Methods for Treating Glaucoma

Abstract

The present disclosure generally relates to methods for treating, preventing, and / or slowing the progression of glaucoma in a subject, the methods comprising administering an antisense oligonucleotide that modulates mRNA productive transcription, stability, and / or translation of an OPA1 gene transcript or a portion thereof.

Description

[Technical field]

[0001] Related Application Data This application claims priority to Australian Patent Application No. 2022900727, entitled "METHOD OF TREATING GLAUCOMA", filed on March 23, 2022, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application is being filed with a Sequence Listing in electronic format, the entire contents of which are incorporated herein by reference.

[0003] Technical Field The present disclosure generally relates to methods for treating, preventing, and / or slowing the progression of glaucoma in a subject, the methods comprising administering an antisense oligonucleotide that modulates mRNA translation, stability, and productive transcription of an OPA1 gene transcript or a portion thereof. [Background technology]

[0004] Glaucoma is a progressive optic neuropathy and a leading cause of blindness, characterized by the damage or degeneration of retinal ganglion cells (RGCs), which transmit visual information to the brain. Currently, approximately 80 million people worldwide suffer from glaucoma, and this number is expected to increase to more than 120 million by 2040. The prevalence of glaucoma increases with age, and this increase is largely affected in African and Asian populations.

[0005] Glaucoma can be caused when aqueous humor accumulates in the front of the eye. Overproduction or reduced drainage of aqueous humor increases intraocular pressure (IOP), which irreversibly damages the optic nerve and RGCs. Glaucoma can be classified as either primary or secondary, with secondary glaucoma resulting from another disorder or problem in the eye (e.g., injury, surgery, drugs, or other eye diseases). Primary glaucoma is classified as open-angle glaucoma (POAG), normal tension glaucoma (NTG), angle-closure glaucoma, and congenital glaucoma. Secondary glaucoma is classified as neovascular, pigmentary, exfoliation, and uveitis glaucoma. The gradual loss of RGCs is a prominent feature in all subtypes of glaucoma. Dysfunction and death of RGCs leads to impaired vision and ultimately blindness.

[0006] There are no approved treatments for glaucoma that directly target RGCs. Of the drugs (e.g., brimonidine and memantine) that have been clinically investigated for neuroprotection and reduced vision loss in POAG patients, none have conclusively proven effective so far. Instead, the only treatments available to reduce IOP levels are those that indirectly protect RGCs. Furthermore, it has been reported that in approximately one-third of glaucoma cases, characteristic optic nerve changes and visual field defects may occur in eyes with normal IOP levels. Thus, there is an urgent need to identify therapeutic strategies for RGC neuroprotection to limit the projected burden of vision impairment and blindness due to glaucoma. The use of neurotrophic factors (e.g., brain-derived, ciliary body-derived, glial cell-derived, and nerve growth factor) has been the focus of recent research, as they are known to prevent uncontrolled RGC loss and aid cell survival. However, their efficacy is limited by their relatively short half-life, poor permeability, and low concentration in the target RGCs.

[0007] Thus, there remains a need for new interventions to treat, prevent, and / or slow the progression of glaucoma.

[0008] overview In presenting the present invention, the inventors have identified optic atrophy gene 1 (OPA1) as a potential target for pharmacological intervention to treat or prevent glaucoma. The inventors have identified antisense oligonucleotides (ASOs) that increase OPA1 expression, which are useful for treating or preventing glaucoma. The inventors have identified ASOs that rely on any of a variety of mechanisms of action to upregulate OPA1 expression. For example, the ASOs identified by the inventors increase the expression of OPA1 by: - Binds to OPA1 gene pre-mRNA in cells and promotes the elimination of nonsense-mediated RNA decay (NMD) exons during splicing of OPA1 pre-mRNA, thereby increasing the levels of OPA1 mRNA transcripts encoding full-length functional OPA1 - Binding to the 5' untranslated region (UTR) of the OPA1 gene transcript in cells, enhancing the translation efficiency of OPA1 mRNA and / or the stability of the transcript • It binds to the 3'UTR of the OPA1 gene transcript in cells and increases the stability of the OPA1 mRNA transcript.

[0009] These findings further provide the basis for methods of treating, preventing, and / or slowing the progression of glaucoma.

[0010] Thus, the disclosure provides a method of treating, preventing, and / or slowing the progression of glaucoma in a subject, the method comprising administering an antisense oligonucleotide that increases functional OPA1 protein levels in the subject, e.g., the level of OPA1 protein in the subject is increased compared to the level in the subject prior to administration of OPA1.

[0011] In one example, the ASO increases the level of OPA1 mRNA and the amount of functional OPA1 protein in the cells and / or tissues of the subject. For example, the ASO increases the level of OPA1 mRNA in the cells and / or tissues of the subject. In another example, the ASO increases the amount of functional OPA1 protein in the cells and / or tissues of the subject.

[0012] In one example, the amount of functional OPA1 protein in cells and / or tissues is increased by about 1.1 to about 10-fold. For example, the amount of functional OPA1 protein in cells and / or tissues is increased by about 1.5 to about 10-fold, about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 1.1 to about 5-fold, about 1.1 to about 6-fold, about 1.1 to about 7-fold, about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, or at least about 1.1-fold. For example, the amount of functional OPA1 protein in a cell and / or tissue is increased by at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold. For example, the amount of functional OPA1 protein in a cell and / or tissue is increased compared to the level in the tissue prior to administration or contact. In one example, administering any of the ASOs or pharmaceutical compositions disclosed herein to a subject or contacting a cell increases the level of OPA1 protein by about 1.1 to about 2.5-fold compared to the level in the tissue prior to administration or contact.

[0013] In one example, the cells and / or tissues are selected from the group consisting of ocular tissue, retinal pigment epithelial (RPE) cells, Muller glial cells, endothelial cells, glial cells, astrocytes, photoreceptors, etc. For example, the cells and / or tissues are selected from the group consisting of retina, RPE cells, and combinations thereof.

[0014] In one example, the ASO: (i) bind to a target portion of the OPA1 gene pre-mRNA in cells and promote the elimination of nonsense-mediated RNA decay (NMD) exons during splicing of OPA1 pre-mRNA, thereby increasing the level of OPA1 mRNA transcripts encoding full-length functional OPA1; (ii) binds to a target portion of the 5' untranslated region (UTR) of the OPA1 gene transcript in cells, thereby enhancing the translation efficiency of OPA1 mRNA; (iii) binding to a target portion of the 5'UTR of the OPA1 gene transcript in a cell, e.g., by inhibiting the activity of a decapping enzyme, thereby increasing the stability of the transcript; and / or (iv) binding to a target portion of the 3'UTR of the OPA1 gene transcript in a cell, for example by preventing the binding of miRNA to the 3'UTR, thereby increasing the stability of the transcript.

[0015] In one example, the ASO binds to a target portion of the OPA1 pre-mRNA in a cell and promotes the exclusion of the NMD exon during splicing of the OPA1 pre-mRNA, increasing the levels of OPA1 mRNA transcripts that encode full-length, functional OPA1.

[0016] In one example, the ASO binds to a target portion of the intron 7 OPA1 pre-mRNA. An exemplary ASO binds within a target portion of the OPA1 pre-mRNA nucleotide sequence that corresponds to one or more of SEQ ID NO:1.

[0017] In one example, the ASO binds to intron 7 of the OPA1 gene pre-mRNA in a cell and increases the level of the OPA1 gene transcript encoding full-length functional OPA1 by excluding the NMD exon 7x, e.g., the ASO is close enough to the exon 7x acceptor site to promote the exclusion of exon 7x during splicing of the OPA1 mRNA.

[0018] In one example, an ASO that binds to a target portion of intron 7 OPA1 pre-mRNA comprises or consists of any one of SEQ ID NOs: 2-54.

[0019] In one example, an ASO that binds to a target portion of intron 7 OPA1 pre-mRNA comprises or consists of any one of SEQ ID NOs: 2-54 or SEQ ID NOs: 2491-2503.

[0020] In one example, an ASO that binds to a target portion of intron 7 OPA1 pre-mRNA comprises or consists of any one of SEQ ID NOs: 2491-2503.

[0021] In one example, the ASO binds to a target portion of the 5'UTR of the OPA1 gene transcript in a cell to increase the translation efficiency of OPA1 mRNA or the stability of the transcript. For example, the ASO increases the expression of the OPA1 protein. Without being bound by theory or mechanism of action, such an ASO may sterically block translation from an upstream open reading frame (uORF) start site and / or sterically block secondary structure of the 5'UTR and / or inhibit the activity of a decapping enzyme.

[0022] In one example, the ASO binds within a target portion of the 5'UTR of OPA1 mRNA, the target portion being within a nucleotide sequence corresponding to SEQ ID NO:55.

[0023] In one example, the ASO that binds to a target portion of the 5'UTR of OPA1 mRNA comprises or consists of any one of SEQ ID NOs: 56-138.

[0024] In one example, an ASO that binds to a target portion of the 5'UTR of OPA1 mRNA comprises or consists of SEQ ID NO:112.

[0025] In one example, ASO binds to the target portion of the 3'UTR of the OPA1 gene transcript in cells, and enhances the stability of the OPA1 mRNA transcript. For example, ASO increases the expression of OPA1 protein. Without being bound by theory or mechanism of action, such ASO can sterically inhibit the binding of miRNA to the 3'UTR.

[0026] In one example, the ASO binds within a target portion of the 3'UTR of OPA1 mRNA, the target portion being within a nucleotide sequence corresponding to SEQ ID NO:139.

[0027] In one example, an ASO that binds to a target portion of the 3'UTR of OPA1 mRNA comprises or consists of any one of SEQ ID NOs: 140-2488.

[0028] In one example, the nucleotide sequence of the ASO is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the nucleotide sequence of the target portion over the length of the ASO.

[0029] In one example, the ASO comprises a backbone modification. For example, the backbone modification comprises a phosphorothioate bond or a phosphorodiamidate bond. In one example, the ASO comprises a phosphorothioate bond. In another example, the ASO comprises a phosphorodiamidate bond.

[0030] In one example, the ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl, a 2'-fluoro, or a 2'-O-methoxyethyl moiety. For example, the ASO comprises a phosphorodiamidate morpholino moiety. In another example, the ASO comprises a locked nucleic acid. In a further example, the ASO comprises a 2'-O-methyl moiety. In one example, the ASO comprises a 2'-fluoro moiety. In another example, the ASO comprises a 2'-O-methoxyethyl moiety.

[0031] In one example, the ASO comprises at least one modified sugar moiety, e.g., each sugar moiety in the antisense oligonucleotide is a modified sugar moiety.

[0032] In one example, the ASO includes a 2'-O-methoxyethyl moiety, e.g., each nucleotide of the ASO includes a 2'-O-methoxyethyl moiety.

[0033] In one example, the nucleotide sequence of the ASO is comprised of 10-50 nucleotides, 15-40 nucleotides, 18-40 nucleotides, 17-25 nucleotides, 20-35 nucleotides, 20-30 nucleotides, 22-30 nucleotides, 22-28 nucleotides, 24-30 nucleotides, 25-30 nucleotides, or 26-30 nucleotides. In one example, the nucleotide sequence of the ASO is comprised of 20-30 nucleotides. For example, the nucleotide sequence of the ASO is comprised of 17 nucleotides. In one example, the nucleotide sequence of the ASO is comprised of 19 nucleotides. In another example, the nucleotide sequence of the ASO is comprised of 21 nucleotides. In a further example, the nucleotide sequence of the ASO is comprised of 22 nucleotides. In one example, the nucleotide sequence of the ASO is comprised of 23 nucleotides. In another example, the nucleotide sequence of the ASO is comprised of 24 nucleotides. In another example, the nucleotide sequence of the ASO is comprised of 25 nucleotides. In another example, the nucleotide sequence of the ASO is comprised of 26 nucleotides. In another example, the nucleotide sequence of the ASO is comprised of 27 nucleotides. In another example, the nucleotide sequence of the ASO is made up of 28 nucleotides. In another example, the nucleotide sequence of the ASO is made up of 29 nucleotides. In another example, the nucleotide sequence of the ASO is made up of 30 nucleotides.

[0034] In one example, the ASO contains one or more phosphorodiamidate morpholino moieties.

[0035] In one example of the methods described herein, the ASO is linked to a functional moiety. The functional moiety may be covalently or non-covalently bound to the ASO. The functional moiety may be at the 5' and / or 3' end of the ASO.

[0036] In some examples, the functional moiety comprises a delivery moiety. For example, the delivery moiety is selected from the group consisting of a lipid, a peptide, a carbohydrate, and an antibody. An exemplary delivery moiety comprises a cell penetrating peptide (CPP). The present disclosure further contemplates a delivery moiety, for example, an N-acetylgalactosamine (GalNAc) moiety, a fatty acid moiety, or a lipid moiety.

[0037] In some examples, the functional moiety comprises a stabilizing moiety.

[0038] The present disclosure further provides a pharmaceutical composition comprising an ASO of the present disclosure and a pharma- ceutically acceptable excipient for use in any of the methods of the present disclosure.

[0039] In one example, the ASO is complexed with a delivery nanocarrier. For example, the delivery nanocarrier is selected from the group consisting of a lipoplex, a liposome, an exosome, an inorganic nanoparticle, and a DNA nanostructure. In one example, the delivery nanocarrier comprises a lipid nanoparticle (LNP) that encapsulates the antisense oligonucleotide.

[0040] In one example of the methods described herein, the ASO is formulated for a route of administration selected from the group consisting of intravitreal, suprachoroidal, subretinal, intramuscular, intravenous, intraarterial, subcutaneous, and topical routes.

[0041] The disclosure also provides for the use of an ASO in the manufacture of a medicament for treating, preventing, and / or slowing the progression of glaucoma in a subject, wherein the ASO regulates mRNA translation of an OPA1 gene transcript or a portion thereof.

[0042] The present disclosure also provides modified cells comprising the ASO of the present disclosure for use in any of the methods described herein. For example, the modified cell is a mammalian cell, such as a human cell.

[0043] The present disclosure further provides an ASO that binds to a target portion of intron 7x of an OPA1 gene transcript in a cell and increases the level of an OPA1 gene transcript encoding a full-length functional OPA1 by eliminating the NMD exon 7x. For example, the ASO comprises or consists of any one of SEQ ID NOs: 2-54. In one example, the ASO comprises or consists of any one of SEQ ID NOs: 2-54 or 2491-2503. In another example, the ASO comprises or consists of any one of SEQ ID NOs: 2491-2503. The present disclosure further provides an ASO that binds to a target portion of the 5'UTR of an OPA1 gene transcript in a cell and increases the stability of the OPA1 mRNA transcript, for example, by inhibiting the activity of a decapping enzyme.

[0044] In one example, the ASO comprises or consists of any one of SEQ ID NOs: 56-138.

[0045] The disclosure further provides ASOs that bind to a target portion of the 3'UTR of an OPA1 gene transcript in a cell and increase the stability of the OPA1 mRNA transcript, e.g., by sterically blocking the binding of miRNA to the 3'UTR.

[0046] In one example, the ASO binds within a target portion of the 3'UTR of OPA1 mRNA, the target portion being within a nucleotide sequence corresponding to SEQ ID NO:139.

[0047] In one example, an ASO that binds to a target portion of the 3'UTR of OPA1 mRNA comprises or consists of any one of SEQ ID NOs: 140-2488.

[0048] The present disclosure further provides a method of treating a condition, the method comprising administering an ASO of the present disclosure. In one example, the condition is associated with OPA1 expression (e.g., reduced OPA1 expression). In one example, the condition is glaucoma. In another example, the condition is autosomal dominant optic atrophy. [Brief description of the drawings]

[0049] [Figure 1-1] A series of graphic representations showing the binding sites of ASOs that increase OPA1 protein levels are included. (A) Schematic diagram of the exonic structure of OPA1 (transcript ID: ENST00000361510) showing the start and stop codons as well as the 5'UTR, NMD exon 7x (if unspliced), and 3'UTR regions. (B) Prediction of the secondary structure of the 5'UTR of the OPA1 transcript (corresponding to SEQ ID NO: 55) using the RNAfold web tool (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi). The thermodynamic ensemble free energy is -137.26 kcal / mol. ASOs 56-138 were designed, which target the upstream open reading frame (uORF), regulatory binding sites, inhibitory 5'UTR secondary structures, and / or the start codon of the G-quadruplex. [Figure 1-2] (C) Exon 7x (black box), which contains a premature termination codon (PTC), is located between exons 7 and 8 (not drawn to scale). ASOs (SEQ ID NOs: 2-54) were designed to target splicing regulatory elements within intron 7 (dashed line, corresponding to SEQ ID NO: 1) to mediate the exclusion of exon 7x during pre-mRNA splicing and increase productive OPA1 transcripts. [Figure 1-3] (D) Schematic diagram (not drawn to scale) of the 3'UTR located in exon 31. The ASO was designed to hybridize to the transcript and mask / inhibit the binding of the miRNA(s), preventing mRNA degradation and increased OPA1 protein levels. [Diagram 2]Screening of PMOs (25 and 50 μM) in ADOA patient fibroblasts. Patient fibroblasts were transfected for 48 h with PMOs targeting the deletion of OPA1 exon 7x as indicated. OPA1 transcript expression was assessed by digital droplet PCR (ddPCR) and normalized to GAPDH, RPL27, and SCL25A3 transcript levels. OPA1 expression in untreated cells was set to 1. [Diagram 3] Screening of PMOs (50 and 100 μM) in ADOA patient fibroblasts. (A) Western blot gel images show expression of long and short OPA1 isoforms in patient fibroblasts transfected with PMOs targeting intron 7 of the OPA1 transcript at 48 hours. (B) Band intensity of OPA1 expression was normalized to beta-actin (assessed with ImageJ™). OPA1 expression in untreated cells was set to 1. [Figure 4] Schematic diagram of antisense oligonucleotide modifications to improve upregulation of OPA1. (A) Diagram of OPA1 exons and location of exon 7x present in the transcript. (B) Binding region of the parent PMO on the OPA1 transcript upstream of exon 7x. Exon 7x is not drawn to scale. (C) Binding region of the daughter sequence with microwalks, nucleotide base substitutions, and extensions to improve efficacy of the PMO. [Diagram 5] Screening of cell-penetrating peptide-linked PMOs (PPMOs) (5, 10, and 20 μM) in ADOA patient fibroblasts. As indicated, ADOA patient fibroblasts were transfected for 5 days with PPMOs targeting intron 7 of the OPA1 transcript. OPA1 transcript expression was assessed by ddPCR and normalized to HPRT1. OPA1 expression in untreated cells was set to 1. [Figure 6]Screening of PMOs targeting exon 7x exclusion (25 and 50 μM) in ADOA patient fibroblasts. Patient fibroblasts were transfected in triplicate for 48 h with PMOs targeting OPA1 exon 7x removal as indicated. Experiments were performed with 1 to 4 biological replicates as indicated by the number of data points in the bar graph. OPA1 transcript expression was assessed by ddPCR and normalized to HPRT1 transcript levels. OPA1 expression in untreated cells was set to 1. [Figure 7] Screening of 5'UTR PMOs (25 and 50 μM) in ADOA patient fibroblasts. PMOs targeting the 5'UTR of OPA1 mRNA, PMOs with SEQ ID NOs: 78, 112, and 2500-2503, were transfected in triplicate into ADOA patient fibroblasts for 72 hours. Western blot analysis was used to determine the upregulation of OPA1 protein in PMO-treated cells. Band intensity of OPA1 expression was normalized to HPRT1 (assessed with ImageJ™). OPA1 expression in untreated cells was set to 1. PMOs (SEQ ID NOs: 78, 112, and 2502) significantly increased the upregulation of OPA1 protein in patient fibroblasts (>1.3-fold). Student's t-test was used for statistical analysis. [Figure 8] This shows that PMO OPA1 H1A(+10+32)1mm10C>T (SEQ ID NO: 112) combined with CPP to enhance cell penetration ability. Dermal fibroblasts from ADOA patients containing OPA1 mutations c.2708_2711delTTAG (patient 1) and c.985-1G>A (patient 2) were incubated with CPP-PMO (or PPMO) for 7 days. Western blot assay was used to evaluate the efficacy of PPMO-induced OPA1 upregulation. The results showed a significant upregulation of OPA1 protein in a dose-dependent manner in two patients with different OPA1 mutations. Student's t-test was used for statistical analysis. [Figure 9]Figure 1 shows improvement of mitochondrial function after PPMO treatment in ADOA patient-derived fibroblasts. PMO OPA1 H1A(+10+32)1mm10C>T (SEQ ID NO: 112) was incubated in fibroblasts in a 6-well plate format for 7 days. On day 7, cells were tricine-treated, re-seeded at 8,000 cells / well in 96-well plates, and incubated for 18 h in glucose-depleted DMEM cell medium supplemented with 2.5 mM 2-deoxy-D-glucose and 5 mM pyruvate. Mitochondrial ATP was assessed using the CellTiter-Glo® assay, and ATP concentrations were calculated according to a standard curve using ATP standard dilutions (ThermoFisher) from 14.7 to 10,000 nM. Student's t-test was used for statistical analysis. [Figure 10] Figure 1 shows that PMO OPA1 H1A(+10+32)1mm10C>T (SEQ ID NO: 112) promotes OPA1 protein upregulation in enriched iPSC-derived RGCs obtained from ADOA patients with OPA1c.985-1G>A mutation. iPSC-RGCs were incubated with PPMO for 5 days before protein harvest. Western blot assay was used to evaluate the efficacy of PPMO-induced OPA1 upregulation and normalized to beta-actin expression. Results showed significant upregulation of OPA1 protein at 10 μM. Student's t-test was used for statistical analysis. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0050] General Throughout this specification, unless specifically stated otherwise or unless the context requires otherwise, a reference to a single step, composition of matter, group of steps, or group of compositions of matter should be construed to include one and more (i.e., one or more) of that step, composition of matter, group of steps, or group of compositions of matter. Thus, as used herein, the singular forms "a," "an," and "the" include plural aspects unless the context clearly indicates otherwise. For example, reference to "a" includes one and more than one, reference to "an" includes one and more than one, reference to "the" includes one and more than one, etc.

[0051] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The present disclosure also includes all steps, features, compositions, and compounds referred to or shown in this specification, individually or collectively, and any and all combinations or any two or more of such steps or features.

[0052] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for illustrative purposes only, and functionally equivalent objects, compositions, and methods are clearly within the scope of the present disclosure.

[0053] Any example of the present disclosure should be construed as applicable mutatis mutandis to any other example of the present disclosure, unless specifically stated otherwise, that is, any specific example of the present disclosure can be combined with any other specific example of the present disclosure (except where mutually exclusive).

[0054] Any example of this disclosure disclosing a particular feature or group of features, or method or method steps, will be construed as providing explicit support for disclaiming the particular feature or group of features, or method or method step.

[0055] Unless specifically stated otherwise, all technical and scientific terms used herein should be understood to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., molecular biology, microbiology, virology, recombinant DNA techniques, peptide synthesis in solution, solid phase peptide synthesis, and immunology).

[0056] Unless otherwise indicated, the conventional techniques of molecular biology, microbiology, virology, recombinant DNA techniques, peptide synthesis in solution, solid phase peptide synthesis, and immunology utilized in this disclosure are standard procedures well known to those skilled in the art. Such techniques are described and explained, for example, throughout the literature in the following sources: J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and FM Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1999). Laboratory, (1988), and JE Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0057] The term "and / or," e.g., "X and / or Y," should be understood to mean either "X and Y" or "X or Y," and should be interpreted as explicitly supporting both meanings or either meaning.

[0058] The term "about" refers to + / - 20% of the specified value, more preferably + / - 10%, unless otherwise stated. For the avoidance of doubt, the term "about" followed by the specified value should also be interpreted as including the extracted specified value itself (e.g., "about 10" includes exactly 10).

[0059] Throughout this specification the word "comprises" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a stated element, integer, or step, or group of elements, integers, or steps, but excluding other elements, integers, or steps, or group of elements, integers, or steps.

[0060] Selected Definitions As used herein, the term "antisense oligonucleotide," "antisense oligomer," or "ASO" encompasses oligonucleotides and any other oligomeric molecules that contain nucleobases capable of hybridizing to a complementary sequence on a target RNA transcript, but do not contain a sugar moiety, as in the case of peptide nucleic acids (PNAs). Preferably, the ASO is an ASO that is resistant to cleavage or degradation by nucleases.

[0061] As used herein, the phrase "binds to a target moiety" or "binds within a target moiety" in reference to an ASO refers to specific hybridization between an ASO nucleotide sequence and a target nucleotide sequence that is complementary within the scope described herein. In some instances, specific hybridization occurs, and under ex vivo conditions, hybridization occurs under high stringency conditions. By "high stringency conditions" is meant that under such ex vivo conditions, the ASO hybridizes to the target sequence in an amount detectably stronger than non-specific hybridization. High stringency conditions are then conditions that distinguish the polynucleotide from an exactly complementary sequence, or one that contains only a few scattered mismatches from a random sequence that happens to have a few small regions (e.g., 1-5 bases) that match the probe. Such small regions of complementarity are more easily resolved than full-length complements of 12-17 bases or more, making them more easily distinguishable by moderate stringency hybridization. In one example, high stringency conditions include, for example, low salt and / or high temperature conditions (e.g., provided by about 0.02-0.1 M NaCl or equivalent, and a temperature of about 50-70° C.). One of skill in the art will understand that under in vivo conditions, the specificity of hybridization between an ASO and its target sequence is defined by the level of complementarity between the ASO and the target sequence that hybridizes within the cell.

[0062] The term "nonsense-mediated RNA decay-induced (NMD) exon" or "NMD exon" refers to an exon or pseudoexon that is a region within an intron and that, when included in a mature RNA transcript, can activate the NMD pathway. In a constitutive splicing event, the intron containing the NMD exon is usually spliced ​​out, but during an alternative or aberrant splicing event, the intron or a portion thereof can be retained. A mature mRNA transcript containing such an NMD exon can be non-productive due to a frameshift that induces the NMD pathway. The inclusion of an NMD exon in a mature OPA1 RNA transcript can downregulate overall OPA1 mRNA and OPA1 protein expression.

[0063] The term "precursor mRNA" or "pre-mRNA" refers to the primary transcript, a single-stranded RNA product synthesized by transcription of a genomic DNA sequence of a transcription unit of a particular gene, which generally includes the nucleotide sequence between the transcription initiation site and the termination signal.

[0064] The term "peptide" is intended to include compounds consisting of amino acid residues linked by amide bonds. Peptides may be natural or non-natural, ribosomal encoded, or synthetically derived. Typically, peptides consist of 2-200 amino acids. For example, peptides may have a length ranging from 10-20 amino acids, or 10-30 amino acids, or 10-40 amino acids, or 10-50 amino acids, or 10-60 amino acids, or 10-70 amino acids, or 10-80 amino acids, or 10-90 amino acids, or 10-100 amino acids, including any length within said range(s). Peptides may comprise or consist of less than about 150 amino acids, or less than about 125 amino acids, or less than about 100 amino acids, or less than about 90 amino acids, or less than about 80 amino acids, or less than about 70 amino acids, or less than about 60 amino acids, or less than about 50 amino acids.

[0065] The peptides referred to herein include "inverso" peptides, in which all L-amino acids are replaced by the corresponding D-amino acids, and "retro-inverso" peptides, in which the sequence of amino acids is reversed and all L-amino acids are replaced by D-amino acids.

[0066] Peptides may include both L- and / or D-form amino acids. For example, both L- and D-forms may be used for various amino acids within the same peptide sequence. In some examples, the amino acids within the peptide sequence are L-form, such as natural amino acids. In some examples, the amino acids within the peptide sequence are a combination of L- and D-forms. Additionally, peptides may include rare but naturally occurring amino acids, including but not limited to hydroxyproline (Hyp), beta-alanine, citrulline (Cit), ornithine (Orn), norleucine (Nle), 3-nitrotyrosine, nitroarginine, pyroglutamic acid (Pyr). Peptides may also incorporate unnatural amino acids, including but not limited to homoamino acids, N-methyl amino acids, alpha-methyl amino acids, beta (homo) amino acids, gamma amino acids, and N-substituted glycines. Peptides may be linear or cyclic peptides.

[0067] The term "protein" should be interpreted to include a single polypeptide chain, i.e., a series of consecutive amino acids linked by peptide bonds, or a series of polypeptide chains that are covalently or non-covalently linked to one another (i.e., a polypeptide complex). For example, a series of polypeptide chains can be covalently linked using suitable chemical bonds or disulfide bonds. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions.

[0068] The percentage of amino acid sequence identity for a given amino acid sequence is defined as the percentage of amino acid residues in the candidate sequence that are identical to those in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to obtain the maximum percent sequence identity, without considering conservative substitutions as part of the sequence identity. Amino acid sequence identity can be determined using the EMBOSS pairwise alignment algorithm tool available from the European Bioinformatics Institute, part of the European Molecular Biology Laboratory (EMBL-EBI). The tool can be accessed on the website at www.ebi.ac.uk / Tools / emboss / align / . The tool utilizes the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970). Default settings are used, including Gap Open: 10.0 and Gap Extend 0.5. The default matrix "Blosum62" is used for amino acid sequences and the default matrix.

[0069] The term "cell membrane penetrating peptide" (CPP) refers to a peptide capable of passing through a cell membrane. In one example, a CPP is capable of translocating across a mammalian cell membrane and entering the cell. In another example, a CPP may direct a conjugate to a desired intracellular compartment. Thus, a CPP may induce or facilitate the penetration of a molecule of interest through a phospholipid, mitochondrial, endosomal, lysosomal, vesicle, or nuclear membrane. A CPP may translocate across the membrane with the amino acid sequence intact or may be partially degraded.

[0070] The CPP may guide a molecule of interest, such as an antisense oligonucleotide disclosed herein, from the outside of the cell across the cell membrane to the cytoplasm or a desired intracellular compartment. Alternatively or additionally, the CPP may guide a molecule of interest across the blood-brain barrier, mucosal barrier, blood-retina barrier, skin barrier, gastrointestinal barrier, and / or pulmonary barrier.

[0071] The term "peptide ligand" or "receptor binding domain" refers to a peptide that binds to a membrane surface receptor and allows translocation of the peptide across the cell membrane. In one example, the peptide ligand can allow translocation across the cell membrane via natural endocytosis of the target receptor. In another example, the peptide ligand can utilize a complementary mechanism of translocation across the cell membrane, including the use of a conjugated CPP. In one example, the peptide ligand can translocate across a mammalian cell membrane and enter the cell. In another example, the peptide ligand can direct the conjugate to a desired intracellular compartment. Thus, the peptide ligand can induce or promote the uptake of a molecule of interest into the cell via phospholipids, mitochondria, endosomes, lysosomes, vesicles, or nuclear membranes. The peptide ligand can translocate across the membrane with the amino acid sequence intact or can be partially degraded.

[0072] Peptide ligands, via binding to a target receptor, may guide a molecule of interest, such as an ASO disclosed herein, from the outside of the cell across the cell membrane to the cytoplasm or a desired intracellular compartment. Alternatively or additionally, peptide ligands, via binding to a target receptor, may guide a molecule of interest across relevant biological barriers, such as the blood-brain barrier, mucosal barrier, blood-retinal barrier, skin barrier, gastrointestinal barrier, and / or pulmonary barrier.

[0073] Methods for Treating or Preventing Glaucoma The disclosure provides, for example, methods of treating, preventing, and / or slowing the progression of glaucoma in a subject. The methods described herein include methods for treating, preventing, and / or slowing the progression of glaucoma in a subject in need thereof by administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising any of the ASOs disclosed herein. Similarly, in some examples, any of the ASOs described herein are used in the manufacture of a medicament for treating, preventing, and / or slowing the progression of glaucoma.

[0074] Glaucoma is a group of eye diseases that can lead to blindness. It is usually caused by an increase in intraocular pressure (IOP), which can lead to damage to the optic nerve. Glaucoma can be classified as either primary or secondary, with secondary glaucoma resulting from another disorder or problem in the eye (e.g., injury, surgery, medication, or other eye disease). Primary glaucoma is classified into open-angle glaucoma (POAG), normal tension glaucoma (NTG), angle-closure glaucoma, and congenital glaucoma. Secondary glaucoma is classified into neovascular glaucoma, pigmentary glaucoma, exfoliation glaucoma, and uveitis glaucoma.

[0075] In one embodiment of the method of the present disclosure, the glaucoma is primary glaucoma. For example, the primary glaucoma is open-angle glaucoma (POAG), normal tension glaucoma (NTG), angle-closure glaucoma, or congenital glaucoma.

[0076] In one example, the primary glaucoma is open angle glaucoma (POAG).

[0077] In one example, the primary glaucoma is normal tension glaucoma (NTG).

[0078] In one example, the primary glaucoma is angle-closure glaucoma.

[0079] In one example, the primary glaucoma is congenital glaucoma.

[0080] In one example of the disclosed method, the glaucoma is secondary glaucoma, for example, neovascular, pigmentary, exfoliation, or uveitic glaucoma.

[0081] In one example, the secondary glaucoma is neovascular glaucoma.

[0082] In one example, the secondary glaucoma is pigmentary glaucoma.

[0083] In one example, the secondary glaucoma is exfoliation glaucoma.

[0084] In one example, the secondary glaucoma is uveitic glaucoma.

[0085] In one example, the subject to be treated suffers from glaucoma.For example, the subject has been diagnosed with or has been diagnosed with glaucoma.In one example, the subject suffers from glaucoma.For example, the subject needs treatment.Such subject can be administered the ASO described herein to treat or prevent the progression of glaucoma.

[0086] In one example, administration of an ASO described herein slows the progression of glaucoma.

[0087] In one example, a subject is at risk of developing glaucoma. Such a subject can be administered an ASO described herein to prevent the onset of glaucoma.

[0088] As used herein, the term "at risk" means that a subject is more likely to develop glaucoma than a normal individual.A subject can be identified as being at risk for developing glaucoma using any method known in the art and / or the method described herein.For example, if a subject has one or more common risk factors, including family history, high intraocular pressure, diabetes, high or low blood pressure, and long-term use of steroid drugs, the subject can be identified as being at risk for developing glaucoma.

[0089] Also provided herein are methods for increasing OPA1 protein in a cell, comprising contacting the cell with a composition or pharmaceutical composition disclosed herein (thereby increasing the amount of OPA1 protein in the cell). Also provided herein are methods for increasing the level of OPA1 protein in a cell (ex vivo) or in a tissue (in vivo), comprising contacting the cell with an ASO or pharmaceutical composition disclosed herein (thereby increasing the amount of OPA1 protein in the cell). In some examples, the cell is a retinal cell. In some examples, the tissue is a retinal tissue, e.g., retina and / or retinal pigment epithelium.

[0090] In some examples, administration of any of the ASOs or pharmaceutical compositions disclosed herein to a subject or contact with a cell increases the level of OPA1 protein by about 1.1 to about 10 times, e.g., 1.5 to about 10 times, about 2 to about 10 times, about 3 to about 10 times, about 4 to about 10 times, about 1.1 to about 5 times, about 1.1 to about 6 times, about 1.1 to about 7 times, about 1.1 to about 8 times, about 1.1 to about 9 times, or about 1.5 to about 10 times, compared to the level in the tissue prior to administration or contact. fold, about 2 to about 5 fold, about 2 to about 6 fold, about 2 to about 7 fold, about 2 to about 8 fold, about 2 to about 9 fold, about 3 to about 6 fold, about 3 to about 7 fold, about 3 to about 8 fold, about 3 to about 9 fold, about 4 to about 7 fold, about 4 to about 8 fold, about 4 to about 9 fold, at least about 1.1 fold, at least about 1.5 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 3.5 fold, at least about 4 fold, at least about 5 fold, or at least about 10 fold.

[0091] Suitable routes of administration for treatment with the compositions, pharmaceutical compositions, or drugs disclosed herein include, but are not limited to, intravitreal, suprachoroidal, subretinal, intramuscular, intravenous, intraarterial, subcutaneous, and topical.

[0092] In some examples, administration is intraocular by intravitreal, suprachoroidal, or subretinal routes. For example, administration to the eye is by intravitreal administration. In another example, administration to the eye is by suprachoroidal administration. In a further example, administration to the eye is by subretinal administration. In one example, administration to the eye is by topical administration.

[0093] As will be appreciated by those of skill in the art, the methods of treatment disclosed herein include administering to a subject (e.g., a human subject) a therapeutically effective amount of the compositions and pharmaceutical compositions disclosed herein. As used herein, the term "effective amount" or "therapeutically effective amount" refers to a sufficient amount of the disclosed ASO administered to alleviate to some extent one or more of the symptoms and / or clinical signs associated with pathological inflammation in a particular disease or condition. In some examples, an "effective amount" in therapeutic applications is the amount of one of the above-mentioned agents required to cause a clinically significant reduction in disease symptoms and / or inflammatory markers, or to prevent disease symptoms without undue adverse side effects. An appropriate "effective amount" in an individual case may be determined using techniques such as dose escalation studies. The term "therapeutically effective amount" includes, for example, a prophylactically effective amount. It is understood that an "effective amount" or "therapeutically effective amount" may vary between subjects due to variations in the age, weight, general condition of the subject, the condition being treated, the severity of the condition being treated, and the metabolism of the compound according to the judgment of the prescribing physician. By way of example only, therapeutically effective amounts can be determined by routine experimentation, including, but not limited to, dose escalation clinical trials. When multiple therapeutic agents are used in combination, the "therapeutically effective amount" of each therapeutic agent can refer to the amount of the therapeutic agent that is therapeutically effective when used alone, or can refer to a reduced amount that is therapeutically effective in combination with one or more additional therapeutic agents.

[0094] Compositions for increasing OPA1 protein levels The OPA1 mitochondrial dynamin-like GTPase gene (OPA1, also known as FLJ12460, KIAA0567, MGM1, NPG, and NTG, herein referred to as OPA1) is composed of 30 coding exons distributed over 90 kb of genomic DNA. It is located on chromosome 3q29 and encodes a ubiquitously expressed dynamic-associated GTPase that is imported into mitochondria by an N-terminal import sequence and localizes to the inner membrane facing the intermembrane space. OPA1 contains a highly conserved functional GTPase domain shared by members of the dynamin superfamily of mechanoenzymes and regulates several important cellular processes, including the stability of the mitochondrial network. In humans, OPA1 generates at least eight isoforms by differential splicing of exons 4, 4b, and 5b. For nomenclature purposes only, and not for limitation, the entire human OPA1 gene sequence and known transcript maps and sequences are publicly available through the online Ensemble database under record ENSG00000198836. Exemplary gene sequences for human OPA1 are set forth in NCBI reference sequence NM_130837, or SEQ ID NO: 2489, and UniProt ID O60313, or SEQ ID NO: 2490.

[0095] The OPA1 gene contains an intron with a premature termination codon (PTC) in intron 7 (located between exons 7 and 8). In some subjects, a portion of the OPA1 RNA transcripts from the wild-type OPA1 gene retains the section of intron 7 that contains this PTC; this retained intron section is referred to as exon 7x in the transcribed RNA. RNA transcripts that contain exon 7x (the retained intron segment that contains the PTC) are subject to nonsense-mediated RNA decay. Thus, a portion of the OPA1 RNA is translated into the mature wild-type protein, and a portion of the OPA1 RNA is almost immediately degraded by RNase because of the presence of the PTC.

[0096] As described herein, the ASOs of any of the examples bind to a target portion of human OPA1 pre-mRNA, which increases expression of OPA1 protein by promoting the exclusion of exon 7x in splicing of OPA1 in mammalian cells.

[0097] Without being bound by theory or mechanism of action, ASOs that bind to a target portion of human OPA1 pre-mRNA in mammalian cells and result in the exclusion of NMD exon 7x are believed to increase OPA1 protein expression by preventing the translation of NMD exon 7x.

[0098] Additionally, as described herein, the ASO according to any of the examples binds to the 5'UTR or 3'UTR of OPA1 mRNA and increases expression of OPA1 protein.

[0099] Without being bound by theory or mechanism of action, ASOs that bind to the 5'UTR are believed to increase OPA1 protein expression through steric inhibition of translation from the upstream open reading frame (uORF) start site, and / or steric inhibition of secondary structure in the UTR, and / or inhibition of binding and / or activity of the decapping enzyme.

[0100] Also, as described herein, the ASO according to any of the examples binds to the 3'UTR or 3'UTR of OPA1 mRNA and increases expression of OPA1 protein. Without being bound by theory or mechanism of action, such ASOs may sterically inhibit the binding of miRNA to the 3'UTR.

[0101] Antisense Oligonucleotides (ASOs) In some examples of the compositions and methods described herein, the ASO has a sequence that is fully complementary to the target sequence over its length, or is close to complementary (e.g., sufficiently complementary to bind to the target sequence and promote exon splicing). The ASO is designed to bind (hybridize) to a target RNA sequence (e.g., a target portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Selection of a suitable sequence for the ASO typically avoids, to the extent possible, similar nucleic acid sequences in other (i.e., off-target) locations in the genome or in mRNAs or miRNAs in the cell, thereby limiting the possibility of the ASO hybridizing at such locations.

[0102] In some examples, the ASO "specifically hybridizes" or is "specific" for a target portion of a target nucleic acid or the 5'UTR of OPA1 mRNA. In some examples, the ASO "specifically hybridizes" or is "specific" for a target portion of a target nucleic acid or the OPA1 pre-mRNA. At a given ionic strength and pH, T m is the temperature at which 50% of the target sequence hybridizes to a complementary oligonucleotide.

[0103] An ASO sequence is "complementary" to its target sequence if hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. Complementarity can be quantified by the proportion (e.g., percentage) of bases on opposite strands that are expected to form hydrogen bonds with each other according to commonly accepted base pairing rules. The nucleotide sequence of an ASO does not need to be 100% complementary to the nucleotide sequence of its target nucleic acid in order to hybridize. In certain examples, the nucleotide sequence of an ASO in a composition disclosed herein can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleotide sequence of the target portion of an RNA transcript over the length of the ASO nucleotide sequence. For example, an ASO in which 18 of 20 nucleotides of an ASO sequence are complementary to a target region and therefore specifically hybridizes would exhibit 90 percent complementarity. In such instances, the remaining non-complementary nucleotides of the ASO may be clustered together or interspersed with complementary nucleotides and need not be contiguous. Complementarity of an ASO sequence to a target nucleotide sequence (expressed as "percent complementarity" to the target sequence, or "percent identity" to its reverse complement) can be routinely determined using algorithms known in the art, as exemplified by the BLAST program (Basic Local Alignment Search Tool) and PowerBLAST programs (Altschul, et al., 1990, J. Mol. Biol., 215:403-410; Zhang et al., 1997, Genome Res., 7:649-656).

[0104] In some instances, the ASO does not hybridize to every nucleotide in the target sequence, and the hybridizing nucleotide positions may be contiguous or non-contiguous. The ASO may hybridize to one or more segments of the 5'UTR region of an mRNA, or one or more segments of intron 7 of the OPA1 pre-mRNA, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop or hairpin structure may be formed).

[0105] In some examples, the nucleotide sequence of the ASO described herein is complementary to a target portion of the 5'UTR of OPA1 mRNA. For example, the ASO is complementary to a target portion of the 5'UTR of OPA1 mRNA corresponding to SEQ ID NO: 55. In some examples, the ASO is complementary to a target portion of the OPA1 mRNA corresponding to SEQ ID NO: 55 including the 5'UTR. In some examples, the nucleotide sequence of the ASO is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the nucleotide sequence of the target portion of the 5'UTR of OPA1 over the length of the ASO.

[0106] In some examples, the nucleotide sequence of the ASO that binds to the target portion of the 5'UTR of OPA1 mRNA comprises or consists of any one of SEQ ID NOs: 56-138.

[0107] In some examples, the nucleotide sequence of the ASO described herein is complementary to a target portion of intron 7 of OPA1 pre-mRNA. In some examples, the ASO is complementary to a target portion sufficiently proximal to an acceptor site of exon 7x to promote the elimination of exon 7x in splicing of OPA1 mRNA, e.g., the antisense oligonucleotide comprises any one of SEQ ID NOs: 2-54. In some examples, the ASO is complementary to a target portion sufficiently proximal to an acceptor site of exon 7x to promote the elimination of exon 7x in splicing of OPA1 mRNA, e.g., the antisense oligonucleotide comprises any one of SEQ ID NOs: 2-54 or 2491-2503. In some examples, the ASO is complementary to a target portion sufficiently proximal to an acceptor site of exon 7x to promote the elimination of exon 7x in splicing of OPA1 mRNA, e.g., the antisense oligonucleotide comprises any one of SEQ ID NOs: 2491-2503. In some examples, the nucleotide sequence of the ASO is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the nucleotide sequence of the target portion of intron 7 of OPA1 pre-mRNA over the length of the ASO.

[0108] In some examples, the nucleotide sequence of the ASO described herein is complementary to a target portion of the 3'UTR of OPA1 mRNA. For example, the ASO is complementary to a target portion of the 3'UTR of OPA1 mRNA corresponding to SEQ ID NO: 139. In some examples, the ASO is complementary to a target portion of the OPA1 mRNA corresponding to SEQ ID NO: 139 including the 3'UTR. In some examples, the nucleotide sequence of the ASO is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the nucleotide sequence of the target portion of the 3'UTR of OPA1 over the length of the ASO.

[0109] The ASOs described herein may be of any length suitable for specific hybridization to a target sequence. In some examples, the nucleotide sequence of the ASO is comprised of 8-50 nucleotides. For example, the ASO sequence can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, or 50 nucleotides long. In some examples, the ASO is comprised of more than 50 nucleotides long, but is 100 or less nucleotides long.

[0110] In some examples, the ASO nucleotide sequence may be 8-50 nucleotides long, 8-40 nucleotides long, 8-35 nucleotides long, 8-30 nucleotides long, 8-25 nucleotides long, 8-20 nucleotides long, 8-15 nucleotides long, 9-50 nucleotides long, 9-40 nucleotides long, 9-35 nucleotides long, 9-30 nucleotides long, 9-25 nucleotides long, 9-20 nucleotides long, 9-15 nucleotides long, 10-50 nucleotides long, 10-40 nucleotides long, 10-35 nucleotides long, 10-30 nucleotides long, 10-25 nucleotides long, 10-20 nucleotides long, 10-15 nucleotides long, 11-50 nucleotides long, 11-40 nucleotides long, 11-35 nucleotides long, 11-30 nucleotides long, 11-25 nucleotides long, 11-20 nucleotides long, 11-15 nucleotides long, 12-50 nucleotides long, 12-40 nucleotides long, 12-35 nucleotides long , 12-30 nucleotides, 12-25 nucleotides, 12-20 nucleotides, 12-15 nucleotides, 13-50 nucleotides, 13-40 nucleotides, 13-35 nucleotides, 13-30 nucleotides, 13-25 nucleotides, 13-20 nucleotides, 14-50 nucleotides, 14-40 nucleotides, 14-35 nucleotides, 14-30 nucleotides, 14-25 nucleotides, 14-20 nucleotides The ASO may be 15-50 nucleotides long, 15-40 nucleotides long, 15-35 nucleotides long, 15-30 nucleotides long, 15-25 nucleotides long, 15-20 nucleotides long, 20-50 nucleotides long, 20-40 nucleotides long, 20-35 nucleotides long, 20-30 nucleotides long, 20-25 nucleotides long, 25-50 nucleotides long, 25-40 nucleotides long, 25-35 nucleotides long, or 25-30 nucleotides long. In some examples, the ASO is 17 nucleotides long. In some preferred examples, the nucleotide sequence of the ASO nucleotide is 25 nucleotides long.

[0111] ASO chemistry and modification The ASOs used in the compositions described herein may include natural nucleotides, nucleotide analogs, modified nucleotides, or any combination thereof. The term "natural nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and / or nucleotides with modified backbones. In some examples, all nucleotides of the ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the compositions and methods described herein are known in the art, for example, as described in U.S. Pat. No. 8,258,109, U.S. Pat. No. 5,656,612, U.S. Patent Publication No. 2012 / 0190728, and Roberts et al., 2020, Nature Rev. Drug Disc., 19:673-694.

[0112] One or more nucleotides of the ASO may be a naturally occurring unmodified nucleobase (e.g., adenine, guanine, cytosine, thymine, uracil, and inosine), or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase to allow hydrogen bonding with a nucleobase present on the target RNA transcript. Examples of suitable modified nucleobases include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethycytosine.

[0113] ASOs include a "backbone" structure, which refers to the linkage between the nucleotides / monomers of the ASO. In naturally occurring oligonucleotides, the backbone includes 3'-5' phosphodiester bonds that link the sugar moieties of adjacent nucleotides. Types of backbone linkages suitable for the ASOs described herein include, but are not limited to, phosphodiester, phosphorothioate, phosphorodithioate, phosphorodiamidate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoroaniladate, phosphoroamidate, and the like. In some examples, the backbone modification is a phosphorothioate linkage. In other examples, the backbone modification is a phosphorodiamidate linkage. See, for example, Roberts et al. and Agrawal (2021), supra, Biomedicines, 9:503. In some instances, the backbone structure of the ASO does not contain phosphorus-based linkages, but rather peptide linkages, for example, as in peptide nucleic acids (PNAs), or linking groups including carbamates, amides, and linear and cyclic hydrocarbon groups.

[0114] In some examples, the stereochemistry at each of the phosphorus internucleotide bonds of the ASO backbone is random.In other examples, the stereochemistry at each of the phosphorus internucleotide bonds of the ASO backbone is controlled and not random.For example, US Patent No. 9,605,019 describes a method for independently selecting the handedness of chirality at each phosphorus atom in an oligonucleotide.In some examples, the composition or compositions used in the methods disclosed herein comprise pure diastereomeric ASO. In other examples, the composition comprises an ASO having a diastereomeric purity of at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to about 100%.

[0115] In some examples, the ASO has a non-random mixture of Rp and Sp configurations at the phospho-internucleotide linkages. In some examples, the ASO used in the compositions and methods disclosed herein comprises about 5-100% Rp, at least about 5% Rp, at least about 10% Rp, at least about 15% Rp, at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, at least about 40% Rp, at least about 45% Rp, at least about 50% Rp, at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp, at least about 80% Rp, at least about 85% Rp, at least about 90% Rp, or at least about 95% Rp (with the remainder being Sp), or about 100% Rp.

[0116] In some examples, the ASOs described herein contain a sugar moiety that includes ribose or deoxyribose, or a modified sugar moiety or sugar analog that includes a morpholine ring. Suitable examples of modified sugar moieties include, but are not limited to, 2'-substitutions, such as 2'-O-modifications, 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F, N3'→P5' phosphoramidate, 2'-dimethylaminooxyethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some examples, the sugar moiety modification is selected from among 2'-O-Me, 2'F, and 2'MOE. In other examples, the sugar moiety modification is an additional bridge linkage, such as a locked nucleic acid (LNA). In some examples, the sugar analog contains a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some examples, the sugar moiety includes a ribofuranyl or 2' deoxyribofuranyl modification. In some examples, the sugar moiety includes a 2'4'-restricted 2'-O-methyloxyethyl (cMOE) modification. In some examples, the sugar moiety includes a cEt2',4'-restricted 2'-O-ethyl BNA modification. In other examples, the sugar moiety includes a tricycloDNA (tcDNA) modification. In some examples, the sugar moiety includes an ethylene nucleic acid (ENA) modification. In some examples, the sugar moiety includes a 2'-O-(2-N-methylcarbamoylethyl) (MCE). Modifications are known in the art, as exemplified in the following: Jarver, et al., 2014, Nucleic Acid Therapeutics, 24(1):37 47.

[0117] In some instances, each of the constituent nucleotides of an ASO are similarly modified, for example, all of the bonds in the backbone of the ASO contain phosphorothioate linkages or each ribose sugar moiety contains a 2'-O-methyl modification. In other instances, ASOs that contain combinations of different modifications are used, for example, ASOs that contain phosphorodiamidate linkages in combination with sugar moieties that contain morpholine rings (morpholinos).

[0118] In some examples, the ASO comprises one or more backbone modifications. In some examples, the ASO comprises one or more sugar moiety modifications. In some examples, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some examples, the ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some examples, the ASO comprises a peptide nucleic acid (PNA).

[0119] In some examples, the ASO comprises a phosphorodiamidate morpholino (PMO).

[0120] Those skilled in the art will understand that ASOs can be modified to achieve desired properties or activities of ASOs or to reduce undesirable properties or activities of ASOs.In some examples, ASOs are modified to change one or more properties.For example, such modifications can increase the binding affinity to target sequences on pre-mRNA transcripts; reduce binding to any non-target sequences; reduce degradation by cellular nucleases (e.g., RNaseH); improve the uptake of ASOs into cells and / or specific intracellular compartments; change the pharmacokinetics or pharmacodynamics of ASOs; and / or modulate the in vivo half-life of ASOs.

[0121] In some examples, the ASO contains one or more 2'-O-(2-methoxyethyl) (MOE) phosphorothioate modified nucleotides, which have been shown to greatly increase the resistance of the ASO to nuclease degradation and improve bioavailability.

[0122] Methods for the synthesis and chemical modification of ASOs, as well as the synthesis of ASO conjugates, are well known in the art, and such ASOs are commercially available.

[0123] In some examples, compositions (e.g., pharmaceutical compositions) provided herein include two or more ASOs that differ in chemistry but are complementary to the same target portion of the 5'UTR of OPA1 mRNA. In other examples, there are two or more ASOs that are complementary to different target portions of the 5'UTR of OPA1 mRNA.

[0124] In some examples, compositions (e.g., pharmaceutical compositions) provided herein include two or more ASOs that differ in chemistry but are complementary to the same target portion of intron 7 of OPA1 pre-mRNA. In other examples, there are two or more ASOs that are complementary to different target portions of intron 7 of OPA1 pre-mRNA.

[0125] In some examples, compositions (e.g., pharmaceutical compositions) provided herein include two or more ASOs that differ in chemistry but are complementary to the same target portion of the 3'UTR of OPA1 mRNA. In other examples, there are two or more ASOs that are complementary to different target portions of the 3'UTR of OPA1 mRNA.

[0126] In some examples, the compositions disclosed herein include an ASO bound to a functional moiety. In some examples, the functional moiety is a delivery moiety, a targeting moiety, a detection moiety, a stabilizing moiety, or a therapeutic moiety. In some examples, the functional moiety includes a delivery moiety or a targeting moiety. In some examples, the functional moiety includes a stabilizing moiety. In some examples, the functional moiety is a delivery moiety.

[0127] Suitable delivery moieties include, but are not limited to, lipids, peptides, carbohydrates, and antibodies.

[0128] In some examples, the delivery moiety comprises a cell penetrating peptide (CPP). Suitable examples of CPPs are described, for example, in PCT / AU2020 / 051397. In some examples, the amino acid sequence of the CPP comprises or consists of RRSRTARAGRPGRNSSRPSAPRGASGGASG (SEQ ID NO: 2504). In one example, the CPP comprises the sequence RRSRTARAGRPGRNSSRPSAPRGASGGASG (SEQ ID NO: 2504), and optionally, the amino acids other than glycine are D-amino acids. In other examples, the delivery moiety comprises a receptor binding domain. In other examples, the delivery moiety comprises a carbohydrate. In some examples, the carbohydrate delivery moiety is selected from among N-acetylgalactosamine (GalNAc), N-Ac-glucosamine (GluNAc), and mannose. In one example, the carbohydrate delivery moiety is GalNAc.

[0129] In other examples, the delivery moiety comprises a lipid. Examples of lipids suitable as delivery moieties include, but are not limited to, cholesterol moieties, cholesteryl moieties, and aliphatic lipids. In some examples, the delivery moiety comprises a fatty acid or lipid moiety. In some embodiments, the length of the fatty acid chain is about C8 to C20. Examples of suitable fatty acid moieties and their conjugation to oligonucleotides can be found, for example, in International Patent Publication WO2019232255 and Prakash et al., (2019).

[0130] In further examples, the delivery moiety includes an antibody, for example, as described in Dugal-Tessier et al., (2021), J Clin Med., 10(4):838.

[0131] Suitable examples of stabilizing moieties include, but are not limited to, polyethylene glycol (PEG), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), and poly(2-oxazoline) (POx).

[0132] In some instances, when the ASO is linked to a functional moiety, the functional moiety is covalently linked to the ASO, while in other instances, the functional moiety is non-covalently linked to the ASO.

[0133] The functional moiety can be attached to one or more of any nucleotides in the ASO at any of several positions on the sugar, base, or phosphate group, for example, using a linker, as understood in the art and described in the literature. The linker can include a bivalent or trivalent branched linker. In some examples, the functional moiety is attached to the 5' end of the ASO. In other examples, the functional moiety is attached to the 3' end of the ASO. In further examples, the functional moiety is attached to the 5' and 3' ends of the ASO.

[0134] In some examples, a composition comprising any of the ASOs disclosed herein also comprises a delivery nanocarrier complexed with the ASO. In some examples, the delivery nanocarrier is selected from among lipoplexes, liposomes, exosomes, inorganic nanoparticles, and DNA nanostructures. In other examples, the delivery nanocarrier comprises a lipid nanoparticle that encapsulates the ASO. A variety of delivery ASO-nanocarrier complex formats are known in the art, for example, as reviewed in Roberts et al., supra.

[0135] Pharmaceutical Compositions Also provided herein are pharmaceutical compositions comprising any of the ASOs described above and modified messenger RNA (mmRNA) disclosed herein, formulated with at least a pharma- ceutically acceptable excipient (including a carrier, filler, preservative, adjuvant, solubilizer, and / or diluent).

[0136] The pharmaceutical composition containing any of the ASO compositions described herein for use in the methods disclosed herein can be prepared according to conventional methods well known in the pharmaceutical industry and described in the published literature.In some examples, the pharmaceutical composition for treating a subject comprises a therapeutically effective amount of any of the ASOs disclosed herein.

[0137] Pharmaceutically acceptable salts are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. Examples of pharma- ceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or organic acids (e.g., acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid). Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactate, and the like. Representative salts include tobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Additionally, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed, where appropriate, with counterions (e.g., halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates).

[0138] Exemplary salts useful in the compositions of the present disclosure include calcium chloride, magnesium chloride, or sodium chloride.

[0139] In one example, the composition comprises a buffer. Exemplary buffers useful in the compositions of the present disclosure include sodium phosphate.

[0140] In some examples, the pharmaceutical compositions are formulated into any of a number of possible dosage forms, including, but not limited to, ophthalmic emulsions, topical ointments, solutions for intravitreal injection, intravenous administration, intrathecal administration, intracisternal administration, tablets, capsules, gel capsules, liquid syrups, and softgels. In some examples, the compositions are formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. Suspensions may also contain stabilizers. In some examples, the pharmaceutical formulations disclosed herein are provided in forms including, but not limited to, solutions, emulsions, microemulsions, foams, or liposome-containing formulations (e.g., cationic or non-cationic liposomes).

[0141] In some examples, pharmaceutical formulations comprising any of the ASOs described herein may optionally include one or more penetration enhancers, carriers, excipients, or other active or inactive ingredients known to those skilled in the art. In some examples, when the pharmaceutical composition comprises liposomes, such liposomes may also comprise sterically stabilized liposomes, for example, liposomes comprising one or more special lipids. These special lipids result in liposomes with extended circulation life. In some examples, the sterically stabilized liposomes comprise one or more glycolipids or are derivatized with one or more hydrophilic polymers (e.g., PEG moieties). In some examples, surfactants are included in the pharmaceutical formulation.

[0142] In some examples, the pharmaceutical composition also includes a penetration enhancer to enhance delivery of the ASO (e.g., to facilitate diffusion across cell membranes and / or increase the permeability of lipophilic drugs). In some examples, the penetration enhancer includes a surfactant, a fatty acid, a bile salt, or a chelating agent.

[0143] In some examples, the pharmaceutical composition comprises an ASO at a dose of about 0.01 mg / kg to 20 mg / kg, e.g., 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 3 mg / kg, 5 mg / kg, 8 mg / kg, 10 mg / kg, 15 mg / kg, or another dose in the range of about 0.01 mg / kg to 20 mg / kg.

[0144] In some examples, the pharmaceutical composition comprises more than one ASO. In some examples, the pharmaceutical composition comprises, in addition to the ASO, another drug or therapeutic agent suitable for treating a subject suffering from glaucoma.

[0145] Combination therapy The pharmaceutical composition comprising any of the ASOs disclosed herein can also be used in combination with other drugs that have therapeutic value in the treatment of glaucoma.In general, the other drugs do not necessarily need to be administered in the same pharmaceutical composition, and can be administered by different routes because they have different physical and chemical properties.The determination of the mode of administration and, if possible, the appropriateness of administration in the same pharmaceutical composition are well within the knowledge of a skilled clinician.Initial administration can be performed according to established protocols known in the art, and then dosage, mode of administration, and administration time can be modified by a skilled clinician based on observed effects.

[0146] Compositions and pharmaceutical compositions comprising an ASO and an additional therapeutic agent may be administered simultaneously (e.g., simultaneously, essentially simultaneously, or within the same treatment protocol) or sequentially, depending on the stage and progression of the glaucoma to be treated, the condition of the patient, and the choice of the particular therapeutic agent used. The determination of the order of administration and the number of repeated administrations of each therapeutic agent in a treatment protocol is well within the knowledge of a skilled physician after evaluation of the glaucoma to be treated and the condition of the patient.

[0147] Those skilled in the art know that therapeutically effective dosages may vary when drugs are used in combination treatment. Methods for experimentally determining therapeutically effective dosages of drugs and other agents used in combination treatment regimens are described in the literature. For example, the use of metronomic dosing (i.e., administering lower doses more frequently to minimize toxic side effects) has been widely described in the literature. Combination treatments also include periodic treatments that start and end at different times to assist in the clinical management of patients.

[0148] In combination therapy, the dosages of the co-administered therapeutic agents will, of course, vary depending on the type of co-agent used, the ASO, and the stage of the disease in the patient being treated.

[0149] The pharmaceutical compositions comprising the ASO and additional therapeutic agent constituting the combination therapy disclosed herein may be in combined dosage form or in separate dosage forms intended for substantially simultaneous administration. The pharmaceutical compositions constituting the combination therapy may also be administered sequentially, with either therapeutic agent being administered in a regimen requiring two-step administration. The two-step administration regimen may require sequential administration of the active agents or spaced administration of the separate active agents. The time between the multiple administration steps may range from minutes to hours, depending on the properties of each agent (e.g., pharmaceutical potency, solubility, bioavailability, plasma half-life, and kinetic profile). Circadian variations of various physiological parameters may also be evaluated to determine optimal administration intervals.

[0150] Examples of therapeutic agents suitable for co-administration with the compositions or pharmaceutical compositions disclosed herein include, but are not limited to, prostaglandins (e.g., latanoprost (Xalatan®), travoprost (Travatan Z®), tafluprost (Zioptan®), bimatoprost (Lumigan®), and latanoprostenebund (Vyzulta®)), beta blockers (e.g., timolol (Betimol®, Istalol®, Timoptic®), and betaxolol (Betoptic®)), alpha adrenergic agonists (e.g., apraclonidine (Iopidine®), and brimonidine (Alphagan®), P, Qoliana®), carbonic anhydrase inhibitors (e.g., dorzolamide (Trusopt®) and brinzolamide (Azopt®)), rho kinase inhibitors (e.g., netarsudil (Rhopressa®)) and miotics or cholinergic agonists (e.g., pilocarpine (Isopto Carpine®)).

[0151] The present disclosure is not limited by the following non-limiting examples. EXAMPLES

[0152] Example 1: ASO design targeting exclusion of OPA1 NMD exon 7x ASO target regions of OPA1 intron 7 and exon 7x are shown in Figure 1A and C. ASOs of 24-25 nucleotides in length (Table 1, SEQ ID NOs: 2-9) are designed to target the intronic splice enhancer motif (predicted using SpliceAid online tool) in intron 7 to mediate the exclusion of exon 7x and generate a highly productive OPA1 transcript. Identified ASO sequences are synthesized as PMO and / or 2'MOE chemistry and nucleofected into HEK293 cells or fibroblasts of ADOA patients harboring an OPA1 mutation (c.2708_2711delTTAG) at 25 μM and 50 μM using the NEON® Electroporation System (ThermoFisher). Nucleofected cells are cultured for 48 h. Total RNA was extracted using MagMAX™-96 Total RNA Isolation Kit, and OPA1 transcript levels were assessed by digital droplet PCR (Qiagen, probe catalog number: dHsaCPE5043545). OPA1 transcript expression is normalized to GAPDH, RPL27, and SCL25A3 transcript levels (Qiagen, probe catalog numbers: dHsaCPE5031596, dHsaCPE5036407, dHsaCPE5032926, respectively). The results of the ASO screening are shown in Figure 2. Furthermore, PMOs showing induction of OPA1 mRNA levels were validated for their ability to increase OPA1 protein upregulation using Western blot assays, as shown in Figure 3. Further refinements of the ASO sequences (Figure 4, Table 1, SEQ ID NOs: 10-31; Table 2, SEQ ID NOs: 32-54) will be performed to shorten or lengthen the ASO length and microwalk or artificial mismatch oligos and re-validated by ddPCR and protein assays. The efficacy of purified ASOs in inducing upregulation of OPA1 is shown in Figures 5 and 6.

[0153] Example 2. ASO design targeting the 5'UTR of the OPA1 transcript Design ASOs (Table 3, SEQ ID NOs: 56-116) of 18-25 nucleotides in length to sterically inhibit uORFs or reduce the complexity of the RNA secondary structure in the 5'UTR. Use the RNAfold online tool to predict the RNA secondary structure. Synthesize the identified ASO sequences as PMO and / or 2'MOE chemistry and nucleofect them into HEK293 cells or fibroblasts of ADOA patients harboring an OPA1 mutation (c.2708_2711delTTAG) at 25 μM and 50 μM using the NEON® Electroporation System (ThermoFisher). Nucleofected cells were cultured for 48 h. Total protein is collected from transfected cells using CytoBuster protein extraction reagent (Merck Millipore) according to the manufacturer's instructions and assessed in a Western blot assay using rabbit anti-OPA1 monoclonal antibody (Cell Signaling, Cat. No. 67589) diluted 1:250 in 5% BSA in TBST buffer, followed by goat anti-rabbit IgG H&L antibody (Abcam, Cat. No. ab216773, IRDye® 800CW). Beta-actin serves as a loading control and is detected using a monoclonal mouse anti-beta-actin antibody (Sigma-Aldrich, Cat. No. A5441), followed by goat anti-mouse IgG H&L antibody (Abcam, Cat. No. ab216776, IRDye® 680RD). Additionally, ASO sequences are modified with microwalks or artificial mismatch oligos and / or extended up to 30 nucleotides (Table 3, SEQ ID NOs. 117-138). The ASO was then revalidated using a Western blot assay, and the results are shown in Figure 7.

[0154] Example 3. ASO design targeting the 3'UTR to increase OPA1 expression levels To mediate RNA stability enhancement, a 25mer (Table 4, SEQ ID NOs: 140-1312) or 17mer (Table 5, SEQ ID NOs: 1313-2488) ASO sequence "microwalk" is performed at 3 bp increments of distance across the sequence of the 3'UTR of the ENST00000361510 transcript. ASOs are screened to guide ASO selection for OPA1 expression upregulation using ddPCR and Western blot assays as described in Examples 1 and 2.

[0155] Example 4. PPMO-mediated OPA1 upregulation to improve mitochondrial ATP production PMO OPA1 H1A(+10+32)1mm10C>T (SEQ ID NO:112) was conjugated with CPP to enhance delivery to cells. CPP-PMO (or PPMO) was tested for its ability to improve OPA1 protein upregulation in fibroblasts from ADOA patients with different OPA1 mutations. PPMO was incubated with patient fibroblasts and Western blot assay was used to evaluate the effectiveness of PPMO-induced OPA1 upregulation. Total protein was collected from transfected cells using RIPA buffer (ThermoFisher) according to the manufacturer's instructions and evaluated by Western blot assay using rabbit anti-OPA1 monoclonal antibody (Cell Signaling Technology, Cat. No. 67589) diluted 1:250 with 5% BSA in TBST buffer, followed by goat anti-rabbit IgG H&L antibody (Abcam, Cat. No. ab216773, IRDye® 800CW). HPRT1 served as a loading control and was detected using HPRT1 polyclonal antibody (ProteinTech, Cat. No. 15059-1-AP). OPA1 protein expression levels were compared between PPMO-transfected cells (UT) and cells incubated with OPA1 PPMO. Figure 8 shows that PPMO showed upregulation of OPA1 protein expression compared to untreated patient fibroblasts (n=3 biological replicates). In addition, PPMO-treated cells were evaluated for improved mitochondrial function using a CellTiter-Glo® assay to assess ATP levels. PPMO-treated cells were cultured in glucose-starved conditions supplemented with 5 mM pyruvate (Cat. No. 11360070, ThermoFisher) to continuously supply substrates for the mitochondrial respiratory chain reaction, while glycolysis was inhibited using 2.5 mM D-deoxyglucose (Cat. No. D8375, Sigma-Aldrich). An ATP standard curve was analyzed using 14.7–10,000 nM ATP (catalog no. R0441, ThermoFisher).The results in FIG. 9 show improved mitochondrial ATP production in patient fibroblasts treated with PPMO (SEQ ID NO: 112) targeting the 5′UTR of the OPA1 transcript.

[0156] Example 5. PPMO treatment induces total OPA1 protein in RGC-enriched cultures from ADOA patients PPMO OPA1 H1A(+10+32)1mm10C>T (SEQ ID NO: 112) was incubated in triplicate with iPSC-RGCs from ADOA patients with OPA1 mutation (c.985-1G>A) for 120 hours. Total protein was collected from transfected cells using CytoBuster protein extraction reagent (Merck Millipore) according to the manufacturer's instructions and assessed in a Western blot assay using rabbit anti-OPA1 monoclonal antibody (Cell Signaling Technology, Cat. No. 67589) diluted 1:250 in 5% BSA in TBST buffer, followed by goat anti-rabbit IgG H&L antibody (Abcam, Cat. No. ab216773, IRDye® 800CW). Beta-actin served as a loading control and was detected using a monoclonal mouse anti-beta-actin antibody (Sigma-Aldrich, Cat. No. A5441) followed by a goat anti-mouse IgG H&L antibody (Abcam, Cat. No. ab216776, IRDye® 680RD). Figure 10 shows PPMO-mediated upregulation of total OPA1 protein up to 1.3-fold at 10 μM compared to untreated patient fibroblasts. Student's t-test was used for statistical analysis. array SEQ ID NO:1: OPA1 intron 7 (lowercase) and exon 7X (uppercase) cDNA sequence (GRCh38 / hg38: chr3 193626203-193628616) [Table 1] [Table 2] Sequence ID55: cDNA sequence of the 5'UTR of the OPA transcript (GRCh38 / hg38:chr3 193593064-193593380). GTCCGTTCCCGACGCACTGTGCGCATGCGCTGGTCCTCCGCGGACCGTTCGTGCTGCCCGCCTAGAAAGGGTGAAGTGGTTGTTTCCGTGACGGACTGAGTACGGGTGCCTGTCAGGCTCTTGCGGAAGTCCATGCGCCATT GGGAGGGCCTCGGCCGCGGCTCTGTGCCCTTGCTGCTGAGGGCCACTTCCTGGGTCATTCCTGGACCGGGAGCCGGGCTGGGGCTCACACGGGGGCTCCCGCGTGGCCGTCTCGGCGCCTGCGTGACCTCCCCGCCGGCGGG [Table 3-1] [Table 3-2] [Table 3-3] Sequence ID 139: cDNA sequence of the 3'UTR located within exon 30 of the OPA transcript (GRCh38 / hg38:chr3 193694606-193697811)

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

Table 4-6

Table 4-7

Table 4-8

Table 4-9

Table 4-10

Table 4-11

Table 4-12

Table 4-13

Table 4-14

Table 4-15

Table 4-16

Table 4-17

Table 4-18

Table 4-19

Table 4-20

Table 4-21

Table 4-22

Table 4-23

Table 4-24

Table 4-25

Table 4-26

Table 4-27

Table 4-28

Table 4-29

Table 4-30

Table 4-31

Table 4-32

Table 4-33

Table 5-1

Table 5-2

Table 5-3

Table 5-4

Table 5-5

Table 5-6

Table 5-7

Table 5-8

Table 5-9

Table 5-10

Table 5-11

Table 5-12

Table 5-13

Table 5-14

Table 5-15

Table 5-16

Table 5-17

Table 5-18

Table 5-19

Table 5-20

Table 5-21

Table 5-22

Table 5-23

Table 5-24

Table 5-25

Table 5-26

Table 5-27

Table 5-28

Table 5-29

Table 5-30

Table 5-31

Table 5-32

Table 5-33

Table 5-34

Claims

1. A pharmaceutical composition comprising an antisense oligonucleotide for treating and / or delaying the progression of a target glaucoma, wherein the antisense oligonucleotide increases the level of OPA1 mRNA or the amount of functional OPA1 protein in the target cells and / or tissues.

2. (i) the amount of functional OPA1 protein in the cells and / or tissue increases by about 1.1 to about 10 times; and / or, (ii) The tissue is selected from the group consisting of the retina, retinal pigment epithelium, and combinations thereof. The pharmaceutical composition according to claim 1.

3. The antisense oligonucleotide is It binds to a target region of the 5' untranslated region (UTR) of the intracellular OPA1 gene transcript to enhance the translation efficiency of OPA1 mRNA and / or improve the stability of the transcript. Here, the target portion is located within the nucleotide sequence corresponding to Sequence ID No.

55. The pharmaceutical composition according to claim 1 or 2.

4. The pharmaceutical composition according to claim 1, wherein the antisense oligonucleotide includes main chain modification.

5. The antisense oligonucleotide is (i) phosphorothioate linkage or phosphorodiamidate linkage, (ii) Phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl, 2'-fluoro, or 2'-O-methoxyethyl moiety, (iii) at least one modified sugar moiety, and / or (iv) 2'-O-methoxyethyl moiety, The pharmaceutical composition according to claim 4, comprising:

6. Each sugar moiety in the antisense oligonucleotide is a modified sugar moiety, and / or Each nucleotide in the antisense oligonucleotide contains a 2'-O-methoxyethyl moiety. The pharmaceutical composition according to claim 5.

7. The nucleotide sequence of the antisense oligonucleotide consists of 10-50 nucleotides, 15-40 nucleotides, 18-40 nucleotides, 17-25 nucleotides, 20-35 nucleotides, 20-30 nucleotides, 22-30 nucleotides, 22-28 nucleotides, 24-30 nucleotides, 25-30 nucleotides, or 26-30 nucleotides, or The nucleotide sequence of the antisense oligonucleotide consists of 20 to 30 nucleotides. The pharmaceutical composition according to claim 1 or 2.

8. The pharmaceutical composition according to claim 1 or 2, wherein the antisense oligonucleotide comprises one or more phosphorodiamidate morpholino moieties.

9. The antisense oligonucleotide is bound to the functional portion, The aforementioned functional part (i) including or consisting of a delivery portion or a stabilization portion, (ii) Covalently or non-covalently bonded to the antisense oligonucleotide, and / or (iii) Bound to the 5' end of the antisense oligonucleotide, or bound to the 3' end of the antisense oligonucleotide, The pharmaceutical composition according to claim 1 or 2.

10. The antisense oligonucleotide is bonded to a functional portion which includes or consists of a delivery portion, The aforementioned delivery portion, (i) Selected from the group consisting of lipids, peptides, carbohydrates, and antibodies, and / or (ii) A cell-permeable peptide (CPP) or N-acetylgalactosamine (GalNAc) moiety, The pharmaceutical composition according to claim 1 or 2.

11. The pharmaceutical composition according to claim 1 or 2, wherein the nucleotide sequence of the antisense oligonucleotide is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the nucleotide sequence of the target portion over the length of the antisense oligonucleotide, and / or corresponds to Sequence ID No.

112.

12. The pharmaceutical composition according to claim 1 or 2, wherein the antisense oligonucleotide is formulated for an administration route selected from the group consisting of intravitreous, choroidal, subretinal, ciliary muscle, intravenous, intraarterial, subcutaneous, and local routes.

Images