Methods and compositions for treating RBM20-associated cardiomyopathy with viral vectors

Abstract

The present disclosure relates to compositions and methods for the treatment of cardiomyopathy.Some embodiments provided herein relate to virus-mediated gene transfer into host cells to induce expression of encoded polypeptide, protein, or other product to improve one or more symptoms of cardiomyopathy in a subject.In some embodiments, the disclosed methods and compositions relate to recombinant adeno-associated virus particles encoding human RBM20 for the treatment of cardiomyopathy, including dilated cardiomyopathy.

Description

[Technical field]

[0001] Priority This application claims priority to U.S. Provisional Patent Application No. 63 / 321,243, filed March 18, 2022, the entire contents of which are incorporated by reference herein. [Background technology]

[0002] background Cardiomyopathy represents a collection of diverse conditions of the heart muscle and is the second most common cause of heart disease in subjects, with medical management of secondary symptoms being the only treatment option. These diseases have many causes, symptoms, and treatments and can affect people of all ages and races. When cardiomyopathy occurs, the normal muscle in the heart can become enlarged, hardened, thin, or filled with substances that the body produces but that do not belong in the heart muscle. As a result, the ability of the heart muscle to pump blood is reduced, which can cause irregular heartbeats, blood backing up into the lungs or the rest of the body, and heart failure. Cardiomyopathy can be acquired or hereditary. The cause is not always known, but the genetic underpinnings of the genetic form of the disease are increasingly being understood.

[0003] Gene transfer strategies have been shown to ameliorate heart disease.

[0004] Incorporation by Reference of Materials in the Sequence Listing File This application incorporates by reference the material in the Sequence Listing contained in the following XML file being filed concurrently with the present specification: Filename: U120270089WO00-SEQ-PRW.xml; created on March 15, 2023, size 82,768 bytes. Summary of the Invention

[0005] overview Cardiomyopathy is a class of heart muscle diseases that adversely affect the heart's ability to circulate blood through the cardiovascular system. There are various types of cardiomyopathy, including dilated cardiomyopathy, hypertrophic cardiomyopathy, and restrictive cardiomyopathy. Cardiomyopathy in the human population is a major medical burden, and although it is particularly desirable to treat cardiomyopathy in the human population, there is currently an unmet need for treatment.

[0006] Dilated cardiomyopathy (DCM) is one of the most common types of cardiomyopathy, occurring primarily in adults aged 20-60 years. DCM affects the ventricles and atria, the lower and upper chambers of the heart, respectively. Most forms of DCM are acquired from a number of causes, including coronary heart disease, heart attacks, high blood pressure, diabetes, thyroid disease, viral hepatitis and viral infections that inflame the heart muscle. Alcoholism and certain drugs, such as cocaine and amphetamines, as well as at least two drugs used to treat cancer (doxorubicin and daunorubicin), can also lead to DCM. In addition, there are numerous genetic forms of DCM, including, but not limited to, DCM associated with Duchenne and Becker muscular dystrophy. In some forms of Becker muscular dystrophy, as well as in most cases of Duchenne muscular dystrophy, cardiomyopathy can ultimately limit the patient's survival.

[0007] Hypertrophic cardiomyopathy (HCM) occurs when the walls of the heart muscle become abnormally thickened. The increased wall thickness can not only increase cardiac complications, but can also block or obstruct the flow of blood through the heart.

[0008] Restrictive cardiomyopathy (RCM) is a condition that leads to stiffening of the heart's chambers over time. While the heart's ability to contract remains largely unaffected, the heart muscle does not fully relax between heart beats. This limits the ability of the ventricles to fill with blood and causes blood to flow backwards through the circulatory system.

[0009] Cardiac function is critically dependent on calcium-dependent signaling. During cardiac disease, the dysfunction of calcium channels in cardiomyocytes promotes calcium circulation abnormalities, further impairing cardiac function. Genetic transfer strategies to reduce calcium circulation abnormalities have been reported to improve cardiac disease in small and large animal models and in human clinical trials.

[0010] Disclosed herein is a gene delivery approach for the treatment of a human subject having one or more types of cardiomyopathy or symptoms thereof.

[0011] Accordingly, some aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) vector for delivering a transgene to the heart of a subject. Such a rAAV vector may include, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to one or more transgenes, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector includes a regulatory element in addition to the promoter, for example, to provide a physiologically relevant expression level and / or to modify expression in a manner that restricts expression to a specific cell type or tissue. In some embodiments, the regulatory element includes one or more of an enhancer, a 5' untranslated region (UTR), and a 3' UTR. In some embodiments, the UTR is an MHCK9 UTR, for example, a 5' MHCK9 UTR. In some embodiments, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of one or more transgenes). In some embodiments, the two transgenes are operably linked to the same single promoter. In some embodiments, each transgene is operably linked to a separate promoter. In some embodiments where multiple transgenes are provided, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of two transgenes expressed from a single promoter, or 3' of one or both transgenes expressed from different promoters). Aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) nucleic acid vector for delivering two or more transgenes to the heart of a subject, wherein the vector comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, two or more transgenes and a promoter operably linked to the two or more transgenes, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0012] In some embodiments, described herein are nucleic acids comprising an expression construct comprising a human RBM20 coding sequence and an enhancer element, such as a CMV enhancer, operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, described herein are nucleic acids comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element, operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native with respect to the human RBM20 coding sequence and / or non-native with respect to the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and an in silico designed consensus Kozak sequence, wherein the in silico designed consensus Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native to the human RBM20 coding sequence and the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is native to the human RBM20 coding sequence and / or native to the promoter. In some embodiments, the Kozak sequence is a synthetic sequence. In some embodiments, the human RBM20 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac-specific promoter.In some embodiments, the promoter is CBA (chicken β-actin) or truncated chicken β-actin (smCBA). In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 (or AAVrh74) particle. In some embodiments, the rAAV particle is a rh10 (or AAVrh10) particle. In some embodiments, a composition comprising a plurality of rAAV particles is provided. In some embodiments, the plurality of rAAV particles may further comprise a pharma- ceutically acceptable carrier. In some embodiments, the rh74 particles comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:10, or a portion of SEQ ID NO:10 (e.g., SEQ ID NO:10 encodes the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the nucleotide sequence of SEQ ID NO:10).In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:11, or a portion of SEQ ID NO:11 (e.g., SEQ ID NO:11 is the amino acid sequence of the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the amino acid sequence of SEQ ID NO:11). In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:12.

[0013] In some embodiments, the therapeutic transgene is encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence set forth as SEQ ID NO:5 (RBM20 cDNA). In some embodiments, one or more of the transgenes of the present disclosure are naturally occurring sequences. In some embodiments, one or more transgenes are engineered to be species-specific. In some embodiments, one or more transgenes are codon-optimized for expression in a species of interest, such as human. For example, in some embodiments, the therapeutic transgene (e.g., the RBM20 transgene) is codon-optimized.

[0014] Further provided herein is a rAAV particle, comprising any of the rAAV vectors disclosed herein, encapsulated in AAV capsid protein.Other aspects of the present disclosure include compositions comprising any of the nucleic acid vectors or rAAV particles described herein.In some embodiments, such compositions can be administered to a subject for gene therapy for cardiomyopathy.In additional embodiments, such compositions can be administered to a subject for gene therapy for heart disease.In some embodiments, the heart disease causes heart failure in the subject.

[0015] The composition of the present disclosure may be administered to a subject via various routes. In some embodiments, the composition is administered via intravenous injection to the subject. In some embodiments, administration of the composition results in expression of the transgene (or expression of two or more transgenes if multiple transgenes are used) in the subject's heart. In various embodiments, administering the composition results in improved cardiac function in the subject, such as improved cardiac function for more than 10 months in the subject. In some embodiments, administration results in improved cardiac function for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, the improved cardiac function is represented by an increase in left ventricular ejection fraction (LVEF). In some embodiments, the LVEF is increased (compared to pre-treatment measurements) by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between those listed). In some embodiments, the LVEF is measured by echocardiography. In some embodiments, administration results in improvement of cardiac physiology (e.g., structural features) for more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, improvement of cardiac physiology is represented by a decrease in the thickness of the left ventricular wall. In some embodiments, the thickness of the left ventricular wall is decreased by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between the listed amounts). In some embodiments, the thickness of the left ventricular wall is measured by cardiac magnetic resonance imaging (MRI) or transthoracic echocardiography (TTE).

[0016] In some embodiments, described herein are compositions comprising AAV vectors, virions, viral particles, and their pharmaceutical preparations, which are useful in methods for delivering genetic material that codes for one or more beneficial or therapeutic product(s) to mammalian cells and tissues.The rAAV vectors, rAAV particles, or compositions comprising rAAV particles of the present disclosure can be used for gene therapy for the treatment of one or more cardiac diseases, such as one or more types of cardiomyopathy.The rAAV vectors, rAAV particles, or compositions comprising rAAV particles of the present disclosure can be administered to subjects in need thereof, such as human subjects suffering from cardiac diseases, such as cardiomyopathy.

[0017] Additionally, provided herein are compositions and therapeutic and / or diagnostic kits that include one or more of the disclosed AAV compositions, formulated with one or more additional ingredients or prepared with one or more instructions for their use.

[0018] In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, one or more silencing elements, and an enhancer element, such as a CMV enhancer, operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, the silencing element comprises an shRNA expression cassette. In some embodiments, the silencing element comprises an shRNA sequence. In some embodiments, the human RBM20 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac specific promoter. In some embodiments, the promoter is TNNT2. In some embodiments, the promoter is CBA (chicken beta-actin). In some embodiments, the promoter is CMV or mini-CMV. In some embodiments, the promoter is desmin. In some embodiments, the promoter is a muscle creatine kinase (MCK) promoter. In some embodiments, the promoter is MHCK7. In some embodiments, the promoter is MHCK9. In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the expression construct is pTR-TNNT2-RBM20. In some embodiments, the expression construct is pTR2-MCHK9-RBM20.

[0019] In some embodiments, the rAAV particles are AAV9 particles. In some embodiments, the rAAV particles are rh74 particles. In some embodiments, the rAAV particles are rh10 particles. In some embodiments, a composition is provided that includes a plurality of rAAV particles. In some embodiments, the plurality of rAAV particles may further include a pharma- ceutically acceptable carrier. In some embodiments, the rh74 particles include at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 10, or a nucleotide sequence set forth as a portion of SEQ ID NO: 10. For example, SEQ ID NO: 10 encodes the rh74 VP1 protein, which also includes VP2 and VP3 proteins. Thus, in some embodiments, rh74 particles according to embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:11 or a portion of SEQ ID NO:11. For example, SEQ ID NO:11 is the amino acid sequence of the rh74 VP1 protein (including VP2 and VP3 proteins), and thus, in some embodiments, rh74 particles according to embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the amino acid sequence of SEQ ID NO:11.In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:12.

[0020] In some embodiments, a method for treating dilated cardiomyopathy is described, comprising administering a therapeutically effective amount of rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter, and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in the expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy. In some embodiments, the rAAV is administered via intravenous injection.

[0021] In some embodiments, a method for treating dilated cardiomyopathy is described, comprising administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence, a silencing element, each element operably linked to a promoter and optionally comprising an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in the expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy. In some embodiments of the disclosed method, a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct is administered to a subject (e.g., a human) to treat dilated cardiomyopathy in the subject.

[0022] In some embodiments, a method for treating dilated cardiomyopathy is described, the method comprises (1) administering a therapeutically effective amount of a rAAV comprising a silencing construct, for example, a rAAV comprising a silencing construct, and (2) a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in the expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy.In some embodiments, the rAAV is administered via intravenous injection.

[0023] In some embodiments, for example, a rAAV containing an RBM20 coding sequence and / or a silencing construct is administered by intravenous injection. 13 ~Approx. 1×10 14 In some embodiments, when the rAAV vector genome is administered, 20%, at least 30%, at least 40%, or at least 50% of the cardiomyocytes are transduced. In some embodiments, about 1 x 10 13 ~Approx. 1×10 14 When one rAAV vector genome is administered, 20%, at least 30%, at least 40%, or at least 50% of the cardiomyocytes are transduced.

[0024] Also described herein is a method of increasing expression of human RBM20 in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a functional human RBM20 coding sequence, a silencing element, and an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the contacting results in increased expression of functional human RBM20 in the target cell compared to before the contact, thereby increasing the expression of functional human RBM20.

[0025] Also described herein is a method of increasing expression of human RBM20 in a target cell, the method comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a functional human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein said contacting results in increased expression of functional human RBM20 in the target cell compared to before the contact, thereby increasing the expression of functional human RBM20.

[0026] Also described herein is a method of increasing expression of human RBM20 in a target cell, the method comprising contacting the target cell with a plurality of silencing constructs and rAAV particles, wherein the rAAV particles comprise a nucleic acid expression construct comprising a functional human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting results in increased expression of functional human RBM20 in the target cell compared to before the contact, thereby increasing the expression of functional human RBM20.

[0027] In some embodiments, the contacting is in vivo. In some embodiments, the method is used for the treatment of dilated cardiomyopathy. In some embodiments, the nucleic acid, rAAV particle, composition, or method of manufacture described herein can be used for the treatment of dilated cardiomyopathy. In some embodiments, the nucleic acid, rAAV particle, composition, or method of manufacture described herein can be used for the treatment of idiopathic DCM. In some embodiments, the nucleic acid, rAAV particle, composition, or method of manufacture described herein can be used for the treatment of DCM associated with Duchenne muscular dystrophy or Becker muscular dystrophy. In some embodiments, the nucleic acid, rAAV particle, composition, or method of manufacture described herein can be used for the treatment of hypertrophic cardiomyopathy or restrictive cardiomyopathy.

[0028] Further provided herein is the use of any of the disclosed nucleic acids, rAAV particles, or compositions for the treatment of DCM, or in the manufacture of a medicament for the treatment of DCM. [Brief description of the drawings]

[0029] [Figure 1] FIG. 1 shows a non-limiting example of a genetic construct map for an embodiment of an expression construct disclosed herein.

[0030] [Diagram 2] FIG. 2 shows a second non-limiting example of a genetic construct map for an embodiment of an expression construct disclosed herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Detailed Description Reference is made to specific features and / or non-limiting embodiments of the invention. It should be understood that the disclosure of the invention herein encompasses all possible combinations of such specific features. For example, if a specific feature is disclosed in the context of a particular aspect or embodiment of the invention, or in the context of a particular claim, that feature can also be used in combination with and / or in the context of other specific aspects and embodiments of the invention, and in the invention in general, to the extent possible.

[0032] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.Unless otherwise stated, all patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety.If there are multiple definitions for a term in this specification, those in this section shall prevail unless otherwise stated.

[0033] "Subject" refers to a mammal that is the subject of treatment using a method or composition as provided herein. "Mammal" includes, without limitation, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates, such as monkeys, chimpanzees, and apes, and humans. In some embodiments, the subject is a human.

[0034] The terms "treating," "treatment," "therapeutic," or "treatment" do not necessarily mean a complete cure or elimination of a disease or condition. Any alleviation of undesirable signs or symptoms of a disease or condition, regardless of the degree, can be considered treatment and / or therapy. "Treating" a disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0035] The term "effective amount," as used herein, refers to an amount that can treat or ameliorate a disease or condition, or that can produce the intended therapeutic effect, such as reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0036] A "nucleic acid" sequence refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence. The term encompasses naturally occurring and non-naturally occurring nucleobases (bases). The term encompasses sequences that include any of the known base analogs of DNA and RNA, including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxy-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methyl Guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

[0037] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including DNA, RNA, or their analogs. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. Modifications to nucleotide structure, if present, may be added before or after the assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.

[0038] Throughout this application, for purposes of describing the relative positions of nucleotide sequences in particular nucleic acid molecules, for example, when a particular nucleotide sequence is described as being located "upstream," "downstream," "3'," or "5'" relative to another sequence, it is to be understood as referring to the position of that sequence on the "sense" or "coding" strand of the DNA molecule being referenced, as is conventional in the art.

[0039] The term "isolated" when referring to a nucleotide sequence means that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. Thus, an "isolated nucleic acid molecule encoding a particular polypeptide" refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode the polypeptide of interest; however, the molecule may include some additional bases or moieties that do not materially affect the essential characteristics of the composition.

[0040] As used herein, "variant" refers to a molecule (e.g., a nucleic acid sequence or a protein sequence) that has characteristics that deviate from those found in nature; for example, a "variant" is at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to its wild-type counterpart. A variant of a nucleic acid or protein molecule may include modifications to the sequence (e.g., substitutions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, or 15-20 bases or amino acids, respectively) compared to the wild-type sequence. These modifications include chemical modifications, as well as truncations.

[0041] The term "identity" refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity". The "percent identity" of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence multiplied by 100. The term refers to the degree to which two sequences (nucleotide or amino acid) have the same residues at the same positions in the alignment. For example, "an amino acid sequence is X% identical to SEQ ID NO:Y" refers to the % identity of the amino acid sequence to SEQ ID NO:Y, reciting that X% of the residues in the amino acid sequence are identical to the residues of the disclosed sequence in SEQ ID NO:Y. Typically, computer programs are used for such calculations. Sequence identity can be determined by aligning sequences using algorithms such as BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package Release 7.0 (Genetics Computer Group, 575 Science Dr., Madison, Wis.) with default gap parameters or by inspection, and by optimal alignment (i.e., the one that results in the highest percentage of sequence similarity over the entire comparison window). The percentage of sequence identity is calculated by comparing two optimally aligned sequences over the entire comparison window, determining the number of positions where identical residues occur in both sequences to calculate the number of matching positions, dividing the number of matching positions by the total number of matching and mismatching positions in the comparison window, not counting gaps (i.e., the size of the window), and multiplying the result by 100 to calculate the percentage of sequence identity. Unless otherwise indicated, the comparison window between two sequences is defined by the total length of the shorter of the two sequences.

[0042] The term "recombinant" when applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps and other procedures that result in constructs distinguishable from polynucleotides found in nature and / or combinations of polynucleotides and viral proteins not found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The terms encompass replication of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0043] The term "gene" refers to a polynucleotide that contains at least one open reading frame that can code for a particular gene product. Any of the polynucleotide sequences described herein may be used to identify larger fragments or full-length coding sequences of the genes with which they are associated. Methods for isolating larger fragment sequences are known to those skilled in the art.

[0044] The term "transgene" as used herein refers to a nucleic acid sequence to be placed in a viral vector, which encodes a polypeptide, protein, or other product of interest.In some embodiments, one rAAV vector may contain sequences encoding one or more transgenes (which may be the same gene or different genes, as desired).For example, one rAAV vector may contain coding sequences for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 transgenes.The transgenes of the present disclosure, as provided herein, relate to the improvement of one or more cardiac conditions, such as cardiomyopathies.

[0045] The term "gene transfer" or "gene delivery" refers to a method or system for inserting DNA, such as a transgene, into a host cell, such as that of a subject suffering from cardiomyopathy. In some embodiments, gene transfer results in the transient expression of unintegrated introduced DNA, extrachromosomal replication, and expression of introduced replicons (e.g., episomes). In additional embodiments, gene transfer results in the integration of introduced genetic material into the genomic DNA of the host cell.

[0046] The term "regulatory element" or "regulatory sequence", or variations thereof, refers to a nucleotide sequence involved in the functional regulation of a polynucleotide, including the replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. Regulatory elements can be enhancing or inhibitory in nature, depending on the embodiment. Non-limiting examples of regulatory elements include transcriptional regulatory sequences, such as promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like. Collectively, these elements provide for the replication, transcription, and translation of the coding sequence in the recipient cell, although not all of these sequences need always be present. It should be understood that the structural components of the rAAV vectors as provided herein may be listed in separate paragraphs and may be combined and used together for clarity only. For example, any regulatory element or other component may be used in combination with any transgene (or transgenes) provided herein.

[0047] A "promoter" is a polynucleotide that interacts with RNA polymerase to initiate transcription of a coding region (eg, a transgene) that is usually located downstream (in the 3' direction) from the promoter.

[0048] The term "operably linked" refers to an arrangement of elements configured so that the components perform a function. For example, a regulatory sequence operably linked to a coding sequence effects expression of the coding sequence. Depending on the embodiment, a regulatory sequence need not be contiguous with the coding sequence. Thus, for example, there may be one or more untranslated but transcribed sequences between the promoter sequence and the coding sequence, and the two sequences are still considered to be "operably linked."

[0049] The term "vector" refers to any molecular vehicle, such as a plasmid, phage, transposon, cosmid, chromosome, virus, viral particle, virion, etc., that can transfer genetic sequences (e.g., a transgene) to or between cells of interest.

[0050] An "expression vector" is a vector that contains a region of nucleic acid (e.g., a transgene) that encodes a gene product (e.g., a polypeptide or protein) of interest. As disclosed herein, the vector is used to achieve expression, e.g., stable expression, of a protein in an intended target cell. The expression vector may also contain a control element operably linked to the transgene to facilitate expression of the encoded protein in the target cell. The combination of one or more regulatory elements and the gene(s) to which they are operably linked for expression may be referred to herein as an "expression cassette."

[0051] The term "AAV" is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or its derivatives. The term covers all subtypes, and both naturally occurring and recombinant forms, unless otherwise indicated. The abbreviation "rAAV" refers to recombinant adeno-associated virus, which is also referred to as recombinant AAV vector (or "rAAV vector"), which refers to AAV that contains a polynucleotide sequence (e.g., a transgene) that is not of AAV origin. The term "AAV" encompasses AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), serotype rh10 AAV, serotype rh74 AAV, or pseudotyped rAAV (e.g., AAV2 / 9, which refers to an AAV vector having the genome of AAV2 (e.g., ITRs of AAV2) and the capsid of AAV9). In some embodiments, the preferred serotype for delivery to a human patient suffering from cardiomyopathy is one of AAV9, serotype rh74, serotype rh10, or AAV8. In some embodiments, the rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine (W505R), or other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference herein in its entirety.

[0052] The term "AAV virus" or "AAV viral particle" or "rAAV vector particle" refers to a viral particle that is composed of at least AAV capsid proteins and an encapsidated polynucleotide.

[0053] The term "heterologous" refers to a genotypically distinct origin. For example, a heterologous polynucleotide is one that originates from a different species compared to the reference species (e.g., a human gene inserted into a viral plasmid is a heterologous gene). A promoter that has been removed from its native coding sequence and operably linked to a coding sequence that is not found in nature to which it is linked is a heterologous promoter.

[0054] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present disclosure.

[0055] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle that is administered with the rAAV particle or preparation and / or rAAV vector. Such pharmaceutical carriers can be sterile liquids such as water and oils (including those of petroleum such as mineral oil, vegetable oils such as peanut oil, soybean oil, and sesame oil, animal oils, or synthetic origin). Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers.

[0056] "Gene silencing" refers to the suppression of gene expression, for example, the expression of a transgene, a heterologous gene and / or an endogenous gene. Gene silencing can be mediated through a process that affects transcription and / or through a process that affects post-transcriptional mechanisms. In some embodiments, gene silencing occurs when siRNA initiates the degradation of the mRNA of a gene of interest in a sequence-specific manner through RNA interference. In some embodiments, gene silencing can be allele-specific. "Allele-specific" gene silencing refers to the specific silencing of one allele of a gene.

[0057] As used herein, "silencing element" refers to a component of an expression construct that suppresses gene expression, such as endogenous gene expression.For example, the silencing element of the present disclosure can be used to epigenetically silence genes at both post-transcriptional and pre-transcriptional levels.In some embodiments, the silencing element is a short hairpin RNA (shRNA).In some embodiments, the silencing element is an siRNA.In a non-limiting example, the epigenetic modification of gene expression by siRNA silencing element can result from the siRNA-mediated modification of chromatin structure or methylation pattern, which changes gene expression.

[0058] "Knockdown", "knockdown technique" refers to a technique of gene silencing that can reduce the expression of a target gene compared to the gene expression before the introduction of an RNAi molecule, thereby resulting in the inhibition of the production of the target gene product. The term "reduction" is used herein to indicate that the expression of the target gene is reduced by 1-100%. For example, the expression may be reduced by 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, 99%, or more than 99%. Knockdown of gene expression can be managed by the use of dsRNA or siRNA. For example, "RNA interference (RNAi)", which can involve the use of siRNA, has been successfully applied to knockdown the expression of specific genes in several vertebrate species, including plants, D. melanogaster, C. elegans, trypanosoma, planaria, hydra, and mice.

[0059] "RNA interference (RNAi)" is the process of sequence-specific post-transcriptional gene silencing initiated by siRNA. RNAi is found in many organisms, such as fruit flies, nematodes, fungi and plants, and is thought to be involved in antiviral defense, modification of transposon activity, and regulation of gene expression. During RNAi, RNAi molecules induce the degradation of target mRNA, which results in sequence-specific inhibition of gene expression.

[0060] "Small interfering" or "short interfering RNA", or siRNA, is an RNA duplex of nucleotides that targets a gene of interest. "RNA duplex" refers to the structure formed by complementary pairing between two regions of an RNA molecule. An siRNA "targets" a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the targeted gene. In some embodiments, the length of the siRNA duplex is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may include a loop portion located between the two sequences that form the duplex. The loop can be of various lengths. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure may also include a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang of 0, 1, 2, 3, 4, or 5 nucleotides in length. "Sense" and "antisense" sequences can be used to form siRNA molecules with or without a loop region. As used herein, the term siRNA is equivalent to other terms used to describe nucleic acid molecules that can mediate sequence-specific RNAi, such as double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetic silencing.For example, the siRNA molecules of the present disclosure can be used to epigenetically silence genes at both post-transcriptional and pre-transcriptional levels.In a non-limiting example, the epigenetic modification of gene expression by the siRNA molecules of the present disclosure can result from the siRNA-mediated modification of chromatin structure or methylation pattern, which changes gene expression.In another non-limiting example, the modification of gene expression by the siRNA molecules of the present disclosure can result from the cleavage of RNA (either coding RNA or non-coding RNA) mediated by RISC, or alternatively, from the inhibition of translation, as known in the art.

[0061] Silencing element (e.g., siRNA) can be encoded by nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal. The nucleic acid construct that contains silencing element may be referred to herein as "silencing construct".

[0062] Terms and phrases used in this application, and variations thereof, particularly in the appended claims, should be construed as open ended, as opposed to limiting, unless expressly stated otherwise. By way of example of the foregoing, the term "including" should be read to mean "including, without limitation," "including but not limited to," and the like; the term "comprising," as used herein, is synonymous with "including," "containing," or "characterized by," and is inclusive or open ended, not excluding additional, unrecited elements or method steps; the term "having" means "having at least The term "include" should be interpreted as "including but not limited to"; the term "examples" is used to provide illustrative instances of the items being discussed, not an exhaustive or limiting list thereof; and the use of terms such as "preferably," "preferred," "desired," or "desirable," and words of similar import, should not be understood as implying that a particular feature is critical, essential, or even important to structure or function, but instead is intended merely to highlight alternative or additional features that may or may not be utilized in a particular embodiment. In addition, the term "comprise" should be interpreted synonymously with the phrases "having at least" or "including at least." When used in the context of a process, the term "comprise" means that the process includes at least the recited steps, but may include additional steps.When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components. Similarly, a group of items joined with the conjunction "and" should not be read as requiring each and every item to be present in the group, but rather as "and / or" unless expressly stated otherwise. Similarly, a group of items joined with the conjunction "or" should not be read as requiring mutual exclusivity within the group, but rather as "and / or" unless expressly stated otherwise.

[0063] With respect to the use of substantially all plural and / or singular terms in this specification, those skilled in the art can translate from plural to singular and / or from singular to plural, where appropriate for the context and / or application. For clarity, various singular / plural permutations may be explicitly stated in this specification. The indefinite article "a" or "an" does not exclude plurals. A single processor or other unit may fulfill the functions of several items recited in the claims. The mere fact that certain means are recited in mutually different dependent claims does not indicate that a combination of these means cannot be used to advantage. Any reference signs in the claims should not be interpreted as limiting the scope.

[0064] Ranges disclosed herein also encompass any and all overlaps, subranges, and combinations thereof. Words such as "up to," "at least," "greater than," "less than," "between" and the like include the recited numbers. Numbers preceded by terms such as "about" or "approximately" include the recited numbers. For example, "about 90%" includes "90%." In some embodiments, at least 95% homologous or identical includes 96%, 97%, 98%, 99%, and 100% homologous or identical to a reference sequence. In addition, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference also includes that the sequence "consists of" or "consists essentially of" the recited sequence, unless otherwise indicated. Similarly, when a composition is disclosed as "comprising" a feature, such reference also includes that the composition "consists of" or "consists essentially of" the recited feature, unless otherwise indicated. Sequence Listing Construct 1 (pTR-TNNT2-RBM20; Figure 1) [Table A-1] [Table A-2] [Table A-3] [Table A-4] [Table A-5] Sequence Listing - Proteins [Table B-1] [Table B-2] Sequence Table - Additional Sequences [Table C-1]

Table C-2

Table D-1

Table D-2

Table D-3

Table D-4

Table D-5

[0065] Kozak sequence In some embodiments, described herein are nucleic acids comprising an expression construct comprising a human RBM20 coding sequence and an enhancer element, such as a CMV enhancer, operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats. In some embodiments, described herein are nucleic acids comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element, operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native with respect to the human RBM20 coding sequence and / or non-native with respect to the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and an in silico designed consensus Kozak sequence, wherein the in silico designed consensus Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is non-native to the human RBM20 coding sequence and the promoter. In some embodiments, described herein is a nucleic acid comprising an expression construct comprising a human RBM20 coding sequence, an enhancer element operably linked to a promoter, and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, wherein the Kozak sequence is native to the human RBM20 coding sequence and / or native to the promoter. In some embodiments, the Kozak sequence is a synthetic sequence. In some embodiments, the human RBM20 coding sequence is codon-optimized for expression in human cells. In some embodiments, the promoter comprises a cardiac-specific promoter.In some embodiments, the promoter is CBA (chicken β-actin) or truncated chicken β-actin (smCBA). In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 (or AAVrh74) particle. In some embodiments, the rAAV particle is a rh10 (or AAVrh10) particle. In some embodiments, a composition comprising a plurality of rAAV particles is provided. In some embodiments, the plurality of rAAV particles may further comprise a pharma- ceutically acceptable carrier. In some embodiments, the rh74 particles comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:10, or a portion of SEQ ID NO:10 (e.g., SEQ ID NO:10 encodes the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the nucleotide sequence of SEQ ID NO:10).In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:11, or a portion of SEQ ID NO:11 (e.g., SEQ ID NO:11 is the amino acid sequence of the rh74 VP1, VP2, and VP3 proteins, and thus, in some embodiments, the rh74 particles according to embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a portion of the amino acid sequence of SEQ ID NO:11). In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:12.

[0066] Transgene Transgenes may be used to correct, reduce, eliminate, or otherwise ameliorate genetic defects, which may include defects in which a normal gene is expressed at lower than normal levels, defects with a gene product that is expressed at normal or near-normal levels but has abnormal activity, or defects in which no functional gene product is expressed. In some embodiments, the transgene sequence encodes a therapeutic protein or polypeptide to be expressed in the host cell. Aspects of the present disclosure also include using multiple transgenes.

[0067] RNA-binding motif protein 20 is encoded by the RBM20 gene. Mutations in RBM20 or perturbations in its function are known to cause DCM (dilated cardiomyopathy). RBM20 is the master regulator of cardiac-specific alternative splicing of the TTN gene, which is found to be most frequently mutated in idiopathic DCM patients (approximately 20-25%). The TTN gene has the largest number of exons (364 in humans), and titin, the sarcomeric protein encoded by the TTN gene, is the largest known protein in mammals. In RBM20 mutant rat lines that lack nearly all of the RBM20 exons, N2B, the shortest cardiac titin isoform, is not expressed. Thus, RBM20 is a key regulator of TTN pre-mRNA processing in the heart and may cause the DCM phenotype through altered splicing of genes regulated by RBM20. Missense mutations in the highly conserved RSRSP stretch, not in the RNA binding domain, but in the arginine / serine (RS) rich region, are the most frequent disease alleles.In some embodiments of the disclosed rAAV vector, the transgene is RBM20 cDNA, such as human RBM20 cDNA.In some embodiments, the transgene is RBM20 coding sequence that is codon-optimized for expression in mammalian cells.In some embodiments, the transgene is RBM20 coding sequence that is codon-optimized for expression in human cells.

[0068] In some embodiments, any of the disclosed rAAV vectors contains multiple transgenes. In some embodiments, the rAAV vector discloses two transgenes.

[0069] Regulatory elements In some embodiments, the rAAV vector includes one or more regions that include sequences that facilitate expression of a heterologous nucleic acid, e.g., expression regulatory sequences operably linked to the heterologous nucleic acid. A promoter drives transcription of the nucleic acid sequence that it regulates, and thus it is typically located at or near the transcription start site of the gene. A promoter can have a length of, e.g., 100 to 1000 nucleotides. In some embodiments, a promoter is operably linked to a nucleic acid, or a sequence of a nucleic acid (a nucleotide sequence). A promoter is considered to be "operably linked" to a sequence of a nucleic acid that it regulates when the promoter is in the correct functional location and orientation with respect to that sequence such that the promoter regulates the sequence (e.g., controls ("drives") its transcription initiation and / or expression). Many such sequences are known in the art.

[0070] Promoters that may be used according to the present disclosure may include any promoter that can drive expression of a transgene in the heart of a subject. In some embodiments, the promoter may be a tissue-specific promoter. "Tissue-specific promoter" as used herein refers to a promoter that can only function in a specific type of tissue, such as the heart. Thus, a "tissue-specific promoter" cannot drive expression of a transgene in other types of tissue. In some embodiments, the promoter that may be used according to the present disclosure is a promoter that is restricted to the heart. Non-limiting examples of tissue-specific promoters and / or regulatory elements that may be used include (1) desmin, creatine kinase, myogenin, alpha myosin heavy chain, and natriuretic peptide, which are specific to muscle cells, and (2) albumin, alpha-1-antitrypsin, Hepatitis B virus core protein promoters, which are specific to liver cells. In some embodiments, the promoter is a muscle creatine kinase promoter, such as MHCK9, which is a muscle and heart specific promoter. Non-limiting examples of heart-restricted promoters are selected from cardiac troponin C, cardiac troponin I, and cardiac troponin T (cTnT). As provided herein, in treating cardiomyopathy, a promoter that is restricted to the heart is advantageous, at least because it effectively increases the dose delivered to the heart by reducing the possibility of off-target expression of transgene, enhancing treatment.Non-limiting examples of expression regulatory sequences include promoters, insulators, silencers, response elements, introns, enhancers, start sites, termination signals, and poly(A) tails.Any combination of such regulatory sequences is contemplated herein (e.g., promoters and enhancers).

[0071] Alternatively, the promoter may be a promoter from one of the following genes, without limitation: α-myosin heavy chain gene, 6-myosin heavy chain gene, myosin light chain 2v (MLC-2v) gene, myosin light chain 2a gene, CARP gene, cardiac α-actin gene, cardiac m2 muscarinic acetylcholine gene, atrial natriuretic factor gene (ANF), cardiac sarcoplasmic reticulum Ca-ATPase gene, skeletal α-actin gene; or the artificial heart promoter derived from the MLC-2v gene.

[0072] Any of a number of promoters suitable for use in a selected host cell may be used to achieve an appropriate expression level of the nucleic acid, protein, or polypeptide of interest. The promoter may be, for example, a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a synthetic promoter. For example, constitutive promoters of various strengths may be used. The rAAV vectors described herein may include one or more constitutive promoters, such as viral promoters or promoters from mammalian genes that are generally active in driving transcription. Non-limiting examples of constitutive viral promoters include promoters of herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), simian virus 40 (SV40), mouse mammary tumor virus (MMTV), Ad E1A, and cytomegalovirus (CMV). Non-limiting examples of non-viral constitutive promoters include various housekeeping gene promoters, as exemplified by the β-actin promoter, including chicken β-actin promoter (CBA).

[0073] Inducible promoters and / or regulatory elements may also be contemplated to achieve the appropriate expression level of the protein or polypeptide of interest.Non-limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes such as estrogen gene promoters.Another example of an inducible promoter is the tetVP16 promoter, which is responsive to tetracycline.

[0074] Synthetic promoters are also contemplated herein. Synthetic promoters may contain, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.

[0075] Enhancer elements can function in combination with other regulatory elements to increase expression of a transgene. In some embodiments, the enhancer element is upstream (located 5') of the transgene. Non-limiting embodiments of enhancer elements include nucleotide sequences including, for example, a 100 base pair element from simian virus 40 (SV40 late 2XUSE), a 35 base pair element from human immunodeficiency virus 1 (HIV-1 USE), a 39 base pair element from ground squirrel hepatitis virus (GHV USE), a 21 base pair element from adenovirus (adenovirus L3 USE), a 21 base pair element from human prothrombin (hTHGB USE), a 53 base pair element from human C2 complement gene (hC2 USE), truncations of any of the foregoing, and combinations of the foregoing. In some embodiments, the enhancer is an MHCK9 enhancer. In some embodiments, the enhancer is derived from an α-myosin heavy chain (αMHC) gene. In some embodiments, the αMHC enhancer comprises a nucleic acid sequence having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity to CCTTCAGATTAAAAATAACTAAGGTAAGGGCCATGTGGGTAGGGGAGGTGGTGTGAGACGGTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCCTGGAGCCAGAGGGGCGAGGGCAGCAGACCTTTCATGGGCAAACCTCAGGGCTGCTGTC (SEQ ID NO: 9); or to SEQ ID NO: 14.

[0076] Non-limiting polyadenylation signals include nucleotide sequences including, for example, the 624 base pair polyadenylation signal from human growth hormone (hGH), the 135 base pair polyadenylation signal from simian virus 40 (sV40 late), the 49 base pair synthetic polyadenylation signal from rabbit beta-globin (SPA), the 250 base pair polyadenylation signal from bovine growth hormone (bGH), truncations of any of the foregoing, and combinations of the foregoing.

[0077] In some embodiments of the disclosed rAAV vectors, the two or more transgenes are operably controlled by a single promoter. In some embodiments, each of the two or more transgenes is operably controlled by a separate promoter.

[0078] In some embodiments, the rAAV vector of the present disclosure further comprises an internal ribosome entry site (IRES). An IRES is a nucleotide sequence that allows translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. In most eukaryotes, translation can only be initiated at the 5' end of an mRNA molecule, since 5' cap recognition is required for the assembly of the initiation complex. In some embodiments, the IRES is located between transgenes.

[0079] In such embodiments, the proteins encoded by the different transgenes are translated individually (i.e., as opposed to being translated as a fusion protein). In some embodiments, the rAAV vector of the present disclosure comprises, at least, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a first transgene, an IRES operably linked to a second transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector of the present disclosure comprises, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a RBM20 cDNA transgene, an IRES operably linked to a second transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0080] In some embodiments, the rAAV vector of the disclosure further comprises a polyadenylation (pA) signal.

[0081] Expression cassette The expression cassette is composed of a transgene and its regulatory sequence at a minimum.When the cassette is designed to be expressed from rAAV, the expression cassette further comprises 5' and 3' AAV ITRs.These ITRs may be full length, or one or both of the ITRs may be truncated.In one embodiment, the rAAV is pseudotyped, i.e., the capsid of the AAV is from a different source AAV than the AAV that provides the ITRs.

[0082] In one embodiment, the ITRs are used from AAV serotype 2. In an additional embodiment, the ITRs are used from AAV serotype 1. However, ITRs from other suitable sources may be selected.

[0083] Figure 1 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR, a TRS (transcriptional regulatory sequence) site, and a TNNT2 promoter. A chimeric intron follows, where a silencing element is present, and the silencing element encodes an shRNA. Following the promoter and silencing element, the RBM20 transgene is represented. The construct further includes a polyadenylation site and a TRS site following the RBM20 transgene. At least one or more spacer sequences may be inserted at any point within the structural sequence described in the above construct. In addition, any number of promoters or regulatory sequences may be included in the construct to modify or alter the expression of RBM20.

[0084] Figure 2 represents an embodiment of the construct described herein. At the 5' end, there is an AAV ITR, a TRS (transcriptional regulatory sequence) site, an alpha MHC, an MHCK9 enhancer, and an MHCK9 promoter. A chimeric intron follows. Following the promoter, the RBM20 transgene is represented. The construct further includes a polyadenylation site and a TRS site following the RBM20 transgene. Within the structural sequence described in the construct above, at least one or more spacer sequences may be inserted at any point within the construct. In addition, any number of promoters or regulatory sequences may be included in the construct to alter or modify the expression of RBM20.

[0085] Expression cassette - silencing element The embodiments of the present disclosure can provide compositions and methods for gene silencing and protein expression modification using small nucleic acid molecules. Examples of nucleic acid molecules include molecules active in RNA interference (RNAi molecules), short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) molecules, and DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), or repeat associated siRNA (rasiRNA). Such molecules can mediate RNA interference on gene expression. In some embodiments, gene silencing can be targeted to a specific defective allele. In some embodiments, the gene-silenced defective allele can then be replaced by a functional copy. In some embodiments, the functional copy of the gene is codon-optimized (e.g., for expression in human cells) so that the dissimilarity between the defective copy and the functional copy allows only the defective copy to be silenced.

[0086] In some embodiments, the expression cassette comprises the RBM20 transgene and associated regulatory sequences, as well as regions that can modify endogenous RBM20 gene expression, for example, via shRNA expression cassettes. Attenuation or knockdown of endogenous gene expression can be achieved using nucleotide sequences that code for small nucleic acid molecules that include shRNA. In some embodiments, the expression cassette comprises a transgene that codes for a functional RBM20 allele, as well as a silencing element for attenuating the expression of a defective gene. In some embodiments, the silencing element is an intron sequence in the entire construct. In some embodiments, the intron sequence contains a restriction site. In some embodiments, the silencing element and the intron sequence can be utilized for subcloning in the expression cassette.

[0087] In some embodiments, the delivery of the nucleotide sequence can be separate from the vector encoding the expression cassette that contains the transgene and related regulatory sequences.For example, two or more constructs can be administered simultaneously, where at least one transgene construct comprises the nucleic acid sequence encoding a functional RBM20 transgene, and where at least one other silencing construct comprises the nucleic acid sequence for regulating endogenous RBM20 gene expression.In some embodiments, the administration of the expression cassette encoding the RBM20 transgene is accompanied by, followed by, or preceded by the administration of the vector encoding the method for silencing gene or modifying RBM20 protein expression.

[0088] In some embodiments, the expression cassette comprises the RBM20 transgene and related regulatory sequences, but does not include the region that modifies endogenous RBM20 gene expression.In some embodiments, a construct is administered that comprises an expression cassette with a functional RBM20 transgene.In some embodiments, the expression of the functional RBM20 transgene is sufficient to provide therapeutic benefit to the subject.In some embodiments, the expression of the functional RBM20 transgene provides the subject with the acquisition of the function of RNA-binding motif 20.

[0089] vector Further provided herein is a rAAV viral particle or a rAAV preparation containing such a particle. In some embodiments, the rAAV particle comprises a viral capsid and one or more transgenes as described herein encapsidated by the viral capsid. Methods for producing rAAV particles are known in the art and commercially available (see, for example, Zolotukhin el al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Application Publication Nos. US2007 / 0015238 and US2012 / 0322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing a rAAV vector may be combined with one or more helper plasmids, such as those containing the rep genes (encoding, e.g., Rep78, Rep68, Rep52 and Rep40) and cap genes (encoding VP1, VP2, and VP3, including the modified VP3 region described herein), and transfected into a production cell line so that the rAAV particles can be packaged and then purified.

[0090] The particles in the rAAV particles or rAAV preparations disclosed herein may be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, 2 / 9, 3 / 1, 3 / 5, 3 / 8, or 3 / 9). As used herein, the serotype of the rAAV rAAV particle refers to the serotype of the capsid protein of the recombinant virus. In some embodiments, the rAAV particle is rAAV6 or rAAV9. In some embodiments, the rAAV particle is AAVrh74. In a preferred embodiment, the rAAV particle is AAVrh74. In an additional preferred embodiment, the rAAV is AAV9. In some embodiments, rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by mutating amino acid 505 of the VP1 capsid from tryptophan to arginine, and / or other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference in its entirety. Non-limiting examples of derivatives, pseudotypes, and / or other vector types include AAVrh.10, AAVrh.74, AAV2 / 1, AAV2 / 5, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2-AAV3 hybrid, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-SC15, AAV-HSC17, AAVhu.37, AAVrh8, CHt-P6, AAV 2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.

[0091] Such AAV serotypes and derivatives / pseudotypes, as well as methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699- 708. doi: 10.1038 / mt.2011.287. Epub Jan. 24, 2012. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer DV, Samulski RJ.). In certain embodiments, the capsid of any of the rAAV particles disclosed herein is of the AAVrhlO serotype. In preferred embodiments, the capsid of the rAAV particle is of the AAVrhlO serotype. In some embodiments, the capsid is of the AAV2 / 6 serotype. In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which includes (a) an rAAV vector that includes ITRs from one serotype (e.g., AAV2, AAV3), and (b) a capsid composed of capsid proteins from another serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al, J. Virol., 75:7662-7671, 2001; Halbert et al, J. Virol., 74:1524-1532, 2000; Zolotukhin et al, Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).

[0092] rAAV Gene Therapy for Heart Disease In some embodiments, the rAAV vector of the present disclosure further comprises a polyadenylation (pA) signal. For example, in preferred embodiments, the pA signal comprises one or both of the following sequences: SEQ ID NOs: 6 and 20.

[0093] In some embodiments, the rAAV vector of the disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a promoter operably linked to a transgene, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0094] In some embodiments, the rAAV vector genome is circular. In some embodiments, the rAAV vector genome is linear. In some embodiments, the rAAV vector genome is single-stranded. In some embodiments, the rAAV vector genome is double-stranded. In some embodiments, the rAAV genome vector is a self-complementary rAAV vector.

[0095] Described herein are non-limiting examples of rAAV vectors. The vectors described below contain linearized plasmid sequences described as SEQ ID NOs: 1-7, or 13-21, arranged in sequence. Thus, in some embodiments, the rAAV vector may have sequences that are identical to SEQ ID NOs: 1-7 or SEQ ID NOs: 13-21, when the groupings are arranged in sequence. As used herein, "arranged in sequence" refers to the arrangement of the subject sequences in the grouping in the vector in the order of 5' to 3'. That is, a rAAV vector having sequences including SEQ ID NOs: 1-7 arranged in sequence contains SEQ ID NOs: 1, 2, 3, 4, 5, 6, and 7 in the order of 5' to 3'. The rAAV vectors of the present disclosure may comprise a nucleotide sequence having at least 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the sequences set forth as SEQ ID NOs: 1-7 or SEQ ID NOs: 13-21, arranged sequentially. In some embodiments, the rAAV vector has 100% identity to the sequences set forth as SEQ ID NOs: 1-7 or SEQ ID NOs: 13-21, arranged sequentially. In some embodiments, any of the disclosed rAAV vectors have at least 85% sequence identity to any of the disclosed sequence groupings arranged sequentially, with no gaps between the subject sequences. In some embodiments, any of the disclosed rAAV vectors have at least 85% sequence identity to any of the sequentially arranged disclosed sequence groupings, with no gaps between the subject sequences.

[0096] In some embodiments, any of the disclosed rAAV nucleic acid vector sequences comprises a truncation at the 5' or 3' end compared to the sequence of any one of SEQ ID NOs: 1-7 or 13-21 arranged sequentially. In some embodiments, any of the rAAV vectors comprises a nucleotide sequence that differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more than 18 nucleotides from the sequence of any one of SEQ ID NOs: 1-7 or 13-21 arranged sequentially.

[0097] In some embodiments, a therapeutic rAAV vector has a sequence comprising, sequentially arranged, SEQ ID NOs: 1-7. In some embodiments, a therapeutic rAAV vector has a sequence comprising, sequentially arranged, SEQ ID NOs: 13-21.

[0098] Recombinant adeno-associated viral vectors and therapeutic uses thereof Many serotypes of AAV have been cloned and sequenced. Serotypes 1 and 6 share >99% amino acid homology in their capsid proteins. Of the first six AAV serotypes, serotype 2 has been extensively characterized and is therefore often used in gene transfer studies, but other AAV serotypes, such as AAV9, AAV20, AAVrh74, AAVrh10, etc., are also used according to embodiments disclosed herein. In some embodiments, repeated administration of a given serotype that is expected to induce a humoral immune response is performed in conjunction with an immune management regimen. In some embodiments, the immune management regimen includes administration of one or more agents that function as B cell depletors, alone or in combination with one or more agents that inhibit one or more aspects of the mTOR pathway. In one embodiment, an anti-CD20 antibody is administered and rapamycin is administered. In some embodiments, this allows repeated administration of rAAV of a given serotype, where the immune response to subsequent administrations of the rAAV is reduced, limited, or absent. Further information regarding immune management can be found in U.S. Patent Application Publication No. US2017 / 0049887, published on February 23, 2017, the entire contents of which are incorporated by reference herein.

[0099] The therapeutic rAAV vectors, therapeutic rAAV particles, or compositions comprising therapeutic rAAV particles of the present disclosure may be used in human subjects in need thereof for gene therapy for cardiac disease, such as cardiomyopathies, as provided herein. Examples of cardiac disease that may be treated using the methods and compositions of the present disclosure include, but are not limited to, cardiomyopathies and acute ischemia. In some embodiments, the cardiomyopathies are hypertrophic or dilated cardiomyopathy. In some embodiments, the cardiomyopathies are dilated cardiomyopathy, which are caused by or associated with reduced or absent expression and / or function of RBM20. The therapeutic rAAV vectors, particles, and compositions comprising therapeutic rAAV particles may be used for the treatment of such heart failure (e.g., heart failure secondary to cardiomyopathies) when administered to a subject in need thereof, for example, via vascular delivery to the coronary arteries and / or direct injection into the heart. The therapeutic rAAV vectors, particles, and compositions comprising rAAV particles drive the co-expression of RBM20 in the subject's cardiomyocytes.

[0100] The amino acid sequence of the therapeutic RBM20 encoded by the RBM20 transgene has at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth as SEQ ID NO:8.

[0101] In some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and / or contained in the attached sequence listing) are provided, accounting for the degeneracy of the nucleic acid code. Additionally, sequences (whether nucleic acid or amino acid) that differ from those explicitly disclosed herein (and / or contained in the attached sequence listing) but have functional similarity or equivalence are also contemplated within the scope of this disclosure. The foregoing includes mutations, truncations, substitutions, or other types of modifications.

[0102] According to some embodiments described herein, any of the sequences may be used, or truncated or mutated forms of any of the sequences disclosed herein (and / or contained in the accompanying sequence listing) may be used in any combination.

[0103] The promoter driving the expression of therapeutic nucleic acid can be, but is not limited to, a constitutive promoter, an inducible promoter, a tissue-specific promoter, a neuron-specific promoter, a muscle-specific promoter, or a synthetic promoter. In some embodiments, the promoter is a neuron-specific promoter or a muscle-specific promoter. The constitutive promoter can be, but is not limited to, a herpes simplex virus (HSV) promoter, a thymidine kinase (TK) promoter, a Rous sarcoma virus (RSV) promoter, a simian virus 40 (SV40) promoter, a mouse mammary tumor virus (MMTV) promoter, an adenovirus E1A promoter, a cytomegalovirus (CMV) promoter, a mammalian housekeeping gene promoter, or a β-actin promoter. The inducible promoter can be, but is not limited to, a cytochrome P450 gene promoter, a heat shock protein gene promoter, a metallothionein gene promoter, a hormone-inducible gene promoter, an estrogen gene promoter, or a tetVP16 promoter that is responsive to tetracycline. The muscle-specific promoter can be, but is not limited to, a desmin promoter, a creatine kinase promoter (e.g., MHCK9), a myogenin promoter, an alpha myosin heavy chain promoter, or a natriuretic peptide promoter.

[0104] In some embodiments, the therapeutic rAAV promoter comprises a neuron-specific or cardiac-specific promoter.

[0105] The therapeutic rAAV can be serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype rh10, or serotype rh74. The therapeutic rAAV can also be pseudotyped rAAV.

[0106] In some embodiments, the therapeutic rAAV has a sequence that shares at least 85% sequence identity to SEQ ID NOs:1-7 or SEQ ID NOs:13-21 arranged sequentially.

[0107] In some embodiments, the therapeutic rAAV has a sequence that shares at least 95% sequence identity to SEQ ID NOs:1-7 or SEQ ID NOs:13-21 arranged sequentially.

[0108] In silico derivation of consensus Kozak sequences for enhanced expression in cardiac tissue To design new synthetic Kozak sequences for enhancing transgene expression in the heart, an analysis of genes highly expressed in human heart tissue was performed. Genes were selected from the Human Protein Atlas, as shown in Table 1 below, and the Kozak sequence for each was identified in NCBI. Consensus sequences were derived using Weblogo (https: / / weblogo.berkeley.edu / logo.cgi). The consensus sequence (AGCCCCAAC (SEQ ID NO: 36)) was then utilized in the design of the selected transgene constructs provided herein. Table 1. [Table 1]

[0109] As shown below, self-complementary AAV (scAAV) genomes were designed with various promoters and alternative Kozak sequences, including in silico derived sequences.

[0110] In silico construct 1 IS1. scAAV containing chicken beta actin (CBA) promoter and Kozak sequence of AGCGCCACC (SEQ ID NO: 37):

[0111] lowercase=5'ITR

[0112] Underlined, capitalized = CBA promoter

[0113] Uppercase, bold = Kozak sequence

[0114] Uppercase = RBM20 sequence

[0115] Uppercase, bold and underlined = Poly A

[0116] Lower case=3'WT ITR [Table E-1] [Table E-2] [Table E-3]

[0117] In silico construct 2 IS2. scAAV containing chicken beta actin (CBA) promoter and in silico derived Kozak sequence:

[0118] lowercase=5'ITR

[0119] Underlined, capitalized = CBA promoter

[0120] Uppercase, bold = in silico derived Kozak sequence

[0121] Upper case = RBM20 cDNA

[0122] Uppercase, bold and underlined = Poly A

[0123] Lower case=3'WT ITR [Table F-1] [Table F-2] [Table F-3]

[0124] In silico construct 3 IS3. scAAV containing chicken beta actin (CBA) promoter and CAACCCAGC Kozak sequence:

[0125] lowercase=5'ITR

[0126] Underlined, capitalized = CBA promoter

[0127] Uppercase, bold = Kozak sequence

[0128] Uppercase = RBM20 sequence

[0129] Uppercase, bold and underlined = Poly A

[0130] Lower case=3'WT ITR [Table G-1] [Table G-2] [Table G-3]

[0131] In silico construct 4 IS4. scAAV containing muscle creatine kinase (MCK) promoter and AGCGCCACC Kozak sequence:

[0132] lowercase=5'ITR

[0133] Underlined, capitalized = MCK promoter

[0134] Uppercase, bold = Kozak sequence

[0135] Uppercase = RBM20 sequence

[0136] Uppercase, bold and underlined = Poly A

[0137] Lower case=3'WT ITR [Table H-1] [Table H-2] [Table H-3]

[0138] In silico construct 5 IS5. scAAV containing muscle creatine kinase (MCK) promoter and in silico derived Kozak sequence:

[0139] lowercase=5'ITR

[0140] Underlined, capitalized = MCK promoter

[0141] Uppercase, bold = in silico derived Kozak sequence

[0142] Uppercase = RBM20 sequence

[0143] Uppercase, bold and underlined = Poly A

[0144] Lower case=3'WT ITR [Table I-1] [Table I-2] [Table I-3]

[0145] In silico construct 6 IS6. scAAV containing muscle creatine kinase (MCK) promoter and CAACCCAGC Kozak sequence:

[0146] lowercase=5'ITR

[0147] Uppercase, bold italics = spacer sequence

[0148] Underlined, capitalized = MCK promoter

[0149] Uppercase, bold = Kozak sequence

[0150] Uppercase = RBM20 sequence

[0151] Uppercase, bold and underlined = Poly A

[0152] Lower case=3'WT ITR [Table J-1] [Table J-2] [Table J-3]

[0153] In silico construct 7 scAAV containing IS7.TNNC1 promoter and AGCGCCACC Kozak sequence:

[0154] lowercase=5'ITR

[0155] Underlined, capital letters = TNNC1 promoter

[0156] Uppercase, bold = Kozak sequence

[0157] Uppercase = RBM20 sequence

[0158] Uppercase, bold and underlined = Poly A

[0159] Lower case=3'WT ITR [Table K-1] [Table K-2] [Table K-3]

[0160] In silico construct 8 scAAV containing IS8.TNNC1 promoter and in silico derived Kozak sequence:

[0161] lowercase=5'ITR

[0162] Underlined, capital letters = TNNC1 promoter

[0163] Uppercase, bold = in silico derived Kozak sequence

[0164] Uppercase = RBM20 sequence

[0165] Uppercase, bold and underlined = Poly A

[0166] Lower case=3'WT ITR [Table L-1] [Table L-2] [Table L-3]

[0167] In silico construct 9 scAAV containing IS9.TNNC1 promoter and CAACCCAGC Kozak sequence:

[0168] lowercase=5'ITR

[0169] Uppercase, bold italics = spacer sequence

[0170] Underlined, capital letters = TNNC1 promoter

[0171] Uppercase, bold = Kozak sequence

[0172] Uppercase = RBM20 sequence

[0173] Uppercase, bold and underlined = Poly A

[0174] Lower case=3'WT ITR [Table M-1] [Table M-2]

[0175] In some embodiments, the promoters, Kozak sequences, and transgenes from Tables 2-4 below may be assembled into an exemplary construct, where the exemplary construct includes at least one promoter, at least one Kozak, and at least one transgene. For example, a desmin (Des1) promoter, an in silico derived Kozak sequence, and RBM20 may be placed into an exemplary construct. Table 2. [Table 2] Table 3. [Table 3] Table 4 [Table 4]

[0176] Pharmaceutical Formulation and Administration The compositions described herein may further comprise pharmaceutical excipients, buffers, or diluents, and may be formulated for administration to host cells ex vivo or to animals, particularly humans, in situ. Such compositions may further comprise, optionally, liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to cells, tissues, organs, or the body of a subject in need thereof. Such compositions may be formulated for use in a variety of therapies, such as in the amelioration, prevention, and / or treatment of conditions such as peptide deficiency, polypeptide deficiency, peptide overexpression, polypeptide overexpression, and the like, including conditions that result in diseases or disorders as described herein.

[0177] Formulations containing pharma- ceutically acceptable excipient and / or carrier solutions are well known to those of skill in the art, as is the development of suitable dosing and treatment regimens for use with specific compositions described herein in a variety of treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administration and formulations.

[0178] Typically, these formulations may contain at least about 0.1% or more of a therapeutic agent (e.g., therapeutic rAAV particles or preparations), although the percentage of active ingredient(s) may of course vary and may conveniently be between about 1 or 2% and about 70% or 90% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent(s) in each therapeutically useful composition may be prepared in such a manner that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be taken into account by those skilled in the art when preparing such pharmaceutical formulations. In addition, various dosages and treatment regimes may be desirable.

[0179] In some circumstances, it may be desirable to deliver the therapeutic rAAV particles or preparations in a suitably formulated pharmaceutical composition disclosed herein; subcutaneously, intravascularly, intracardially, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells (e.g., cardiac myocytes and / or other cardiac cells), tissues, or organs. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are delivered systemically via intravenous injection, particularly for treating humans. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising therapeutic rAAV particles are injected directly into the heart of a subject. Direct injection into the heart may include, for example, injection into one or more of cardiac muscle tissue, the lining of the heart, or the skeletal muscle surrounding the heart, using a needle catheter. In some embodiments, direct injection into the human heart is preferred, for example, when delivery is performed simultaneously with a surgical or interventional procedure that improves access to the heart. In some embodiments, the interventional procedure includes any procedure in which coronary or pulmonary blood perfusion is altered. In some embodiments, the interventional procedure includes one or more of percutaneous administration, catheterization, or coronary retrograde perfusion.

[0180] Pharmaceutical preparations of compositions suitable for injectable use include sterile aqueous solutions or dispersions. In some embodiments, the preparations are sterile and fluid to the extent that easy syringability exists. In some embodiments, the form is stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier is, for example, a solvent or dispersion medium containing water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, vegetable oils, or other pharma- ceutically acceptable carriers generally recognized as safe (GRAS) by the U.S. Food and Drug Administration. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. There is virtually no limit to the other components that can be included, so long as the additional agent does not cause significant adverse effects when in contact with the target cells or host tissues. The therapeutic rAAV particles or preparations may thus be delivered together with a variety of other pharma- ceutically acceptable agents, as appropriate in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.

[0181] The amount of therapeutic rAAV particles or preparations and / or therapeutic rAAV vector compositions, as well as the time of administration of such compositions, will be within the knowledge of a person skilled in the art who has the benefit of the teachings of the present invention.However, it is possible that administration of a therapeutically effective amount of the compositions of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.In some situations, it may be desirable to provide multiple or continuous administrations of rAAV particles or preparations and / or rAAV vector compositions, either over a relatively short period of time or over a relatively long period of time, which can be determined by the physician supervising the administration of such compositions.

[0182] The toxicity and efficacy of the compositions utilized in the methods of the present disclosure may be determined by standard pharmaceutical procedures, using either cultured cells or experimental animals to determine LD50 (the dose lethal to 50% of the population). The dose ratio between toxicity and efficacy is the therapeutic index, which may be expressed by the ratio LD50 / ED50. Compositions that exhibit large therapeutic indices are preferred. Compositions that exhibit toxic side effects may be used, while care should be taken to design a delivery system that minimizes the potential damage of such side effects. The dosage of the compositions as described herein is generally within a range that includes the ED50, with little or no toxicity. Dosage may vary within this range, depending on the dosage form used and the route of administration utilized.

[0183] Other aspects of the present disclosure relate to methods and preparations for use with subjects, such as human or non-human subjects, host cells in situ in a subject, or host cells derived from a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is a companion animal. "Companion animal" as used herein refers to pets and other domestic animals. Non-limiting examples of companion animals include dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters. In some embodiments, the subject is a human subject.

[0184] In some embodiments, one or more pharma- ceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition that includes a therapeutic agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, such as a human.

[0185] A pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of a therapeutic agent and optionally one or more pharma- ceutically acceptable excipients. A pharma-ceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic product) that is intentionally included in a drug delivery system. The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. The excipient may act to a) aid in the processing of the drug delivery system during manufacture, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) aid in product identification, and / or d) enhance any other attribute of the overall safety, efficacy, delivery of the API during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.

[0186] Excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents.

[0187] The pharmaceutical composition may contain other additional components that are typically included in pharmaceutical compositions. Such additional components may include, but are not limited to, antipruritic agents, astringents, local anesthetics, anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).

[0188] The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof, but is not limited thereto. The carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. The carrier may also contain isotonic agents such as sugars, polyalcohols, sodium chloride, etc. in the composition.

[0189] Pharmaceutically acceptable refers to properties and / or substances that are acceptable to subjects from a pharmacological / toxicological point of view.The phrase "pharmacologically acceptable" refers to molecular entities, compositions, and properties that can be physiologically tolerated and do not typically cause allergic or other adverse or toxic reactions when administered to a subject.In some embodiments, pharmaceutically acceptable compounds are approved by federal or state government regulatory agencies or listed in the United States Pharmacopeia or other commonly recognized pharmacopoeias for use in animals and more specifically in humans.

[0190] The rAAV or pharmaceutical composition as described herein may be formulated for administration to a host cell ex vivo or in situ in an animal, particularly a human. The rAAV or pharmaceutical composition may be administered by various routes. Routes of administration include, but are not limited to, intravenous, intraarterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and / or localized delivery to a target tissue. In some embodiments, multiple injections, or other types of administration, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more injections, are provided. Routes of administration may be combined, if desired. Depending on the embodiment, the first and second rAAV do not have to be administered the same number of times (e.g., the first rAAV may be administered once and the second vector may be administered three times). In some embodiments, administration is intramuscular administration.

[0191] In some embodiments, the number of rAAV particles administered to a subject is about 10 6 ~about 10 14 particles / mL or approximately 10 3 ~about 10 13 An order of magnitude range of particles / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the number of rAAV particles administered to a subject may be about 10 6 ~about 10 14 Vector genomes (vgs) / mL or 10 3 ~10 15 An order of magnitude range of vgs / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 1014 vgs / mL, etc. The rAAV particles can be administered as a single dose, or can be divided into two or more administrations, as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, a dose ranging from about 0.0001 mL to about 10 mL is delivered to the subject.

[0192] For administration of injectable aqueous solutions, for example, the solution may be suitably buffered, if necessary, and the liquid diluent may first be made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous media that can be used will be known to those skilled in the art in view of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of subcutaneous infusion or injected at the proposed site of injection (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035-1038 and 1570-1580). In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, monobasic buffer (e.g., monobasic sodium phosphate buffer), dibasic salt (e.g., dibasic sodium phosphate), sodium-based tonicity agent (e.g., sodium chloride tonicity agent), non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent), surfactant (e.g., poloxamer 188 surfactant), and water. In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, sodium phosphate monobasic buffer, dibasic sodium phosphate, sodium chloride tonicity agent, magnesium chloride hexahydrate tonicity agent, poloxamer 188 surfactant, and water. In some embodiments, the active rAAV components are present in the formulation according to the amount of vector genome provided herein. In some embodiments, the monobasic buffer (e.g., sodium phosphate monobasic buffer) is present in the formulation at a concentration of about 0.2 mg / mL to about 0.5 mg / mL. In some embodiments, the dibasic salt (e.g., sodium phosphate dibasic) is present in the formulation at a concentration of about 1.5 mg / mL to about 4 mg / mL. In some embodiments, the sodium-based tonicity agent (e.g., sodium chloride tonicity agent) is present in the formulation at a concentration of about 8 mg / mL to about 12 mg / mL.In some embodiments, the non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent) is present in the formulation at a concentration of about 0.1 mg / mL to about 0.35 mg / mL. In some embodiments, the surfactant (e.g., poloxamer 188 surfactant) is present in the formulation at a concentration of about 0.05 mg / mL to about 0.8 mg / mL. In some embodiments, water is present to bring the volume of the formulation (e.g., dosage unit) to 1 mL.

[0193] Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will in any event determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required, for example, by the FDA Office of Biologics standards.

[0194] Sterile injectable solutions are prepared by incorporating rAAV particles or preparations in the required amount in a suitable solvent with some of the other ingredients listed above as necessary, and then sterilizing by filtration.In general, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other ingredients from those listed above.In the case of sterile powders for preparing sterile injectable solutions, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powders of active ingredients plus any additional desired ingredients from their previously sterile-filtered solutions.

[0195] The amount of rAAV particles or preparations and the time of administration of such particles or preparations will be within the knowledge of a person skilled in the art who has the benefit of the teachings of the present invention.However, it is possible that administration of a therapeutically effective amount of the rAAV particles or preparations of the present disclosure may be achieved by a single administration, for example, a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to a patient undergoing such treatment.Alternatively, in some situations, it may be desirable to provide multiple or successive administrations of rAAV particles or preparations over either a relatively short or relatively long period of time, as can be determined by the physician supervising the administration of such compositions.

[0196] If desired, the rAAV particles can be administered in combination with other agents, such as proteins or polypeptides or various pharmacologic active agents, including administration of one or more therapeutic polypeptides, biologically active fragments or variants thereof. In fact, there is virtually no limit to the other components that can be included, so long as the additional agent does not cause significant adverse effects when contacted with target cells or host tissues. The rAAV particles or preparations can thus be delivered together with various other pharmacologic acceptable agents, as required in a particular case. Such compositions can be purified from host cells or other biological sources, or alternatively, can be chemically synthesized as described herein.

[0197] In some embodiments, treatment of a subject with rAAV particles as described herein achieves one, two, three, four or more of the following effects, including, for example: (i) reduction or amelioration of the severity of a disease or a symptom associated therewith; (ii) shortening the duration of a symptom associated with a disease; (iii) protection against progression of a disease or a symptom associated therewith; (iv) regression of a disease or a symptom associated therewith; (v) protection against the onset or onset of a symptom associated with a disease; (vi) protection against recurrence of a symptom associated with a disease; (vii) reduction in hospitalization of a subject; (viii) shortening the length of hospitalization; (ix) increasing the survival rate of a subject with a disease; (x) reducing the number of symptoms associated with a disease; (xi) enhancing, improving, supplementing, complementing, or enhancing the prophylactic or therapeutic effect(s) of another treatment. In some embodiments, the disease or condition is caused by hypertrophic cardiomyopathy or dilated cardiomyopathy. In some embodiments, the disease or condition is dilated cardiomyopathy. In some embodiments, the disease or condition is idiopathic dilated cardiomyopathy.

[0198] In view of the teachings herein, it will be clear to those skilled in the art that the effective amount of viral vector to be added can be empirically determined. Administration can be administered in a single dose, multiple doses, continuously or intermittently throughout the course of treatment. Methods for determining the most effective administration means and dosages are well known to those skilled in the art and will vary depending on the viral vector, the composition of the treatment, the target cells, and the subject being treated. Single and multiple administrations can be administered, with the level and pattern of administration being selected by the treating physician.

[0199] kit Described herein is a composition comprising one or more of the disclosed rAAV vectors, which is included in a kit for diagnosing, preventing, treating or ameliorating one or more symptoms of heart disease or condition, such as cardiomyopathy.Such kits may be useful in diagnosing, preventing, and / or treating human disease, and may be particularly useful in treating, preventing, and / or ameliorating one or more symptoms of heart disease, such as cardiomyopathy.In some embodiments, the heart disease is caused by cardiomyopathy.In some embodiments, the heart disease is caused by hypertrophic cardiomyopathy or dilated cardiomyopathy.In some embodiments, the heart disease is dilated cardiomyopathy.

[0200] Also provided in some embodiments are kits comprising one or more of the disclosed rAAV vectors (as well as one or more virions, viral particles, transformed host cells, or pharmaceutical compositions comprising such vectors); and instructions for using such kits in one or more therapeutic, diagnostic, and / or prophylactic clinical embodiments. Such kits may include one or more reagents, restriction enzymes, peptides, therapeutic agents, pharmaceutical compounds, or a means for delivery of the composition(s) to a host cell or to an animal (e.g., a syringe, injection, etc.). Depending on the embodiment, the kits may include those for treating, preventing, or ameliorating symptoms of a disease, deficiency, dysfunction, and / or injury, or may include components for large-scale production of the viral vectors themselves.

[0201] In some embodiments, the kit includes one or more containers or receptacles containing one or more doses of any of the described therapeutic agents. Such kits may be therapeutic in nature. In some embodiments, the kit contains a unit dosage, which means, for example, a predetermined amount of a composition including a described therapeutic agent, with or without one or more additional agents.

[0202] One or more components of the kit can be provided in one or more liquid or frozen solvents. The solvent can be aqueous or non-aqueous. The formulations in the kit can also be provided as dry powder(s) or in lyophilized form that can be reconstituted by adding a suitable solvent.

[0203] In some embodiments, the kit includes a label, marker, package insert, bar code, and / or reader indicating the proper use of the contents of the kit. In some embodiments, the kit may include a label, marker, package insert, bar code, and / or reader indicating that the contents of the kit can be administered according to a particular dosage or administration regimen to treat a subject.

[0204] In addition, the kit may also include various reagents, including, but not limited to, washing reagents, elution reagents, and concentration reagents. Such reagents may be readily selected from among those described herein and from among conventional concentration reagents.

[0205] As used herein, the term "kit" may be used to describe a portable, self-contained, enclosed variation that includes at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present invention.

[0206] Combination therapy Aspects of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is encompassed within the scope of the present disclosure.

[0207] The compositions of the present disclosure may include rAAV particles or preparations and / or rAAV vectors, either alone or in combination with one or more additional therapeutic agents, which may be obtained from natural or recombinant sources or chemically synthesized. In some embodiments, the rAAV particles or preparations are administered in combination with therapeutic agents, including proteasome inhibitors such as bortezomib or hydroxyurea, in the same composition or as part of the same treatment regimen.

[0208] If desired, the rAAV particles may be administered in combination with other agents, such as proteins or polypeptides or various pharmacoactive agents. In some embodiments, this may reflect, for example, one or more administrations of a therapeutic polypeptide (e.g., a recombinant form of a functional peptide or protein that serves to replace or supplement the rAAV-based production of a protein encoded by a transgene), biologically active fragments or variants thereof. The rAAV particles or preparations may thus be delivered together with a variety of other pharmacologic acceptable agents, as required in a particular case. Such compositions may be purified from host cells or other biological sources, or alternatively may be chemically synthesized as described herein.

[0209] The amount of the composition containing the disclosed rAAV particles and additional therapeutic agent, and the time of administration of such composition will be within the knowledge of a person skilled in the art who has the benefit of the present teachings.However, it is possible that administration of a therapeutically effective amount of the disclosed composition may be achieved by simultaneous administration or separate administration.The disclosed rAAV particles and / or rAAV vectors may be delivered before, after, or simultaneously with any of the disclosed additional therapeutic agents.In some embodiments, the rAAV particles are delivered before the additional therapeutic agent.In some embodiments, the rAAV particles are delivered after the additional therapeutic agent.

[0210] In some embodiments, the additional therapeutic agent comprises an anti-inflammatory agent. The anti-inflammatory agent can be, but is not limited to, a corticosteroid, cortisone, hydrocortisone, hydrocortisone-21-monoesters (e.g., hydrocortisone-21-acetate, hydrocortisone-21-butyrate, hydrocortisone-21-propionate, hydrocortisone-21-parate, etc.), hydrocortisone-17,21-diesters (e.g., hydrocortisone-17,21-di ... betamethasone (typically as betamethasone benzoate or betamethasone dipropionate); fluocinonide; prednisolone; and triamcinolone (typically as triamcinolone acetonide). In some embodiments, the anti-inflammatory agent includes, but is not limited to, cromolyn (5,5'-(2-hydroxypropane-1,3-diyl)bis(oxy)bis(4-oxo-4H-chromene-2-carboxylic acid) (also known as cromoglycate), and 2-carboxylatochromone-5'-yl-2-hydroxypropane derivatives such as bis(acetoxymethyl), cromoglycate disodium, nedocromil (9-ethyl-4,6-dioxo-10-propyl-6,9-dihydro-4H-pyrano[3,2-g]quinoline-2,8-dicarboxylic acid), and tranilast (2-{[(2E)-3-(3,4-dimethoxyphenyl)prop-2 In some embodiments, the anti-inflammatory agent is a mast cell degranulation inhibitor such as, without limitation, aspirin compounds (acetylsalicylate), non-aspirin salicylates, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamic acid, naproxen, naproxen sodium, phenylbutazone, sulindac, and tometin.

[0211] In some embodiments, the anti-inflammatory agent comprises an antihistamine. The antihistamine may be, but is not limited to, clemastine, clemastine fumarate (2(R)-[2-[1-(4-chlorophenyl)-1-phenylethoxy]ethyl-1-methylpyrrolidine), dexmedetomidine, doxylamine, loratidine, desloratidine and promethazine, and diphenhydramine, or a pharmaceutically acceptable salt, solvate or ester thereof. In some embodiments, the antihistamine includes, but is not limited to, azatadine, azelastine, bruflorine, cetirizine, cyproheptadine, doxantrozole, etodroxydine, forskolin, hydroxyzine, ketotifen, oxatomide, pizotifen, proxicromil, N,N'-substituted piperazine or terfenadine. In some embodiments, the antihistamine is an H1 antagonist, such as, but not limited to, cetirizine, chlorpheniramine, dimenhydrinate, diphenhydramine, fexofenadine, hydroxyzine, orphenadrine, pheniramine, and doxylamine.In some embodiments, the antihistamine is an H2 antagonist, such as, but not limited to, cimetidine, famotidine, lafutidine, nizatidine, ranitidine, and roxatidine.

[0212] In some embodiments, the additional therapeutic agent comprises an antiviral agent, including an antiretroviral agent. Suitable antiviral agents include, but are not limited to, remdesivir, acyclovir, famciclovir, ganciclovir, foscarnet, idoxuridine, sorivudine, trifluorothymidine, valacyclovir, vidarabine, didanosine, dideoxyinosine, stavudine, zalcitabine, zidovudine, amantadine, interferon alpha, ribavirin, and rimantadine.

[0213] In some embodiments, the additional therapeutic agent comprises an antibiotic.Non-limiting examples of suitable antibiotics include beta-lactams such as penicillins, aminopenicillins (e.g., amoxicillin, ampicillin, hetacillin, etc.), penicillinase-resistant antibiotics (e.g., cloxacillin, dicloxacillin, methicillin, nafcillin, oxacillin, etc.), broad-spectrum antibiotics (e.g., axocillin, carbenicillin, mezlocillin, piperacillin, ticarcillin, etc.); cephalosporins (e.g., cefadroxil, cefazolin, cephalixin, cephalothin, cephapirin, cephradine, cefaclor, cefaclor, cefaclovir ... cefacmandole, cefmetazole, cefonicid, ceforanide, cefotetan, cefoxitin, cefprozil, cefuroxime, loracarbef, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftiofur, ceftizoxime, ceftriaxone, moxalactam, etc.; monobactams such as aztreonam; carbapenems such as imipenem and elopenem; quinolones (e.g., ciprofloxacin, enrofloxacin, difloxacin, orbifloxacin, marbofloxacin, etc.) ;Chloramphenicol (e.g., chloramphenicol, thiamphenicol, florfenicol, etc.);Tetracyclines (e.g., chlortetracycline, tetracycline, oxytetracycline, doxycycline, minocycline, etc.);Macrolides (e.g., erythromycin, tylosin, trimycosin, clarithromycin, azithromycin, etc.);Lincosamides (e.g., lincomycin, clindamycin, etc.);Aminoglycosides (e.g., gentamicin, amikacin, kanamycin, apramycin, tobramycin, etc.) sulfonamides (e.g., sulfadomethoxine, sulfamethazine, sulfaquinoxaline, sulfamerazine, sulfathiazole, sulfasalazine, sulfadiazine, sulfabromomethazine, sulfurethoxypyridazine, etc.); glycopeptides (e.g., vancomycin, teicoplanin, ramoplanin, and decaplanin; and other antibiotics (e.g., rifampin, nitrofuran, virginiamycin, polymyxin, tobramycin, etc.).

[0214] In some embodiments, the additional therapeutic agent includes, but is not limited to, antifungal agents, such as itraconazole, ketoconazole, fluoconazole, and amphotericin B. In some embodiments, the therapeutic agent is an antiparasitic agent, such as, but not limited to, the broad-spectrum antiparasitic agent nitazoxanide; antimalarials and other antiprotozoal agents (e.g., artemisin, mefloquine, lumefantrine, tinidazole, and miltefosine); anthelmintics, such as mebendazole, thiabendazole, and ivermectin; and antiamoebic agents, such as rifampin and amphotericin B.

[0215] In some embodiments, the additional therapeutic agents include analgesics, including, without limitation, opioid analgesics such as alfentanil, buprenorphine, butorphanol, codeine, dihydrocodeine (drocode), fentanyl, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, sufentanil, and tramadol; and non-opioid analgesics such as apazone, etodolac, difenpyramide, indomethacin, meclofenamate, mefenamic acid, oxaprozin, phenylbutazone, piroxicam, and tolmetin.

[0216] Any particular feature, aspect, method, property, characteristic, quality, attribute, element, etc. disclosed herein in relation to an embodiment can be used in all other embodiments described herein. It should therefore be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another to form various modes of the disclosed invention. Thus, it is intended that the scope of the invention disclosed herein should not be limited by the particular disclosed embodiments described above. Moreover, the invention is susceptible to various modifications and alternative forms, specific examples of which are shown in the drawings and described in detail herein. However, the invention is not limited to the particular forms or methods disclosed, but on the contrary, it should be understood that the invention covers all modifications, equivalents, and alternatives falling within the spirit and scope of the various embodiments described and the appended claims. Any method disclosed herein need not be performed in the order described. The methods disclosed herein include specific actions performed by the practitioner; however, they may also include, either explicitly or implicitly, instructions for those actions by a third party. Furthermore, when features or aspects of the disclosure are described in terms of a Markush group, those skilled in the art will recognize that the disclosure also can be described in terms of any individual members or subgroups of members of that Markush group.

[0217] Any headings or sub-headings used herein are for organizational purposes only and should not be used to limit the scope of the aspects disclosed herein.

[0218] example The following examples are illustrative only and are not intended to limit the scope of the invention.

[0219] material and method

[0220] Construct design.

[0221] The RBM20 cDNA was codon optimized for expression in human tissues and subcloned into a plasmid backbone suitable for production of AAV. The construct was engineered to contain elements as provided in Tables 1 and 2 below. Schematic diagrams of the construct are provided in Figures 1 and 2. The chimeric intron sequence carries a unique FseI restriction site, which is used to subclone a knockdown cassette (e.g., an shRNA expression cassette) into the construct if it is desired to reduce or eliminate expression of mutant RBM20. Table 5. Construct 1 (pTR-TNNT2-RBM20; Figure 1) [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] Table 6. Construct 2 (ppTR2-MHCK9-RBM20; Figure 2) [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6]

[0222] AAV production. Recombinant AAV (rAAV) particles containing each of the constructs are made by suspension transfection of Expi293F cells with the pTR2-TNNT2-RBM20 construct, and other plasmids required for rAAV production (e.g., containing the rep and cap expression cassettes), generating three groups of rAAVs including: (1) AAV9 capsid protein, (2) rh74 capsid protein, and (3) rh74 variant capsid protein containing a tryptophan to arginine mutation at amino acid 505 of the rh74 VP1 capsid protein. Vectors are isolated using a capture column, followed by an anion exchange column, and purified using a cesium chloride gradient to a titer of 2E+13 to 5E+13 vg / ml.

[0223] Example 1. In vitro expression studies

[0224] rAAV particles containing RBM20 constructs will be generated as described above and delivered to HEK293 cells, C2C12 myoblasts, or cardiomyocytes derived from human induced pluripotent stem cells. Whole cell lysates will be generated and probed for RBM20 expression by ELISA and / or immunoblotting.

[0225] Example 2. In vivo expression studies

[0226] rAAV containing the RBM20 construct will be generated as described above and administered to newborn C57BL / 6 mice (n=6-10 / group) via the facial vein at 5E+13 vector genomes per kg of subject (vg / kg). Two to four weeks after rAAV administration, cardiac, diaphragm, and skeletal muscle tissues from mouse subjects will be harvested and whole cell lysates will be analyzed for RBM20 expression using ELISA and / or immunoblotting.

[0227] rAAV containing RBM20 constructs are generated as described above and administered via the jugular vein to 5-7 week old C57BL / 6 mice (n=6-10 / group) at three different doses: 1E+13vg / kg, 5E+13vg / kg, or 1+E14vg / kg. One month after rAAV administration, heart, diaphragm, and skeletal muscle tissues are harvested and whole cell lysates are analyzed for RBM20 expression using ELISA and / or immunoblotting.

[0228] Example 3. Restoration of RBM20 expression in vivo

[0229] Mutations in RBM20, which encodes RNA-binding motif protein 20 (RBM20), are known to cause DCM. RBM20 is the master regulator of cardiac-specific alternative splicing of the TTN gene, which is found to be most frequently mutated in idiopathic DCM patients (approximately 20-25%). The TTN gene has the largest number of exons (364 in humans), and titin, the sarcomeric protein encoded by the TTN gene, is the largest known protein in mammals. In RBM20 mutant rat lines that lack nearly all of the RBM20 exons, the shortest cardiac titin isoform, N2B, is not expressed. Thus, RBM20 is a key regulator of TTN pre-mRNA processing in the heart, causing the DCM phenotype through altered splicing of genes regulated by RBM20. Missense mutations in the highly conserved RS-SRSP stretch, within the arginine / serine (RS)-rich region, but not in the RNA-binding domain, are the most frequent disease alleles.

[0230] RBM20 S637A / S637A and RBM20 KO / KO mice lack RBM20-dependent alternative splicing and are suitable for testing gain of function of rAAV-RMB20.

[0231] RBM20 S637A The knock-in mouse model carries a mouse mutation orthologous to the human S637A mutation. The disease phenotype can be mimicked by overexpression of the S637A allele via vector-based transgenic or homozygous knock-in mouse models.

[0232] rAAV containing RBM20 constructs are produced as described above and delivered to pre-symptomatic and / or symptomatic RBM20 mutant mice via a single IV injection using various doses. Exemplary doses include 1E+13vg / kg, 5E+13vg / kg, and 1+E14vg / kg. Endpoints include survival and cardiac function monitored by echocardiography. Upon necropsy, cardiac tissue is harvested and whole tissue lysates are analyzed for AAV biodistribution by digital droplet PCR (ddPCR) and for human RBM20 expression by ELISA and / or immunoblot. In addition, tissue sections are analyzed for histopathology. The therapeutic efficacy of rAAV is evaluated via measured endpoints and / or histopathological evaluation.

[0233] Non-limiting aspects The following numbered embodiments represent non-limiting aspects of the invention. 1. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, and wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 2. The nucleic acid of embodiment 1, wherein the human RBM20 coding sequence is codon-optimized for expression in a human cell. 3. The nucleic acid of embodiment 1 or 2, wherein the human RBM20 coding sequence comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO:5, optionally wherein the human RBM20 coding sequence comprises the sequence of SEQ ID NO:5. 4. The nucleic acid of any one of aspects 1 to 3, wherein the promoter comprises a cardiac-specific promoter. 5. The nucleic acid of embodiment 4, wherein the promoter is selected from the group consisting of TNNT2, MHCK9, and combinations thereof. 6. The nucleic acid of embodiment 4 or 5, wherein the promoter comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO: 2 or 16. 7. The nucleic acid according to any one of aspects 4 to 6, wherein the promoter comprises a nucleic acid sequence comprising the sequence of SEQ ID NO: 2 or 16. 8. The nucleic acid according to any one of aspects 1 to 7, wherein the expression cassette has at least about 85% sequence identity to the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in a sequential manner. 9. The nucleic acid according to aspect 8, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence. 10. The nucleic acid according to any one of aspects 1 to 9, which is a recombinant adeno-associated virus (rAAV) vector. 11. The nucleic acid of claim 10 which is a single-stranded nucleic acid vector. 12. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to any one of aspects 1 to 11. 13. The rAAV particle of embodiment 12, which is an AAV9 particle. 14. The rAAV particle of embodiment 12, which is an AAVrh74 particle. 15. The rAAV particle of embodiment 12, which is an AAVrh10 particle. 16. A composition comprising a plurality of rAAV particles according to any one of aspects 12 to 15. 17. The composition according to embodiment 16, further comprising a pharma- ceutically acceptable carrier. 18. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of a rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence and a silencing element; wherein the coding sequence and silencing element are operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in expression of a therapeutically effective amount of human TBM20, thereby treating dilated cardiomyopathy. The method comprising: 19. The method of embodiment 18, wherein the rAAV is administered via intravenous injection. 20. Approximately 1×10 13 ~Approx. 1×10 14 The method of embodiment 18, wherein one or more rAAV vector genomes are administered. 21. A method for increasing expression of human RBM20 in a target cell, comprising: contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said contacting results in increased expression of functional human RBM20 in the target cell compared to before the contacting, thereby increasing expression of functional human RBM20. The method comprising: 22. The method of embodiment 12, wherein the contacting is in vivo. 23. The method according to embodiment 21 or 22, for the treatment of dilated cardiomyopathy. 24. Use of a nucleic acid according to any one of aspects 1 to 11, an rAAV particle according to any one of aspects 12 to 15, or a composition according to aspect 16 or 17 in the manufacture of a medicament for the treatment of dilated cardiomyopathy. 25. Use of a nucleic acid according to any one of aspects 1 to 11, an rAAV particle according to any one of aspects 12 to 15, or a composition according to aspect 16 or 17 for the treatment of dilated cardiomyopathy. 26. The nucleic acid according to any one of aspects 1 to 11, wherein the silencing element encodes an shRNA sequence. 27. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 28. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the administering step results in expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy; The method comprising: 29. The method of embodiment 28, further comprising administering a therapeutically effective amount of a silencing construct. 30. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the administering step results in expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy; The method comprising: 31. The method of embodiment 30, further comprising administering a therapeutically effective amount of a silencing construct. 32. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, and wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences. 33. The nucleic acid of aspect 32, wherein the human RBM20 coding sequence is codon-optimized for expression in a human cell. 34. The nucleic acid of embodiment 32 or embodiment 33, wherein the human RBM20 coding sequence comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO:5. 35. The nucleic acid according to any one of aspects 32 to 34, wherein the promoter comprises a cardiac-specific promoter. 36. The nucleic acid of embodiment 35, wherein the promoter is selected from the group consisting of TNNT2, MHCK9, and combinations thereof. 37. The nucleic acid of embodiment 35 or 36, wherein the promoter comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO: 2 or 16. 38. The nucleic acid according to any one of aspects 32 to 37, wherein the expression cassette has at least about 85% sequence identity to the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence. 39. The nucleic acid according to aspect 38, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence. 40. The nucleic acid according to any one of aspects 32 to 39, which is a recombinant adeno-associated virus (rAAV) vector. 41. The nucleic acid according to aspect 40, which is a single-stranded nucleic acid vector. 42. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to embodiment 40 or embodiment 41. 43. The rAAV particle of embodiment 42, which is an AAV9 particle. 44. The rAAV particle of embodiment 42, which is an AAVrh74 particle. 45. The rAAV particle of embodiment 42, which is an AAVrh10 particle. 46. ​​A composition comprising a plurality of rAAV particles according to embodiment 10, wherein the rAAV is selected from one or more of AAV9 particles, AAVrh74 particles, and AAVrh10 particles. 47. The composition according to aspect 46, further comprising a pharma- ceutically acceptable carrier. 48. A method for inducing increased expression of human RBM20 in a target cell, comprising: contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting results in increased expression of functional human RBM20 in the target cell compared to before the contacting, thereby increasing the expression of functional human RBM20. The method comprising: 49. The method of embodiment 48, wherein the contacting is in vivo. 50. The method according to embodiment 48 or 49, for the treatment of dilated cardiomyopathy. 51. Use of a nucleic acid according to any one of aspects 32 to 41, an rAAV particle according to any one of aspects 42 to 45, or a composition according to aspect 46 or 47 in the manufacture of a medicament for the treatment of dilated cardiomyopathy. 52. Use of a nucleic acid according to any one of aspects 32 to 41, an rAAV particle according to any one of aspects 42 to 45, or a composition according to aspect 46 or 47 for the treatment of dilated cardiomyopathy. 53. The nucleic acid according to any one of aspects 32 to 41, wherein the silencing element encodes an shRNA sequence. 54. A nucleic acid comprising an expression construct comprising a human RBM20 coding sequence; a cardiac enhancer element operably linked to a promoter; and a Kozak sequence, wherein the Kozak sequence enhances expression of a transgene in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the Kozak sequence is non-native to the human RBM20 coding sequence, the cardiac enhancer element, and / or the promoter. 55. The nucleic acid according to embodiment 54, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO: 47. 56. The nucleic acid according to embodiment 54, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO: 36.

Claims

1. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, and wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences.

2. The nucleic acid of claim 1 , wherein the human RBM20 coding sequence is codon-optimized for expression in a human cell.

3. The nucleic acid of claim 1, wherein the human RBM20 coding sequence has a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO:

5.

4. The nucleic acid of claim 1 , wherein the promoter comprises a cardiac-specific promoter.

5. 5. The nucleic acid of claim 4, wherein the promoter is selected from the group consisting of TNNT2, MHCK9, and combinations thereof.

6. The nucleic acid of claim 4, wherein the promoter comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO: 2 or 16.

7. The nucleic acid of claim 4, wherein the promoter comprises a nucleic acid sequence comprising the sequence of SEQ ID NO: 2 or 16.

8. 2. The nucleic acid of claim 1, wherein the expression cassette has at least about 85% sequence identity to the sequences of SEQ ID NOs: 1-7 or SEQ ID NOs: 13-21 arranged in sequence.

9. The nucleic acid of claim 8, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence.

10. The nucleic acid of claim 1, which is a recombinant adeno-associated virus (rAAV) vector.

11. The nucleic acid of claim 10 which is a single-stranded nucleic acid vector.

12. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to any one of claims 1 to 11.

13. The rAAV particle of claim 12, which is an AAV9 particle.

14. The rAAV particle of claim 12, which is an AAVrh74 particle.

15. The rAAV particle of claim 12, which is an AAVrhlO particle.

16. A composition comprising a plurality of rAAV particles according to any one of claims 12 to 15.

17. 17. The composition of claim 16, further comprising a pharma- ceutically acceptable carrier.

18. 1. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter, a silencing element; wherein the coding sequence and silencing element are operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said administration results in expression of a therapeutically effective amount of human TBM20, thereby treating dilated cardiomyopathy. The method comprising:

19. 20. The method of claim 18, wherein the rAAV is administered via intravenous injection.

20. Approximately 1×10 １３ ~Approx. 1×10 １４ 20. The method of claim 18, wherein one or more rAAV vector genomes are administered.

21. 1. A method for inducing increased expression of human RBM20 in a target cell, comprising: contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting step results in increased expression of the functional human RBM20 in the target cell compared to before the contacting, thereby increasing the expression of the functional human RBM20. The method comprising:

22. The method of claim 21 , wherein the contacting is in vivo.

23. 23. The method according to claim 21 or 22 for the treatment of dilated cardiomyopathy.

24. Use of a nucleic acid according to any one of claims 1 to 11, an rAAV particle according to any one of claims 12 to 14, or a composition according to claim 16 or 17 in the manufacture of a medicament for the treatment of dilated cardiomyopathy.

25. Use of a nucleic acid according to any one of claims 1 to 11, an rAAV particle according to any one of claims 12 to 15, or a composition according to claim 16 or 17 for the treatment of dilated cardiomyopathy.

26. A nucleic acid according to any one of claims 1 to 11, wherein the silencing element encodes an shRNA sequence.

27. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences.

28. 1. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the administering step results in expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy; The method comprising:

29. The method of claim 28, further comprising administering a therapeutically effective amount of a silencing construct.

30. 1. A method for treating dilated cardiomyopathy, comprising: administering a therapeutically effective amount of an rAAV comprising a nucleic acid expression construct comprising a human RBM20 coding sequence operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the administering step results in expression of a therapeutically effective amount of human RBM20, thereby treating dilated cardiomyopathy; The method comprising:

31. The method of claim 30, further comprising administering a therapeutically effective amount of a silencing construct.

32. A nucleic acid comprising an expression cassette comprising a human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, and wherein the expression cassette is flanked on both sides by inverted terminal repeat sequences.

33. 33. The nucleic acid of claim 32, wherein the human RBM20 coding sequence is codon-optimized for expression in a human cell.

34. 34. The nucleic acid of claim 32 or 33, wherein the human RBM20 coding sequence comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO:

5.

35. The nucleic acid of any one of claims 32 to 34, wherein the promoter comprises a cardiac-specific promoter.

36. 36. The nucleic acid of claim 35, wherein the promoter is selected from the group consisting of TNNT2, MHCK9, and combinations thereof.

37. 37. The nucleic acid of claim 35 or 36, wherein the promoter comprises a nucleic acid sequence having at least about 85% sequence identity to the sequence of SEQ ID NO: 2 or 16.

38. 38. The nucleic acid of any one of claims 32 to 37, wherein the expression cassette has at least about 85% sequence identity to the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence.

39. The nucleic acid of claim 38, wherein the expression cassette comprises the sequences of SEQ ID NOs: 1 to 7 or SEQ ID NOs: 13 to 21 arranged in sequence.

40. 40. The nucleic acid of any one of claims 32 to 39, which is a recombinant adeno-associated virus (rAAV) vector.

41. 41. The nucleic acid of claim 40 which is a single stranded nucleic acid vector.

42. 42. A recombinant adeno-associated virus (rAAV) particle comprising a nucleic acid according to claim 40 or 41.

43. The rAAV particle of claim 42, which is an AAV9 particle.

44. The rAAV particle of claim 42, which is an AAVrh74 particle.

45. The rAAV particle of claim 42, which is an AAVrhlO particle.

46. 11. A composition comprising a plurality of rAAV particles according to claim 10, wherein the rAAV is selected from one or more of AAV9 particles, AAVrh74 particles, and AAVrhlO particles.

47. 47. The composition of claim 46, further comprising a pharma- ceutically acceptable carrier.

48. 1. A method for inducing increased expression of human RBM20 in a target cell, comprising: contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression cassette comprising a functional human RBM20 coding sequence, a silencing element, wherein the coding sequence and the silencing element are each operably linked to a promoter and optionally an enhancer element, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein said contacting step results in increased expression of functional human RBM20 in the target cell compared to before the contacting, thereby increasing expression of functional human RBM20. The method comprising:

49. 49. The method of claim 48, wherein the contacting is in vivo.

50. 50. The method of claim 48 or 49 for the treatment of dilated cardiomyopathy.

51. 20. Use of a nucleic acid according to any one of claims 32 to 41, an rAAV particle according to any one of claims 42 to 45, or a composition according to claim 46 or 47 in the manufacture of a medicament for the treatment of dilated cardiomyopathy.

52. Use of a nucleic acid according to any one of claims 32 to 41, an rAAV particle according to any one of claims 42 to 45, or a composition according to claim 46 or 47 for the treatment of dilated cardiomyopathy.

53. A nucleic acid according to any one of claims 32 to 41, wherein the silencing element encodes an shRNA sequence.

54. A nucleic acid comprising an expression construct comprising a human RBM20 coding sequence; a cardiac enhancer element operably linked to a promoter; and a Kozak sequence, wherein the Kozak sequence enhances transgene expression in the heart, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and wherein the Kozak sequence is non-native with respect to the human RBM20 coding sequence, the cardiac enhancer element, and / or the promoter.

55. 55. The nucleic acid of claim 54, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO:

47.

56. 55. The nucleic acid of claim 54, wherein the Kozak sequence is a synthetic sequence and has at least 85% sequence identity to the sequence of SEQ ID NO:36.

Images