); washing the membrane in a wash buffer (e.g., PBS-TWEEN® 20); blocking the membrane with a primary antibody (antibody of interest) diluted in blocking buffer; washing the membrane in a wash buffer; blocking the membrane with an enzyme substrate (e.g., horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (e.g., 32 P or 125 The method includes the steps of blocking with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) bound to I); washing the membrane in a wash buffer; and detecting the presence of the antigen. In view of the present disclosure, one of skill in the art would be familiar with the parameters that can be modified to increase the signal detected and reduce background noise. Further Western blot protocols are provided in Current Protocols in Molecular Biology, (Ausubel et al., eds.), Greene Publishing Associates and Wiley-Interscience, New York (2002).
[0201] Enzyme-linked immunosorbent assay (ELISA) includes the steps of: preparing an antigen; coating the wells of a 96-well microtiter plate with the antigen; adding an antibody of interest bound to a detectable compound, such as an enzyme substrate (e.g., horseradish peroxidase or alkaline phosphatase), to the wells and incubating for a period of time; and detecting the presence of the antigen. When performing an ELISA, the antibody of interest does not need to be bound to a detectable compound, but instead, a second antibody (that recognizes the antibody of interest) bound to a detectable compound can be added to the well. Furthermore, instead of coating the wells with the antigen, the wells can be coated with an antibody. In this case, the antigen of interest can be added to the coated wells, followed by the addition of a second antibody bound to a detectable compound. Those skilled in the art will be familiar with the parameters that can be modified to increase the signal detected, as well as other variations of ELISA protocols known in the art. For further discussion of ELISA protocols, see, e.g., Current Protocols in Molecular Biology, (Ausubel et al., eds.), Greene Publishing Associates and Wiley-Interscience, New York (2002).
[0202] The binding affinity of an antibody to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay, which involves the binding of a labeled antigen (e.g., 3 H or 125I) with the antibody of interest and detecting the antibody bound to the labeled antigen. The affinity of the antibody of interest for a particular antigen and the binding off-rate can be determined from the data by Scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, the antigen is incubated with a labeled compound (e.g., 3 H or 125 I) and incubated with an antibody bound to
[0203] Decoy Receptor In another embodiment of the present disclosure, decoy receptors that bind epiregulin, such as but not limited to soluble ErbB receptors (or soluble fragments thereof), are contemplated as inhibitors of epiregulin activity. These agents can be used to reduce or prevent binding of epiregulin to cell-bound epiregulin receptors (e.g., EGFR), thereby acting as antagonists of epiregulin activity. Such decoy receptors have been used to bind and regulate the function of cytokines or other ligands (Thomson, (1998) Cytokine Handbook, Academic Press).
[0204] In some embodiments, the decoy receptor described herein is a soluble ErbB receptor, such as soluble EGFR, soluble ErbB-2, soluble ErbB-3, soluble ErbB-4, or a soluble fragment thereof. In some embodiments, the decoy receptor described herein is a soluble EGFR or a soluble fragment thereof.
[0205] Without wishing to be bound by theory, decoy receptors can recognize certain molecules, such as growth factors (e.g., epiregulin), with high affinity and specificity, but are structurally incapable of signaling or presenting agonists to the signaling receptor complex. They function as molecular traps for agonists and signaling receptor components. Interleukin-1 receptor type II (IL-1RII) was the first pure decoy identified. Decoy receptors have since been identified, for example, for members of the tumor necrosis factor receptor and IL-1R family. In addition, silent non-signaling receptors may also function as decoys. Thus, the use of decoy receptors is a general strategy for modulating the action of various signaling molecules.
[0206] Decoy receptors may occur in solution or on the outside of the membrane. Decoy receptors may occur due to the absence of a membrane-spanning or membrane-binding segment of the molecule. This segment is generally referred to in the art as the transmembrane domain of the receptor. Thus, in some embodiments of the present disclosure, the soluble receptor comprises a fragment or variant of the membrane-bound receptor that does not have a transmembrane domain. Preferably, the fragment contains at least 6, e.g., 10, 15, 20, 25, 30, 40, 50, 60, or 70 amino acids, so long as it retains the desired activity (e.g., binding to epiregulin).
[0207] In other embodiments of the present disclosure, the structure of the membrane-associated segment is altered (e.g., by DNA sequence polymorphism or genetic mutation) such that the receptor is no longer tethered to the membrane, or the receptor is inserted but not retained within the membrane. Thus, in contrast to the corresponding membrane-associated form, the decoy receptor differs in one or more segments of the gene or receptor protein that are important for membrane association.
[0208] The present disclosure encompasses cDNA encoding a decoy receptor (eg, a soluble EGFR) isolated from decoy receptor-producing cells or recombinantly engineered from decoy receptor-encoding DNA.
[0209] In some embodiments, the decoy receptors described herein (e.g., soluble ErbB receptors) are capable of binding to epiregulin without inducing undesirable downstream effects, including, but not limited to, skin rash, hair loss, pulmonary toxicity (e.g., pneumonia or fibrosis), neurological disorders, or gastrointestinal disorders.
[0210] Any epiregulin receptor that has been identified can serve as the basis for the generation of the decoy receptors of the present disclosure.
[0211] Any of a variety of procedures may be used to molecularly clone the decoy receptors described herein (eg, soluble EGFR).
[0212] For example, a suitable cDNA library can be prepared from cells or cell lines that have soluble receptor (e.g., soluble EGFR) activity. Cells or cell lines for use in preparing a cDNA library for isolating soluble receptor (e.g., soluble EGFR) cDNA can be selected by first measuring receptor activity using a receptor binding assay.
[0213] Preparation of a cDNA library can be carried out by standard techniques known in the art. Known cDNA library construction techniques can be found, for example, in Maniatis, T., Fritsch, EF, Sambrook, J., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982).
[0214] The DNA encoding the decoy receptor can also be isolated from a suitable genomic DNA library.The construction of genomic DNA library can be carried out by standard techniques known in the art.The known techniques for constructing genomic DNA library can be found in Maniatis, T., Fritsch, EF, Sambrook, J., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982).
[0215] Decoy receptor molecules can also be obtained by recombinant engineering from DNA encoding partial or complete amino acid sequences of decoy receptors (e.g., soluble EGFR). Using recombinant DNA techniques, DNA molecules encoding at least a portion of decoy receptors (e.g., soluble EGFR) that can bind to epiregulin without irritation, pathological collagen deposition, and alveolar remodeling are constructed. Standard recombinant DNA techniques are used, such as those identified in Maniatis, et al., supra.
[0216] For illustrative purposes, a DNA encoding a decoy receptor, such as a soluble EGFR, is used. The receptor DNA sequence is used to construct a DNA molecule encoding only the extracellular domain of the receptor, or the epiregulin-binding domain. Restriction endonuclease cleavage sites can be identified within the receptor DNA and used to directly excise the extracellular coding portion. Furthermore, PCR techniques known in the art can be used to generate the desired portion of DNA. Other cloning techniques can also be used to generate decoy receptor molecules in a similar manner to those described above.
[0217] The cloned decoy receptor (e.g., soluble EGFR) cDNA obtained by the above-mentioned method can be recombinantly expressed by molecular cloning into an expression vector containing a suitable promoter and other suitable transcriptional regulatory elements, and then transferred into a prokaryotic or eukaryotic host cell to produce a recombinant decoy receptor (e.g., soluble EGFR).The techniques for such manipulation are fully described in Maniatis, et al., supra, and are known in the art.
[0218] Chimeric Antigen Receptor (CAR) Modified Cells Chimeric antigen receptors (CARs) are hybrid molecules that contain an antigen-binding domain, typically a single-chain variable fragment (scFv), followed by a linker, a transmembrane domain, and any of a variety of signaling domains involved in lymphocyte activation. First generation CARs contain a signaling domain that includes only CD3-zeta, which is required for the first signal of T cell activation ("signal 1"). Second and third generation CARs further contain one or more co-stimulatory signaling domains (e.g., 4-1BB and / or CD28), respectively, to provide the second signal ("signal 2").
[0219] In some embodiments of the present disclosure, the inhibitor of epiregulin activity is a CAR modified cell, such as, but not limited to, a CAR modified T cell (CAR-T cell) or a CAR modified natural killer (NK) cell (CAR-NK cell). In some embodiments, the CAR modified cell (e.g., a CAR-T cell) destroys or kills an epiregulin expressing cell, such as, but not limited to, an epiregulin expressing cell disclosed herein, such as an epiregulin expressing dendritic cell.
[0220] Also provided are cells expressing the CARs of the present disclosure. Such cells can be immune cells, including but not limited to T cells (CAR-T cells) or natural killer (NK) cells (CAR-NK cells). In some embodiments, the CAR modified cells (e.g., CAR-T cells) destroy or kill epiregulin expressing cells, including but not limited to epiregulin expressing cells disclosed herein, such as epiregulin expressing dendritic cells.
[0221] In some embodiments, a CAR of the present disclosure comprises: a) an extracellular domain comprising an antigen binding moiety that specifically binds epiregulin; b) a transmembrane domain; and c) a cytoplasmic domain comprising one or more signaling domains. In some embodiments, the antigen binding moiety that specifically binds epiregulin comprises an antibody or antigen binding fragment described herein.
[0222] CARs that may be useful in carrying out the methods disclosed herein may include an anti-epiregulin binding domain, a cytoplasmic domain, and a transmembrane domain. The cytoplasmic domain may include one or more signaling domains. The transmembrane domain is generally located between the cytoplasmic domain and the epiregulin binding domain.
[0223] The anti-epiregulin binding domain may comprise a receptor, an antigen-binding polypeptide, or a natural ligand for a target cell antigen or receptor. The anti-epiregulin binding domain may comprise an antigen-binding polypeptide. Illustrative examples of antigen-binding polypeptides are antibodies and antibody fragments. As non-limiting examples, the antigen-binding polypeptide may be a single chain variable fragment (scFv), a rabbit antibody, a human antibody, a mouse antibody, a humanized antibody, a shark antibody variable domain, a humanized version of a shark antibody, a camelized antibody variable domain, a camelid antibody variable domain, a humanized version of a camelid antibody variable domain, a single domain antibody variable domain, and a nanobody.
[0224] The transmembrane domain may be derived from CD28, CD45, CD4, DAP10, CD3-zeta, CD3-epsilon, CD5, CD7, CD9, DAP12, CD8, CD8alpha, CD137, CD4, CD16, CD22, CD80, CD86, CD134 (OX-40), CD33, CD37, CD40, CD64, or CD154.
[0225] The signaling domain may be derived from Fcε receptor Iγ chain (FCER1G), FcRβ, CD226, CD66d, CD79A, CD79B, DAP10, DAP12 CD3-δ, CD3-ε, CD3-γ, or CD3-ζ.
[0226] The cytoplasmic domain may comprise one or more costimulatory signaling domains. In some embodiments, the costimulatory signaling domain is derived from FcRβ, Fcε receptor Iγ chain (FCER1G), DAP12, DAP10, CD3-δ, CD3-ε, CD3-γ, CD3-ζ, CD79A, CD79B, CD226, or CD66d.
[0227] The cytoplasmic domain may comprise more than one signaling domain, for example the cytoplasmic domain may comprise two signaling domains.
[0228] In some embodiments, the CAR further comprises one or more additional polypeptide sequences. Exemplary additional polypeptide sequences include, but are not limited to, signal sequences, epitope tags, and polypeptides that generate a detectable signal.
[0229] In some embodiments, the antigen binding domain may comprise a linker.
[0230] In some embodiments, the CAR comprises a hinge domain located between the anti-epiregulin binding domain and the transmembrane domain. The hinge domain may be an immunoglobulin hinge region.
[0231] In some embodiments, the CAR comprises a leader sequence.
[0232] Aptamers In some embodiments of the present disclosure, the inhibitor of epiregulin activity is an aptamer. Without wishing to be bound by theory, an aptamer may be a synthetic molecule, typically a polynucleotide- or peptide-based molecule, capable of specifically binding to another molecule. A polynucleotide aptamer may be a DNA or RNA molecule, typically containing multiple nucleic acid strands, that adopts a highly specific three-dimensional conformation designed to have appropriate binding affinity and specificity for a particular target molecule, including but not limited to peptides, proteins, drugs, vitamins, among other organic and inorganic molecules. Such cellular polynucleotide aptamers can be selected from a vast population of random sequences using systematic evolution of ligands by exponential enrichment. Peptide aptamers are typically loops of about 10 to about 20 amino acids attached to a protein scaffold that binds to a specific ligand. In some embodiments, peptide aptamers may be identified and isolated from combinatorial libraries using methods such as the yeast two-hybrid system.
[0233] Alternative scaffolds Alternative scaffolds to immunoglobulins that exhibit similar functional properties, such as high affinity specific binding of target biomolecules, may also be used as inhibitors of epiregulin activity in the present disclosure. Such scaffolds have been shown to result in molecules with improved properties, such as reduced immunogenicity or increased stability. Non-limiting examples of alternative scaffolds that may be useful in the practice of the methods disclosed herein include: artificial fibronectin-derived 10th fibronectin type III (10Fn3) domain (e.g., monobodies, AdNectin™, or AdNexin™); artificial ankyrin repeat motif-containing polypeptides (e.g., DARPins™) lipocalins (e.g., Anticalin); artificial low density lipoprotein receptor-derived A domain (LDLR-A) (e.g., Avimer™); artificial protein A-derived Z domain (Affibody™) CTLD3 (e.g., tetranectin); artificial tenascin-derived tenascin type III domain (e.g., Centyrin™). artificial gamma-B crystallin derived scaffolds or artificial ubiquitin derived scaffolds (e.g. Affilin); thioredoxins (e.g. peptide aptamers); KALBITOR®; beta sandwiches (e.g. iMabs); artificial protease inhibitor derived Kunitz domains (e.g. EETI-II / AGRP, BPTI / LACI-D1 / ITI-D2); C-type lectin-like domain scaffolds; Sac7d derived polypeptides (e.g. Nanoffitin®, or affitin); artificial Fyn derived SH2 domains (e.g. Fynomers®); artificial antibody mimics; mini-proteins; and any engineered counterparts of these that retain their binding functionality.Skerra, Current Opin. in Biotech., 2007 18: 295-304; Binz H et al., Nat Biolechnol 23: (Woern A, Pluckthun A, J Mol Biol 305: 989-1010 (2001); Xu L et al., Chem Biol 9: 933-42 (2002); 1257-68 (2005); Wikman M et al., Protein Eng Des Sel 17: 455-62 (2004); Byla P et al., J Biol Chem 285: 12096 (2010); Zoller F et al., Molecules 16: 2467-85 (2011), Hey T et al., Trends Biotechnol 23:514-522 (2005); Koide A, Koide S, Methods Mol Biol 352: 95-109 (2007); Holliger P, Hudson P, Nat Biotechnol 23: 1126-36 (2005); Gill D, Damle N, Curr Opin Biotech 17: 653-8 (2006); each of the above references is incorporated herein by reference in its entirety for all purposes.
[0234] Methods of Inhibiting Epiregulin In certain aspects, the disclosure provides methods of inhibiting activity of epiregulin in a cell, the method comprising contacting the cell with an effective amount of an epiregulin inhibitor. In some embodiments, the activity of epiregulin is interaction of epiregulin with an ErbB receptor. In some embodiments, the cell is a fibroblast or a pericyte. In some embodiments, the cell is a human cell.
[0235] In some embodiments, the present disclosure provides a method of inhibiting activity of epiregulin in a cell, the method comprising contacting the cell with an effective amount of an antibody or antigen-binding fragment of the present disclosure.
[0236] In some embodiments, the ErbB receptor is an epidermal growth factor receptor (EGFR) receptor, sometimes referred to as ErbB-1. In some embodiments, the ErbB receptor is ErbB-2 (e.g., HER2 or neu). In some embodiments, the ErbB receptor is ErbB-3 (HER3). In some embodiments, the ErbB receptor is ErbB-4 (HER4).
[0237] In some embodiments, epiregulin activity is reduced by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even higher percentages. In some embodiments, epiregulin activity is reduced by about 5%-20%, 10%-30%, 20%-40%, 30%-50%, 40%-60%, 50%-70%, 60%-80%, 70%-90%, 80%-95%, or even higher percentages. In some embodiments, epiregulin activity is reduced by about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or even higher percentages, hi some embodiments, epiregulin activity is reduced by about 50%.
[0238] In some embodiments, the activity of epiregulin is the interaction of epiregulin with an ErbB receptor and the interaction of epiregulin with the ErbB receptor is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even higher percentage. In some embodiments, the activity of epiregulin is the interaction of epiregulin with an ErbB receptor and the interaction of epiregulin with the ErbB receptor is reduced by about 5%-20%, 10%-30%, 20%-40%, 30%-50%, 40%-60%, 50%-70%, 60%-80%, 70%-90%, 80%-95%, or even higher percentage. In some embodiments, the activity of epiregulin is the interaction of epiregulin with an ErbB receptor and the interaction of epiregulin with the ErbB receptor is reduced by about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or even higher percentages. In some embodiments, the activity of epiregulin is the interaction of epiregulin with an ErbB receptor and the interaction of epiregulin with the ErbB receptor is reduced by about 50%.
[0239] In some embodiments, the antibodies or antigen-binding fragments of the disclosure inhibit epiregulin-induced proliferation of fibroblasts. In some embodiments, the antibodies or antigen-binding fragments of the disclosure inhibit epiregulin-induced proliferation of fibroblasts by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even higher percentages. In some embodiments, the antibodies or antigen-binding fragments of the disclosure inhibit epiregulin-induced proliferation of fibroblasts by at least about 5%-20%, 10%-30%, 20%-40%, 30%-50%, 40%-60%, 50%-70%, 60%-80%, 70%-90%, 80%-95%, or even higher percentages. In some embodiments, the epiregulin inhibitor inhibits epiregulin-induced proliferation of fibroblasts by about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or even higher percentages, hi some embodiments, the epiregulin inhibitor inhibits epiregulin-induced proliferation of fibroblasts by about 50%.
[0240] Treatment Method In one aspect, the disclosure includes a method of reversing or preventing one or more changes in a cell associated with fibrosis, the method comprising contacting the cell with an effective amount of an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure.
[0241] In some embodiments, the one or more changes associated with fibrosis include, but are not limited to, increased expression of fibronectin I (FN1); increased expression of epiregulin (EREG); increased expression of type I collagen alpha 1 chain (COL1A1); increased expression of type IV collagen alpha 1 chain (COL4A1); increased expression of type VI collagen alpha 1 chain (COL6A1); increased expression of tenascin-C (TNC); increased expression of fibronectin extra domain A isoform (FN EDA), increased expression of monocyte chemoattractant protein 1 (MCP-1); increased expression of tissue inhibitor of metalloproteinase 1 (TIMP-1), or a combination thereof.
[0242] In some embodiments, the reversal of the one or more alterations associated with fibrosis is complete. In some embodiments, the reversal of the one or more alterations associated with fibrosis is partial.
[0243] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse one or more of the changes associated with fibrosis by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, one or more of the changes associated with fibrosis may be reversed by more than 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure, such that the amount of change is less than that which occurs in the absence of disease or disorder, i.e., control levels. In some embodiments, the one or more changes associated with fibrosis may be reversed by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, or 200% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0244] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of fibronectin I (FN1) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of fibronectin I (FN1) by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0245] In some embodiments, the epiregulin inhibitor (e.g., antibody or antigen-binding fragment) of the present disclosure is administered in an amount sufficient to reverse the increased expression of EREG by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% after administration of the epiregulin inhibitor (e.g., antibody or antigen-binding fragment). In some embodiments, the epiregulin inhibitor (e.g., antibody or antigen-binding fragment) of the present disclosure is administered in an amount sufficient to reverse the increased expression of EREG by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the epiregulin inhibitor (e.g., antibody or antigen-binding fragment).
[0246] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL1A1 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL1A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0247] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL4A1 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL4A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0248] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL6A1 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of COL6A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0249] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of TNC by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of TNC by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0250] In some embodiments, the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) is EDA In some embodiments, the epiregulin inhibitors (e.g., antibodies or antigen-binding fragments) of the present disclosure are administered in an amount sufficient to reverse the increased expression of FN by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the antibody or antigen-binding fragment. EDAThe epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) is administered in an amount sufficient to reverse increased expression of at least about 110%, 120%, 130%, 140%, 150%, 160%, 180%, 200%, 300%, 400%, or 500% following administration of the epiregulin inhibitor.
[0251] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of MCP-1 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated expression of MCP-1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, or 200% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0252] In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated TIMP-1 expression by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) of the disclosure is administered in an amount sufficient to reverse elevated TIMP-1 expression by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, or 200% following administration of the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment).
[0253] In some embodiments, the cell is a fibroblast or a pericyte.
[0254] In some embodiments, the cell is a human cell.
[0255] In one aspect, the disclosure includes a method of treating or preventing a fibrotic disease or disorder in a subject (e.g., a human subject) in need thereof, the method comprising administering to the subject a therapeutically effective amount of a described epiregulin inhibitor (e.g., an antibody or antigen-binding fragment). In some embodiments, the administration of the described epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) results in reversal of the fibrotic disease and / or disorder. In some embodiments, the reversal of the fibrotic disease and / or disorder is a complete reversal of the fibrotic disease and / or disorder. In some embodiments, the reversal is a partial reversal of the fibrotic disease and / or disorder.
[0256] In some embodiments, the epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) described is administered in an amount sufficient to reverse the fibrotic disease and / or disorder by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% following administration of the antibody or antigen-binding fragment described.
[0257] Fibrotic Diseases and Disorders The present disclosure can be carried out in any subject diagnosed with fibrosis or at risk of developing fibrosis. Fibrosis is associated with many diseases and disorders. The subject may be diagnosed with or at risk of developing, for example: interstitial lung disease, including idiopathic pulmonary fibrosis; scleroderma (or sclerosis), including both systemic scleroderma (affecting visceral organs) and localized scleroderma (only skin), sometimes called morphea; gastrointestinal fibrosis; cardiac fibrosis; radiation-induced pulmonary fibrosis; bleomycin lung; sarcoidosis; silicosis; familial pulmonary fibrosis; autoimmune disease; or any disorder in which alveolar septal rupture occurs with one or more fibroproliferative matrix molecule deposition, increased pathological collagen accumulation, apoptosis, and honeycombing. The subject may be identified as suffering from or at risk for developing fibrosis due to exposure to asbestos, rubble, and metal dust, or due to administration of drugs such as bleomycin, busulfan, phenytoin, and nitrofurantoin, which are risk factors for developing fibrosis. Preferably, the subject is a mammal, and more preferably a human.
[0258] Other illustrative examples of fibrotic diseases include, but are not limited to, scleromyxedema, nephrogenic systemic fibrosis (also called nephrogenic fibrosing dermopathy), and long COVID syndrome.
[0259] It is also contemplated that the compositions and methods of the present disclosure can be used to treat organ fibrosis secondary to allogeneic organ transplantation, such as graft fibrosis, or graft-versus-host disease, including but not limited to chronic graft-versus-host disease, sclerosing graft-versus-host disease, and sclerosing graft-versus-host disease skin fibrosis. Non-limiting examples include kidney transplant fibrosis, cardiac transplant fibrosis, liver transplant fibrosis, and the like. In some embodiments, the compositions and methods of the present disclosure may be used to treat bronchiolitis obliterans syndrome, which may result from, for example, lung transplant rejection.
[0260] In some embodiments, the methods of treating or preventing a fibrotic disease or disorder disclosed herein may include treating or preventing a fibrotic disease or disorder, such as, but not limited to, scleroderma, interstitial lung disease, gastrointestinal fibrosis, cardiac fibrosis, dermal fibrosis (e.g., systemic sclerosis dermatofibrosis, or sclerosing graft-versus-host disease dermatofibrosis), sclerosing myxedema, nephrogenic systemic fibrosis (nephrogenic fibrosing dermatosis), chronic graft-versus-host disease, sclerosing graft-versus-host disease, bronchiolitis obliterans syndrome, keloid scarring, fibrosis (e.g., pulmonary fibrosis) associated with or caused by COVID-19 (e.g., SARS-COV-2 infection), including long-term COVID syndrome, or a combination thereof. In some embodiments, the scleroderma is systemic scleroderma, and in some embodiments, the scleroderma is localized scleroderma (morphea). In some embodiments, the interstitial lung disease is idiopathic pulmonary fibrosis.
[0261] In some embodiments, the fibrosis is pulmonary fibrosis. As used herein, the term "pulmonary fibrosis" or "fibrotic lung disease" or "fibroid lung disease" or "scarring of the lung" refers to a group of diseases (fibroses) characterized by the formation or development of excess fibrous connective tissue in the lungs. The main symptoms of pulmonary fibrosis are: shortness of breath, especially on exertion; chronic dry cough; fatigue and weakness; chest discomfort; and loss of appetite and rapid weight loss. Pulmonary fibrosis may be a secondary effect of other diseases, most of which are classified as interstitial lung diseases, such as autoimmune disorders, viral infections, or other microscopic damage to the lungs. Pulmonary fibrosis may also appear without any known cause ("idiopathic"). Idiopathic pulmonary fibrosis is diagnosed by exclusion of a set of characteristic histologic / pathologic features known as usual interstitial pneumonia (UIP).
[0262] Diseases and conditions that can cause pulmonary fibrosis as a secondary effect include: inhalation of environmental and occupational pollutants (asbestosis, silicosis, and gas exposure); hypersensitivity pneumonitis, most often caused by inhalation of dust contaminated with bacteria, fungi, or animal products; smoking; connective tissue diseases such as rheumatoid arthritis, SLE; scleroderma, sarcoidosis, and Wegener's granulomatosis; infections; drugs such as amiodarone, bleomycin (pingyangmycin), busulfan, methotrexate, apomorphine, and nitrofurantoin; and radiation therapy to the chest.
[0263] In some embodiments, the compositions and methods of the present disclosure can be used to treat or prevent idiopathic pulmonary fibrosis (IPF). IPF is a devastating chronic lung disease of unknown etiology. Regardless of treatment, more than 50% of patients with IPF die within 3.5-4 years of initial diagnosis (Travis, et al., 2013, Am. J. Resp. Crit. Care Med. 188:733-748). Despite extensive research efforts, its pathogenesis remains elusive and controversial (Selman, et al., 2001, Ann. Int. Med. 134:136-151; Selman, et al., 2008, PLoS Med. 5:e62).
[0264] With a gradually increasing incidence worldwide and the lack of proven therapies other than lung transplantation, the treatment of IPF represents a major challenge for both the pharmaceutical industry and thoracic physicians. To date, all available therapeutic agents have been delivered systemically, either orally or subcutaneously. In addition to their limited therapeutic efficacy, the use of most of these agents is associated with side effects, ranging from major (e.g., immunosuppression with subsequent infections, acute disease exacerbations, and excessive bleeding) to minor (including gastrointestinal complications such as diarrhea and nausea), which significantly impact the quality of life of patients. None of the agents tested to date have had a significant effect on patient survival.
[0265] In some embodiments, the compositions and methods of the present disclosure can be used to treat or prevent scleroderma. Scleroderma is a chronic connective tissue disease that is generally classified as one of the autoimmune rheumatic diseases. Patients with scleroderma may have certain antibodies in their blood (ANA, anticentromere, or antitopoisomerase) that indicate autoimmunity. Symptoms generally include thickening of the skin that may be accompanied by scarring, vascular disorders, varying degrees of inflammation, and pain, and are associated with overactivity of the immune system.
[0266] Scleroderma can be classified according to the extent and site of skin and organ involvement. Thus, scleroderma is categorized into two main groups, localized scleroderma and systemic sclerosis, which can be further subdivided into diffuse or localized forms based on the site and extent of skin involvement. Localized scleroderma skin changes are in isolated areas as patchy morphea or linear scleroderma. Morphea is scleroderma localized to patchy areas of hardened, slightly pigmented skin. Morphea may cause multiple lesions on the skin. Morphea is not associated with disease in other parts of the body, but only with the affected skin area. Linear scleroderma is scleroderma usually limited to the lower limbs, often appearing as bands of hardened skin along the legs of children. Linear scleroderma in children may interfere with bone growth in the affected limbs. Linear scleroderma may be associated with "satellite" areas of skin patches of localized scleroderma, such as on the abdomen.
[0267] Extensive scleroderma involves the internal organs in addition to the skin. This type, called systemic sclerosis, is further categorized as diffuse or localized, depending on the extent of skin involvement. The diffuse form of scleroderma (diffuse systemic sclerosis) involves symmetric thickening of the skin of the limbs, face, and trunk (chest, back, abdomen, or flanks), which may progress rapidly to sclerosis after an early inflammatory phase. Organ disease may develop early and is severe, greatly reducing life expectancy. Affected organs include the esophagus, intestine, and scarring (fibrosis) of the lungs, heart, and kidneys. High blood pressure may be a problem, which may lead to kidney failure (renal crisis).
[0268] The localized form of scleroderma tends to be much less invasive, with skin thickening limited to the skin of the fingers, hands, and face. Skin changes and other features of the disease tend to develop more slowly than the diffuse form. Because characteristic clinical features may occur in patients with the localized form of scleroderma, this form has been given an alternative name consisting of the first letters of the common components. This form is therefore also called the "CREST" variant of scleroderma (a subset of it, e.g. CRST, REST, or ST). CREST syndrome is characterized by the following: calcinosis (the formation of tiny deposits of calcium in the skin), Raynaud's phenomenon (spasm of the tiny arteries that supply the fingers, toes, nose, tongue, or ears), esophageal disease (characterized by muscle weakness in the lower two-thirds of the esophagus), sclerodactyly (localized thickening and hardening of the skin of the fingers or toes), and telangiectasia (tiny red areas, often on the face, hands, and behind the lips).
[0269] Some subjects have scleroderma and one or more other connective tissue diseases, such as rheumatoid arthritis, systemic lupus erythematosus, and polymyositis. Features of scleroderma combined with features of polymyositis, systemic lupus erythematosus, and certain abnormal blood tests may lead to a diagnosis of mixed connective tissue disease (MCTD).
[0270] Combination therapy In certain embodiments, the epiregulin inhibitors (e.g., antibodies or antigen-binding fragments) described herein can be used in the methods of the present disclosure in combination with at least one additional therapeutic agent useful for treating or preventing fibrotic diseases and / or disorders, which may include a therapeutic agent identified herein or another therapeutic agent, such as a commercially available therapeutic agent known to treat, prevent, or reduce the symptoms of fibrotic lung diseases.
[0271] Non-limiting examples of additional therapeutic agents contemplated for use in accordance with the present disclosure include mycophenolate mofetil, nintedanib, tocilizumab, pirfenidone, rituximab, prednisone or another corticosteroid drug, methotrexate, UVA or UVB phototherapy, extracorporeal photopheresis, stem cell transplantation, and cyclophosphamide.
[0272] Synergistic effects include, for example, Sigmoid-E max The above-mentioned equations can be applied to experimental data to generate corresponding graphs to assist in evaluating the effect of drug combinations. The corresponding graphs associated with the above-mentioned equations are the concentration-effect curve, the isobologram curve, and the combination index curve, respectively.
[0273] Dosing, Formulation, and Administration The dose of a described epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) administered to a subject (such as a human) can vary depending on the particular composition, the method of administration, and the particular type and stage of the disease or disorder (such as a fibrotic disease or disorder) being treated. The amount will be sufficient to effect a desired response, such as a therapeutic response to the disease or disorder (such as a fibrotic disease or disorder). In some embodiments, the amount of the composition (e.g., a described epiregulin inhibitor (e.g., an antibody or antigen-binding fragment)) is a therapeutically effective amount.
[0274] In some embodiments, the amount of the composition is sufficient to promote normalization and / or improvement of dermal thickness. In some embodiments, the amount of the composition is sufficient to promote normalization and / or improvement of pulmonary fibrosis. In some embodiments, the amount of the composition is sufficient to promote normalization and / or improvement of alveolar septa. In some embodiments, the amount of the composition is sufficient to reduce or prevent fibrotic masses.
[0275] In some embodiments, the amount of the composition is sufficient to reverse or prevent one or more changes in cells associated with fibrosis. By way of non-limiting example, such changes associated with fibrosis include increased expression of FN1; increased expression of EREG; increased expression of COL1A1; increased expression of COL4A1; increased expression of COL6A1; increased expression of TNC; increased expression of FN EDA increased expression of MCP-1; increased expression of TIMP-1, or a combination thereof.
[0276] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in FN1 after administration of the composition. In some embodiments, the composition is sufficient to reverse overexpression of fibronectin I (FN1) by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the composition.
[0277] In some embodiments, the amount of the composition is sufficient to cause at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in EREG after administration of the composition. In some embodiments, the composition is sufficient to reverse EREG overexpression by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the composition.
[0278] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in COL1A1 after administration of the composition, hi some embodiments, the composition is sufficient to reverse overexpression of COL1A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the composition.
[0279] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in COL4A1 following administration of the composition, hi some embodiments, the amount of the composition is sufficient to reverse overexpression of COL4A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% following administration of the composition.
[0280] In some embodiments, the amount of the composition is sufficient to cause at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in COL6A1 after administration of the composition. In some embodiments, the composition is sufficient to reverse overexpression of COL6A1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% after administration of the composition.
[0281] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in TNC following administration of the composition, hi some embodiments, the amount of the composition is sufficient to reverse overexpression of TNC by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% following administration of the composition.
[0282] In some embodiments, the amount of the composition is greater than or equal to 100 mg / kg FN after administration of the composition. EDA In some embodiments, the composition is in an amount sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in FN after administration of the composition. EDA The amount is sufficient to reverse overexpression of at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500%.
[0283] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in MCP-1 following administration of the composition, hi some embodiments, the amount of the composition is sufficient to reverse overexpression of MCP-1 by at least about 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 200%, 300%, 400%, or 500% following administration of the composition.
[0284] In some embodiments, the amount of the composition is sufficient to result in at least about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in TIMP-1 following administration of the composition.
[0285] In addition to collagen hydroxyproline assays, assays for measuring any of the above-mentioned changes in expression and / or amount, for example, of FN1 and TNC, include, but are not limited to, quantitative polymerase chain reaction (qPCR), microarrays, RNA sequencing (RNA-Seq), single-cell RNA-Seq (scRNA-Seq), enzyme-linked immunosorbent assay (ELISA), mass spectrometry, and western blot.
[0286] Any of the epiregulin inhibitors (eg, antibodies or antigen-binding fragments) described herein can be provided in a composition, such as a formulation, that includes other agents, excipients, or stabilizers.
[0287] In some embodiments, the compositions further comprise a targeting agent or carrier that facilitates delivery of the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments) to fibrotic tissues or tissues associated with fibrotic diseases and / or disorders. Exemplary carriers include liposomes, micelles, nanodispersed albumin and modifications thereof, polymeric nanoparticles, dendrimers, inorganic nanoparticles of various compositions.
[0288] In some embodiments, the compositions are suitable for administration to humans, hi some embodiments, the compositions are suitable for administration to mammals, such as household pets and agricultural animals in the veterinary context.
[0289] In some embodiments, the composition is administered to a subject (e.g., a human subject) after onset of a fibrotic disease and / or disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, or 7 days or more after onset of a fibrotic disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 weeks or more after onset of a fibrotic disease or disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 years or more after onset of a fibrotic disease or disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 years or more after onset of a fibrotic disease or disorder.
[0290] In some embodiments, the composition is administered to a subject (e.g., a human subject) prior to the onset of a fibrotic disease and / or disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, or 7 days or more prior to the onset of a fibrotic disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 weeks or more prior to the onset of a fibrotic disease or disorder. In some embodiments, the composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 years or more prior to the onset of a fibrotic disease or disorder.
[0291] There are a wide variety of suitable formulations of compositions comprising the epiregulin inhibitors (e.g., antibodies or antigen-binding fragments) disclosed herein. The following formulations and methods are merely exemplary and in no way limiting. Formulations suitable for oral administration may consist of (a) liquid solutions, such as an effective amount of the compound dissolved in a diluent such as water, saline, or orange juice; (b) capsules, sachets, or tablets, each containing a predetermined amount of the active ingredient as a solid or granules; (c) suspensions in a suitable liquid; and (d) suitable emulsions. Tablet forms may contain one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffers, humectants, preservatives, flavorings, and pharmacologically compatible excipients. Lozenge forms can contain the active ingredient in a flavoring, usually sucrose and acacia or tragacanth, and troches containing the active ingredient in an inert base such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like, containing the active ingredient plus the above-mentioned excipients, are also known in the art.
[0292] Examples of suitable carriers, excipients, and diluents include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginic acid, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline solution, syrup, methylcellulose, methyl and propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In some embodiments, a composition comprising the described epiregulin inhibitor (e.g., antibody or antigen-binding fragment) together with a carrier as discussed herein is provided in a dry formulation (e.g., a lyophilized formulation). The formulation may further include a lubricating agent, a wetting agent, an emulsifying and suspending agent, a preserving agent, a sweetening agent, or a flavoring agent.
[0293] In some embodiments, the compositions are formulated for administration by any route that results in a therapeutically effective outcome, including, but not limited to, intravenous, intraarterial, intraperitoneal, intravesicular, subcutaneous, intrathecal, intrapulmonary, intramuscular, intratracheal, intraocular, transdermal, oral, or inhalation administration.
[0294] Preparations suitable for parenteral administration include: aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bactericides, and solutes that render the preparations compatible with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The preparations may be provided in unit-dose or multi-dose sealed containers, such as ampoules and vials, and may be stored in a freeze-dried state, requiring only the addition of a sterile liquid excipient for injection, such as water, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets of the kind described above. Preparations for injection are preferred.
[0295] In some embodiments, the composition is formulated to have a pH range of about 4.5 to about 9.0, including, for example, any of the following pH ranges: about 5.0 to about 8.0, about 6.5 to about 7.5, and about 6.5 to about 7.0. In some embodiments, the composition is formulated to have a pH of about 6 or greater, including, for example, any of the following pH ranges: about 6.5 or greater, about 7 or greater, or about 8 or greater (e.g., about 8). The composition can also be made isotonic with blood by the addition of a suitable tonicity modifying agent, such as glycerol.
[0296] In certain embodiments, the compositions of the present disclosure are formulated with one or more pharma- ceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a therapeutically effective amount of a compound of the present disclosure and a pharma- ceutically acceptable carrier.
[0297] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is advisable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition.
[0298] In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising: a container holding a therapeutically effective amount of a compound of the present disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a disease or disorder contemplated by the present disclosure.
[0299] The formulations can be used in admixture with conventional excipients, i.e., pharma- ceutically acceptable organic or inorganic carrier substances suitable for any suitable administration form, as known in the art. The pharmaceutical preparations can be sterilized and, if necessary, can be mixed with auxiliary substances, such as: lubricants; preservatives; stabilizers; wetting agents; emulsifiers; salts for influencing osmotic pressure; buffers, coloring, flavoring and / or aromatic substances, etc. They can also be combined, if necessary, with other active agents, such as analgesics.
[0300] Suitable compositions and dosage forms include, for example, dispersions, suspensions, solutions, syrups, granules, beads, powders, pellets, liquid sprays for nasal or oral administration, dry powders for inhalation, and aerosolized formulations. Powdered and granular formulations of pharmaceutical preparations of the present disclosure can be prepared using known methods. Such formulations can be administered directly to a subject or can be used, for example, to form a material suitable for administration to a subject. Each of these formulations can further include one or more of a dispersing or wetting agent, a suspending agent, and a preservative. Additional excipients, such as fillers and sweeteners, flavoring agents, or coloring agents, can also be included in these formulations.
[0301] The pharmaceutical compositions of the present disclosure can also be formulated to provide the active ingredient in the form of droplets of a solution or suspension. Such dosage forms can be prepared, packaged, or sold as an aqueous or dilute alcoholic solution or suspension, optionally sterile, containing the active ingredient, and can be conveniently administered using any nebulizer or atomizer device. Such formulations may further include one or more additional ingredients, including, but not limited to, flavoring agents such as sodium saccharin, volatile oils, buffers, surfactants, or preservatives such as methyl hydroxybenzoate. It is understood that the formulations and compositions useful in the present disclosure are not limited to the specific formulations and compositions described herein.
[0302] kit Kits provided herein include one or more containers containing a described epiregulin inhibitor or a pharmaceutical composition containing an epiregulin inhibitor described herein and / or one or more other agents, and in some embodiments further include instructions for use according to the methods described herein. The kits further include instructions for selecting a suitable subject for treatment. The instructions provided in kits of the present disclosure are typically instructions written on a label or package insert (e.g., a sheet of paper included in the kit), although machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.
[0303] In some embodiments, the kit comprises: a) a composition comprising an anti-epiregulin antibody and / or antigen-binding fragment described herein, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier; and optionally b) instructions for administering the described antibody or antigen-binding fragment for the treatment of a disease or disorder.
[0304] In some embodiments, the kit comprises: a) a composition comprising an epiregulin inhibitor, including but not limited to a soluble ErbB receptor, e.g., a decoy receptor such as a soluble EGFR, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier; and, optionally, b) instructions for administering the epiregulin inhibitor for the treatment of a disease or disorder.
[0305] In some embodiments, the kit comprises: a) a composition comprising a CAR modified cell (e.g., a CAR-T cell) described herein, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier; and, optionally, b) instructions for administering the CAR modified cell (e.g., a CAR-T cell) for the treatment of a disease or disorder.
[0306] In some embodiments, the kit comprises: a) a composition comprising an epiregulin inhibitor, including an aptamer, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier; and, optionally, b) instructions for administering the epiregulin inhibitor for the treatment of a disease or disorder.
[0307] In some embodiments, the kit comprises: a) a composition comprising an epiregulin inhibitor comprising an alternative scaffold, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier; and, optionally, b) instructions for administering the epiregulin inhibitor for the treatment of a disease or disorder.
[0308] The kits of the present disclosure are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. The kits may optionally provide additional components, such as buffers and interpretive information. Thus, the present application also provides articles of manufacture that include vials (such as sealed vials), bottles, jars, flexible packaging, and the like.
[0309] In some embodiments, the kit comprises one or more components that facilitate delivery of the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments), or compositions comprising the agents, and / or additional therapeutic agents to a subject. In some embodiments, the kit comprises, for example, a syringe and needle suitable for delivery to cells of a subject. In such embodiments, the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments), or compositions comprising the agents, may be contained in the kit in a bag or in one or more vials. In some embodiments, the kit comprises components that facilitate intravenous or intra-arterial delivery of the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments), or compositions comprising the agents, to a subject. In some embodiments, the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments), or compositions comprising the agents, may be contained, for example, in a bottle or bag (e.g., a blood bag or similar bag capable of containing up to about 1.5 L of solution comprising cells), and the kit further comprises tubing and needles suitable for delivery of the described epiregulin inhibitors (e.g., antibodies or antigen-binding fragments), or compositions comprising the agents, to a subject.
[0310] The instructions associated with the use of the composition generally include information regarding dosage, dosing schedule, and route of administration for the intended treatment. The container may be a unit dose, bulk package (e.g., multi-dose package), or less than a unit dose. For example, a kit may be provided that contains a sufficient dosage of an epiregulin inhibitor (e.g., an antibody or antigen-binding fragment) as disclosed herein to provide effective treatment to a subject over an extended period of time, such as 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 3 weeks, 4 weeks, 6 weeks, 8 weeks, 3 months, 4 months, 5 months, 7 months, 8 months, 9 months, or longer. The kit may include multiple unit doses of the pharmaceutical composition and instructions for use, and may be packaged in a quantity sufficient for storage and use in a pharmacy, such as a hospital pharmacy and a compounding pharmacy. EXAMPLES
[0311] To further illustrate some of the embodiments disclosed herein, the following examples are provided, which are intended to illustrate, but not to limit, embodiments of the present disclosure.
[0312] Example 1. Generation of human epiregulin neutralizing antibodies In this study, we aimed to generate humanized epiregulin neutralizing antibodies for the treatment of scleroderma (systemic sclerosis / SSc)-associated fibrosis of the skin and lungs, as well as other fibrotic diseases such as idiopathic pulmonary fibrosis, chronic graft-versus-host disease, and pulmonary fibrosis, a complication of COVID19 infection. To achieve the proposed goals of this study, we launched a project to generate humanized epiregulin antibodies using Alloy mice, which can generate fully human antibody variable regions. Alloy mice (ATX GK-BL6 and ATX GK MIX) were used. A bulk order of recombinant human epiregulin containing the epidermal growth factor (EGF) domain was purchased from R&D Biosciences (Cat# 1195-EP) for use as an immunogen. Triplicates of each Alloy mouse strain were immunized with recombinant epiregulin protein (illustrated in Figure 1). Epiregulin antibody titers were measured 35 days after immunization. Although the mixed background of Alloy mice produced positive epiregulin titers, B6 did not (Figure 2). B cells from the spleens of the mixed mice were pooled and used to generate a hybridoma library. From the hybridoma library, cells were plated individually to obtain five wells whose supernatants contained epiregulin-binding antibodies by ELISA (Figure 3, and Table 1). The variable regions of the heavy and light chains of these clones were sequenced, from which two unique sequences were found. As discussed below, the unique clones representing wells M3, M4, and M5 were found to have neutralizing activity against human epiregulin protein. The sequences of the antibodies generated by M3-5 are shown in Figure 4, and this antibody clone is referred to herein as humanized epiregulin neutralizing antibody 1 (hEreg NAb1).
[0313] [Table 1]
[0314] Example 2. hEreg NAb1 neutralizes recombinant and full-length epiregulin protein To evaluate their epiregulin inhibitory potential, we tested whether the two unique antibodies generated by the hybridoma clones could inhibit recombinant epiregulin protein in vitro. As characteristic of other EGFR ligands, recombinant human epiregulin (identical to that used to immunize Alloy mice) induced proliferation of cultured human foreskin fibroblasts (HFFs, ATCC# SCRC-1041) (Figure 5, left panel). Maximal proliferation occurred at 100 ng / ml, so this concentration was used for subsequent inhibition experiments. We then compared the inhibitory potential of hEreg NAb1 and a commercial rat anti-human / mouse neutralizing epiregulin antibody (R&D Systems MAB1068) against epiregulin-induced HFF proliferation. Similar to the commercial neutralizing antibody, hEreg NAb1 inhibited HFF proliferation in a concentration-dependent manner (Figure 5, center and right panels). IC of commercial antibody and hEreg NAb1 50 were comparable, 0.16 μg / ml for the commercial antibody and 0.1-0.3 μg / ml for the humanized antibody. Cultured HFFs expressed endogenous full-length epiregulin but little or no other EGFR ligands. If HFFs depend on epiregulin expression for growth and survival, inhibition of the endogenously produced protein should reduce their growth. Thus, HFFs were incubated with increasing concentrations of hEreg NAb1 and a reduction in growth was observed. This was due to inhibition of full-length epiregulin protein by hEreg NAb1 (Figure 6). Thus, hEreg NAb1 inhibits both recombinant and full-length human epiregulin protein.
[0315] Example 3. hEreg NAb1 does not cross-react with mouse epiregulin To validate the humanized antibody in a mouse model of fibrosis, we needed to establish whether it cross-reacted with the mouse epiregulin homologue. To set up the assay, we first tested whether recombinant mouse epiregulin could induce HFF proliferation, which was similar to the human protein (Figure 7, left panel). The same commercially available epiregulin antibody used above also inhibited mouse epiregulin-induced HFF proliferation (Figure 7, center panel). In contrast, hEreg NAb1 required a >100-fold higher concentration to inhibit HFF proliferation by mouse epiregulin protein (Figure 7, right panel). These results indicate that hEreg NAb1 has little cross-reactivity to mouse epiregulin protein. These findings are likely due to the negative selection of B cells producing autoreactive antibodies by generating humanized antibodies in mice.
[0316] Example 4. hEreg NAb1 shows no cross-reactivity with other human EGFR ligands We next considered whether hEreg NAb1 could inhibit other EGFR ligands (commercially available from R&D Systems). HFFs were incubated with only 5 mg / ml hEreg NAb1, which inhibits epiregulin-driven HFF growth as described above. We tested whether the addition of the other six EGFR ligands could rescue HFF growth by EGFR activation. Compared with the hEreg NAb1-only control, the lowest tested concentration, 0.1 ng / ml of each EGFR ligand, was sufficient to rescue HFF growth (Figure 8). For EGF, moderate rescue was shown at 0.1 ng / ml and complete rescue at 1 ng / ml. In other experiments, this stock of recombinant EGF did not stimulate HFF growth below 1 ng / mg, so the moderate rescue is likely a reflection of its relative affinity rather than cross-reactivity by the epiregulin antibody. Thus, hEreg NAb1 does not cross-react with other EGFR ligands.
[0317] Example 5. Humanized epiregulin antibodies have affinity comparable to FDA-approved biologics Octet biolayer interferometry was used to assess the kinetics of binding of humanized epiregulin antibodies to immobilized recombinant human epiregulin protein. hEreg NAb1 inhibited K D is 38 x 10 -12 together with the IC calculated from the HFF proliferation assay 50 was found to be 1.8 nM (Table 2). These are measurements comparable to current FDA-approved monoclonal antibody therapies for the treatment of psoriasis.
[0318] [Table 2]
[0319] Example 6. Use of hEreg NAbs for the treatment of fibrotic diseases Epiregulin enrichment was confirmed in human scleroderma skin and lung fibrotic tissues. In mouse models, rat anti-human / mouse epiregulin antibodies were used as surrogate therapeutic agents, which reversed both skin and lung fibrosis. hEreg NAb1 can be used to treat scleroderma-associated fibrosis in skin, lung, and other tissues. Because epiregulin enrichment occurs in other fibrotic tissues, such as idiopathic pulmonary fibrosis, keloids, and scars, hEreg NAb may have therapeutic potential for these diseases as well. Furthermore, COVID19-induced pulmonary fibrosis has a similar single-cell RNA expression profile to idiopathic pulmonary fibrosis. Thus, hEreg NAb may be broadly applicable to the treatment of human fibrotic diseases in multiple tissues, including chronic graft-versus-host disease, sclerosing graft-versus-host disease, and sclerosing graft-versus-host disease skin fibrosis.
[0320] Example 7. hEreg NAb1 reduces markers of skin fibrosis As described in the epiregulin manuscript by Odell et al. in Science Immunology, epiregulin enrichment was identified in human scleroderma skin and lung fibrotic tissues. In a bleomycin-induced skin and lung fibrosis mouse model, a commercially available rat anti-human / mouse epiregulin antibody (R&D Biosciences MAB1068) reversed both skin and lung fibrosis. This antibody was tested for its ability to reduce skin fibrosis in human disease. The antibody was incubated with skin explants from patients with SSc and lung explants from deceased IPF donors compared to untreated controls. Epiregulin inhibition with this surrogate antibody was found to reduce the expression of fibrotic protein markers in both SSc fibrotic skin and IPF fibrotic lung.
[0321] We next investigated whether hEreg NAb1 could reduce fibrosis similarly to the epiregulin-neutralizing rat antibody. To investigate whether hEreg NAb1 reduces fibrotic protein markers, hEreg NAb1 was tested on skin biopsies from two patients with a fibrotic form of graft-vs-host disease (sGvHD). Patient 1 was a 51-year-old male who had received a stem cell transplant from a matched unrelated donor for the treatment of myelodysplastic syndrome 3 years ago and was not receiving immunosuppressive therapy. Patient 2 was a 76-year-old male who had received a stem cell transplant from a matched unrelated donor for the treatment of acute myeloid leukemia 3 years ago and was not receiving immunosuppressive therapy. Paired 4 mm skin biopsies from the most affected skin of the right arm of patient 1 and the left abdomen of patient 2 were obtained (Figure 21A). Skin explants were incubated with 2.5 mg / ml hEreg NAb1 or isotype control IgG1 antibody for 10 days. The medium was changed every 48 hours, and the levels of fibrotic protein markers in the supernatants were quantified by ELISA. Skin explants treated with hEreg NAb1 from patient 1 showed significantly reduced expression of TNC, TIMP1, and MCP-1 compared to the IgG1 isotype control antibody (Figures 21B-21C). Skin treated with hEreg NAb1 from patient 2 also showed significantly reduced expression of TNC, but not TIMP1 or MCP-1. hEreg NAb1 did not reduce expression of procollagen I α1 / procollagen I N-terminal propeptide (PINP) or fibronectin (FN) in skin explants from either patient. These results demonstrate that expression of multiple fibrotic markers by human fibrotic skin can be directly reduced. As TNC was the most consistently reduced fibrotic marker gene, this may provide an excellent biomarker for hEreg NAb1 in patients.
[0322] Example 8. Indications for hEreg NAb1 hEreg NAb1 has the strongest preclinical data for the treatment of sGvHD, SSc, and IPF, because it has been validated for its ability to reduce sGvHD skin fibrosis and surrogate rat epiregulin neutralizing antibodies have been used in SSc skin fibrosis and IPF lung fibrosis. hEreg NAb1 has therapeutic potential for additional fibrotic diseases such as keloid scars. Furthermore, COVID19-induced pulmonary fibrosis has a similar single-cell RNA expression profile to idiopathic pulmonary fibrosis. Thus, hEreg NAb may be broadly applicable for the treatment of human fibrotic diseases in multiple tissues.
[0323] Example 9. EGFR activation marks pathogenic fibroblasts in SSc skin and lung To understand the cell signaling occurring in SSc skin, fibrotic skin biopsies for single-cell RNA sequencing (scRNA-Seq) were obtained from five diffuse cutaneous SSc patients and five healthy controls. Clinical characteristics of study participants, including age, sex, affected organs, comorbid conditions, and immunomodulatory therapy at the time of biopsy, are listed in Table 3. Immediately after skin biopsy, tissue was lysed, all viable cells were sorted, and barcoded single-cell cDNA libraries were generated using 10x Chromium Single Cell Controller. Uniform manifold approximation projection (UMAP) embedding of single-cell cDNA identified 12 major cell clusters (Figure 9A), each defined by a set of signature genes (Figure 16). Cells from individual SSc samples were localized in similar regions of fibroblast, pericyte, and endothelial clusters (Figure 9B), suggesting that gene expression profiles in cells from fibrotic skin are similar compared to those from healthy skin. SSc dermal fibroblasts showed increased expression of multiple extracellular matrix (ECM) genes, including collagen types I and III (Figure 9C). Similarly, SSc pericytes, marked by regulator of G protein signaling 5 (RGS5) expression (26), showed increased expression of collagen types I, III, IV, and VI transcripts. Together, these data indicate that both fibroblasts and pericytes produced excess collagen in SSc skin.
[0324] [Table 3]
[0325] To identify signaling pathways driving abundant ECM production in SSc, we calculated differential gene expression for each cell type in SSc compared to healthy controls and performed functional enrichment analysis using DAVID (27) for upregulated genes with log2(fold change) >0.58 and p-value <0.05. As shown in Figure 9D (full list in Table 4), enriched gene ontology terms included outcomes such as ECM organization and type I interferon signaling (28, 29). However, in addition to these outcomes, multiple pathways related to receptor tyrosine kinase (RTK) signal transduction were found, such as cell proliferation, response to fibroblast growth factor (FGF) stimulation, collagen-activated RTK signaling, positive regulation of extracellular signal-regulated kinase 1 and 2 (ERK1 and ERK2) cascades, and positive regulation of phosphoinositide 3 kinase (PI3K) activity. Based on previous studies showing that inhibition of EGFR can prevent fibrosis (8-10), and our findings herein that multiple EGFR ligands are overexpressed in SSc skin (see also, e.g., Example 10), we investigated the scRNA-Seq data to determine the cell types that most strongly express EGFR, and found that EGFR is expressed by fibroblasts and pericytes (Figure 9E). Thus, these data suggest that EGFR may be activated in SSc fibroblasts and pericytes to regulate their ECM production. Table 4 shows healthy skin and lung, as well as SSc skin and lung enriched for receptor-ligand interactions. In particular, the enriched receptor-ligand interactions of the SSc skin data and at least 2 / 3 of the SSc lung data set were compared to healthy controls. The interactions shown in italics are enriched in both skin and lung, and the remaining enriched interactions are different between skin and lung.
[0326] [Table 4] TIFF2025509220000007.tif254170
[0327] EGFR expression (EGFR+ ) Determining whether fibroblasts and pericytes show differential expression of related SSc gene signatures was a key focus of this example. Using skin scRNA-Seq data, we identified EGFR - SSc fibroblasts and EGFR + and EGFR - EGFR compared to healthy control fibroblasts + Differential gene expression in SSc fibroblasts was calculated.
[0328] Compared with other fibroblast subsets, EGFR + The upregulated genes with the highest differential expression by SSc fibroblasts and the lowest p-values are shown in Figure 9F. In particular, EGFR + SSc fibroblasts activate Wingless-related insertion site (Wnt) signaling (e.g., secreted Frizzled-related protein 2, SFRP2; collagen triple helical repeat-containing protein 1, CTHRC1; and Wnt1-inducible signaling pathway protein-2, WISP2), pathways activated primarily by fibroblasts residing in the reticular dermis (13), which are hyperactivated in SSc skin (30). Among Wnt genes, expression of SFRP2 defines a subset of dermal fibroblasts (31, 32) that have recently been shown to differentiate into myofibroblasts in SSc skin (15). CTHRC1 is a gene that characterizes a subpopulation of fibroblasts that produce the most collagen in fibrotic lung specimens in SSc and idiopathic pulmonary fibrosis (IPF) (33) and, together with leucine-rich repeat-containing protein 15 (LRRC15), is a tissue-wide marker of myofibroblasts (16). EGFR +SSc fibroblasts also expressed high levels of interferon-inducible genes (e.g., interferon-α-inducible protein 27 (IFI27), bone marrow stromal cell antigen 2 (BST2), and interferon-α-inducible protein 6 (IFI6)) that have been shown to correlate with SSc disease severity (34, 35). Fibroblast subclustering shown in Figure 9G demonstrates that while both healthy and SSc fibroblasts express EGFR, in SSc fibroblasts EGFR is coexpressed with the fibrosis signature genes described above. EGFR + In contrast to fibroblasts, EGFR + A similar analysis of pericytes did not reveal overexpression of the fibrosis gene signature. + SSc fibroblasts, but not pericytes, express multiple key gene signatures associated with SSc skin and lung fibrosis.
[0329] Next, EGFR + We assessed whether SSc fibroblasts are activated in areas of fibrotic dermis. Upon activation, EGFR is phosphorylated at multiple sites in its cytoplasmic domain (36), making it detectable using a phospho-specific antibody to phosphorylate EGFR (pEGFR). To confirm activation of EGFR in SSc, SSc skin was stained with the phospho-specific antibody Tyr-1068 against EGFR, and strongly labeled cells were observed in the fibrotic dermis (Figure 9H, top row; isotype control in Figure 16C, low magnification scans of histology and immunohistochemistry in Figure 17). Similarly, as shown in Figure 9H, bottom row, pEGFR was also phosphorylated at multiple sites in the cytoplasmic domain (37), making it detectable using a phospho-specific antibody to phosphorylate EGFR (pEGFR). + pEGFR cells were observed in fibrotic lung tissue. + Both cells co-stained with vimentin (FIG. 16D), confirming its expression and activation in fibroblasts and pericytes. pEGFR in Skin and Lung +Quantification of the cells showed that they were significantly increased in SSc compared to healthy control samples (Figure 9I). Thus, EGFR-expressing fibroblasts are activated in fibrotic skin and lung and express genes that characterize fibrosis.
[0330] Example 10. Epiregulin + Dendritic cells accumulate in human skin and lung fibrosis EGFR has seven activating ligands with distinct signaling properties based on their binding kinetics (37, 38). To characterize the activating ligands of EGFR and other RTKs in SSc skin, we identified receptor-ligand enrichment in the skin scRNA-Seq dataset using CellPhoneDB (39, 40) (www.cellphonedb.org), which identifies increased expression of receptor-ligand pairs between cell clusters. Significant interactions, indicated by a rank <0.05, were identified comparing SSc to healthy skin and examined based on the cell type generating each ligand-receptor pair. Enriched interactions in the SSc skin signaling network consisted primarily of growth factor ligands and their receptors, including EGFR, platelet-derived growth factor receptor (PDGFR), NOTCH, ephrin, and other receptor tyrosine kinases (illustrated in Figure 18A), with most growth signals occurring between mesenchymal cell types. Compared to mesenchymal cells, immune cells expressed distinct growth factor ligands, including EGFR activating ligands and oncostatin M. These findings suggest that immune-mesenchymal and mesenchymal-mesenchymal growth factor signals support the cell-cell communication network in fibrotic skin.
[0331] To investigate whether the significant interactions identified in SSc skin were reproducible in other tissues, we compared skin scRNA-Seq data with published scRNA-Seq data from another study of SSc skin (15), a study of cutaneous keloid scars (14), and three studies of SSc-associated pulmonary fibrosis in patients at the time of lung transplantation (33, 41, 42). Enriched interactions common to at least two of the SSc skin and lung datasets are shown in Figure S10A. The most significant interactions were found between epiregulin from a cluster of bone marrow antigen-presenting cells (APCs) and EGFR in two subclusters of fibroblasts. Elevated expression of epiregulin in all tissues of SSc skin compared to healthy controls was confirmed by quantitative polymerase chain reaction (qPCR) (Figure S18B). In myeloid antigen-presenting cells (APCs), including dendritic cells (DCs), monocytes, and macrophages, expression of the EGFR ligands amphiregulin and heparin-binding EGF-like growth factor (HBEGF) was also enriched in the scRNA-Seq data but not increased when assayed with qPCR. To better visualize the hierarchy of myeloid APC-fibroblast interactions, the rank of each EGFR ligand from each study is plotted in Figure 10B. Compared to healthy controls, SSc skin and lungs showed higher enrichment of epiregulin-EGFR interactions than amphiregulin or HBEGF. Enrichment of epiregulin with EGFR was also observed in scarred and keloid skin, as well as in lungs of patients with idiopathic pulmonary fibrosis (IPF), a related but pathologically distinct fibrotic lung disease. Two studies (skin and lung 2 in FIG. 10C) also showed enriched expression of epiregulin with EGFR in healthy skin, which may be due to technical artifacts of sample processing over long digestion times. Collectively, these data suggest that epiregulin is a common pathogenic signaling molecule in multiple fibrotic diseases of the skin and lung.
[0332] The cellular origin and function of epiregulin have not been clearly defined. Among the cell types in the skin scRNA-Seq data, epiregulin was uniquely expressed in a cluster of bone marrow APCs (Figure S10C), whereas amphiregulin and HBEGF were expressed by bone marrow APCs and multiple other cell types. A recent study of healthy human lungs identified epiregulin as a defining gene specific to a rare DC cell population (43). In the skin data presented here, epiregulin expression (EREG) from both healthy and SSc samples was significantly higher than that from wild-type mice (Figure S10C). + ) APCs showed similar gene expression profiles to each other and co-expression of amphiregulin similar to healthy human lungs ( FIG. 10D ). + APCs also express circulating cluster of differentiation 1c positive (CD1c) antigens whose maturation can be induced by type I interferon. + ) showed elevated markers of DC3 (e.g., versican (VCAN), S100A8, and S100A9), a proinflammatory subset of DCs (44, 45). + Surface expression of epiregulin in DCs was confirmed by fluorescence-activated cell sorting (FACS) analysis of peripheral blood from healthy participants (Figures 18C-18D). Thus, enrichment of epiregulin expression in APCs in SSc most likely reflects the inducible cell state of DCs.
[0333] EREG in SSc skin and lung + To assess the spatial localization and abundance of DCs, these locations were studied by immunohistochemistry and immunofluorescence. + DC clusters were observed around blood vessels and in areas of fibrotic tissue that were rare in healthy skin and lung (Fig. S10E). Furthermore, counting of SSc skin and lung showed that the number of epiregulin-positive cells in each tissue was significantly increased compared to healthy controls (Fig. S10F). Immunofluorescence demonstrated that both healthy and SSc skin expressed pEGFR +In SSc, these blood vessels coursed through the fibrous dermis and colocalized with epiregulin (Fig. 1G, top two rows). In SSc, pEGFR colabeled mostly with epiregulin. + There were areas of fibrosis containing EREG cells in the SSc skin and lung, but not in the healthy lung (bottom two rows in Figure 10G). Because epiregulin is shed from the cell surface by proteolytic cleavage by A disintegrin and metalloprotease 17 (ADAM17) (46), these findings suggest that secreted epiregulin binds to EGFR on fibroblasts in SSc skin and lung. + DCs are localized in SSc fibrotic skin and lungs and are abundantly increased in both tissues. + These results suggest that DCs may be responsible for activating EGFR and promoting disease.
[0334] We found that the number of EREG+ cells was increased in SSc skin compared with healthy controls (Figure 22A), and EREG expression showed a significant positive correlation with disease severity by modified Rodnan skin score (mRSS) (Figure 22B). The strength of the correlation between EREG expression and mRSS was small to moderate (Pearson correlation coefficient = 0.31). This correlation may be underestimated because EREG expression is induced by the relatively long skin digestion time (1 h) used in the protocol. Nevertheless, EREG expression by DC3 is associated with the severity of skin fibrosis in SSc.
[0335] Example 11. Epiregulin has distinct expression patterns in mouse skin and pulmonary fibrosis Different mouse models of SSc recapitulate features of distinct SSc disease subsets (47). To best investigate the role of epiregulin in SSc, the present study required a mouse model that relies on bone marrow APCs and induces both dermal and pulmonary fibrosis. The subcutaneous or intratracheal injection bleomycin model accomplishes each of these requirements (48, 49). A multiple-dosing protocol of bleomycin was tested (modified from Yamamoto et al. (50)) and it was determined that a single subcutaneous dose of 0.2 mg bleomycin per 6- to 10-week-old female B6 mouse induced skin changes similar to those in human SSc by 3 weeks after injection. Histological changes included a thickening of the dermis, a decrease in dermal white adipose tissue (DWAT), and CD34 expression, along with an increase in dermal collagen over time (Figure 11D). + The findings included a reduction in pulmonary fibrosis (51) (Figures 11A-11C). These findings are consistent with previous studies showing that B6 mice develop fibrosis over a period of up to 3 weeks (49) and that pulmonary fibrosis can be modeled with a single dose of bleomycin (52). Pulmonary fibrosis was modeled using a single intratracheal dose of 0.016 mg bleomycin sulfate as previously described (53).
[0336] To characterize the dynamics of EGFR ligand expression in bleomycin-induced skin and lung fibrosis, we observed the time course of gene expression in each tissue. One week after bleomycin injection into the skin, elevated expression of the high-affinity EGFR ligand transforming growth factor alpha (Tgfa) was observed in fibrotic skin compared to control skin treated with phosphate-buffered saline (PBS) (Figure 11E), consistent with a previous report that Tgfa-deficient mice are protected from the development of lung fibrosis (54). Three weeks after bleomycin injection, increased epiregulin expression was observed, which coincided in time with the elevated expression of interferon signature genes by DCs (Figure 11F). These observations suggest that while the early onset of fibrosis is influenced by Tgfa, the later chronic phase, represented by 3 weeks in mice, is influenced by interferon-activated EREG. +This suggests that DCs are likely important. Epiregulin expression was similarly measured in the lungs of mice after intratracheal administration of bleomycin, with elevated epiregulin levels 1–2 weeks after exposure to bleomycin (Figure (Figure11G). Thus, in mice exposed to bleomycin, epiregulin has a distinct expression pattern in both dermal and pulmonary fibrosis, making this model useful for understanding epiregulin-EGFR signaling relevant to human disease.
[0337] Example 12. Epiregulin inhibition reduces mouse and human dermal fibrosis Because the increase in epiregulin expression in fibrotic mouse skin was delayed until 3 weeks, it was hypothesized that epiregulin is dispensable for the development of fibrosis but is important during the chronic phase. In B6 mice, it takes 3 weeks for dermal fibrosis to develop in response to bleomycin (49). Therefore, to assess the time point at which epiregulin is required for the development and maintenance of dermal fibrosis, the response of epiregulin-deficient mice to bleomycin was examined 3 and 5 weeks after challenge. Five weeks after bleomycin injection, Eregulin expression was significantly increased in mice with bleomycin-deficient mice. - / - Mice showed reduced dermal thickness compared to wild-type mice, suggesting that epiregulin supports the persistence of fibrosis (Figures 12A-12C). - / - The reduction in skin fibrosis in mice was not due to any defect in fibrosis development, because at 3 weeks, Ereg - / - Mice with epiregulin in the fibrosis-inducing fibrosis model showed dermal thickening and elevated collagen levels similar to those of wild-type mice (Figures 19A-19C). Together, these findings indicate that epiregulin is required for the maintenance of fibrosis, but not for its establishment.
[0338] To specifically assess the time-dependent role of epiregulin in the bleomycin model of skin fibrosis using a method transferable to patient care, epiregulin was inhibited by subcutaneous injection of neutralizing antibody twice weekly starting 3 weeks after bleomycin injection (corresponding to peak expression in FIG. 11E), as illustrated in FIG. 12D. The antibody was injected at a location (dorsal neck) distant from the bleomycin (lumbar region). In wild-type mice, 2 weeks of treatment with epiregulin antibody (Ereg Ab) resulted in complete normalization of dermal thickness, a 50% reduction in collagen protein, and a 190% reduction in type I collagen α1 chain (COL1A1) expression below PBS control levels (FIGS. 12E-12G). Ereg Ab treatment was also associated with a reduction in pEGFR staining in dermal cells, which is consistent with EREG + These results support the inhibition of EGFR activation by DCs (Fig. 12I, lower panel). Ereg Ab did not change epiregulin expression in the skin, indicating that Ereg Ab inhibited the expression of EREG + Thus, after dermal fibrosis is established, inhibition of epiregulin reverses dermal thickening and collagen content, possibly via a reduction in collagen expression.
[0339] To investigate whether epiregulin inhibition could be translated to treat human SSc patients, epiregulin neutralizing antibodies were tested on skin explants obtained from a patient with worsening diffuse cutaneous SSc. At the time of biopsy, the patient had a modified Rodnan skin score of 45 and was positive for RNA polymerase III antibodies. Adjacent 4 mm punch biopsies were obtained from the right forearm and cultured for 9 days in the presence or absence of Ereg neutralizing antibodies. Epiregulin inhibition resulted in an improvement in the histological appearance of the skin, with a reduction in collagen fiber thickness (Figure 12J). Measurement of proCOL1A1 in untreated skin graft medium showed high initial levels at day 2, which declined over the remaining 7 days (Figure 12K). At each time point of culture, a decrease in proCOL1A1 was observed in Ereg Ab-treated samples compared to untreated controls. Thus, epiregulin inhibition appears to reduce fibrosis not only in mouse but also in human SSc skin.
[0340] Example 13. Epiregulin inhibition ameliorates pulmonary fibrosis in mice and humans Based on the efficacy of epiregulin inhibition in reversing dermal fibrosis along with increased expression of epiregulin in fibrotic mouse and human lungs, we next investigated whether epiregulin inhibition could also treat pulmonary fibrosis. Because epiregulin expression in the lung increases 1-2 weeks after intratracheal bleomycin exposure (Figure 11G), a 2-week antibody treatment was initiated on day 10 of bleomycin administration, as illustrated in Figure 13A. In these mice, treatment with subcutaneous Ereg Ab administration prevented the development of large fibrotic masses and preserved visible alveolar septa, as shown in Figure 13B. pEGFR +Clusters of cells were found in the fibrotic areas of the lungs of untreated mice injected with bleomycin, but were absent from PBS controls and mice treated with Ereg Ab (Fig. 13B, bottom), supporting the model of epiregulin-dependent EGFR activation. These findings corresponded to a significant improvement in pulmonary fibrosis indices, with a 2-point reduction in the modified Ashcroft score and a 38% reduction in collagen protein (Fig. 13C-13D). Ereg Ab treatment also reduced epiregulin expression from all tissues, which was consistent with the EREG + Decreased expression of epiregulin by DCs, or EREG + This may reflect a decrease in the number of DCs (Figure 13E). Together, these findings indicate that epiregulin is also required for the development of pulmonary fibrosis and is a promising therapeutic target in models of both dermal and pulmonary fibrosis.
[0341] To examine the effect of epiregulin inhibition on human pulmonary fibrosis, we investigated the impact of anti-epiregulin treatment on lung explants from patients with IPF that were found by scRNA-Seq to show enrichment of epiregulin and EGFR (Figure 10B). Pathological evaluation confirmed the diagnosis of early IPF as evidenced by the presence of fibroblast foci and hyperplasia of alveolar type II epithelial cells, as shown in Figure 13F. Lung tissues were plated in 24-well plates and cultured for 10 days with medium changes every 2 days. The impact of epiregulin antibodies compared to the multikinase inhibitor nintedanib and the transforming growth factor beta type 1 receptor TGF-βRI / Alk5 small molecule inhibitor was evaluated by measuring disease-related endpoints in gene expression and protein production. At the gene level, a decrease in epiregulin expression was observed that was similar to that observed in mouse lungs with both epiregulin and TGF-βRI inhibition (Figure 13G, left panel). These two inhibitors also significantly reduced the expression of COL1A1 (Figure 13G, right panel). Epiregulin inhibition reduced the expression of tenascin-C (TNC) and FN EDA(extra domain A-containing isoform of fibronectin) (Fig. 13H, left and right panels). At the protein level, a significant reduction in the levels of proCOL1A1 was observed with all three inhibitors (Fig. 13I, left panel). Anti-epiregulin treatment also reduced TIMP-1 levels and tended to significantly reduce monocyte chemoattractant protein-1 (MCP-1) (Fig. 13I, center and right panels). These results highlight the ability of epiregulin blockade to affect aspects of the ECM, ECM remodeling, and inflammation. Nintedanib and TGF-βRI / Alk5 inhibition also supported the reduction of some of these disease endpoints. Overall, these results support the potential of anti-epiregulin treatment as a modulator of disease-related endpoints in IPF and further support the findings with bleomycin in mouse lungs.
[0342] Example 14. Type I interferon-EGFR-NOTCH axis regulates epiregulin and ECM gene expression scRNA-Seq data are +This suggests that DCs are an inducible state for DC3s. Therefore, we investigated what signals regulate epiregulin expression by human DC3s compared to circulating DCs and monocytes. To answer these questions, we first screened THP-1 monocytes for activating signals for epiregulin expression. Conserved regulatory elements within the first intron of the human epiregulin gene include binding sites for signal transducer and activator of transcription 1 (STAT1) complexed with signal transducer and activator of transcription 2 (STAT2) (STAT1 / 2), GATA binding protein 3 (GATA3), and FOS. STAT1 / 2 dimerization and activation are known to occur as a result of binding of ligands for type I interferon receptors (55). Accordingly, higher expression of interferon-stimulated genes was observed in the human scRNA-Seq data (Figure 9F) and in the mouse fibrosis model (Figure 11F). Previous studies of epiregulin expression by cultured smooth muscle cells have shown induction of epiregulin by interleukin 6 (IL-6), endothelin-1, angiotensin II, and α-thrombin (56, 57). Epiregulin expression in response to these cytokines was examined, showing the finding that in THP-1 monocytes, epiregulin is induced by the type I interferon IFNα2 (Figure 14A). However, epiregulin induction by endothelin-1, IL-6, IL-4, or TGFβ (the last two of which induce the transcription factors GATA3 and FOS, respectively) was not observed.
[0343] EREG + Although DCs showed a gene expression profile characteristic of DC3s, published peripheral blood scRNA-Seq also showed a differential expression profile between DC3s and CD14 + showed a similar expression profile between DC3s and monocytes (44). Thus, epiregulin may be expressed by both DC3s and monocytes. To determine whether monocytes, conventional dendritic cells (cDCs), or DC3s can be induced to express epiregulin, we examined their epiregulin expression levels in response to type I interferon. Monocytes and cDCs were cultured using fresh peripheral blood CD14 +Monocytes and CD1c + DCs were isolated. For DC3, whose maturation is dependent on GM-CSF (58), human bone marrow-derived DC3 (BMDC) were generated by culturing human bone marrow with granulocyte-macrophage colony-stimulating factor (GM-CSF) for 7 days. IFNα2 stimulates CD14 + Epiregulin expression was induced in both monocytes and BMDCs, but not in CD1c + and its expression in DCs (Figures 14B-14D). These data support the conclusion that CD14 + This supports a model in which epiregulin expression reflects a type I interferon-inducible cellular state of DC3, which may also include monocytes.
[0344] To understand how epiregulin regulates fibrotic pathways in dermal fibroblasts, we investigated the expression of growth factor ligands and receptors identified in the scRNA-Seq data. In particular, we noted that NOTCH receptors are commonly expressed by immune cells and fibroblasts, suggesting a potential feedback loop. After incubating confluent human foreskin fibroblasts (HFFs) with recombinant epiregulin, we observed increased expression of the NOTCH ligands nephroblastoma overexpressed (NOV) and delta-like ligand 4 (DLL4) along with their respective receptors NOTCH1 and NOTCH2 (Figure (Figure14E).14E). NOTCH3 expression was also increased, whereas expression of its ligand jagged1 (JAG1) was decreased. Autocrine signaling by NOTCH is tightly regulated by cis-inhibition, where the ligand inhibits the NOTCH receptor on the same cells (59). In epiregulin-treated HFFs, expression of NOTCH ligands and receptors was accompanied by increased expression of the NOTCH target genes hes family basic helix-loop-helix (bHLH) transcription factor 1 (HES1) and hes family bHLH transcription factor 4 (HES4), demonstrating pathway activation in response to epiregulin. Thus, in dermal fibroblasts, epiregulin induces expression of a specific subset of NOTCH ligands and receptors, which leads to activation of the NOTCH pathway.
[0345] Immune cells also express NOTCH receptors, so NOTCH ligands activate EREG. +We also tested whether IFNa2 could signal back to DCs. In response to IFNa2, epiregulin expression by BMDCs increased, followed by a decline to baseline by 6 h, suggesting a loss of responsiveness to this cytokine after a transient state of expression (Figure 14F). Epiregulin expression by BMDCs was subsequently restored by exposing these cells to the NOTCH ligands DLL4 and NOV (Figure 14F and Davi). Induction of epiregulin expression by NOTCH occurred to similar levels regardless of interferon priming. Thus, it is possible that NOTCH ligands, in addition to type I interferons, are additional inducers of epiregulin expression in primary DCs, thereby upregulating EREG expression. + It functions as a positive feedback signal from SSc fibroblasts to maintain DCs.
[0346] Given the ability of epiregulin to drive NOTCH activation, we next hypothesized that epiregulin might also regulate ECM gene expression. Unlike fresh adult dermal fibroblasts, cultured HFFs expressed epiregulin in an autocrine manner (Figure 14G). Taking advantage of this observation, we tested whether epiregulin neutralizing antibodies (Ereg Abs) could reduce ECM gene expression in cultured HFFs and found that Ereg Abs downregulated COL1A1, TNC, and FN. EDA We found that type I interferon significantly reduced the expression of EREG (Figure 14H). Overall, these results reveal a multicellular circuit by which type I interferon induces epiregulin expression in DC3 (Figure 14I). + DCs activate NOTCH signaling in fibroblasts, and fibroblast-derived NOTCH ligands activate EREG + It binds to NOTCH receptors on DCs to maintain epiregulin expression. Furthermore, epiregulin-mediated EGFR activation is required for the expression of multiple fibrotic ECM genes.
[0347] Example 15. Inhibition of the Type I Interferon-EGFR-NOTCH Axis Prevents Fibrosis In Vivo Initiation of the EGFR-NOTCH circuit by type I interferon implies that interferon inhibition prior to circuit activation during fibrosis reduces epiregulin expression and NOTCH activation. To test whether activation of the EGFR-NOTCH circuit is dependent on interferon in vivo, we used a bleomycin dermal fibrosis model. Two weeks after subcutaneous bleomycin injection, mice were treated intraperitoneally with an interferon receptor (interferon alpha and beta receptor subunit 1, Ifnar1) blocking antibody to inhibit activation of monocytes and DCs by type I interferon (illustrated in FIG. 15A). We hypothesized that this would prevent initiation of the signaling circuit. Indeed, compared to vehicle and isotype antibody-treated controls, mice treated with Ifnar1 antibody showed reduced skin thickness and collagen content (FIGS. 15B-15D). Furthermore, the relative expression of epiregulin and the NOTCH target gene Hes1 was reduced in mice treated with Ifnar1 antibody (FIGS. 15E-15F). This means that when administered before epiregulin induction, interferon inhibition can reduce fibrosis along with the stimulation for epiregulin expression, thereby preventing NOTCH activation. Thus, the interferon-EGFR-NOTCH circuit appears to be activated in vivo during skin fibrosis. In summary, scRNA-Seq analysis of SSc skin and lung identified an abnormally activated DC-fibroblast signaling circuit centered on type I interferon-triggered expression of epiregulin by DC3. Targeted epiregulin inhibition reversed fibrosis in both mouse skin and lung models and patient explants, identifying epiregulin as a potential breakthrough therapy for patients with SSc and other fibrotic diseases.
[0348] The Examples herein demonstrate how type I interferons induce the EGFR ligand epiregulin to activate multicellular circuits that promote the persistence of skin and lung fibrosis. +DCs are a recently identified rare population of dendritic cells with unknown function (43). Epiregulin is one of the seven cell surface EGFR ligands and has previously been reported to protect the gastrointestinal tract from dextran sulfate sodium colitis (60) and to signal with betacellulin and amphiregulin to induce follicular maturation (61). This study identified a novel EREG ligand called epiregulin. + We show that DC-defined ligands drive a multicellular circuit to activate NOTCH signaling and ECM expression in human fibroblasts. In patients, circulating levels of type I interferon correlate with the severity of fibrosis in SSc skin and lung (35, 62). Similarly, we show here that epiregulin, which drives the circuit, is abrogated by blocking type I interferon signaling. Thus, our findings provide a compelling mechanism to explain these observations in SSc disease development, whereby chronically elevated type I interferon in SSc patients drives epiregulin expression to induce EGFR and NOTCH activation and excessive ECM production. As a result, targeted inhibition of epiregulin can interrupt this circuit and reverse fibrotic disease.
[0349] Although EGFR and NOTCH are both developmental morphogens and have been observed to interact in progenitor cells, the connection between these signaling pathways has not been previously recognized in fibrosis. Previous studies have identified crosstalk between EGFR and NOTCH during development of the retina (63) and vulva (64) and in regulating neural stem cell fate (65). NOTCH3 has recently been identified to drive fibroblast-mediated inflammatory arthritis (66), but whether crosstalk with EGFR occurs in this context is unknown. Examples herein show that epiregulin induces NOTCH3 expression in fibroblasts, which can regulate NOTCH activation in fibroblasts. Furthermore, EGFR and NOTCH are integrated into signaling between immune and mesenchymal cells in human fibrotic diseases (illustrated in Figure 14I), and EGFR activation marks fibroblasts that produce excessive ECM in SSc.
[0350] Previous studies have shown that global EGFR inhibition can prevent the development of fibrosis in the skin, liver, and kidney (8-10). Taken alone, these observations suggested that EGFR inhibitors could be therapeutically effective for patients. However, clinical studies of broad-acting tyrosine kinase inhibitors for the treatment of skin and lung fibrosis have been marred by the occurrence of severe adverse events (67, 68). The findings disclosed herein show that targeted inhibition of the EGFR ligand epiregulin restores collagen and other ECM genes to homeostatic levels in animal models of fibrosis and in tissue explants. Thus, epiregulin provides a promising therapeutic target for clinical development to treat multiple fibrotic diseases.
[0351] The following are the methods used in the above examples.
[0352] Patients for the study. Skin biopsies from five patients with diffuse cutaneous SSc and five healthy controls were analyzed by single-cell RNA sequencing. Adult patients with diffuse scleroderma (systemic sclerosis) diagnosed by the American College of Rheumatology criteria (69) and healthy controls were recruited for a study approved by the Yale Human Investigation Committee (HIC# 1511016816). The clinical diagnosis of scleroderma was confirmed by histopathology of the skin in all patients. Women and minorities were not excluded from the study on the basis of sex, race, or ethnicity. Patient clinical data, including age, sex, age at disease onset, duration of disease, family history of autoimmune disease, and current and past treatments, were reviewed by Dr. Odell, who was the only member with access to the de-identified patient data. Exclusion criteria included evidence of overlapping autoimmune diseases, chronic blood infections including HIV and hepatitis B and C, and inability to provide informed consent. Healthy controls were excluded if they had a personal or family history of autoimmune disease.
[0353] Single-cell tissue preparation and RNA sequencing. After anesthetizing a 1-2 cm area of skin with 1% lidocaine hydrochloride with 1:100,000 epinephrine, two adjacent punch biopsies of 6 mm and 3 mm dimensions were performed. The 3 mm biopsy was fixed in 10% neutral buffered formalin, and the 6 mm biopsy was immediately processed for single-cell RNA library preparation. First, the entire 6 mm specimen was incubated at 37 °C for 45 min with shaking at 200-250 rpm in RPMI 1640 medium (Gibco) containing 5% fetal bovine serum (5% FBS / RPMI) and 10 mg / ml dispase II (Sigma D4693-1G). A 6 mm sample was then removed from the medium, minced with sterile iris scissors, and digested with 0.5 mg / ml Liberase TM (Sigma) and 30 units / ml DNase I in 5% FBS / RPMI for 45 min at 37 °C with shaking at 200-250 rpm. The resulting single cell suspension was then filtered through a 70 μm nylon membrane and washed. Viable cells were sorted on a Yale Flow Core FACSAria for final concentration and viability quantified with trypan blue on a hemocytometer. Cells were pelleted and suspended at 500-1000 cells / μl in phosphate buffered saline containing 0.04% bovine serum albumin. 3000-6000 cells with >80% viability were sent to the Yale University DNA Sequencing Facility for generation of single cell cDNA libraries using the Chromium Single Cell Controller (10x Genomics).
[0354] Single-cell analysis. Each cDNA library generated from 6 mm skin samples was paired-end sequenced on an Illumina HiSeq 2500 System in one lane with a read length of 75 base pairs, generating at least 75,000 reads per cell. The reads were then aligned using the 10x genomics Cell Ranger pipeline, clustering and gene expression analysis were performed, and samples were tabulated by normalized read counts. t-SNE plots used 10 principal components. The raw matrix obtained from Cell Ranger was also processed with the Seurat version 3R toolkit for single-cell genomics (70, 71) to filter low-quality samples, followed by data normalization (log-normalized using a default scaling factor of 10000), scaling, PCA analysis, UMAP clustering, and generation of violin plots, which were then analyzed using CellPhoneDB v2.0 (39, 40) for receptor-ligand enrichment. All 10x experiments were completed using the same 3' chemistry high-throughput sequencer to avoid batch effects. Raw matrices from skin and lung scRNA-Seq were downloaded from the NCBI Gene Expression Omnibus (GSE138669, GSE122960, GSE128169, GSE132771, and GSE163973) and analyzed as described above using the Seurat toolkit followed by CellPhoneDB. Donors numbers 1, 3, 4, and 7 were used for the healthy control data to best match the age and sex of the SSc samples in Reyfman et al. (41). Heatmaps of gene expression were generated from cell clusters with the 10x Loupe Browser v5 with MORPHEUS software (software.broadinstitute.org / morpheus).
[0355] Immunohistochemistry of skin and lung sections. From the patient's skin, 3 mm skin biopsy samples were fixed in 10% neutral buffered formalin for 24 hours and then embedded in paraffin. Samples were processed at Yale Pathology Tissue Services. For immunohistochemistry analysis, 5 μm sections were cut and slides were deparaffinized and rehydrated with distilled water. They were then placed in TBS with Tween®, the same solution used in the linearization step below. Endogenous peroxidase was blocked with 3% hydrogen peroxide and then rinsed. Slides were then treated with proteinase K for 7 minutes and then rinsed. Heat-induced epitope retrieval was used for co-labeling of pEGFR and vimentin. Slides were incubated with primary antibodies, rinsed, and the antibodies were detected with HRP-conjugated secondary antibodies. After identifying the reaction with DAB, slides were washed, counterstained in hematoxylin, dehydrated, cleared, and mounted with resin mounting medium. Quantification of epiregulin- and EGFR-positive cells was completed in a blinded manner by scoring the number of positive cells in 10 high-power fields.
[0356] Primary antibodies and dilutions: rabbit anti-human / mouse EGFR (phospho-Y1068) antibody (clone EP774Y, Abcam ab40815), diluted 1 / 400 in human tissues and 1 / 800 in mouse tissues; rabbit IgG isotype control (clone EPR25A, Abcam ab172730) 1 / 400; anti-human epiregulin antibody (R&D Biosciences AF1195) 5 μg / mL; anti-mouse / human epiregulin antibody (clone 189611, R&D Biosciences MAB1068); anti-mouse IFNAR-1 antibody (clone MAR1-5A3 from Bio X Cell)
[0357] Animals. Wild-type C57BL / 6 mice were purchased from Charles River Laboratories. DTReGFPpANeo(Mgl2-DTR-GFP) mice were kindly provided by Akiko Iwasaki (Yale University). All mice were maintained at the Yale University School of Medicine Animal Resources Center. Mouse experiments were performed in accordance with AAALAC guidelines under protocols approved by the Yale University Institutional Animal Care and Use Committee.
[0358] Bleomycin Mouse Model of Fibrosis. Mice were anesthetized using an isoflurane precision vaporizer. For induction of skin fibrosis, mice were placed on their ventral sides and a 2 × 2 cm area was dehaired with electric clippers, after which 0.2 mg bleomycin sulfate (Sigma B8416) diluted in 0.2 ml sterile PBS (10 mg / kg) or 0.2 ml PBS vehicle control was injected subcutaneously using a 30-gauge needle. For induction of pulmonary fibrosis, mice were suspended vertically by their incisors and intratracheally administered 1.25 U / kg bleomycin sulfate in 60 μL PBS as previously described (53). From the lung specimens, three right lobes were used for hydroxyproline quantification, the left upper lobe for histology, and the left lower lobe for gene expression. The modified Ashcroft score (72) of the lungs was calculated in a blinded manner. To account for the variability in the efficacy of multiple lots of bleomycin in inducing fibrosis, all experiments include a wild-type (B6) control. Fibrosis was measured 21 days after bleomycin injection unless otherwise noted. Anesthetized mice were given 10 mg / kg of epiregulin neutralizing antibody (clone 189611, R&D Systems MAB1068) diluted in 100 μl of PBS subcutaneously in the dorsal neck twice weekly. To block type I interferon signaling, a single dose of 1.67 mg of IFNAR-1 antibody (clone MAR1-5A3 from Bio X Cell) diluted in 0.5 mL of PBS was given intraperitoneally 2 weeks after bleomycin injection. For bulk RNA sequencing of skin dendritic cells, Mgl2 DTReGFPpANeoMice were injected subcutaneously with bleomycin as described above, but not with diphtheria toxin. Three weeks later, affected skin was harvested and digested with 0.5 mg / ml Liberase TM (Sigma) and 30 units / ml DNase I in 5% FBS / RPMI for 1 h at 37°C with shaking at 200-250 rpm. The resulting single cell suspension was then filtered through a 70 μm nylon membrane and washed. Live GFP was then isolated. + Cellular CD64 - Dendritic cells were sorted from macrophages by population gating, followed by bulk RNA sequencing and analysis with a suite of Tuxedo applications.
[0359] Culture of patient skin and lung explants. For the culture of skin explants, two adjacent 4 mm punch biopsies were obtained from the right arm of an SSc6 patient. They were immediately placed in skin medium of DMEM containing 4.5 g / L D-glucose, L-glutamine, 0.1% FBS, 100 U / ml penicillin-streptomycin, and 2.5 mg / L amphotericin B. After careful removal of excess subcutaneous fat with iris scissors, each biopsy specimen was gently floated epidermal side up in the center of a 12-well tissue culture plate containing 1 ml skin medium alone or 2.5 μg / ml anti-mouse / human epiregulin antibody, exposed to air, and then incubated at 37°C in a 5% CO2 humidified incubator. The medium was changed after 2 hours and on days 2, 5, and 7. The used skin medium was stored at -20°C before protein measurement. ProCOL1A1 was measured using an ELISA kit according to the manufacturer's instructions (Abcam, ab210966).
[0360] For lung explants, human IPF lungs (44-year-old Hispanic male) were obtained from the National Disease Research Interchange (NDRI), maintained at low temperature, and received within 24 hours after cross-clamping. A diagnosis of IPF of 2 years duration was confirmed by the NDRI. While maintained at low temperature, the tissue was first cut into coarse and then fine strips. From there, the tissue was cut into small pieces suitable for culture (approximately 50-100 mg in size). Pieces were cultured in 24-well plates in Dulbecco's Modified Eagle's Medium: F-12 Ham's Nutrient Mixture (DMEM: F-12, Gibco 11039-021). It is phenol red-free and contains L-glutamine, 15 mM HEPES, sodium bicarbonate, penicillin, streptomycin, and amphotericin antibiotic-antimycotic solution (Gibco), 50ug / ml gentamicin, and 1X insulin-transferrin-selenium-ethanolamine liquid supplement (Sigma). Media changes were performed every 2 days for 10 days, and changes of the pharmacological agents mentioned above occurred at each media change. After 10 days, culture supernatants were harvested, pre-cleared at 4000Xg (4°C, 10 min), transferred to clean 96-well polypropylene plates, and stored at -80°C until protein endpoint measurement. Secreted proteins measured included: Human MCP-1 V-Plex (MesoScale Discovery, K151NND-1), Human TIMP-1 (MesoScale Discovery, K151JFC-1), and Human Procollagen 1α1 DuoSet Elisa (R&D systems, DY6220-05). All proteins were assayed and analyzed according to the respective assay product datasheet. After 10 days, lung fragments were harvested and dissociated in 350 μl RLT buffer containing β-mercaptoethanol using a TissueLyser II (Qiagen), and mRNA was isolated using the Rneasy Fibrous mini kit (QiaGen, 74704). For each treatment group, secreted protein results represent 8 individual fragments and gene expression represents 4 individual fragments.
[0361] Hydroxyproline analysis. After euthanasia, shaved skin or lungs were stored at -70°C until processing. From the skin, 2 mm punch biopsies (Accu-Punch) were obtained from the affected area for hydroxyproline quantification using a Hydroxyproline Assay Kit (Sigma MAK008). Briefly, 2 mm skin specimens or three right lung lobes were boiled in 100 μl or 500 μl of 37% hydrochloric acid, respectively, at 120°C for 3 hours. Samples were then centrifuged at 16000xg for 1 minute to pellet remaining hair and debris. From the supernatant, 3 μl was transferred to a new microcentrifuge tube and air-dried with the top open at 60°C for approximately 25 minutes. The dried pellet was suspended in 100 μl of chloramine T / oxidizing buffer mixture for 5-10 min, followed by addition of 100 μl of diluted 4-(dimethylamino)benzaldehyde and incubation for 90 min at 60° C. The absorbance at 550 nm was measured using a BioRad iMark or BioTek Synergy HTX microplate reader.
[0362] Cell lines. THP-1 monocytes and human foreskin fibroblasts were purchased from ATCC (TIB-202 and SCRC-1041). CD14 + Monocytes and CD1c + DC precursor cells were isolated using the Human CD14 Positive Selection Kit II (STEMCELL Technologies) and the CD1c + Human BMDCs were isolated from fresh peripheral blood obtained from healthy participants using the Human Dendritic Cell Isolation Kit according to the manufacturer's protocol. Human BMDCs were generated by incubating bone marrow from MISTRG6 humanized mice (73, 74) with 100 ng / ml human GM-CSF (R&D Biosciences 215-GM) for 7 days.
[0363] Monocyte and dendritic cell gene expression. Monocytes and dendritic cells were incubated in Gibco Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 humidified incubator. They were incubated with cytokines for 4 hours prior to RNA isolation and cDNA synthesis, unless otherwise indicated, using the following concentrations: IFNa2 1000U / mL (Biolegend 592704), TGF-β1 0.64ng / ml (R&D Biosciences 7754-BH), endothelin-1 100ng / ml (Abcam ab158332), IL-4 25ng / ml (R&D Biosciences 6507-IL), and IL-6 100ng / ml (R&D Biosciences 206-IL). To test the effect of NOTCH ligands, monocytes were incubated in medium alone or 1000 U / mL IFNa2 for 6 h at 37°C. During the last 45 min, recombinant NOTCH ligands DLL4 (R&D Biosciences 1506-D4) and NOV (R&D Biosciences 1640-NV), each at 10 μg / mL, were added to the bottom of 48-well plates for 45 min at 37°C as previously described (75). Monocytes were pelleted and suspended in fresh medium before being transferred to wells containing NOTCH ligand or medium alone.
[0364] Fibroblast gene expression. Human foreskin fibroblasts (HFFs) were seeded overnight at 37°C in Dulbecco's modified Eagle medium (DMEM) containing 1% FBS in a 5% CO2 humidified incubator. The next day, the medium was removed and fresh medium was added. To test the effect of recombinant human epiregulin (R&D Biosciences 1195-EP) on NOTCH signaling, 1 μg / ml was added to confluent HFFs in medium supplemented with 50 μg / mL ascorbic acid, followed by RNA extraction and cDNA synthesis overnight. For EGFR ligand expression, subconfluent HFFs were incubated with medium alone for 48 h. For EGFR inhibition, subconfluent HFFs were incubated with medium alone or with 5 μg / mL of anti-human epiregulin neutralizing antibody (R&D Biosciences AF1195) for 24 h, followed by RNA isolation and qPCR analysis.
[0365] RNA preparation and quantitative PCR (qPCR). RNA was extracted from tissues and cells using the RNeasy Mini Plus Kit (Qiagen). Skin and lung tissues were disrupted and homogenized with a Qiagen TissueRuptor II in RLT Plus buffer containing 1:100 dilution of β-mercaptoethanol and 1:200 dilution of Reagent DX (Qiagen) for approximately 30-60 seconds until no intact tissue was visible remaining. cDNA was prepared using 0.5 mM dNTPs and 25 ng / μl Oligo d(T) 20Gene expression was generated using 10 U / μl Maxima H Minus Reverse Transcriptase supplemented with 100 μl of ... -ΔΔCt The calculation was performed using the method (77).
[0366] [Table 5]
[0367] [Table 6] References
[0368] 1. Gieseck RL, 3rd, Wilson MS, and Wynn TA. Type 2 immunity in tissue repair and fibrosis. Nat Rev Immunol. 2017. 2. Distler O, Highland KB, Gahlemann M, Azuma A, Fischer A, Mayes MD, et al. Nintedanib for Systemic Sclerosis-Associated Interstitial Lung Disease. N Engl J Med. 2019. 3. Khanna D, Lin CJF, Furst DE, Goldin J, Kim G, Kuwana M, et al. Tocilizumab in systemic sclerosis: a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Respir Med. 2020;8(10):963-74. 4. Olson LE, and Soriano P. Increased PDGFRalpha activation disrupts connective tissue development and drives systemic fibrosis. Dev Cell. 2009;16(2):303-13. 5. Chakraborty D, Zhu H, Jungel A, Summa L, Li YN, Matei AE, et al. Fibroblast growth factor receptor 3 activates a network of profibrotic signaling pathways to promote fibrosis in systemic sclerosis. Sci Transl Med. 2020;12(563). 6. Wilson KJ, Gilmore JL, Foley J, Lemmon MA, and Riese DJ, 2nd. Functional selectivity of EGF family peptide growth factors: implications for cancer. Pharmacol Ther. 2009;122(1):1-8. 7. Lofgren S, Hinchcliff M, Carns M, Wood T, Aren K, Arroyo E, et al. Integrated, multicohort analysis of systemic sclerosis identifies robust transcriptional signature of disease severity. JCI Insight. 2016;1(21):e89073. 8. Fuchs BC, Hoshida Y, Fujii T, Wei L, Yamada S, Lauwers GY, et al. Epidermal growth factor receptor inhibition attenuates liver fibrosis and development of hepatocellular carcinoma. Hepatology. 2014;59(4):1577-90. 9. Morin F, Kavian N, Marut W, Chereau C, Cerles O, Grange P, et al. Inhibition of EGFR Tyrosine Kinase by Erlotinib Prevents Sclerodermatous Graft-Versus-Host Disease in a Mouse Model. J Invest Dermatol. 2015;135(10):2385-93. 10. Liu N, Guo JK, Pang M, Tolbert E, Ponnusamy M, Gong R, et al. Genetic or pharmacologic blockade of EGFR inhibits renal fibrosis. J Am Soc Nephrol. 2012;23(5):854-67. 11. Suzuki H, Aoshiba K, Yokohori N, and Nagai A. Epidermal growth factor receptor tyrosine kinase inhibition augments a murine model of pulmonary fibrosis. Cancer Res. 2003;63(16):5054-9. 12. Zhou X, Franklin RA, Adler M, Jacox JB, Bailis W, Shyer JA, et al. Circuit Design Features of a Stable Two-Cell System. Cell. 2018;172(4):744-57 e17. 13. Sole-Boldo L, Raddatz G, Schutz S, Mallm JP, Rippe K, Lonsdorf AS, et al. Single-cell transcriptomes of the human skin reveal age-related loss of fibroblast priming. Commun Biol. 2020;3(1):188. 14. Deng CC, Hu YF, Zhu DH, Cheng Q, Gu JJ, Feng QL, et al. Single-cell RNA-seq reveals fibroblast heterogeneity and increased mesenchymal fibroblasts in human fibrotic skin diseases. Nat Commun. 2021;12(1):3709. 15. Tabib T, Huang M, Morse N, Papazoglou A, Behera R, Jia M, et al. Myofibroblast transcriptome indicates SFRP2(hi) fibroblast progenitors in systemic sclerosis skin. Nat Commun. 2021;12(1):4384. 16. Buechler MB, Pradhan RN, Krishnamurty AT, Cox C, Calviello AK, Wang AW, et al. Cross-tissue organization of the fibroblast lineage. Nature. 2021;593(7860):575-9. 17. Apostolidis SA, Stifano G, Tabib T, Rice LM, Morse CM, Kahaleh B, et al. Single Cell RNA Sequencing Identifies HSPG2 and APLNR as Markers of Endothelial Cell Injury in Systemic Sclerosis Skin. Front Immunol. 2018;9:2191. 18. Aliprantis AO, Wang J, Fathman JW, Lemaire R, Dorfman DM, Lafyatis R, et al. Transcription factor T-bet regulates skin sclerosis through its function in innate immunity and via IL-13. Proc Natl Acad Sci U S A. 2007;104(8):2827-30. 19. Satoh T, Nakagawa K, Sugihara F, Kuwahara R, Ashihara M, Yamane F, et al. Identification of an atypical monocyte and committed progenitor involved in fibrosis. Nature. 2017;541(7635):96-101. 20. Ah Kioon MD, Tripodo C, Fernandez D, Kirou KA, Spiera RF, Crow MK, et al. Plasmacytoid dendritic cells promote systemic sclerosis with a key role for TLR8. Sci Transl Med. 2018;10(423). 21. Kraling BM, Maul GG, and Jimenez SA. Mononuclear cellular infiltrates in clinically involved skin from patients with systemic sclerosis of recent onset predominantly consist of monocytes / macrophages. Pathobiology. 1995;63(1):48-56. 22. Duan H, Fleming J, Pritchard DK, Amon LM, Xue J, Arnett HA, et al. Combined analysis of monocyte and lymphocyte messenger RNA expression with serum protein profiles in patients with scleroderma. Arthritis Rheum. 2008;58(5):1465-74. 23. Wohlfahrt T, Usherenko S, Englbrecht M, Dees C, Weber S, Beyer C, et al. Type 2 innate lymphoid cell counts are increased in patients with systemic sclerosis and correlate with the extent of fibrosis. Ann Rheum Dis. 2015. 24. Kahari VM, Sandberg M, Kalimo H, Vuorio T, and Vuorio E. Identification of fibroblasts responsible for increased collagen production in localized scleroderma by in situ hybridization. J Invest Dermatol. 1988;90(5):664-70. 25. Scharffetter K, Lankat-Buttgereit B, and Krieg T. Localization of collagen mRNA in normal and scleroderma skin by in-situ hybridization. Eur J Clin Invest. 1988;18(1):9-17. 26. Bondjers C, Kalen M, Hellstrom M, Scheidl SJ, Abramsson A, Renner O, et al. Transcription profiling of platelet-derived growth factor-B-deficient mouse embryos identifies RGS5 as a novel marker for pericytes and vascular smooth muscle cells. Am J Pathol. 2003;162(3):721-9. 27. Huang da W, Sherman BT, and Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4(1):44-57. 28. Henderson NC, Rieder F, and Wynn TA. Fibrosis: from mechanisms to medicines. Nature. 2020;587(7835):555-66. 29. Der E, Suryawanshi H, Morozov P, Kustagi M, Goilav B, Ranabothu S, et al. Tubular cell and keratinocyte single-cell transcriptomics applied to lupus nephritis reveal type I IFN and fibrosis relevant pathways. Nat Immunol. 2019;20(7):915-27. 30. Wei J, Fang F, Lam AP, Sargent JL, Hamburg E, Hinchcliff ME, et al. Wnt / beta-catenin signaling is hyperactivated in systemic sclerosis and induces Smad-dependent fibrotic responses in mesenchymal cells. Arthritis Rheum. 2012;64(8):2734-45. 31. Ascension AM, Fuertes-Alvarez S, Ibanez-Sole O, Izeta A, and Arauzo-Bravo MJ. Human Dermal Fibroblast Subpopulations Are Conserved across Single-Cell RNA Sequencing Studies. J Invest Dermatol. 2021;141(7):1735-44 e35. 32. Plikus MV, Wang X, Sinha S, Forte E, Thompson SM, Herzog EL, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell. 2021;184(15):3852-72. 33. Tsukui T, Sun KH, Wetter JB, Wilson-Kanamori JR, Hazelwood LA, Henderson NC, et al. Collagen-producing lung cell atlas identifies multiple subsets with distinct localization and relevance to fibrosis. Nat Commun. 2020;11(1):1920. 34. Kim HJ, Li G, Gjertson D, Elashoff R, Shah SK, Ochs R, et al. Classification of parenchymal abnormality in scleroderma lung using a novel approach to denoise images collected via a multicenter study. Acad Radiol. 2008;15(8):1004-16. 35. Eloranta ML, Franck-Larsson K, Lovgren T, Kalamajski S, Ronnblom A, Rubin K, et al. Type I interferon system activation and association with disease manifestations in systemic sclerosis. Ann Rheum Dis. 2010;69(7):1396-402. 36. Lemmon MA, and Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell. 2010;141(7):1117-34. 37. Freed DM, Bessman NJ, Kiyatkin A, Salazar-Cavazos E, Byrne PO, Moore JO, et al. EGFR Ligands Differentially Stabilize Receptor Dimers to Specify Signaling Kinetics. Cell. 2017;171(3):683-95 e18. 38. Hu C, Leche CA, 2nd, Kiyatkin A, Yu Z, Stayrook SE, Ferguson KM, et al. Glioblastoma mutations alter EGFR dimer structure to prevent ligand bias. Nature. 2022. 39. Vento-Tormo R, Efremova M, Botting RA, Turco MY, Vento-Tormo M, Meyer KB, et al. Single-cell reconstruction of the early maternal-fetal interface in humans. Nature. 2018;563(7731):347-53. 40. Efremova M, Vento-Tormo M, Teichmann SA, and Vento-Tormo R. CellPhoneDB v2.0: Inferring cell-cell communication from combined expression of multi-subunit receptor-ligand complexes. bioRxiv. 2019:680926. 41. Reyfman PA, Walter JM, Joshi N, Anekalla KR, McQuattie-Pimentel AC, Chiu S, et al. Single-Cell Transcriptomic Analysis of Human Lung Provides Insights into the Pathobiology of Pulmonary Fibrosis. Am J Respir Crit Care Med. 2018. 42. Valenzi E, Bulik M, Tabib T, Morse C, Sembrat J, Trejo Bittar H, et al. Single-cell analysis reveals fibroblast heterogeneity and myofibroblasts in systemic sclerosis-associated interstitial lung disease. Ann Rheum Dis. 2019. 43. Travaglini KJ, Nabhan AN, Penland L, Sinha R, Gillich A, Sit RV, et al. A molecular cell atlas of the human lung from single-cell RNA sequencing. Nature. 2020;587(7835):619-25. 44. Villani AC, Satija R, Reynolds G, Sarkizova S, Shekhar K, Fletcher J, et al. Single-cell RNA-seq reveals new types of human blood dendritic cells, monocytes, and progenitors. Science. 2017;356(6335). 45. Girard M, Law JC, Edilova MI, and Watts TH. Type I interferons drive the maturation of human DC3s with a distinct costimulatory profile characterized by high GITRL. Sci Immunol. 2020;5(53). 46. Sahin U, Weskamp G, Kelly K, Zhou HM, Higashiyama S, Peschon J, et al. Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J Cell Biol. 2004;164(5):769-79. 47. Sargent JL, Li Z, Aliprantis AO, Greenblatt M, Lemaire R, Wu MH, et al. Identification of Optimal Mouse Models of Systemic Sclerosis by Interspecies Comparative Genomics. Arthritis Rheumatol. 2016;68(8):2003-15. 48. Lescoat A, Lecureur V, and Varga J. Contribution of monocytes and macrophages to the pathogenesis of systemic sclerosis: recent insights and therapeutic implications. Curr Opin Rheumatol. 2021;33(6):463-70. 49. Lakos G, Takagawa S, and Varga J. Animal models of scleroderma. Methods Mol Med. 2004;102:377-93. 50. Yamamoto T, Takagawa S, Katayama I, Yamazaki K, Hamazaki Y, Shinkai H, et al. Animal model of sclerotic skin. I: Local injections of bleomycin induce sclerotic skin mimicking scleroderma. J Invest Dermatol. 1999;112(4):456-62. 51. Aiba S, Tabata N, Ohtani H, and Tagami H. CD34+ spindle-shaped cells selectively disappear from the skin lesion of scleroderma. Arch Dermatol. 1994;130(5):593-7. 52. Snider GL, Hayes JA, and Korthy AL. Chronic interstitial pulmonary fibrosis produced in hamsters by endotracheal bleomycin: pathology and stereology. Am Rev Respir Dis. 1978;117(6):1099-108. 53. Rangarajan S, Bone NB, Zmijewska AA, Jiang S, Park DW, Bernard K, et al. Metformin reverses established lung fibrosis in a bleomycin model. Nat Med. 2018;24(8):1121-7. 54. Madtes DK, Elston AL, Hackman RC, Dunn AR, and Clark JG. Transforming growth factor-alpha deficiency reduces pulmonary fibrosis in transgenic mice. Am J Respir Cell Mol Biol. 1999;20(5):924-34. 55. O'Shea JJ, Schwartz DM, Villarino AV, Gadina M, McInnes IB, and Laurence A. The JAK-STAT pathway: impact on human disease and therapeutic intervention. Annu Rev Med. 2015;66:311-28. 56. Taylor DS, Cheng X, Pawlowski JE, Wallace AR, Ferrer P, and Molloy CJ. Epiregulin is a potent vascular smooth muscle cell-derived mitogen induced by angiotensin II, endothelin-1, and thrombin. Proc Natl Acad Sci U S A. 1999;96(4):1633-8. 57. Kyotani Y, Itaya-Hironaka A, Yamauchi A, Sakuramoto-Tsuchida S, Makino M, Takasawa S, et al. Intermittent hypoxia-induced epiregulin expression by IL-6 production in human coronary artery smooth muscle cells. FEBS Open Bio. 2018;8(5):868-76. 58. Bourdely P, Anselmi G, Vaivode K, Ramos RN, Missolo-Koussou Y, Hidalgo S, et al. Transcriptional and Functional Analysis of CD1c(+) Human Dendritic Cells Identifies a CD163(+) Subset Priming CD8(+)CD103(+) T Cells. Immunity. 2020;53(2):335-52 e8. 59. del Alamo D, Rouault H, and Schweisguth F. Mechanism and significance of cis-inhibition in Notch signalling. Curr Biol. 2011;21(1):R40-7. 60. Lee D, Pearsall RS, Das S, Dey SK, Godfrey VL, and Threadgill DW. Epiregulin is not essential for development of intestinal tumors but is required for protection from intestinal damage. Mol Cell Biol. 2004;24(20):8907-16. 61. Park JY, Su YQ, Ariga M, Law E, Jin SL, and Conti M. EGF-like growth factors as mediators of LH action in the ovulatory follicle. Science. 2004;303(5658):682-4. 62. Kim D, Peck A, Santer D, Patole P, Schwartz SM, Molitor JA, et al. Induction of interferon-alpha by scleroderma sera containing autoantibodies to topoisomerase I: association of higher interferon-alpha activity with lung fibrosis. Arthritis Rheum. 2008;58(7):2163-73. 63. Kumar JP, and Moses K. The EGF receptor and notch signaling pathways control the initiation of the morphogenetic furrow during Drosophila eye development. Development. 2001;128(14):2689-97. 64. Yoo AS, Bais C, and Greenwald I. Crosstalk between the EGFR and LIN-12 / Notch pathways in C. elegans vulval development. Science. 2004;303(5658):663-6. 65. Aguirre A, Rubio ME, and Gallo V. Notch and EGFR pathway interaction regulates neural stem cell number and self-renewal. Nature. 2010;467(7313):323-7. 66. Wei K, Korsunsky I, Marshall JL, Gao A, Watts GFM, Major T, et al. Notch signalling drives synovial fibroblast identity and arthritis pathology. Nature. 2020;582(7811):259-64. 67. Iwamoto N, Distler JH, and Distler O. Tyrosine kinase inhibitors in the treatment of systemic sclerosis: from animal models to clinical trials. Curr Rheumatol Rep. 2011;13(1):21-7. 68. Gordon JK, Martyanov V, Magro C, Wildman HF, Wood TA, Huang WT, et al. Nilotinib (Tasigna) in the treatment of early diffuse systemic sclerosis: an open-label, pilot clinical trial. Arthritis Res Ther. 2015;17:213. 69. van den Hoogen F, Khanna D, Fransen J, Johnson SR, Baron M, Tyndall A, et al. 2013 classification criteria for systemic sclerosis: an American college of rheumatology / European league against rheumatism collaborative initiative. Ann Rheum Dis. 2013;72(11):1747-55. 70. Butler A, Hoffman P, Smibert P, Papalexi E, and Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nature biotechnology. 2018. 71. Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM, 3rd, et al. Comprehensive Integration of Single-Cell Data. Cell. 2019;177(7):1888-902 e21. 72. Hubner RH, Gitter W, El Mokhtari NE, Mathiak M, Both M, Bolte H, et al. Standardized quantification of pulmonary fibrosis in histological samples. Biotechniques. 2008;44(4):507-11, 14-7. 73. Sefik E, Israelow B, Mirza H, Zhao J, Qu R, Kaffe E, et al. A humanized mouse model of chronic COVID-19. Nature biotechnology. 2021. 74. Rongvaux A, Willinger T, Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nature biotechnology. 2014;32(4):364-72. 75. Gerli MFM, Moyle LA, Benedetti S, Ferrari G, Ucuncu E, Ragazzi M, et al. Combined Notch and PDGF Signaling Enhances Migration and Expression of Stem Cell Markers while Inducing Perivascular Cell Features in Muscle Satellite Cells. Stem Cell Reports. 2019;12(3):461- 76. Chua SL, See Too WC, Khoo BY, and Few LL. UBC and YWHAZ as suitable reference genes for accurate normalisation of gene expression using MCF7, HCT116 and HepG2 cell lines. Cytotechnology. 2011;63(6):645-54. 77. Livak KJ, and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. 78. Bhattacharyya S, Tamaki Z, Wang W, Hinchcliff M, Hoover P, Getsios S, et al. FibronectinEDA promotes chronic cutaneous fibrosis through Toll-like receptor signaling. Sci Transl Med. 2014;6(232):232ra50. 79. Sampaio-Pinto V, Rodrigues SC, Laundos TL, Silva ED, Vasques-Novoa F, Silva AC, et al. Neonatal Apex Resection Triggers Cardiomyocyte Proliferation, Neovascularization and Functional Recovery Despite Local Fibrosis. Stem Cell Reports. 2018;10(3):860-74. 80. Garbers, C. et al. Inhibition of classic signaling is a novel function of soluble glycoprotein 130 (sgp130), which is controlled by the ratio of interleukin 6 and soluble interleukin 6 receptor. J Biol Chem 286, 42959-42970, doi:10.1074 / jbc.M111.295758 (2011).
[0369] The present invention is not limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to be included within the scope of the appended claims.
[0370] All patents, applications, publications, test methods, literature, and other materials cited herein are incorporated by reference in their entirety as if physically present herein.
[0371] TIFF2025509220000010.tif238170TIFF2025509220000011.tif250132TIFF2025509220000012.tif252114TIFF2025509220000013.tif251123TIFF2025509220000014.tif235110
Claims
1. An isolated antibody or antigen-binding fragment thereof that specifically binds to epiregulin, comprising three heavy chain complementarity determining regions (CDRs) (HCDR1, HCDR2, and HCDR3) contained within a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 1 or a sequence having at least 80% identity to that sequence; and / or three light chain CDRs (LCDR1, LCDR2, and LCDR3) contained within a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 6 or a sequence having at least 80% identity to that sequence.
2. The isolated antibody or antigen-binding fragment has the following characteristics: (a) specifically binds to the epiregulin epidermal growth factor (EGF)-like domain; (b) specifically binds to human epiregulin; (c) specifically binds epiregulin with a K D of less than about 1×10 −9 M, a K D of less than about 1×10 −10 M, or a K D of about 3.8×10 −11 M; (d) neutralizing epiregulin; (e) inhibiting the interaction of epiregulin with ErbB receptors; (f) inhibiting epiregulin-induced proliferation of fibroblasts; (g) does not specifically bind to mouse epiregulin; and (f) does not specifically bind to one or more other human EGFR ligands 2. The isolated antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment has one or more properties selected from the group consisting of:
3. The isolated antibody or antigen-binding fragment of claim 1, comprising: an HCDR1 having the amino acid sequence of SEQ ID NO: 2, an HCDR2 having the amino acid sequence of SEQ ID NO: 3, and / or an HCDR3 having the amino acid sequence of SEQ ID NO: 4; and / or an LCDR1 having the amino acid sequence of SEQ ID NO: 7, an LCDR2 having the amino acid sequence of SEQ ID NO: 8, and / or an LCDR3 having the amino acid sequence of SEQ ID NO:
9.
4. 2. The isolated antibody or antigen-binding fragment of claim 1, comprising a VH comprising the amino acid sequence of SEQ ID NO: 1 or a sequence having at least 80% identity to that sequence; and / or a VL comprising the amino acid sequence of SEQ ID NO: 6 or a sequence having at least 80% identity to that sequence.
5. 2. The isolated antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment is a human antibody, a monoclonal antibody, a humanized antibody, a single-chain antibody, Fab, Fab', F(ab')2, Fv, or scFv.
6. 2. The isolated antibody or antigen-binding fragment of claim 1, wherein the antibody is a humanized antibody.
7. 2. The isolated antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment is of the IgG1, IgG2, IgG3, or IgG4 isotype.
8. An isolated antibody or antigen-binding fragment thereof that competes with the antibody or antigen-binding fragment of claim 1 for binding to epiregulin.
9. An isolated antibody or antigen-binding fragment thereof that binds to the same epitope as the antibody or antigen-binding fragment of claim 1.
10. An isolated polynucleotide encoding the isolated antibody or antigen-binding fragment of any one of claims 1 to 9.
11. A vector comprising the polynucleotide of claim 10.
12. A host cell comprising the polynucleotide of claim 10.
13. A method for producing an isolated antibody or antigen-binding fragment that specifically binds to epiregulin, the method comprising the steps of culturing the host cell described in claim 12 and isolating the antibody or antibody-binding fragment.
14. A chimeric antigen receptor (CAR) comprising an extracellular domain comprising an antigen-binding portion that specifically binds to epiregulin, wherein the antigen-binding portion comprises the antibody or antigen-binding fragment of any one of claims 1 to 9.
15. An immune cell comprising the CAR of claim 14 on its cell surface.
16. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 9 and a pharmaceutically acceptable carrier or diluent.
17. A kit comprising: (i) the antibody or antigen-binding fragment of any one of claims 1 to 9; and (ii) packaging for the antibody or antigen-binding fragment.
18. 10. A method for inhibiting the activity of epiregulin in a cell, comprising contacting the cell with an effective amount of the antibody or antigen-binding fragment of any one of claims 1 to 9, except when the method is carried out inside the human body.
19. A composition for inhibiting the activity of epiregulin in a cell, comprising an antibody or antigen-binding fragment described in any one of claims 1 to 9, and contacting the cell with the antibody or antigen-binding fragment.
20. 10. A method for reversing or preventing one or more changes in cells associated with fibrosis, comprising contacting said cells with an effective amount of the antibody or antigen-binding fragment of any one of claims 1 to 9, except when the method is carried out in a human body.
21. A composition for reversing or preventing one or more changes in cells associated with fibrosis, comprising an antibody or antigen-binding fragment of any one of claims 1 to 9, wherein the cell is contacted with an effective amount of the antibody or antigen-binding fragment.
22. A composition for treating or preventing a fibrotic disease or disorder in a subject in need thereof, the composition comprising the antibody or antigen-binding fragment of any one of claims 1 to 9.