Methods of Treating SCN2A-Associated Disorders Using Oligomeric Compounds
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-03-28
- Publication Date
- 2026-04-06
AI Technical Summary
Current treatments for early-onset developmental and epileptic encephalopathy (DEE) associated with SCN2A mutations are ineffective, leading to severe seizures, developmental delays, and high mortality rates, with a significant adverse event profile and limited efficacy.
The use of oligomeric compounds, specifically SCN2A-related oligomeric compounds, which can be used in therapeutic methods to target and modify the expression of the SCN2A gene, thereby reducing the severity of symptoms associated with SCN2A-related disorders.
The oligomeric compounds demonstrate the ability to knockdown SCN2A mRNA and protein in mouse models, leading to improved survival rates and reduced seizure frequency, potentially offering a more effective treatment for SCN2A-related disorders compared to existing therapies.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 324,531, filed March 28, 2022, and U.S. Provisional Patent Application No. 63 / 335,152, filed April 26, 2022. The entire contents of each of the foregoing applications are incorporated herein by reference.
[0002] The present disclosure relates in certain aspects to compositions and methods of using SCN2A oligomeric compounds to treat SCN2A-associated disorders, including developmental and epileptic encephalopathies, such as early onset developmental and epileptic encephalopathies, in subjects in need thereof. [Background technology]
[0003] The human gene SCN2A encodes the human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, including developmental and epileptic encephalopathies (DEE), such as early-onset DEE. Early-onset DEE is caused by gain-of-function (GoF) variants in the SCN2A gene, which encodes the voltage-gated sodium channel NaV1.2. It is a rare, severe, and life-threatening condition characterized by drug-resistant epilepsy with seizure onset widely reported in the first 3 months of life (Wolff et al 2017, Wolff et al 2019). In addition to frequent seizures, patients with early-onset DEE have severe developmental disabilities and extensive comorbidities, including limited non-verbal communication in most children; autonomic dysfunction; developmental delay; GI abnormalities; movement disorders, e.g., choreoathetosis, dystonia, ataxia; anxiety; sensory problems; urinary retention problems; and impaired quality of life resulting from (and characterized by) severe irritability, various sleep problems (e.g., difficulty falling asleep and staying asleep), behavioral problems, frequent ER visits and hospitalizations, and total dependency on caregivers. In a study that retrospectively collected real-world data, 10 out of 15 (66.7%) patients with early-onset DEE had experienced an average of 4 status epilepticus episodes, ranging from 1 to 33 episodes (Dalby et al., 2021). A significant number of early mortality in patients with DEE, especially those with early onset, has been reported in published cases with reported causes including sudden unexpected death in epilepsy (SUDEP), severe infections such as pneumonia, and autonomic dysfunction (Wolff et al., 2019, Wolff et al., 2017). Furthermore, in an ongoing natural history study, mortality in DEE due to status epilepticus or SUDEP occurred in 29% of early onset patients (ongoing natural history study, archived data).
[0004] DEE includes a broad range of disorders including neonatal and early infantile DEE, e.g., Ohtahara syndrome, and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and pediatric DEE, e.g., West syndrome and Lennox-Gastaut syndrome; Dravet syndrome; idiopathic / generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic atonic epilepsy (MAE); migrating partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine with or without epilepsy (Wolff,M.,et al.,2019; Harkin,LA,et al.,2007,Brain 130,843-852; Escayg,A.,et al.,2010,Epilepsia 51,1650-1658; Miller IO,et al.,2007 Nov 29[updated 2019 Apr 18]; Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020).
[0005] In addition to DEE, including early-onset DEE, mutations in SCN2A have also been associated with other neurodevelopmental and intellectual diseases and disorders, such as late-onset epileptic encephalopathy and benign familial neonatal-infantile seizures (BFNIS), as well as intellectual disability (ID) with or without seizures, and / or autism spectrum disorder (ASD) (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336).
[0006] Symptoms and characteristics associated with DEE include seizures, hypotonia, sensory problems, such as sensory integration disorders, motor developmental delays and dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delays, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy. Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, tonic seizures (often lasting more than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, fainting, focal, blunting, and tonic) (Guzzetta, F., 2011, Epilepsia 52:S2,35-38; Anwar et al., 2019, Cureus 11,e5006; Wolff et al., 2019). Symptoms and characteristics associated with ID and ASD include delayed motor development, delayed social and language milestones, repetitive behaviors, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019). There are no approved therapies specific to the treatment of patients with early-onset DEE. The current standard of care for the treatment of seizures in early-onset DEE includes polytherapy with multiple sodium channel blockers and anticonvulsants from other mechanistic classes. This approach offers limited efficacy with a significant adverse event profile. Moreover, it has been further recognized that current treatments target seizures, do not affect other aspects of the DEE phenotype, and there is a strong need for new therapies that offer improved seizure efficacy with the potential for clinical benefit for other conditions. [Prior art documents] [Non-patent literature]
[0007] [Non-Patent Document 1] Harkin, LA, et al., 2007, Brain 130, 843-852 [Non-Patent Document 2] Escayg, A., et al., 2010, Epilepsia 51, 1650-1658 [Non-Patent Document 3] Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020 [Non-Patent Document 4] Wolff, M., et al., 2019, Epilepsia 60, S59-S67 [Non-Patent Document 5] Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456 [Non-Patent Document 6] Wolff, M., et al., 2017, Brain 140, 1316-1336 [Non-Patent Document 7] Guzzetta, F., 2011, Epilepsia 52:S2, 35-38 Summary of the Invention
[0008] Provided herein are oligomeric compounds, methods, and pharmaceutical compositions for treating an SCN2A-associated disorder in a subject.
[0009] In certain embodiments, the SCN2A-associated disorder is an early onset developmental or epileptic encephalopathy (DEE). In certain embodiments, the SCN2A-associated disorder is a DEE, including, for example, Ohtahara syndrome; epilepsy with migrating focal seizures of infancy (EIMFS); infantile and pediatric DEE, such as West syndrome and Lennox-Gastaut syndrome; Dravet syndrome; idiopathic / generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic atonic epilepsy (MAE); migratory partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine with or without epilepsy. In certain embodiments, the SCN2A-associated disorder is late onset seizure-onset epileptic encephalopathy. In certain embodiments, the SCN2A-associated disorder is benign familial neonatal-infantile seizures. In certain embodiments, the SCN2A-associated disorder is intellectual disability (ID). In certain embodiments, the SCN2A-associated disorder is an autism spectrum disorder (ASD).
[0010] The oligomeric compounds described in this application can be used in therapeutic methods.In certain embodiments, the oligomeric compounds are paired with a second oligomeric compound that is complementary to the first oligomeric compound.In certain embodiments, the oligomeric compounds are single-stranded oligomeric compounds that are not paired with a second oligomeric compound, such as the antisense oligonucleotides described herein.In certain embodiments, the oligomeric compounds useful for treating SCN2A-related disorders are modified oligonucleotides, such as the modified antisense oligonucleotides described herein.
[0011] Also provided are useful methods for improving at least one symptom or characteristic of an SCN2A-related disorder, such as early-onset DEE, in a subject in need thereof. In certain embodiments, the symptom or characteristic includes one or more of seizures, hypotonia, sensory problems, such as sensory integration disorders, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, such as choreoathetosis, dystonia, and ataxia, anxiety, sensory problems, urinary retention problems, irritability, behavioral problems, visual dysfunction, language and speech delays, gastrointestinal disorders (e.g., gastroesophageal reflux disease, diarrhea, constipation, movement disorders, etc.), neurodevelopmental delays, sleep problems, unexpected death in epilepsy, motor developmental delays, delayed social milestones, repetitive behaviors, and uncoordinated oral movement. In certain embodiments, seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, persistent seizures (often lasting more than 10 minutes), and recurrent seizures (e.g., convulsive, myoclonic, syncope, focal, blunt state, and tonic seizures). [Brief description of the drawings]
[0012] [Figure 1] Panel A is a graph showing SCN2A mRNA knockdown in the brain of an R1883Q mutant mouse 14 days after intraventricular administration of an exemplary oligomeric compound (SCN2A ASO) described herein. Panel B is a graph showing SCN2A protein knockdown in the brain of an R1883Q mutant mouse 14 days after intraventricular administration of an exemplary oligomeric compound (SCN2A ASO) described herein. [Diagram 2] 1 is a graph demonstrating that a single dose of an exemplary oligomeric compound described herein (SCN2A ASO) increases survival over standard of care in SCN2A GoF mice. [Diagram 3]Panel A is a graph showing that a single dose of an exemplary oligomeric compound described herein (SCN2A ASO) increases survival in SCN2A GoF mice. Panel B is a graph showing that re-administration of an exemplary oligomeric compound described herein (SCN2A ASO) significantly extends survival in SCN2A GoF mice. [Figure 4] 1 is a graph showing that an exemplary oligomeric compound described herein (SCN2A ASO) extends survival of SCN2A GoF mice when administered after disease onset. [Figure 5-1] Panel A is a diagram of IEDs detected in an 11-year-old with early-onset SCN2A DEE. [Figure 5-2] Panel B is a bar graph showing IED burden in subjects of different ages with early-onset SCN2A DEE and age-matched healthy controls. [Figure 6] 1 is a graph showing the results of PK / PD modeling of exemplary oligomeric compounds described herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0013] It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. In this application, the use of the singular includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Also, unless otherwise specified, terms such as "element" or "component" encompass both elements and components that include one unit and elements and components that include more than one subunit.
[0014] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.
[0015] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.
[0016] Unless stated otherwise, the following terms have the following meanings.
[0017] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).
[0018] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.
[0019] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.
[0020] As used herein, "2'-OMe" means a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" means a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.
[0021] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.
[0022] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means a sugar moiety that includes at least one 2'-substituent group other than H or OH.
[0023] As used herein, "5-methylcytosine" means a cytosine modified by the attachment of a methyl group at position 5. 5-methylcytosine is a modified nucleobase.
[0024] As used herein, "administering" means providing a pharmaceutical agent to a subject.
[0025] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.
[0026] As used herein, "antisense compound" refers to an oligomeric compound capable of achieving at least one antisense activity. Antisense compounds include an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0027] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.
[0028] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0029] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of an antisense compound that can hybridize with a target nucleic acid and has at least one antisense activity.Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
[0030] As used herein, "ameliorate" in relation to treatment means an improvement in at least one symptom or characteristic, compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of a symptom or characteristic, or a slowing or delay in the progression in the severity or frequency of a symptom or characteristic. In certain embodiments, the symptom or characteristic is seizures, hypotonia, sensory problems, such as sensory integration disorders, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delay, gastrointestinal disorders (e.g., gastroesophageal reflux disease, diarrhea, constipation, dysmotility, etc.), neurodevelopmental delay, sleep problems, unexpected death in epilepsy, motor developmental delay, delayed social milestones, repetitive behavior, uncoordinated oral movement. In certain embodiments, seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, persistent seizures (often lasting more than 10 minutes), and recurrent seizures (e.g., convulsive, myoclonic, syncope, focal, blunt state, and tonic seizures).
[0031] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.
[0032] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0033] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
[0034] As used herein, a "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, eg, inside a cell, animal, or human.
[0035] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. As used herein, complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to another oligonucleotide or a target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or at every nucleoside if the oligonucleotides are the same length.
[0036] As used herein, "conjugate group" refers to a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that connect the conjugate moieties to the oligonucleotide.
[0037] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.
[0038] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
[0039] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.
[0040] As used herein, "cEt" means a 4' to 2' bridge in place of the 2'OH-group of the ribosyl sugar moiety, the bridge having a formula of 4'-CH(CH3)-O-2', and the methyl group of the bridge being in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety having a 4' to 2' bridge in place of the 2'OH-group of the ribosyl sugar moiety, the bridge having a formula of 4'-CH(CH3)-O-2', and the methyl group of the bridge being in the S configuration. "cEt" means constrained ethyl.
[0041] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.
[0042] As used herein, "chirally enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereoirregular. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereoirregular chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds that contain modified oligonucleotides.
[0043] As used herein, "chiral controlled" with respect to an internucleoside linkage means that the chirality at that linkage is enriched for a particular stereochemical configuration.
[0044] As used herein, a "deoxy region" refers to a region of 5-12 contiguous nucleotides, in which at least 70% of the nucleosides are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.
[0045] As used herein, a "gapmer" refers to a modified oligonucleotide that includes an internal region having multiple nucleosides that support RNase H cleavage and that are located between external regions having one or more nucleosides, where the nucleosides that make up the internal region are chemically distinct from the nucleosides that make up the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as "wings" or "wing segments." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting starting from the 5' end of the internal region. Unless otherwise specified, a "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap includes one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed winged gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow a gapmer pattern of sugar modifications.
[0046] As used herein, a "hot spot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.
[0047] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.
[0048] As used herein, the terms "in some embodiments," "in other embodiments," and the like refer to embodiments of all aspects of the disclosure unless the context clearly indicates otherwise.
[0049] As used herein, "internucleoside linkage" refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0050] As used herein, "linker-nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of an oligomeric compound. The linker-nucleoside is not considered part of the oligonucleotide portion of the oligomeric compound, even if it is adjacent to the oligonucleotide.
[0051] As used herein, "LNA" refers to a locked nucleic acid. An "LNA sugar moiety" is a bicyclic sugar moiety having a 4' to 2' bridge in place of the 2'OH group of the furanosyl sugar moiety, the formula of the bridge being 4'-CH2-O-2'. "LNA" refers to a locked nucleic acid. In some embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. As used herein, "LNA nucleoside" refers to a nucleoside comprising an LNA sugar moiety.
[0052] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification such as a substituent that does not form a bridge between two atoms of the sugar to form a second ring.
[0053] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first oligonucleotide are not complementary to the corresponding nucleobases of a second oligonucleotide or a target nucleic acid when the first and second oligonucleotides are aligned.
[0054] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0055] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or internucleoside linkage modifications.
[0056] As used herein, "nucleoside" refers to a compound or fragment of a compound that includes a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between them that are linked).
[0057] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound can be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or can be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex can be referred to as a "double-stranded oligomeric compound".
[0058] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside bonds, where each nucleoside and internucleoside bond can be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.
[0059] As used herein, "a pharma- ceutically acceptable carrier or diluent" refers to any substance suitable for use in administration to a subject. Certain such carriers can formulate the pharmaceutical composition as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharma- ceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.
[0060] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
[0061] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a particular cell line.
[0062] As used herein, "prodrug" refers to a form of a therapeutic agent outside the body that is converted to a different form within the subject or cells thereof. Typically, the conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.
[0063] As used herein, "reduce the amount," "reduce the activity," "reducing the amount," or "reducing the activity" refers to a reduction or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete elimination of transcriptional expression or activity.
[0064] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.
[0065] As used herein, "RNAi compound" refers to an antisense compound that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, RNAi compounds regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.
[0066] As used herein, the term "SCN2A-associated disorder" refers to a disease or disorder associated with a mutation in the SCN2A gene, including developmental and epileptic encephalopathies (DEE), including early-onset DEE, Ohtahara syndrome, and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, including West syndrome and Lennox-Gastaut syndrome; Dravet syndrome; idiopathic / generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic atonic epilepsy (MAE); migrating partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine with or without epilepsy. Other SCN2A disorders include, for example, late-onset epileptic encephalopathy and benign familial neonatal-infantile seizures (BFNIS), as well as intellectual disability (ID) with or without seizures, and / or autism spectrum disorder (ASD).
[0067] As used herein, the term "early onset developmental and epileptic encephalopathies" encompasses SCN2A-related disorders as defined herein.
[0068] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that hybridizes at least partially with itself.
[0069] As used herein, "standard in vitro assay" means the assay described in Example 1 and reasonable variations thereof.
[0070] As used herein, "standard in vivo assay" refers to the assay described in Example 8 and reasonable variations thereof.
[0071] As used herein, "stereoirregular chiral center" in the context of a population of molecules of the same molecular formula means a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereoirregular chiral center, the number of molecules that have the stereoirregular chiral center in the (S) configuration may be, but is not necessarily, the same as the number of molecules that have the stereoirregular chiral center in the (R) configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereoirregular chiral center is a stereoirregular phosphorothioate internucleoside linkage.
[0072] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.
[0073] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0074] As used herein, "sugar surrogate" refers to a modified sugar group having a group other than a furanosyl group that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.
[0075] As used herein, "symptom or feature" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or to a medical professional examining or testing the subject. In certain embodiments, the feature is evident upon invasive diagnostic testing, including but not limited to post-mortem examination. In certain embodiments, the feature is evident on a brain MRI scan.
[0076] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid against which an antisense compound is designed to act. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.
[0077] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0078] As used herein, "terminal group" means a group of chemical groups or atoms covalently attached to the end of an oligonucleotide.
[0079] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates a symptom or characteristic of a disease or disorder.
[0080] As used herein, "treat", "treating" and "treatment" refer to improving a disease or disorder in a subject by administering an oligomeric agent or oligomeric compound described herein. In some embodiments, "treat", "treating" and "treatment" refer to reducing the severity of a disease or disorder in a subject, including delaying or slowing the progression of a disease or disorder ("therapeutic treatment"), or achieving a beneficial or desired clinical outcome. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms; reduction in the extent of a disease or disorder; stabilization (i.e., not worsening) of a disease or disorder, delaying or slowing the onset of progression of a disease or disorder; amelioration or remission (whether partial or complete) of a disease or disorder state, whether detectable or undetectable; restoration of at least one measurable physical parameter, not necessarily discernible by the subject; and improvement or amelioration of a disease or disorder. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes extending survival compared to expected survival in the absence of treatment. In certain embodiments, treating a subject ameliorates a symptom as compared to the same symptom in the absence of treatment, hi certain embodiments, treating reduces the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
[0081] As used herein, the terms "prevent," "preventing," and "prevention" refer to actions taken before a subject begins to suffer from a particular disease, disorder, or condition ("prophylactic treatment").
[0082] I. Specific Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (including modified sugar moieties and / or modified nucleobases) and / or at least one modified internucleoside linkage.
[0083] A. Certain Modified Nucleosides A modified nucleoside comprises a modified sugar moiety, or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.
[0084] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to those of other types of modified sugar moieties.
[0085] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm) -alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), or OCH2C(=O)-N(Rm)(Rn), where each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl, and the 2'-substituents are described in Cook et al., US6,531,584, Cook et al., US5,859,221, and Cook et al., US6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include more than one non-bridging sugar substituent, such as, for example, 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157, and Rajeev et al., US2013 / 0203836.
[0086] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl.
[0087] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0088] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0089] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position compared to 2'-deoxyfuranosyl sugar moieties, and therefore such sugar moieties have a total of 16 possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.
[0090] Certain modified sugar moieties include substituents that bridge two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring.Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE"), and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686; al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2', and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2', and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,741,457, and Swayze et al., US 8,022,193), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2', and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, Ra, and Rb is independently H, a protecting group, or C1-C12 alkyl (see, e.g., Imanishi et al., US7,427,672).In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-. x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is independently H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, a substituted C1-C12 aminoalkyl, or a protecting group.
[0091] The molecular weight of the particles was obtained by analyzing the solvent and was reported by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490; al.US6,770,748; Imanishi et al.,USRE44,779; Wengel et al.,US6,794,499; al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO2004 / 106356 al.,WO1999 / 014226;Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. .
[0092] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in the exemplary embodiments of this specification, they are in the β-D configuration unless otherwise specified.
[0093] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2'-bridging sugars).
[0094] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, for example, with a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom, and substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733, and Bhat et al., US 7,939,677), and / or substitutions at the 5'-position.
[0095] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered ring tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and additional modified THP compounds having the formula: [ka] Independently, for each modified THP nucleoside, Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H, or C1-C6 alkyl.
[0096] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0097] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685, Summerton et al., US 5,166,315, Summerton et al., US 5,185,444, and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]
[0098] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents from the morpholino structures above. Such sugar surrogates are referred to herein as "modified morpholinos."
[0099] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0100] Many other bicyclic and tricyclic sugars and sugar-substituted ring systems are known in the art that can be used in modified nucleosides.
[0101] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobase, and is called abasic nucleoside.
[0102] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8 -substituted purine, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0103] Publications teaching the specific preparation of the above and other modified nucleobases include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.
[0104] 3. Specific modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside bond.Two main classes of internucleoside linking groups are defined by the presence or absence of phosphorus atom.Exemplary phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiesters, including phosphodiester bonds ("P(O2)=O") (also referred to as unmodified or naturally occurring bonds), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P(O2)=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.
[0105] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereoirregular internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate internucleoside linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereoirregular. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, as will be well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 99% of the molecules in the population. Chirally enriched populations of such modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 2003, 125, 8307; Wan et al. Nuc. Acid. Res., 2014, 42, 13456; and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereoregular or of a specific stereochemical configuration.
[0106] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 component moieties.
[0107] B. Specific motifs In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and different modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modification to the nucleobases independent of the sequence of the nucleobases).
[0108] 1. Specific glycomotifs In certain embodiments, oligonucleotides contain one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide, or portions thereof, in defined patterns or sugar motifs, including, but not limited to, any of the sugar modifications discussed herein.
[0109] In certain embodiments, modified oligonucleotides have a gapmer motif defined by two exterior regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).
[0110] In certain embodiments, the wings of the gapmer comprise between 1 and 6 nucleosides. In certain embodiments, each nucleoside of each wing of the gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of the gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of the gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of the gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of the gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of the gapmer comprise a modified sugar moiety.
[0111] In certain embodiments, the gapmer gap comprises between 7 and 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least six nucleosides of the gapmer gap comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.
[0112] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, at least six nucleosides of the gap of a gapmer comprise a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety.
[0113] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of a fully modified portion of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, where each nucleoside within a fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.
[0114] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is of each sugar moiety of each wing, with the gap nucleosides including a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of 5 linked nucleosides with modified sugar moieties in the 5'-wing, 8 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked nucleosides with modified sugar moieties in the 3'-wing. A mixed wing gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing. A 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5'-wing and / or 3'-wing.
[0115] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
[0116] In certain embodiments, modified oligonucleotides have the following sugar motifs (5' to 3'): eeeeedyddddddddeeeee, eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, eeeeeeddddddddddeeee, or eeeeeddddddddddeeeee, where "d" represents a 2'-deoxyribosyl sugar moiety, "e" represents a 2'-MOE sugar moiety and "y" represents a 2'-OMe sugar moiety.
[0117] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
[0118] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within three nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within three nucleosides of the 5'-end of the oligonucleotide.
[0119] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0120] 3. Specific internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereoirregular phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate internucleoside linkages are stereoirregular. In certain embodiments, all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
[0121] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sooosssssssssssss, sooooossssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, soooossssssssss, sooooosssssssss, or soooosssssssssss (5' to 3') where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0122] C. A specific length It is possible to increase or decrease the length of the oligonucleotide without compromising activity. For example, in Woolf et al (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of a target nucleic acid, albeit to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including oligonucleotides with 1 or 3 mismatches.
[0123] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the smallest number of nucleosides in the range, and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13 ...3-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 12-31, 12-32, 6 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~2 8 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces , 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces , 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces, 17~30 pieces,18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19~27 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, It is composed of 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
[0124] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif can be modified or unmodified, and can or can not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing region of the sugar gapmer can be the same as each other or different, and can be the same as or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides can contain one or more modified nucleobases, independent of the gapmer pattern of sugar modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.
[0125] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereoirregular population or a chiral enriched population. All of the chiral centers of the modified oligonucleotides are stereoirregular in a stereoirregular population. In a chiral enriched population, at least one specific chiral center is not stereoirregular in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereoirregular. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for both β-D ribosyl sugar moieties in a specific stereochemical configuration and at least one specific phosphorothioate internucleoside linkage.
[0126] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or the entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.
[0127] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both termini of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached at the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached at the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached at the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.
[0128] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.
[0129] A. Specific Conjugation Groups In certain embodiments, oligonucleotides are covalently linked to one or more conjugate groups.In certain embodiments, conjugate groups modify one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.In certain embodiments, conjugate groups impart new properties to the linked oligonucleotide, for example, fluorophores or reporter groups that allow detection of the oligonucleotide. Specific conjugate groups and moieties include, for example, cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or N-acetylgalactosamine (GalNAc) clusters (e.g., WO2014 / 179620).
[0130] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
[0131] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.
[0132] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0133] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazine, chlorothiazide, diazepine, indomethicine, barbiturate, cephalosporin, sulfa drug, antidiabetic, antibacterial, or antibiotic.
[0134] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is linked to the oligonucleotide via a more complex conjugate linker that comprises one or more conjugate linker moieties, which are the subunits that make up the conjugate linker. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.
[0135] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl groups and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl groups and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0136] In certain embodiments, the conjugate linker, including the conjugate linker described above, is known in the art to be useful for attaching a bifunctional linking moiety, for example, a conjugate group to a parent compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0137] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, with a non-limiting list of preferred substituents including, but not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0138] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker-nucleoside to be cleaved from the oligomeric compound after it reaches the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.
[0139] Herein, linker-nucleosides are not considered part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising a linker-nucleoside, these linker-nucleosides are not counted toward the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with a nucleoside of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise specified, the conjugate linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker-nucleoside.
[0140] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are better taken up by certain cell types, but it is desirable to cleave the conjugate group to release the unconjugated or parent oligonucleotide once the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes a group of atoms that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0141] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or a phosphodiester bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0142] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3' or 5' end of the oligonucleotide by a phosphodiester internucleoside bond and covalently linked to the conjugate linker or the remainder of the conjugate moiety by a phosphate or phosphorothioate internucleoside bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0143] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.
[0144] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.
[0145] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently linked to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently linked to the branching group.
[0146] B. Specific terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.
[0147] III. Oligomeric duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid, and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide, and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide, and optionally a conjugate group. Either or both of the oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.
[0148] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize with target nucleic acids, resulting in at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize with one or more target nucleic acids, resulting in one or more desired antisense activities, and do not hybridize with one or more non-target nucleic acids or do not hybridize in such a way as to result in significant undesired antisense activity to one or more non-target nucleic acids.
[0149] In certain antisense activities, the hybridization of antisense compounds with target nucleic acid results in the recruitment of proteins that cleave the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.
[0150] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound loaded into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).
[0151] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an alteration in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an alteration in the translation of the target nucleic acid.
[0152] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or subject.
[0153] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion that is complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from a mature mRNA and a pre-mRNA comprising an intron region, an exon region, and an untranslated region. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.
[0154] A. Complementarity / Mismatch to Target Nucleic Acid It is possible to introduce mismatch bases without impairing activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides consisting of two or three sequences of the tandem oligonucleotides, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, but more modestly than the 28 or 42 nucleobase oligonucleotides.
[0155] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a portion that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the fully complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
[0156] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity with respect to the target is reduced by such mismatches, but the activity with respect to the non-target is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, or 11th position from the 5' end of the gap region. In certain embodiments, the mismatch is at the 1st, 2nd, 3rd, 4th, 5th, or 6th position from the 5' end of the 5' wing region or the 3' wing region.
[0157] B.SCN2A In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that is complementary to a target nucleic acid, and the target nucleic acid is an SCN2A nucleic acid. In certain embodiments, the SCN2A nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2), or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12, truncated from nucleotides 165127001-165395000).
[0158] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of SCN2A RNA in the cell, and in certain embodiments, reduces the amount of SCN1A protein in the cell. In certain embodiments, contacting a cell with a modified oligonucleotide complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of SCN2A RNA in the cell, and in certain embodiments, reduces the amount of SCN2A protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell of a subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 ameliorates one or more symptoms or features of a disease or disorder associated with a voltage-gated sodium channel protein. In certain embodiments, the voltage-gated sodium channel protein is SCN2A. In certain embodiments, the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A, and in certain embodiments, the subject has a disease or disorder associated with SCN1A. In certain embodiments, the disease or disorder is developmental or epileptic encephalopathy, e.g., early onset seizure onset epileptic or encephalopathy, benign familial neonatal-infantile seizures, in certain embodiments, the disease or disorder is intellectual disability or autism spectrum disorder, in certain embodiments, the disease or disorder is Dravet syndrome.
[0159] In certain embodiments, the symptom or characteristic is any of seizures, hypotonia, sensory problems, such as impaired sensory integration, impaired motor function, intellectual and cognitive function, impaired motor and balance function, impaired visual function, speech and language delays, gastrointestinal problems (e.g., gastroesophageal reflux disease, diarrhea, constipation, dysmotility, etc.), neurodevelopmental delays, sleep problems, unexpected death in epilepsy, delayed motor development, delayed social milestones, repetitive behaviors, uncoordinated oral movements. In certain embodiments, the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, tonic seizures (often lasting more than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, fainting, focal, blunting, and tonic seizures).
[0160] In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard in vitro assay. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard in vitro assay. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2, when administered according to standard in vivo assays, can reduce the detectable amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2, when administered according to standard in vivo assays, can reduce the detectable amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of SCN2A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of SCN2A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
[0161] In certain embodiments, the oligomeric compound does not comprise a bicyclic sugar moiety. In certain embodiments, the oligomeric compound does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the oligomeric compound comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the oligomeric compound does not comprise an LNA sugar moiety. In certain embodiments, the oligomeric compound does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the oligomeric compound comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0162] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system. Such tissues include the brain, including but not limited to the cortex and hippocampus, and the spinal cord.
[0163] VI. Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0164] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0165] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0166] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.
[0167] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, and the conjugate groups are cleaved by endogenous nucleases in the body.
[0168] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to a particular cell or tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to muscle tissue.
[0169] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.
[0170] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a particular tissue or cell type, for example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.
[0171] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied significantly without significantly changing their solubility and toxicity properties. Furthermore, the identity of the co-solvent components can be changed, for example, other surfactants can be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol can be changed, other biocompatible polymers, such as, for example, polyvinylpyrrolidone, can be used in place of polyethylene glycol, and other sugars or polysaccharides can be used in place of dextrose.
[0172] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or function as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Pharmaceutical compositions for certain injections are provided in unit dosage form, e.g., ampoules or multi-dose containers. Pharmaceutical compositions for certain injections are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulating agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0173] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in a protonated (free acid) form, or in a form that is ionized and associated with a cationic (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate linkages of an oligonucleotide in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have multiple such linkages, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of various forms at multiple locations, all of which are in equilibrium. The term "oligonucleotide" is intended to include all such forms. The depicted structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, when a structure depicting the free acid of a compound is followed by the term "or a salt thereof," all forms that may be fully or partially protonated / deprotonated / associated with a cation are expressly included. In certain cases, one or more specific cations are identified.
[0174] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0175] In the present specification, a specific dose is described. The dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, but the mass of the Na+ ions is not counted toward the weight of the dose. Thus, for example, a dosage unit or dosage unit of 10 mg of compound number 1348259 is equal to the number of fully protonated molecules weighing 10 mg. This would be equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium compound number 1348259. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating the dosage.
[0176] VII. Specific Compositions 1. Compound number 1348259 In certain embodiments, compound number 1348259 has the sequence (5' to 3') of GCATAATCCCATTATACAAA (SEQ ID NO: 2493). It is characterized as an MOE gapmer, in which each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0177] In certain embodiments, compound number 1348259 is represented by the following chemical designation: GesmCeoAeoTeoAeoAdsTdsmCdsmCdsmCdsAdsTdsTdsAdsTdsAeomCeoAesAesAe (SEQ ID NO: 2493); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0178] In certain embodiments, compound number 1348259 has the following chemical structure: [ka] (sequence number 2493). Structure 1. Compound number 1348259
[0179] In certain embodiments, the sodium salt of compound number 1348259 has the following chemical structure: [ka] (sequence number 2493). Structure 2. Sodium salt of compound number 1348259
[0180] 2. Compound number 1348289 In certain embodiments, compound number 1348289 has the sequence (5' to 3') of CACGACATATTTTTCTACAC (SEQ ID NO: 2514). It is characterized as an MOE gapmer, in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0181] In certain embodiments, compound number 1348289 is represented by the following chemical designation: mCesAeomCeoGeoAeomCeoAdsTdsAdsTdsTdsTdsTdsTdsmCdsTdsAeomCesAesmCe (SEQ ID NO: 2514); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0182] In certain embodiments, compound number 1348289 has the following chemical structure: [ka] (sequence number 2514). Structure 3. Compound number 1348289
[0183] In certain embodiments, the sodium salt of compound number 1348289 has the following chemical structure: [ka] (sequence number 2514). Structure 4. Sodium salt of compound number 1348289
[0184] 3. Compound number 1348290 In certain embodiments, compound number 1348290 is a 6-10-4 nucleotide analog having the sequence (5' to 3') of CCACGACATATTTTTCTACA (SEQ ID NO: 2510). It is characterized as an MOE gapmer, in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0185] In certain embodiments, compound number 1348290 is represented by the following chemical designation: mCesmCeoAeomCeoGeoAeomCdsAdsTdsAdsTdsTdsTdsTdsTdsmCdsTeoAesmCesAe (SEQ ID NO: 2510); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0186] In certain embodiments, compound number 1348290 has the following chemical structure: [ka] (sequence number 2510). Structure 5: Compound number 1348290
[0187] In certain embodiments, the sodium salt of compound number 1348290 has the following chemical structure: [ka] Represented by (SEQ ID NO: 2510) Structure 6: Sodium salt of compound number 1348290
[0188] 4. Compound number 1348331 In certain embodiments, compound number 1348331 is a 6-10-4 nucleotide analog having the sequence (5' to 3') of TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487). It is characterized as an MOE gapmer, in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0189] In certain embodiments, compound number 1348331 is represented by the following chemical designation: TesmCeoTeoGeomCeoAeoTdsGdsTdsAdsAdsmCdsmCdsTdsTdsTdsAeoTesAesmCe (SEQ ID NO: 2487); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0190] In certain embodiments, compound number 1348331 has the following chemical structure: [ka] (sequence number 2487). Structure 7: Compound number 1348331
[0191] In certain embodiments, the sodium salt of compound number 1348331 has the following chemical structure: [ka] Represented by (SEQ ID NO: 2487) Structure 8: Sodium salt of compound number 1348331
[0192] 5. Compound number 1348347 In certain embodiments, compound number 1348347 has the sequence (5' to 3') of GCATAATCCCATTATACAAA (SEQ ID NO: 2493). It is characterized as an MOE gapmer, in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0193] In certain embodiments, compound number 1348347 is represented by the following chemical designation: GesmCeoAeoTeoAeoAeoTdsmCdsmCdsmCdsAdsTdsTdsAdsTdsAdsCeoAesAesAe (SEQ ID NO: 2493); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0194] In certain embodiments, compound number 1348347 has the following chemical structure: [ka] (sequence number 2493). Structure 9: Compound number 1348347
[0195] In certain embodiments, the sodium salt of compound number 1348347 has the following chemical structure: [ka] Represented by (SEQ ID NO: 2493) Structure 10: Sodium salt of compound number 1348347
[0196] 6. Compound number 1348937 In certain embodiments, compound number 1348937 has the sequence (5' to 3') of CTGCATGTAACCTTTATA (SEQ ID NO: 2534). It is characterized as an MOE gapmer, in which each of nucleosides 1-5 and 14-18 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-13 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 14-15, and 15-16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0197] In certain embodiments, compound number 1348937 has the following chemical designation: mCesTeoGeomCeoAesTdsGdsTdsAdsAdsmCdsmCdsTdsTeoTeoAesTesAe (SEQ ID NO: 2534), A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0198] In certain embodiments, compound number 1348937 has the following chemical structure: [ka] (sequence number 2534). Structure 11: Compound number 1348937
[0199] In certain embodiments, the sodium salt of compound number 1348937 has the following chemical structure: [ka] Represented by (SEQ ID NO: 2534) Structure 12: Sodium salt of compound number 1348937
[0200] VIII. Specific Hotspot Areas In certain embodiments, the nucleobase ranges shown below include hotspot regions of SCN2A nucleic acids. In certain embodiments, modified oligonucleotides that are complementary to equal length portions within the hotspot regions of SCN2A nucleic acids achieve an average of 69.9% or greater reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides that are complementary to equal length portions within the hotspot regions of SCN2A nucleic acids achieve an average of 59% or greater reduction in SCN2A RNA in vivo in a standard in vivo assay.
[0201] 1. Nucleic acid bases 2306 to 2367 of SEQ ID NO: 1, or 199863 to 199905 of SEQ ID NO: 2 In certain embodiments, nucleobases 2306-2367 of SEQ ID NO:1 or nucleobases 199863-199905 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 2306-2367 of SEQ ID NO:1 or nucleobases 199863-199905 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0202] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0203] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0204] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0205] The nucleobase sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to portions of equal length within nucleobases 2306 to 2367 of SEQ ID NO:1 or nucleobases 199863 to 199905 of SEQ ID NO:2.
[0206] The nucleobase sequences of compound IDs: 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to an equal length portion of nucleobases 2306 to 2367 of SEQ ID NO:1 or nucleobases 199863 to 199905 of SEQ ID NO:2.
[0207] In certain embodiments, modified oligonucleotides complementary to nucleobases 2306-2367 of SEQ ID NO:1 or an equivalent length portion of nucleobases 199863-199905 of SEQ ID NO:2 achieve at least 53% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 2306-2367 of SEQ ID NO:1 or an equivalent length portion of nucleobases 199863-199905 of SEQ ID NO:2 achieve an average of 69.9% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 2306-2367 of SEQ ID NO:1 or an equivalent length portion of nucleobases 199863-199905 of SEQ ID NO:2 achieve an average of 77.1% reduction in SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equivalent length portion of nucleobases 2306-2367 of SEQ ID NO:1, or nucleobases 199863-199905 of SEQ ID NO:2, achieve an average of 63.2% reduction of SCN2A RNA in vivo in a standard in vivo assay.
[0208] 2. Nucleic acid bases 3499 to 3557 of SEQ ID NO: 1, or nucleic acid bases 227493 to 227551 of SEQ ID NO: 2 In certain embodiments, nucleobases 3499-3557 of SEQ ID NO:1 or nucleobases 227493-227551 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 3499-3557 of SEQ ID NO:1 or nucleobases 227493-227551 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0209] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0210] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0211] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0212] The nucleobase sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to portions of equal length within nucleobases 3499 to 3557 of SEQ ID NO: 1 or nucleobases 227493 to 227551 of SEQ ID NO: 2.
[0213] Compound ID:909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 13483 03, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 134838 2, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to portions of equal length within nucleobases 3499 to 3557 of SEQ ID NO:1 or nucleobases 227493 to 227551 of SEQ ID NO:2.
[0214] In certain embodiments, modified oligonucleotides complementary to nucleobases 3499-3557 of SEQ ID NO:1 or an equivalent length portion of nucleobases 227493-227551 of SEQ ID NO:2 achieve at least 75% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 3499-3557 of SEQ ID NO:1 or an equivalent length portion of nucleobases 227493-227551 of SEQ ID NO:2 achieve an average of 81.6% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 3499-3557 of SEQ ID NO:1 or an equivalent length portion of nucleobases 227493-227551 of SEQ ID NO:2 achieve an average of 76.6% reduction in SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equivalent length portion of nucleobases 3499 to 3557 of SEQ ID NO:1 or nucleobases 227493 to 227551 of SEQ ID NO:2 achieve an average of 67.2% reduction of SCN2A RNA in vivo in a standard in vivo assay.
[0215] 3. Nucleic acid bases 243124 to 243204 of SEQ ID NO: 2 In certain embodiments, nucleobases 243124-243204 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 243124-243204 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0216] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0217] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0218] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0219] The nucleobase sequences of SEQ ID NOs: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to portions of equal length within nucleobases 243124 to 243204 of SEQ ID NO:2.
[0220] The nucleobase sequences of compound IDs: 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to portions of equal length within nucleobases 243124 to 243204 of SEQ ID NO:2.
[0221] In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243124-243204 of SEQ ID NO:2 achieve at least a 51% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243124-243204 of SEQ ID NO:2 achieve an average of 71.4% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243124-243204 of SEQ ID NO:2 achieve an average of 61.3% reduction in SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243124-243204 of SEQ ID NO:2 achieve an average of 61.5% reduction in SCN2A RNA in vivo in a standard in vivo assay.
[0222] 4. Nucleic acid bases 243917 to 244073 of SEQ ID NO:2 In certain embodiments, nucleobases 243917-244073 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 243917-244073 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0223] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0224] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0225] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0226] The nucleobase sequences of SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to portions of equal length within nucleobases 243917 to 244073 of SEQ ID NO:2.
[0227] Compound ID: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 13 48332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 13 The nucleobase sequences of 48428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to portions of equal length within nucleobases 243917 to 244073 of SEQ ID NO:2.
[0228] In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243917-244073 of SEQ ID NO:2 achieve at least 80% reduction of SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243917-244073 of SEQ ID NO:2 achieve an average of 80.5% reduction of SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243917-244073 of SEQ ID NO:2 achieve an average of 67.7% reduction of SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 243917-244073 of SEQ ID NO:2 achieve an average of 62.1% reduction of SCN2A RNA in vivo in a standard in vivo assay.
[0229] 5. Nucleic acid bases 4389 to 4487 of SEQ ID NO: 1, or nucleic acid bases 247823 to 247921 of SEQ ID NO: 2 In certain embodiments, nucleobases 4389-4487 of SEQ ID NO:1 or nucleobases 247823-247921 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 4389-4487 of SEQ ID NO:1 or nucleobases 247823-247921 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0230] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0231] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0232] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0233] The nucleobase sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to portions of equal length within nucleobases 4389 to 4487 of SEQ ID NO: 1 or nucleobases 247823 to 247921 of SEQ ID NO: 2.
[0234] Compound ID:910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 91 0019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 134 The nucleobase sequences of 8269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to portions of equal length within nucleobases 4389 to 4487 of SEQ ID NO:1 or nucleobases 247823 to 247921 of SEQ ID NO:2.
[0235] In certain embodiments, modified oligonucleotides complementary to nucleobases 4389-4487 of SEQ ID NO:1 or an equal length portion of nucleobases 247823-247921 of SEQ ID NO:2 achieve at least 27% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 4389-4487 of SEQ ID NO:1 or an equal length portion of nucleobases 247823-247921 of SEQ ID NO:2 achieve an average of 71.1% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 4389-4487 of SEQ ID NO:1 or an equal length portion of nucleobases 247823-247921 of SEQ ID NO:2 achieve an average of 63.4% reduction in SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion of nucleobases 4389 to 4487 of SEQ ID NO:1 or nucleobases 247823 to 247921 of SEQ ID NO:2 achieve an average of 59.1% reduction of SCN2A RNA in vivo in a standard in vivo assay.
[0236] 6. Nucleic acid bases 4774 to 4809 of SEQ ID NO: 1, or nucleic acid bases 254142 to 254177 of SEQ ID NO: 2 In certain embodiments, nucleobases 4774-4809 of SEQ ID NO:1 or nucleobases 254142-254177 of SEQ ID NO:2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion of nucleobases 4774-4809 of SEQ ID NO:1 or nucleobases 254142-254177 of SEQ ID NO:2. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0237] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0238] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0239] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0240] The nucleobase sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to nucleobases 4774 to 4809 of SEQ ID NO:1, or portions of equal length within 254142 to 254177 of SEQ ID NO:2.
[0241] The nucleobase sequences of compound IDs: 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to nucleobases 4774 to 4809 of SEQ ID NO:1 or an equal length portion of 254142 to 254177 of SEQ ID NO:2.
[0242] In certain embodiments, modified oligonucleotides complementary to nucleobases 4774-4809 of SEQ ID NO:1 or an equivalent length portion of nucleobases 254142-254177 of SEQ ID NO:2 achieve at least a 51% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 4774-4809 of SEQ ID NO:1 or an equivalent length portion of nucleobases 254142-254177 of SEQ ID NO:2 achieve an average of 89% reduction in SCN2A RNA in vitro in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 4774-4809 of SEQ ID NO:1 or an equivalent length portion of nucleobases 254142-254177 of SEQ ID NO:2 achieve an average of 74.8% reduction in SCN2A RNA in vivo in a standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equivalent length portion of nucleobases 4774 to 4809 of SEQ ID NO:1, or nucleobases 254142 to 254177 of SEQ ID NO:2, achieve an average of 67.8% reduction of SCN2A RNA in vivo in a standard in vivo assay.
[0243] 7. Additional Hotspot Regions In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins with a nucleobase of SEQ ID NO:2 identified in the "Start Site SEQ ID NO:2" column and ends with a nucleobase of SEQ ID NO:2 identified in the "Stop Site SEQ ID NO:2" column. In certain embodiments, the modified oligonucleotide is complementary to an equal length portion within any of hotspot regions 1-17 as defined in the table below. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, the modified oligonucleotide consists of 17-19, or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer.
[0244] In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has, in 5' to 3' order, the sugar motifs: eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, eeeeddddddddddeeee, eeeeddddddddddeeeeee, eeeeeeddddddddddeeeeee, or eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. In certain embodiments, a gapmer comprises a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is at the 2-position (5' to 3') of the gap.
[0245] In certain embodiments, the modified oligonucleotide does not comprise a bicyclic sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 bicyclic sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not a bicyclic nucleoside. In certain embodiments, the modified oligonucleotide does not comprise an LNA sugar moiety. In certain embodiments, the modified oligonucleotide does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, or 9 LNA sugar moieties. In certain embodiments, the modified oligonucleotide comprises one or two wing segments comprising a nucleoside that is not an LNA nucleoside.
[0246] In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in 5' to 3' order. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, or soooossssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0247] The nucleobase sequences of the compounds listed in the "Compound ID in Range" column of the table below are complementary to SEQ ID NO: 2 within the designated hotspot region. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO: in Range" column of the table below are complementary to the target sequence SEQ ID NO: 2 within the designated hotspot region.
[0248] In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve at least a "minimum % in vitro reduction" (minimum % reduction compared to untreated control cells) of SCN2A RNA in vitro in a standard in vitro assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve an average "average % in vitro reduction" (average % reduction compared to untreated control cells) of SCN2A RNA in vitro in a standard in vitro assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve a maximum "maximum % in vitro reduction" (maximum % reduction compared to untreated control cells) of SCN2A RNA in vitro in a standard in vitro assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve a mean "mean % cortex in vivo reduction" (mean % reduction compared to PBS-treated animals) of mean SCN2A RNA in vivo in a standard in vivo assay in cortical tissue as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve a mean "mean % spinal cord in vivo reduction" (mean % reduction compared to PBS-treated animals) of mean SCN2A RNA in vivo in a standard in vivo assay in spinal cord tissue as shown in the table below. "nd" indicates that in vivo data is not available for compounds within the range. In other cases, the mean in vivo reduction includes a subset of compounds at any given hotspot because not all compounds were tested in vivo. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]
[0249] IX. Specific Comparison Compounds Comparative compound number 1506060 was selected as the comparative compound. Comparative compound number 1506060 was previously described in WO2020 / 041348, incorporated herein by reference, and is a 4-8-4 LNA gapmer having the sequence (5' to 3') TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), in which the central gap segment is composed of eight 2'-β-D-deoxynucleosides, the 5' and 3' wing segments are each composed of four LNA modified nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
[0250] In certain embodiments, the compounds described herein are better tolerated as compared to comparative compound no. 1506060.
[0251] For example, as described in Example 4 of WO / 2022 / 032060, the entirety of which is incorporated herein by reference, comparative compound No. 1506060 had a 3-hour FOB of 6.00 in mice, while compound Nos. 1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and compound Nos. 1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Thus, certain compounds described herein are better tolerated in this assay than comparative compound No. 1506060.
[0252] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications listed herein is incorporated by reference in its entirety. Although the specific compounds, compositions, and methods described herein have been described in detail according to specific embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. listed in this application is incorporated by reference in its entirety.
[0253] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that such designations of "RNA" or "DNA" to describe modified oligonucleotides are arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including such compounds containing RNA bases, e.g., those having the sequence "AUCGAUCG", as well as some DNA bases and some RNA bases, e.g., "AUCGATCG", as well as other modified nucleobases, e.g., oligomeric compounds having "ATmCGAUCG", where mC denotes a cytosine base containing a methyl group at the 5-position.
[0254] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers, including stereoirregular and optically pure forms thereof, unless otherwise specified. Similarly, all cis and trans isomers and tautomers of the compounds herein are included, unless otherwise specified. Oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate internucleoside linkages include compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random. Unless otherwise specified, the compounds described herein are meant to include the corresponding salt forms.
[0255] The compounds described herein include variants in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein that contain hydrogen atoms include all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to, 2H or 3H instead of 1H, 13C or 14C instead of 12C, 15N instead of 14N, 17O or 18O instead of 16O, and 33S, 34S, 35S, or 36S instead of 32S. In certain embodiments, non-radioactive isotope substitutions can impart new properties to the oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions can make the compounds suitable for research or diagnostic purposes, such as imaging.
[0256] Treatment method Disclosed herein are methods of treating SCN2A-associated disorders, such as early-onset developmental or epileptic encephalopathy (DEE).
[0257] In one aspect, the SCN2A associated disorder is early onset developmental or epileptic encephalopathy (DEE), and the method comprises administering to a subject in need thereof a therapeutically effective amount of an oligomeric compound described herein, wherein the oligomeric compound is administered intrathecally to the subject at a dosage of about 1 mg to about 100 mg.
[0258] The methods disclosed herein may be used to improve one or more symptoms of early-onset DEE, including, for example, seizures, communication limitations such as language and speech delays, autonomic neuropathy, developmental delays, gastrointestinal abnormalities, movement disorders such as choreoathetosis, dystonia, ataxia, anxiety, sensory problems, urinary retention problems, irritability, sleep disorders (e.g., difficulty falling asleep and staying asleep), and behavioral problems. Seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, tonic seizures (often lasting more than 10 minutes), and frequent seizures.
[0259] In certain embodiments, the method includes a dose escalation step (or titration step) and a maintenance step. Typically, the dose escalation step is used to determine the maximum dose for the subject, and the maintenance step is used to administer the maximum dose to the subject on an ongoing basis. In certain embodiments, the method does not include a dose escalation step, and the selected dose (also referred to herein as the maintenance dose) is administered to the subject on an ongoing basis.
[0260] In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 15 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 10 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 40 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 30 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 20 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 15 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 10 mg. In certain embodiments, the dosage of the oligomeric compound is about 10 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 10 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 35 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 25 mg.
[0261] In certain embodiments, the dosage of the oligomeric compound is at least 0.25 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.5 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.75 mg. In certain embodiments, the dosage of the oligomeric compound is at least 1 mg. In various embodiments, the dosage of the oligomeric compound administered to the subject is at least 0.25 mg, at least 0.5 mg, at least 0.75 mg, at least 1 mg, at least 1.5 mg, at least 2 mg, at least 2.5 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, at least 10 mg, at least 11 mg, at least 12 mg, at least 13 mg, at least 14 mg, at least 15 mg, at least 16 mg, at least 17 mg, at least 18 mg, at least 19 mg, or at least 20 mg.
[0262] In certain embodiments, the dosage of the oligomeric compound is at least 0.251 mg, and is no more than 50, 45, 40, 35, 30, 25, or 20, 15, 10, 5, 2.5, or 1 mg. In various embodiments, the dosage of the oligomeric compound is at least 0.25 mg, at least 0.5 mg, at least 0.75 mg, at least 1 mg, at least 1.5 mg, at least 2 mg, at least 2.5 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, at least 10 mg, at least 11 mg, at least 12 mg, at least 13 mg, at least 14 mg, at least 15 mg, at least 16 mg, at least 17 mg, at least 18 mg, or at least 19 mg, and is no more than 50, 45, 40, 35, 30, 25, or 20 mg. In certain embodiments, the dosage of the oligomeric compound is at least 20 mg and not more than 50, 45, 40, 35, 30, or 25 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.25 mg and not more than 2.0 mg, or not more than 1 mg.
[0263] In certain embodiments, the dosage of the oligomeric compound is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, or at least 100 mg.
[0264] In various embodiments, the dosage of the oligomeric compound is at least 5 mg, at least 10 mg, at least 15 mg, or at least 20 mg, and not more than 50, 45, 40, 35, 30 mg, or 25 mg. In various embodiments, the dosage of the oligomeric compound is at least 25 mg, or 30 mg, and not more than 60, 55, 50, 45, 40, or 35 mg. In various embodiments, the dosage of the oligomeric compound is at least 35 mg, or at least 40 mg, and not more than 70, 65, 60, 55, 50, or 45 mg. In various embodiments, the dosage of the oligomeric compound is at least 45 mg, or at least 50 mg, and not more than 80, 75, 70, 65, 60, or 55 mg. In various embodiments, the dosage of the oligomeric compound is at least 55 mg, or at least 60 mg, and not more than 90, 85, 80, 75, 70, or 65 mg. In various embodiments, the dosage of the oligomeric compound is at least 65 mg, or at least 70 mg, and not more than 100, 95, 90, 85, 80, or 75 mg. In various embodiments, the dosage of the oligomeric compound is at least 75 mg, or at least 80 mg, and not more than 110, 105, 100, 95, 90, or 85 mg. In various embodiments, the dosage of the oligomeric compound is at least 85 mg, or at least 90 mg, and not more than 120, 115, 110, 105, 100, or 95 mg. In various embodiments, the dosage of the oligomeric compound is at least 95 mg, or at least 100 mg, and not more than 130, 125, 120, 115, 110, or 100 mg.
[0265] In certain embodiments, the dosage of the oligomeric compound is at least 0.1 mg / kg. In various embodiments, the dosage of the oligomeric compound administered to the subject is at least 0.2 mg / kg, at least 0.3 mg / kg, at least 0.4 mg / kg, at least 0.5 mg / kg, at least 0.6 mg / kg, at least 0.7 mg / kg, at least 0.8 mg / kg, at least 0.9 mg / kg, at least 1.0 mg / kg, at least 1.1 mg / kg, at least 1.2 mg / kg, at least 1.3 mg / kg, at least 1.4 mg / kg, at least 1.5 mg / kg, at least 1.6 mg / kg, at least 1.7 mg / kg, at least 1.8 mg / kg, at least 1.9 mg / kg, or at least 2.0 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 0.1 mg / kg, and is no more than 10 mg / kg, no more than 5 mg / kg, no more than 2.0 mg / kg, or no more than 1.0 mg / kg.
[0266] In various embodiments, the dosage of the oligomeric compound administered to the subject is at least 5 mg / kg, at least 10 mg / kg, at least 15 mg / kg, at least 20 mg / kg, at least 25 mg / kg, at least 30 mg / kg, at least 35 mg / kg, at least 40 mg / kg, at least 45 mg / kg, at least 50 mg / kg, at least 55 mg / kg, at least 60 mg / kg, at least 65 mg / kg, at least 70 mg / kg, at least 75 mg / kg, at least 80 mg / kg, at least 85 mg / kg, at least 90 mg / kg, at least 95 mg / kg, or at least 100 mg / kg.
[0267] In various embodiments, the dosage of the oligomeric compound is at least 5 mg / kg, or at least 10 mg / kg, and not more than 20 mg / kg, or not more than 15 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 15 mg / kg, or at least 20 mg / kg, and not more than 30 mg / kg, or not more than 25 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 25 mg / kg, or at least 30 mg / kg, and not more than 40 mg / kg, or not more than 35 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 35 mg / kg, or at least 40 mg / kg, and not more than 50 mg / kg, or not more than 45 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 45 mg / kg, or at least 50 mg / kg, and not more than 60 mg / kg, or not more than 55 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 55 mg / kg, or at least 60 mg / kg, and not more than 70 mg / kg, or 65 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 65 mg / kg, or at least 70 mg / kg, and not more than 80 mg / kg, or 75 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 75 mg / kg, or at least 80 mg / kg, and not more than 90 mg / kg, or 85 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 85 mg / kg, or at least 90 mg / kg, and not more than 100 mg / kg, or 95 mg / kg. In certain embodiments, the dosage of the oligomeric compound is at least 95 mg / kg, or at least 100 mg / kg, and not more than 150 mg / kg, or 125 mg / kg.
[0268] In one aspect, the dosage of the oligomeric compound is titrated one or more times. In certain embodiments, the dosage increases 1.25-5 fold between each titration dose. In certain embodiments, the dosage increases 1.25-2 fold, 1.5-3 fold, 1.5-2.5 fold, or 1.5-2 fold between each titration dose. In certain embodiments, the dosage increases 1.25-1.75 fold between each titration dose. In certain embodiments, the dosage increases 2-fold, up to a maximum of 8 mg, followed by an increase of 1.5-fold or less for all subsequent doses.
[0269] In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least about 2 mg, about 4 mg, about 8 mg, about 10 mg, about 12 mg, about 15 mg, about 18 mg, about 20 mg, about 15 mg, about 25 mg, about 30 mg, about 32 mg, about 35 mg, about 40 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg, or more. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, or about 15 mg to a maximum dose of at least about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 50 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, or more. In certain embodiments, the maximum dose is about 4-100 mg, about 4-50 mg, about 4-25 mg, about 4-15 mg, about 8-100 mg, about 8-75 mg, about 8-50 mg, about 8-25 mg, or about 8-15 mg. In certain embodiments, the maximum dose is about 15-100 mg, about 15-75 mg, about 15-50 mg, about 15-40 mg, about 15-30 mg, or about 15-25 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least about 15 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 32 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 32-64 mg. In certain embodiments, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least 64 mg.
[0270] In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, or more. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 25 mg, or about 30 mg to a cumulative dose of at least about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, or more. In certain embodiments, during the dose escalation phase, the cumulative dose is about 40-200 mg, about 50-200 mg, about 50-175 mg, about 50-150 mg, about 50-125 mg, about 50-100 mg, about 50-75 mg, about 40-50 mg, about 75-200 mg, about 75-175 mg, about 75-150 mg, about 75-125 mg, about 75-100 mg, about 100-200 mg, about 100-175 mg, about 100-150 mg, about 100-125 mg, about 125-200 mg, about 125-175 mg, about 125-150 mg, about 150-200 mg, or about 150-175 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 40 mg, or 50 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 100 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 40-100 mg, or 50-100 mg.
[0271] In one aspect, either the maximum dose or the cumulative dose of the dose escalation phase is reached after administration of multiple titrated doses of the oligomeric compound. In certain embodiments, the cumulative dose of the dose escalation phase is reached after administration of 2-20 titrated doses of the oligomeric compound, including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 titrated doses of the oligomeric compound. In certain embodiments, either the maximum dose or the cumulative dose of the dose escalation phase is reached after administration of 4-16, 4-12, 4-10, 4-8, 5-15, 5-12, 5-10, 5-8, 6-12, 6-10, 8-12, or 8-10 titrated doses of the oligomeric compound. In certain embodiments, either the maximum dose or the cumulative dose of the dose escalation phase is reached after administration of up to about 4 to about 12 titrated doses of the oligomeric compound.
[0272] In one aspect, each administration of the titrated dose of the oligomeric compound is separated by about 3-20 weeks. In certain embodiments, each administration of the titrated dose of the oligomeric compound is separated by about 1 week, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In certain embodiments of the dose escalation phase, the titrated dose of the oligomeric compound is administered about every 4-6 weeks. In certain embodiments, each administration of the titrated dose of the oligomeric compound is separated by at least about 6 weeks. In certain embodiments, each administration of the titrated dose of the oligomeric compound is separated by at least about 4 weeks. In other embodiments, each administration of the titrated dose of the oligomeric compound is separated by at least about 2 weeks. In certain embodiments, the titrated dose of the oligomeric compound is administered no more frequently than every 6 weeks. In other embodiments, the titrated dose of the oligomeric compound is administered no more frequently than every 4 weeks. In other embodiments, titrated doses of the oligomeric compounds are administered no more frequently than every two weeks.
[0273] In some embodiments, the oligomeric compound is administered to the subject every week. In some embodiments, the oligomeric compound is administered to the subject every two weeks. In some embodiments, the oligomeric compound is administered to the subject every three weeks. In some embodiments, the oligomeric compound is administered to the subject every four weeks. In some embodiments, the oligomeric compound is administered to the subject every six weeks. In some embodiments, the oligomeric compound is administered to the subject every eight weeks. In some embodiments, the oligomeric compound is administered to the subject every ten weeks. In some embodiments, the oligomeric compound is administered to the subject every twelve weeks.
[0274] In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 15 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from a first dose of about 1 mg to a second dose of about 2 mg, and optionally to a third dose of about 4 mg, and optionally to a fourth dose up to about 8 mg, and optionally to a fifth dose up to about 12 mg, and optionally to a sixth dose up to about 15 mg. In certain embodiments, the fourth dose of about 8 mg is titrated to a fifth dose of about 15 mg. In certain embodiments, the administration of each titration dose is separated by 2-6 weeks. In other embodiments, titration can continue to a maximum dose of 100 mg.
[0275] In one aspect, the method of treatment further comprises administering a maintenance dose during the maintenance phase. In certain embodiments, the maintenance phase follows the dose escalation phase. In certain embodiments, the maintenance dose is the maximum dose after the dose escalation phase. In other embodiments, the maintenance dose is selected and administered to the subject without the subject undergoing a dose escalation phase.
[0276] In certain embodiments, the maintenance dose is administered up to about every 16-20 weeks, or every 2-20 weeks. In certain embodiments, the maintenance dose is administered up to about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In certain embodiments, the maintenance dose is administered up to about every 1-16 weeks, 2-16 weeks, 2-8 weeks, 6-18 weeks, 6-16 weeks, 6-14 weeks, 6-12 weeks, 6-10 weeks, 8-18 weeks, 8-16 weeks, 8-14 weeks, 8-12 weeks, 8-10 weeks, 10-18 weeks, 10-16 weeks, 10-14 weeks, or 10-12 weeks. In certain embodiments, the maintenance dose is administered up to about every 12 weeks.
[0277] In one aspect of the method of treatment, a maintenance dose is administered after a maximum dose described herein is reached during the dose escalation phase. In certain embodiments, the maintenance dose is administered after a maximum dose of about 8-15 mg is reached. In certain embodiments, the maintenance dose is administered after a maximum dose of about 15 mg is reached. In certain embodiments, the maintenance dose is administered after a maximum dose of more than 15 mg is reached. In certain embodiments, the maintenance dose is administered after a maximum dose of about 15-32 mg is reached. In certain embodiments, the maintenance dose is administered after a maximum dose of about 30-50 mg is reached. In certain embodiments, the maintenance dose is administered after a maximum dose of more than 50 mg is reached.
[0278] In one aspect, multiple maintenance doses are administered. In certain embodiments, each administration of the maintenance dose is separated by about 8-20 weeks. In certain embodiments, each administration of the maintenance dose is separated by about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In certain embodiments, each administration of the maintenance dose is separated by about 8-16, 8-14, 8-12, 8-10, 10-16, 10-14, or 10-12 weeks. In certain embodiments, the maintenance doses are administered at least about every 12 weeks.
[0279] In one aspect, the maintenance dose is administered for a period of 6 months or more. In certain embodiments, the maintenance dose is administered for the rest of the subject's life. In certain embodiments, the maintenance dose is administered for at least 1-50 years. In certain embodiments, the maintenance dose is administered for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In certain embodiments, the maintenance dose is administered for at least 2-50 years, 2-40 years, 2-35 years, 2-30 years, 2-25 years, 2-20 years, 2-15 years, 2-10 years, or 2-5 years. In certain embodiments, the maintenance dose is administered for at least 2 years.
[0280] In one embodiment, the method of treatment includes inhibiting expression of SCN2A in a neuronal cell of a subject. In various embodiments, the method of treatment includes inhibiting expression of SCN2A mRNA in a subject by about 10% to about 90%, about 35% to about 80%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more than about 95% to less than 100%. In other embodiments, about 25% to about 50%, or about 35% to about 40% knockdown of SCN2A mRNA is achieved.
[0281] In one aspect, the subject is diagnosed with early onset DEE before 3 months of age. In certain embodiments, the subject is diagnosed with early onset DEE before 2 months of age or before 1 month of age. In certain embodiments, the subject is diagnosed with early onset DEE in utero. Typically, the diagnosis includes determining that the subject carries an SCN2A mutation before administering the oligomeric compound. Any SCN2A mutation can be used to diagnose early onset DEE, including any known SCN2A mutation and any SCN2A mutation identified in the future. In certain embodiments, the SCN2A mutations include one or more of A263V, E430A, E430G, R1882Q, G879R, G1593R, K1502N, V1601L, G211D, S1780I, D343H, R1626Q, G882E, M1545V, L210Q, Q1479H, N1662D, F1597L, V423L, A215T, I891T, or a combination thereof. In some embodiments, the SCN2A mutations are Q1531K, L1563V, E1321K, Y1589C, M252V, R223E, L1330F, V208E, R36G, R1882G, D343G, V261L, F1651C, R1319Q, A263V, Q383E, V1325I, K908E, V261M, S9 87I, R1629H, R1882Q, M1338T, E999K, R856Q, V423L, S1336Y, R1626Q, G882E, N212D, E1211K, D195G, L1342P, R220Q, R853Q, R1435*, K503fs*, R937C, or combinations thereof.
[0282] In one aspect, the subject is a human or a non-human animal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a human between the ages of 2 and 18. In other embodiments, the subject is a human over the age of 2 or under the age of 18. In other embodiments, the subject is a human over the age of 18.
[0283] In certain embodiments, the subject is a human under the age of 2. In certain embodiments, the subject is a human infant. In further embodiments, the infant is 6 months or younger, 5 months or younger, 4 months or younger, 3 months or younger, 2 months or younger, or 1 month or younger.
[0284] In certain embodiments, the subject is a human newborn. In further embodiments, the newborn is a full-term newborn, i.e., born after a gestational age of 39 weeks or more. In other embodiments, the newborn is a preterm newborn, i.e., born after a gestational age of less than 39 weeks. In some embodiments, the subject is a preterm human newborn born after a gestational age of less than 38 weeks, less than 37 weeks, less than 36 weeks, less than 35 weeks, less than 34 weeks, less than 33 weeks, less than 32 weeks, or less than 31 weeks, less than 30 weeks, or less than 28 weeks.
[0285] The oligomeric compounds described herein, in the context of the present invention, may be administered to a subject in combination with another drug or therapy, for example, an antiepileptic drug.Non-limiting examples of antiepileptic drugs include brivaracetam, carbamazepine, clobazam, clonazepam, diazepam, divalproex, eslicarbazepine, ethosuximide, ezogabine, felbamate, gabapentin, lacosamide, lamotrigine, levetiracetam, lorazepam, oxcarbezepine, permpanel, phenobarbital, phenytoin, pregabalin, primidone, rufinamide, tigabine, topiramate, valproic acid, vigabatrin, zonisamide, and cannabidiol.In a particular embodiment, the oligomeric compound is administered in combination with carbamazepine.
[0286] In addition to intrathecal administration, the oligomeric compounds described herein may also be administered, for example, orally, parenterally, intraventricularly, intraparenchymally, buccally, sublingually, nasally, rectally, by patch, pump, or transdermal administration. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, intranasal, intrapulmonary, intrathecal, intracisternal, intraventricular, intraparenchymal, rectal, and topical modes.
[0287] Other SCN2A disorders, including developmental or epileptic encephalopathies (DEE), such as Ohtahara syndrome; epilepsy with transitional focal seizures of infancy (EIMFS); infantile and pediatric DEE, such as West syndrome and Lennox-Gastaut syndrome; Dravet syndrome; idiopathic / generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic atonic epilepsy (MAE); migratory partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine with or without epilepsy, can also be treated according to the methods disclosed in this application. In certain embodiments, the SCN2A-related disorder is late-onset seizure-onset epileptic encephalopathy. In certain embodiments, the SCN2A-related disorder is benign familial neonatal-infantile seizures. In certain embodiments, the SCN2A-related disorder is intellectual disability (ID). In certain embodiments, the SCN2A-related disorder is autism spectrum disorder (ASD).
[0288] The therapeutic methods disclosed herein may be used to improve one or more symptoms of SCN2A disorders, including seizures, hypotonia, sensory problems, such as sensory integration disorders, motor developmental delays and dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech delays, gastrointestinal disorders, neurodevelopmental delays, and sleep problems. Seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, tonic seizures (often lasting more than 10 minutes), and frequent seizures.
[0289] In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a reduction in the frequency of seizures in the subject compared to the frequency of seizures in the subject prior to administration of the oligomeric compound. In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a reduction in the frequency of seizures in the subject of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% reduction in the frequency of seizures in the subject compared to the frequency of seizures in the subject prior to administration of the oligomeric compound. In some embodiments, a reduction in seizure frequency in a subject is observed for at least 1 week, at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after initiation of administration of the oligomeric compound, hi other embodiments, a reduction in seizure frequency is observed within 24 hours after initiation of administration of the oligomeric compound.
[0290] Interictal epileptic discharges (IEDs) are abnormal electrical brain activity patterns that occur between seizures in patients with epilepsy (Smith et al.,Elife.2022 Jan 20;11:e73541.doi:10.7554 / eLife.73541.PMID: 35050851;PMCID: PMC8813051). It has been reported that IEDs in children with idiopathic epilepsy can affect both cognitive function and academic performance (Cheng et al.,BMC Neurol.2020 Jun 6;20(1):233.doi: 10.1186 / s12883-020-01807-z.PMID:32505173;PMCID:PMC7275426). IEDs can be measured non-invasively using electroencephalography (EEG), a technique that records electrical activity in the brain through electrodes placed on the scalp, making it possible to monitor changes in IED frequency in real time without causing discomfort to the subject.
[0291] Without wishing to be bound by a particular theory, it is believed that IEDs can be used clinically, for example, to test the effects of various therapies in subjects with DEE. For example, IEDs can serve as objective biomarkers for the presence and severity of epilepsy activity. By measuring the frequency and distribution in the brain of IEDs before and after drug treatment, the effectiveness of a drug in reducing epilepsy activity can be monitored. It is also believed that changes in IED frequency and distribution may be detectable before any significant changes in seizure frequency or other clinical signs. Thus, IEDs can provide an early indication of the efficacy of a drug in treating DEE in clinical trials and can be used as a reference for target engagement and administration strategies. It is also believed that a reduction in IED frequency after drug treatment may be associated with improved seizure control and cognitive outcomes. Thus, monitoring IEDs during clinical trials may provide valuable information regarding the potential long-term benefits of treatment.
[0292] In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a decrease in the frequency of IEDs in the subject compared to the frequency of IEDs in the subject prior to administration of the oligomeric compound. In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a decrease in the frequency of IEDs in the subject of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% decrease in the frequency of IEDs in the subject compared to the frequency of IEDs in the subject prior to administration of the oligomeric compound. In some embodiments, a reduction in the frequency of IEDs in the subject is observed for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after initiation of administration of the oligomeric compound. In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a reduction in the frequency of amplitude-integrated electroencephalogram (aEEG) signals compared to the frequency of aEEG signals in the subject prior to administration of the oligomeric compound. In some embodiments, in the context of the present disclosure, administering an oligomeric compound to a subject in need thereof results in a decrease in the frequency of aEEG signals in the subject of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% compared to the frequency of aEEG signals in the subject prior to administration of the oligomeric compound.In some embodiments, the reduction in frequency of aEEG signals in the subject is observed for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after initiation of administration of the oligomeric compound, hi other embodiments, the reduction in frequency of aEEG signals in the subject is observed within 24 hours after initiation of administration of the oligomeric compound.
[0293] In some aspects, the disclosure also provides a method of evaluating the effectiveness of a therapy for early onset developmental and epileptic encephalopathies (early onset DEE therapy), the method comprising measuring the frequency of interictal epileptic discharges (IEDs) in a subject receiving early onset DEE therapy. In some embodiments, the method further comprises comparing the frequency of IEDs in the subject measured before administration of the early onset DEE therapy to the frequency of IEDs in the subject measured after initiation of administration of the early onset DEE therapy, wherein a decrease in the frequency of IEDs measured after initiation of administration of the early onset DEE therapy indicates that the early onset DEE therapy is effective, and a lack of a decrease in the increase in the frequency of IEDs measured after initiation of administration of the early onset DEE therapy indicates that the early onset DEE therapy is not effective. In some embodiments, the early onset DEE therapy comprises an oligomeric compound.
[0294] In one aspect, an oligomeric compound useful in the methods of the disclosure comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0295] In certain embodiments, oligomeric compounds are at least 90% complementary to an equal length portion of SEQ ID NO:2 and no more than 50% complementary to an equal length portion of SEQ ID NO:1.
[0296] In certain embodiments, the oligomeric compound has a nucleobase sequence that includes at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531.
[0297] In certain embodiments, the oligomeric compound has a nucleobase sequence that includes at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539.
[0298] In certain embodiments, the oligomeric compound comprises a) the same length of nucleic acid bases 199863 to 199905, 227493 to 22755, 243124 to 243204, 247823 to 247921, 254142 to 254177, 168911 to 168945, 170026 to 170061, 183519 to 183562, 188630 to 188668, 199912 to 199962, 227419 to 227450, or 238173 to 238192 of SEQ ID NO: 2 , at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to a portion of b) having a nucleic acid base sequence that contains at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases that are complementary to an equal length portion of nucleic acid bases 243917 to 244073, 170174 to 170200, 176724 to 176751, 180772 to 180801, 183968 to 184016, 202877 to 202906, 224198 to 224217, 224199 to 224218, or 243918 to 243937 of SEQ ID NO: 2.
[0299] In certain embodiments, the oligomeric compound comprises a) SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522;1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539;18, 96, 485, 561, 638, 715, 791, 868, 2247 ,2323,2400;174,1328,1405,1482,1559,1636,1713,1790,1865,1942,2019;20,98,253,332,410,1406,1483,1560,1637,1714,1791,1866,1943;21,411,1407,1484,1561,1638,1715;24,414,871,948,1025,1100;25,337,415,490,566,2099,2176,2 252, 2328, 2405; and 182; with the proviso that the modified oligonucleotide does not contain more than six LNA nucleosides; or b) SEQ ID NOs: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537, 302, 1513, 1667, 1744, 1819, 1896, 197, 148, 226, 1364, 1441, 1518, 1595, 1672, 1749, 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829, 228, 1679, 1756, 1831, 1908, 1985, 2061, 2138, 2214, 2290, 1226, 1303, 1380, 1457, 1534, 1611; 2079, 2523, and 2477.
[0300] In certain embodiments, oligomeric compounds have a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514. In certain embodiments, oligomeric compounds have a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of SEQ ID NO: 2510. In certain embodiments, oligomeric compounds comprise or consist of the nucleobase sequence of SEQ ID NO: 2510.
[0301] In certain embodiments, oligomeric compounds have a nucleobase sequence consisting of 17-19, or 21-30 linked nucleosides. In certain embodiments, oligomeric compounds have a nucleobase sequence consisting of 16, 17, 18, 19, or 20 linked nucleosides.
[0302] In certain embodiments, oligomeric compounds are antisense oligonucleotides and contain one or more modified sugar moieties, one or more modified internucleoside linkages, and one or more modified nucleobases, as described herein.
[0303] In certain embodiments, each of the one or more modified sugars is independently selected from a bicyclic sugar, a 2'-O-methoxyethyl (2MOE) modified sugar, a 2'-O-methyl (2-OMe) modified sugar, a 2'-methoxy modified sugar, a 2'-fluoro modified sugar, a 2'-O-alkyl modified sugar, a constrained ethyl (cEt) modified sugar, a locked sugar, or an unlocked sugar. In certain embodiments, the antisense oligonucleotide comprises one or more 2MOE modified sugars. In certain embodiments, the antisense oligonucleotide does not comprise a bicyclic sugar moiety.
[0304] In certain embodiments, each of the one or more modified internucleoside linkages is independently selected from phosphorothioate, phosphorodithioate, phosphoramidate, phosphorodiamidate, thiophosphoramidate, thiophosphorodiamidate, methylphosphonate, phosphoromorpholidate, or phosphoropiperazidate.In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the antisense oligonucleotide are phosphorothioate internucleoside linkages.In certain embodiments, each internucleoside linkage of the antisense oligonucleotide is independently selected from phosphodiester or phosphorothioate internucleoside linkages.
[0305] In certain embodiments, the internucleoside linkage motif of the modified oligonucleotide is selected from sooooosssssssssss, soooooosssssssssss, soooosssssssssss, soooosssssssssss, sooooossssssssss, and soooosssssssssss, where s = phosphorothioate internucleoside linkage and o = phosphodiester internucleoside linkage.
[0306] In certain embodiments, the one or more modified nucleobases are 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-azocytosine, 8-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-adenine, 8-azocytos ... and 8-aminoadenine, 8-thioadenine, 8-thioalkyladenine, 8-hydroxyadenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxyguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxyguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.
[0307] In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, each cytosine in the antisense oligonucleotide is a 5-methylcytosine.
[0308] In certain embodiments, the antisense oligonucleotide comprises a gap segment comprised of linked deoxynucleosides, a 5' wing segment comprised of linked nucleosides, and a 3' wing segment comprised of linked nucleosides, wherein the gap segment is positioned directly adjacent to and between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.
[0309] In certain embodiments, the antisense oligonucleotide does not contain a bicyclic sugar moiety. The antisense oligonucleotide is characterized according to the following chemical designation: GesmCeoAeoTeoAeoAdsTdsmCdsmCdsmCdsAdsTdsTdsAdsTdsAeomCeoAesAesAe (SEQ ID NO: 2493); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0310] In certain embodiments, the antisense oligonucleotide is characterized according to the following chemical designation: mCesAeomCeoGeoAeomCeoAdsTdsAdsTdsTdsTdsTdsTdsmCdsTdsAeomCesAesmCe (SEQ ID NO: 2514), A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0311] In certain embodiments, the antisense oligonucleotide is characterized according to the following chemical designation: mCesmCeoAeomCeoGeoAeomCdsAdsTdsAdsTdsTdsTdsTdsTdsmCdsTeoAesmCesAe (SEQ ID NO: 2510); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0312] In certain embodiments, the antisense oligonucleotide is characterized according to the following chemical designation: TesmCeoTeoGeomCeoAeoTdsGdsTdsAdsAdsmCdsmCdsTdsTdsTdsAeoTesAesmCe (SEQ ID NO: 2487); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0313] In certain embodiments, the antisense oligonucleotide is characterized according to the following chemical designation: GesmCeoAeoTeoAeoAeoTdsmCdsmCdsmCdsAdsTdsTdsAdsTdsAdsmCeoAesAesAe (SEQ ID NO: 2493); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0314] In certain embodiments, the antisense oligonucleotide has the following chemical designation: Characterized according to GTmCesTeoGeomCeoAesTdsGdsTdsAdsAdsmCdsmCdsTdsTeoTeoAesTesAe (SEQ ID NO: 2534); A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
[0315] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2493), or a salt thereof, such as a potassium salt.
[0316] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2514), or a salt thereof, such as a potassium salt.
[0317] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2510), or a salt thereof, such as a potassium salt.
[0318] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2487), or a salt thereof, such as a potassium salt.
[0319] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2493), or a salt thereof, such as a potassium salt.
[0320] In certain embodiments, the antisense oligonucleotide has the following chemical structure: [ka] (SEQ ID NO: 2534), or a salt thereof, such as a potassium salt. EXAMPLES
[0321] Example 1. Seamless clinical trial to investigate the safety and efficacy of multiple doses of Compound 1 in pediatric participants with early-onset SCN2A developmental and epileptic encephalopathy.
[0322] This is a seamless, partially non-randomized, open-label, and partially randomized, placebo-treated, double-blind clinical trial to investigate the safety, tolerability, PK, and efficacy of escalating doses of an oligomeric compound of the disclosure (Compound 1) in pediatric participants with early-onset SCN2A DEE, ages 2 to 18. The study will be conducted in four parts: exploratory safety Part 1 (open-label), dose escalation Part A (double-blind), confirmatory Part B (double-blind), followed by an open-label extension in Part C.
[0323] Objectives and Evaluation Items [Table 5] [Table 6-1] [Table 6-2] [Table 6-3] [Table 7-1] [Table 7-2] [Table 8-1] [Table 8-2]
[0324] Part 1: Preliminary safety Part 1 will be conducted exclusively in the United States (US) with the purpose of obtaining clinical safety data that will further inform dose escalation in Part A. In this open-label, non-randomized portion of the study, four participants will be enrolled and will receive 1 mg doses of Compound 1 at ≥4 week intervals for up to 13 weeks.
[0325] Safety will be continually evaluated by the Sponsor with available PK data, with scheduled quarterly Data Monitoring Committee (DMC) evaluations after each interim analysis, and ad-hoc evaluations as needed based on emerging safety data. Preliminary efficacy in seizure reduction and safety will also be evaluated after four doses.
[0326] After the four participants have received a minimum of two doses of Compound 1 and undergone a minimum of two weeks of monitoring, safety, tolerability, and PK data collected from this portion of the study will be submitted to the FDA for interim evaluation. The study will not progress to Parts A, B, and C until a favorable opinion and approval to continue the study has been received from the agency.
[0327] After their final dose, Part 1 participants may transition to a long-term extension, subject to further evaluation and approval by the FDA to continue the study, as well as updated pending chronic toxicity data.
[0328] Part A: Dose Escalation Part A will commence in the United States only after regulatory approval upon completion of Part 1. The goal of Part A is to identify a cumulative dose of Compound 1 with a favorable benefit-risk profile for seizure reduction that can be further evaluated in Part B. Part A will consist of up to 16 participants. Initially, eight treatment-naive participants will be randomized 3:1 to receive escalating doses of Compound 1 or placebo treatment. The first four participants will be required to reach at least 4 weeks after their first dose before additional participants will receive study drug. Dosing will occur at intervals of ≥4 weeks for the first four doses and ≥6 weeks for subsequent doses. Dose escalation will occur within participants. The starting dose will be 1 mg with ≤2-fold increases for subsequent doses according to the specific dose escalation criteria in Section 6.5. The goal is to reach a maximum cumulative dose of 42 mg, which corresponds to approximately 35% knockdown (KD), expected to be split into six doses.
[0329] Safety will be continually evaluated by the Sponsor with available PK data, scheduled quarterly DMC evaluations, and ad-hoc evaluations as needed based on emerging safety data. Preliminary efficacy in seizure reduction and safety will be evaluated during the post-6th dose period after up to 8 participants have reached the maximum cumulative dose of 42 mg or matching placebo treatment.
[0330] The dosing regimen may be revised based on safety and efficacy analysis. The maximum tolerated dose (MTD) in this study is defined as one dose level below the single or cumulative dose associated with dose-limiting toxicity (DLT) of 2 or more doses in Part A, or a percentage of 25% across the study. Up to eight additional participants may be added (Arm 2, randomized to active or placebo in a 3:1 ratio) to further evaluate safety and efficacy during dose escalation of Compound 1. The starting dose of these additional participants will be up to the maximum tolerated single dose previously administered. A second planned analysis evaluating safety and efficacy during the post-sixth dose period will be performed after up to eight participants have reached a cumulative maximum of 100 mg. After the final dose (or placebo treatment), participants will then have the opportunity to enter Part C / open-label extension.
[0331] Part B: Verification Phase Part B will further evaluate and confirm the safety and efficacy of the cumulative doses specified in Part A in a randomized, placebo-controlled design. The study will commence only after approval from regulatory authorities. Up to 40 treatment-naive participants will be randomized, with up to 75% receiving Compound 1 over placebo treatment (maximum 3:1 randomization). The final sample size and randomization scheme will be further confirmed based on preliminary data from Part A and power calculations.
[0332] The cumulative dose and highest single dose will not exceed their respective MTDs in Part A. The cumulative dose from Part A will be split into ≦6 administrations of Compound 1 or placebo treatment, administered no more frequently than every 6 weeks.
[0333] The primary endpoint will be seizure frequency over the period after the sixth dose as assessed by seizure diary. Thus, participation in Part B will last up to 30 weeks. After the final dose (or placebo treatment), participants will then have the opportunity to enter an open-label extension, Part C.
[0334] Parts 1, A, and B will each consist of three periods: a screening period, an intervention period (open-label in part 1, double-blind in parts A and B), and a follow-up period.
[0335] Screening Period Prior to any clinical trial procedures, participants / caregivers will provide written informed consent and meet the inclusion / exclusion criteria. Primary assessments during screening include medical and disease history, demographic data, weight and height, physical examination (including a detailed neurological examination), clinical laboratory evaluations, magnetic resonance imaging (MRI) of the brain, vital sign measurements, 12-lead ECG, and assessment of concomitant medications / procedures as outlined in the Schedule of Activities (SoA) (Tables 1, 2, and 3 for Part 1, Part A, and Part B, respectively).
[0336] Caregivers will record and complete a daily seizure diary, including days without visits, for a minimum of 4 weeks from the baseline observation period (baseline pre-dose visit) through EOT. Other screening assessments may still occur during this 4-week period (and do not necessarily have to be completed prior to the start of the daily seizure diary). Eligibility of each participant will be reviewed and approved by an Eligibility Review Committee (ERC) prior to each participant's inclusion in the study. A baseline extended vEEG will be completed within 4 weeks prior to the baseline dosing visit.
[0337] Intervention period Part 1 (Open-Label Intervention): Participants will be admitted to the study site on Day -1 for a baseline dosing visit. On Day 1, after confirmation of eligibility, they will receive Compound 1 via IT dosing. Each participant will remain hospitalized for at least 24-48 hours after dosing for physical examination (including detailed neurological examination), clinical laboratory assessment, vital sign measurements, 12-lead ECG, and any other study evaluations at this visit as outlined in the SoA (Table 1). Corresponding procedures and assessments, including administration of Compound 1, will be performed again at intervals of approximately every 4 weeks (but no more frequently) for up to a total of 4 doses. Dosing in Part 1 may be less frequent based on tolerability of the study medication.
[0338] Approximately 2 weeks after each P Compound 1 dose, a home health visit and home vEEG will be performed according to the SoA (Table 1). Home health visits may be performed at the participant's discretion, with the investigator at home (i.e., away from the study site) or at the clinic (study site). If there are any changes regarding AEs or the participant's examination, the participant may return for an unscheduled visit at the clinic for further evaluation, at the investigator's discretion.
[0339] Parts A and B (double-blind interventions): Participants will be admitted to the study site on Day -1 for a baseline dosing visit. On Day 1, after confirmation of eligibility, they will receive Compound 1 or placebo treatment via IT dosing according to the randomization schedule. Each participant will remain hospitalized for at least 24-48 hours after dosing for physical examination (including a detailed neurological examination), clinical laboratory assessments, vital sign measurements, 12-lead ECG, and any other study evaluations at this visit, as outlined in the SoA (Tables 2, 3). Compound 1 administration, or corresponding treatments and evaluations including placebo treatment, will be performed at intervals of approximately every 4 weeks for the first 4 doses, every 6 weeks for subsequent doses in Part A, and every 6 weeks in Part B (but no more frequently), as outlined in the SoA (Tables 2, 3).
[0340] Approximately 2 weeks after each Compound 1 dose or placebo treatment, a home health visit and home vEEG will be performed according to the SoA (Table 2, Table 3). Home health visits may be performed at the participant's discretion, with the investigator at home (i.e., away from the study site) or at the clinic (study site). If there are any changes regarding AEs or the participant's examination, the participant may return for an unscheduled visit at the clinic for further evaluation, at the investigator's discretion.
[0341] Safety follow-up period During the 6-month follow-up period, home-health visits and home vEEG (Table 1, Table 2, Table 3) will be conducted as outlined in the SoA. Home health visits may be conducted at home (i.e., away from the study site) or at the clinic (study site) with the investigator at the participant's discretion. If there is an AE or any change in the participant's examination (as reported by caregiver or as identified during the home health visit), the participant may return at the investigator's discretion for an unscheduled visit at the clinic for further evaluation. A final visit to the clinic will be conducted for completion of study evaluations as outlined in the SoA (Table 1, Table 2, Table 3).
[0342] The follow-up period may be extended based on the results of the evaluation at the End of Study (EOS) visit and the investigator's best clinical judgment. If deemed necessary, extended follow-up will include evaluation of the presence or absence of potential long-term and developmental effects.
[0343] Part C: Open-label extension An open-label extension will be available for all patients previously exposed to Compound 1 or for patients crossing over from active Compound 1 studies.
[0344] After Part 1 After their final dose, participants from Part 1 will have the possibility to transition to a long-term extension. The dose and dosing frequency in the open-label extension for participants from Part 1 will be determined after regulatory approval. If patients participating in Part 1 have a treatment gap of more than 6 weeks, additional instructions will be provided.
[0345] After Part A or B Participants from Parts A and B will have the possibility to enroll in Part C, an open-label extension of the study that will evaluate the safety and durability of effects on seizures and other outcome measures of the maintenance dosing regimen for up to 2 years (see Table 4 for the activity schedule for this part).
[0346] The maximum dose administered in Part C will be up to the maximum tolerated single dose from Parts A and B. This dose level may change as Parts A and B progress. Dosing every 12 weeks will be expected to be sufficient to maintain KD levels. Thus, dosing will be at least 12-week intervals for up to 2 years. Participants may receive lower doses or less frequent dosing based on tolerability.
[0347] For participants who received only placebo treatment in Part A or Part B, a titration dosing regimen may be added. The starting dose of this titration regimen will be less than or equal to the maximum tolerated single dose from Part A or Part B.
[0348] The follow-up period may be extended based on the results of the evaluation at the End of Study (EOS) visit and the investigator's best clinical judgment. If deemed necessary, extended follow-up will include evaluation of the presence or absence of potential long-term and developmental effects. [Table 1-8] [Table 1-9]
Table 1-10
Table 1-11
Table 1-12
Table 2-1
Table 2-2
Table 2-3
Table 2-4
Table 2-5
Table 2-6
Table 2-7
Table 3-1
Table 3-2
Table 3-3
Table 3-4
Table 3-5
Table 3-6
Table 4-1
Table 4-2
[0349] Efficacy evaluation The planned time points of all efficacy assessments are provided in the SoA (Table 1, Table 2, Table 3, Table 4).
[0350] Seizure diary Electronic devices (e.g., tablets / phones, watch applications, and / or other devices) will be used to collect information about participants' seizures and daily concomitant medication use during the clinical trial. Diaries will be completed daily for a minimum of 28 days prior to the baseline dosing visit, during the baseline observation period (after the screening visit), and throughout the remainder of the clinical trial. Diaries from the baseline observation period will serve as a check of eligibility and establish a baseline. Prompts will be used to ensure adequate data capture in addition to spontaneous reporting. Diaries will be completed by the same caregiver as frequently as possible. Daily seizure diary data collected as part of an ongoing observational study that falls within the screening window according to this protocol may be used without the need to repeat.
[0351] Video EEG To the extent permitted by local regulations, vEEG will be performed by trained technicians throughout the study to record electroencephalographic activity and evaluate changes over time. Longitudinal vEEG can be completed at home or at a facility and ideally involves capturing periods of both wakefulness and sleep for a minimum of 12 consecutive hours of recording. As part of an ongoing observational study, vEEG collected within the screening window according to this protocol does not need to be repeated during the screening period.
[0352] Bayley Scales of Infant Development-4th Edition (Bayley-4) The Bayley-4 is a standardized neurodevelopmental assessment scale used by clinicians to assess key domains of early childhood development for individuals between 16 days and 42 months of age (Bayley and Aylward 2019). These domains include adaptive behavior, cognition, language, motor skills (gross and fine), and social-emotional development. Bayley-4 assessments will be video-recorded to the extent permitted by local regulations.
[0353] Vineland Adaptive Behavior Scales-3 (Vineland-3) The Vineland-3 is a clinician-rated measure of adaptive behavior in individuals with intellectual disability (Sparrow et al. 2016). The Vineland-3 includes assessments of communication, socialization, maladaptive behavior, motor skills, and daily living skills in children aged 3 years.
[0354] Wechsler Preschool and Elementary Intelligence Scale, Fourth Edition (WPPSI-IV) The WPPSI-IV is a comprehensive test used to assess cognitive function in children aged 2 years 6 months to 7 years 7 months. The WPPSI-IV assesses five domains: overall intelligence quotient (IQ), verbal IQ, functional IQ, processing speed, and comprehensive language. Investigators will be trained in administering the WPPSI-IV.
[0355] Cognitive Test Selection Guide During the assessment period, participants will undergo cognitive testing. The cognitive test used (Bayley-4 or WPPSI-IV) will depend on the participant's age as well as the participant's initial Vineland-3 score obtained prior to baseline for participants ≥ 3 years of age, as shown in Figure 2. The Vineland-3 is an individually administered behavioral scale used to assess individuals with intellectual, developmental, and other neurological disabilities. The Vineland-3 will be used to assess the participant's cognitive age based on measures of receptive and expressive communication, rather than chronological age, in participants ≥ 3 years of age as follows: ● Participants <3 years (36 months) at baseline (Visit 1): All participants will be assigned to the Bayley-4 cognitive test; ● Participants ≥ 3 years (36 months) at Baseline (Visit 1): All participants will be assigned to either the Bayley-4 or WPPSI-IV based on their initial Vineland-3, parent / caregiver version scores, as described in Figure 2. Scores achieved on the Receptive Communication and Expressive Communication subscales will determine cognitive testing assignment. Once assigned, cognitive testing will not change for the duration of the study, with the following exceptions: - If the investigator determines that the initial Vineland score is invalid secondary to external factors, including but not limited to illness, social stress, or other events that may affect test results, the Vineland-3 may be repeated and the score used.
[0356] Children's Sleep Disorders Scale The Parent-Reported Sleep Disorders Scale for Children (SDSC) is a 27-item scale rated on a 5-point Likert scale and designed to classify children's sleep disorders (Bruni et al 1996). In addition to an overall score, the instrument provides five subscores: disorders of sleep initiation and maintenance, sleep-disordered breathing, disorders of arousal or sleep-disordered-awake transitions, disorders of excessive somnolence, and hyperhidrosis.
[0357] Quality of Life-Disability (QI-Disability) QI-Disability is a parent-reported measure of quality of life for children with intellectual disability. It is a reliable and valid measure of quality of life across the spectrum of intellectual disability (Downs et al 2018). This has the potential to more clearly identify support needs and measure responses to interventions.
[0358] Abnormal Behavior Checklist-2nd Edition (ABC-2) The ABC-2 is a clinician-rated scale that measures the severity of a range of problem behaviors commonly seen in individuals with intellectual disabilities (Aman and Singh 2017).
[0359] Clinical Global Impression-Severity (CGI-S) and Clinical Global Impression-Improvement (CGI-I) The CGI was developed for use in NIH-sponsored clinical trials in individuals with psychiatric disorders. The CGI provides an overall assessment of improvement over a specific period of time. The CGI includes two 7-point Likert rating scales, the CGI-S and the CGI-I scales (Guy 1976). The CGI will be anchored with reference to the domains / symptoms experienced by participants with SCN2A-DEE. Participants will be assessed by clinicians at baseline (day 1) for the severity of SCN2A-DEE symptoms using the CGI-S. Changes from baseline in SCN2A-DEE symptoms will be assessed by clinicians using the CGI-I.
[0360] Caregiver Global Impression-Severity (CgGI-S) and Caregiver Global Impression-Improvement (CgGI-I) These scales are similar to the CGI-S and CGI-I (Guy 1976). Participants will be rated by caregivers at baseline (day 1) for severity of SCN2A-DEE symptoms using the CgGI-S. Change from baseline in SCN2A-DEE symptoms will be rated by caregivers using the CgGI-I.
[0361] [Table 9-1]
Table 9-2
Table 9-3
Table 9-4
Table 9-5
Table 9-6
Table 9-7
Table 9-8
Table 9-9
Table 9-10
Table 9-11
Table 9-12
Table 9-13
Table 9-14
Table 9-15
Table 9-16
Table 9-17
Table 9-18
Table 9-19
Table 9-20
Table 9-21
Table 9-22
Table 9-23
Table 9-24
Table 9-25
Table 9-26
Table 9-27
Table 9-28
Table 9-29
Table 9-30
Table 9-31
Table 9-32
Table 9-33
Table 9-34
Table 9-35
Table 9-36
Table 9-37
Table 9-38
Table 9-39
Table 9-40
Table 9-41
Table 9-42
Table 9-43
Table 9-44
Table 9-45
Table 9-46
Table 9-47
Table 9-48
Table 9-49
Table 9-50
Table 9-51
Table 9-52
Table 9-53
Table 9-54
Table 9-55
Table 9-56
Table 9-57
Table 9-58
Table 9-59
Table 9-60
Table 9-61
Claims
1. A composition comprising an oligomer compound for use in the treatment of early-onset developmental and epileptic encephalopathy in subjects requiring treatment for early-onset developmental and epileptic encephalopathy, wherein the use is The procedure involves administering the oligomer compound to the subject in an initial dose of approximately 0.5 mg to approximately 100 mg via intraarachnoid space. A composition wherein the oligomer compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to a portion of equal length of SCN2A nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
2. The composition for use according to claim 1, wherein the initial dose is approximately 1 mg to approximately 25 mg.
3. The composition for use according to claim 1, wherein the initial dose of the oligomer compound is titrated upward to the maximum dose during the dose escalation step.
4. During the dose escalation step, the dose of the oligomer compound is titrated from an initial dose of about 1 mg to the maximum dose of about 4 to 50 mg; or The composition for use according to claim 3, wherein during the dose escalation step, the dose of the oligomer compound is titrated from an initial dose of about 1 mg to the maximum dose of about 15 to 100 mg.
5. The composition for use according to claim 3, wherein the maximum dose is reached after administration of 2 to 12 titration doses of the oligomer compound.
6. The composition for use according to claim 5, wherein the administration of each dose of the oligomer compound is spaced apart by at least about two weeks, at least about three weeks, at least about four weeks, at least about six weeks, at least about eight weeks, at least about ten weeks, or at least about twelve weeks.
7. The composition for use according to claim 1, wherein the use further comprises a maintenance step, the maintenance step comprising administering a maintenance dose of the oligomer compound.
8. The maintenance dose is characterized by being administered after the dose escalation stage; and / or The maintenance dose is characterized by being administered at least every 12 weeks; and / or The composition for use according to claim 7, characterized in that the maintenance dose is administered over a period of at least two years.
9. A composition comprising an oligomer compound for use in the treatment of early-onset developmental and epileptic encephalopathy in subjects requiring treatment for early-onset developmental and epileptic encephalopathy, wherein the use is The procedure includes administering the oligomer compound to the subject via subarachnoid space, A composition wherein the oligomer compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to a portion of equal length of SCN2A nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
10. The composition for use according to claim 9, characterized in that the oligomer compound is administered in a dose of about 0.5 mg to about 100 mg.
11. The composition for use according to claim 10, wherein the dose is approximately 8 mg to approximately 64 mg.
12. The composition for use according to claim 1 or claim 9, characterized in that the oligomer compound is administered at least every 12 weeks.
13. The composition for use according to claim 12, characterized in that the oligomer compound is administered over a period of at least two years.
14. The composition for use according to claim 1 or 9, wherein the use comprises inhibiting the expression of SCN2A in the target nerve cells.
15. The composition for use according to claim 1 or 9, wherein the subject has been diagnosed with early-onset developmental and epileptic encephalopathy before 3 months of age, before 2 months of age, or before 1 month of age.
16. The composition for use according to claim 1 or 9, further comprising determining that the subject harbors the SCN2A mutation before administering the oligomer compound.
17. The SCN2A mutations are A263V, E430A, E430G, R1882Q, G879R, G1593R, K1502N, V1601L, G211D, S1780I, D343H, R1626Q, G882E, M1545V, L210Q, Q1479H, N1662D, F1597L, V423L, A215T, I891T, Q1531K, L1563V, E1321K, Y1589C, M252V, R223E, L1330F, V208E, R3 A composition for use according to claim 16, selected from the group consisting of 6G, R1882G, D343G, V261L, F1651C, R1319Q, Q383E, V1325I, K908E, V261M, S987I, R1629H, M1338T, E999K, R856Q, S1336Y, N212D, E1211K, D195G, L1342P, R220Q, R853Q, R1435*, K503fs*, R937C, and combinations thereof.
18. The composition for use according to claim 1 or claim 9, wherein the subject is a human.
19. The aforementioned oligomer compound (i) Is it at least 90% complementary to the equal-length portion of sequence number 2, and 50% or less complementary to the equal-length portion of sequence number 1? (ii) Having a nucleic acid sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases from any of the nucleic acid sequences of sequence numbers 16 to 2531; (iii) Having a nucleic acid sequence containing at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleic acid bases from any of the nucleic acid sequences of sequence numbers 2532 to 2539; (iv) a) Nucleic acid bases of Sequence ID No. 2 of equal length: 199863-199905, 227493-22755, 243124-243204, 247823-247921, 254142-254177, 168911-168945, 170026-170061, 183519-183562, 188630-188668, 199912-199962, 227419-227450, or 238173-238192 The modified oligonucleotide has a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to the portion, wherein the modified oligonucleotide does not contain more than 6 LNA nucleosides, or b) Having a nucleic acid base sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to portions of equal length of nucleic acid bases 243917-244073, 170174-170200, 176724-176751, 180772-180801, 183968-184016, 202877-202906, 224198-224217, 224199-224218, or 243918-243937 of Sequence ID No. 2; (v) a) Sequence numbers 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, 2527; 29, 30, 107, 1 08, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 2522; 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, 2539; 18, 96, 485, 561, 638, 715, 791, 868, 2247, 2323, 2400; 174, 1328, 1405, 1482, 1559, 1636, 1713, 1790, 1865, 1942, 2019; 20, 98, 253, 332, 410, 1406, 1483, 1560, 1637, 1714, 1791, 1866, 1943; 21, 411, 1407, 1484, 1561, 1638, 1715; 24, 414, 871, 948, 1025, 1100; 25, 337, 415, 490, 566, 2099, 2176, 22 Having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases selected from 52, 2328, 2405; and 182, wherein the modified oligonucleotide does not contain more than 6 LNA nucleosides, or b) Sequence numbers 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, 2537, 302, 1513, 1667, 1744, 1819, 1896, 197, 148, 226, 1364, 1441, 1518, 1595, 1672, 1749, 227, 1292, 1369, 1446, 1523, 1600, 1677, 1754, 1829, 228, 1679, 1756, 1831, 1908, 1985, 20 Having a nucleic acid base sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases from a sequence selected from 61, 2138, 2214, 2290, 1226, 1303, 1380, 1457, 1534, 1611; 2079, 2523, and 2477; or (vi) A composition for use according to claim 1 or 9, having a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases from sequence numbers 2487, 2493, 2510, or 2514.
20. The aforementioned oligomer compound (i) Having a nucleic acid sequence consisting of 17 to 19 or 21 to 30 linked nucleosides; (ii) Having a nucleic acid base sequence consisting of 16, 17, 18, 19, or 20 linked nucleosides; or (iii) A composition for use according to claim 1 or claim 9, comprising the nucleic acid base sequence of Sequence ID No. 2510.
21. The composition for use according to claim 1 or 9, wherein the oligomer compound is an antisense oligonucleotide and comprises one or more modified sugar moieties, one or more modified nucleoside bonds, and one or more modified nucleic acid bases.
22. (i) Each of the one or more modified sugars is independently selected from the group consisting of bicyclic sugars, 2'-O-methoxyethyl (2MOE) modified sugars, 2'-O-methyl (2-OMe) modified sugars, 2'-methoxy modified sugars, 2'-fluoro modified sugars, 2'-O-alkyl modified sugars, restricted ethyl (cEt) modified sugars, locked sugars, and unlocked sugars; and / or (ii) Each of one or more modified nucleoside bonds is independently selected from the group consisting of phosphorothioates, phosphorodithioates, phosphoramidates, phosphorodiamidates, thiophosphoroamidates, thiophosphorodiamidates, methylphosphonates, phosphoromolholides, and phosphoropiperadates; and / or (iii) The one or more modified nucleic acid bases independently include 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-uracil (pseudracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thio A composition for use according to claim 21, selected from the group consisting of ruadenine, 8-thioalkyladenine, 8-hydroxyadenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxyguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
23. (i) The antisense oligonucleotide comprises one or more 2MOE-modified sugars; or (ii) Each modified nucleoside bond is a phosphorothioate nucleoside bond; or (iii) At least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 nucleoside bonds of the antisense oligonucleotide are phosphorothioate nucleoside bonds; or (iv) The composition for use according to claim 22, wherein each nucleoside bond of the antisense oligonucleotide is independently selected from the group consisting of phosphodiesters and phosphorothioate nucleoside bonds.
24. The nucleoside-binding motif of the aforementioned accessory oligonucleotide is selected from among the following: soooooooss The composition for use according to claim 23, wherein s = phosphorothioate nucleoside bond and o = phosphodiester nucleoside bond.
25. The composition for use according to claim 22, wherein the modified nucleic acid base is 5-methylcytosine.
26. The composition for use according to claim 25, wherein each cytosine in the antisense oligonucleotide is 5-methylcytosine.
27. The antisense oligonucleotide comprises a gap segment consisting of a linked deoxynucleoside, a 5'-wing segment consisting of a linked nucleoside, and a 3'-wing segment consisting of a linked nucleoside, wherein the gap segment is directly adjacent to and between the 5'-wing segment and the 3'-wing segment, and each nucleoside in each wing segment contains a modified sugar; or The composition for use according to claim 21, wherein the antisense oligonucleotide does not contain a bicyclic sugar moiety.
28. The aforementioned antisense oligonucleotide has the following chemical notation: (i)G es m C eo A eo T eo A eo A ds T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A eo m C eo A es A es A e characterized according to (Accession No. 2493) A = adenine nucleic acid base, mC = 5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = Is it a phosphodiester nucleoside bond? (ii) m C es A eo m C eo G eo A eo m C eo A ds T ds A ds T ds T ds T ds T ds T ds m C ds T ds A eo m C es A es m C e (SEQ ID NO: 2514); A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = Is it a phosphodiester nucleoside bond? (iii) m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (SEQ ID NO: 2510); A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = Is it a phosphodiester nucleoside bond? (iv) T es m C eo T eo G eo m C eo A eo T ds G ds T ds A ds A ds m C ds m C ds T ds T ds T ds A eo T es A es m C e (SEQ ID NO: 2487); A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = Is it a phosphodiester nucleoside bond? (v) G es m C eo A eo T eo A eo A eo T ds m C ds m C ds m C ds A ds T ds T ds A ds T ds A ds m C eo A es A es A e (SEQ ID NO: 2493); A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and o = is a phosphodiester nucleoside bond; or (vi) characterized according to GT m C es T eo G eo m C eo A es T ds G ds T ds A ds A ds m C ds m C ds T ds T eo T eo A es T es A e (SEQ ID NO: 2534); A = adenine nucleic acid base, m C=5-methylcytosine nucleic acid base, G = guanine nucleic acid base, T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, and The composition for use according to claim 21, wherein o = phosphodiester nucleoside interbonding.
29. The aforementioned antisense oligonucleotide has the following chemical structure: (i) 【Chemistry 25】 (Sequence ID 2493), or having a salt thereof; (ii) 【Chemistry 26】 (Sequence ID 2514), or having a salt thereof; (iii) 【Chemistry 27】 (Sequence ID 2510), or having a salt thereof; (iv) 【Chemistry 28】 (Sequence ID 2487), or having a salt thereof; (v) 【Chemistry 29】 (Sequence ID 2493), or having a salt thereof; or (vi) 【Transformation 30】 A composition for use according to claim 21, comprising (SEQ ID NO: 2534) or a salt thereof.
30. The composition for use according to claim 29, wherein the salt is a sodium salt or a potassium salt.
31. The composition for use according to claim 1 or 9, wherein the use results in a reduction in the frequency of seizures in the subject compared to the frequency of seizures in the subject before administration of the oligomer compound.
32. The reduction is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80%; and / or The composition for use according to claim 31, wherein the reduction in the frequency of seizures in the subject is observed for at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after the commencement of administration of the oligomer compound to the subject.
33. The composition for use according to claim 1 or 9, wherein the use results in a reduction in the frequency of interictal epileptic discharges (IEDs) in the subject compared to the frequency of IEDs in the subject before administration of the oligomer compound.
34. The reduction is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80%; and / or The composition for use according to claim 33, wherein the reduction in the frequency of IEDs in the subject is observed for at least one week, at least two weeks, at least three weeks, at least four weeks, at least six weeks, at least eight weeks, at least ten weeks, at least twelve weeks, at least fourteen weeks, or at least sixteen weeks or more after the commencement of administration of the oligomer compound to the subject.
35. A method for obtaining the frequency of interictal epileptic discharges (IEDs) in subjects receiving the aforementioned therapy, as an indicator of the effectiveness of the therapy for early-onset developmental and epileptic encephalopathy.
36. The method further includes comparing the frequency of IEDs in the subject measured before administration of the therapy with the frequency of IEDs in the subject measured after the commencement of administration of the therapy. A decrease in the frequency of IEDs after the commencement of the administration of the said therapy indicates that the said therapy is effective. The method of claim 35, wherein the absence of a reduction in the increase in the frequency of IEDs after the commencement of the administration of the therapy indicates that the therapy is ineffective.
37. The method according to claim 35 or 36, wherein the therapy comprises the administration of an oligomeric compound.
38. The method according to claim 37, wherein the oligomer compound comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleic acid base sequence of the modified oligonucleotide is at least 90% complementary to a portion of equal length of SCN2A nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.