Methods and compositions for treating lipoprotein-associated diseases

JP2025510739A5Pending Publication Date: 2026-03-25CRISPR THERAPEUTICS AG
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-03-20
Publication Date
2026-03-25

AI Technical Summary

Technical Problem

The prior art cannot effectively reduce the Lp(a) level in the blood, resulting in an increased risk of cardiovascular disease.

Method used

The expression of Lp(a) is reduced by using complex nanoparticles, carrying guide RNA (gRNA) targeting the LPA gene and RNA-induced endonucleic acids (such as Cas9 endonucleic acid).

Benefits of technology

A significant reduction in the expression level of Lp(a) in the receptor body is achieved, thereby reducing the risk of cardiovascular disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure relates to methods, compositions, and kits for regulating expression of the LPA gene in a subject by gene editing to treat lipoprotein-related diseases, such as cardiovascular diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 322,078, filed March 21, 2022, U.S. Provisional Application No. 63 / 351,542, filed June 13, 2022, and U.S. Provisional Application No. 63 / 385,093, filed November 28, 2022. The contents of these related applications are incorporated herein by reference in their entireties for all purposes.

[0002] Sequence Listing Reference This application is submitted with a Sequence Listing in electronic format. The Sequence Listing is provided as a file named 80EM-341712-WO_SeqList, created on March 15, 2023, and 35.9 kilobytes in size. The information in the electronic Sequence Listing is incorporated herein by reference in its entirety.

[0003] Field The present disclosure relates generally to the fields of molecular biology and biotechnology, including gene editing. [Background technology]

[0004] 2. Description of Related Art Lipoprotein(a) (Lp(a)) is an atherogenic lipoprotein that consists of the protein apolipoprotein(a) [apo(a)] covalently bound to the apolipoprotein B-100 (apoB) component of low-density lipoprotein (LDL) particles. High levels of Lp(a) are associated with increased risk of cardiovascular disease, including, for example, calcific aortic valve disease (high levels of Lp(a) cause high incidence and rapid progression of this disease), myocardial infarction (MI), coronary heart disease, atherosclerosis, thrombosis, and stroke. Currently, there are no approved drugs that directly target Lp(a).

[0005] DNA targeting using the RNA-guided DNA targeting principle of CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) system has been widely used. CRISPR-Cas systems can be divided into two classes, class 1 systems utilize a complex of multiple Cas proteins (such as type I, type III, and type IV CRISPR-Cas systems), and class 2 systems utilize a single Cas protein (such as type II, type V, and type VI CRISPR-Cas systems). Type II CRISPR-Cas-based systems are used for genome editing and require Cas polypeptides or their variants guided by customizable guide RNAs (gRNAs) for programmable DNA targeting.

[0006] There is a need for safe and effective gene editing strategies to treat lipoprotein-associated diseases, such as cardiovascular disease and calcific aortic valve disease, by lowering Lp(a) levels. Summary of the Invention

[0007] Disclosed herein include methods, compositions, and kits for treating lipoprotein-associated disease. Some embodiments provide a method for treating lipoprotein-associated disease in a subject in need of treatment, the method comprising administering to the subject a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) targeting the LPA gene (LPA gRNA) or a nucleic acid encoding the LPA gRNA; and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby treating the lipoprotein-associated disease in the subject. The subject may be administered the plurality of nanoparticles two or more times. In some embodiments, each of the two or more administrations is about 2 weeks to about 4 weeks apart. In some embodiments, each of the two or more administrations is at least 3 months apart. In some embodiments, the method comprises a single administration of the plurality of nanoparticles to the subject.

[0008] In some embodiments, the LPA expression in the plasma of the subject is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% after administration. In some embodiments, the concentration of LPA protein in the plasma of the subject is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% after administration. In some embodiments, the reduction is 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 6 months, 1 year, 2 years, 3 years, 5 years, 10 years, 15 years, or longer after administration. In some embodiments, the reduction is 65% at 1 month after administration. In some embodiments, the reduction is 75% at 3 months after administration. In some embodiments, the reduction is relative to a reference level of: (a) LPA expression or LPA protein concentration in the plasma of the subject before administration of the plurality of nanoparticles; (b) LPA expression or LPA protein concentration in one or more untreated subjects; and / or (c) LPA expression or LPA protein concentration in a healthy subject.

[0009] The subject in need of treatment may have an Lp(a) level greater than 50 mg / dl, such as 60 mg / dl, 70 mg / dl, 80 mg / dl, 90 mg / dl, 100 mg / dl, 110 mg / dl, 120 mg / dl, 130 mg / dl, 140 mg / dl, 150 mg / dl, 200 mg / dl, 250 mg / dl, 300 mg / dl, or greater. In some embodiments, the subject in need of treatment has an Lp(a) level greater than 100 mg / dL. In some embodiments, the subject in need of treatment has an increased risk of myocardial infarction (MI) independent of established cardiovascular disease (CVD) risk factors, or has an increased lifetime risk of atherosclerotic cardiovascular disease (ASCVD).

[0010] The methods described herein can include measuring the subject's blood or serum levels of Lp(a) before, during, and / or after administration. In some embodiments, the methods include identifying a subject in need of treatment.

[0011] The lipoprotein-related disease can be a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof.In some embodiments, the lipoprotein-related disease is calcific aortic valve disease, myocardial infarction, coronary heart disease, atherosclerosis, thrombosis, stroke, coronary artery disease, familial hyperlipidemia, myocardial infarction, peripheral artery disease, calcific aortic valve stenosis, or a combination thereof.In some embodiments, one or more symptoms of lipoprotein-related disease in a subject are reduced or alleviated.In some embodiments, administering a plurality of complexed nanoparticles to a subject reduces cardiovascular risk, the probability of death associated with cardiovascular events, or a combination thereof.

[0012] In some embodiments, the nucleic acid encoding the RNA-guided endonuclease is an mRNA of an RNA-guided endonuclease, such as a Cas9 endonuclease. Non-limiting examples of Cas9 endonucleases include S. pyogenes Cas9, S. aureus Cas9, N. meningitides Cas9, S. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9, and variants thereof. The gRNA can be a single guide RNA (sgRNA). In some embodiments, the gRNA targets exon 3 of the LPA gene. In some embodiments, the LPA gRNA comprises any one of the spacer sequences of SEQ ID NOs: 18-25. In some embodiments, the LPA gRNA comprises the spacer sequence of SEQ ID NO: 18. In some embodiments, the LPA gRNA is a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO: 32. In some embodiments, the LPA gRNA is a single guide RNA (sgRNA) comprising the sequence of SEQ ID NO: 11.

[0013] The LPA gRNA or the nucleic acid encoding the LPA gRNA and the RNA-guided nuclease can be encapsulated in a plurality of nanoparticles.In some embodiments, the nanoparticle is a lipid nanoparticle.The subject can be a primate subject, for example, a human.

[0014] In some embodiments, the method includes administering a single dose of the nanoparticles to the subject. For example, the nanoparticles can be administered to the subject in a single dose at or about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, or 1 mg / kg of the nucleic acids (a) and (b) as a whole.

[0015] In some embodiments, the plurality of nanoparticles are lipid nanoparticles.In some embodiments, the lipid nanoparticles comprise one or more of neutral lipids, charged lipids, ionized lipids, steroids, and lipids conjugated to polymers.In some embodiments, the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.

[0016] The method may further include determining the subject's (i) levels of one or more of alanine transaminase (ALT), aspartate transaminase (AST), gamma glutamyl transferase (GGT), bilirubin, alkaline phosphatase (Alk Phos), and albumin before, after, or both of the administration; (ii) prothrombin time (PT); and / or (iii) partial thromboplastin time (PTT). In some embodiments, the subject is provided with an additional treatment, wherein the additional treatment comprises administration of a corticosteroid, an anti-H1 antihistamine, an anti-H2 antihistamine, or any combination thereof. The additional treatment may be administered to the subject 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, or more prior to administration of the multiple nanoparticles to the subject. In some embodiments, providing the additional treatment and administering the multiple nanoparticles are performed simultaneously.

[0017] Disclosed herein includes a composition comprising a nanoparticle complexed with (a) a guide RNA (gRNA) targeting the LPA gene (LPA gRNA), and (b) an mRNA encoding a Cas9 endonuclease, where the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 18-25. Disclosed herein also includes a composition for use in treating a lipoprotein-associated disease comprising a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) targeting the LPA gene (LPA gRNA), and (b) an mRNA encoding a Cas9 endonuclease, where the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 18-25. The lipoprotein-associated disease can be a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof. In some embodiments, the lipoprotein-associated disease is calcific aortic valve disease, myocardial infarction, coronary heart disease, atherosclerosis, thrombosis, stroke, coronary artery disease, familial hyperlipidemia, myocardial infarction, peripheral artery disease, calcific aortic valve stenosis, or a combination thereof. In some embodiments, the gRNA comprises a spacer sequence of SEQ ID NO: 18. In some embodiments, the gRNA comprises a sequence of SEQ ID NO: 32. In some embodiments, the gRNA comprises a sequence of SEQ ID NO: 11. The Cas9 endonuclease can be S. pyogenes Cas9 endonuclease. In some embodiments, the plurality of nanoparticles are lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionized lipids, steroids, and lipids conjugated to a polymer. In some embodiments, the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both. In some embodiments, the composition is a pharmaceutical composition comprising one or more pharma- ceutically acceptable excipients. [Brief description of the drawings]

[0018] [Figure 1] FIG. 1 depicts an exemplary lipoprotein(a) (Lp(a)) structure.

[0019] [Diagram 2] FIG. 2 depicts a non-limiting example of a non-human primate (NHP) study design.

[0020] [Figure 3-1] 3A-B depict plots showing plasma Lp(a) levels in NHPs from Group 4 (FIG. 3A) and NHPs from Group 5 (FIG. 3B). [Figure 3-2] Same as above.

[0021] [Figure 4-1] 4A-B depict plots showing the percent change from baseline in plasma Lp(a) levels for NHPs in Group 4 (FIG. 4A) and NHPs in Group 5 (FIG. 4B). [Figure 4-2] Same as above

[0022] [Diagram 5] Figure 5 depicts a non-limiting example of an experimental design. Endpoints include, but are not limited to: Hematology: d-14 (i.e. day -14), d-7 (i.e. day -7), d7 (i.e. day 7), d15, d29, d43, d57, d71, and / or d84; Serum Chemistry: d-14, d-7, d2, d4, d7, d10, d15, d29, d43, d57, d71, and / or d84; Coagulation: d-14, d-7, d15, d29 , d43, d57, d71, and / or d84; ECG: d-12, d2, d22, and / or d84; Bioanalytical: d-7, d1, d2, d4, d8, d15, d29, d43, d57, d71, and / or d84; Biomarkers: d-14, d-7, d8, d15, d29, d43, d57, d71, and / or d84; and Edit on Tissues: tissue list includes reproductive tissues.

[0023] [Figure 6] FIG. 6 is a graph showing baseline Lp(a) levels in NHP plasma 14 days prior to treatment (day −14).

[0024] [Figure 7] FIG. 7 depicts a non-limiting example of an NHP study design.

[0025] [Figure 8-1] Figure 8A is a graph showing the percent change from baseline in plasma Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3 mg / kg compared to a control group. Figure 8B is a graph showing the percent change from baseline in serum Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3 mg / kg compared to a control group. [Figure 8-2] Same as above.

[0026] [Figure 9-1] Figures 9A-C are graphs showing plasma Lp(a) protein levels in NHPs before and after treatment with three different doses of CTX320: 0.5 mg / kg (Figure 9A), 1.5 mg / kg (Figure 9B), and 3.0 mg / kg (Figure 9C). Figure 9D is a graph showing the percent change from baseline in plasma Lp(a) levels in NHPs at 29 days after CTX320 treatment. [Figure 9-2] Same as above.

[0027] [Figure 10] Figure 10A is a graph showing the percent change from baseline in serum Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3 mg / kg compared to a control group. Figure 10B shows the percent change from baseline in plasma Lp(a) levels in NHPs about 3 months after CTX320 treatment.

[0028] [Figure 11] FIG. 11 is a plot showing the rate of LPA gene editing in liver and other organ tissues including spleen, adrenal gland, brain, kidney, lung, epididymis, testis, and ovary.

[0029] [Figure 12-1] Figures 12A-12C are plots showing reproductive tissue editing following administration of CTX320. [Figure 12-2] Same as above.

[0030] [Figure 13] 13A-13B are plots showing plasma levels of LNP component A after treatment.

[0031] [Figure 14] 14A-14B are plots showing plasma levels of LNP component B after treatment.

[0032] [Figure 15] FIG. 15 shows an example, non-limiting study design for a Phase 1 safety and tolerability clinical trial for one or more of the LPA gene editing nanoparticles described herein (e.g., CTX320).

[0033] [Figure 16] 16 is a graph showing the percent change from baseline in serum Lp(a) protein levels following CTX320 treatment in patients pretreated with steroids and antihistamines.

[0034] [Figure 17] FIG. 17 provides plots comparing aspartate aminotransferase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP) and total bilirubin levels in patients pretreated with steroids and antihistamines prior to CTX320 administration (2.0 mg / kg), as well as in patients not pretreated and administered 1.5 mg / kg CTX320 and 3 mg / kg CTX320. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] Detailed Description In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, similar symbols typically refer to similar components unless the context indicates otherwise. The exemplary embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized and other changes may be made without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein and illustrated in the figures, can be arranged, substituted, combined, separated, and designed in a variety of different configurations, all of which are expressly contemplated herein and form part of the disclosure herein.

[0036] All patents, patent application publications, other publications, and sequences from GenBank and other databases referenced herein are hereby incorporated by reference in their entirety for the technology to which they pertain.

[0037] High levels of Lp(a) have been associated with increased risk of cardiovascular disease. Lp(a) levels higher than 50 mg / dL (e.g., >125 nmol / L) can cause calcific aortic valve disease (CAVD) and cardiovascular disease (CVD). Unlike low-density lipoproteins, Lp(a) levels cannot be regulated by the environment, diet, exercise, or existing lipid-lowering drugs such as statins, which makes Lp(a) levels a genetic disease risk factor. Currently, there are no approved drugs that directly target Lp(a). The present disclosure provides methods, compositions, systems, and kits for regulating (e.g., reducing) Lp(a) levels to reduce the risk of cardiovascular disease and / or treat cardiovascular disease in subjects in need of such risk reduction and / or treatment.

[0038] Disclosed herein includes methods, compositions, and kits for treating cardiovascular disease or cardiovascular disorder in subjects, such as primate subjects.In some embodiments, the method comprises administering to a subject in need of cardiovascular disease or cardiovascular disorder treatment a plurality of nanoparticles complexed with (a) guide RNA (gRNA) targeting LPA gene or a nucleic acid encoding gRNA targeting LPA gene, and (b) a nucleic acid (e.g., mRNA) encoding RNA-guided endonuclease, thereby treating the cardiovascular disease or cardiovascular disorder of the subject.

[0039] definition As used herein, the term "about" means plus or minus 5% of the stated value.

[0040] As used herein, the term "RNA-guided endonuclease" refers to a polypeptide that can bind to an RNA (e.g., gRNA) to form a complex targeted to a specific DNA sequence (e.g., in a target DNA). A non-limiting example of an RNA-guided endonuclease is a Cas polypeptide (e.g., a Cas endonuclease, such as Cas9 endonuclease). In some embodiments, the RNA-guided endonuclease described herein is targeted to a specific DNA sequence in a target DNA by an RNA molecule that binds to it. The RNA molecule can include a sequence that is complementary to and can hybridize to a target sequence in the target DNA, thereby allowing the bound polypeptide to be targeted to a specific location in the target DNA.

[0041] As used herein, the term "guide RNA" or "gRNA" refers to a site-specific targeting RNA that can bind to and form a complex with an RNA-guided endonuclease, and direct the activity of the bound RNA-guided endonuclease (such as Cas endonuclease) to a specific target sequence in a target nucleic acid. A guide RNA can include one or more RNA molecules.

[0042] As used herein, the "secondary structure" of a nucleic acid molecule (e.g., an RNA fragment, or a gRNA) refers to base-pairing interactions within the nucleic acid molecule.

[0043] As used herein, the term "target DNA" refers to DNA that includes a "target site" or "target sequence." The term "target sequence" is used herein to refer to a nucleic acid sequence present in the target DNA to which a gRNA DNA targeting sequence or segment (also referred to herein as a "spacer") can hybridize if sufficient conditions for hybridization exist. For example, the target sequence 5'-GAGCATATC-3' in the target DNA is targeted by (or hybridizable with or complementary to) the RNA sequence 5'-GAUAUGCUC-3'. Hybridization between the gRNA DNA targeting sequence or segment and the target sequence can be based, for example, on Watson-Crick base pairing rules, which allows for programming of the DNA targeting sequence or segment. The gRNA DNA targeting sequence or segment can be designed, for example, to hybridize with any target sequence.

[0044] As used herein, the term "Cas endonuclease" or "Cas nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR adaptive immune system.

[0045] Unless otherwise indicated, "nuclease" and "endonuclease" are used interchangeably herein to refer to an enzyme having endonucleolytic enzymatic activity for cleavage of polynucleotides.

[0046] As used herein, the term "invariant region" of gRNA refers to the nucleotide sequence of gRNA that associates with RNA-guided endonuclease. In some embodiments, gRNA comprises crRNA and transactivating crRNA (tracrRNA), where crRNA and tracrRNA hybridize with each other to form a duplex. In some embodiments, crRNA comprises the following in the order of 5' to 3': a spacer sequence and a minimal CRISPR repeat sequence (also referred to herein as "crRNA repeat sequence"); and a tracrRNA that comprises a minimal tracrRNA sequence that is complementary to the minimal CRISPR repeat sequence (also referred to herein as "tracrRNA anti-repeat sequence") and a 3' tracrRNA sequence. In some embodiments, the invariant region of gRNA refers to the minimal CRISPR repeat sequence portion of crRNA and tracrRNA.

[0047] As used herein, the term "donor template" refers to a nucleic acid strand that contains exogenous genetic material, which can be introduced into genome (e.g., by homology-directed repair) to result in targeted integration of exogenous genetic material.In some embodiments, donor template can have no region of homology to the target site of DNA, and can be integrated by NHEJ-dependent end joining after cleavage of the target site.Donor template can be DNA or RNA, single-stranded or double-stranded, and can be introduced into cell in linear or circular form.

[0048] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. A polynucleotide can be single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids / triple helices, or polymers that contain purine and pyrimidine bases or other naturally occurring nucleotide bases, chemically or biochemically modified nucleotide bases, non-naturally occurring nucleotide bases, or derivatized nucleotide bases.

[0049] As used herein, the term "binding" refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). During a non-covalent interaction, the macromolecules are said to be "associated" or "interacting" or "bound" (e.g., when molecule X is said to interact with molecule Y, this means that molecule X is non-covalently bound to molecule Y). Binding interactions are characterized by a dissociation constant (Kd), e.g., 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M, 10 -14 M, 10 -15 The binding affinity can be characterized by a Kd of less than or equal to M, or a value or range between any two of these values. Kd can depend on environmental conditions such as pH and temperature. "Affinity" refers to the strength of binding, and high binding affinity correlates with a low Kd.

[0050] As used herein, the term "hybridizing" or "hybridizing" refers to the pairing of substantially complementary or complementary nucleic acid sequences in two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence is linked to a substantially complementary or fully complementary sequence through base pairing to form a hybridization complex. "Hybridizing" or "hybridizing" can include denaturing a molecule to disrupt the intramolecular structure (e.g., secondary structure) of the molecule. In some embodiments, denaturing a molecule includes heating a solution containing the molecule to a temperature sufficient to disrupt the intramolecular structure of the molecule. In some cases, denaturing a molecule includes adjusting the pH of a solution containing the molecule to a pH sufficient to disrupt the intramolecular structure of the molecule. In the context of hybridization, two nucleic acid sequences or segments of sequences are "substantially complementary" if at least 80% of their individual bases are complementary to one another. In some embodiments, a splint oligonucleotide sequence has about 50% or less identity to one of the two polynucleotides (e.g., RNA fragments) that it is designed to be complementary to. The complementary portions of each sequence may be referred to herein as "segments," and a segment is substantially complementary if it has 80% or more identity.

[0051] The terms "complementary" and "complementary" mean that one nucleic acid can form hydrogen bonds with another nucleic acid according to the classical Watson-Crick base pairing rules, where adenosine (A) pairs with thymine (U) and guanine (G) pairs with cytosine (C). Complementarity can be perfect (e.g., complete complementarity) or imperfect (e.g., partial complementarity). Perfect or complete complementarity refers to the ability of every nucleic acid base in one strand to form hydrogen bonds with the corresponding base in another antiparallel nucleic acid sequence according to the classical Watson-Crick base pairing. Partial complementarity refers to the ability of only a certain percentage of adjacent residues of a nucleic acid sequence to form Watson-Crick base pairs with the same number of adjacent residues in the other antiparallel nucleic acid sequence. In some embodiments, complementarity can be at least 70%, 80%, 90%, 100%, or a number or range between any two of these values. In some embodiments, complementarity is complete, i.e., 100%. For example, a complementary candidate sequence segment is perfectly complementary to a candidate sequence segment, the sequence of which can be deduced from the candidate sequence segment using Watson-Crick base pairing rules.

[0052] As used herein, the term "vector" refers to a polynucleotide construct, typically a plasmid or virus, used to transfer genetic material to a host cell. A vector can be, for example, a virus, a plasmid, a cosmid, or a phage. A vector as used herein can be composed of either DNA or RNA. In some embodiments, a vector is composed of DNA. An "expression vector" is a vector that, when present in the appropriate environment, can induce expression of a protein encoded by one or more genes carried by the vector. The vector is preferably capable of self-replicating. Typically, an expression vector includes a transcription promoter, a gene, and a transcription terminator. Gene expression usually occurs under the control of a promoter, and a gene is said to be "operably linked" to the promoter.

[0053] As used herein, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to any nucleic acid, whether composed of phosphodiester bonds or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonic acid, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonic acid, phosphorothioate, methylphosphonic acid, phosphorodithioate, bridged phosphorothioate, or sultone bonds, and combinations of such linkages.The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine, and uracil).

[0054] As used herein, "transfection" or "infection" refers to the introduction of nucleic acid into a host cell, such as by contacting the cell with a recombinant MVA virus or gutless picornavirus particle described herein.

[0055] As used herein, the term "transgene" refers to any nucleotide or DNA sequence that is integrated into one or more chromosomes of a target cell by human intervention. In some embodiments, the transgene comprises a polynucleotide that encodes a protein of interest. The polynucleotide that encodes the protein is generally operably linked to other sequences that are useful for obtaining the desired expression of the protein of interest, such as transcriptional regulatory sequences. In some embodiments, the transgene may additionally comprise a nucleic acid or other molecule that is used to mark the chromosome into which the transgene is integrated.

[0056] As used herein, "treatment" refers to a clinical intervention that is performed in response to a disease, disorder, or physiological condition that a patient exhibits or may suffer from. The purpose of treatment includes, but is not limited to, alleviating or preventing symptoms, or slowing or stopping the progression or worsening of a disease, disorder, or condition, and / or the recurrence of a disease, disorder, or condition. "Treatment" refers to either or both of therapeutic treatment and prophylactic or preventative measures. Subjects in need of treatment include those already suffering from a disease or disorder or an undesirable physiological condition, and those in whom a disease or disorder or an undesirable physiological condition is to be prevented.

[0057] As used herein, the term "effective amount" or "pharmacologically effective amount" or "therapeutically effective amount" refers to an amount sufficient to effect beneficial or desired biological and / or clinical results.

[0058] As used herein, the term "pharmaceutical acceptable excipient" refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive, or diluent for administering a compound of interest to a subject. Pharmaceutically acceptable excipients can include substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers.

[0059] As used herein, "subject" refers to an animal for which diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. As used herein, "mammal" refers to an individual belonging to the mammalian species, and includes, but is not limited to, humans, livestock, farm animals, zoo animals, sport animals, and pet animals. Non-limiting examples of mammals include mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, and primates such as monkeys, chimpanzees, and apes, and in particular humans. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. In some embodiments, the subject may have or be suspected of having cardiovascular disease and / or have one or more symptoms of cardiovascular disease. In some embodiments, the subject is a human who has been diagnosed as having a risk of cardiovascular disease at the time of diagnosis or thereafter. In some cases, a diagnosis of being at risk for cardiovascular disease may be determined based on the presence of one or more mutations in the endogenous apolipoprotein(a) (LPA) gene or in genomic sequences near the LPA gene in the genome that may affect expression of the apo(a) protein.

[0060] The term "plasma level" as used herein in the context of a molecule refers to the concentration or amount of that molecule, e.g., the number of moles or weight of the molecule present in a given volume of plasma.

[0061] High levels of Lp(a) have been associated with increased risk of cardiovascular disease. Lp(a) levels higher than 50 mg / dL can cause calcific aortic valve disease (CAVD) and cardiovascular disease (CVD). Unlike low-density lipoprotein, Lp(a) levels cannot be regulated by environment, diet, exercise, or existing lipid-lowering drugs such as statins, which makes Lp(a) levels a genetic disease risk factor. There is a need for novel gene therapy that can stably reduce Lp(a) levels over a long period of time or permanently reduce Lp(a) levels. The present disclosure provides a highly efficient gene editing method and related compositions and kits that directly target the LPA gene or its variants to permanently knock out the LPA gene from the genome, thereby permanently reducing the level of Lp(a) in the blood (e.g., plasma) of a subject. In some embodiments, the methods, compositions, and kits described herein can reduce plasma Lp(a) levels by at least 20%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or more. In some embodiments, plasma Lp(a) levels in a subject after performing the method are reduced to just or about 60 mg / dL, 55 mg / dL, 50 mg / dL, 45 mg / dL, 40 mg / dL, 35 mg / dL, 30 mg / dL, or less. The gRNA sequences described herein can also significantly minimize the number and frequency of off-target effects, thereby reducing the risk of genotoxicity. The methods, compositions, and kits described herein can be used to treat and / or reduce the risk of cardiovascular disease in a subject.

[0062] Lipoprotein(a) (Lp(a)) Provided herein are vectors, compositions, methods, systems, and kits for editing the LPA gene (including, for example, LPA gene variants associated with increased cardiovascular disease risk and / or increased Lp(a) expression) encoding the apolipoprotein(a) protein of lipoprotein(a) (Lp(a)) in a cell genome to regulate (e.g., decrease) the expression, function, or activity of Lp(a) in a cell. As used herein, the term "LPA gene" includes the gene region encompassing the LPA-regulated promoter and enhancer sequences as well as the LPA coding sequence.

[0063] Lp(a) is an atherogenic lipoprotein composed of the protein apolipoprotein(a) (apo(a)) covalently bound to the apolipoprotein B-100 (apoB) component of low-density lipoprotein (LDL) particles (see, e.g., FIG. 1). The apo(a) protein is encoded by the LPA gene, made in hepatocytes, and secreted into the circulation. However, while it is known that apo(a) docks to LDL and forms a covalent disulfide bond with apoB to form Lp(a), the exact site of Lp(a) association is unknown. This binding of apo(a) to apoB blocks the LDL receptor binding site of apoB, thereby inhibiting clearance through the LDL receptor pathway. Apo(a) evolved from the plasminogen gene and contains related protein domains. The apo(a) protein is composed of one kringle V (KV) domain, multiple copies of the kringle IV (KIV) domain, and an inactive protease-like domain, all of which are derived from plasminogen. KIV is classified into 10 subtypes: KIVi and KIV3-10, which are present in one copy, and KIV2, which is present in 1 to more than 40 copies. The size of apo(a) varies between individuals and is proportional to the copy number of KIV2, which is genetically determined. Plasma levels of Lp(a) are negatively correlated with the size of the apo(a) protein, which may be due to the slow secretion of the larger isoform. High plasma levels of Lp(a) are an independent risk factor for many cardiovascular diseases, including calcific aortic valve disease, coronary heart disease, atherosclerosis, thrombosis, and stroke (reviewed in Kronenberg, F. (2016). Cardiovasc. Drugs Ther., 30(l):87-100).

[0064] The pathogenic mechanism of Lp(a) is through its atherogenic, proinflammatory and prothrombotic properties. The combination of the apo(a) and LDL components of Lp(a) results in complex effects on the cardiovascular system. LDL alone can trigger the immune and inflammatory responses characteristic of atherosclerosis through the entry of LDL into the vessel wall where phospholipids are oxidized. Lp(a) circulates in the plasma and binds to oxidized phospholipids, triggering a proinflammatory response. Apo(a) itself contains sites that can bind to exposed surfaces of damaged vessel walls, thereby mediating the entry and accumulation of apo(a) at that location. Small isoforms of apo(a) have been shown to promote thrombosis by inhibiting fibrinolysis.

[0065] Plasma levels of Lp(a) have been widely studied in relation to cardiovascular disease, and multiple studies have positively associated high Lp(a) levels with a higher risk of cardiovascular disease (reviewed in Kronenberg, F. (2016). Cardiovasc. Drugs Ther., 30(l):87-100). The range of plasma Lp(a) levels in humans can vary 1000-fold between individuals (e.g., 0.1 mg / dL to >300 mg / dL, or <30 nmol / L to >400 nmol / L). Variable serum levels are genetically determined, for example, by apo(a) allele size (number of KIV-2 repeats), 5' pentanucleotide repeat polymorphism, SNPs in the 5' and other regions of the LPA gene, etc. Lp(a) levels in serum can be detected using ELISA assays or immunoturbidimetry, as will be understood by those skilled in the art.

[0066] The LPA gene (also known as LP, AK38, and APOA) has a cytogenetic location of 6q25.3-q26 and genomic coordinates are chromosome 6, reverse strand, positions 160531482-160664275. The nucleotide sequence of LPA can be found on the NCBI website under NCBI Reference Sequence: NC_000006.12. The NCBI Gene ID for LPA is 4018, the Uniprot ID is P08519, and the Ensembl Gene ID is ENSG00000198670.

[0067] Gene editing Provided herein include methods, compositions, and kits for editing the LPA gene or variants thereof, thereby reducing the expression level of Lp(a) (e.g., plasma concentration of Lp(a)) in a subject. Gene editing (including genome editing) is a type of genetic engineering in which nucleotides / nucleic acids in a DNA sequence, such as the genome of a target cell, are inserted, deleted, and / or replaced. Targeted gene editing allows for insertion, deletion, and / or replacement at a preselected site in the genome of a target cell (e.g., in a targeted gene or in a targeted DNA sequence). When the sequence of an endogenous gene is edited, for example by deletion, insertion, or replacement of nucleotides / nucleic acids, the endogenous gene containing the affected sequence can be knocked out or knocked down due to the change in sequence. Thus, targeted editing can be used to disrupt endogenous gene expression. "Targeted integration" refers to a process involving the insertion of one or more exogenous sequences, with or without the deletion of endogenous sequences at the insertion site. When a donor template containing an exogenous sequence is present, targeted gene editing can result in targeted integration.

[0068] Targeted editing can be achieved through either nuclease-independent or nuclease-dependent approach.In the nuclease-independent targeted editing approach, homologous recombination is induced by the homologous sequences that flank the exogenous polynucleotide, so that it is introduced into endogenous sequence through the enzyme mechanism of host cell.The exogenous polynucleotide can introduce deletion, insertion or substitution of nucleotide into endogenous sequence.

[0069] Alternatively, nuclease-dependent approaches can achieve targeted editing at high frequencies through the specific introduction of double-strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ), which occurs in response to DSBs. DNA repair by NHEJ often results in random insertion or deletion (indels) of a small number of endogenous nucleotides. In contrast to repair via NHEJ, repair can also occur by homology-directed repair (HDR). If a donor template is present that contains exogenous genetic material flanked by a pair of homology arms, the exogenous genetic material can be introduced into the genome by HDR, resulting in targeted integration of the exogenous genetic material.

[0070] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; clustered regularly interspaced short palindromic repeats associated 9).In addition, the DICE (dual integrase cassette exchange) system utilizing phiC31 and Bxb1 integrases may be used for targeted integration.

[0071] ZFN is a targeted nuclease that comprises a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that sequence-specifically binds to DNA through one or more zinc fingers. A zinc finger is a domain of about 30 amino acids in the zinc finger binding domain, whose structure is stabilized by the coordination of zinc ions. Examples of zinc fingers include, but are not limited to, C2H2 zinc finger, C3H zinc finger, and C4 zinc finger. Designed zinc finger domains are non-natural domains, and their design / composition is mainly the result of rational criteria, such as the application of substitution rules and computer algorithms to process information from databases that accumulate information on existing ZFP designs and binding data. For example, see U.S. Patent Nos. 6,140,081, 6,453,242, and 6,534,261. See also WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536, and WO03 / 016496. The zinc finger domain selected is a non-naturally occurring domain that is produced primarily as a result of empirical processes such as phage display, interaction trap, or hybrid selection. ZFNs are described in more detail in U.S. Patent No. 7,888,121 and U.S. Patent No. 7,972,854. The most recognized example of ZFN is the fusion of FokI nuclease with zinc finger DNA binding domain.

[0072] TALENs are targeted nucleases that contain a nuclease fused to a TAL effector DNA binding domain. A "transcription activator-like effector DNA binding domain", "TAL effector DNA binding domain", or "TALE DNA binding domain" is a polypeptide domain of a TAL effector protein that is responsible for binding of the TAL effector protein to DNA. TAL effector proteins are secreted during the infection process by plant pathogens of the genus Xanthomonas. These proteins enter the nucleus of the plant cell, bind to effector-specific DNA sequences via the DNA binding domain, and activate gene transcription at those sequences via the transactivation domain. The specificity of the TAL effector DNA binding domain depends on the effector variable of imperfect 34 amino acid repeats that contain polymorphisms called repeat variable diresidues (RVDs) at selected repeat positions. TALENs are described in more detail in U.S. Patent Application Publication No. 2011 / 0145940. The most recognized example of a TALEN in the art is a fusion polypeptide between FokI nuclease and a TAL effector DNA-binding domain.

[0073] Further examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wβ / SPBc / TP901-1, used alone or in combination.

[0074] Other non-limiting examples of targeted nucleases include natural and recombinant nucleases, such as CRISPR / Cas9, restriction endonucleases, meganucleases, homing endonucleases, and the like.

[0075] CRISPR-Cas gene editing system and RNA-guided nucleases In some embodiments, the vectors, compositions, methods, and kits described herein may be used to gene edit the LPA gene in a gene editing system, such as the CRISPR-Cas gene editing system. For example, the CRISPR-Cas9 system repurposes a natural defense mechanism of prokaryotes as an RNA-guided DNA targeting platform used for gene editing. It relies on Cas9, a DNA nuclease, and two non-coding RNAs, crisprRNA (crRNA) and transactivating RNA (tracrRNA), for targeting cleavage of DNA. The crRNA drives the sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing with a typically 20 nucleotide (nt) sequence in the target DNA. The CRISPR-Cas9 complex binds only to DNA sequences that contain the first 20 nt of the crRNA, i.e., a sequence that matches the single guide RNA (sgRNA), if the target sequence is followed by a specific short DNA motif (with the sequence NGG) called the protospacer adjacent motif (PAM). The tracrRNA hybridizes with the 3' end of the crRNA to form an RNA duplex structure to which the Cas9 endonuclease can bind to form a catalytically active CRISPR-Cas9 complex, thereby cleaving the target DNA. When the CRISPR-Cas9 complex binds to DNA at the target site, two independent nuclease domains in the Cas9 enzyme each cut one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) (blunt end) where both strands of DNA terminate in base pairing. After the binding of the CRISPR-Cas9 complex to DNA at a specific target site and the formation of a site-specific DSB, the next important step is the repair of the DSB. Cells use two major DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homology-directed repair (HDR). In some embodiments, the CRISPR-Cas9 gene editing system comprises an RNA-guided nuclease and one or more guide RNAs that target one or more target genes.

[0076] As described herein, the RNA-guided endonuclease can be naturally occurring or non-naturally occurring. Non-limiting examples of RNA-guided endonucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Csm7, Csm8, Csm9, Csm10, Csm11, Csm12, Csm13, Csm14, Csm15, Csm16, Csm17, Csm18, Csm19, Csm20, Csm21, Csm22, Csm23, Csm24, Csm25, Csm26, Csm27, Csm28, Csm29, Csm210, Csm211, Csm22, Csm23, Csm24, Csm25, Csm26, Csm27, Csm28, Csm29, Csm212, Csm213, Csm214, Csm215, Csm216, Csm22, Csm23, Csm24, Csm25, Csm26, Csm27, Csm28, Csm29, Csm215, Csm216, Csm217, Csm218, Csm219, Csm22, Csm23, Csm219, Csm22, Csm23, Csm23, Csm24 In some cases, the RNA-guided endonuclease is a Cas9 endonuclease. Cas9 endonucleases include, for example, Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus lugdunensis Cas9 (SluCas9), P. pneumotropica Cas9 (PpCas9), Staphylococcus auricularis Cas9 (SauriCas9), Staphylococcus lugdunensis Cas9 (SlugCas9), Staphylococcus lutrae Cas9 (SlutrCas9), Staphylococcus haemolyticus Cas9 (Staphylococcus The causative agent may be a Cas9 vector such as Campylobacter haemolyticus Cas9 (ShaCas9), Campylobacter jejuni (CjCas9), Staphylococcus aureus (SaCas9), or a variant thereof.In some embodiments, the RNA-guided endonuclease is a variant of Cas9, including but not limited to small Cas9, dead Cas9 (dCas9), and Cas9 nickase. In some embodiments, the Cas nuclease may include a RuvC or RuvC-like nuclease domain (e.g., Cpf1), and / or an HNH or HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 endonuclease is S. pyogenes Cas9, S. aureus Cas9, N. meningitidis Cas9, S. thermophilus Cas9, S. thermophilus 3 Cas9, T. denticola Cas9, or a variant thereof.

[0077] The RNA-guided endonuclease can be a small RNA-guided endonuclease.The small RNA-guided endonuclease can be designed from the part of the RNA-guided endonuclease from any of the RNA-guided endonucleases described herein and known in the art.The small RNA-guided endonuclease can be, for example, a small Cas endonuclease.In some cases, the small RNA-guided nuclease is less than about 1,100 amino acids in length.

[0078] The RNA-guided endonuclease may be a mutant RNA-guided endonuclease. For example, the RNA-guided endonuclease may be a mutant of a natural RNA-guided endonuclease. The mutant RNA-guided endonuclease may also be a mutant RNA-guided endonuclease with altered activity compared to the natural RNA-guided endonuclease, such as altered endonuclease activity (e.g., altered or suppressed DNA endonuclease activity without substantially reducing the binding affinity to DNA). Such modifications may allow sequence-specific DNA targeting of the mutant RNA-guided endonuclease for transcriptional regulation (e.g., activation or suppression); epigenetic or chromatin modification by methylation, demethylation, acetylation or deacetylation; or any other modification of DNA-binding and / or DNA-modifying proteins known in the art. In some embodiments, the mutant RNA-guided endonuclease does not have DNA endonuclease activity.

[0079] The RNA-guided endonuclease may be a nickase that has a reduced ability to cleave a complementary strand of the target DNA while cleaving a non-complementary strand of the target DNA, or a reduced ability to cleave a complementary strand of the target DNA while cleaving a non-complementary strand of the target DNA. In some embodiments, the RNA-guided endonuclease has a reduced ability to cleave both the complementary and non-complementary strands of the target DNA.

[0080] In some embodiments, a nucleic acid encoding an RNA-guided endonuclease is administered to a subject. In some embodiments, the nucleic acid may be produced by an in vitro transcription reaction. In some embodiments, producing the in vitro transcribed RNA comprises incubating a linear DNA template with an RNA polymerase and a nucleotide mixture under conditions that allow for (run-off) RNA in vitro transcription. The nucleotide mixture may be part of an in vitro transcription mix (IVT mix). In some embodiments, the RNA polymerase is T7 RNA polymerase. The nucleotide mixture used for RNA in vitro transcription may additionally contain modified nucleotides as defined below. In some embodiments, the nucleotide mixture used for the RNA in vitro transcription reaction (e.g., a mixture of minute amounts of each nucleotide) may be optimized for a given RNA sequence (optimized NTP mix). Such methods are described, for example, in WO2015 / 188933. The RNA obtained by the process using an optimized NTP mix is, in some embodiments, characterized by reduced immunostimulatory properties.

[0081] In some embodiments, the nucleotide mixture includes the unmodified ribonucleoside triphosphates (NTPs) GTP, ATP, CTP, and UTP. In some embodiments, the in vitro transcription can include the presence of at least one cap analog, such as the cap1 trinucleotide cap analog, m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG, m7G(5')ppp(5')(2'OMeA)pG, or rn7(3'OMeG)(5')ppp(5')(2'OMeA)pG. In some embodiments, the 5' cap structure is formed via enzymatic capping using a capping enzyme (e.g., vaccinia virus capping enzyme and / or cap-dependent 2'-O-methyltransferase) to generate a cap0 or cap1 or cap2 structure. The 5' cap structure (cap0 or cap1) may be added using the methods and means disclosed in WO2016 / 193226 using immobilized capping enzymes and / or cap-dependent 2'-O-methyltransferases. In some embodiments, at least one (ribo)nucleoside triphosphate is partially or completely replaced by a modified nucleoside triphosphate. In some embodiments, the modified nucleoside triphosphate comprises pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine, or 5-methoxyuridine. In some embodiments, to obtain a modified RNA, uracil nucleotides in the nucleotide mixture are replaced (partially or completely) by pseudouridine (ψ) and / or N1-methylpseudouridine (m1ψ). In some embodiments, the chemically modified nucleotide is pseudouridine (ψ). In some embodiments, the chemically modified nucleotide is N1-methylpseudouridine (m1ψ). In some embodiments, the nucleotide mixture includes at least one modified nucleotide and / or at least one nucleotide analog or nucleotide derivative for incorporation into RNA.For example, modified nucleotides as defined herein may include nucleotide analogs / variants, such as backbone variants, sugar variants, or base variants. Backbone variants may include variants in which the phosphate of the nucleotide backbone is chemically modified. Sugar variants may include chemical modifications of the sugar of the nucleotide. Furthermore, base variants may include chemical modifications of the base moiety of the nucleotide. In this context, nucleotide analogs or variants may include nucleotide analogs applicable to transcription and / or translation. In some embodiments, the nucleotide mixture includes at least one modified nucleotide, and / or the at least one nucleotide analog is selected from a backbone modified nucleotide, a sugar modified nucleotide, and / or a base modified nucleotide, or any combination thereof.

[0082] Modified nucleosides and nucleotides that may be included in the nucleotide mixture and incorporated into RNA may have modified sugar moieties. For example, the 2' hydroxy group (OH) may be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxy group modifications include alkoxy or aryloxy (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycol (PEG), -O(CHCH 20)nCH2CH2OR; "locked" nucleic acids (LNAs) in which the 2' hydroxyl group is linked to the 4' carbon of the same ribose sugar, for example by a methylene bridge; and amino groups (-O-amino, where the amino group can be alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy. "Deoxy" modifications include hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or the amino group can be linked to the sugar via a linker, where the linker includes one or more of the atoms C, N, and O. Also, the sugar group can contain one or more carbons that have the opposite stereochemical configuration relative to the stereochemical configuration of the corresponding carbon of ribose. Thus, modified RNA molecules can include nucleotides that contain, for example, arabinose as the sugar.

[0083] The phosphate backbone can be further modified in modified nucleosides and modified nucleotides, which can be included in nucleotide mixtures and incorporated into modified in vitro transcribed RNA. The backbone phosphate group can be modified by replacing one or more oxygen atoms with different substituents. In addition, modified nucleosides and modified nucleotides can include those that completely replace the unmodified phosphate moiety with modified phosphates as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boron phosphates, boron phosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In phosphorodithioates, both oxygens not involved in the linkage are replaced by sulfur. Phosphate linkers can also be modified by replacing oxygens involved in the linkage with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates).

[0084] The nucleotide described herein can be modified in nucleobase portion.The examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine and uracil.For example, the nucleosides and nucleotides described herein can be chemically modified in the major groove side.In some embodiments, the major groove chemical modification comprises amino group, thiol group, alkyl group or halogen group.

[0085] Nucleotide analogs / modifications include 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate. , 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo- 2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5' -triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, xanthosine-5'-triphosphate. Base modified nucleotides include 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine,1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, di Hydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-cytidine, -methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, Nopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine,2-Methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyladenine, 2-methylthioadenine, and 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl -guanosine, 6-thio-7-methylguanosine, 7-methylinosine, 6-methoxyguanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxoguanosine, 7-methyl-8-oxoguanosine, 1-methyl-6-thioguanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'- O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseudouridine, 6-aza-cytidine, 2-thio-cytidine, alpha-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, alpha-thio-uridine, 4-thiouridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidylidene The purine may include 5-methyl-uridine, pyrrolo-cytidine, inosine, alpha-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, alpha-thio-adenosine, 8-azido-adenosine, or 7-deaza-adenosine.

[0086] The at least one modified nucleotide and / or at least one nucleotide analogue described herein may be 1-methyl adenosine, 2-methyl adenosine, N6-methyl adenosine, 2'-O-methyl adenosine, 2-methylthio-N6-methyl adenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6-Methyl-N6-threonylcarbamoyl adenosine, N6-hydroxynorvalylcarbamoyl adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl adenosine, inosine, 3-methylcytidine, 2-O-methylcytidine, 2-thiocytidine, N4-acetylcytidine, lysidine, 1-methylguanosine, 7-methylguanosine, 2'-O-methylguanosine, keosine, epoxykeosine, 7-cyano-7-deazaglycine uridine, 5-hydroxyuridine, 5-methoxyuridine, 5-oxyacetic acid uridine, 5-oxyacetic acid uridine methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0087] In some embodiments, the chemical modification comprises pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-azauridine, dihydropseudouridine, 5-methoxyuridine, 2'-O-methyluridine, or a combination thereof.

[0088] In some embodiments, 100% of the uracils in the coding sequence may have a chemical modification. In some embodiments, the chemical modification is at the 5' position of the uracil. In some embodiments, 100% of the uracils in the coding sequence (cds) of the RNA may have a chemical modification, such as a chemical modification at the 5' position of the uracil. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the uracil nucleotides in the cds have a chemical modification, such as a chemical modification at the 5 position of the uracil nucleotide. Such modifications may reduce the stimulation of the innate immune system (after in vivo administration of the RNA containing such modified nucleotides).

[0089] The term "cds" or "coding sequence" or "coding region" as used herein is recognized and understood by those of skill in the art and may refer to a sequence of multiple nucleotide triplets that may be translated, for example, into a peptide or protein. The cds of an RNA may include at least one modified nucleotide, and the at least one modified nucleotide may be selected from pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine, and 5-methoxyuridine.

[0090] As used herein, the term "modified nucleotides" or "chemically modified nucleotides" can refer to all possible natural and non-natural chemical modifications of the building blocks of RNA, i.e., ribonucleotides A, G, C, and U.

[0091] In some embodiments, the nucleotide mixture in the in vitro transcription reaction includes a cap analog. Thus, in some embodiments, the cap analog is a cap0, cap1, cap2, modified cap0 or modified cap1 analog, or a cap1 analog as described below. The term "cap analog" or "5' cap structure" as used herein may refer to the 5' structure of an RNA, particularly a guanine nucleotide located at the 5' end of an RNA, such as an mRNA. In some embodiments, the 5' cap structure is linked to the RNA via a 5'-5'-triphosphate bond. In some embodiments, a "5' cap structure" or "cap analog" is not considered a "modified nucleotide" or a "chemically modified nucleotide". Suitable 5' cap structures include cap0 (methylation of the first nucleobase, e.g., m7GpppN), cap1 (additional methylation of the ribose of the nucleotide adjacent to m7GpppN), cap2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), cap3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), cap4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse cap analog), modARCA (e.g., phosphothioate modARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0092] The 5' cap (cap0 or cap1) structure can be formed using a capping enzyme in RNA chemical synthesis or using a cap analog in RNA in vitro transcription (co-transcriptional capping). As used herein, the term "cap analog" can refer to a non-polymerizable di- or trinucleotide that has a capping function that, when incorporated at the 5' end of an RNA, facilitates translation or localization of the RNA and / or inhibits degradation. Non-polymerizable means that the cap analog will only be incorporated at the 5' end because it does not have a 5' triphosphate and therefore cannot be extended in the 3' direction by a template-dependent polymerase (e.g., a DNA-dependent RNA polymerase). Examples of cap analogs include m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetric cap analogs (e.g., m7Gpppm7G), or anti-reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG, and their tetraphosphate derivatives). Additional cap analogs have been previously described, for example, in WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347, and WO2013 / 059475. Further suitable cap analogs in this context are described, for example, in WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 053297, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797, the disclosures of which are incorporated herein by reference.

[0093] In some embodiments, the cap1 structure is generated using a trinucleotide cap analog as disclosed in WO2017 / 053297, WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797. For example, any cap analog derivable from the structures disclosed in claims 1-5 of WO2017 / 053297 may be suitably used to co-transcriptionally generate the cap1 structure. In some embodiments, any cap analog derivable from the structures described in WO2018 / 075827 may be suitably used to co-transcriptionally generate the cap1 structure. In some embodiments, the cap1 analog is a cap1 trinucleotide cap analog. In some embodiments, the cap1 structure of the in vitro transcribed RNA is formed using co-transcriptional capping using the trinucleotide cap analog m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG. In some embodiments, the cap1 analog is m7G(5')ppp(5')(2'OMeA)pG.

[0094] In some embodiments, the RNA (e.g., mRNA) comprises a 5' cap structure, such as a cap1 structure. In some embodiments, the 5' cap structure may improve the stability and / or expression of the mRNA. A cap1 structure containing mRNA (e.g., produced by in vitro transcription) has several advantageous features, including increased translation efficiency and reduced stimulation of the innate immune system. In some embodiments, the in vitro transcribed RNA comprises at least one coding sequence that encodes at least one peptide or protein. In some embodiments, the protein is an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is Cas9 or a derivative thereof.

[0095] The present disclosure provides an optimized mRNA encoding a S. pyogenes Cas9 endonuclease ("SpCas9 mRNA"), which optionally includes chemically modified nucleotides, and which, when administered with one or more gRNAs, provides effective genome editing of a target cell population. In some embodiments, the present disclosure provides an mRNA comprising: (i) a 5' untranslated region (UTR); (ii) an open reading frame (ORF) comprising a nucleotide sequence encoding a site-specific endonuclease; and (iii) a 3' untranslated region (UTR). In some embodiments, the site-specific endonuclease is a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide is a Streptococcus pyogenes derived Cas9 (SpCas9) polypeptide. In some embodiments, the ORF further comprises one or more nucleotide sequences encoding a nuclear localization signal, such as those described herein. In some embodiments, the ORF comprises a nucleotide sequence encoding a site-specific endonuclease, such as an SpCas9 polypeptide, and at least one NLS that is a nucleoplasmin and / or an SV40 NLS. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal and / or C-terminal NLS operably linked to a site-specific endonuclease, such as an SpCas9 polypeptide. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal SV40 NLS operably linked to a site-specific endonuclease, such as an SpCas9 polypeptide, and a C-terminal nucleoplasmin NLS operably linked to a site-specific endonuclease, such as an SpCas9 polypeptide.

[0096] In some embodiments, the mRNA may contain at least one chemically modified nucleoside and / or nucleotide. In some embodiments, the chemically modified nucleoside is selected from pseudouridine, N1-methylpseudouridine, and 5-methoxyuridine. In some embodiments, the chemically modified nucleoside is N1-methylpseudouridine (e.g., 1-methylpseudouridine). In some embodiments, at least about 80% or more (e.g., about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) of the uridines in the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, 100% of the uridines (e.g., uracil) in the mRNA are modified or replaced with N1-methylpseudouridine. In some embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 100, 100 5, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800, or more) is N1-methylpseudouridine.

[0097] Guide RNA (gRNA) In some embodiments, the CRISPR / Cas-mediated gene editing system used to gene-edit the LPA gene comprises a genome-targeting nucleic acid (e.g., a guide RNA) that can direct the activity of an RNA-guided endonuclease to a specific target sequence in the LPA gene. The guide RNA comprises at least a spacer sequence that hybridizes to the target nucleic acid sequence of interest, and a CRISPR repeat sequence. The gRNA can be a single-molecule guide RNA or a double-molecule guide RNA. The RNA-guided endonuclease can be, for example, a Cas endonuclease, including a Cas9 endonuclease. The Cas9 endonuclease can be, for example, a SpyCas9, SaCas9, or SluCas9 endonuclease. In some embodiments, the RNA-endonuclease is a Cas9 variant. In some embodiments, the RNA-guided endonuclease is a small RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a small Cas endonuclease.

[0098] In some embodiments, the gRNA comprises, in 5' to 3' order, a crRNA and a tracrRNA, where the crRNA and the tracrRNA hybridize to form a duplex. In some embodiments, the crRNA comprises a spacer sequence capable of targeting a target sequence in a target nucleic acid (e.g., a genomic DNA molecule), and a crRNA repeat sequence. In some embodiments, the tracrRNA comprises a tracrRNA anti-repeat sequence and a 3' tracrRNA sequence. In some embodiments, the 3' end of the crRNA repeat sequence is linked to the 5' end of the tracrRNA anti-repeat sequence, for example by a tetraloop, where the crRNA repeat sequence and the tracrRNA anti-repeat sequence hybridize to form an sgRNA. In some embodiments, the sgRNA comprises, in 5' to 3' order, a spacer sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA anti-repeat sequence, and a 3' tracrRNA sequence. In some embodiments, the sgRNA comprises a 5' spacer extension sequence. In some embodiments, the sgRNA comprises a 3' tracrRNA extension sequence. The 3'tracrRNA can comprise or consist of one or more stem loops, for example, one, two, three, or more stem loops.

[0099] In some embodiments, the invariant sequence of the sgRNA comprises the nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 1), or a nucleotide sequence having a deletion, insertion, or substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 nucleotides compared to SEQ ID NO: 1. In some embodiments, the sgRNA is for use with SpCa9 or SpyCas9 endonucleases.

[0100] The guide RNA disclosed herein can target any sequence of interest via the spacer sequence of the crRNA. The spacer sequence of the gRNA is a sequence (e.g., a 20 nucleotide sequence) that defines a target sequence (e.g., a DNA target sequence such as a genomic target sequence) of a target gene of interest (e.g., an LPA gene). In some embodiments, the spacer sequence ranges from 15 to 30 nucleotides. For example, the spacer sequence can be exactly, about, at least, or at most 10, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50 nucleotides in length, or a number or range of nucleotides between any of these values. In some embodiments, the spacer sequence contains 20 nucleotides. In some embodiments, the gRNA can hybridize to the forward strand of the target dsDNA. In some embodiments, the gRNA can hybridize to the reverse strand of the target dsDNA.

[0101] A "target sequence" is a sequence in a target gene adjacent to a PAM sequence and is modified by an RNA-guided nuclease (e.g., Cas9). A "target sequence" is located on the so-called PAM strand of a "target nucleic acid," which is a double-stranded molecule containing a PAM strand and a complementary non-PAM strand. Those skilled in the art recognize that a gRNA spacer sequence hybridizes to a complementary sequence located in the non-PAM strand of a target nucleic acid sequence of interest. Thus, a gRNA spacer sequence is an RNA equivalent of a target sequence. The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner through hybridization (i.e., base pairing). Thus, the nucleotide sequence of the spacer varies depending on the target sequence of the target nucleic acid of interest. In some embodiments, the target sequence of the LPA gene is within exon 3 of the LPA gene.

[0102] In the CRISPR / Cas system used herein, the spacer sequence is designed to hybridize with the region of the target nucleic acid located 5' of the PAM that can be recognized by the Cas9 enzyme used in the system. The spacer can be perfectly matched to the target sequence or have a mismatch. Each Cas9 enzyme has a specific PAM sequence that it recognizes in the target DNA. For example, S. pyogenes recognizes the PAM that contains the 5'-NRG-3' sequence in the target nucleic acid, where R contains either A or G, N is any nucleotide, and N is immediately 3' of the target nucleic acid sequence that is targeted by the spacer sequence.

[0103] In some embodiments, the target nucleic acid sequence has a length of 20 nucleotides. In some embodiments, the target nucleic acid has a length of less than 20 nucleotides. In some embodiments, the target nucleic acid has a length of more than 20 nucleotides. In some embodiments, the target nucleic acid has a length of at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 nucleotides or more. In some embodiments, the target nucleic acid has a length of up to 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 nucleotides or more. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' to the first nucleotide of the PAM. For example, 5'-NNNNNNNNNNNNNNNNNNNN NRG In the sequence comprising -3' (SEQ ID NO:2), the target nucleic acid can be a sequence corresponding to N, where N can be any nucleotide, and the underlined sequence NRG (R is G or A) is the PAM of S. pyogenes. In some embodiments, the PAM sequence used as the sequence recognized by SpCas9 in the compositions and methods of the disclosure is NGG, where N can be A, T, C, or G.

[0104] The percent complementarity between the spacer sequence and the target nucleic acid can be about, at least, at least about, up to, or up to about, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer sequence of the guide RNA and the target nucleic acid in the target gene are 100% complementary. In some embodiments, the percent complementarity between the spacer sequence and the target sequence is 100% over the six consecutive 5'-most nucleotides of the target sequence of the complementary strand of the target nucleic acid. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least 60% over about 20 consecutive nucleotides. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, such as up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.

[0105] The LPA gRNA may target a target sequence within exon 3 of the LPA gene. In some embodiments, the LPA gRNA comprises a spacer sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10, listed in Table 1. In some embodiments, the LPA gRNA comprises a spacer sequence selected from SEQ ID NOs: 18-25, listed in Table 1. [Table 1]

[0106] In some embodiments, the gRNA comprises a spacer sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10 or variants thereof. In some embodiments, the gRNA comprises a spacer sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10. In some embodiments, the gRNA comprises a spacer sequence having one, two, or three mismatches to an RNA sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10. In some embodiments, the gRNA comprises a spacer sequence represented in SEQ ID NOs: 18-25 or a variant thereof. In some embodiments, the gRNA comprises a spacer sequence selected from SEQ ID NOs: 18-25. In some embodiments, the gRNA comprises a spacer sequence having one, two, or three mismatches to a sequence selected from SEQ ID NOs: 18-25. In some embodiments, the gRNA is an sgRNA.

[0107] In some embodiments, two gRNAs comprising a spacer complementary to the target sequence of the LPA gene are provided to the cell. In some embodiments, the gRNAs are any two gRNAs comprising a spacer corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10 or variants thereof. In some embodiments, one or both of the two gRNAs comprises a spacer sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10. In some embodiments, one or both of the two gRNAs comprises a spacer sequence having one, two, or three mismatches to an RNA sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 3-10. In some embodiments, one or both of the two gRNAs comprises a spacer sequence represented in SEQ ID NOs: 18-25 or a variant thereof. In some embodiments, one or both of the two gRNAs comprises a spacer sequence selected from SEQ ID NOs: 18-25. In some embodiments, one or both of the two gRNAs comprises a spacer sequence having one, two, or three mismatches to a sequence selected from SEQ ID NOs: 18-25.

[0108] In some embodiments, the gRNA comprises a first gRNA comprising a spacer having a sequence of SEQ ID NO: 18 or a sequence having at least 85% (e.g., at least 90%, or at least 95%) homology to SEQ ID NO: 18, and a second gRNA comprising a spacer having a sequence of any one of SEQ ID NOs: 19-25 or a sequence having at least 85% (e.g., at least 90% or at least 95%) homology to any one of SEQ ID NOs: 19-25. In some embodiments, the gRNA comprises a first gRNA comprising a spacer having a sequence of SEQ ID NO: 18, and a second gRNA comprising a spacer having a sequence of any one of SEQ ID NOs: 19-25.

[0109] In some embodiments, the gRNA comprises a spacer sequence depicted in SEQ ID NO: 18, or a sequence having about, at least, or at least about, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence having 3 or fewer mismatches (e.g., 1 or 2 mismatches) compared to SEQ ID NO: 18. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 18.

[0110] In some embodiments, the LPA gRNA comprises a spacer sequence corresponding to any one of the target sequences represented in SEQ ID NOs: 12-17, listed in Table 2 below. In some embodiments, the LPA gRNA comprises a spacer sequence selected from SEQ ID NOs: 26-31, listed in Table 2. [Table 2]

[0111] In some embodiments, the gRNA is a chemically modified gRNA. Various types of RNA modifications can be introduced into the gRNA to enhance stability, reduce the likelihood or extent of innate immune response, and / or enhance other properties known in the art. The gRNAs described herein can include one or more modifications, including internucleoside linkages, purine or pyrimidine bases, or sugars. In some embodiments, modifications are introduced at the end of the gRNA by chemical synthesis or polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in WO2013 / 052523. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

[0112] The chemically modified gRNA may comprise one or more phosphorothioated 2'-O-methyl nucleotides at the 3' and / or 5' ends of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA. In some embodiments, the chemically modified gRNA comprises phosphorothioated 2'-O-methyl nucleotides at the 5' end of the gRNA. In some embodiments, the chemically modified gRNA comprises three or four phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA and / or three or four phosphorothioated 2'-O-methyl nucleotides at the 5' end of the gRNA. In some embodiments, any one of SEQ ID NOs: 18-25 and 26-31 may be chemically modified to have one, two, three, or four phosphorothioated 2'-O-methyl nucleotides at the 3' end of the gRNA; one, two, or three phosphorothioated 2'-O-methyl nucleotides at the 5' end of the gRNA, or a combination thereof. The number and position of phosphorothioate bonds can vary. In some embodiments, phosphorothioate bonds can be located between the first and second, between the second and third, between the third and fourth, between the fourth and fifth, between the fifth and sixth, between the sixth and seventh, between the seventh and eighth, between the eighth and ninth, between the ninth or tenth, or further positions from the 5' end of the gRNA. In some embodiments, phosphorothioate bonds can be located between the first and second, between the second and third, between the third and fourth, between the fourth and fifth, between the fifth and sixth, between the sixth and seventh, between the seventh and eighth, between the eighth and ninth, between the ninth or tenth, or further positions from the 3' end of the gRNA. In some embodiments, the chemically modified gRNA has the sequence of any one of the gRNAs described herein (e.g., SEQ ID NO: 32) and has one or more chemically modified nucleotides and / or one or more phosphorothioate linkages described herein. As an example, the chemically modified gRNA is SEQ ID NO: 11.

[0113] In some embodiments, the nucleotide analog / variant is 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine riboside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 4-amino-6-chloropurine riboside ... 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5 -Iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate. Base modified nucleotides include 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate, pyridin-4-one ribonucleoside, 5-azauridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine,5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxypseudouridine, 4-methoxy-2-thiopseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine , 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, Aminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine,2-Methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl Chirguanosine, 7-methylinosine, 6-methoxyguanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxoguanosine, 7-methyl-8-oxoguanosine, 1-methyl-6-thioguanosine, N2-methyl-6-thioguanosine, and N2,N2-dimethyl-6-thioguanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine ... -thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseudouridine, 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, It may include 5-methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, or 7-deaza-adenosine.

[0114] The at least one modified nucleotide and / or the at least one nucleotide analogue may be 1-methyl adenosine, 2-methyl adenosine, N6-methyl adenosine, 2'-O-methyl adenosine, 2-methylthio-N6-methyl adenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6-methyl -N6-Threonylcarbamoyl adenosine, N6-Hydroxynorvalylcarbamoyl adenosine, 2-Methylthio-N6-Hydroxynorvalylcarbamoyl adenosine, Inosine, 3-Methylcytidine, 2-O-Methylcytidine, 2-Thiocytidine, N4-Acetylcytidine, Lysidine, 1-Methylguanosine, 7-Methylguanosine, 2'-O-Methylguanosine, Keosine, Epoxykeosine, 7-Cyano-7-Deazaguanosine, 7-Aminome uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, or 5-(isopentenylaminomethyl)-2'-O-methyluridine.

[0115] In some embodiments, the chemical modification comprises pseudouridine, N1-methyl-pseudouridine, N1-ethyl-pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modifications include 2'-O-methyluridine (2'OMe-rU), 2-O-methylcytidine (2'OMe-rC), 2'-O-methyladenosine (2'OMe-rA), or 2'-O-methylguanosine (2'OMe-rG).

[0116] The gRNA can include any number of modified nucleotides. For example, the percentage of modified nucleotides in the gRNA can be exactly, about, or at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109, 108, 109, 109, 102, 103, 104, 1 It could be 4%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%.

[0117] For example, SEQ ID NO:3 is "g * a * u *UAA UGA CAU ACG CAU UU" (T is converted to U), where u=2'OMe-rU; a=2'OMe-rA; g=2'OMe-rG; * = thiolated phosphate. In some embodiments, the LPA gRNA is a chemically modified SEQ ID NO: 18, e.g., * a * u * UAA UGA CAU ACG CAU UU", where u=2'OMe-rU; a=2'OMe-rA; g=2'OMe-rG; * = Thiolated phosphate.

[0118] In some embodiments, the gRNA comprises or consists of the sequence GAUUAAUGACAUACGCAUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 32). One or more of the nucleotides of the gRNA (e.g., SEQ ID NO: 32) may be modified nucleotides, for example, one or more U of the gRNA (e.g., SEQ ID NO: 32) may be 2'OMe-rU, one or more A of the gRNA (e.g., SEQ ID NO: 32) may be 2'OMe-rA, one or more C of the gRNA (e.g., SEQ ID NO: 32) may be 2'OMe-rC, and one or more G of the gRNA (e.g., SEQ ID NO: 32) may be 2'OMe-rG. One or more positions of the gRNA (e.g., SEQ ID NO: 32) may be modified; for example, a thiolated phosphate. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 11: 5'- g * a * u * UAA UGA CAU ACG CAU UU G UUU UAG Agc uag aaa uag cAA GUU AAA AUA AGG CUA GUC CGU UAU Caa cuu gaa aaa gug gca ccg agu cgg ugc u * u * u *u-3', comprising or consisting of the sequence, where u=2'OMe-rU; a=2'OMe-rA; c=2'OMe-rC; g=2'OMe-rG; * = thiolated phosphate. The underlined sequences correspond to the spacers.

[0119] In some embodiments, more than one guide RNA can be used with CRISPR / Cas nuclease system.Each guide RNA can contain different targeting sequence, so that CRISPR / Cas system cuts more than one target nucleic acid.In some embodiments, one or more guide RNAs can have the same or different properties, such as activity or stability in Cas9 RNP complex.When more than one guide RNA is used, each guide RNA can be encoded on the same or different vectors.

[0120] The gRNA described herein can be produced by in vitro transcription (IVT), synthesis and / or chemical synthesis, or a combination thereof. Enzymatic methods (IVT), solid phase, liquid phase, combinatorial synthesis, small region synthesis, and ligation methods are utilized. In some embodiments, gRNA is produced using IVT enzymatic synthesis. Methods for producing polynucleotides by IVT are known in the art and described in WO2013 / 151666. Polynucleotide constructs and vectors can be used to in vitro transcribe the gRNA described herein.

[0121] How to edit an LPA Provided herein includes a method of using genome editing to edit LPA by functionally knocking out or reducing expression of LPA gene in the genome of a cell.This method can be used to treat subjects with lipoprotein-related diseases or disorders, such as patients with cardiovascular disease.In some embodiments, the method includes administering to a subject (e.g., a primate subject) a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets LPA and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby treating the cardiovascular disease of the primate subject.

[0122] A subject may be administered a plurality of nanoparticles more than once, for example, twice, for treatment. The two administrations of nanoparticles to a subject may be separated by a suitable period of time, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 1 year, 18 months, 2 years, 3 years, 5 years, 10 years, 15 years, or more. In some embodiments, two of the two or more administrations are separated by about 2 weeks to about 2 months, for example, about 3 weeks. In some embodiments, each of the two or more administrations is separated by about 2 weeks to about 2 months, for example, about 3 weeks, from each other. The suitable period of time between two administrations may be the same as or different from the suitable period of time between another two administrations. In some embodiments, the methods described herein include administering a single dose of a plurality of nanoparticles to a subject once during a predetermined time, for example, 1 year, 2 years, 3 years, 5 years, 6 years, 8 years, 10 years, 15 years, 20 years, or more. In some embodiments, the methods described herein include administering a single dose of a plurality of nanoparticles to a subject once during the subject's lifetime. In some embodiments, the methods described herein include administering a single dose of a plurality of nanoparticles to a subject. In some embodiments, the plurality of nanoparticles is administered to a subject at a dose of about 0.01-5 mg / kg, e.g., 0.05-2 mg / kg, 0.5-3 mg / kg, or 0.1-1 mg / kg of gRNA per administration. In some embodiments, the plurality of nanoparticles is administered to a subject at a dose of about 0.01-5 mg / kg, e.g., 0.05-2 mg / kg, 0.5-3 mg / kg, or 0.1-1 mg / kg of total nucleic acid (i.e., the total amount of LPA gRNA and RNA encoding an RNA-guided endonuclease (e.g., Cas9 mRNA)) per administration.

[0123] In some embodiments, the gRNA targets within or near the coding sequence of the LPA gene. In some embodiments, the gRNA targets any one of the exons of the LPA gene. In some embodiments, the gRNA targets a sequence within exon 3 of the LPA gene. The gRNA may include a spacer sequence that is complementary to a target sequence within exon 3 of the LPA gene. In some embodiments, the spacer is complementary to a sequence within or near exon 3 of the LPA gene (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from exon 3). Complementarity between the spacer of the gRNA and the target sequence in the LPA gene may be perfect or incomplete. In some embodiments, the complementarity can be at least 70%, 80%, 90%, 100%, or a number or range between any two of those values, hi some embodiments, the complementarity is perfect, i.e., 100%.

[0124] In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 18-25 or a sequence having at least, or at least about, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to any one of SEQ ID NOs: 18-25. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 18-25 or a sequence having one, two, or three mismatches compared to any one of SEQ ID NOs: 18-25.

[0125] In some embodiments, the gRNA comprises the sequence of SEQ ID NO:11 or a sequence having about, at least, or at least about, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence homology to SEQ ID NO:11. In some embodiments, the gRNA comprises the sequence of SEQ ID NO:11.

[0126] The gRNA used herein can enhance on-target effects while significantly reducing potential off-target effects (i.e., cleavage of genomic DNA at undesirable locations other than the LPA gene). In some embodiments, off-target binding is reduced by about, at least, or at least about, 80%, 85%, 90%, 95%, 98%, 99%, or 100%.

[0127] The RNA-guided endonuclease may be a Cas endonuclease described herein or known in the art. The Cas endonuclease may be natural or non-natural (e.g., recombinant or mutated). In some embodiments, the Cas endonuclease is a Cas9 endonuclease or a variant thereof. In some embodiments, the DNA endonuclease is Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Casl00, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, The DNA endonuclease is selected from the group consisting of Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl endonuclease or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease or a variant thereof. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0128] In some embodiments, genetic modification of the LPA gene results in significantly reduced blood or plasma Lp(a) levels in a subject (e.g., a mammal, NHP, human subject). In some embodiments, plasma Lp(a) levels are 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 109%, 109%, 102%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 10 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a number or range between any two of these values. In some embodiments, the reduction in plasma Lp(a) levels is about, at least, or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100%, or a value or range between any two of these values.

[0129] In some embodiments, the plasma Lp(a) levels in a genetically modified subject (e.g., mammal, NHP, human subject) are about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 102%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 109%, 109%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 1 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or a number or range between, less than, or about less than any two of these values.

[0130] In some embodiments, the reduction is relative to LPA expression or LPA protein concentration in the plasma of a subject (e.g., a mammal, NHP, human subject) before administration of the plurality of nanoparticles. In some embodiments, the reduction is relative to LPA expression or LPA protein concentration in one or more untreated subjects. In some embodiments, the reduction is relative to a reference level of LPA expression or LPA protein concentration in a healthy and / or unaltered subject.

[0131] In some embodiments, the plasma Lp(a) level after performing the method is reduced to about 50 mg / dL or less (e.g., about, at most, or up to about, 40 mg / dL, 30 mg / dL, 20 mg / dL, or less). In some embodiments, the plasma Lp(a) level after performing the method is reduced to about 40 mg / dL or less. In some embodiments, the plasma Lp(a) level after performing the method is reduced to about 30 mg / dL or less. In some embodiments, the plasma Lp(a) level after performing the method is reduced to about 20 mg / dL or less.

[0132] Pharmaceutical Compositions and Therapeutic Applications What is provided herein also includes pharmaceutical compositions for carrying out the methods disclosed herein.The composition may comprise one or more gRNAs, RNA-guided endonucleases or nucleotide sequences encoding RNA-guided endonucleases as described herein.In some embodiments, the composition may further comprise a polynucleotide (e.g., donor template) that is inserted to affect the desired genetic modification of the methods disclosed herein.

[0133] In some embodiments, one or more gRNAs each include a spacer complementary to a genomic sequence within or near exon 3 of the LPA gene (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from exon 3). The gRNA may include a spacer sequence complementary to a target sequence within exon 3 of the LPA gene. In some embodiments, the gRNA used in the methods herein includes a spacer sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the gRNA includes a spacer sequence of SEQ ID NO: 18 or a sequence having at least 85% homology to the sequence of SEQ ID NO: 18. In some embodiments, the gRNA includes a sequence of SEQ ID NO: 11 or a sequence having at least 85% homology to the sequence of SEQ ID NO: 11.

[0134] In some embodiments, the RNA-guided endonuclease is Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, The DNA endonuclease is selected from Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9). In some embodiments, the DNA sequence transcribed into the nucleic acid encoding the DNA endonuclease is codon-optimized. In some embodiments, the nucleic acid encoding the DNA endonuclease comprises a 5' cap structure and a 3' poly(A) tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0135] In some embodiments, one or more nucleic acid sequences and / or polypeptides may be delivered to cells, either in vitro or in vivo, via viral or non-viral based delivery systems including adenoviral vectors, adeno-associated viral (AAV) vectors, retroviral vectors, lentiviral vectors, herpes viral vectors, nanoparticles, liposomes, lipid nanoparticles, poxviruses, naked DNA administration, plasmids, cosmids, phages, encapsulated cell technologies, and the like.

[0136] In some embodiments, the compounds in the compositions disclosed herein (e.g., LPA gRNA and nucleic acid encoding RNA-guided endonuclease) may be formulated into liposomes or lipid nanoparticles. In some embodiments, the compounds in the compositions are formulated into lipid nanoparticles (LNPs). The term "lipid nanoparticle" refers to a nanoscale particle composed of lipids, having a size measured in nanometers (e.g., 1-5,000 nm). In some embodiments, the lipids included in the lipid nanoparticles include cationic lipids and / or ionizable lipids. Any suitable cationic lipids and / or ionizable lipids known in the art may be used to formulate LNPs for delivery of gRNA and Cas endonuclease to cells. Exemplary cationic lipids include one or more amino groups that carry a positive charge. In some embodiments, the cationic lipids are ionizable and may exist in a positively charged or neutral state depending on the pH. In some embodiments, the cationic lipids of the lipid nanoparticles include a protonizable tertiary amine group head, which exhibits a positive charge at low pH. The lipid nanoparticles may further comprise one or more neutral lipids, charged lipids, steroids, and lipids conjugated to polymers.

[0137] In some embodiments, the lipid nanoparticles can have an average diameter of about, at least, at least about, up to, or up to about, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, or any value or range between these values. In some embodiments, the lipid nanoparticles are sized from about 50 to about 100 nm in diameter, or from about 70 to about 90 nm in diameter, or from about 55 to about 95 nm in diameter. In some embodiments, the plurality of nanoparticles is administered at a dose of about 0.1-5 mg / kg (total nucleic acid (e.g., LPA gRNA and Cas9)) per administration. The amount of mRNA administered to the subject is determined by the total amount of mRNA, which can be 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg , 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3mg / kg, 3.5mg / kg, 4mg / kg, 4.5mg / kg, or 5mg / kg, or any value or range between any two of these values. In some embodiments, the nanoparticles are administered to a subject at a dose of at or about 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 2 mg / kg, 2.5 mg / kg, or 3.0 mg / kg (in some embodiments, determined by the total amount of LPA gRNA and SpCas9 mRNA).

[0138] In some embodiments, the compound of the composition described herein is encapsulated in the lipid portion of the lipid nanoparticle, or in the aqueous space that is enclosed in some or all of the lipid portion of the lipid nanoparticle.Encapsulation can be complete encapsulation, partial encapsulation, or both.In some embodiments, nucleic acid and / or polypeptide is completely encapsulated in lipid nanoparticle.

[0139] In some embodiments, one or more compounds described herein are associated with liposomes or lipid nanoparticles via covalent or non-covalent bonds.In some embodiments, any compound in the composition can be contained in liposomes or lipid nanoparticles separately or together.

[0140] In some embodiments, the above compositions may further comprise one or more additional reagents, where such additional reagents are selected from buffers, buffers for introducing polypeptides or polynucleotides into cells, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, adaptors for sequencing, etc. The buffers may be stabilization buffers, reconstitution buffers, dilution buffers, etc. In some embodiments, the compositions may also comprise one or more components that can be used to facilitate or enhance on-target binding or endonuclease cleavage of DNA, or to improve targeting specificity.

[0141] In some embodiments, any component of the composition is formulated with pharma- ceutically acceptable excipients, such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending on the particular mode and form of administration. In some embodiments, the guide RNA composition is formulated to achieve a generally physiologically compatible pH, and ranges from about pH 3 to about pH 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In some embodiments, the pH is adjusted to a range of about pH 5.0 to about pH 8.

[0142] Suitable excipients may include carrier molecules, including, for example, large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients include antioxidants (e.g., but not limited to, ascorbic acid), chelating agents (e.g., but not limited to, EDTA), carbohydrates (e.g., but not limited to, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (e.g., but not limited to, oils, water, saline, glycerol, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[0143] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no other substances than active ingredient and water, or sterile aqueous solutions that contain buffers such as sodium phosphate, saline, or both, such as phosphate buffered saline, at physiological pH values. Aqueous carriers can contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, dextrose, polyethylene glycol, and other solutes. Liquid compositions can also contain liquid phases in addition to or other than water. Examples of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound used in the cell composition that is effective for treating a particular disorder or condition depends on the nature of the disorder or condition, and can be determined by standard clinical techniques.

[0144] In some embodiments, the compounds described herein (e.g., RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease, and / or gRNA) of the composition can be delivered via transfection, such as calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, electrical nuclear transport, chemical transduction, electrical transduction, lipofectamine mediated transfection, Effectene mediated transfection, lipid nanoparticle (LNP) mediated transfection, or any combination thereof. In some embodiments, the composition is introduced into the cell via lipid-mediated transfection using lipid nanoparticles.

[0145] The compositions described herein can be administered to a subject in need of administration to treat cardiovascular disease or to reduce the risk of developing cardiovascular disease. Thus, the present disclosure also provides a gene therapy approach to treat cardiovascular disease in a patient or to reduce the risk of developing cardiovascular disease in a patient by editing the LPA gene of the subject. In some embodiments, the gene therapy approach knocks out the LPA gene functionally in the genome of the patient's relevant cell type. The LPA gene of the subject's relevant cell (e.g., hepatocyte) is edited using the materials and methods described herein, which uses an RNA-guided endonuclease such as Cas9 to permanently delete, insert, edit, correct, or replace a target sequence in the genome, or to insert an exogenous sequence, thereby knocking out the LPA gene functionally. This can provide a permanent cure for cardiovascular disease by permanently reducing the level of Lp(a) in blood.

[0146] In some embodiments, a method for treating a cardiovascular disease or disorder in a subject (e.g., a primate subject) in need of such treatment is disclosed. The method may include administering to the primate subject a plurality of nanoparticles complexed with (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA targeting the LPA gene, and (b) a nucleic acid encoding an RNA-guided endonuclease, thereby alleviating the cardiovascular disease or disorder in the primate subject. The subject may be administered the plurality of nanoparticles more than once, for example, twice, for treatment. The two administrations of nanoparticles to the subject may be separated by a suitable time. In some embodiments, the suitable time is exactly or about 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, or more. In some embodiments, two of the two or more administrations are separated by about 2 weeks to about 2 months, for example, about 3 weeks. In some embodiments, each of the two or more administrations is about 2 weeks to about 2 months, for example 3 weeks, apart from each other. In some embodiments, two of the two or more administrations are about 1 month to about 4 months, for example about 2 months or 3 months or more, apart from each other. In some embodiments, each of the two or more administrations is about 1 month to about 4 months, for example about 2 months or 3 months, apart from each other. In some embodiments, two of the two or more administrations are at least 2 months or 3 months apart. In some embodiments, each of the two or more administrations are at least 2 months or 3 months apart from each other. In some embodiments, Lp(a) levels in a subject receiving a single dose of a composition described herein may be substantially reduced (e.g., by at least 20%, 30%, 40%, 50%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) and maintained at reduced levels for at least 2 months, 3 months, 4 months, 6 months, 10 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 10 years, 15 years, 20 years or more after administration. The appropriate period of time between two doses may be the same as or different from the appropriate period of time between two other doses.In some embodiments, the plurality of nanoparticles are administered to the subject at a dose of about 0.1-5 mg / kg total RNA (e.g., LPA gRNA and Cas9 mRNA), e.g., 0.5-3 mg / kg total RNA per administration. In some embodiments, the LPA gRNA or a nucleic acid encoding the LPA gRNA is administered to the subject at a dose of just or about 0.1-5 mg / kg, e.g., 0.1 mg / kg to 5 mg / kg gRNA per administration. In some embodiments, the nucleic acid encoding the RNA-guided endonuclease is administered to the subject at a dose of just or about 0.1-5 mg / kg gRNA, e.g., 0.5-3 mg / kg gRNA per administration. The doses may be the same or different for each administration to the subject. In some embodiments, the nanoparticles are administered to the subject at a dose of about 0.02 to about 1 mg / mL total RNA (e.g., total amount of LPA gRNA and Cas9 mRNA), for example, about 0.1-0.6 mg / mL total RNA per administration. The methods disclosed herein, in some embodiments, include a single administration of the nanoparticles to the subject. For example, the nanoparticles can be administered to the subject in a single dose at a dose of about 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3.0 mg / kg of RNA content of (a) the LPA gRNA or the nucleic acid encoding the LPA gRNA, and (b) the nucleic acid encoding the RNA-guided endonuclease. As described herein, the single dose treatment can be effective for the subject, and thus the subject does not require any additional treatment. For example, in some embodiments, the subject receives a single dose of multiple nanoparticles once every 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 15 years, 20 years, 25 years, 30 years, 35 years, 40 years, 50 years, 60 years or more, or any value or range between any two of these values.

[0147] In some embodiments, the target tissue of the compositions and methods described herein is liver tissue. In some embodiments, the target cell of the compositions and methods described herein is a liver cell.

[0148] In some embodiments, the pharmaceutical composition may be administered by aerosol delivery, nasal delivery, vaginal delivery, rectal delivery, buccal delivery, intraocular delivery, topical delivery, local delivery, intracisternal delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous injection, subcutaneous injection, intralymph node injection, intratumoral injection, intraperitoneal injection, and / or intradermal injection, or any combination thereof. Administration may be local or systemic. Systemic administration includes enteral administration and parenteral administration. In some embodiments, more than one administration may be employed over a period of time, such as daily, weekly, monthly, or yearly, to achieve a desired level of gene expression.

[0149] The pharmaceutical composition can be administered to the subject that needs administration in a pharmacologic effective amount.The term "pharmacologic effective amount" as used herein means the amount of pharmaceutical composition that will cause the desired therapeutic effect and / or biological or medical response of tissue, system, animal or human.Administration can result in the desired reduction in the expression of LPA gene, such as the desired reduction in the plasma level of Lp(a).

[0150] As used herein, the term "cardiovascular disease" refers to disorders of the heart and vascular wall, and includes disorders of arteries, veins, arterioles, venules, and capillaries.In some embodiments, cardiovascular disease is stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral artery disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, or rheumatic heart disease.In some embodiments, the methods and compositions described herein can be used to treat calcific aortic valve disease, myocardial infarction, coronary heart disease, atherosclerosis, thrombosis, stroke, or a combination thereof.

[0151] In some embodiments, the subject has one or more cardiovascular disorder symptoms that affect the heart, brain, one or both legs, pelvis, one or both arms, and / or shoulder.The cardiovascular disorder symptoms that affect the heart include, but are not limited to, chest pain, chest discomfort, and one or both arms, one or both shoulders, neck, jaw, or back pain, difficulty in breathing, dizziness, increased heart rate, nausea, arrhythmia, fatigue, and / or myocardial infarction.The cardiovascular disorder symptoms that affect the brain include, but are not limited to, sudden numbness or weakness of the face, one or both arms, or one or both legs, sudden confusion or difficulty in speaking or understanding speech, sudden loss of vision in one or both eyes, sudden dizziness, difficulty in walking, or loss of balance or coordination, and / or sudden severe headache of unknown cause. Symptoms of cardiovascular disorders affecting one or both legs, pelvis, one or both arms, and / or shoulders include, but are not limited to, muscle pain, muscle cramps, coldness in one or both feet and / or toes, one or both hands and / or fingers, and / or numbness or weakness in one or both feet and / or toes, one or both hands and / or fingers.

[0152] In some embodiments, a subject in need of treatment may have abnormal levels (higher or lower than levels in a healthy individual) of total cholesterol, triglycerides, high density lipoprotein, low density lipoprotein, complete blood count with partial blood count differential, Lp(a), apolipoprotein B, homocysteine, hemeglobulin A1c, fasting glucose, insulin, creatine kinase, alanine aminotransferase, aspartate transaminase, fibrogen, thyroid stimulating hormone, high sensitivity C-reactive protein, urinary albumin creatinine ratio, MPO, vitamin D, trimethylamine N-oxide, amino terminal, pro-brain natriuretic peptide, serum creatinine, global risk score, or a combination thereof.

[0153] In some embodiments, the subject may be pretreated with steroids and / or antihistamines.For example, the subject may be pretreated with dexamethasone, famotidine, diphenhydramine, or combinations thereof.Pretreatment can be performed about, at least, at least about, up to, or up to about, 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 16 hours, 1 day, 2 days, 5 days, 10 days before administration.

[0154] In some embodiments, the method further comprises identifying a subject in need of treatment. In some embodiments, the method further comprises measuring blood levels of Lp(a) in the primate subject before, during, and / or after administration.

[0155] In some embodiments, the subject has an elevated level of Lp(a) (e.g., plasma Lp(a)) prior to administration. Subjects with elevated levels of Lp(a) can include, for example, subjects with Lp(a) levels higher than 90% of the human population. In some embodiments, the subject has symptoms of cardiovascular disease. In some embodiments, the subject does not have symptoms of cardiovascular disease. In some embodiments, the subject is at risk of developing cardiovascular disease. In some embodiments, the subject has or is suspected of developing cardiovascular disease.

[0156] In some embodiments, the subject prior to administration has a plasma Lp(a) level of greater than about 30 mg / dL (such as greater than about any of 40 mg / dL, 50 mg / dL, 60 mg / dL, 70 mg / dL, 80 mg / dL, 100 mg / dL, 125 mg / dL, 150 mg / dL, 175 mg / dL, 200 mg / dL, 225 mg / dL, 250 mg / dL, 275 mg / dL, 300 mg / dL or more). In some embodiments, the subject in need of treatment has a plasma Lp(a) level greater than 50 mg / dL. In some embodiments, the subject prior to administration has a plasma Lp(a) level of greater than about 30 mg / dL (such as greater than about any of 100 nmol / L, 125 nmol / L, 150 nmol / L, 175 nmol / L, 200 nmol / L, 225 nmol / L, 250 nmol / L, 275 nmol / L, 300 nmol / L, 350 nmol / L, 400 nmol / L or more). In some embodiments, the subject has one or more genetic markers (e.g., deletions, insertions, and / or mutations) in the endogenous LPA gene or its regulatory sequences, such that the expression level or activity, including functionality, of apo(a) protein is substantially elevated compared to normal healthy subjects.

[0157] In some embodiments, the subject in need of treatment is a patient with elevated levels of Lp(a), defined as Lp(a) levels higher than 90% of the human population (e.g., levels higher than 60 mg / dL), and symptoms of lipoprotein-associated disease (e.g., cardiovascular disease). In some embodiments, the subject may be a human suspected of having lipoprotein-associated disease. Alternatively, the subject may be a human diagnosed as at risk for lipoprotein-associated disease based on the presence of Lp(a) levels greater than 60 mg / dL or 70 mg / dL or 80 mg / dL or 100 mg / dL or 200 mg / dL or 300 mg / dL. In some embodiments, the subject in need of treatment may have an LPA gene variant associated with increased lipoprotein-associated disease risk and / or increased Lp(a) expression. In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate. In some embodiments, the subject is a human.

[0158] The methods and compositions described herein can reduce plasma low-density lipoprotein (LDL), such as plasma Lp(a) levels, thereby reducing the risk of cardiovascular disease, such as heart attack, stroke, blood clots, fat accumulation in veins, and other coronary artery disease, the probability of death associated with a cardiovascular event, or a combination thereof. In some embodiments, the methods and compositions described herein can reduce or alleviate one or more symptoms of cardiovascular disease.

[0159] In some embodiments, the plasma Lp(a) level in the subject after performing the method is reduced to about 50 mg / dL or less (e.g., about, at most, or up to about, 40 mg / dL, 30 mg / dL, 20 mg / dL, or less). In some embodiments, the plasma Lp(a) level in the subject after performing the method is reduced to about 40 mg / dL or less. In some embodiments, the plasma Lp(a) level in the subject after performing the method is reduced to about 30 mg / dL or less. In some embodiments, the plasma Lp(a) level in the subject after performing the method is reduced to about 20 mg / dL or less.

[0160] In some embodiments, plasma Lp(a) levels in a subject after performing the method are reduced by about, at least, or by at least about, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or a value or range between any of these values.

[0161] In some embodiments, plasma LDL levels in the subject after performing the method are reduced by about, at least, at least about, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or a value or range between any of these values.

[0162] What is provided herein also includes a kit for carrying out the method described herein.The kit can include a genome targeting nucleic acid (e.g., gRNA targeting LPA gene) and an RNA-guided endonuclease (e.g., Cas9) or a nucleic acid encoding an RNA-guided endonuclease.In any of the above kits, the kit can further include a polynucleotide (e.g., donor template) that is inserted to produce desired genetic modification.The components of the kit can be in separate containers or combined in a single container.

[0163] Any of the above kits may further include one or more additional reagents selected from buffers, buffers for introducing polypeptides or polynucleotides into cells, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for in vitro production of polypeptides from DNA, adaptors for sequencing, etc. The buffers may be stabilization buffers, reconstitution buffers, dilution buffers, etc. The kits may also include one or more components that can be used to promote or enhance on-target effects or endonuclease cleavage of DNA, or to improve targeting specificity.

[0164] In some embodiments, the kit may further include instructions for using the components of the kit to carry out the methods described herein. The instructions for carrying out the methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be included in the kit as a package insert, a label on the container of the kit, or a component thereof (i.e., associated with the package or subpackage), and the like. The instructions may be included as an electronically stored data file contained on a suitable computer-readable recording medium, such as a CD-ROM, a floppy disk, a flash drive, and the like. In some cases, the actual instructions are not included in the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or the instructions can be downloaded. As with the instructions, this means for obtaining the instructions may be recorded on a suitable substrate. EXAMPLES

[0165] Certain aspects of the above-described embodiments are disclosed in further detail in the following examples, which are not intended to limit the scope of the disclosure in any way.

[0166] Example 1 In vitro validation of gRNA spacer targeting LPA To evaluate the ability of gRNAs to affect targeted cleavage, the spacer sequences described in Table 1 herein were synthesized by in vitro transcription (IVT gRNAs) and evaluated in a system using transfection into a human embryonic kidney (HEK) cell line engineered to constitutively express SpCas9 nuclease. The cleavage efficiency at the on-target site for each gRNA was measured using the TIDES protocol (Brinkman, EK et al. (2014). Nucleic Acids Research, 42(22):e168), in which PCR primers flanking the predicted cleavage site were used to amplify the genomic DNA of treated cells, and then the PCR products were subjected to Sanger sequencing. When a double-strand break is created in the genome of a cell, the cell will attempt to repair the double-strand break. This repair process is error-prone and can result in the deletion or insertion of nucleotides at the double-strand break site. Completely repaired cleavage will be cleaved again by Cas9 nuclease, while nucleotide insertion or deletion will inhibit Cas9 cleavage, resulting in the accumulation of insertions and deletions, which are indicators of cleavage efficiency. Sequencing chromatogram data were then analyzed using a computer algorithm that calculates the frequency of inserted or deleted bases at the predicted cleavage site. The frequency of inserted or deleted bases (INDELs) was used to calculate the overall cleavage frequency. However, some of the kringle IV regions are repetitive, making PCR amplification impossible. For these guide RNA targets, INDELs could not be assayed using this method. The results of IVT gRNA experiments in HEK cells are shown in Table 3, where gRNAs are ranked according to the cleavage efficiency observed. In Table 3, Y = 100% match to Macaca fascicularis. [Table 3]

[0167] Example 2 Assessment of LPA gene editing efficiency in non-human primates (NHPs) In this example, LPA gene editing efficiency in NHPs is assessed by measuring plasma Lp(a) levels before and after treatment.

[0168] NHPs were pre-screened for SNPs in the LPA gene and Lp(a) plasma basal levels were measured. T4 gRNA (SEQ ID NO: 3) was selected to match the LPA gene of NHPs. Lipid nanoparticle (LNP) delivery vehicles were used to deliver Cas9 mRNA and T4 gRNA molecules to NHPs. LNPs encapsulating gRNA molecules and Cas9 mRNA were injected into NHPs according to the study design shown in Figure 2. In particular, two doses of RNA097 Cas9 mRNA (pseudouridine-modified) and T4 gRNA encapsulated in Gen3 LNPs (group 4) or one dose of RNA010 Cas9 mRNA (N-methylpseudouridine-modified) and T4 gRNA encapsulated in Gen3 LNPs (group 5) were injected into each NHP. Plasma samples were collected and plasma Lp(a) levels were monitored before and after treatment. A sandwich enzyme-linked immunosorbent assay (ELISA) was used to detect Lp(a) protein concentrations in the collected plasma. Efficient editing was seen, including approximately 50% liver editing at the 2 mg / kg dose.

[0169] Figures 3A-B are two graphs showing plasma Lp(a) levels in NHPs from Group 4 (Figure 3A) and Group 5 (Figure 3B). Figures 4A-4B are two graphs showing percent change from baseline in plasma Lp(a) in NHPs from Group 4 (Figure 4A) and Group 5 (Figure 4B).

[0170] Results demonstrate that the use of T4 gRNA and Cas9 mRNA significantly reduces plasma Lp(a) levels in NHPs, with 66% and 87% reductions from baseline in group 4 and 75% and 86% reductions in group 5.

[0171] Example 3 Toxicity testing of LPA gRNA formulations In this example, toxicity studies were performed in NHPs. Lipid nanoparticles encapsulating gRNA molecules of SEQ ID NO: 3 (T4 gRNA) and Cas9 mRNA were formulated into LPA gRNA formulations designated "CTX320". CTX320 formulations were administered in single doses to three groups of NHPs (e.g., cynomolgus monkeys) at dosage levels of 0.5 mg / kg, 1.5 mg / kg, and 3.0 mg / kg, respectively. Plasma Lp(a) protein levels were measured using Mercodia ELISA assay. Figure 5 depicts a non-limiting experimental design.

[0172] 6 is a graph showing baseline Lp(a) levels in NHP plasma 14 days prior to treatment (day -14). Baseline values ​​vary between individual NHPs due to the number of kringle IV-2 repeats.

[0173] Figure 7 depicts a non-limiting example of the NHP study design. Plasma Lp(a) protein levels were measured 7 days before treatment and 8, 15, and 29 days after treatment.

[0174] FIG. 8A is a graph showing the percent change from baseline in plasma Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3 mg / kg, compared to the control group. FIG. 8B is a graph showing the percent change from baseline in serum Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3 mg / kg, compared to the control group. The data demonstrate a dose-dependent reduction in plasma and serum Lp(a) protein after CTX320 administration. A reduction of about 66% from baseline in Lp(a) protein was observed in NHPs treated with 1.5 mg / kg CTX320, and a reduction of about 92% was observed in NHPs treated with 3.0 mg / kg CTX320. No significant reduction in plasma Lp(a) protein was observed with 0.5 mg / kg CTX320 administration.

[0175] Figures 9A-C are graphs showing plasma Lp(a) protein levels in NHPs before and after treatment with three different doses of CTX320: 0.5 mg / kg (Figure 9A), 1.5 mg / kg (Figure 9B), and 3.0 mg / kg (Figure 9C). Figure 9D shows the percent change from baseline in plasma Lp(a) levels in NHPs after 29 days of CTX320 treatment. An average of 50% or more reduction in plasma Lp(a) levels from baseline was observed in NHPs treated with 1.5 mg / kg and 3 mg / kg CTX320 formulations.

[0176] Serum tests were also performed on NHPs following CTX320 treatment. This included liver function tests, plasma levels of lipids (e.g., triglycerides, HDL, LDL, and total cholesterol), renal function tests (e.g., blood urea nitrogen, creatinine, glucose, and calcium), injury markers (e.g., lactate dehydrogenase (LDH), gamma glutamyl transferase, and C-reactive protein (CRP)), white blood cells, electrolyte panels, red blood cell indices, coagulation profiles, and urinalysis. Data (not shown here) demonstrate that liver enzymes and total bilirubin transiently elevated in a dose-dependent manner, peaking approximately 2-4 days after treatment and returning to baseline by day 15. Transient elevations in LDH and CRP peaked at day 2 and returned to baseline by day 7. NHP body weights remain stable following CTX320 treatment. The data also suggest that the 3 mg / kg CTX320 formulation does not alter cholesterol levels, induces a transient increase in triglyceride and LDL levels that peaks 2-4 days after treatment, and induces a steep decrease in HDL levels on day 4 after treatment. Additionally, it was found that treatment with CTX320 does not alter renal markers of function, including blood urea nitrogen and creatinine.

[0177] Example 4 Efficacy evaluation and toxicity testing of LPA gRNA formulations This example reports another non-limiting example of efficacy and toxicity evaluation of the CTX320 formulation of Example 3.

[0178] According to the experimental design of Figure 5, CTX320 formulations were administered in a single dose to three groups of NHPs (e.g., cynomolgus monkeys) at dosage levels of 0.5 mg / kg, 1.5 mg / kg, and 3.0 mg / kg, respectively. Plasma Lp(a) protein levels were measured throughout the study using a Mercodia ELISA assay. Animals were euthanized after 85 days of treatment.

[0179] FIG. 10A is a graph showing the percent change from baseline in serum Lp(a) protein levels in NHPs after treatment with CTX320 at three different doses: 0.5 mg / kg, 1.5 mg / kg, and 3.0 mg / kg, compared to the control group. The data demonstrate a dose-dependent reduction in plasma and serum Lp(a) protein after CTX320 administration. NHPs treated with 1.5 mg / kg CTX320 showed a reduction of about 78% from baseline in Lp(a) protein, and NHPs treated with 3.0 mg / kg CTX320 showed a reduction of about 90%. Administration of 0.5 mg / kg CTX320 showed a reduction of about 19% in plasma Lp(a) protein. As shown in FIG. 10A, a single dose of CTX320 resulted in a sustained reduction in Lp(a), and a significant reduction in Lp(a) levels was sustained over the study period at the intermediate and high doses.

[0180] Figure 10B shows the percent change from baseline in plasma Lp(a) levels in NHPs about 3 months after CTX320 treatment. A significant reduction in Lp(a) levels from baseline was observed in NHPs treated with 1.5 mg / kg and 3 mg / kg CTX320 formulations. The results demonstrate that a single dose of CTX320 at medium and high doses results in a sustained reduction in Lp(a) from baseline even after 3 months of treatment.

[0181] Figure 11 is a plot showing the percentage of LPA gene editing in the liver and other organ tissues including spleen, adrenal gland, brain, kidney, lung, epididymis, testis, and ovary. The results demonstrate that after about 3 months of CTX320 treatment, the liver is the main organ for LPA gene editing, while only about 0.1-5% LPA gene editing is seen in the spleen. In addition, after 85 days of treatment, dose-dependent editing was also seen in the liver. After treatment with 1.5 mg / kg CTX320 and 3 mg / kg CTX320, about 40% and 65% LPA gene editing was seen, respectively. Some results of LPA on-target editing in tissues are shown in Table 4. Table 4: Three-month (% indels) data of LPA on-target editing in tissues [Table 4]

[0182] Additionally, additional data (Figures 12A-12C) demonstrated dose-dependent editing in reproductive tissues of the testis, epididymis, and ovary, with less than 0.5% editing after 85 days of treatment with 3 mg / kg CTX320, and even less with 0.5 mg / kg and 1.5 mg / kg CTX320.

[0183] Figures 13A-B are plots showing plasma levels of LNP component A after treatment. Figures 14A-B are plots showing plasma levels of LNP component B after treatment. Toxicokinetic analysis suggests that most of LNP components A and B are cleared from plasma one week after CTX320 treatment. Both LNP components A and B are excreted by 168 hours after injection.

[0184] Data (not shown here) indicate that CTX320 causes transient dose-dependent increases in liver function tests (e.g., alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and bilirubin). No impairment or damage to liver function was detected following treatment (e.g., 85 days after dosing).

[0185] Additional endpoint analyses including body weight, clinical signs (e.g. aspartate transaminase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), total bilirubin), urinalysis, hematology and coagulation, electrocardiogram, and histopathology (both gross and microscopic evaluation) reveal no CTX320-related changes throughout the study period.

[0186] Example 5 Phase 1 Study Design A non-limiting example design of a Phase 1 safety and tolerability clinical trial for one or more of the LPA gene editing nanoparticles described herein (e.g., CTX320) is shown in Figure 15.

[0187] In some cases, phase 1 clinical trials of CTX320 are conducted in patients with elevated Lp(a) levels. For example, patients may have Lp(a) of 50 mg / dL or more or 100 nmol / L or more, with an increased risk of myocardial infarction (MI), regardless of established CVD risk factors. In some cases, patients may have Lp(a) of 50 mg / dL or more or 125 nmol / L or more. In some cases, patients may have Lp(a) levels of over 180 mg / dL (over 430 nmol / L), with an increased lifetime risk of atherosclerotic cardiovascular disease (ASCVD). Patients may be between 18 and 75 years old. In some cases, patients are tested for HBA1C approximately every 3 months.

[0188] In some cases, subjects with advanced liver disease will be excluded from the study.Advanced liver disease may include: (a) aspartate transaminase (AST), alanine transaminase (ALT) greater than 3 times the upper limit of normal (ULN), or direct bilirubin value greater than 2 times the ULN, and / or (b) baseline prothrombin time (international normalized ratio [INR]) greater than 1.5 times the ULN, and / or (c) fibroscan or MRE measurement greater than 7.5 kpa, and / or (d) history of cirrhosis, and / or (e) history of alcohol or drug abuse, and / or (f) acute monitoring of ALT, AST, GGT, Bili., Alk, Phos., albumin, INR, PT, and PTT through D30.Monitoring will continue until the end of the study (12 months).

[0189] Example 6 Persistence study of LPA gRNA formulations In this example, a non-limiting example of a durability validation study of the CTX320 formulation of Example 3 is reported. In particular, this example uses ELISA to evaluate the durability of LPA protein knockdown in plasma and evaluate the destruction of LPA in liver tissue. The durability study also evaluates whether pretreatment with steroids and / or antihistamines reduces the increase in liver function tests. Table 5 shows the durability study design used in this example. [Table 5]

[0190] Selected patients have elevated LNP(a) levels of more than 100 mg / dL. Patients may be pretreated with steroids and / or antihistamines. For example, patients may be pretreated with 1 mg / kg dexamethasone, 0.5 mg / kg famotidine, and 5 mg / kg diphenhydramine the day before LNP administration, and then again 30-60 minutes before LNP administration.

[0191] 16 is a graph showing the percent change from baseline in serum Lp(a) protein levels in patients after CTX320 treatment. Even after 56 days of administration, patients treated with CTX320 still showed at least a 90% reduction in Lp(a) protein from baseline.

[0192] Serum tests were also performed on patients following CTX320 treatment, including liver function tests (LFTs) and plasma levels of lipids (eg, triglycerides, HDL, LDL, and total cholesterol).

[0193] Figure 17 compares aspartate aminotransferase (AST), alanine transaminase (ALT), alkaline phosphatase (ALP), and total bilirubin levels in patients who received a CTX320 formulation at 2.0 mg / kg with pretreatment, and in patients who received a CTX320 formulation at 1.5 mg / kg and 3 mg / kg without pretreatment. The data suggest that the CTX320 formulation with pretreatment induces LFT elevations similar to those seen in previous studies without pretreatment, and that pretreatment with antihistamines does not attenuate LFT responses in patients.

[0194] CTX320 was also observed to induce a reduction in total cholesterol and LDL. No other discernible differences in serum chemistry markers were found to be induced by the CTX320 formulation.

[0195] term In at least some of the above embodiments, one or more elements used in one embodiment may be used interchangeably in another embodiment, unless such substitution is technically infeasible. It will be understood by those skilled in the art that various other omissions, additions, and modifications may be made to the methods and structures described above without departing from the scope of the subject matter described in the claims. All such modifications and variations are intended to be within the scope of the subject matter defined by the appended claims.

[0196] With respect to the use of substantially any plural and / or singular term herein, those skilled in the art can read the plural into the singular and / or the singular into the plural, where appropriate in the context and / or application. For clarity, various singular / plural permutations may be expressly represented herein. As used herein and in the appended claims, the singular forms "a", "an" and "the" include plural references unless the context clearly dictates otherwise. Any reference to "or" herein is intended to include "and / or" unless otherwise stated.

[0197] It will be understood by those skilled in the art that the terms used herein, and particularly in the appended claims (e.g., the body of the appended claims), are generally intended to be "open" terms (e.g., the term "including" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "include" should be interpreted as "including but not limited to," etc.). It will be further understood by those skilled in the art that if a specific number of claim recitations to be introduced are intended, such intent will be clearly set forth in the claim, and that in the absence of such a recitation, no such intent will exist. For example, as an aid in understanding, the appended claims may include the use of the preambles "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be construed as meaning that the introduction of a claim recitation with the indefinite article "a" or "an" limits a particular claim that includes such a claim recitation to embodiments that include only one such recitation, even if the same claim includes both the preamble "one or more" or "at least one" and an indefinite article such as "a" or "an" (e.g., "a" and / or "an" should be construed to mean "at least one" or "one or more"), nor should the use of a definite article used to introduce a claim recitation. In addition, even if a specific number of claim recitations being introduced is explicitly recited, one of ordinary skill in the art will recognize that such recitation should be construed to mean at least the recited number (e.g., the mere recitation "two recitations" without other modifiers means at least two recitations, or more than two recitations).Furthermore, when a collection similar to "at least one of A, B, and C, etc." is used, such syntax is generally intended to mean what one of ordinary skill in the art would understand the collection (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together). When a collection similar to "at least one of A, B, or C, etc." is used, such syntax is generally intended to mean what one of ordinary skill in the art would understand the collection (e.g., "a system having at least one of A, B, or C" includes, but is not limited to, systems having A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together). Moreover, those skilled in the art will understand that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the specification, claims, or drawings, should be understood to contemplate the possibility of including one of those terms, either of those terms, or both of those terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."

[0198] Additionally, when features or aspects of the disclosure are described in terms of a Markush group, those of skill in the art will recognize that the disclosure is also described in terms of any individual members or subgroups of members of the Markush group.

[0199] As will be appreciated by those skilled in the art, for all purposes, including, for example, with respect to providing written opinions, all ranges disclosed herein encompass all possible sub-ranges and combinations of sub-ranges. The recited ranges can be readily recognized as fully descriptive and allowing for the same range to be divided into at least one half, one third, one quarter, one fifth, one tenth, etc. As a non-limiting example, each range described herein can be readily divided into a lower third, a middle third, and an upper third, etc. As will also be appreciated by those skilled in the art, all terms such as "up to," "at least," "greater than," "less than," etc. refer to ranges that are inclusive of the recited numbers and that can be further divided into sub-ranges as described above. Finally, as will be appreciated by those skilled in the art, ranges include each individual member. Thus, for example, a group having 1-3 entities refers to a group having 1, 2, or 3 entities. Similarly, a group having 1-5 entities refers to a group having 1, 2, 3, 4, or 5 entities, and so forth.

[0200] While various aspects and embodiments are disclosed herein, other aspects and embodiments will be apparent to those of ordinary skill in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

Claims

1. (a) a guide RNA (gRNA) (LPA gRNA) targeting the LPA gene and (b) a plurality of nanoparticles complexed with mRNA encoding Cas9 endonuclease, wherein the gRNA comprises the sequence of SEQ ID NO: 11; and One or more pharmaceutically acceptable excipients A composition containing the following:

2. The composition according to claim 1, wherein the Cas9 endonuclease is S. pyogenes Cas9 endonuclease.

3. The composition according to claim 1, wherein the plurality of nanoparticles are lipid nanoparticles.

4. The composition according to claim 3, wherein the lipid nanoparticles include one or more neutral lipids, charged lipids, ionized lipids, steroids, and lipids conjugated to polymers.

5. The composition according to claim 3, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipid, or both.

6. The composition according to claim 1, which is a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients.

7. The composition according to any one of claims 1 to 6, wherein the gRNA is a single guide RNA.

8. (a) a guide RNA (gRNA) (LPA gRNA) that targets the LPA gene, and (b) mRNA encoding Cas9 endonuclease A composition comprising multiple nanoparticles complexed with, for use in treating lipoprotein-related diseases in a subject, gRNA (i) The sequence of sequence number 11, or (ii) Spacer arrangement of sequence number 18 Includes, The composition can reduce Lp(a) protein levels in the plasma of subjects with lipoprotein-related disease by at least 65% one or two months after administration. composition.

9. The composition according to claim 8, wherein the lipoprotein-related disease is a metabolic disease, a cardiovascular disease, a lipid metabolism disease, or a combination thereof.

10. The composition according to claim 9, wherein the lipoprotein-related disease is calcific aortic valve disease, myocardial infarction, coronary heart disease, atherosclerosis, thrombosis, stroke, coronary artery disease, familial hyperlipidemia, myocardial infarction, peripheral artery disease, calcific aortic stenosis, or a combination thereof.

11. The composition according to claim 8, wherein the gRNA comprises the sequence of Sequence ID No.

32.

12. The composition according to claim 8, wherein the Cas9 endonuclease is S. pyogenes Cas9 endonuclease.

13. The composition according to claim 8, wherein the plurality of nanoparticles are lipid nanoparticles.

14. The composition according to claim 13, wherein the lipid nanoparticles include one or more neutral lipids, charged lipids, ionized lipids, steroids, and lipids conjugated to polymers.

15. The composition according to claim 13, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipid, or both.

16. The composition according to claim 8, which is a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients.

17. The composition according to claim 8, wherein the gRNA is a single guide RNA.

18. The composition according to claim 8, wherein (i) the subject has an Lp(a) level higher than 50 mg / dL; (ii) the subject has an Lp(a) level higher than 100 mg / dL; and / or (iii) the subject has an increased risk of myocardial infarction (MI) or an increased lifetime risk of atherosclerotic cardiovascular disease (ASCVD), independently of established cardiovascular disease (CVD) risk factors.

19. The composition according to claim 8, wherein the reduction is (a) LPA expression or LPA protein concentration in the plasma of a subject before treatment with the composition; (b) LPA expression or LPA protein concentration in one or more untreated subjects; and / or (c) a reduction in LPA expression or LPA protein concentration in a healthy subject relative to a reference level.

20. The composition according to any one of claims 8 to 19, wherein the subject is a primate, and in some cases the subject is a human.