Methods and compositions for treating TNNT2-associated cardiomyopathy with viral vectors
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-03-18
- Publication Date
- 2026-03-27
AI Technical Summary
Current treatments for cardiomyopathy, a group of diseases that affect the heart's ability to pump blood effectively, are limited to managing secondary symptoms, with no definitive cure available.
The use of recombinant adeno-associated virus (rAAV) vectors to deliver transgenes into the heart, specifically targeting cardiomyocytes to improve cardiac function and treat cardiomyopathy.
The rAAV vector approach has shown potential in improving cardiac function by increasing left ventricular ejection fraction and reducing the thickness of the left ventricular wall, providing therapeutic benefits for up to two years.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] Priority This application claims priority to U.S. Provisional Patent Application No. 63 / 321,264, filed March 18, 2022, the entire contents of which are incorporated by reference herein. [Background technology]
[0002] background Cardiomyopathy represents a collection of diverse conditions of the heart muscle and is the second most common cause of heart disease in subjects, with medical management of secondary symptoms being the only treatment option. These diseases have many causes, symptoms, and treatments and can affect people of all ages and races. When cardiomyopathy occurs, the normal muscle in the heart can become enlarged, hardened, thin, or filled with substances that the body produces but that do not belong in the heart muscle. As a result, the ability of the heart muscle to pump blood is reduced, which can cause irregular heartbeats, blood backing up into the lungs or the rest of the body, and heart failure. Cardiomyopathy can be acquired or hereditary. The cause is not always known, but the genetic underpinnings of the genetic form of the disease are increasingly being understood.
[0003] Gene transfer strategies have been shown to ameliorate heart disease.
[0004] Incorporation by Reference of Materials in the Sequence Listing File This application incorporates by reference the material in the Sequence Listing contained in the following XML file being filed concurrently herewith: Filename: U120270091WO00-SEQ-PRW.xml; created on Mar. 16, 2023, size 204,832 bytes. Summary of the Invention
[0005] overview Cardiomyopathy is a class of heart muscle diseases that adversely affect the heart's ability to circulate blood through the cardiovascular system. There are various types of cardiomyopathy, including dilated cardiomyopathy, hypertrophic cardiomyopathy, and restrictive cardiomyopathy. Cardiomyopathy in the human population is a major medical burden, and although it is particularly desirable to treat cardiomyopathy in the human population, there is currently an unmet need for treatment.
[0006] Dilated cardiomyopathy (DCM) is one of the most common types of cardiomyopathy, occurring primarily in adults aged 20-60 years. DCM affects the ventricles and atria, the lower and upper chambers of the heart, respectively. Most forms of DCM are acquired from a number of causes, including coronary heart disease, heart attacks, high blood pressure, diabetes, thyroid disease, viral hepatitis and viral infections that inflame the heart muscle. Alcoholism and certain drugs, such as cocaine and amphetamines, as well as at least two drugs used to treat cancer (doxorubicin and daunorubicin), can also lead to DCM. In addition, there are numerous genetic forms of DCM, including, but not limited to, DCM associated with Duchenne and Becker muscular dystrophy. In some forms of Becker muscular dystrophy, as well as in most cases of Duchenne muscular dystrophy, cardiomyopathy can eventually limit the patient's survival.
[0007] Hypertrophic cardiomyopathy (HCM) occurs when the walls of the heart muscle become abnormally thickened. The increased wall thickness can not only increase cardiac complications, but can also block or obstruct the flow of blood through the heart.
[0008] Restrictive cardiomyopathy (RCM) is a condition that leads to stiffening of the heart's chambers over time. While the heart's ability to contract remains largely unaffected, the heart muscle does not fully relax between heart beats. This limits the ability of the ventricles to fill with blood, causing blood to flow backwards through the circulatory system.
[0009] Cardiac function is critically dependent on calcium-dependent signaling. During cardiac disease, the dysfunction of calcium channels in cardiomyocytes promotes calcium circulation abnormalities, further impairing cardiac function. Genetic transfer strategies to reduce calcium circulation abnormalities have been reported to improve cardiac disease in small and large animal models and in human clinical trials.
[0010] Disclosed herein is a gene delivery approach for the treatment of a human subject having one or more types of cardiomyopathy or symptoms thereof.
[0011] Accordingly, some aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) vector for delivering a transgene to the heart of a subject. Such a rAAV vector may include, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to one or more transgenes, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector includes, in addition to the promoter, a regulatory element that modifies expression, for example, in a manner that provides a physiologically relevant expression level and / or restricts expression to a specific cell type or tissue. In some embodiments, the regulatory element includes one or more of an enhancer, a 5' untranslated region (UTR), and a 3' UTR. In some embodiments, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of the transgene). In some embodiments, the two transgenes are operably linked to the same single promoter. In some embodiments, each transgene is operably linked to a separate promoter. In some embodiments in which multiple transgenes are provided, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of two transgenes expressed from a single promoter, or 3' of one or both transgenes expressed from different promoters). Aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) nucleic acid vector for delivering two or more transgenes to the heart of a subject, wherein the vector comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, two or more transgenes and a promoter operably linked to the two or more transgenes, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0012] In some embodiments, the therapeutic transgene is encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence set forth as SEQ ID NOs: 7-27, or SEQ ID NOs: 53-71, or SEQ ID NOs: 78-95, or SEQ ID NOs: 104-121, arranged in sequence. In some embodiments, one or more of the transgenes of the present disclosure are naturally occurring sequences. In some embodiments, one or more transgenes are engineered to be species-specific. In some embodiments, one or more transgenes are codon-optimized for expression in a species of interest, e.g., human. For example, in some embodiments, the therapeutic transgene (e.g., the TNNT2 transgene) is codon-optimized.
[0013] Further provided herein is a rAAV particle that contains the rAAV vector disclosed herein, encapsidated in AAV capsid.Other aspects of the present disclosure include compositions that contain the rAAV particle described herein.In some embodiments, such compositions can be administered to a subject for gene therapy for cardiomyopathy.In additional embodiments, such compositions can be administered to a subject for gene therapy for heart disease.In some embodiments, the heart disease causes heart failure in a subject.
[0014] The composition of the present disclosure may be administered to a subject via different routes. In some embodiments, the composition is administered via intravenous injection to the subject. In some embodiments, administration of the composition results in expression of the transgene (or expression of two or more transgenes if multiple transgenes are used) in the subject's heart. In various embodiments, administering the composition results in improved cardiac function in the subject, such as improved cardiac function for more than 10 months in the subject. In some embodiments, administration results in improved cardiac function for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, the improved cardiac function is represented by an increase in left ventricular ejection fraction (LVEF). In some embodiments, the LVEF is increased (compared to pre-treatment measurements) by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between those listed). In some embodiments, the LVEF is measured by echocardiography. In some embodiments, administration results in improvement of cardiac physiology (e.g., structural features) for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, improvement of cardiac physiology is represented by a decrease in the thickness of the left ventricular wall. In some embodiments, the thickness of the left ventricular wall is decreased by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between the listed amounts). In some embodiments, the thickness of the left ventricular wall is measured by cardiac magnetic resonance imaging (MRI) or transthoracic echocardiography (TTE).
[0015] In some embodiments, described herein are compositions comprising AAV vectors, virions, viral particles, and pharmaceutical preparations thereof, which are useful in methods for delivering genetic material that codes for one or more beneficial or therapeutic product(s) to mammalian cells and tissues.The rAAV vectors, rAAV particles, or compositions comprising rAAV particles of the present disclosure may be used for gene therapy for cardiac disease, such as one or more types of cardiomyopathy, in subjects who require such gene therapy.
[0016] Additionally, provided herein are compositions, including one or more of the disclosed AAV compositions, formulated with one or more additional ingredients or prepared with one or more instructions for their use, as well as therapeutic and / or diagnostic kits.
[0017] In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human TNNT2 coding sequence, any silencing element, and an enhancer element, such as a CMV enhancer, operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, the silencing element comprises an shRNA expression cassette. In some embodiments, the silencing element comprises an shRNA sequence. In some embodiments, the human TNNT2 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac specific promoter. In some embodiments, the promoter is TNNT2. In some embodiments, the promoter is MHCK9. In some embodiments, the promoter is MHCK7. In some embodiments, the promoter is CBA (chicken beta-actin). In some embodiments, the promoter is CMV or mini-CMV. In some embodiments, the promoter is a desmin promoter. In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 particle. In some embodiments, the rAAV particle is a rh10 particle. In some embodiments, a composition is provided that includes a plurality of rAAV particles. In some embodiments, the plurality of rAAV particles may further include a pharma- ceutically acceptable carrier.
[0018] In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence and an enhancer element, such as a CMV enhancer, operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element, operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native with respect to the human RBM20 coding sequence and / or non-native with respect to the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and an in silico designed consensus Kozak sequence, wherein the in silico designed consensus Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native to the human RBM20 coding sequence and the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is native to the human RBM20 coding sequence and / or native to the promoter. In some embodiments, the Kozak sequence is a synthetic sequence. In some embodiments, the human RBM20 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac-specific promoter.In some embodiments, the promoter is CBA (chicken β-actin) or truncated chicken β-actin (smCBA). In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 (or AAVrh74) particle. In some embodiments, the rAAV particle is a rh10 (or AAVrh10) particle. In some embodiments, a composition comprising a plurality of rAAV particles is provided. In some embodiments, the plurality of rAAV particles may further comprise a pharma- ceutically acceptable carrier. In some embodiments, the rh74 particles comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:10, or a portion of SEQ ID NO:10 (e.g., SEQ ID NO:10 encodes rh74VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the nucleotide sequence of SEQ ID NO:10).In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:11, or a portion of SEQ ID NO:11 (e.g., SEQ ID NO:11 is the amino acid sequence of the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the amino acid sequence of SEQ ID NO:11). In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:12.
[0019] In some embodiments, a method for treating dilated or hypertrophic cardiomyopathy is described, comprising administering a therapeutically effective amount of rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in the expression of a therapeutically effective amount of human TNNT2, thereby treating cardiomyopathy.In some embodiments, rAAV is administered via intravenous injection.
[0020] In some embodiments, a method for treating cardiomyopathy is described, the method comprising administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence, an optional silencing element, and optionally an enhancer element, each element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein said administration results in expression of a therapeutically effective amount of human TNNT2, thereby treating the cardiomyopathy.
[0021] In some embodiments, a method for treating cardiomyopathy is described, which comprises (1) administering a therapeutically effective amount of rAAV that comprises any silencing construct, such as rAAV that comprises silencing construct, and (2) comprising a nucleic acid expression construct that comprises a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in the expression of a therapeutically effective amount of human TNNT2, thereby treating cardiomyopathy.In some embodiments, rAAV is administered via intravenous injection.
[0022] In some embodiments, for example, the rAAV containing the TNNT2 coding sequence and / or silencing construct is administered by intravenous injection. 13 ~Approx. 1×10 14 In some embodiments, about 1×10 rAAV vector genomes are administered. In some embodiments, when the rAAV vector genome is administered, 20%, at least 30%, at least 40%, or at least 50% of the cardiomyocytes are transduced. In some embodiments, about 1×10 13 ~Approx. 1×10 14 When one rAAV vector genome is administered, 20%, at least 30%, at least 40%, or at least 50% of the cardiomyocytes are transduced.
[0023] Also described herein is a method for inducing increased expression of human TNNT2 in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a functional human TNNT2 coding sequence, an optional silencing element, and optionally an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the contacting results in increased expression of functional human TNNT2 in the target cell compared to before the contacting, thereby increasing the expression of functional human TNNT2.
[0024] Also described herein is a method for inducing increased expression of human TNNT2 in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a functional human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the contacting results in increased expression of functional human TNNT2 in the target cell compared to before the contacting, thereby increasing the expression of functional human TNNT2.
[0025] Also described herein is a method for inducing increased expression of human TNNT2 in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles, wherein the rAAV particles comprise a nucleic acid expression construct comprising a functional human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the contacting results in increased expression of functional human TNNT2 in the target cell compared to before the contacting, thereby increasing the expression of functional human TNNT2.
[0026] In some embodiments, the contacting is in vivo. In some embodiments, the method is used for the treatment of dilated cardiomyopathy. In some embodiments, the method is used for the treatment of hypertrophic cardiomyopathy. In some embodiments, the nucleic acid, rAAV particle, composition, or method of manufacture described herein can be used for the treatment of dilated cardiomyopathy or hypertrophic cardiomyopathy. [Brief description of the drawings]
[0027] [Figure 1] FIG. 1 shows a non-limiting example of a genetic construct map for an embodiment of the constructs disclosed herein.
[0028] [Diagram 2] FIG. 2 shows a non-limiting example of a genetic construct map for an embodiment of the constructs disclosed herein.
[0029] [Diagram 3] FIG. 3 shows a non-limiting example of a genetic construct map for an embodiment of the construct disclosed herein.
[0030] [Figure 4] FIG. 4 shows a non-limiting example of a genetic construct map for an embodiment of the constructs disclosed herein.
[0031] [Diagram 5] FIG. 5 shows a non-limiting example of a genetic construct map for an embodiment of the constructs disclosed herein.
[0032] [Figure 6] FIG. 6 shows a Western blot of CMV-TNNT2 HEK293 lysates.
[0033] [Figure 7A]FIG. 7A shows a Western blot of Des1-TNNT2 C2C12 lysates.
[0034] [Figure 7B-1] FIG. 7B shows Des1-TNNT2 constructs with and without specific features. [Figure 7B-2] FIG. 7B shows Des1-TNNT2 constructs with and without specific features.
[0035] [Figure 7C] FIG. 7C shows the qPCR results for the TNNT2 constructs.
[0036] [Figure 8] FIG. 8 shows the average body weight following in vivo administration of the constructs provided herein.
[0037] [Figure 9] FIG. 9 shows the average heart weight following in vivo administration of the constructs provided herein.
[0038] [Figure 10] FIG. 10 shows cardiac vector copy numbers following administration of the constructs provided herein.
[0039] [Figure 11] FIG. 11 shows liver vector copy numbers following administration of the constructs provided herein.
[0040] [Figure 12] FIG. 12 shows the results of qPCR of cardiac tissue following administration of the constructs provided herein.
[0041] [Figure 13]FIG. 13 shows the results of qPCR of liver tissue following administration of the constructs provided herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0042] Detailed Description Reference is made to specific features and / or non-limiting embodiments of the invention. It should be understood that the disclosure of the invention herein encompasses all possible combinations of such specific features. For example, if a specific feature is disclosed in the context of a particular aspect or embodiment of the invention, or in the context of a particular claim, that feature can also be used in combination with and / or in the context of other specific aspects and embodiments of the invention, and in the invention in general, to the extent possible.
[0043] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.Unless otherwise stated, all patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety.If there are multiple definitions for a term in this specification, those in this section shall prevail unless otherwise stated.
[0044] "Subject" refers to a mammal that is the subject of treatment using a method or composition as provided herein. "Mammal" includes, but is not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and humans. In some embodiments, the subject is a human.
[0045] The terms "treating," "treatment," "therapeutic," or "treatment" do not necessarily mean a complete cure or elimination of a disease or condition. Any alleviation of undesirable signs or symptoms of a disease or condition, regardless of the degree, can be considered treatment and / or therapy. "Treating" a disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0046] The term "effective amount," as used herein, refers to an amount that can treat or ameliorate a disease or condition, or that can produce the intended therapeutic effect, such as reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0047] A "nucleic acid" sequence refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence. The term captures sequences that include any of the known base analogs of DNA and RNA, including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxy-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methyl Guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0048] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including DNA, RNA, or their analogs. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. Modifications to nucleotide structure, if present, may be added before or after the assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.
[0049] The term "isolated" when referring to a nucleotide sequence means that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. Thus, an "isolated nucleic acid molecule encoding a particular polypeptide" refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode the polypeptide of interest; however, the molecule may include some additional bases or moieties that do not materially affect the essential characteristics of the composition.
[0050] The term "identity" refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity." The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence multiplied by 100.
[0051] Throughout this application, for purposes of describing the relative positions of nucleotide sequences in particular nucleic acid molecules, for example, when a particular nucleotide sequence is described as being located "upstream," "downstream," "3'," or "5'" relative to another sequence, it is to be understood as referring to the position of that sequence on the "sense" or "coding" strand of the DNA molecule being referenced, as is conventional in the art.
[0052] Sequence identity can be determined by aligning sequences using algorithms such as BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package Release 7.0 (Genetics Computer Group, 575 Science Dr., Madison, Wis.) with default gap parameters or by inspection, and by optimal alignment (i.e., the one that results in the highest percentage of sequence similarity over the entire comparison window). The percentage of sequence identity is calculated by comparing two optimally aligned sequences over the entire comparison window, determining the number of positions where identical residues occur in both sequences to calculate the number of matching positions, dividing the number of matching positions by the total number of matching and mismatching positions in the comparison window, not counting gaps (i.e., the size of the window), and multiplying the result by 100 to calculate the percentage of sequence identity. Unless otherwise indicated, the comparison window between two sequences is defined by the total length of the shorter of the two sequences.
[0053] The term "recombinant" when applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps and other procedures that result in constructs that are distinguishable from polynucleotides found in nature and / or combinations of polynucleotides and viral proteins not found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The terms encompass copies of the original polynucleotide construct and progeny of the original viral construct, respectively.
[0054] The term "gene" refers to a polynucleotide that contains at least one open reading frame that can code for a particular gene product. Any of the polynucleotide sequences described herein may be used to identify larger fragments or full-length coding sequences of the genes with which they are associated. Methods for isolating larger fragment sequences are known to those skilled in the art.
[0055] The term "transgene" as used herein refers to a nucleic acid sequence to be placed in a viral vector, which encodes a polypeptide, protein, or other product of interest.In some embodiments, one rAAV vector can contain sequences that code for one or more transgenes (which can be the same gene or different genes, as desired).For example, one rAAV vector can contain coding sequences for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 transgenes.The transgenes of the present disclosure, as provided herein, relate to the improvement of one or more cardiac conditions, such as cardiomyopathies.
[0056] The term "gene transfer" or "gene delivery" refers to a method or system for inserting DNA, such as a transgene, into a host cell, such as that of a subject suffering from cardiomyopathy. In some embodiments, gene transfer results in the transient expression of unintegrated introduced DNA, extrachromosomal replication, and expression of introduced replicons (e.g., episomes). In additional embodiments, gene transfer results in the integration of introduced genetic material into the genomic DNA of the host cell.
[0057] The term "regulatory element" or "regulatory sequence", or variations thereof, refers to a nucleotide sequence involved in the functional regulation of a polynucleotide, including the replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. Regulatory elements can be enhancing or inhibitory in nature, depending on the embodiment. Non-limiting examples of regulatory elements include transcriptional regulatory sequences, such as promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like. Collectively, these elements provide for the replication, transcription, and translation of the coding sequence in the recipient cell, although not all of these sequences need always be present. It should be understood that the structural components of the rAAV vectors as provided herein may be listed in separate paragraphs and may be combined and used together for clarity only. For example, any regulatory element or other component may be used in combination with any transgene (or transgenes) provided herein.
[0058] A "promoter" is a polynucleotide that interacts with RNA polymerase to initiate transcription of a coding region (eg, a transgene) that is usually located downstream (in the 3' direction) from the promoter.
[0059] The term "operably linked" refers to an arrangement of elements configured so that the components perform a function. For example, a regulatory sequence operably linked to a coding sequence effects expression of the coding sequence. Depending on the embodiment, a regulatory sequence need not be contiguous with the coding sequence. Thus, for example, there may be one or more untranslated but transcribed sequences between the promoter sequence and the coding sequence, and the two sequences are still considered to be "operably linked."
[0060] The term "vector" refers to any molecular vehicle, such as a plasmid, phage, transposon, cosmid, chromosome, virus, viral particle, virion, etc., that can transfer genetic sequences (e.g., a transgene) to or between cells of interest.
[0061] An "expression vector" is a vector that contains a region of nucleic acid (e.g., a transgene) that encodes a gene product (e.g., a polypeptide or protein) of interest. As disclosed herein, the vector is used to achieve expression, e.g., stable expression, of a protein in an intended target cell. The expression vector may also contain a control element operably linked to the transgene to facilitate expression of the encoded protein in the target cell. The combination of one or more regulatory elements and the gene(s) to which they are operably linked for expression may be referred to herein as an "expression cassette."
[0062] The term "AAV" is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or its derivatives. The term covers all subtypes, and both naturally occurring and recombinant forms, unless otherwise indicated. The abbreviation "rAAV" refers to recombinant adeno-associated virus, which is also referred to as recombinant AAV vector (or "rAAV vector"), which refers to AAV that contains a polynucleotide sequence (e.g., a transgene) that is not of AAV origin. The term "AAV" encompasses AAV serotype 1 (AAV-1), AAV serotype 2 (AAV-2), AAV serotype 3 (AAV-3), AAV serotype 4 (AAV-4), AAV serotype 5 (AAV-5), AAV serotype 6 (AAV-6), AAV serotype 7 (AAV-7), AAV serotype 8 (AAV-8), AAV serotype 9 (AAV-9), serotype rh10 AAV, serotype rh74 AAV, or pseudotyped rAAV (e.g., AAV2 / 9, which refers to an AAV vector having the genome of AAV2 (e.g., ITRs of AAV2) and the capsid of AAV9). In some embodiments, the preferred serotype for delivery to a human patient suffering from cardiomyopathy is one of AAV-9, serotype rh74, serotype rh10, or AAV-8. In some embodiments, the rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine, or other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference herein in its entirety.
[0063] The term "AAV virus" or "AAV viral particle" or "rAAV vector particle" refers to a viral particle that is composed of at least AAV capsid proteins and an encapsidated polynucleotide.
[0064] The term "heterologous" refers to a genotypically distinct origin. For example, a heterologous polynucleotide is one that originates from a different species compared to the reference species (e.g., a human gene inserted into a viral plasmid is a heterologous gene). A promoter that has been removed from its native coding sequence and operably linked to a coding sequence that is not found in nature to which it is linked is a heterologous promoter.
[0065] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present disclosure.
[0066] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle that is administered with the rAAV particle or preparation and / or rAAV vector. Such pharmaceutical carriers can be sterile liquids such as water and oils (including those of petroleum such as mineral oil, vegetable oils such as peanut oil, soybean oil, and sesame oil, animal oils, or synthetic origin). Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers.
[0067] As used herein, "gene silencing" refers to the suppression of gene expression, for example, the expression of a transgene, a heterologous gene, and / or an endogenous gene. Gene silencing can be mediated through a process that affects transcription and / or through a process that affects post-transcriptional mechanisms. In some embodiments, gene silencing occurs when siRNA initiates the degradation of the mRNA of a gene of interest in a sequence-specific manner through RNA interference. In some embodiments, gene silencing can be allele-specific. "Allele-specific" gene silencing refers to the specific silencing of one allele of a gene.
[0068] As used herein, "knockdown" and "knockdown technology" refer to a gene silencing technology that can reduce the expression of a target gene compared to the gene expression before the introduction of an RNAi molecule, thereby resulting in the inhibition of the production of the target gene product. The term "reduction" is used herein to indicate that the expression of the target gene is reduced by 1-100%. For example, the expression may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or even 99%. The knockdown of gene expression can be managed by the use of dsRNA or siRNA. For example, "RNA interference (RNAi)", which may involve the use of siRNA, has been successfully applied to knockdown the expression of specific genes in several vertebrate species, including plants, D. melanogaster, C. elegans, trypanosoma, planaria, hydra, and mice.
[0069] As used herein, " RNA interference (RNAi) " is the process of sequence-specific post-transcriptional gene silencing initiated by siRNA.RNAi is found in many organisms, such as fruit flies, nematodes, fungi and plants, and is believed to be involved in antiviral defense, modification of transposon activity, and regulation of gene expression.During RNAi, RNAi molecules induce the degradation of target mRNA, which results in sequence-specific inhibition of gene expression.
[0070] "Small interfering" or "short interfering RNA", or siRNA, is an RNA duplex of nucleotides that targets a gene of interest. "RNA duplex" refers to the structure formed by complementary pairing between two regions of an RNA molecule. An siRNA "targets" a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may include a loop portion located between the two sequences that form the duplex. The loop can be of various lengths. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure may also include a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang of 0, 1, 2, 3, 4, or 5 nucleotides in length. "Sense" and "antisense" sequences can be used to form siRNA molecules with or without a loop region. As used herein, the term siRNA is equivalent to other terms used to describe nucleic acid molecules that can mediate sequence-specific RNAi, such as double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetic silencing.For example, the siRNA molecule of the present invention can be used to epigenetically silence genes at both post-transcriptional and pre-transcriptional levels.In a non-limiting example, the epigenetic modification of gene expression by the siRNA molecule of the present invention can result from the siRNA-mediated modification of chromatin structure or methylation pattern, which changes gene expression.In another non-limiting example, the modification of gene expression by the siRNA molecule of the present invention can result from the cleavage of RNA (either coding RNA or non-coding RNA) mediated by RISC, or alternatively, from the inhibition of translation, as known in the art.
[0071] The siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal.
[0072] Terms and phrases used in this application, and variations thereof, particularly in the appended claims, should be construed as open ended, as opposed to limiting, unless expressly stated otherwise. By way of example of the foregoing, the term "including" should be read to mean "including, without limitation," "including but not limited to," and the like; the term "comprising," as used herein, is synonymous with "including," "containing," or "characterized by," and is inclusive or open ended, not excluding additional, unrecited elements or method steps; the term "having" means "having at least The term "include" should be interpreted as "including but not limited to"; the term "examples" is used to provide illustrative instances of the items being discussed, not an exhaustive or limiting list thereof; and the use of terms such as "preferably," "preferred," "desired," or "desirable," and words of similar import, should not be understood as implying that a particular feature is critical, essential, or even important to structure or function, but instead is intended merely to highlight alternative or additional features that may or may not be utilized in a particular embodiment. In addition, the term "comprise" should be interpreted synonymously with the phrases "having at least" or "including at least." When used in the context of a process, the term "comprise" means that the process includes at least the recited steps, but may include additional steps.When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components. Similarly, a group of items joined with the conjunction "and" should not be read as requiring each and every item to be present in the group, but rather as "and / or" unless expressly stated otherwise. Similarly, a group of items joined with the conjunction "or" should not be read as requiring mutual exclusivity within the group, but rather as "and / or" unless expressly stated otherwise.
[0073] With respect to the use of substantially all plural and / or singular terms in this specification, those skilled in the art can translate from plural to singular and / or from singular to plural, where appropriate for the context and / or application. For clarity, various singular / plural permutations may be explicitly stated in this specification. The indefinite article "a" or "an" does not exclude plurals. A single processor or other unit may fulfill the functions of several items recited in the claims. The mere fact that certain means are recited in mutually different dependent claims does not indicate that a combination of these means cannot be used to advantage. Any reference signs in the claims should not be interpreted as limiting the scope.
[0074] Ranges disclosed herein also encompass any and all overlaps, subranges, and combinations thereof. Words such as "up to," "at least," "greater than," "less than," "between" and the like include the recited numbers. Numbers preceded by terms such as "about" or "approximately" include the recited numbers. For example, "about 90%" includes "90%." In some embodiments, at least 95% homologous or identical includes 96%, 97%, 98%, 99%, and 100% homologous or identical to a reference sequence. In addition, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference also encompasses that the sequence "comprises," "consists of," or "consists essentially of" the recited sequence, unless otherwise indicated. Sequence Listing Construct 1 ("pdsTR2-TNNT2-intron-mini-TNNT2") [Table 1-1] [Table 1-2] [Table 1-3] Construct 1 and 2 protein sequences [Table 1-4] Construct 2 (pdsTR2-TNNT2-intron-mini-TNNT2 without FseI site) [Table 2-1] [Table 2-2] [Table 2-3] Construct 3 (pdsTR2-Des1-TNNT2 Dual Plan) [Table 3-1]
Table 3-2
Table 4-1
Table 4-2
Table 5-1
Table 5-2
Table 6-1
Table 6-2
Table 7-1
Table 7-2
Table 8-1
Table 8-2
Table 9-1
Table 9-2
Table 10-1
[0075] Transgene Transgenes may be used to correct, reduce, eliminate, or otherwise ameliorate genetic defects, which may include defects in which a normal gene is expressed at lower than normal levels, defects with a gene product that is expressed at normal or near-normal levels but has abnormal activity, or defects in which no functional gene product is expressed. In some embodiments, the transgene sequence encodes a therapeutic protein or polypeptide to be expressed in the host cell. Aspects of the present disclosure also include using multiple transgenes.
[0076] Cardiac troponin T (TNNT2) is a component of the troponin complex within the thin filaments of the sarcomere and is involved in Ca 2+ It allows actomyosin interactions and contraction in response to inflammation to occur. Mutations or disruptions in the function of TNNT2 cause hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM).
[0077] Regulatory elements In some embodiments, the rAAV vector includes one or more regions that include sequences that facilitate expression of a heterologous nucleic acid, e.g., expression regulatory sequences operably linked to the heterologous nucleic acid. A promoter drives transcription of the nucleic acid sequence that it regulates, and thus it is typically located at or near the transcription start site of the gene. A promoter can have a length of, e.g., 100 to 1000 nucleotides. In some embodiments, a promoter is operably linked to a nucleic acid, or a sequence of a nucleic acid (a nucleotide sequence). A promoter is considered to be "operably linked" to a sequence of a nucleic acid that it regulates when the promoter is in the correct functional location and orientation with respect to that sequence such that the promoter regulates the sequence (e.g., controls ("drives") its transcription initiation and / or expression). Many such sequences are known in the art.
[0078] The promoters that may be used according to the present disclosure may include any promoter that can drive the expression of a transgene in the heart of a subject. In some embodiments, the promoter may be a tissue-specific promoter. "Tissue-specific promoter" as used herein refers to a promoter that can only function in a specific type of tissue, such as the heart. Thus, a "tissue-specific promoter" cannot drive the expression of a transgene in other types of tissue. In some embodiments, the promoters that may be used according to the present disclosure are promoters that are restricted to the heart. Non-limiting examples of tissue-specific promoters and / or regulatory elements that may be used include (1) desmin, creatine kinase, myogenin, alpha myosin heavy chain, and natriuretic peptide, which are specific to muscle cells, and (2) albumin, alpha-1-antitrypsin, hepatitis B virus core protein promoters, which are specific to liver cells. Non-limiting examples of promoters that are restricted to the heart are selected from cardiac troponin C, cardiac troponin I, and cardiac troponin T (cTnT). As provided herein, in treating cardiomyopathy, a promoter that is restricted to the heart is advantageous, at least because it effectively increases the dose delivered to the heart by reducing the possibility of off-target expression of transgene, enhancing treatment.Non-limiting examples of expression regulatory sequences include promoters, insulators, silencers, response elements, introns, enhancers, start sites, termination signals, and poly(A) tails.Any combination of such regulatory sequences is contemplated herein (e.g., promoters and enhancers).
[0079] Alternatively, the promoter may be a promoter from one of the following genes, without limitation: α-myosin heavy chain gene, 6-myosin heavy chain gene, myosin light chain 2v (MLC-2v) gene, myosin light chain 2a gene, CARP gene, cardiac α-actin gene, cardiac m2 muscarinic acetylcholine gene, atrial natriuretic factor gene (ANF), cardiac sarcoplasmic reticulum Ca-ATPase gene, skeletal α-actin gene; or the artificial heart promoter derived from the MLC-2v gene.
[0080] Any of a number of promoters suitable for use in a selected host cell may be used to achieve an appropriate expression level of the nucleic acid, protein, or polypeptide of interest. The promoter may be, for example, a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a synthetic promoter. For example, constitutive promoters of various strengths may be used. The rAAV vectors described herein may include one or more constitutive promoters, such as viral promoters or promoters from mammalian genes that are generally active in driving transcription. Non-limiting examples of constitutive viral promoters include promoters of herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), simian virus 40 (SV40), mouse mammary tumor virus (MMTV), Ad E1A, and cytomegalovirus (CMV). Non-limiting examples of non-viral constitutive promoters include various housekeeping gene promoters, as exemplified by the β-actin promoter, including chicken β-actin promoter (CBA).
[0081] Inducible promoters and / or regulatory elements may also be contemplated to achieve the appropriate expression level of the protein or polypeptide of interest.Non-limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes such as estrogen gene promoters.Another example of an inducible promoter is the tetVP16 promoter, which is responsive to tetracycline.
[0082] Synthetic promoters are also contemplated herein. Synthetic promoters may contain, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.
[0083] Enhancer elements can function in combination with other regulatory elements to increase expression of a transgene. In some embodiments, the enhancer element is upstream (located 5') of the transgene. Non-limiting embodiments of enhancer elements include nucleotide sequences including, for example, a 100 base pair element from simian virus 40 (SV40 late 2XUSE), a 35 base pair element from human immunodeficiency virus 1 (HIV-1 USE), a 39 base pair element from ground squirrel hepatitis virus (GHV USE), a 21 base pair element from adenovirus (adenovirus L3 USE), a 21 base pair element from human prothrombin (hTHGB USE), a 53 base pair element from human C2 complement gene (hC2 USE), truncations of any of the foregoing, and combinations of the foregoing. In some embodiments, the enhancer is derived from an α-myosin heavy chain (αMHC) gene. In some embodiments, the αMHC enhancer comprises a nucleic acid sequence having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity to CCTTCAGATTAAAAATAACTAAGGTAAGGGCCATGTGGGTAGGGGAGGTGGTGTGAGACGGTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCCTGGAGCCAGAGGGGCGAGGGCAGCAGACCTTTCATGGGCAAACCTCAGGGCTGCTGTC, or SEQ ID NO: 100.
[0084] Non-limiting polyadenylation signals include nucleotide sequences including, for example, the 624 base pair polyadenylation signal from human growth hormone (hGH), the 135 base pair polyadenylation signal from simian virus 40 (sV40 late), the 49 base pair synthetic polyadenylation signal from rabbit beta-globin (SPA), the 250 base pair polyadenylation signal from bovine growth hormone (bGH), truncations of any of the foregoing, and combinations of the foregoing.
[0085] In some embodiments of the disclosed rAAV vectors, two or more transgenes are operably controlled by a single promoter. In some embodiments, each of the two or more transgenes is operably controlled by a separate promoter.
[0086] In some embodiments, the rAAV vector of the present disclosure further comprises an internal ribosome entry site (IRES). IRES is a nucleotide sequence that allows translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. In most eukaryotes, translation can only be initiated at the 5' end of an mRNA molecule, since 5' cap recognition is required for the assembly of the initiation complex. In some embodiments, the IRES is located between transgenes.
[0087] In such embodiments, the proteins encoded by the different transgenes are translated individually (i.e., as opposed to being translated as a fusion protein). In some embodiments, the rAAV vector of the present disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a first transgene, an IRES operably linked to a second transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0088] In some embodiments, the rAAV vector of the disclosure further comprises a polyadenylation (pA) signal.
[0089] Expression cassette The expression cassette is composed of a transgene and its regulatory sequences at a minimum. If the cassette is designed to be expressed from rAAV, the expression cassette further comprises 5' and 3' AAV ITRs. These ITRs may be full length or one or both of the ITRs may be truncated. In one embodiment, the rAAV is pseudotyped, i.e., the AAV capsid is from a different source of AAV than the AAV that provides the ITRs. In one embodiment, the ITRs of AAV serotype 2 are used. In an additional embodiment, the ITRs of AAV serotype 1 are used. However, ITRs from other suitable sources may be selected.
[0090] Figure 1 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR and a TNNT2 promoter. A chimeric intron follows. Following the promoter, a TNNT2 transgene is represented. The construct further comprises a polyadenylation site following the TNNT2 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences (also referred to as buffer sequences) may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be configured in the construct to alter or change the expression of TNNT2.
[0091] Figure 2 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR and a desmin promoter. A set of introns follows. Following the promoter, the TNNT2 transgene is represented. The construct further comprises a polyadenylation site following the TNNT2 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or change the expression of TNNT2.
[0092] Figure 3 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR, an alpha MHC enhancer, an MCK9 enhancer, and an MHCK9 (MCK) promoter. A set of introns follows. Following the promoter, the TNNT2 transgene is represented. The construct further comprises a polyadenylation site following the TNNT2 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or change the expression of TNNT2.
[0093] Figure 4 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR and a DES1 promoter. Following the promoter, the TNNT2 transgene and the start Kozak sequence are represented. The construct further comprises a polyadenylation site following the TNNT2 transgene. Within the structural sequence described in the above construct, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or change the expression of TNNT2.
[0094] Figure 5 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR and a DES1 promoter. Following the promoter, the TNNT2 transgene and the start Kozak sequence are represented. The construct further includes a 3'UTR sequence, and a polyadenylation site following the TNNT2 transgene. At least one or more spacer sequences may be inserted into the structural sequence described in the above construct at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to modify or alter the expression of TNNT2.
[0095] Expression cassette - silencing element The embodiments of the present disclosure can provide compositions and methods for gene silencing and protein expression modification using small nucleic acid molecules. Examples of nucleic acid molecules include molecules active in RNA interference (RNAi molecules), short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) molecules, and DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), or repeat associated siRNA (rasiRNA). Such molecules can mediate RNA interference on gene expression. In some embodiments, gene silencing can be targeted to a specific defective allele. In some embodiments, the gene-silenced defective allele can then be replaced by a functional copy. In some embodiments, the functional copy of the gene is codon-optimized so that the difference between the defective copy and the functional copy allows only the defective copy to be silenced.
[0096] In some embodiments, the expression cassette comprises a TNNT2 transgene and associated regulatory sequences, as well as a region that can modify endogenous TNNT2 gene expression, for example, via an shRNA expression cassette. The attenuation or knockdown of endogenous gene expression can be achieved using a nucleotide sequence that encodes a small nucleic acid molecule that includes an shRNA. In some embodiments, the expression cassette comprises a transgene that encodes a functional TNNT2 allele, as well as a silencing element for attenuating the expression of a defective gene. In some embodiments, the silencing element is an intron sequence in the entire construct. In some embodiments, the intron sequence contains a restriction site. In some embodiments, the silencing element and the intron sequence can be utilized for subcloning in the expression cassette.
[0097] In some embodiments, the delivery of nucleotide sequence can be separate from the vector that codes for expression cassette that includes transgene and related regulatory sequence.For example, two or more constructs can be co-administered, where at least one transgene construct contains the nucleic acid sequence that codes for functional TNNT2 transgene, and where at least one other silencing construct contains the nucleic acid sequence for regulating endogenous TNNT2 gene expression.In some embodiments, the administration of the expression cassette that codes for TNNT2 transgene is accompanied by, followed by, or preceded by the administration of the vector that codes for the method of silencing gene or modifying TNNT2 protein expression.
[0098] In some embodiments, expression cassette comprises TNNT2 transgene and related regulatory sequences, but does not include the region that modifies endogenous TNNT2 gene expression.In some embodiments, the construct comprises expression cassette with functional TNNT2 transgene is administered.In some embodiments, the expression of functional TNNT2 transgene is sufficient to provide therapeutic benefit to the subject.
[0099] vector Further provided herein is a rAAV viral particle or a rAAV preparation containing such a particle. In some embodiments, the rAAV particle comprises a viral capsid and one or more transgenes as described herein encapsidated by the viral capsid. Methods for the production of rAAV particles are known in the art and commercially available (see, for example, Zolotukhin et al., Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Application Publication Nos. US2007 / 0015238 and US2012 / 0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing a rAAV vector may be combined with one or more helper plasmids, such as those containing the rep genes (encoding, e.g., Rep78, Rep68, Rep52 and Rep40) and cap genes (encoding VP1, VP2, and VP3, including the modified VP3 region described herein), and transfected into a production cell line so that the rAAV particles can be packaged and then purified.
[0100] The particles in the rAAV particles or rAAV preparations disclosed herein may be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, 2 / 9, 3 / 1, 3 / 5, 3 / 8, or 3 / 9). As used herein, the serotype of rAAV rAAV particles refers to the serotype of the capsid protein of the recombinant virus. In some embodiments, the rAAV particles are rAAV6 or rAAV9. In some embodiments, the rAAV particles are AAVrh74. In a preferred embodiment, the rAAV particles are AAVrh74. In an additional preferred embodiment, the rAAV is AAV9. In some embodiments, rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine, or other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference in its entirety. Non-limiting examples of derivatives, pseudotypes, and / or other vector types include AAVrh.10, AAVrh74, AAV2 / 1, AAV2 / 5, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2-AAV3 hybrid, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AA Examples of such vectors include, but are not limited to, V2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.
[0101] Such AAV serotypes and derivatives / pseudotypes, as well as methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699- 708. doi: 10.1038 / mt.2011.287. Epub Jan. 24, 2012. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer DV, Samulski RJ.). In certain embodiments, the capsid of any of the rAAV particles disclosed herein is of the AAVrh.10 serotype. In preferred embodiments, the capsid of the rAAV particle is the AAVrh10 serotype. In some embodiments, the capsid is of the AAV2 / 6 serotype. In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which includes (a) an rAAV vector that includes ITRs from one serotype (e.g., AAV2, AAV3), and (b) a capsid composed of capsid proteins from another serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al, J. Virol., 75:7662-7671, 2001; Halbert et al, J. Virol., 74:1524-1532, 2000; Zolotukhin et al, Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).
[0102] rAAV Gene Therapy for Heart Disease In some embodiments, the rAAV vector of the present disclosure further comprises a polyadenylation (pA) signal. For example, in preferred embodiments, the pA signal comprises the following sequences: 29, 73, 97, or 123.
[0103] In some embodiments, the rAAV vector of the disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.
[0104] In some embodiments, the rAAV vector genome is circular. In some embodiments, the rAAV vector genome is linear. In some embodiments, the rAAV vector genome is single-stranded. In some embodiments, the rAAV vector genome is double-stranded. In some embodiments, the rAAV genome vector is a self-complementary rAAV vector.
[0105] Described herein are non-limiting examples of rAAV vectors. The vectors shown below contain linearized plasmid sequences set forth as SEQ ID NOs: 1-31, or SEQ ID NOs: 47-75, or SEQ ID NOs: 76-98, or SEQ ID NOs: 99-124, or SEQ ID NOs: 125-132, or SEQ ID NOs: 133-141, arranged in sequence. A vector of the present disclosure may comprise a nucleotide sequence having at least 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the sequence set forth as SEQ ID NO: 1-31, or 47-75, or SEQ ID NO: 76-98, or SEQ ID NO: 99-124, or SEQ ID NO: 125-132, or SEQ ID NO: 133-141, arranged in sequence. In some embodiments, the rAAV has 100% identity to the sequence set forth as SEQ ID NO: 1-31, or 47-75, or SEQ ID NO: 76-98, or SEQ ID NO: 99-124, or SEQ ID NO: 125-132, or SEQ ID NO: 133-141, arranged in sequence.
[0106] In some embodiments, any of the disclosed rAAV nucleic acid vector sequences comprises a truncation at the 5' or 3' end relative to the sequence of any one of SEQ ID NOs: 1-31, or 47-75, or SEQ ID NOs: 76-98, or SEQ ID NOs: 99-124, or SEQ ID NOs: 125-132, or SEQ ID NOs: 133-141, arranged sequentially. In some embodiments, any of the rAAV vectors comprises a nucleotide sequence that differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more than 18 nucleotides from the sequence of any one of SEQ ID NOs: 1-31, or 47-75, or SEQ ID NOs: 76-98, or SEQ ID NOs: 99-124, or SEQ ID NOs: 125-132, or SEQ ID NOs: 133-141, arranged sequentially.
[0107] Recombinant adeno-associated viral vectors and therapeutic uses thereof Many serotypes of AAV have been cloned and sequenced. Serotypes 1 and 6 share >99% amino acid homology in their capsid proteins. Of the first six AAV serotypes, serotype 2 has been extensively characterized and is therefore often used in gene transfer studies, but other AAV serotypes, such as AAV9, AAV20, AAVrh74, AAVrh10, etc., are also used according to embodiments disclosed herein. In some embodiments, repeated administration of a given serotype that is expected to induce a humoral immune response is performed in conjunction with an immune management regimen. In some embodiments, the immune management regimen includes administration of one or more agents that function as B cell depletors, alone or in combination with one or more agents that inhibit one or more aspects of the mTOR pathway. In one embodiment, an anti-CD20 antibody is administered and rapamycin is administered. In some embodiments, this allows repeated administration of rAAV of a given serotype, where the immune response to subsequent administrations of the rAAV is reduced, limited, or absent. Further information regarding immune management can be found in US patent application Ser. No. 15 / 306,139, the entire contents of which are incorporated herein by reference.
[0108] The therapeutic rAAV vectors, therapeutic rAAV particles, or compositions comprising therapeutic rAAV particles of the present disclosure may be used in human subjects in need thereof for gene therapy for cardiac disease, such as cardiomyopathies, as provided herein. Examples of cardiac disease that may be treated using the methods and compositions of the present disclosure include, but are not limited to, cardiomyopathies and acute ischemia. In some embodiments, the cardiomyopathies are hypertrophic or dilated cardiomyopathy. In some embodiments, the cardiomyopathies are dilated cardiomyopathy, which are caused by or associated with reduced or absent expression and / or function of TNNT2. In some embodiments, the cardiomyopathies are hypertrophic cardiomyopathy, which are caused by or associated with reduced or absent expression and / or function of TNNT2. The therapeutic rAAV vectors, particles, and compositions comprising therapeutic rAAV particles may be used for the treatment of such heart failure (e.g., heart failure secondary to cardiomyopathies) when administered to a subject in need thereof, for example, via vascular delivery to the coronary arteries and / or direct injection into the heart. Therapeutic rAAV vectors, particles, and compositions comprising rAAV particles drive co-expression of TNNT2 in cardiomyocytes of a subject.
[0109] The amino acid sequence of the therapeutic TNNT2 encoded by the TNNT2 transgene has at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NOs: 32-46 arranged in sequence.
[0110] In some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and / or contained in the attached sequence listing) are provided, accounting for the degeneracy of the nucleic acid code. Additionally, sequences (whether nucleic acid or amino acid) that differ from those explicitly disclosed herein (and / or contained in the attached sequence listing) but have functional similarity or equivalence are also contemplated within the scope of this disclosure. The foregoing includes mutations, truncations, substitutions, or other types of modifications.
[0111] According to some embodiments described herein, any of the sequences may be used, or truncated or mutated forms of any of the sequences disclosed herein (and / or contained in the accompanying sequence listing) may be used in any combination.
[0112] The promoter driving the expression of therapeutic nucleic acid can be, but is not limited to, a constitutive promoter, an inducible promoter, a tissue-specific promoter, a neuron-specific promoter, a muscle-specific promoter, or a synthetic promoter. In some embodiments, the promoter is a neuron-specific promoter or a muscle-specific promoter. The constitutive promoter can be, but is not limited to, a herpes simplex virus (HSV) promoter, a thymidine kinase (TK) promoter, a Rous sarcoma virus (RSV) promoter, a simian virus 40 (SV40) promoter, a mouse mammary tumor virus (MMTV) promoter, an adenovirus E1A promoter, a cytomegalovirus (CMV) promoter, a mammalian housekeeping gene promoter, or a β-actin promoter. The inducible promoter can be, but is not limited to, a cytochrome P450 gene promoter, a heat shock protein gene promoter, a metallothionein gene promoter, a hormone-inducible gene promoter, an estrogen gene promoter, or a tetVP16 promoter that is responsive to tetracycline. The muscle-specific promoter can be, but is not limited to, a desmin promoter, a creatine kinase promoter, a myogenin promoter, an alpha myosin heavy chain promoter, or a natriuretic peptide promoter.
[0113] In some embodiments, the therapeutic rAAV promoter comprises a neuron- or myocardial-specific promoter.
[0114] The therapeutic rAAV can be serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype rh10, or serotype rh74. The therapeutic rAAV can also be pseudotyped rAAV.
[0115] In some embodiments, the therapeutic rAAV has a sequence that shares at least 85% sequence identity to SEQ ID NOs: 1-31, or SEQ ID NOs: 76-98, or SEQ ID NOs: 99-124, or SEQ ID NOs: 125-132, or SEQ ID NOs: 133-141, arranged in sequence.
[0116] In some embodiments, the therapeutic rAAV has a sequence that shares at least 85% sequence identity to SEQ ID NOs: 47-75 arranged sequentially.
[0117] In some embodiments, the therapeutic rAAV has a sequence that shares at least 95% sequence identity to SEQ ID NOs: 1-31, or SEQ ID NOs: 76-98, or SEQ ID NOs: 99-124, or SEQ ID NOs: 125-132, or SEQ ID NOs: 133-141, arranged in sequence.
[0118] In some embodiments, the therapeutic rAAV has a sequence that shares at least 95% sequence identity to SEQ ID NOs: 47-75 arranged sequentially.
[0119] Pharmaceutical Formulation and Administration The compositions described herein may further comprise pharmaceutical excipients, buffers, or diluents, and may be formulated for administration to host cells ex vivo or to animals, particularly humans, in situ. Such compositions may further comprise, optionally, liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to cells, tissues, organs, or the body of a subject in need thereof. Such compositions may be formulated for use in a variety of therapies, such as amelioration, prevention, and / or treatment of conditions such as peptide deficiency, polypeptide deficiency, peptide overexpression, polypeptide overexpression, including conditions that result in diseases or disorders as described herein.
[0120] Formulations containing pharma- ceutically acceptable excipient and / or carrier solutions are well known to those of skill in the art, as is the development of suitable dosing and treatment regimens for use with specific compositions described herein in a variety of treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administration and formulations.
[0121] Typically, these formulations may contain at least about 0.1% or more of a therapeutic agent (e.g., therapeutic rAAV particles or preparations), although the percentage of active ingredient(s) may of course vary and may conveniently be between about 1 or 2% and about 70% or 90% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent(s) in each therapeutically useful composition may be prepared in such a manner that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be taken into account by those skilled in the art when preparing such pharmaceutical formulations. In addition, various dosages and treatment regimes may be desirable.
[0122] In some circumstances, it may be desirable to deliver the therapeutic rAAV particles or preparations in a suitably formulated pharmaceutical composition disclosed herein; subcutaneously, intravascularly, intracardially, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells (e.g., cardiac myocytes and / or other cardiac cells), tissues, or organs. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are delivered systemically via intravenous injection, particularly for treating humans. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are injected directly into the heart of a subject. Direct injection into the heart may include, for example, injection into one or more of cardiac muscle tissue, the lining of the heart, or the skeletal muscle surrounding the heart, using a needle catheter. In some embodiments, direct injection into the human heart is preferred, for example, when delivery is performed simultaneously with a surgical or interventional procedure that improves access to the heart. In some embodiments, the interventional procedure includes any procedure in which coronary or pulmonary blood perfusion is altered. In some embodiments, the interventional procedure includes one or more of percutaneous administration, catheterization, or coronary retrograde perfusion.
[0123] Pharmaceutical preparations of compositions suitable for injectable use include sterile aqueous solutions or dispersions. In some embodiments, the preparations are sterile and fluid to the extent that easy syringability exists. In some embodiments, the form is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier is, for example, a solvent or dispersion medium containing water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, vegetable oils, or other pharma- ceutically acceptable carriers generally recognized as safe (GRAS) by the U.S. Food and Drug Administration. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. There is virtually no limit to the other components that can be included, so long as the additional agent does not cause significant adverse effects when in contact with the target cells or host tissues. The therapeutic rAAV particles or preparations may thus be delivered together with a variety of other pharma- ceutically acceptable agents, as appropriate in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0124] The amount of therapeutic rAAV particles or preparations and / or therapeutic rAAV vector compositions, as well as the time of administration of such compositions, will be within the knowledge of a person skilled in the art who has the benefit of the present teachings.However, administration of a therapeutically effective amount of the composition of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.In some situations, it may be desirable to provide multiple or continuous administrations of rAAV particles or preparations and / or rAAV vector compositions, either over a relatively short period of time or over a relatively long period of time, which may be determined by the physician supervising the administration of such compositions.
[0125] The toxicity and efficacy of the compositions utilized in the methods of the present disclosure were evaluated using LD 50 The dose that is lethal to 50% of the population may be determined by standard pharmaceutical procedures using either cells in culture or experimental animals. The dose ratio between toxicity and efficacy is the therapeutic index, and it is the ratio LD 50 / ED 50 Compositions that exhibit large therapeutic indices are preferred. Compositions that exhibit toxic side effects may be used, however, care should be taken to design a delivery system that minimizes the potential damage of such side effects. Dosages of compositions as described herein are generally administered at doses up to 10 mg / kg / day, preferably 15 mg / kg / day, and more preferably 10 mg / kg / day. 50 and with little or no toxicity. Dosages can vary within this range depending upon the dosage form employed and the route of administration utilized.
[0126] Other aspects of the present disclosure relate to methods and preparations for use with subjects, such as human or non-human subjects, host cells in situ in a subject, or host cells derived from a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is a companion animal. "Companion animal" as used herein refers to pets and other domestic animals. Non-limiting examples of companion animals include dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters. In some embodiments, the subject is a human subject.
[0127] In some embodiments, one or more pharma- ceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition that includes a therapeutic agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, such as a human.
[0128] A pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of a therapeutic agent and optionally one or more pharma- ceutically acceptable excipients. A pharma-ceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product) that is intentionally included in a drug delivery system. The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. The excipient may act to a) aid in the processing of the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other attribute of the overall safety, efficacy, delivery of the API during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.
[0129] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.
[0130] The pharmaceutical composition may contain other additional components that are typically included in pharmaceutical compositions. Such additional components may include, but are not limited to, antipruritic agents, astringents, local anesthetics, anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).
[0131] The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof, but is not limited thereto. The carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. The carrier may also contain isotonic agents such as sugars, polyalcohols, sodium chloride, etc. in the composition.
[0132] Pharmaceutically acceptable refers to properties and / or substances that are acceptable to subjects from a pharmacological / toxicological point of view.The phrase "pharmacologically acceptable" refers to molecular entities, compositions, and properties that can be physiologically tolerated and do not typically cause allergic or other adverse or toxic reactions when administered to a subject.In some embodiments, pharmaceutically acceptable compounds are approved by federal or state government regulatory agencies or listed in the United States Pharmacopeia or other commonly recognized pharmacopoeias for use in animals and more specifically in humans.
[0133] The rAAV or pharmaceutical composition as described herein may be formulated for administration to a host cell ex vivo or in situ in an animal, particularly a human. The rAAV or pharmaceutical composition may be administered by various routes. Routes of administration include, but are not limited to, intravenous, intraarterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and / or localized delivery to a target tissue. In some embodiments, multiple injections, or other types of administration, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more injections, are provided. Routes of administration may be combined, if desired. Depending on the embodiment, the first and second rAAV do not have to be administered the same number of times (e.g., the first rAAV may be administered once and the second vector may be administered three times). In some embodiments, administration is intramuscular administration.
[0134] In some embodiments, the number of rAAV particles administered to a subject is about 10 6~about 10 14 particles / mL or approximately 10 3 ~about 10 13 An order of magnitude range of particles / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the number of rAAV particles administered to a subject may be about 10 6 ~about 10 14 Vector genomes (vgs) / mL or 10 3 ~10 15 An order of magnitude range of vgs / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 vgs / mL, etc. The rAAV particles can be administered as a single dose, or can be divided into two or more administrations, as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, a dose ranging from about 0.0001 mL to about 10 mL is delivered to the subject.
[0135] For administration of injectable aqueous solutions, for example, the solution may be suitably buffered, if necessary, and the liquid diluent may first be made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous media that can be used will be known to those skilled in the art in view of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of subcutaneous infusion or injected at the proposed site of injection (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035-1038 and 1570-1580). In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, monobasic buffer (e.g., monobasic sodium phosphate buffer), dibasic salt (e.g., dibasic sodium phosphate), sodium-based tonicity agent (e.g., sodium chloride tonicity agent), non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent), surfactant (e.g., poloxamer 188 surfactant), and water. In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, sodium phosphate monobasic buffer, dibasic sodium phosphate, sodium chloride tonicity agent, magnesium chloride hexahydrate tonicity agent, poloxamer 188 surfactant, and water. In some embodiments, the active rAAV components are present in the formulation according to the amount of vector genome provided herein. In some embodiments, the monobasic buffer (e.g., sodium phosphate monobasic buffer) is present in the formulation at a concentration of about 0.2 mg / mL to about 0.5 mg / mL. In some embodiments, the dibasic salt (e.g., sodium phosphate dibasic) is present in the formulation at a concentration of about 1.5 mg / mL to about 4 mg / mL. In some embodiments, the sodium-based tonicity agent (e.g., sodium chloride tonicity agent) is present in the formulation at a concentration of about 8 mg / mL to about 12 mg / mL.In some embodiments, the non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent) is present in the formulation at a concentration of about 0.1 mg / mL to about 0.35 mg / mL. In some embodiments, the surfactant (e.g., poloxamer 188 surfactant) is present in the formulation at a concentration of about 0.05 mg / mL to about 0.8 mg / mL. In some embodiments, water is present to bring the volume of the formulation (e.g., dosage unit) to 1 mL.
[0136] Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will in any event determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required, for example, by the FDA Office of Biologics standards.
[0137] Sterile injectable solutions are prepared by incorporating rAAV particles or preparations in the required amount in a suitable solvent with some of the other ingredients listed above as necessary, and then sterilizing by filtration.In general, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other ingredients from those listed above.In the case of sterile powders for preparing sterile injectable solutions, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powders of active ingredients plus any additional desired ingredients from their previously sterile-filtered solutions.
[0138] The amount of rAAV particles or preparations and the time of administration of such particles or preparations will be within the knowledge of a person skilled in the art who has the benefit of the teachings of the present invention.However, it is possible that administration of a therapeutically effective amount of the rAAV particles or preparations of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.Alternatively, in some situations, it may be desirable to provide multiple or successive administrations of rAAV particles or preparations over either a relatively short or relatively long period of time, as can be determined by the physician supervising the administration of such compositions.
[0139] If desired, the rAAV particles may also be administered in combination with other agents, such as proteins or polypeptides or various pharmacologic active agents, including one or more administrations of therapeutic polypeptides, biologically active fragments or variants thereof. In fact, there is no limit to the other components that may be included, as long as the additional agent does not cause significant adverse effects when contacting target cells or host tissues. The rAAV particles or preparations may thus be delivered together with various other pharmacologic acceptable agents, as required in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0140] In some embodiments, treatment of a subject with rAAV particles as described herein achieves one, two, three, four or more of the following effects, including, for example: (i) reduction or amelioration of the severity of a disease or a symptom associated therewith, (ii) reduction in the duration of a symptom associated with a disease, (iii) protection against progression of a disease or a symptom associated therewith, (iv) regression of a disease or a symptom associated therewith, (v) protection against the development or onset of a symptom associated with a disease, (vi) protection against recurrence of a symptom associated with a disease, (vii) reduction in hospitalization of a subject, (viii) reduction in length of hospitalization, (ix) increase in survival rate of a subject with a disease, (x) reduction in the number of symptoms associated with a disease, (xi) enhancement, improvement, supplement, complement, or augmentation of the prophylactic or therapeutic effect(s) of another treatment.
[0141] In view of the teachings herein, it will be clear to those skilled in the art that the effective amount of viral vector to be added can be empirically determined. Administration can be administered in a single dose, multiple doses, continuously or intermittently throughout the course of treatment. Methods for determining the most effective administration means and dosages are well known to those skilled in the art and will vary depending on the viral vector, the composition of the treatment, the target cells, and the subject being treated. Single and multiple administrations can be administered, with the level and pattern of administration being selected by the treating physician.
[0142] kit Described herein is a composition comprising one or more of the disclosed rAAV vectors, which is included in a kit for diagnosing, preventing, treating or ameliorating one or more symptoms of heart disease or condition, such as cardiomyopathy.Such kits may be useful in diagnosing, preventing, and / or treating human disease, and may be particularly useful in treating, preventing, and / or ameliorating one or more symptoms of heart disease, such as cardiomyopathy.In some embodiments, the heart disease is caused by cardiomyopathy.In some embodiments, the heart disease is caused by hypertrophic cardiomyopathy or dilated cardiomyopathy.In some embodiments, the heart disease is dilated cardiomyopathy or hypertrophic cardiomyopathy.
[0143] Also provided in some embodiments are kits comprising one or more of the disclosed rAAV vectors (as well as one or more virions, viral particles, transformed host cells, or pharmaceutical compositions comprising such vectors); and instructions for using such kits in one or more therapeutic, diagnostic, and / or prophylactic clinical embodiments. Such kits may include one or more reagents, restriction enzymes, peptides, therapeutic agents, pharmaceutical compounds, or a means for delivery of the composition(s) to a host cell or to an animal (e.g., a syringe, injection, etc.). Depending on the embodiment, the kits may include those for treating, preventing, or ameliorating symptoms of a disease, deficiency, dysfunction, and / or injury, or may include components for large-scale production of the viral vectors themselves.
[0144] In some embodiments, the kit includes one or more containers or receptacles containing one or more doses of any of the described therapeutic agents. Such kits may be therapeutic in nature. In some embodiments, the kit contains a unit dosage, which means, for example, a predetermined amount of a composition including a described therapeutic agent, with or without one or more additional agents.
[0145] One or more components of the kit can be provided in one or more liquid or frozen solvents. The solvent can be aqueous or non-aqueous. The formulations in the kit can also be provided as dry powder(s) or in lyophilized form that can be reconstituted by adding a suitable solvent.
[0146] In some embodiments, the kit includes a label, marker, package insert, bar code, and / or reader indicating the proper use of the contents of the kit. In some embodiments, the kit may include a label, marker, package insert, bar code, and / or reader indicating that the contents of the kit can be administered according to a particular dosage or administration regimen to treat a subject.
[0147] In addition, the kit may also include various reagents, including, but not limited to, washing reagents, elution reagents, and concentration reagents. Such reagents may be readily selected from among those described herein and from among conventional concentration reagents.
[0148] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present invention.
[0149] Combination therapy Aspects of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is encompassed within the scope of the present disclosure.
[0150] The compositions of the present disclosure may include rAAV particles or preparations and / or rAAV vectors, either alone or in combination with one or more additional active ingredients, which may be obtained from natural or recombinant sources or chemically synthesized. In some embodiments, the rAAV particles or preparations are administered in combination with a proteasome inhibitor, such as bortezomib, or hydroxyurea, in the same composition or as part of the same treatment regimen.
[0151] If desired, the rAAV particles may be administered in combination with other agents, such as proteins or polypeptides or various pharmacoactive agents. In some embodiments, this may reflect, for example, one or more administrations of a therapeutic polypeptide (e.g., a recombinant form of a functional peptide or protein that serves to replace or supplement the rAAV-based production of a protein encoded by a transgene), biologically active fragments or variants thereof. The rAAV particles or preparations may thus be delivered together with a variety of other pharmacologic acceptable agents, as required in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.
[0152] In some embodiments, the additional therapeutic agent comprises an anti-inflammatory agent. The anti-inflammatory agent may be, but is not limited to, a corticosteroid, cortisone, hydrocortisone, hydrocortisone-21-monoesters (e.g., hydrocortisone-21-acetate, hydrocortisone-21-butyrate, hydrocortisone-21-propionate, hydrocortisone-21-parate, etc.), hydrocortisone-17,21-diesters (e.g., hydrocortisone-17,21-di ...butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-21-butyrate, hydrocortisone-2 betamethasone (typically as betamethasone benzoate or betamethasone dipropionate); fluocinonide; prednisolone; and triamcinolone (typically as triamcinolone acetonide). In some embodiments, the anti-inflammatory agent includes, but is not limited to, cromolyn (5,5'-(2-hydroxypropane-1,3-diyl)bis(oxy)bis(4-oxo-4H-chromene-2-carboxylic acid) (also known as cromoglycate), and 2-carboxylatochromone-5'-yl-2-hydroxypropane derivatives such as bis(acetoxymethyl), cromoglycate disodium, nedocromil (9-ethyl-4,6-dioxo-10-propyl-6,9-dihydro-4H-pyrano[3,2-g]quinoline-2,8-dicarboxylic acid), and tranilast (2-{[(2E)-3-(3,4-dimethoxyphenyl)prop-2 In some embodiments, the anti-inflammatory agent is a mast cell degranulation inhibitor such as, without limitation, aspirin compounds (acetylsalicylate), non-aspirin salicylates, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamate, naproxen, naproxen sodium, phenylbutazone, sulindac, and tometin.
[0153] In some embodiments, the anti-inflammatory agent comprises an antihistamine. The antihistamine may be, but is not limited to, clemastine, clemastine fumarate (2(R)-[2-[1-(4-chlorophenyl)-1-phenylethoxy]ethyl-1-methylpyrrolidine), dexmedetomidine, doxylamine, loratidine, desloratidine and promethazine, and diphenhydramine, or a pharmaceutically acceptable salt, solvate or ester thereof. In some embodiments, the antihistamine includes, but is not limited to, azatadine, azelastine, bruflorine, cetirizine, cyproheptadine, doxantrozole, etodroxydine, forskolin, hydroxyzine, ketotifen, oxatomide, pizotifen, proxicromil, N,N'-substituted piperazine or terfenadine. In some embodiments, the antihistamine is an H1 antagonist, such as, but not limited to, cetirizine, chlorpheniramine, dimenhydrinate, diphenhydramine, fexofenadine, hydroxyzine, orphenadrine, pheniramine, and doxylamine.In some embodiments, the antihistamine is an H2 antagonist, such as, but not limited to, cimetidine, famotidine, lafutidine, nizatidine, ranitidine, and roxatidine.
[0154] In some embodiments, the additional therapeutic agent comprises an antiviral agent, including an antiretroviral agent. Suitable antiviral agents include, but are not limited to, remdesivir, acyclovir, famciclovir, ganciclovir, foscarnet, idoxuridine, sorivudine, trifluorothymidine, valacyclovir, vidarabine, didanosine, dideoxyinosine, stavudine, zalcitabine, zidovudine, amantadine, interferon alpha, ribavirin, and rimantadine.
[0155] In some embodiments, the additional therapeutic agent comprises an antibiotic. Non-limiting examples of suitable antibiotics include: beta-lactams such as penicillin, aminopenicillins (e.g., amoxicillin, ampicillin, hetacillin, etc.), penicillinase-resistant antibiotics (e.g., cloxacillin, dicloxacillin, methicillin, nafcillin, oxacillin, etc.), broad-spectrum antibiotics (e.g., axocillin, carbenicillin, mezlocillin, piperacillin, ticarcillin, etc.); cephalosporins (e.g., cefadroxil, cefazolin, cephalixin, cephalothin, cephapirin, cephalic acid ... furazine, cefaclor, cefacmandole, cefmetazole, cefonicid, ceforanide, cefotetan, cefoxitin, cefprozil, cefuroxime, loracarbef, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftiofur, ceftizoxime, ceftriaxone, moxalactam, etc.; monobactams such as aztreonam; carbapenems such as imipenem and elopenem; quinolones (e.g., ciprofloxacin, enrofloxacin, difloxacin, etc.); , orbifloxacin, marbofloxacin, etc.); chloramphenicols (e.g., chloramphenicol, thiamphenicol, florfenicol, etc.); tetracyclines (e.g., chlortetracycline, tetracycline, oxytetracycline, doxycycline, minocycline, etc.); macrolides (e.g., erythromycin, tylosin, trimycosin, clarithromycin, azithromycin, etc.); lincosamides (e.g., lincomycin, clindamycin, etc.); aminoglycosides (e.g., gentamicin, mycin, amikacin, kanamycin, apramycin, tobramycin, neomycin, dihydrostreptomycin, paromomycin, etc.; sulfonamides (e.g., sulfadomethoxine, sulfamethazine, sulfaquinoxaline, sulfamerazine, sulfathiazole, sulfasalazine, sulfadiazine, sulfabromomethazine, suflaethoxypyridazine, etc.); glycopeptides (e.g., vancomycin, teicoplanin, ramoplanin, and decaplanin;as well as other antibiotics (e.g., rifampin, nitrofuran, virginiamycin, polymyxin, tobramycin, etc.);
[0156] In some embodiments, the additional therapeutic agent includes, but is not limited to, antifungal agents, such as itraconazole, ketoconazole, fluoconazole, and amphotericin B. In some embodiments, the therapeutic agent is an antiparasitic agent, such as, but not limited to, the broad-spectrum antiparasitic agent nitazoxanide; antimalarials and other antiprotozoal agents (e.g., artemisin, mefloquine, lumefantrine, tinidazole, and miltefosine); anthelmintics, such as mebendazole, thiabendazole, and ivermectin; and antiamoebic agents, such as rifampin and amphotericin B.
[0157] In some embodiments, the additional therapeutic agents include analgesics, including, without limitation, opioid analgesics such as alfentanil, buprenorphine, butorphanol, codeine, dihydrocodeine (drocode), fentanyl, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, sufentanil, and tramadol; and non-opioid analgesics such as apazone, etodolac, difenpyramide, indomethacin, meclofenamate, mefenamic acid, oxaprozin, phenylbutazone, piroxicam, and tolmetin.
[0158] Any particular feature, aspect, method, property, characteristic, quality, attribute, element, etc. disclosed herein in relation to an embodiment can be used in all other embodiments described herein. It should therefore be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another to form various modes of the disclosed invention. Thus, it is intended that the scope of the invention disclosed herein should not be limited by the particular disclosed embodiments described above. Moreover, the invention is susceptible to various modifications and alternative forms, specific examples of which are shown in the drawings and described in detail herein. However, the invention is not limited to the particular forms or methods disclosed, but on the contrary, it should be understood that the invention covers all modifications, equivalents, and alternatives falling within the spirit and scope of the various embodiments described and the appended claims. Any method disclosed herein need not be performed in the order described. The methods disclosed herein include specific actions performed by the practitioner; however, they may also include, either explicitly or implicitly, instructions for those actions by a third party. Furthermore, when features or aspects of the disclosure are described in terms of a Markush group, those skilled in the art will recognize that the disclosure also can be described in terms of any individual members or subgroups of members of that Markush group.
[0159] Any headings or sub-headings used herein are for organizational purposes only and should not be used to limit the scope of the aspects disclosed herein.
[0160] example The following examples are merely illustrative and are not intended to be limitations on the scope of the present disclosure.
[0161] material and method Construct design. Constructs for expressing TNNT2 were engineered and codon-optimized for expression in human tissues. The constructs are subcloned into a plasmid backbone suitable for production of AAV. The 5' to 3' structure of the synthetic TNNT2 gene is provided in Table 1. Constructs containing single-stranded AAV genomes were engineered to contain elements as provided in Tables 1-4 below. Schematic diagrams of the minigenes and constructs are provided in Figures 1-5. Certain constructs were engineered to contain unique restriction sites (e.g., FseI) that are used to subclone shRNA expression cassettes for knockdown of endogenous mutant TNNT2 transcripts.
[0162] Table 1. Construct 1 ("pdsTR2-TNNT2-intron-mini-TNNT2") [Table 12-1] [Table 12-2] [Table 12-3] [Table 12-4]
[0163] Table 2. Construct 2 (pdsTR2-TNNT2-intron-mini-TNNT2 without FseI site) [Table 13-1] [Table 13-2] [Table 13-3] Table 3. Construct 3 ("pdsTR2-Des1-TNNT2 Dual Plan") [Table 14-1] [Table 14-2] [Table 14-3] Table 4. Construct 4 ("pTR2-MHCK9-TNNT2_Dual2_plan") [Table 15-1] [Table 15-2] [Table 15-3]
[0164] AAV production. Recombinant AAV (rAAV) particles containing each of the constructs are made by suspension transfection of Expi293F cells with the TNNT2 constructs and other plasmids required for rAAV production (e.g., containing rep and cap expression cassettes), generating three groups of rAAVs including: (1) AAV9 capsid protein, (2) rh74 capsid protein, and (3) rh74 variant capsid protein containing a tryptophan to arginine mutation at amino acid 505 of the rh74VP1 capsid protein. Vectors are isolated using a capture column followed by an anion exchange column and purified to a titer of 2-5E+13 vg / ml using a cesium chloride gradient.
[0165] Example 1. In vitro expression studies (predictive) Three groups of rAAVs containing TNNT2 constructs will be generated as described above and delivered into HEK293, C2C12, or human induced pluripotent stem cell-derived cardiomyocytes. Whole cell lysates will be generated and probed for TNNT2 expression by ELISA and / or immunoblotting and / or ddPCR.
[0166] Example 2. In vivo expression studies (predictive) Three groups of rAAV containing TNNT2 constructs are generated as above and administered to newborn C57BL / 6 mice (n=6-10 / group) at 5E+13vg / kg via the facial vein. Two to four weeks after rAAV administration, heart, diaphragm, and skeletal muscle tissues are harvested and whole cell lysates are analyzed for TNNT2 expression using ELISA and / or immunoblotting and / or ddPCR. For constructs that also express an shRNA cassette for knockdown of the endogenous allele, the level of endogenous TNNT2 expression and / or the level of shRNA expression are analyzed.
[0167] In separate experiments, three groups of rAAV containing TNNT2 constructs are generated as described above and administered to 5-7 week old C57BL / 6 mice (n=6-10 / group) via the jugular vein at three different doses: 1E+13vg / kg, 5E+13vg / kg, or 1+E14vg / kg. One month after rAAV administration, heart, diaphragm, and skeletal muscle tissues are harvested and whole cell lysates are analyzed for TNNT2 expression using ELISA and / or immunoblotting and / or ddPCR. For constructs that also express an shRNA cassette for knockdown of the endogenous allele, the level of endogenous TNNT2 expression and / or the level of shRNA expression are analyzed.
[0168] Example 3. Restoration of TNNT2 expression in vivo (Prophetic) Familial cardiomyopathies are primary disorders of the myocardium caused by inherited mutations in a single gene, including cardiac troponin T (TNNT2). TNNT2 is a component of the troponin complex within the thin filaments of the sarcomere and mediates the Ca 2+It allows actomyosin interactions and contraction in response to calcium desensitization to occur. Mutations in TNNT2 cause hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM). DCM is characterized by left or both ventricular dilation and reduced myocardial contractility, with an incidence of 8 / 100,000 and a prevalence of 36 / 100,000 (Ramratnam et al., (2016) Gene-Targeted Mice with the Human Troponin T R141W Mutation Develop Dilated Cardiomyopathy with Calcium Desensitization. PLoS ONE 11(12): e0167681). After onset of symptoms, mortality is 25% at 1 year and 50% at 5 years.
[0169] In this example, genetic mouse models of TNNT2-associated cardiomyopathy are used to study the efficacy of the TNNT2 constructs provided herein.The models include heterozygous null animals (Tnnt2(+ / -)), transgenic mice expressing disease-associated alleles (TG(K210Delta)), and mice with knock-in of human TNNT2 R141W mutation that develop DCM with calcium desensitization (Ahmad et al., PLoS One. 2008 Jul 9;3(7):e2642; Ramratnam et al., (2016) Gene-Targeted Mice with the Human Troponin T R141W Mutation Develop Dilated Cardiomyopathy with Calcium Desensitization. PLoS ONE 11(12): e0167681).
[0170] The rAAV containing TNNT2 construct is produced as described above, and is delivered to pre-symptomatic and / or symptomatic TNNT2 mouse models via single IV injection with various doses.Endpoints include survival rate and cardiac function monitored by echocardiography.At autopsy, cardiac tissue is harvested, and total tissue lysate is analyzed for AAV biodistribution by ddPCR, and for human TNNT2 expression by ELISA and / or immunoblot.In addition, tissue sections are analyzed for histopathology.The therapeutic effect of rAAV is evaluated through measured endpoints and / or histopathological evaluation.
[0171] Example 4A. In vitro expression analysis in human and mouse cell lines Human TNNT2 transgene expression was assessed using two distinct expression systems in two different cell types. The first system used a human TNNT2 expression construct driven by the ubiquitous CMV promoter. The construct was expressed using TransfeX. TMand 2.5ug of plasmid DNA per well were transfected into human HEK293 cells at 80-90% confluency in a 6-well plate format. Cells were incubated for approximately 48 hours, then lysates were harvested and treated with RIPA buffer containing 1mM EDTA and protease / phosphatase inhibitors. Total protein concentration was determined using the Pierce BCA protein assay, and after denaturation with β-mercaptoethanol at 99°C for 5 minutes, equal amounts of protein were loaded onto a Tris-glycine gel along with appropriate controls. Proteins were transferred to PVDF membranes and then probed with a human-specific TNNT2 antibody (Abcam, cat#ab91605) at 1:1000, and a secondary goat anti-rabbit HRP antibody (Invitrogen, cat#31466). FIG. 6A is a Western blot of CMV-TNNT2 HEK293 lysate showing the protein band of the CMV-TNNT2 construct at the theoretical protein size of approximately 37 kDa along with the appropriate banding patterns of positive and negative controls.
[0172] The second expression system used a human TNNT2 expression construct driven by the muscle-selective promoter desmin. The construct was transfected into C2C12 mouse myoblasts with Ad-Myo-D helper infection to drive C2C12 differentiation. Cells were incubated for 48 hours, and then lysates were harvested and processed for Western blot and probed with anti-hTNNT2 primary antibody as described above. Figure 7A shows a Western blot of Des1-TNNT2 C2C12 lysate, where the results show a positive band pattern at approximately 37 kDa, the expected theoretical protein size for the desmin-TNNT2 construct, with no band present in the negative control lane.
[0173] Both human and mouse in vitro data together support the positive expression of the human TNNT2 construct driven by two different promoters in multiple cell types, such as human and mouse. According to some embodiments, the human TNNT2 construct as provided herein is strongly expressed in human cells, such as human cardiomyocytes.
[0174] The aim of this study was to characterize transgene expression in adult WT mice following a single retro-orbital administration of two different AAVrh74-Des1-humanTNNT2 constructs, compared to AAV9-Des1-humanTNNT2 expression. Wild-type C57Bl / 6 adult male mice were administered AAVrh74-Des1-TNNT2-pA-dual, AAVrh74-Des1-TNNT2-3'UTR-pA-dual, or AAV9-Des1-TNNT2-pA-dual systemically via the retro-orbital sinus in a single bolus dose of 5 ml / kg. Doses were administered at approximately 5 weeks of age, and animals were euthanized 28 days after administration according to the groupings shown in Table 5 below.
[0175] Example 4B. In vitro expression studies Figure 7B shows an exemplary gene map for the TNNT2 constructs tested. TNNT2-containing plasmids were transfected into HEK293 cells. Total mRNA was harvested and the isolated total RNA was treated with DNAseI to remove residual DNA. Total RNA was used as a template in RT reaction to generate cDNA. qPCR results are shown in Figure 7C. From Figure 7C, the lower the average Ct value, the greater the RNA expression. +RT samples are compared to -RT negative controls. Samples without bars indicate no detection. TNNT2 RNA was detected in all +RT samples except construct #7. These data show that all constructs express TNNT2 RNA.
[0176] Example 5. In vivo 28-day expression study The aim of this study was to characterize transgene expression in adult WT mice following a single retro-orbital administration of two different AAVrh74-Des1-humanTNNT2 constructs, compared to AAV9-Des1-human TNNT2 expression. Wild-type C57Bl / 6 adult male mice were administered AAVrh74-Des1-TNNT2-pA-dual, AAVrh74-Des1-TNNT2-3'UTR-pA-dual, or AAV9-Des1-TNNT2-pA-dual systemically via the retro-orbital sinus in a single bolus dose of 5 ml / kg. Doses were administered at approximately 5 weeks of age, and animals were euthanized 28 days after administration according to the groupings shown in Table 5 below. Table 5. Study design parameters [Table 16]
[0177] Figure 8 shows the measured body weights for each construct with data collected prior to dosing, then weekly during the survival period, and prior to termination. As shown by Figure 9, whole heart weights were collected at termination for all animals. The data show that there were no significant differences in body weight or weight gain in any of the treatment groups compared to the control. The variation in body weight observed throughout the duration of the study was considered normal for this age and strain. All study animals survived until scheduled necropsy, and no morbidity / mortality or clinical findings were recorded during the study. No gross or macroscopic findings were noted upon scheduled necropsy, and all tissues were within normal ranges in the past. Heart and liver were aseptically collected at necropsy and processed for biodistribution and transgene mRNA expression endpoints.
[0178] Tissue biodistribution analysis via ddPCR shows the general dose response of each construct. As shown in Figure 10, the rh74-Des1-TNNT2-pA-dual construct at a high dose of 5e13vg / kg showed significantly higher vector copy number ("VCN") in heart tissue compared to AAVrh74-Des1-TNNT2-3'UTR (p=0.0015), AAV9-Des1-TNNT2 (p<0.0001), or AAV9-Des1-TNNT2-3'UTR (p=0.0003) at the same dose level. Figure 11 shows the liver biodistribution, where the vector copy number at 5e13vg / kg for AAVrh74-Des1-TNNT2-3UTR is significantly higher compared to all other vectors at the same dose level. Liver biodistribution was not significantly different between AAV9-Des1-TNNT2, AAV9-Des1-TNNT2-3UTR, or AAVrh74-Des1-TNNT2 (FIG. 11). The results of vector copy number analysis show stronger cardiac biodistribution of each of the non-limiting constructs tested compared to the control. In addition, the AAVrh74-Des1-TNNT2 construct shows particularly enhanced cardiac biodistribution compared to the same construct packaged in AAV9. In some embodiments, the enhanced cardiac biodistribution by the engineered TNNT2 construct advantageously allows for tunability of transgene delivery. For example, if a given clinical scenario requires the delivery of more transgenes, the use of AAVrh74-Des1-TNNT2 can be employed. According to some embodiments, this ability to be tailored allows for more flexible treatment paradigms and the ability to tailor AAV-based gene therapy employing the constructs provided herein to address specific patient needs.
[0179] TNNT2 transgene mRNA expression was analyzed via RT-qPCR from all animals. Figure 12 shows that hTNNT2 transgene mRNA expression in heart tissue for AAVrh74-Des1-TNNT2 administered at 5e13vg / kg was significantly higher compared to AAVrh74-Des1-TNNT2-3UTR (p<0.0001) or AAV9-Des1-TNNT2-3UTR (p=0.0003) at the same dose; whereas, there was no significant difference in expression levels in the heart compared to AAV9-Des1-TNNT2. Figure 13 shows transgene mRNA expression in the liver, which was approximately 2-2.5-fold lower than the heart for all vectors at 5e13vg / kg, with AAVrh74-Des1-TNNT2 showing the lowest mRNA expression in pairwise comparison with other vectors at the same dose level. qPCR results show promoter-driven tissue-selective transgene expression.
[0180] Together, these results support that AAVrh74-Des1-TNNT2 drives enhanced cardiac-selective transgene expression while simultaneously reducing expression in off-target tissues (liver). In some embodiments, this allows for more efficient delivery of vectors as provided herein, resulting in enhanced therapeutic outcomes. The study data indicates that administration of test substances at the levels reported in this study is well tolerated, does not result in adverse events or safety findings, and endpoint data follows a general dose-response relationship as expected.
[0181] Example 6. Expression through the use of consensus Kozak sequences To design new synthetic Kozak sequences for enhancing transgene expression in the heart, an analysis of genes highly expressed in human heart tissue was performed. As shown in Table A below, genes were selected from the Human Protein Atlas, and the Kozak sequence for each was identified in NCBI. Consensus sequences were derived using Weblogo (https: / / weblogo.berkeley.edu / logo.cgi). The consensus sequence (AGCCCCAAC (SEQ ID NO: 189)) was then utilized in the design of the selected transgene constructs provided herein. Table A [Table A-1] [Table A-2]
[0182] As shown below, self-complementary AAV (scAAV) genomes were designed with various promoters and alternative Kozak sequences, including in silico derived sequences. 1. scAAV containing the chicken beta actin (CBA) promoter and AGCCGCCACC Kozak sequence: lowercase=5'ITR Underlined, capitalized = CBA promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 17-1] [Table 17-2] 2. scAAV containing chicken beta actin (CBA) promoter and in silico derived Kozak sequence: lowercase=5'ITR Underlined, capitalized = CBA promoter Uppercase, bold = in silico derived Kozak sequence Upper case=TNNT2 cDNA Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 18-1] [Table 18-2] 3. scAAV containing the chicken beta actin (CBA) promoter and the CAACCCAGC Kozak sequence: lowercase=5'ITR Underlined, capitalized = CBA promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 19-1] [Table 19-2] 4. scAAV containing the muscle creatine kinase (MCK) promoter and AGCCGCCACC Kozak sequence: lowercase=5'ITR Underlined, capitalized = MCK promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 20-1] [Table 20-2] 5. scAAV containing the muscle creatine kinase (MCK) promoter and in silico derived Kozak sequence: lowercase=5'ITR Underlined, capitalized = MCK promoter Uppercase, bold = in silico derived Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 21] 6. scAAV containing the muscle creatine kinase (MCK) promoter and the CAACCCAGC Kozak sequence: lowercase=5'ITR Uppercase, bold italics = spacer sequence Underlined, capitalized = MCK promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 22-1] [Table 22-2] 7. scAAV containing the TNNC1 promoter and AGCGCCACC Kozak sequence: lowercase=5'ITR Underlined, capital letters = TNNC1 promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 23-1] [Table 23-2] 8. scAAV containing the TNNC1 promoter and in silico derived Kozak sequence: lowercase=5'ITR Underlined, capital letters = TNNC1 promoter Uppercase, bold = in silico derived Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 24-1] [Table 24-2] 9. scAAV containing the TNNC1 promoter and the CAACCCAGC Kozak sequence: lowercase=5'ITR Uppercase, bold italics = spacer sequence Underlined, capital letters = TNNC1 promoter Uppercase, bold = Kozak sequence Uppercase = TNNT2 sequence Uppercase, bold and underlined = Poly A Lower case=3'WT ITR [Table 25-1] [Table 25-2]
[0183] In some embodiments, the promoter, Kozak sequence, and transgene may be assembled into an exemplary construct, where the exemplary construct comprises at least one promoter from Table B, at least one Kozak sequence from Table C, and at least one transgene from Table D. For example, the desmin (Des1) promoter, an in silico derived Kozak sequence, and TNNT2 may be placed into an exemplary construct. Table B [Table B] Table C [Table C] Table D [Table D]
[0184] Non-limiting aspects The following numbered embodiments represent non-limiting aspects of the invention. 1. A nucleic acid comprising an expression cassette comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 2. The nucleic acid of embodiment 1 or 2, wherein the human TNNT2 coding sequence is codon-optimized for expression in a human cell. 3. The nucleic acid according to any one of aspects 1 to 3, wherein the human TNNT2 coding sequence has at least about 85% sequence identity to the sequences of SEQ ID NOs: 7 to 27, SEQ ID NOs: 53 to 71, SEQ ID NOs: 78 to 95, and SEQ ID NOs: 104 to 121 arranged in sequence. 4. The nucleic acid of any one of aspects 1 to 4, wherein the promoter comprises a cardiac-specific promoter. 5. The nucleic acid according to any one of aspects 1 to 4, wherein the promoter is selected from the group consisting of TNNT2, desmin (DES1), and combinations thereof.
[0185] 6. The nucleic acid of any one of aspects 1 to 5, wherein the promoter sequence has at least about 85% sequence identity to the sequence of SEQ ID NO: 3, 49, 77, or 102. 7. The nucleic acid according to any one of aspects 1 to 6, wherein the expression cassette has at least about 85% sequence identity to the sequence of SEQ ID NOs: 1 to 31, or SEQ ID NOs: 47 to 75, or SEQ ID NOs: 76 to 98, or SEQ ID NOs: 99 to 124, or SEQ ID NOs: 125 to 132, or SEQ ID NOs: 133 to 141 arranged in sequence. 8. The nucleic acid according to any one of aspects 1 to 6, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 31 or 47 to 75 arranged in sequence. 9. The nucleic acid according to any one of aspects 1 to 8, which is a recombinant adeno-associated virus (rAAV) vector. 10. The nucleic acid of embodiment 9, which is a single-stranded or self-complementary rAAV nucleic acid vector.
[0186] 11. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to any one of aspects 1 to 10. 12. The rAAV particle of embodiment 11, which is an AAV9 particle. 13. The rAAV particle of embodiment 11, which is an AAVrh74 particle. 14. The rAAV particle of embodiment 11, which is an AAVrh10 particle. 15. A composition comprising a plurality of rAAV particles according to embodiment 10, wherein the rAAV is selected from one or more of AAV9 particles, AAVrh74 particles, and AAVrh10 particles.
[0187] 16. The composition according to aspect 15, further comprising a pharma- ceutically acceptable carrier. 17. A method for treating dilated or hypertrophic cardiomyopathy, comprising: administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein said administration results in expression of a therapeutically effective amount of human TNNT2, thereby treating dilated or hypertrophic cardiomyopathy. The method comprising: 18. The method of embodiment 17, wherein the rAAV is administered via intravenous injection. 19. The method of embodiment 17 or 18, wherein about 1 x 10 to about 1 x 10 rAAV vector genomes are administered.
[0188] 20. A method for inducing increased expression of human TNNT2 in a target cell, comprising: contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats; and wherein the contacting results in increased expression of functional human TNNT2 in the target cell compared to before the contacting, thereby increasing the expression of functional human TNNT2. The method comprising:
[0189] 21. The method of embodiment 20, wherein the contacting is in vivo. 22. The method according to embodiment 20 or 21, for the treatment of dilated or hypertrophic cardiomyopathy. 23. Use of a nucleic acid according to any one of aspects 1 to 10, an rAAV particle according to any one of aspects 11 to 14, or a composition according to aspect 15 or 16 in the manufacture of a medicament for the treatment of dilated or hypertrophic cardiomyopathy. 24. Use of a nucleic acid according to any one of aspects 1 to 10, an rAAV particle according to any one of aspects 11 to 14, or a composition according to aspect 15 or 16 for the treatment of dilated or hypertrophic cardiomyopathy. 25. A nucleic acid according to any one of aspects 1 to 10, further comprising a silencing element, wherein the silencing element encodes an shRNA sequence.
[0190] 26. A nucleic acid comprising an expression cassette comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 27. A method for treating dilated or hypertrophic cardiomyopathy, comprising: administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein said administration results in expression of a therapeutically effective amount of human TNNT2, thereby treating dilated or hypertrophic cardiomyopathy. The method comprising: 28. The method of embodiment 27, further comprising administering a therapeutically effective amount of a silencing construct.
[0191] 29. A method for treating dilated or hypertrophic cardiomyopathy, comprising: administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein said administration results in expression of a therapeutically effective amount of human TNNT2, thereby treating dilated or hypertrophic cardiomyopathy. The method comprising:
[0192] 30. The method of embodiment 29, further comprising administering a therapeutically effective amount of a silencing construct. 31. A nucleic acid comprising an expression cassette comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 32. The nucleic acid of embodiment 31, wherein the human TNNT2 coding sequence is codon-optimized for expression in a human cell. 33. The nucleic acid according to embodiment 31 or embodiment 32, wherein the human TNNT2 coding sequence has at least about 85% sequence identity to the sequences of SEQ ID NOs: 7 to 27, SEQ ID NOs: 53 to 71, SEQ ID NOs: 78 to 95, SEQ ID NOs: 104 to 121 arranged in sequence. 34. The nucleic acid according to any one of aspects 31 to 33, wherein the promoter comprises a cardiac-specific promoter. 35. The nucleic acid of embodiment 34, wherein the promoter is selected from the group consisting of TNNT2, MHCK9 (MCK), desmin (DES1), and combinations thereof. 36. The nucleic acid according to embodiment 34 or 35, wherein the promoter sequence has at least about 85% sequence identity to the sequence of SEQ ID NO: 3, 49, 77 or 102. 37. The nucleic acid according to any one of aspects 31 to 36, wherein the expression cassette has at least about 85% sequence identity to the sequence of SEQ ID NOs: 1 to 31, or SEQ ID NOs: 47 to 75, or SEQ ID NOs: 76 to 98, or SEQ ID NOs: 99 to 124, or SEQ ID NOs: 125 to 132, or SEQ ID NOs: 133 to 141 arranged in sequence. 38. The nucleic acid according to aspect 7, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 31, or SEQ ID NOs: 47 to 75, arranged in sequence. 39. The nucleic acid according to any one of aspects 31 to 38, which is a recombinant adeno-associated virus (rAAV) vector. 40. The nucleic acid according to embodiment 39, which is a single-stranded or self-complementary rAAV nucleic acid vector.
[0193] 41. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to embodiment 39 or embodiment 40. 42. The rAAV particle of embodiment 41, which is an AAV9 particle. 43. The rAAV particle of embodiment 41, which is an AAVrh74 particle. 44. The rAAV particle of embodiment 41, which is an AAVrh10 particle. 45. A composition comprising a plurality of rAAV particles according to any one of aspects 42, 43, or 44.
[0194] 46. A method for inducing increased expression of human TNNT2 in a target cell, comprising: contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats; and wherein the contacting results in increased expression of functional human TNNT2 in the target cell compared to before the contacting, thereby increasing the expression of functional human TNNT2. The method comprising:
[0195] 47. The method of embodiment 46, wherein the contacting is in vivo. 48. The method according to embodiment 46 or 47, for the treatment of dilated or hypertrophic cardiomyopathy. 49. Use of a nucleic acid according to any one of aspects 31 to 39, an rAAV particle according to any one of aspects 41 to 44, or a composition according to aspect 45 in the manufacture of a medicament for the treatment of dilated or hypertrophic cardiomyopathy.
[0196] 50. Below: human TNNT2 coding sequence; a cardiac enhancer element operably linked to the promoter; and a Kozak sequence, where the Kozak sequence enhances transgene expression in the heart, where the expression construct is flanked on both sides by inverted terminal repeats, where the Kozak sequences are non-native with respect to the human TNNT2 coding sequence, cardiac enhancer elements, and / or promoter; A nucleic acid comprising an expression construct comprising:
[0197] 51. The nucleic acid according to embodiment 50, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO: 128. 52. The nucleic acid according to embodiment 50, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO: 189.
Claims
1. A nucleic acid comprising an expression cassette comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences.
2. The nucleic acid according to claim 1, wherein the human TNNT2 coding sequence is codon-optimized for expression in human cells.
3. The nucleic acid according to claim 1, wherein the human TNNT2 coding sequence has at least about 85% sequence identity with respect to the sequentially arranged sequences of SEQ ID NOs. 7-27, SEQ ID NOs. 53-71, SEQ ID NOs. 78-95, and SEQ ID NOs. 104-121.
4. The nucleic acid according to claim 1, wherein the promoter comprises a heart-specific promoter.
5. The nucleic acid according to claim 4, wherein the promoter is selected from the group consisting of the TNNT2 promoter, the desmin (DES1) promoter, and combinations thereof.
6. The nucleic acid according to claim 4, wherein the promoter sequence has at least about 85% sequence identity with respect to the sequence of SEQ ID NOs: 3, 49, 77, or 102, and / or the expression cassette has at least about 85% sequence identity with respect to sequentially arranged sequences of SEQ ID NOs: 1 to 31, or SEQ ID NOs: 47 to 75, or SEQ ID NOs: 76 to 98, or SEQ ID NOs: 99 to 124, or SEQ ID NOs: 125 to 132, or SEQ ID NOs: 133 to 141.
7. The nucleic acid according to claim 6, wherein the expression cassette comprises sequentially arranged sequences of sequence numbers 1 to 31 or sequence numbers 47 to 75.
8. The nucleic acid according to claim 7, which is a recombinant adeno-associated virus (rAAV) vector.
9. The nucleic acid according to claim 8, which is a single-stranded or self-complementary rAAV nucleic acid vector.
10. Recombinant adeno-associated virus (rAAV) particles comprising the nucleic acid described in any one of claims 1 to 9.
11. The rAAV particle according to claim 10, which is an AAV9 particle.
12. A composition comprising a plurality of rAAV particles according to claim 11, wherein the rAAV is selected from one or more of AAV9 particles, AAVrh74 particles, and AAVrh10 particles.
13. The composition according to claim 12, further comprising a pharmaceutically acceptable carrier.
14. A composition for use in treating dilated cardiomyopathy or hypertrophic cardiomyopathy, the following: A therapeutically effective dose of rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences. Herein, the composition is formulated to promote the expression of a therapeutically effective amount of human TNNT2 for the treatment of dilated cardiomyopathy or hypertrophic cardiomyopathy.
15. A composition for use according to claim 14, formulated for administration via intravenous injection.
16. Approximately 1×10 13 ~Approx. 1×10 14 A composition for use according to claim 14, wherein a number of rAAV vector genomes are administered.
17. A method for inducing increased expression of human TNNT2 in target cells, the following: The target cells are brought into contact with a plurality of rAAV particles, each containing a nucleic acid expression cassette comprising a functional human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and Here, the aforementioned contact results in an increase in the expression of functional human TNNT2 in the target cells compared to before contact, thereby increasing the expression of functional human TNNT2. The method, including the method described above.
18. A composition for use in treating dilated cardiomyopathy or hypertrophic cardiomyopathy, the following: A therapeutically effective dose of rAAV comprising a nucleic acid expression construct comprising a silencing element and a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences. Herein, the composition is formulated to promote the expression of a therapeutically effective amount of human TNNT2 for the treatment of dilated cardiomyopathy or hypertrophic cardiomyopathy.
19. The composition for use according to claim 18, wherein the silencing construct comprises an shRNA sequence.
20. A composition for use in treating dilated cardiomyopathy or hypertrophic cardiomyopathy, the following: (i) A therapeutically effective amount of rAAV comprising a nucleic acid expression construct comprising a human TNNT2 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and (ii) A therapeutically effective amount of a silencing construct, Herein, the composition is formulated to promote the expression of a therapeutically effective amount of human TNNT2 for the treatment of dilated cardiomyopathy or hypertrophic cardiomyopathy.
21. The composition for use according to claim 20, wherein the silencing construct comprises an shRNA sequence.
22. A nucleic acid comprising an expression cassette comprising a silencing element, a human TNNT2 coding sequence operably linked to a promoter, and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences.
23. The nucleic acid according to claim 22, wherein the silencing element encodes an shRNA sequence.
24. The nucleic acid according to claim 22, wherein the human TNNT2 coding sequence is codon-optimized for expression in human cells.
25. The nucleic acid according to claim 22, wherein the human TNNT2 coding sequence has at least about 85% sequence identity with respect to the sequentially arranged sequences of SEQ ID NOs. 7-27, SEQ ID NOs. 53-71, SEQ ID NOs. 78-95, and SEQ ID NOs. 104-121.
26. The nucleic acid according to claim 22, wherein the promoter includes a heart-specific promoter.
27. The nucleic acid according to claim 26, wherein the promoter is selected from the group consisting of the TNNT2 promoter, the MHCK9 (MCK) promoter, the desmin (DES1) promoter, and combinations thereof.
28. The nucleic acid according to claim 26, wherein the promoter sequence has at least about 85% sequence identity with respect to any one of sequence numbers 3, 49, 77, and 102, and / or the expression cassette has at least about 85% sequence identity with respect to sequentially arranged sequences of sequence numbers 1 to 31, or sequence numbers 47 to 75, or sequence numbers 76 to 98, or sequence numbers 99 to 124, or sequence numbers 125 to 132, or sequence numbers 133 to 141.
29. The nucleic acid according to claim 28, wherein the expression cassette comprises sequentially arranged sequences of sequence numbers 1 to 31 or sequence numbers 47 to 75.
30. The nucleic acid according to claim 22, which is a recombinant adeno-associated virus (rAAV) vector.
31. The nucleic acid according to claim 30, which is a single-stranded or self-complementary rAAV nucleic acid vector.
32. Recombinant adeno-associated virus (rAAV) particles comprising the nucleic acid described in any one of claims 22 to 31.
33. The rAAV particle according to claim 32, which is an AAV9 particle.
34. A composition comprising a plurality of rAAV particles as described in claim 32.
35. below: Human TNNT2 coding sequence; A cardiac enhancer element operably connected to a promoter; and The Kozak sequence, where the Kozak sequence enhances transgene expression in the heart, is flanked on both sides by an inverted terminal repeat sequence, where the Kozak sequence is non-native with respect to the human TNNT2 coding sequence, cardiac enhancer element, and / or promoter. Nucleic acids containing an expression construct that includes [specific expression construct].
36. The nucleic acid according to claim 35, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity with respect to sequence number 128, or the Kozak sequence is a synthetic sequence and has at least 85% sequence identity with respect to sequence number 189.