Messenger ribonucleic acid with extended half-life

Abstract

The present disclosure features a polynucleotide encoding a polypeptide, the polynucleotide comprising a 5'UTR, a coding region encoding the polypeptide, and a 3'UTR, and lipid nanoparticles comprising the same. The polynucleotide and / or lipid nanoparticle of the present disclosure can increase the level and / or activity of the polypeptide by increasing the half-life and / or duration of expression of the polynucleotide encoding the polypeptide. Also disclosed herein is a method of treating a disease or disorder in a subject using the lipid nanoparticle of the present disclosure.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 323,748, filed March 25, 2022, U.S. Provisional Application No. 63 / 405,142, filed September 9, 2022, and U.S. Provisional Application No. 63 / 419,924, filed October 27, 2022, the contents of which are incorporated herein by reference. [Background technology]

[0002] Attempts to enhance the efficacy of messenger ribonucleic acid (mRNA) have focused on optimally sequenced open reading frames (ORFs), but there is a need to further improve the potency and durability of mRNA expression by leveraging RNA biology. Summary of the Invention

[0003] The present disclosure provides, inter alia, polynucleotides (e.g., mRNAs) encoding a polypeptide, the polynucleotides comprising (a) a 5' UTR (e.g., as described herein), (b) a coding region including a termination element (e.g., as described herein), and (c) a 3' UTR (e.g., as described herein), as well as LNP compositions comprising the same. In one embodiment, the coding region comprises a polynucleotide sequence (e.g., mRNA, e.g., an open reading frame (ORF)) that encodes a peptide or polypeptide payload (e.g., a therapeutic payload or a prophylactic payload). In one embodiment, the polynucleotide (e.g., mRNA) or the polypeptide encoded by the polynucleotide has increased level and / or activity (e.g., expression level or half-life) relative to a version lacking the 5' UTR, 3' UTR, or termination element described herein. In one embodiment, the level and / or activity of the polynucleotide (e.g., mRNA) is increased. In one embodiment, the level, activity, and / or duration of expression of the polypeptide encoded by the polynucleotide is increased. Also disclosed herein are methods for using LNP compositions comprising the polynucleotides disclosed herein to treat diseases or disorders or promote desired biological effects in subjects.It will be understood that any ORF can be combined with the disclosed elements, for example, ORFs encoding polypeptides or peptides (e.g., whether intracellular, transmembrane, or secreted).Further aspects of the present disclosure are described in more detail below.

[0004] Specifically, in some embodiments, provided herein is a messenger RNA (mRNA) comprising a 5' UTR, an open reading frame encoding a polypeptide, and a 3' UTR, wherein the 3' UTR comprises: (i) a nucleotide sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147; or (ii) a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, or a deletion variant thereof, wherein the deletion variant has 1 to 75 consecutive nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, and the nucleic acid sequence or the deletion variant thereof is a) one or more miRNA binding sites inserted within the nucleic acid sequence or the deletion variant thereof; and / or b) modified to include a TENT recruitment sequence, a FUT8 recruitment sequence, one or more discrimination and ratio determination (IDR) sequences, one or more ribosome association detection assay (REDA) sequences, or a combination of one or more IDR sequences and one or more REDA sequences inserted within the nucleic acid sequence or the deletion variant thereof.

[0005] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 139. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 139.

[0006] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 140. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 140.

[0007] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 141. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 141.

[0008] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 142. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 142.

[0009] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 143. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 143.

[0010] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 144. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 144.

[0011] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 145. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 145.

[0012] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 146. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 146.

[0013] In certain embodiments, the present disclosure provides a 3' UTR comprising a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 147. In certain embodiments, the present disclosure provides a 3' UTR comprising the nucleic acid sequence set forth in SEQ ID NO: 147.

[0014] In some embodiments of the present disclosure, the 3' UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more miRNA binding sites inserted within the nucleic acid sequence. In some examples, the one or more miRNA binding sites are selected from SEQ ID NOs: 148-157. In some embodiments, the one or more miRNA binding sites comprise at least one copy of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least three copies of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least two copies of SEQ ID NO: 149. In some embodiments, the one or more miRNA binding sites comprise at least two copies of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least three copies of SEQ ID NO: 148.

[0015] In some embodiments provided herein, the 3'UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147, wherein the nucleic acid sequence is modified to comprise a TENT recruit sequence inserted within the nucleic acid sequence.

[0016] In some embodiments provided herein, the 3'UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147, wherein the nucleic acid sequence is modified to comprise a FUT8 recruitment sequence inserted within the nucleic acid sequence.

[0017] In some examples provided herein, the 3'UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147, and the nucleic acid sequence is modified to include one or more IDR sequences inserted within the nucleic acid sequence.

[0018] In some embodiments provided herein, the 3'UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147, wherein the nucleic acid sequence is modified to include one or more REDA sequences inserted within the nucleic acid sequence.

[0019] In some embodiments provided herein, a deletion variant has 1 to 60 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, a deletion variant has 1 to 50 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, a deletion variant has 1 to 40 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, a deletion variant has 1 to 30 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, a deletion variant has 1 to 20 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, a deletion variant has 1 to 10 contiguous nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147. In some embodiments provided herein, the deletion variants have fewer than 10 consecutive nucleotides deleted from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147.

[0020] In certain embodiments of any of the above mRNAs, the 5' UTR comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 50. In some embodiments, the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO: 50.

[0021] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:139 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0022] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:140 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0023] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:141 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0024] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:142 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0025] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:143 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0026] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:144 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0027] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:145 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0028] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:146 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0029] In certain embodiments provided herein, the 3' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:147 and the 5' UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0030] In certain aspects of any of the above mRNAs, the mRNA comprises a termination cassette. In some embodiments, the termination cassette is selected from SEQ ID NOs: 158-174. In some embodiments, the termination cassette is UAAAGCUCCCCGGGG (SEQ ID NO: 165) or UAAGCCCCUCCGGGG (SEQ ID NO: 164).

[0031] In certain embodiments of any of the above mRNAs, the mRNA comprises a 5' end cap. In some embodiments, the 5' end cap is 7 GpppG 2´OMe , m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5' methyl G cap, or analogs thereof.

[0032] In certain aspects of any of the above mRNAs, the mRNA comprises a polyA region. In some embodiments, the polyA region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length. In some embodiments, the polyA region has a length of about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides. In some embodiments, the polyA region comprises A100-UCUAG-A20-inverted deoxy-thymidine.

[0033] In certain aspects of any of the above mRNAs, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some embodiments, the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (m1ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof.

[0034] In certain aspects of any of the above mRNAs, the polypeptide comprises a secreted protein, a membrane-bound protein, or an intracellular protein. In some embodiments, the polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, or a component, variant, or fragment thereof.

[0035] Also provided herein is a pharmaceutical composition comprising any one of the above mRNAs and a pharmaceutically acceptable carrier.

[0036] Also provided herein are lipid nanoparticles comprising any one of the above mRNAs. In some embodiments, the lipid nanoparticles comprise (i) an ionizable lipid, (ii) a phospholipid, (iii) a structured lipid, and (iv) a PEG-lipid. In some embodiments, the lipid nanoparticles comprise a lipid having a structure represented by Formula (I): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R´ a is R´ 分枝 where: R´ 分枝 teeth, [ka] (where: [ka] indicates the point of attachment, R aα , R aβ , R aγ , and R aδ are independently H, C 2~12 Alkyl, and C 2~12 alkenyl), R 2 and R 3 are each independently 1~14 Alkyl and C 2~14 alkenyl, R 4 is -(CH2) n OH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R 10is N(R)2, and each R is independently C 1~6 Alkyl, C 2~3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 independently, C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R 6 independently, C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1~12 Alkyl or C 2~12 is alkenyl, l is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0037] In some embodiments, the lipid nanoparticles comprise: (a) (i) Compound II, (ii) cholesterol, and (iii) PEG-DMG or Compound I; (b) (i) Compound VI, (ii) cholesterol, and (iii) PEG-DMG or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I, (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I, (e) (i) Compound II, (ii) cholesterol, and (iii) Compound I; (f) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I, (g) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I, (h) (i) Compound B, (ii) cholesterol, and (iii) Compound I, or (i) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I.

[0038] In some embodiments, the lipid nanoparticles comprise Compound II and Compound I. In some embodiments, the lipid nanoparticles comprise Compound B and Compound I. In some embodiments, the lipid nanoparticles comprise Compound II, DSPC, cholesterol, and Compound I. In some embodiments, the lipid nanoparticles are composed of a molar ratio of about 20-60% ionizable lipid, 5-25% phospholipid, 25-55% cholesterol, and 0.5-15% PEG lipid. In some embodiments, the lipid nanoparticles are formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery.

[0039] Also provided herein is a pharmaceutical composition comprising any one of the above lipid nanoparticles. Also provided herein is a cell comprising any one of the above lipid nanoparticles.

[0040] Also provided herein, in some embodiments, is a method of increasing expression of a polypeptide, comprising administering to a cell any one of the above lipid nanoparticles.

[0041] Also provided herein is a method of delivering any one of the above lipid nanoparticles to a cell, comprising contacting the cell with the lipid nanoparticle in vitro, in vivo or ex vivo.

[0042] In some instances, also provided herein is a method for delivering any one of the above lipid nanoparticles to a human subject having a disease or disorder, the method comprising administering an effective amount of lipid nanoparticles to a human subject in need thereof.

[0043] Also provided herein is another aspect of a method for treating, preventing, or preventing a symptom of a disease or disorder in a human subject in need thereof, the method comprising administering to the human subject an effective amount of any one of the lipid nanoparticles described above.

[0044] Also provided herein is another aspect of a method for treating, preventing, or preventing a symptom of a disease or disorder in a human subject in need thereof, the method comprising administering to the human subject an effective amount of any one of the lipid nanoparticles described above.

[0045] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]

[0046] [Figure 1A] 1 is a graph depicting the expression levels of luciferase encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. Systemic ffLuc activity is shown 96 hours after administration. [Figure 1B] 1 is a graph depicting the expression levels of luciferase encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. Systemic ffLuc activity is shown 72 hours after administration. [Figure 1C]1 is a graph depicting the expression levels of luciferase encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. Systemic ffLuc activity is shown 0-4 days after administration. [Figure 1D] 1 is a graph showing the expression levels of luciferase encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR, showing expression levels in the liver. [Figure 1E] 1 is a graph showing the expression levels of luciferase encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. Expression levels in the spleen are shown. [Figure 1F] 1 is a graph showing the expression level of the target protein encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. The expression level of the target protein (i.e., EPO) in serum 96 hours after administration is shown. [Figure 1G] 1 is a graph depicting the expression levels of target proteins encoded by mRNA constructs having the v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) combined with either the alpha 3'UTR or the kappa 3'UTR. The expression levels of target proteins (i.e., EPO) in serum 0-4 days after administration are shown. [Figure 2A]Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted as "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells are shown in LSK+ hematopoietic stem and progenitor cells. [Figure 2B] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic dendritic cells are shown. [Figure 2C] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic macrophages are shown. [Figure 2D] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic neutrophils are shown. [Figure 2E]Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted as "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic monocytes are shown. [Figure 2F] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted as "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic eosinophils are shown. [Figure 2G] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic CD4+ T cells are shown. [Figure 2H] Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted as "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic CD8+ T cells are shown. [Figure 2I]Graphs depicting the overall mean fluorescence intensity or percentage of mOX40L+ cells in immune cells 1, 2, and 3 days after administration when encoded by mRNA constructs with the v2.0 5'UTR combined with a control 3'UTR (denoted as "Triple" in the figure legend), a kappa 3'UTR, or an iota 3'UTR. Mean fluorescence intensity and % mOX40L+ cells in splenic B cells are shown. [Figure 3A] Figure 1 shows images showing FANCA (top panel for each sample) and nucleolin (bottom panel for each sample) protein levels in cells transfected with the indicated constructs in three FaDu cell lines at the indicated time points. Fold changes in FANCA expression were calculated by normalizing to the loading control and wild-type (WT) mean values. [Figure 3B] Graph showing FANCA expression levels normalized to nucleolin and expressed as fold change relative to the average FANCA expression in the WT FaDu cell line. [Figure 4] Figure 1 shows the viability of FaDu-WT, FaDu-KO transfected with 1 μg of a GFP mRNA construct, or FaDu-KO transfected with 1 μg of a FANCA construct when treated with the indicated concentrations of mitomycin C (MMC) 24 hours after transfection. Viability was assessed 5 days after treatment using Cell Titer Glo. [Figure 5A] This graph shows the accumulation of cells in the G2-M phase of the cell cycle in control (Ctl) or cells treated with 1,3-butadiene diepoxide (DEB) and MMC. WT-GFP refers to FaDu WT cells transfected with GFP mRNA, KO-GFP refers to FaDu KO cells transfected with GFP mRNA, and FANCA_01 to FANCA-04 refer to FaDu KO cells transfected with FANCA constructs. Transfection was performed 6 hours before treatment. [Figure 5B]5B is a graph showing the frequency of G2M (presented as mean ± SD) for the data in FIG. 5A. Statistical significance was calculated using Student's t-test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 6A] This graph shows the accumulation of cells in the G2-M phase of the cell cycle in control (Ctl) or cells treated with 1,3-butadiene diepoxide (DEB) and MMC. WT-GFP refers to FaDu WT cells transfected with GFP mRNA, KO-GFP refers to FaDu KO cells transfected with GFP mRNA, and FANCA_01 to FANCA-04 refer to FaDu KO cells transfected with FANCA constructs. Transfection was performed 72 hours before treatment. [Figure 6B] 6B is a graph showing the frequency of G2M (presented as mean ± SD) for the data in FIG. 6A. Statistical significance was calculated using Student's t-test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 6C] 1 is a graph showing FANCA expression levels normalized to nucleolin and expressed as fold change relative to FANCA expression levels in the WT FaDu cell line. [Figure 7] Ovalbumin concentrations are shown 6 and 48 hours after administration. The mRNAs evaluated had the kappa 3'UTR (SEQ ID NO: 139) and either the v1.1 5'UTR (SEQ ID NO: 56) or the v2.0 5'UTR (SEQ ID NO: 50). Both mRNAs were prepared using the same "alpha" process. [Figure 8] 1 is a bar graph showing antibody responses using mRNA containing the v2.0 5'UTR (SEQ ID NO: 50) and the kappa 3'UTR (SEQ ID NO: 139). [Figure 9]1 is a bar graph showing the effect of a FUT8 sequence in the 3' UTR compared to its absence. From left to right, shows a PBS control, an mRNA containing the v1.0 UTR, an mRNA with the v2.0 5' UTR (SEQ ID NO: 50) and a reoptimized coding sequence, an mRNA with a 3' UTR containing a "delta" termination cassette and a "FUT8" sequence in addition to elements (2) (the 3' UTR corresponds to SEQ ID NO: 140), and two positive controls. [Figure 10] FIG. 1 is a schematic diagram showing that the presence of v2.0 5′UTR mRNA encoding hemagglutinin enhances immunogenicity in mice. [Figure 11] 1 is a bar graph showing that the presence of v2.0 5'UTR and v2.0 3'UTR enhances expression of hemagglutinin-encoding mRNA in vitro. DETAILED DESCRIPTION OF THE INVENTION

[0047] The potency and persistence of mRNA can be optimized by (1) ensuring that mRNA delivered to the cytoplasm properly and productively associates with ribosomes, and (2) maximizing the time the mRNA spends actively producing the desired protein product. The sequence of the mRNA is a key determinant in how all of these aspects work.

[0048] Disclosed herein, inter alia, is the discovery that the sequence of a 3' untranslated region (UTR) can be optimized to increase the potency and / or persistence of the mRNA. In some embodiments, the sequence combination of a 3' UTR and an mRNA's 5' UTR and / or termination element can be optimized to increase the potency and / or persistence of the mRNA, for example, by extending the half-life and / or duration of expression of the mRNA. In some embodiments, the present disclosure provides polynucleotide and lipid nanoparticle compositions comprising an optimized 3' UTR that can increase the efficacy (e.g., level and / or activity) of an mRNA or a polypeptide encoded by the mRNA.

[0049] 1. Untranslated Region (UTR) Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before the start codon (5'UTR) and after the stop codon (3'UTR) that are not translated. In some embodiments, a polynucleotide (e.g., ribonucleic acid (RNA)) of the invention, e.g., an mRNA, comprising an open reading frame (ORF) encoding a polypeptide further comprises a UTR (e.g., a 5'UTR or a functional fragment thereof, a 3'UTR or a functional fragment thereof, or a combination thereof).

[0050] The UTR can be homologous or heterologous to the coding region in the polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the therapeutic or prophylactic payload. In some embodiments, the UTR is heterologous to the ORF encoding the therapeutic or prophylactic payload.

[0051] In some embodiments, the polynucleotide comprises two or more 5' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.

[0052] In some embodiments, the 5' UTR or a functional fragment thereof, the 3' UTR or a functional fragment thereof, or any combination thereof, is sequence optimized.

[0053] In some embodiments, the 5' UTR or a functional fragment thereof, the 3' UTR or a functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, for example, N1-methylpseudouracil or 5-methoxyuracil.

[0054] UTRs can have characteristics that provide a regulatory role (e.g., stability, localization, and / or increased or decreased translation efficiency). A polynucleotide containing a UTR can be administered to a cell, tissue, or organism, and one or more regulatory characteristics can be measured using routine methods. In some embodiments, a functional fragment of a 5' or 3' UTR comprises one or more regulatory characteristics of the full-length 5' or 3' UTR, respectively.

[0055] Natural 5'UTRs have characteristics that play a role in translation initiation. They possess signatures such as the Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate the translation of many genes. The Kozak sequence has the consensus CCR(A / G)CCAUGG (SEQ ID NO: 125), in which R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G." 5'UTRs are also known to form secondary structures involved in the binding of elongation factors.

[0056] Polynucleotide stability and protein production can be enhanced by engineering features typically found in genes abundantly expressed in specific target organs. For example, introducing a 5' UTR into liver-expressed mRNAs (such as albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII) can enhance polynucleotide expression in hepatocyte cell lines or the liver. Similarly, the 5'UTRs of other tissue-specific mRNAs can be used to improve expression in that tissue in muscle (e.g., MyoD, myosin, myoglobin, myogenin, herculin), endothelial cells (e.g., Tie-1, CD36), bone marrow cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), leukocytes (e.g., CD45, CD18), adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and lung epithelial cells (e.g., SP-A / B / C / D).

[0057] In some embodiments, the UTR is selected from a family of transcripts, and the proteins of the transcript family share a common function, structure, characteristic or property. For example, the encoded polypeptide may belong to a family of proteins (i.e., share at least one function, structure, characteristic, localization, origin, or expression pattern), which are expressed in a particular cell, tissue, or at a certain time during development. The UTR of either a gene or mRNA can be exchanged with any other UTR from the same or different protein family to create a new polynucleotide.

[0058] In some embodiments, the 5'UTR and 3'UTR can be heterologous. In some embodiments, the 5'UTR can be from a different species than the 3'UTR.

[0059] International Patent Application Publication No. WO / 2014 / 164253, which is incorporated herein by reference in its entirety, provides a list of exemplary UTRs that can be utilized in the polynucleotides of the invention as regions flanking the ORF.

[0060] Further exemplary UTRs of the present application include, but are not limited to, one or more 5' UTRs and / or 3' UTRs derived from the following nucleic acid sequences: globin, such as α- or β-globin (e.g., Xenopus, mouse, rabbit, or human globin), strong Kozak translation initiation signal, CYBA (e.g., human cytochrome b-245α polypeptide), albumin (e.g., human albumin 7), HSD17B4 (hydroxysteroid (17-β) dehydrogenase), viruses (e.g., tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), hepatitis virus ( Hepatitis B virus, Sindbis virus, or PAV (barley yellow dwarf virus), heat shock proteins (e.g., hsp70), translation initiation factors (e.g., eIF4G), glucose transporters (e.g., hGLUT1 (human glucose transporter 1)), actin (e.g., human α- or β-actin), GAPDH, tubulin, histones, citric acid cycle enzymes, topoisomerases (e.g., the 5'UTR of the TOP gene lacking a 5'TOP motif (oligopyrimidine tract)), ribosomal protein Large 32 (L32), ribosomal proteins (e.g., human or mouse ribosomal proteins such as rps9), ATP synthase (e.g., ATP5A1 or mitochondrial H +-ATP synthase beta subunit), growth hormone e (e.g., bovine (bGH) or human (hGH)), elongation factors (e.g., elongation factor 1 alpha 1 (EEF1A1)), manganese superoxide dismutase (MnSOD), myocyte enhancer factor 2A (MEF2A), beta-F1-ATPase, creatine kinase, myoglobin, granulocyte colony-stimulating factor (G-CSF), collagen (e.g., type I collagen alpha 2 (Col1A2), type I collagen alpha 1 (Co l1A1), type VI collagen alpha 2 (Col6A2), type VI collagen alpha 1 (Col6A1), ribophorins (e.g., ribophorin I (RPNI)), low-density lipoprotein receptor-related proteins (e.g., LRP1), cardiotrophin-like cytokine factors (e.g., Nnt1), calreticulin (Calr), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1), and nucleobindins (e.g., Nucb1).

[0061] In some embodiments, the 5'UTR is selected from the group consisting of β-globin 5'UTR, a 5'UTR containing a strong Kozak translation initiation signal, cytochrome b-245 alpha polypeptide (CYBA) 5'UTR, hydroxysteroid (17-beta) dehydrogenase (HSD17B4) 5'UTR, tobacco etch virus (TEV) 5'UTR, Venezuelan equine encephalitis virus (TEEV) 5'UTR, the 5' proximal open reading frame of rubella virus (RV) RNA encoding a nonstructural protein, dengue virus (DEN) 5'UTR, heat shock protein 70 (Hsp70) 5'UTR, eIF4G 5'UTR, GLUT1 5'UTR, functional fragments thereof, and any combination thereof.

[0062] The wild-type UTR from any gene or mRNA can be incorporated into the polynucleotide of the present invention.In some embodiments, UTR can be modified relative to wild-type or natural UTR, for example, by changing the orientation or position of UTR relative to ORF, or by including additional nucleotides, deleting nucleotides, exchanging or rearranging nucleotides, to obtain variant UTR.In some embodiments, 5' or 3' UTR variant (for example, the mutant of wild-type UTR, or the variant in which one or more nucleotides are added or removed from the end of UTR) can be used.

[0063] Additionally, one or more synthetic UTRs may be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety.

[0064] UTRs or portions thereof may be positioned in the same orientation as their selected transcript, or their orientation or position may be altered. Thus, the 5' and / or 3' UTRs may be inverted, shortened, extended, or combined with one or more other 5' or 3' UTRs.

[0065] In some embodiments, the polynucleotide comprises multiple UTRs (e.g., duplicated, tripled, or quadrupled 5' or 3' UTRs). For example, a duplicated UTR comprises two copies of the same UTR, either in tandem or substantially in tandem. For example, a duplicated beta-globin 3' UTR can be used (see US2010 / 0129877, the contents of which are incorporated herein by reference in their entirety).

[0066] Polynucleotides of the invention may comprise a combination of features. For example, an ORF may be flanked by a 5' UTR containing a strong Kozak translation initiation signal and / or a 3' UTR containing an oligo(dT) sequence for templated addition of a polyA tail. The 5' UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, incorporated herein by reference in its entirety).

[0067] Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the invention. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the invention. Incorporation of intron sequences can increase protein production and polynucleotide expression levels. In some embodiments, the polynucleotides of the invention contain an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide contains an IRES instead of a 5'UTR sequence. In some embodiments, the polynucleotide contains an ORF and a viral capsid sequence. In some embodiments, the polynucleotide contains a synthetic 5'UTR in combination with a non-synthetic 3'UTR.

[0068] In some embodiments, the UTR may also contain at least one translation enhancer polynucleotide, a translation enhancer element(s) (collectively "TEE," which refers to a nucleic acid sequence that increases the amount of polypeptide or protein produced from a polynucleotide). As a non-limiting example, the TEE may be located between the transcription promoter and the start codon. In some embodiments, the 5' UTR contains a TEE.

[0069] In one embodiment, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid, including, but not limited to, cap-dependent or cap-independent translation.

[0070] a.5´UTR sequence The 5'UTR sequence is reported to be important for recruiting ribosomes to mRNA and play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292:1413-6).

[0071] Disclosed herein, inter alia, are polynucleotides encoding polypeptides, particularly those comprising a 5' UTR. In one embodiment, the polynucleotides disclosed herein comprise, and the LNP compositions comprise, (a) a 5' UTR (e.g., as set forth in Table 1 or a variant or fragment thereof), (b) a coding region, and (c) a termination element and a 3' UTR (e.g., as set forth in Table 2 or a variant or fragment thereof). In one embodiment, the polynucleotide comprises a 5' UTR comprising a sequence set forth in Table 1 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such 5' UTRs may be incorporated into constructs not found in nature (e.g., such 5' UTRs may be synthetic, have an altered sequence of a naturally occurring 5' UTR, be a truncated or extended version of one found in nature, contain chemically modified bases, be 5' to an ORF sequence different from that which may be found in nature, etc.).

[0072] In one embodiment, the 5' UTR comprises a sequence set forth in Table 1 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5' UTR sequence set forth in Table 1, or a variant or fragment thereof. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57 or SEQ ID NO:58.

[0073] In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 50. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 51. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 52. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 53. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 54. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 55. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 56. In one embodiment, the 5' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 57. In one embodiment, the 5'UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:58.

[0074] In one embodiment, the 5'UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:64.

[0075] In one embodiment, the 5' UTR comprises the sequence of SEQ ID NO: 50. In one embodiment, the 5' UTR consists of the sequence of SEQ ID NO: 50.

[0076] In one embodiment, the 5' UTR comprises the sequence of SEQ ID NO: 64. In one embodiment, the 5' UTR consists of the sequence of SEQ ID NO: 64.

[0077] In one embodiment, the 5'UTR sequence shown in Table 1 has a first nucleotide that is A. In one embodiment, the 5'UTR sequence shown in Table 1 has a first nucleotide that is G. In one embodiment, the 5'UTR sequence shown in Table 1 has two first nucleotides that are AG. In one embodiment, the 5'UTR sequence shown in Table 1 has two first nucleotides that are GA. [Table 1-1] [Table 1-2] [Table 1-3]

[0078] In one embodiment, the 5'UTR comprises a variant of SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 has Formula A: GGAAAUCGCAAAA (N2) X (N3) X CU (N4) X (N5) X CGCGUUAGAUUUCUUUUAGUU UUCU N6N7C AACUAGCAAGCUUUUUGUUCU CGCC (N8C C)x (SEQ ID NO: 59) wherein: (N2) x is uracil, and x is an integer from 0 to 5 (e.g., x=3 or 4), (N3) x is guanine, and x is an integer from 0 to 1; (N4) x is cytosine, and x is an integer from 0 to 1; (N5) x is uracil, and x is an integer from 0 to 5 (e.g., x=2 or 3), N6 is uracil or cytosine, N7 is uracil or guanine, N8 is adenine or guanine, and x is an integer of 0-1.

[0079] In one embodiment, (N2) x is uracil and x is 0. In one embodiment, (N2) x is uracil and x is 1. In one embodiment, (N2) x is uracil and x is 2. In one embodiment, (N2) x is uracil and x is 3. In one embodiment, (N2) x is uracil and x is 4. In one embodiment, (N2) x is uracil and x is 5.

[0080] In one embodiment, (N3) xis guanine and x is 0. In one embodiment, (N3) x is guanine and x is 1.

[0081] In one embodiment, (N4) x is cytosine and x is 0. In one embodiment, (N4) x is cytosine and x is 1.

[0082] In one embodiment, (N5) x is uracil and x is 0. In one embodiment, (N5) x is uracil and x is 1. In one embodiment, (N5) x is uracil and x is 2. In one embodiment, (N5) x is uracil and x is 3. In one embodiment, (N5) x is uracil and x is 4. In one embodiment, (N5) x is uracil and x is 5.

[0083] In one embodiment, N6 is uracil. In one embodiment, N6 is cytosine.

[0084] In one embodiment, N7 is uracil.In one embodiment, N7 is guanine.

[0085] In one embodiment, N8 is adenine and x is 0. In one embodiment, N8 is adenine and x is 1.

[0086] In one embodiment, N8 is guanine and x is 0. In one embodiment, N8 is guanine and x is 1.

[0087] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 50% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 60% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 70% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 80% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 90% identity to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence having at least 95% identity to SEQ ID NO: 50. In one embodiment, a variant of SEQ ID NO: 50 comprises a sequence having at least 96% identity to SEQ ID NO: 50. In one embodiment, a variant of SEQ ID NO: 50 comprises a sequence having at least 97% identity to SEQ ID NO: 50. In one embodiment, a variant of SEQ ID NO: 50 comprises a sequence having at least 98% identity to SEQ ID NO: 50. In one embodiment, a variant of SEQ ID NO: 50 comprises a sequence having at least 99% identity to SEQ ID NO: 50.

[0088] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 64%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 64% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 60% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 70% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 80% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 90% identity to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence having at least 95% identity to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence having at least 96% identity to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence having at least 97% identity to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence having at least 98% identity to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence having at least 99% identity to SEQ ID NO: 64.

[0089] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 55%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 55% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 60% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 70% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 80% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 90% identity to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence having at least 95% identity to SEQ ID NO: 55. In one embodiment, a variant of SEQ ID NO: 55 comprises a sequence having at least 96% identity to SEQ ID NO: 55. In one embodiment, a variant of SEQ ID NO: 55 comprises a sequence having at least 97% identity to SEQ ID NO: 55. In one embodiment, a variant of SEQ ID NO: 55 comprises a sequence having at least 98% identity to SEQ ID NO: 55. In one embodiment, a variant of SEQ ID NO: 55 comprises a sequence having at least 99% identity to SEQ ID NO: 55.

[0090] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 56%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 56% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 60% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 70% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 80% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 90% identity to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence having at least 95% identity to SEQ ID NO: 56. In one embodiment, a variant of SEQ ID NO: 56 comprises a sequence having at least 96% identity to SEQ ID NO: 56. In one embodiment, a variant of SEQ ID NO: 56 comprises a sequence having at least 97% identity to SEQ ID NO: 56. In one embodiment, a variant of SEQ ID NO: 56 comprises a sequence having at least 98% identity to SEQ ID NO: 56. In one embodiment, a variant of SEQ ID NO: 56 comprises a sequence having at least 99% identity to SEQ ID NO: 56.

[0091] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 58%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 58% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 60% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 70% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 80% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 90% identity to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence having at least 95% identity to SEQ ID NO: 58. In one embodiment, a variant of SEQ ID NO: 58 comprises a sequence having at least 96% identity to SEQ ID NO: 58. In one embodiment, a variant of SEQ ID NO: 58 comprises a sequence having at least 97% identity to SEQ ID NO: 58. In one embodiment, a variant of SEQ ID NO: 58 comprises a sequence having at least 98% identity to SEQ ID NO: 58. In one embodiment, a variant of SEQ ID NO: 58 comprises a sequence having at least 99% identity to SEQ ID NO: 58.

[0092] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 76%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 76% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 60% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 70% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 80% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 90% identity to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence having at least 95% identity to SEQ ID NO: 76. In one embodiment, a variant of SEQ ID NO: 76 comprises a sequence having at least 96% identity to SEQ ID NO: 76. In one embodiment, a variant of SEQ ID NO: 76 comprises a sequence having at least 97% identity to SEQ ID NO: 76. In one embodiment, a variant of SEQ ID NO: 76 comprises a sequence having at least 98% identity to SEQ ID NO: 76. In one embodiment, a variant of SEQ ID NO: 76 comprises a sequence having at least 99% identity to SEQ ID NO: 76.

[0093] In one embodiment, the 5' UTR comprises a variant of SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 78%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 78% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 60% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 70% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 80% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 90% identity to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence having at least 95% identity to SEQ ID NO: 78. In one embodiment, a variant of SEQ ID NO: 78 comprises a sequence having at least 96% identity to SEQ ID NO: 78. In one embodiment, a variant of SEQ ID NO: 78 comprises a sequence having at least 97% identity to SEQ ID NO: 78. In one embodiment, a variant of SEQ ID NO: 78 comprises a sequence having at least 98% identity to SEQ ID NO: 78. In one embodiment, a variant of SEQ ID NO: 78 comprises a sequence having at least 99% identity to SEQ ID NO: 78.

[0094] In one embodiment, a variant of SEQ ID NO:50 comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:50 comprises at least 50% uridine content. In one embodiment, a variant of SEQ ID NO:60 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:70 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:80 comprises at least 80% uridine content.

[0095] In one embodiment, a variant of SEQ ID NO:64 comprises at least 5%, 10%, 20%, 30%, 40%, 64%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 64% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:64 comprises at least 80% uridine content.

[0096] In one embodiment, a variant of SEQ ID NO:55 comprises at least 5%, 10%, 20%, 30%, 40%, 55%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 55% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:55 comprises at least 80% uridine content.

[0097] In one embodiment, a variant of SEQ ID NO:56 comprises at least 5%, 10%, 20%, 30%, 40%, 56%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 56% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:56 comprises at least 80% uridine content.

[0098] In one embodiment, a variant of SEQ ID NO:58 comprises at least 5%, 10%, 20%, 30%, 40%, 58%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 58% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:58 comprises at least 80% uridine content.

[0099] In one embodiment, a variant of SEQ ID NO:76 comprises at least 5%, 10%, 20%, 30%, 40%, 76%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 76% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:76 comprises at least 80% uridine content.

[0100] In one embodiment, a variant of SEQ ID NO:78 comprises at least 5%, 10%, 20%, 30%, 40%, 78%, 60%, 70%, or 80% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 5% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 10% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 20% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 30% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 40% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 78% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 60% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 70% uridine content. In one embodiment, a variant of SEQ ID NO:78 comprises at least 80% uridine content.

[0101] In one embodiment, a variant of SEQ ID NO:50 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO:50 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO:50 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO:50 comprises 5 consecutive uridines.

[0102] In one embodiment, a variant of SEQ ID NO:64 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO:64 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO:64 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO:64 comprises 5 consecutive uridines.

[0103] In one embodiment, a variant of SEQ ID NO: 55 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 55 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 55 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 55 comprises 5 consecutive uridines.

[0104] In one embodiment, a variant of SEQ ID NO: 56 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 56 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 56 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 56 comprises 5 consecutive uridines.

[0105] In one embodiment, a variant of SEQ ID NO: 58 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 58 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 58 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 58 comprises 5 consecutive uridines.

[0106] In one embodiment, a variant of SEQ ID NO: 76 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 76 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 76 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 76 comprises 5 consecutive uridines.

[0107] In one embodiment, a variant of SEQ ID NO: 78 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine tract). In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 78 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 78 comprises 4 consecutive uridines. In one embodiment, the polyuridine tract in a variant of SEQ ID NO: 78 comprises 5 consecutive uridines.

[0108] In one embodiment, a variant of SEQ ID NO:50 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:50 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:50 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:50 comprises 5 polyuridine tracts.

[0109] In one embodiment, a variant of SEQ ID NO:64 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:64 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:64 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO:64 comprises 5 polyuridine tracts.

[0110] In one embodiment, a variant of SEQ ID NO: 55 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 55 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 55 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 55 comprises 5 polyuridine tracts.

[0111] In one embodiment, a variant of SEQ ID NO: 56 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 56 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 56 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 56 comprises 5 polyuridine tracts.

[0112] In one embodiment, a variant of SEQ ID NO: 58 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 58 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 58 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 58 comprises 5 polyuridine tracts.

[0113] In one embodiment, a variant of SEQ ID NO: 76 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 76 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 76 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 76 comprises 5 polyuridine tracts.

[0114] In one embodiment, a variant of SEQ ID NO: 78 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 78 comprises 3 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 78 comprises 4 polyuridine tracts. In one embodiment, a variant of SEQ ID NO: 78 comprises 5 polyuridine tracts.

[0115] In one embodiment, one or more of the polyuridine tracts are adjacent to a different polyuridine tract, hi one embodiment, each, e.g., all, of the polyuridine tracts are adjacent to one another, e.g., all of the polyuridine tracts are contiguous.

[0116] In one embodiment, one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides. In one embodiment, each of the polyuridine tracts, e.g., all, are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0117] In one embodiment, the first polyuridine tract and the second polyuridine tract are adjacent to one another.

[0118] In one embodiment, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth or tenth polyuridine tract is separated from the first polyuridine tract, the second polyuridine tract or any one of the subsequent polyuridine tracts by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or 60 nucleotides.

[0119] In one embodiment, the first polyuridine tract is separated from a subsequent polyuridine tract, for example, the second, third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth polyuridine tract, by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides. In one embodiment, one or more of the subsequent polyuridine tracts is adjacent to a different polyuridine tract.

[0120] In one embodiment, the 5' UTR comprises a Kozak sequence (e.g., the GCCRCC nucleotide sequence (SEQ ID NO: 79), where R is adenine or guanine). In one embodiment, the Kozak sequence is positioned at the 3' end of the 5' UTR sequence.

[0121] In one embodiment, a polynucleotide comprising a 5' UTR sequence disclosed herein comprises a coding region that encodes a payload (eg, a therapeutic or prophylactic payload).

[0122] In one aspect, a polynucleotide (e.g., mRNA) comprising a 5' UTR sequence disclosed herein is formulated as an LNP. In one embodiment, the LNP composition comprises (i) an ionizable lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a non-cationic helper lipid or phospholipid, and (iv) a PEG-lipid.

[0123] In another embodiment, the LNP compositions of the present disclosure are used in methods of treating a disease or disorder or inhibiting an immune response in a subject.

[0124] In one embodiment, an LNP composition comprising a polynucleotide disclosed herein encoding a therapeutic or prophylactic payload (e.g., as described herein) can be administered with an additional agent (e.g., as described herein).

[0125] b. Termination element + 3'UTR sequence The translation stop codons UAA, UAG, and UGA are essential components of the genetic code and signal the end of mRNA translation. During protein synthesis, stop codons interact with protein release factors, and this interaction can regulate ribosomal activity, thus affecting translation (Tate WP, et al., (2018) Biochem Soc Trans, 46(6):1615-162).

[0126] The 3'UTR sequence has been shown to affect mRNA translation, half-life, and subcellular localization (Mayr C., Cold Spring Harb Persp Biol 2019 Oct 1;11(10):a034728).

[0127] Disclosed herein, inter alia, are polynucleotides encoding polypeptides having a termination element in combination with a 3' UTR that confers increased half-life, increased expression, and / or increased activity of the polypeptide encoded by the polynucleotide or of the polynucleotide itself. In one embodiment, the polynucleotides disclosed herein comprise, and LNP compositions comprise, (a) a 5' UTR, (b) a coding region, and (c) a termination element and a 3' UTR (e.g., as described herein).

[0128] Disclosed herein, inter alia, are polynucleotides encoding polypeptides, particularly those comprising a 3' UTR. In one embodiment, the polynucleotides disclosed herein comprise, and the LNP compositions comprise, (a) a 5' UTR (e.g., as set forth in Table 1 or a variant or fragment thereof), (b) a coding region, and (c) a termination element and a 3' UTR (e.g., as set forth in Table 2 or a variant or fragment thereof). In one embodiment, the polynucleotide comprises a 3' UTR comprising a sequence set forth in Table 2 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such a 3' UTR may be incorporated into a construct not found in nature (e.g., such a 3' UTR may be synthetic, have an altered sequence of a naturally occurring 3' UTR, be a truncated or extended version of one found in nature, contain chemically modified bases, be 3' to an ORF sequence different from that which may be found in nature, etc.).

[0129] In one embodiment, the 3' UTR comprises a sequence set forth in Table 2 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3' UTR sequence set forth in Table 2, or a variant or fragment thereof. In one embodiment, the 3' UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, or SEQ ID NO:147. [Table 2-1] [Table 2-2] [Table 2-3]

[0130] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 139) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 139).

[0131] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 139, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0132] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 139, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0133] In one embodiment, the increase is compared to other similar polynucleotides that do not have the 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 139 or a variant or fragment thereof.

[0134] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 139 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 139.

[0135] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAGUCUAAGCUGGAGCCUCCUGAGAGACCUGUGUGAACUAUUGAGAAGAUCGGAACAGCUCCUUACUCUGAGGAAGUUGGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 140) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 140).

[0136] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 140, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0137] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 140, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0138] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 140 or a variant or fragment thereof.

[0139] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 140 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 140.

[0140] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAAGCUCCCCGGGGCAAACACCAUUGUCACACUCCAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 141) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 141).

[0141] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 141, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0142] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 141, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0143] In one embodiment, the increase is compared to other similar polynucleotides that do not have the 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 141 or a variant or fragment thereof.

[0144] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO:141 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO:141.

[0145] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 142) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 142).

[0146] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 142, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0147] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 142, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0148] In one embodiment, the increase is compared to other similar polynucleotides that do not have the 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 142 or a variant or fragment thereof.

[0149] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 142 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 142.

[0150] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 143) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 143).

[0151] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 143, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0152] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 143, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0153] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 143 or a variant or fragment thereof.

[0154] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 143 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 143.

[0155] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAGCCCCUCCGGGGCAAACACCAUUGUCACACUCCAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 144) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 144).

[0156] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 144, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0157] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 144, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0158] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 144 or a variant or fragment thereof.

[0159] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 144 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 144.

[0160] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAGCCCCUCCGGGGUCCAUAAAGUAGGAAACACUACAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCAUAAAGUAGGAAACACUACAUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCGCAUUAUUACUCACGGUACGAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 145) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 145).

[0161] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 145, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0162] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 145, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0163] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 145 or a variant or fragment thereof.

[0164] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 145 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 145.

[0165] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAGCCCCUCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 146) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 146).

[0166] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 146, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0167] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 146, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0168] In one embodiment, the increase is compared to other similar polynucleotides that do not have a 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 146 or a variant or fragment thereof.

[0169] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO:146 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO:146.

[0170] In one embodiment, the polynucleotide comprises a termination element and a 3' UTR, and the sequence (terminator element in italics) is UAAGCCCCUCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 147) or a variant or fragment thereof (e.g., a fragment lacking the first 1, 2, 3, 4, 5, 6, or more nucleotides of SEQ ID NO: 147).

[0171] In one embodiment, a polynucleotide having a 3' UTR sequence set forth in SEQ ID NO: 147, or a variant or fragment thereof, results in an increased half-life of the polynucleotide (e.g., an increase in the half-life of the polynucleotide of about 1.5-10 fold). In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold or more. In one embodiment, the increase in half-life is about 1.5 fold or more. In one embodiment, the increase in half-life is about 2 fold or more. In one embodiment, the increase in half-life is about 3 fold or more. In one embodiment, the increase in half-life is about 4 fold or more. In one embodiment, the increase in half-life is about 5 fold or more. In one embodiment, the increase in half-life is about 6 fold or more. In one embodiment, the increase in half-life is about 7 fold or more. In one embodiment, the increase in half-life is about 8 fold or more. In one embodiment, the increase in half-life is about 9 fold or more. In one embodiment, the increase in half-life is about 10-fold or greater.

[0172] In one embodiment, a polynucleotide having the 3'UTR sequence set forth in SEQ ID NO: 147, or a variant or fragment thereof, increases the level and / or activity (e.g., production) of a polypeptide encoded by the polynucleotide.

[0173] In one embodiment, the increase is compared to other similar polynucleotides that do not have the 3'UTR, have a different 3'UTR, or do not have the 3'UTR of SEQ ID NO: 147 or a variant or fragment thereof.

[0174] In one embodiment, the polynucleotide comprises the 3' UTR sequence set forth in SEQ ID NO: 147 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the 3' UTR sequence set forth in SEQ ID NO: 147.

[0175] 2.3´ Stabilization region Disclosed herein, inter alia, are polynucleotides encoding polypeptides, the polynucleotides comprising: (a) a 5' UTR (e.g., as described herein), (b) a coding region including a termination element (e.g., as described herein), (c) a 3' UTR (e.g., as described herein), and (d) a 3' stabilizing region. Also disclosed herein are LNP compositions comprising them.

[0176] In one embodiment, the polynucleotide comprises a 3' stabilizing region (e.g., a stabilizing tail, e.g., as described herein). Polynucleotides containing a 3' stabilizing region (e.g., a 3' stabilizing region comprising an alternative nucleobase, sugar, and / or backbone) may be particularly effective for use in therapeutic compositions, as they may benefit from increased stability and higher expression levels.

[0177] In one embodiment, the 3' stabilization region comprises a poly-A tail (e.g., a poly-A tail comprising 80-150, e.g., 120, adenines (SEQ ID NO: 123)). In one embodiment, the poly-A tail comprises one or more non-adenosine residues (e.g., one or more guanosines, e.g., as described herein). In one embodiment, the poly-A tail comprises the sequence UCUAG (SEQ ID NO: 44). In one embodiment, the poly-A tail comprises about 80-120 (e.g., 100) adenines upstream of SEQ ID NO: 44. In one embodiment, the poly-A tail comprises about 1-40 (e.g., 20) adenines downstream of SEQ ID NO: 44.

[0178] In one embodiment, the 3' stabilization region comprises at least one alternative nucleoside. In one embodiment, the alternative nucleoside is inverted thymidine (idT). In one embodiment, the alternative nucleoside is positioned at the 3' end of the 3' stabilization region.

[0179] In one embodiment, the 3' stabilizing region has Formula VII: [ka] or a salt thereof, wherein each X is independently O or S, A represents adenine, and T represents thymine.

[0180] In one aspect, disclosed herein is a polynucleotide encoding a polypeptide, the polynucleotide comprising: (a) a 5' UTR (e.g., as described herein), (b) a coding region comprising a termination element (e.g., as described herein), (c) a 3' UTR (e.g., as described herein), and (d) a 3' stabilizing region (e.g., as described herein).

[0181] In one aspect, an LNP composition comprising a polynucleotide comprising a stabilizing region disclosed herein comprises (i) an ionizable lipid (e.g., an amino lipid), (ii) a sterol or other structural lipid, (iii) a non-cationic helper lipid or phospholipid, and (iv) a PEG lipid.

[0182] In another embodiment, the LNP compositions of the present disclosure are used in methods of treating a disease or disorder or inhibiting an immune response in a subject.

[0183] In one embodiment, an LNP composition comprising a polynucleotide disclosed herein that encodes a therapeutic or prophylactic payload (e.g., as described herein) can be administered with an additional agent (e.g., as described herein).

[0184] 3. MicroRNA (miRNA) binding sites Nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can include regulatory elements, such as microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof.

[0185] In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). The inclusion or incorporation of the miRNA binding site(s) regulates the nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure, and thus the polypeptide encoded thereby, based on tissue-specific and / or cell-type-specific expression of naturally occurring miRNAs.

[0186] miRNAs (e.g., naturally occurring miRNAs) are 19-25 nucleotide-long non-coding RNAs that bind to nucleic acid molecules (e.g., RNAs, e.g., mRNAs) and downregulate gene expression by either reducing the stability of the polynucleotide or inhibiting its translation. The miRNA sequence comprises a "seed" region, i.e., a sequence located in the region of positions 2-8 of the mature miRNA. The miRNA seed may comprise positions 2-8 or 2-7 of the mature miRNA. In some embodiments, the miRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), and the seed-complementary portion of the corresponding miRNA-binding site is adjacent to an adenosine (A) relative to position 1 of the miRNA. In some embodiments, the miRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), and the seed-complementary portion of the corresponding miRNA-binding site is adjacent to an adenosine (A) relative to position 1 of the miRNA. See, e.g., Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. miRNA profiling of target cells or tissues can be performed to determine the presence or absence of miRNAs in the cells or tissues. In some embodiments, nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure comprise one or more microRNA binding sites, microRNA target sequences, microRNA complementary sequences, or microRNA seed complementary sequences. Such sequences can correspond to (e.g., be complementary to) any known microRNA, such as those taught in U.S. Publication No. US2005 / 0261218 and U.S. Publication No. US2005 / 0059005 (the contents of each of which are incorporated herein by reference in their entirety).

[0187] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a nucleic acid molecule (e.g., within a DNA or within an RNA transcript, including the 5' UTR and / or 3' UTR) that has sufficient complementarity to all or a region of an miRNA to interact with, associate with, or bind to the miRNA. In some embodiments, a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the present disclosure that includes an ORF encoding a polypeptide of interest further comprises one or more miRNA binding site(s). In exemplary embodiments, the 5' UTR and / or 3' UTR of a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) comprises one or more miRNA binding site(s).

[0188] "Sufficient complementarity" of an miRNA-binding site to an miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated regulation of a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) (e.g., miRNA-mediated translational repression or degradation of a nucleic acid molecule (e.g., an RNA, e.g., an mRNA)). In exemplary embodiments of the present disclosure, "sufficient complementarity" of an miRNA-binding site to an miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated degradation of a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) (e.g., miRNA-guided RNA-induced silencing complex (RISC)-mediated mRNA cleavage). The miRNA-binding site may be complementary to, for example, a 19-25 nucleotide miRNA sequence, a 19-23 nucleotide miRNA sequence, or a 22 nucleotide miRNA sequence. The miRNA-binding site may be complementary to only a portion of the miRNA (e.g., 1, 2, 3, or 4 nucleotides less than the full length of a naturally occurring miRNA sequence). When the desired modulation is mRNA degradation, maximal or complete complementarity (e.g., maximal or complete complementarity over all or a substantial portion of the length of the naturally occurring miRNA) is preferred.

[0189] In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA sequence. In some embodiments, the miRNA binding site has complete complementarity with the miRNA sequence apart from one, two, or three nucleotide substitutions, terminal additions, and / or truncations.

[0190] In some embodiments, the miRNA-binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA-binding site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the corresponding miRNA at the 5'-end, 3'-end, or both. In still other embodiments, the microRNA-binding site is 2 nucleotides shorter than the corresponding microRNA at the 5'-end, 3'-end, or both. Even if the miRNA-binding site is shorter than the corresponding miRNA, it is still possible to degrade mRNAs incorporating one or more miRNA-binding sites or prevent the translation of the mRNA.

[0191] In some embodiments, the miRNA-binding site binds a corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA-binding site to the corresponding miRNA in the RISC degrades the mRNA containing the miRNA-binding site or prevents translation of the mRNA. In some embodiments, the miRNA-binding site has sufficient complementarity to the miRNA such that a RISC complex containing the miRNA cleaves the nucleic acid molecule (e.g., RNA, e.g., mRNA) containing the miRNA-binding site. In other embodiments, the miRNA-binding site has imperfect complementarity such that a RISC complex containing the miRNA induces instability in the nucleic acid molecule (e.g., RNA, e.g., mRNA) containing the miRNA-binding site. In another embodiment, the miRNA-binding site has imperfect complementarity such that a RISC complex containing the miRNA represses transcription of the nucleic acid molecule (e.g., RNA, e.g., mRNA) containing the miRNA-binding site.

[0192] In some embodiments, the miRNA-binding site has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mismatch(es) from the corresponding miRNA. In some embodiments, the miRNA-binding site has at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides that are complementary to at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides of the corresponding miRNA, respectively.

[0193] By engineering one or more miRNA binding sites into a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the present disclosure, the nucleic acid molecule (e.g., an RNA, e.g., an mRNA) can be targeted for degradation or reduced translation, if the corresponding miRNA is available. This can reduce off-target effects during delivery of the nucleic acid molecule (e.g., an RNA, e.g., an mRNA). For example, if a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the present disclosure is not intended to be delivered to a tissue or cell but ends up in that tissue or cell, an miRNA that is abundant in that tissue or cell can inhibit expression of a gene of interest if one or more binding sites for that miRNA are engineered into the 5' UTR and / or 3' UTR of the nucleic acid molecule (e.g., an RNA, e.g., an mRNA).

[0194] For example, one skilled in the art will understand that one or more miR binding sites can be included in a nucleic acid molecule (e.g., RNA, e.g., mRNA) to minimize expression in cell types other than lymphoid cells. In one embodiment, a miR122 binding site can be used. In another embodiment, a miR126 binding site can be used. In yet another embodiment, multiple copies or combinations of these miR binding sites can be used.

[0195] Conversely, to increase protein expression in a particular tissue, an miRNA-binding site can be removed from the sequence of a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) in which it naturally occurs. For example, a binding site for a particular miRNA can be removed from a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) to improve protein expression in tissues or cells containing that miRNA.

[0196] Modulation of expression in multiple tissues can be achieved by introducing or removing one or more miRNA binding sites (e.g., one or more different miRNA binding sites). The decision to remove or insert a miRNA binding site can be made based on miRNA expression patterns and / or profiling in tissues and / or cells during development and / or disease. The identification of miRNAs, miRNA binding sites, and their expression patterns and roles in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi:10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al., Cell, 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403, and all references therein, each of which is incorporated herein by reference in its entirety).

[0197] The miRNA and miRNA binding sites may correspond to any known sequences, including the non-limiting examples set forth in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005, each of which is incorporated by reference herein in its entirety.

[0198] Examples of tissues in which miRNAs are known to regulate mRNA and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), bone marrow cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0199] Specifically, miRNAs are known to be specifically expressed in immune cells (also called hematopoietic cells), such as antigen-presenting cells (APCs) (e.g., dendritic cells and monocytes), monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killer cells. Immune cell-specific miRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and undesirable immune responses after gene therapy and tissue / organ transplantation. Immune cell-specific miRNAs also regulate many aspects of hematopoietic cell (immune cell) development, proliferation, differentiation, and apoptosis. For example, miR-142 and miR-146 are exclusively expressed in immune cells and are particularly abundant in myeloid dendritic cells. It has been demonstrated that immune responses to nucleic acid molecules (e.g., RNA, e.g., mRNA) can be blocked by adding miR-142 binding sites to the 3' UTR of polynucleotides, thereby enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous nucleic acid molecules (e.g., RNA, e.g., mRNA) in antigen-presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., Blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., Blood, 2007, 110(13):4144-4152, each of which is incorporated herein by reference in its entirety).

[0200] An antigen-mediated immune response can refer to an immune response elicited by a foreign antigen that enters an organism and is processed by antigen-presenting cells and presented on their surface. T cells can recognize the presented antigen and induce cytotoxic elimination of cells expressing that antigen.

[0201] By introducing a miR-142 binding site into the 5'UTR and / or 3'UTR of a nucleic acid molecule of the present disclosure, gene expression in antigen-presenting cells can be selectively suppressed through miR-142-mediated degradation, limiting antigen presentation in antigen-presenting cells (e.g., dendritic cells), thereby preventing antigen-mediated immune responses after delivery of the nucleic acid molecule (e.g., RNA, e.g., mRNA).The nucleic acid molecule (e.g., RNA, e.g., mRNA) is then stably expressed in target tissues or cells without inducing cytotoxic elimination.

[0202] In one embodiment, a binding site for an miRNA known to be expressed in immune cells, particularly antigen-presenting cells, can be engineered into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure to suppress expression of the nucleic acid molecule (e.g., RNA, e.g., mRNA) in antigen-presenting cells via miRNA-mediated RNA degradation, thereby suppressing antigen-mediated immune responses. Expression of the nucleic acid molecule (e.g., RNA, e.g., mRNA) is maintained in non-immune cells in which the immune cell-specific miRNA is not expressed. For example, in some embodiments, to prevent immunogenic responses against liver-specific proteins, any miR-122 binding site can be removed, and miR-142 (and / or miR-146) binding sites can be engineered into the 5' UTR and / or 3' UTR of a nucleic acid molecule of the present disclosure.

[0203] To further promote selective degradation and suppression in APCs and macrophages, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can include additional negative regulatory elements within the 5'UTR and / or 3'UTR, either alone or in combination with miR-142 and / or miR-146 binding sites. As a non-limiting example, an additional negative regulatory element is a constitutive decay element (CDE).

[0204] Immune cell-specific miRNAs include hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-1--3p, hsa-let-7f-2--5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p,miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p, miR-29b-2-5p, miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, miR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-3 Examples of miR-63-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5p, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR-548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cells by microarray hybridization and microtome analysis (e.g., Jima DD et al., Blood, 2010, 116:e118-e127; Vaz C et al., BMC Genomics, 2010, 11, 288, the contents of each of which are incorporated herein by reference in their entirety).

[0205] In some embodiments, an miRNA binding site is inserted in a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the disclosure at any position (e.g., the 5' UTR and / or the 3' UTR) of the nucleic acid molecule (e.g., an RNA, e.g., an mRNA). In some embodiments, the 5' UTR comprises an miRNA binding site. In some embodiments, the 3' UTR comprises an miRNA binding site. In some embodiments, both the 5' UTR and the 3' UTR comprise miRNA binding sites. The insertion site in a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) may be anywhere within the nucleic acid molecule (e.g., an RNA, e.g., an mRNA), so long as insertion of the miRNA-binding site into the nucleic acid molecule (e.g., an RNA, e.g., an mRNA) does not interfere with translation of a functional polypeptide in the absence of the corresponding miRNA, and so long as, in the presence of the miRNA, insertion of the miRNA-binding site into the nucleic acid molecule (e.g., an RNA, e.g., an mRNA) and binding of the miRNA-binding site to the corresponding miRNA can degrade the polynucleotide or prevent translation of the nucleic acid molecule (e.g., an RNA, e.g., an mRNA).

[0206] In some embodiments, the miRNA binding site is inserted into a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the present disclosure comprising an ORF at least about 30 nucleotides downstream from the stop codon of the ORF. In some embodiments, the miRNA binding site is inserted into a polynucleotide of the present disclosure at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of the ORF. In some embodiments, the miRNA binding site is inserted in a nucleic acid molecule (e.g., an RNA, e.g., an mRNA) of the present disclosure about 10 to about 100 nucleotides, about 20 to about 90 nucleotides, about 30 to about 80 nucleotides, about 40 to about 70 nucleotides, about 50 to about 60 nucleotides, or about 45 to about 65 nucleotides downstream from the stop codon of the ORF.

[0207] MiRNA gene regulation can be influenced by the sequences surrounding the miRNA, including, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), the regulatory elements of the surrounding sequence, and / or the structural elements of the surrounding sequence. miRNA can be influenced by the 5' UTR and / or 3' UTR. As a non-limiting example, a non-human 3' UTR can enhance the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3' UTR of the same sequence type.

[0208] In one embodiment, other regulatory and / or structural elements in the 5'UTR can affect miRNA-mediated gene regulation. One example of a regulatory and / or structural element is a structured IRES (internal ribosome entry site) in the 5'UTR, which is required for binding of translation elongation factors to initiate protein translation. Binding of EIF4A2 to this secondary structured element in the 5'UTR is required for miRNA-mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, incorporated herein by reference in its entirety). A nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure can further comprise this structured 5'UTR to enhance microRNA-mediated gene regulation.

[0209] At least one miRNA binding site can be engineered into the 3' UTR of a polynucleotide of the present disclosure. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into the 3' UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding site can be engineered into the 3' UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure. In one embodiment, the miRNA binding sites incorporated into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure can be the same miRNA site or different miRNA sites. Combinations of different miRNA binding sites incorporated into nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure may include combinations in which two or more copies of any of the different miRNA sites are incorporated. In another embodiment, the miRNA binding sites incorporated into nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure may target the same or different tissues in the body. As a non-limiting example, the level of expression in specific cell types (e.g., hepatocytes, bone marrow cells, endothelial cells, cancer cells, etc.) may be reduced through the introduction of tissue-specific, cell type-specific, or disease-specific miRNA binding sites in the 3' UTR of nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure.

[0210] In one embodiment, an miRNA binding site can be engineered into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure near the 5' end of the 3' UTR, approximately midway between the 5' and 3' ends of the 3' UTR, and / or near the 3' end of the 3' UTR. As a non-limiting example, an miRNA binding site can be engineered into the 5' end of the 3' UTR and approximately midway between the 5' and 3' ends of the 3' UTR. As another non-limiting example, an miRNA binding site can be engineered into the 3' end of the 3' UTR and approximately midway between the 5' and 3' ends of the 3' UTR. As yet another non-limiting example, an miRNA binding site can be engineered into the 5' end of the 3' UTR and approximately midway between the 5' and 3' ends of the 3' UTR.

[0211] In another embodiment, the 3'UTR can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to the miRNA, the miRNA seed sequence, and / or the miRNA sequence adjacent to the seed sequence.

[0212] The nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can be engineered for more targeted expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in different tissues, cell types, or biological conditions. Through the introduction of tissue-specific miRNA binding sites, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition.

[0213] In some embodiments, nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can contain at least one miRNA binding site in the 3'UTR to selectively degrade mRNA therapeutics in immune cells, thereby suppressing undesirable immunogenic responses caused by delivery of the therapeutic. As a non-limiting example, the miRNA binding site can make the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure more unstable in antigen-presenting cells. Non-limiting examples of such miRNAs are shown in Table 3 below. [Table 3]

[0214] In some embodiments, the 3'UTR of a nucleic acid molecule described herein comprises miR122 bs (i.e., SEQ ID NO: 148 shown in Table 3 above). In some embodiments, the 3'UTR of a nucleic acid molecule described herein comprises miR-142-3p bs (i.e., SEQ ID NO: 149 shown in Table 3 above). In some embodiments, the 3'UTR of a nucleic acid molecule described herein comprises miR-126-3p bs (i.e., SEQ ID NO: 150 shown in Table 3 above).

[0215] In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises two or more miRNA binding sites. In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. In some embodiments, when two or more miRNA binding sites are present, the miRNA binding sites are identical. In some embodiments, when two or more miRNA binding sites are present, the miRNA binding sites are (e.g., any combination of any of the miRNA binding sites listed in Table 3 above). In some embodiments, when two or more miRNA binding sites are present, there may be approximately 1 to 25 nucleotides between each miRNA binding site. For example, there may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides between each miRNA binding site.

[0216] In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises both miR142-3p bs and miR-126-3p bs. In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises three copies of miR-142-3p bs. In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises two copies of miR-142-3p bs. In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises two copies of miR-142-3p bs and one copy of miR-126-3p bs. In some embodiments, the 3' UTR of a nucleic acid molecule described herein comprises three copies of miR122 bs.

[0217] 4. Nucleotide Capping The present disclosure also includes polynucleotides that include both a 5' cap and a polynucleotide of the invention (e.g., a polynucleotide that includes a nucleotide sequence that encodes a polypeptide to be expressed).

[0218] The 5' cap structure of natural mRNA is involved in nuclear export, enhances mRNA stability, and allows the binding of mRNA cap-binding protein (CBP), which contributes to mRNA stability and translation competence in cells through the association of CBP with poly(A)-binding protein to form mature circular mRNA species. The cap also assists in the removal of 5'-proximal introns during mRNA splicing.

[0219] Endogenous mRNA molecules can be capped at the 5' end, generating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue and the 5'-most transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or terminal forward transcribed nucleotide at the mRNA 5' end can also optionally be 2'-O-methylated. 5'-decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0220] In some embodiments, a polynucleotide of the invention (eg, a polynucleotide comprising a nucleotide sequence encoding a polypeptide) incorporates a cap moiety.

[0221] In some embodiments, polynucleotides of the present invention contain a non-hydrolyzable cap structure that prevents decapping and thus increases the half-life of the mRNA. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5'-phosphorodiester bond, modified nucleotides can be used during the capping reaction. For example, Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate bond in the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can be used.

[0222] Additional modifications include, but are not limited to, 2'-O-methylation of the 2'-hydroxyl group of the ribose sugar of the 5'-terminus and / or 5'-prefix nucleotide of a polynucleotide (as described above). Several different 5'-cap structures can be used to generate the 5'-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ in their chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized and / or linked to polynucleotides of the invention chemically (i.e., non-enzymatically) or enzymatically.

[0223] For example, the anti-reverse cap analog (ARCA) cap contains two guanines linked by a 5'-5'-triphosphate group, with one guanine containing a 3'-O-methyl group in addition to the N7 methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine (m 7 G-3´mppp-G, which is similar to 3´O-Me-m 7 (It may also be referred to as G(5')ppp(5')G). The 3'-O atom of the other unmodified guanine is linked to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-O-methylated guanine provides the terminal portion of the capped polynucleotide.

[0224] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7 Gm-ppp-G).

[0225] Another exemplary cap is m 7 GpppG 2´OMe or m 7G-ppp-Gm-A (i.e., N7, guanosine-5'-triphosphate-2'-O-dimethyl-guanosine-adenosine).

[0226] In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group, such as the dinucleotide cap analogs described in U.S. Pat. No. 8,519,110, the entire contents of which are incorporated herein by reference.

[0227] In another embodiment, the cap is a cap analog of an N7-(4-chlorophenoxyethyl)-substituted dinucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide forms of cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m 3´-O G(5')ppp(5')G cap analogs (see, e.g., the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the entire contents of which are incorporated herein by reference). In another embodiment, the cap analog of the present invention is a 4-chloro / bromophenoxyethyl analog.

[0228] Polynucleotides of the present invention can also be capped after production using enzymes (whether by IVT or chemical synthesis) to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to characteristics that closely reflect or mimic, either structurally or functionally, endogenous or wild-type characteristics. That is, "more authentic" characteristics are more representative of endogenous, wild-type, native, or physiological cellular functions and / or structures, or superior in one or more respects to corresponding endogenous, wild-type, native, or physiological characteristics, when compared to prior art synthetic characteristics or analogs, etc. Non-limiting examples of more authentic 5'-cap structures of the present invention are those that, among others, enhance cap-binding protein binding, increase half-life, decrease susceptibility to 5' endonucleases, and / or decrease 5'-decapping, when compared to synthetic 5'-cap structures known in the art (or to wild-type, native, or physiological 5'-cap structures). For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can create a classical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is referred to as the Cap1 structure. This cap results in higher translational competence and cellular stability, as well as reduced activation of cellular inflammatory cytokines, for example, when compared with other 5'-cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N1pN2p (Cap0), 7mG(5')ppp(5')N1mpNp (Cap1), and 7mG(5')-ppp(5')N1mpN2mp (Cap2).

[0229] As a non-limiting example, capping the polynucleotides after they are produced can be more efficient, as nearly 100% of the polynucleotides can be capped, as opposed to approximately 80% when a cap analog is attached to the polynucleotide during the in vitro transcription reaction.

[0230] According to the present invention, the 5'-end cap can comprise an endogenous cap or a cap analog. According to the present invention, the 5'-end cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0231] Also provided herein are exemplary caps, including those that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis using an RNA polymerase, e.g., a wild-type RNA polymerase or a variant thereof, such as a variant described herein. In one embodiment, when RNA is produced in a "one-pot" reaction, a cap can be added without the need for a separate capping reaction. Thus, the method, in some embodiments, includes reacting a polynucleotide template with an RNA polymerase variant, a nucleoside triphosphate, and a cap analog under in vitro transcription reaction conditions to produce an RNA transcript.

[0232] As used herein, the term "cap" includes an inverted G nucleotide and can include one or more additional nucleotides 3' to the inverted G nucleotide, e.g., one, two, three, or more nucleotides 3' to the inverted G nucleotide and 5' to the 5' UTR, e.g., 5' UTRs described herein.

[0233] Exemplary caps include: [ka] where the underlined and italicized G is an inverted G nucleotide followed by a 5'-5'-triphosphate group.

[0234] In one embodiment, the cap is represented by formula (I): [ka] or a stereoisomer, tautomer or salt thereof, wherein [ka] and Ring B1 is a modified or unmodified guanine, Ring B2 and Ring B3 are each independently a nucleobase or a modified nucleobase; X2 is O, S(O) p , N.R. 24 or CR 25 R 26 where p is 0, 1, or 2; Y0 is O or CR6R7, Y1 is O, S(O) n , CR6R7, or NR8, where n is 0, 1, or 2; Each - is a single bond or is absent, where if each - is a single bond, then Yi is O, S(O) n , CR6R7, or NR8, and if each --- is not present, Y1 is invalid, Y2 is (OP(O)R4) m (where m is 0, 1, or 2), or -O-(CR 40 R 41 )u-Q0-(CR 42 R 43 )v-(where Q0 is a bond, O, S(O) r , N.R. 44 , or CR 45 R 46 wherein r is 0, 1, or 2, and each of u and v is independently 1, 2, 3, or 4; each R2 and R2' is independently halo, LNA, or OR3; each R3 is independently H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, and when R3 is C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, it is optionally substituted with one or more of halo, OH, and C1-C6 alkoxyl optionally substituted with one or more OH or OC(O)—C1-C6 alkyl; Each R4 and R4' is independently H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3 - and Each of R6, R7, and R8 is independently -Q1-T1, where Q1 is a bond or a C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH, and C1-C6 alkoxy, and T1 is H, halo, OH, COOH, cyano, or R s1 where R s1 is C1-C3 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxyl, C(O)O-C1-C6 alkyl, C3-C8 cycloalkyl, C6-C 10 Aryl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R s1 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , C3-C8 cycloalkyl, C6-C 10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; R 10 , R 11 , R 12 , R13 , R 14 , and R 15 is independently -Q2-T2, where Q2 is a bond or a C1-C3 alkyl linker optionally substituted with one or more halo, cyano, OH, and C1-C6 alkoxy, and T2 is H, halo, OH, NH2, cyano, NO2, N3, R s2 , or OR s2 where R s2 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C 10 Aryl, NHC(O)-C1-C6 alkyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R s2 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , C3-C8 cycloalkyl, C6-C 10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl, or R 12 is R 14 and R are oxo, or 13 is R 15 together with oxo, R 20 , R 21 , R 22 , and R 23 is independently -Q3-T3, where Q3 is a bond or a C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH, and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, R S3 , or OR S3 where RS3 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C 10 aryl, NHC(O)—C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; Rs3 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O—C1-C6 alkyl, cyano, C1-C6 alkoxyl, amino, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C 10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; R 24 , R 25 , and R 26 each is independently H or C1-C6 alkyl; R 27 and R 28 each independently represents H or OR 29 or R 27 and R 28 Both OR 30 -O, and each R 29 are independently H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, and R 29 is C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, which is optionally substituted with one or more of halo, OH, and C1-C6 alkoxyl optionally substituted with one or more OH or OC(O)—C1-C6 alkyl; R 30 is C1-C6 alkylene optionally substituted with one or more of halo, OH, and C1-C6 alkoxyl; R 31 , R 32 , and R 33 each independently represents H, C1-C6 alkyl, C3-C8 cycloalkyl, C6-C 10 aryl, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R 40 , R 41 , R 42 , and R 43 each independently represents H, halo, OH, cyano, N3, OP(O)R 47 R 48 , or one or more OP(O)R 47 R 48 or one R 41 and one R 43 However, together with the carbon atoms and Q0 to which they are attached, C4 to C 10 Cycloalkyl, 4-14 membered heterocycloalkyl, C6-C 10 aryl, or 5- to 14-membered heteroaryl, and each of cycloalkyl, heterocycloalkyl, phenyl, or 5- to 6-membered heteroaryl is OH, halo, cyano, N3, oxo, OP(O)R 47 R 48 , optionally substituted with one or more of C1-C6 alkyl, C1-C6 haloalkyl, COOH, C(O)O—C1-C6 alkyl, C1-C6 alkoxyl, C1-C6 haloalkoxyl, amino, mono-C1-C6 alkylamino, and di-C1-C6 alkylamino; R 44 is H, C1-C6 alkyl, or an amine protecting group; R 45 and R 46 each of which is independently H, OP(O)R 47 R 48 , or one or more OP(O)R 47 R 48 C1-C6 alkyl optionally substituted with R 47 and R 48 each is independently H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3-.

[0235] It should be understood that the cap analogs as provided herein may include any of the cap analogs described in International Publication WO2017 / 066797, published April 20, 2017, which is incorporated herein by reference in its entirety.

[0236] In some embodiments, the central position of B2 can be a non-ribose molecule, such as arabinose.

[0237] In some embodiments, R2 is based on ethyl.

[0238] Thus, in some embodiments, the cap has the following structure: [ka] Includes.

[0239] In other embodiments, the cap has the following structure: [ka] Includes.

[0240] In yet other embodiments, the cap has the following structure: [ka] Includes.

[0241] In yet other embodiments, the cap has the following structure: [ka] Includes.

[0242] In some embodiments, R is an alkyl (e.g., a C1-C6 alkyl). In some embodiments, R is a methyl group (e.g., a C1 alkyl). In some embodiments, R is an ethyl group (e.g., a C2 alkyl).

[0243] In some embodiments, the cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA, GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, the cap comprises GAA. In some embodiments, the cap comprises GAC. In some embodiments, the cap comprises GAG. In some embodiments, the cap comprises GAU. In some embodiments, the cap comprises GCA. In some embodiments, the cap comprises GCC. In some embodiments, the cap comprises GCG. In some embodiments, the cap comprises GCU. In some embodiments, the cap comprises GGA. In some embodiments, the cap comprises GGC. In some embodiments, the cap comprises GGG. In some embodiments, the cap comprises GGU. In some embodiments, the cap comprises GUA. In some embodiments, the cap comprises GUC. In some embodiments, the cap comprises GUG. In some embodiments, the cap comprises GUU.

[0244] In some embodiments, the cap comprises a sequence selected from the following sequences: 7 GpppG, m 7 GpppApA, m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 GpppCpA, m 7 GpppCpC, m 7 GpppCpG, m 7 GpppCpU, m 7 GpppGpA, m 7 GpppGpC, m 7 GpppGpG, m 7 GpppGpU, m 7 GpppUpA,m 7 GpppUpC, m 7 GpppUpG, and m 7 GpppUpU.

[0245] In some embodiments, the cap is7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises GpppCpA. 7 In some embodiments, the cap comprises GpppCpC. 7 In some embodiments, the cap comprises GpppCpG. 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises GpppGpC. 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 In some embodiments, the cap comprises m 7 Includes GpppUpU.

[0246] The cap, in some embodiments, comprises a sequence selected from the following sequences: 7 G 3´OMe pppApA, m 7 G 3´OMe pppApC, m 7 G 3´OMe pppApG, m 7 G 3´OMe pppApU, m 7 G 3´OMe pppCpA, m 7 G 3´OMe pppCpC, m 7 G 3´OMe pppCpG, m 7G 3´OMe pppCpU, m 7 G 3´OMe pppGpA, m 7 G 3´OMe pppGpC, m 7 G 3´OMe pppGpG, m 7 G 3´OMe pppGpU,m 7 G 3´OMe pppUpA,m 7 G 3´OMe pppUpC,m 7 G 3´OMe pppUpG, and m 7 G 3´OMe pppUpU.

[0247] In some embodiments, the cap is 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises pppCpU. 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe In some embodiments, the cap comprises pppUpC. 7 G 3´OMe In some embodiments, the cap comprises m 7 G 3´OMe Includes pppUpU.

[0248] The cap, in other embodiments, comprises a sequence selected from the following sequences: 7 G 3´OMe pppA 2´OMe pA, m 7 G 3´OMe pppA 2´OMe pC, m 7 G 3´OMe pppA 2´OMe pG, m 7 G 3´OMe pppA 2´OMe pU, m 7 G 3´OMe pppC 2´OMe pA, m 7 G 3´OMe pppC 2´OMe pC, m 7 G 3´OMe pppC 2´OMe pG, m 7 G 3´OMe pppC 2´OMe pU, m 7 G 3´OMe pppG 2´OMe pA, m 7 G 3´OMe pppG 2´OMe pC, m 7 G 3´OMe pppG 2´OMe pG, m 7 G 3´OMe pppG 2´OMe pU, m 7 G 3´OMe pppU 2´OMe pA, m 7 G 3´OMe pppU 2´OMe pC, m 7G 3´OMe pppU 2´OMe pG, and m 7 G 3´OMe pppU 2´OMe pU 。

[0249] In some embodiments, the cap is 7 G 3´OMe pppA 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppA 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppA 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppA 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppC 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppC 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppC 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppC 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppG 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppG 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppG 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppG 2´OMe In some embodiments, the cap comprises m 7 G3´OMe pppU 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppU 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppU 2´OMe In some embodiments, the cap comprises m 7 G 3´OMe pppU 2´OMe Contains pU.

[0250] The cap, in yet another embodiment, comprises a sequence selected from the following sequences: 7 GpppG 2´OMe , m 7 GpppA 2´OMe pA, m 7 GpppA 2´OMe pC, m 7 GpppA 2´OMe pG, m 7 GpppA 2´OMe pU, m 7 GpppC 2´OMe pA, m 7 GpppC 2´OMe pC, m 7 GpppC 2´OMe pG, m 7 GpppC 2´OMe pU, m 7 GpppG 2´OMe pA, m 7 GpppG 2´OMe pC, m 7 GpppG 2´OMe pG, m 7 GpppG 2´OMe pU, m 7 GpppU 2´OMe pA, m 7 GpppU 2´OMe pC, m 7 GpppU 2´OMe pG, and m 7 GpppU 2´OMe pU.

[0251] In some embodiments, the cap is 7 GpppA 2´OMeIn some embodiments, the cap comprises m 7 GpppA 2´OMe In some embodiments, the cap comprises m 7 GpppA 2´OMe In some embodiments, the cap comprises m 7 GpppA 2´OMe In some embodiments, the cap comprises m 7 GpppC 2´OMe In some embodiments, the cap comprises m 7 GpppC 2´OMe In some embodiments, the cap comprises m 7 GpppC 2´OMe In some embodiments, the cap comprises m 7 GpppC 2´OMe In some embodiments, the cap comprises m 7 GpppG 2´OMe In some embodiments, the cap comprises m 7 GpppG 2´OMe In some embodiments, the cap comprises m 7 GpppG 2´OMe In some embodiments, the cap comprises m 7 GpppG 2´OMe In some embodiments, the cap comprises m 7 GpppU 2´OMe In some embodiments, the cap comprises m 7 GpppU 2´OMe In some embodiments, the cap comprises m 7 GpppU 2´OMe In some embodiments, the cap comprises m 7 GpppU 2´OMe Contains pU.

[0252] In some embodiments, the cap is 7 Gpppm 6 A 2´Ome In some embodiments, the cap comprises m 7 Gpppe6 A 2´Ome Contains pG.

[0253] In some embodiments, the cap comprises GAG. In some embodiments, the cap comprises GCG. In some embodiments, the cap comprises GUG. In some embodiments, the cap comprises GGG.

[0254] In some embodiments, the cap comprises any one of the following structures: [ka]

[0255] In some embodiments, the cap comprises: m7 In some embodiments, the nucleoside bases include GpppN1N2N3, where N1, N2, and N3 are optional (i.e., may be absent, or one or more may be present) and are independently natural, modified, or non-natural nucleoside bases. m7 The G is further methylated, for example, at the 3' position. m7 G comprises an O-methyl at the 3' position. In some embodiments, N1, N2, and N3, if present, are optionally independently adenine, uracil, guanidine, thymine, or cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the 2' position. In some embodiments, one or more (or all) of N1, N2, and N3, if present, have an O-methyl at the 2' position.

[0256] In some embodiments, the cap has the following structure: [ka] Including, wherein B1, B2, and B3 are independently natural, modified, or non-natural nucleoside bases, and R1, R2, R3, and R4 are independently OH or O-methyl. In some embodiments, R3 is O-methyl and R4 is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl.

[0257] In some embodiments, B1, B2, and B3 are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3 is a modified or non-natural base. In some embodiments, at least one of B1, B2, and B3 is N6-methyladenine. In some embodiments, B1 is adenine, cytosine, thymine, or uracil. In some embodiments, B1 is adenine, B2 is uracil, and B3 is adenine. In some embodiments, R1 and R2 are OH, R3 and R4 are O-methyl, B1 is adenine, B2 is uracil, and B3 is adenine.

[0258] In some embodiments, the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments, the cap comprises a sequence selected from the following sequences: GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments, the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments, the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC.

[0259] The cap, in some embodiments, comprises a sequence selected from the following sequences: 7 G 3´OMe pppApApN, m 7 G 3´OMe pppApCpN, m 7 G 3´OMe pppApGpN, m 7 G 3´OMe pppApUpN, m 7 G 3´OMe pppCpApN, m 7 G 3´OMe pppCpCpN, m 7 G 3´OMe pppCpGpN, m 7 G 3´OMe pppCpUpN, m 7 G 3´OMe pppGpApN, m 7 G 3´OMe pppGpCpN, m 7 G 3´OMe pppGpGpN, m 7 G 3´OMe pppGpUpN,m 7 G3´OMe pppUpApN,m 7 G 3´OMe pppUpCpN,m 7 G 3´OMe pppUpGpN, and m 7 G 3´OMe pppUpUpN, where N is a natural, modified, or unnatural nucleoside base.

[0260] The cap, in other embodiments, comprises a sequence selected from the following sequences: 7 G 3´OMe pppA 2´OMe pApN, m 7 G 3´OMe pppA 2´OMe pCpN, m 7 G 3´OMe pppA 2´OMe pGpN, m 7 G 3´OMe pppA 2´OMe pUpN, m 7 G 3´OMe pppC 2´OMe pApN, m 7 G 3´OMe pppC 2´OMe pCpN, m 7 G 3´OMe pppC 2´OMe pGpN, m 7 G 3´OMe pppC 2´OMe pUpN, m 7 G 3´OMe pppG 2´OMe pApN, m 7 G 3´OMe pppG 2´OMe pCpN, m 7 G 3´OMe pppG 2´OMe pGpN, m 7 G 3´OMe pppG 2´OMe pUpN, m 7 G 3´OMe pppU 2´OMe pApN, m 7 G 3´OMe pppU 2´OMe pCpN, m 7 G 3´OMe pppU 2´OMe pGpN, and m 7G 3´OMe pppU 2´OMe pUpN, where N is a natural, modified, or unnatural nucleoside base.

[0261] The cap, in yet another embodiment, comprises a sequence selected from the following sequences: 7 GpppA 2´OMe pApN, m 7 GpppA 2´OMe pCpN, m 7 GpppA 2´OMe pGpN, m 7 GpppA 2´OMe pUpN, m 7 GpppC 2´OMe pApN, m 7 GpppC 2´OMe pCpN, m 7 GpppC 2´OMe pGpN, m 7 GpppC 2´OMe pUpN, m 7 GpppG 2´OMe pApN, m 7 GpppG 2´OMe pCpN, m 7 GpppG 2´OMe pGpN, m 7 GpppG 2´OMe pUpN, m 7 GpppU 2´OMe pApN, m 7 GpppU 2´OMe pCpN, m 7 GpppU 2´OMe pGpN, and m 7 GpppU 2´OMe pUpN, where N is a natural, modified, or unnatural nucleoside base.

[0262] The cap, in other embodiments, comprises a sequence selected from the following sequences: 7 G 3´OMe pppA 2´OMe pA 2´OMe pN, m 7 G 3´OMe pppA 2´OMe PC 2´OMe pN, m 7 G 3´OMe pppA2´OMe p.g. 2´OMe pN, m 7 G 3´OMe pppA 2´OMe pU 2´OMe pN, m 7 G 3´OMe pppC 2´OMe pA 2´OMe pN, m 7 G 3´OMe pppC 2´OMe PC 2´OMe pN, m 7 G 3´OMe pppC 2´OMe p.g. 2´OMe pN, m 7 G 3´OMe pppC 2´OMe pU 2´OMe pN, m 7 G 3´OMe pppG 2´OMe pA 2´OMe pN, m 7 G 3´OMe pppG 2´OMe PC 2´OMe pN, m 7 G 3´OMe pppG 2´OMe p.g. 2´OMe pN, m 7 G 3´OMe pppG 2´OMe pU 2´OMe pN, m 7 G 3´OMe pppU 2´OMe pA 2´OMe pN, m 7 G 3´OMe pppU 2´OMe PC 2´OMe pN, m 7 G 3´OMe pppU 2´OMe p.g. 2´OMe pN, and m 7 G 3´OMe pppU 2´OMe pU 2´OMe pN, where N is a natural, modified, or unnatural nucleoside base.

[0263] The cap, in yet another embodiment, comprises a sequence selected from the following sequences: 7 GpppA 2´OMe pA 2´OMepN, m 7 GpppA 2´OMe PC 2´OMe pN, m 7 GpppA 2´OMe p.g. 2´OMe pN, m 7 GpppA 2´OMe pU 2´OMe pN, m 7 GpppC 2´OMe pA 2´OMe pN, m 7 GpppC 2´OMe PC 2´OMe pN, m 7 GpppC 2´OMe p.g. 2´OMe pN, m 7 GpppC 2´OMe pU 2´OMe pN, m 7 GpppG 2´OMe pA 2´OMe pN, m 7 GpppG 2´OMe PC 2´OMe pN, m 7 GpppG 2´OMe p.g. 2´OMe pN, m 7 GpppG 2´OMe pU 2´OMe pN, m 7 GpppU 2´OMe pA 2´OMe pN, m 7 GpppU 2´OMe PC 2´OMe pN, m 7 GpppU 2´OMe p.g. 2´OMe pN, and m 7 GpppU 2´OMe pU 2´OMe pN, where N is a natural, modified, or unnatural nucleoside base.

[0264] In some embodiments, the cap comprises GGAG. In some embodiments, the cap has the following structure: [ka] Includes.

[0265] 5. Termination element The translation stop codons UAA, UAG, and UGA are essential components of the genetic code and signal the end of mRNA translation. During protein synthesis, stop codons interact with protein release factors, and this interaction can regulate ribosomal activity, thus affecting translation (Tate WP, et al., (2018) Biochem Soc Trans, 46(6):1615-162).

[0266] Disclosed herein, inter alia, are polynucleotides encoding polypeptides, the polynucleotides having a coding region comprising a termination element that confers increased half-life, increased expression, and / or increased activity of the polypeptide encoded by the polynucleotide or of the polynucleotide itself. In one embodiment, the polynucleotide comprises, and an LNP composition comprises, (a) a 5' UTR (e.g., as described herein), (b) a coding region comprising a termination element (e.g., as described herein), and (c) a 3' UTR (e.g., as described herein). In one embodiment, the polynucleotide comprises a coding region comprising a termination element as shown in Table 4.

[0267] As used herein, a stop element refers to a nucleic acid sequence that includes a stop codon. The stop codon may be selected from TGA, TAA, and TAG in the case of DNA, or from UGA, UAA, and UAG in the case of RNA. In one embodiment, the stop element includes two consecutive stop codons. In one embodiment, the stop element includes three consecutive stop codons. In one embodiment, the stop element includes four consecutive stop codons. In one embodiment, the stop element includes five consecutive stop codons.

[0268] In one embodiment, the stop element comprises a plurality of identical stop codons. In one embodiment, the stop element comprises a plurality of different stop codons.

[0269] In one embodiment, the stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides upstream and / or downstream of the one or more stop codons. In one embodiment, the stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides upstream of the one or more stop codons. In one embodiment, the stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides downstream of the one or more stop codons.

[0270] The present invention also includes polynucleotides that contain both a stop codon element and a polynucleotide described herein. In some embodiments, the stop codon element comprises a stop codon region. In some embodiments, the coding region of the polynucleotide comprises the stop element. In some embodiments, the stop element is upstream (e.g., before) the 3' UTR sequence of the polynucleotide.

[0271] In some embodiments, polynucleotides of the invention may contain at least two stop codons before the 3' untranslated region (UTR). The stop codons may be selected from TGA, TAA, and TAG in the case of DNA, or from UGA, UAA, and UAG in the case of RNA. In some embodiments, polynucleotides of the invention contain the stop codon TGA in the case of DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In further embodiments, the additional stop codon may be TAA or UAA. In another embodiment, polynucleotides of the invention contain three consecutive stop codons, four stop codons, or more.

[0272] It has been observed that termination elements containing the sequences shown in Table 4 may increase the half-life of the polynucleotide and / or may increase the level or activity of the polypeptide encoded by the polynucleotide.

[0273] In one embodiment, a polynucleotide having a termination element as shown in Table 4 increases the half-life of the polynucleotide or increases the level and / or activity (e.g., production) of the polypeptide encoded by the polynucleotide. In one embodiment, the increase in half-life is about 1.5-20 fold. In one embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or more. In one embodiment, the increase in half-life is about 1.5-fold or more. In one embodiment, the increase in half-life is about 2-fold or more. In one embodiment, the increase in half-life is about 3-fold or more. In one embodiment, the increase in half-life is about 4-fold or more. In one embodiment, the increase in half-life is about 5-fold or more.

[0274] In one embodiment, a polynucleotide having a termination element as shown in Table 4 increases the level and / or activity (e.g., production or duration of expression) of a polypeptide encoded by the polynucleotide. In one embodiment, the termination element increases the level and / or activity (e.g., detectable level or activity) of a polypeptide encoded by the polynucleotide by about 1.5-20 fold for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days. In one embodiment, the termination element allows the level or activity of a polypeptide encoded by the polynucleotide to be detectable for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days.

[0275] In one embodiment, the increase in activity is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-fold or more. In one embodiment, the increase in activity is about 1.5-fold or more. In one embodiment, the increase in activity is about 2-fold or more. In one embodiment, the increase in activity is about 3-fold or more. In one embodiment, the increase in activity is about 4-fold or more. In one embodiment, the increase in activity is about 5-fold or more.

[0276] In one embodiment, the increase is compared to other similar polynucleotides that do not have a termination element, have a different termination element, or do not have a termination element shown in Table 4.

[0277] In one embodiment, the stop element comprises a sequence shown in Table 4. In one embodiment, the stop element comprises the sequence of SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167 or SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:173 or SEQ ID NO:174. In one embodiment, the stop element comprises the sequence of SEQ ID NO:158. In one embodiment, the stop element comprises the sequence of SEQ ID NO:159. In one embodiment, the stop element comprises the sequence of SEQ ID NO:160. In one embodiment, the stop element comprises the sequence of SEQ ID NO:161. In one embodiment, the stop element comprises the sequence of SEQ ID NO:162. In one embodiment, the stop element comprises the sequence of SEQ ID NO:163. In one embodiment, the stop element comprises the sequence of SEQ ID NO:164. In one embodiment, the stop element comprises the sequence of SEQ ID NO:165. In one embodiment, the stop element comprises the sequence of SEQ ID NO:166. In one embodiment, the stop element comprises the sequence of SEQ ID NO: 167. In one embodiment, the stop element comprises the sequence of SEQ ID NO: 168. In one embodiment, the stop element comprises the sequence of SEQ ID NO: 169. In one embodiment, the stop element comprises the sequence of SEQ ID NO: 173. In one embodiment, the stop element comprises the sequence of SEQ ID NO: 174.

[0278] In some embodiments, the polynucleotide comprises a kappa termination cassette (i.e., UAAAGCUCCCCGGGG (SEQ ID NO: 165) or an iota termination cassette (i.e., UAAGCCCCUCCGGGG (SEQ ID NO: 164)).

[0279] In one embodiment, the coding region of (b) has formula B: X -3 -X -2 -X -1-UAA-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 170) (In the formula, X1 is G or A; X2, X4, X5, X6 or X7 are each independently C or U; X3 is C or A; X8, X 10 , X 11 , X 12 , X -1 or X -3 are each independently C or G; X9 is G or U, and / or X -2 is A or U) The stop element contains the consensus sequence:

[0280] In one embodiment, X1 is G. In one embodiment, X1 is A.

[0281] In one embodiment, X2 is C. In one embodiment, X2 is U.

[0282] In one embodiment, X4 is C. In one embodiment, X4 is U.

[0283] In one embodiment, X5 is C. In one embodiment, X5 is U.

[0284] In one embodiment, X6 is C. In one embodiment, X6 is U.

[0285] In one embodiment, X7 is C. In one embodiment, X7 is U.

[0286] In one embodiment, X3 is C. In one embodiment, X3 is A.

[0287] In one embodiment, X8 is C. In one embodiment, X8 is G.

[0288] In one embodiment, X 10 is C. In one embodiment, X 10 is G.

[0289] In one embodiment, X 11 is C. In one embodiment, X 11 is G.

[0290] In one embodiment, X 12 is C. In one embodiment, X 12 is G.

[0291] In one embodiment, X -1 is C. In one embodiment, X -1 is G.

[0292] In one embodiment, X -3 is C. In one embodiment, X -3 is G.

[0293] In one embodiment, X9 is G. In one embodiment, X9 is U.

[0294] In one embodiment, X -2 is A. In one embodiment, X -2 is U.

[0295] In one embodiment, the consensus sequence of Formula B (SEQ ID NO: 170) has a high GC content (e.g., a GC content of about 50%, 60%, 70%, 80%, 90%, or 99%). In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%.

[0296] In one embodiment, the coding region of (b) has formula C: X -3 -X -2 -X -1 -UGA-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 171) (In the formula, X -3 , X -1 , X2, X5, X6, X7, X8, X9, or X 12 are each independently G or C; X -2 , X3, or X4 are each independently A or C; X1 is A or G, and / or X 10 or X 11 are each independently C or U. The stop element contains the consensus sequence:

[0297] In one embodiment, X -3 is G. In one embodiment, X -3 is C.

[0298] In one embodiment, X -1 is G. In one embodiment, X -1 is C.

[0299] In one embodiment, X2 is G. In one embodiment, X2 is C.

[0300] In one embodiment, X5 is G. In one embodiment, X5 is C.

[0301] In one embodiment, X6 is G. In one embodiment, X6 is C.

[0302] In one embodiment, X7 is G. In one embodiment, X7 is C.

[0303] In one embodiment, X8 is G. In one embodiment, X8 is C.

[0304] In one embodiment, X9 is G. In one embodiment, X9 is C.

[0305] In one embodiment, X 12 is G. In one embodiment, X 12 is C.

[0306] In one embodiment, X -2 is A. In one embodiment, X -2 is C.

[0307] In one embodiment, X3 is A. In one embodiment, X3 is C.

[0308] In one embodiment, X4 is A. In one embodiment, X4 is C.

[0309] In one embodiment, X1 is A. In one embodiment, X1 is G.

[0310] In one embodiment, X 10 is C. In one embodiment, X 10 is U.

[0311] In one embodiment, X 11 is C. In one embodiment, X 11 is U.

[0312] In one embodiment, the consensus sequence of Formula C (SEQ ID NO: 171) has a high GC content (e.g., a GC content of about 50%, 60%, 70%, 80%, 90%, or 99%). In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%.

[0313] In one embodiment, the coding region of (b) has formula D: X -3 -X -2 -X -1 -UAG-X1-X2-X3-X4-X5-X6-X7-X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 172) (In the formula, X -3 , X -1 , X2, X3, X 10 are each independently G or C; X -2 or X9 is independently A or U; X1 or X4 are each independently A or G; X5 or X8 are each independently A or C; and / or X6, X7, X 11 or X 12 are each independently C or U. The stop element contains the consensus sequence:

[0314] In one embodiment, X -3 is G. In one embodiment, X -3 is C.

[0315] In one embodiment, X -1 is G. In one embodiment, X -1 is C.

[0316] In one embodiment, X2 is G. In one embodiment, X2 is C.

[0317] In one embodiment, X3 is G. In one embodiment, X3 is C.

[0318] In one embodiment, X 10 is G. In one embodiment, X 10 is C.

[0319] In one embodiment, X-2 is A. In one embodiment, X -2 is U.

[0320] In one embodiment, X9 is A. In one embodiment, X9 is U.

[0321] In one embodiment, X1 is A. In one embodiment, X1 is G.

[0322] In one embodiment, X4 is A. In one embodiment, X4 is G.

[0323] In one embodiment, X5 is A. In one embodiment, X5 is C.

[0324] In one embodiment, X8 is A. In one embodiment, X8 is C.

[0325] In one embodiment, X6 is C. In one embodiment, X6 is U.

[0326] In one embodiment, X7 is C. In one embodiment, X7 is U.

[0327] In one embodiment, X 11 is C. In one embodiment, X 11 is U.

[0328] In one embodiment, X 12 is C. In one embodiment, X 12 is U.

[0329] In one embodiment, the consensus sequence of Formula D (SEQ ID NO: 172) has a high GC content (e.g., a GC content of about 50%, 60%, 70%, 80%, 90%, or 99%). In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%. [Table 4-1] [Table 4-2]

[0330] In one aspect, disclosed herein is a polynucleotide encoding a polypeptide, the polynucleotide comprising: (a) a 5' UTR (e.g., as described herein), (b) a coding region comprising a termination element (e.g., as shown in Table 4), and (c) a 3' UTR (e.g., as described herein).

[0331] 6. Poly A tail In some embodiments, the polynucleotides of the present disclosure further comprise a poly-A tail. In further embodiments, terminal groups may be incorporated into the poly-A tail for stabilization. In other embodiments, the poly-A tail comprises a des-3' hydroxyl tail.

[0332] To enhance stability, long chains of adenine nucleotides (poly-A tails) can be added to polynucleotides, such as mRNA molecules, during RNA processing. Immediately after transcription, the 3' end of the transcript can be cleaved, freeing a 3' hydroxyl. Poly-A polymerase then adds chains of adenine nucleotides to the RNA. This process, called polyadenylation, adds a poly-A tail that can be approximately 80 to approximately 250 residues in length, including, for example, approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues in length. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO: 121). aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa (Sequence number 121)

[0333] A polyA tail can also be added after the construct has been exported from the nucleus.

[0334] According to the present invention, terminal groups can be incorporated into the polyA tail for stabilization. The polynucleotides of the present invention can include des-3' hydroxyl tails. They can also include structural moieties or 2'-O methyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety).

[0335] Polynucleotides of the invention can be designed to encode transcripts with alternative poly(A) tail structures, including histone mRNAs. According to Norbury, "terminal uridylation has also been detected on human replication-dependent histone mRNAs. The turnover of these mRNAs is thought to be important for preventing potentially toxic histone accumulation after the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by the lack of a 3' poly(A) tail; their function is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP), which performs the same function as PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online August 29, 2013; doi:10.1038 / nrm3645), the contents of which are incorporated herein by reference in their entirety.

[0336] The unique poly-A tail length provides certain advantages to the polynucleotides of the present invention. Generally, the length of the poly-A tail, if present, is greater than 30 nucleotides. In another embodiment, the length of the poly-A tail is greater than 35 nucleotides (e.g., at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides or more).

[0337] In some embodiments, the polynucleotide or region thereof is from about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 10 These ranges include: 0-1,500, 100-2,000, 100-2,500, 100-3,000, 500-750, 500-1,000, 500-1,500, 500-2,000, 500-2,500, 500-3,000, 1,000-1,500, 1,000-2,000, 1,000-2,500, 1,000-3,000, 1,500-2,000, 1,500-2,500, 1,500-3,000, 2,000-3,000, 2,000-2,500, and 2,500-3,000.

[0338] In some embodiments, the polyA tail is designed relative to the length of the entire polynucleotide or the length of a particular region of the polynucleotide, which may be based on the length of the coding region, the length of a particular feature or region, or based on the length of the final product expressed from the polynucleotide.

[0339] In this context, the polyA tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer in length than the polynucleotide or feature thereof. The polyA tail may also be designed as part of the polynucleotide to which it belongs. In this context, the polyA tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a region of the construct, or the total length of the construct minus the polyA tail. Furthermore, engineered binding sites for polyA binding proteins and binding of the polynucleotide may enhance expression.

[0340] Alternatively, multiple different polynucleotides can be linked together via PABP (poly-A binding protein) through their 3'-ends using modified nucleotides at the 3'-end of the poly-A tail. Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection.

[0341] In some embodiments, polynucleotides of the invention are designed to contain a poly-AG quartet region. A G-quartet is a cyclic, hydrogen-bonded arrangement of four guanine nucleotides and can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of a poly-A tail. The resulting polynucleotides are assayed at various time points for stability, protein production, and other parameters, including half-life. Poly-AG quartets have been found to result in protein production from mRNA that is at least 75% of the protein production seen when a 120-nucleotide poly-A tail (SEQ ID NO: 51) is used alone. aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa (SEQ ID NO. 51)

[0342] In some embodiments, the poly A tail is a mixed poly A tail punctuated with non-adenosine residues (e.g., guanosine). In some embodiments, the poly A tail is guanylated. Without wishing to be bound by theory, it is believed that in some embodiments, a mixed poly A tail may protect the mRNA from rapid deadenylation.

[0343] In some embodiments, the poly-A tail comprises one or more non-adenosine residues. In some embodiments, the non-adenosine residue is guanosine. In some embodiments, the poly-A tail comprises 1 to 20 (e.g., 1 to 15, 1 to 10, 1 to 5, 15 to 20, 10 to 20, 5 to 20, 2 to 15, 5 to 10, 1 to 5, 2 to 10, or 5 to 15) non-adenosine residues (e.g., guanosine). For example, the poly-A tail can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more non-adenosine residues (e.g., guanosine). In some embodiments, at least 1% (e.g., at least 2%, 5%, 10%, 15%, 20%, or 25%) of the residues in the poly-A tail are non-adenosine residues (e.g., guanosine). In some embodiments, the poly-A tail is guanylated (e.g., comprises one or more guanosine residues).

[0344] In one embodiment, the polyA tail containing one or more non-adenosine residues is chemically synthesized.

[0345] In one embodiment, the 3' UTR comprises a TENT recruitment sequence (e.g., as described herein) that recruits one or more terminal nucleotidyl transferases (TENTs) to a polynucleotide comprising the 3' UTR. In one embodiment, the TENT is TENT4 (e.g., TENT4A and / or TENT4B). Without wishing to be bound by theory, it is believed that in some embodiments, one or more TENTs (e.g., TENT4A and / or TENT4B) generate a mixed polyA tail with intermittent non-adenosine residues (e.g., guanosine), protecting the mRNA from rapid deadenylation.

[0346] Exemplary TENT recruiting sequences include: CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG (SEQ ID NO: 91) and CCACCCCAGCGCCACCACCGCUGCCGUCGCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGAACGGGUCGGCGGCCGGUCGGCUUCUGUUUUA (SEQ ID NO: 92) These include, but are not limited to:

[0347] In one embodiment, the TENT recruit sequence comprises the nucleotide sequence of SEQ ID NO:91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the TENT recruit sequence comprises the nucleotide sequence of SEQ ID NO:91.

[0348] In one embodiment, the TENT recruit sequence comprises the nucleotide sequence of SEQ ID NO:92, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In one embodiment, the TENT recruit sequence comprises the nucleotide sequence of SEQ ID NO:92.

[0349] In one embodiment, the 3'UTR comprises one or more (e.g., 2, 3, 4, 5, or more) TENT recruitment sequences (e.g., one or more TENT recruitment sequences described herein). In one embodiment, the 3'UTR comprises one TENT recruitment sequence. In one embodiment, the 3'UTR comprises two TENT recruitment sequences. In one embodiment, the 3'UTR comprises three TENT recruitment sequences. In one embodiment, the 3'UTR comprises four TENT recruitment sequences. In one embodiment, the 3'UTR comprises five TENT recruitment sequences. For example, the multiple TENT recruitment sequences in a 3'UTR can be identical or different.

[0350] In one embodiment, the 3' UTR comprises a TENT recruit sequence comprising the nucleotide sequence of SEQ ID NO:91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3' UTR comprises a TENT recruit sequence comprising the nucleotide sequence of SEQ ID NO:91.

[0351] In one embodiment, the 3' UTR comprises one or more (e.g., 2, 3, 4, 5, or more) TENT recruit sequences comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3' UTR comprises one TENT recruit sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3' UTR comprises two TENT recruit sequences each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3' UTR comprises three TENT recruit sequences each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3'UTR comprises four TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.In one embodiment, the 3'UTR comprises five TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0352] In one embodiment, the 3' UTR comprises one or more (e.g., 2, 3, 4, 5, or more) TENT recruit sequences comprising the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3' UTR comprises two TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3' UTR comprises three TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3' UTR comprises four TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3' UTR comprises five TENT recruit sequences, each comprising the nucleotide sequence of SEQ ID NO: 91.

[0353] 7. Additional 3´UTR Elements A) Discrimination and Ratio Determination (IDR) A discrimination and ratio determining (IDR) sequence is a sequence of a biomolecule (e.g., a nucleic acid or a protein) that, when combined with the sequence of a target biomolecule, serves to identify the target biomolecule. Typically, the IDR sequence is a heterologous sequence that is incorporated within or added to the sequence of the target biomolecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., an mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein), and (ii) a unique IDR sequence.

[0354] An RNA species (e.g., an RNA having a given coding sequence) may contain IDR sequences that differ from the IDR sequences of other RNA species (e.g., RNA(s) having different coding sequence(s)). Thus, because each IDR sequence distinguishes a particular RNA species, the abundance of the IDR sequences can be measured to determine the abundance of each RNA species in a composition. The use of different IDR sequences to distinguish RNA species enables the analysis of polyvalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths that may otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNA.

[0355] Each RNA species in a multivalent RNA composition can contain an IDR sequence that is not a sequence isomer of the IDR sequence of another RNA species in the multivalent RNA composition (e.g., an IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, making it challenging to distinguish between sequence isomers using mass-based discrimination methods (e.g., mass spectrometry).

[0356] Each RNA species in the multivalent RNA composition can comprise an IDR sequence with a mass that is different from the mass of the IDR sequence of each other RNA species in the multivalent RNA composition.For example, the mass of each IDR sequence can be different from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da.Using IDR sequences with different masses makes it possible to distinguish the RNA fragments that contain different IDR sequences using mass-based analysis methods (such as mass spectrometry) that do not require reverse transcription, amplification, or sequencing of RNA.

[0357] Each RNA species in an RNA composition can contain IDR sequences of different lengths. For example, each IDR sequence can have a length independently selected from 0 to 25 nucleotides. Because nucleic acid length affects the rate at which a nucleic acid passes through a chromatography column, using IDR sequences of different lengths for different RNA species allows for the use of chromatography-based methods (e.g., LC-UV) to distinguish between RNA fragments with different IDR sequences.

[0358] The IDR sequences may be selected so that there are no IDR sequences containing the start codon "AUG." The lack of a start codon in the IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence.

[0359] The IDR sequences can be selected so that there are no IDR sequences containing restriction enzyme recognition sites. In one example, there are no IDR sequences containing the XbaI recognition site "UCUAG." The lack of restriction enzyme recognition sites (e.g., the XbaI recognition site "UCUAG") allows restriction enzymes to be used to generate and modify DNA templates for in vitro transcription without affecting the IDR sequences or the sequence of the transcribed RNA.

[0360] B) FUT8 In some embodiments, the 3'UTR comprises a FUT8 sequence. For example, the FUT8 sequence comprises the following sequence: CUGAGAGACCUGUGUGAACUAUUGAGAAGAUCGGAACAGCUCCUUACUCUGAGGAAGUUG SEQ ID NO: 93. In one embodiment, the 3' UTR comprises a FUT8 sequence comprising the nucleotide sequence of SEQ ID NO: 93, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the FUT8 sequence may be combined with any of the miRNA binding sites described herein that are present in the 3' UTR.

[0361] C) Ribosome Association Detection Assay (REDA) REDA can be used to assess the efficacy and effectiveness of intracellular lipid nanoparticle-nucleic acid uptake and translation of the produced nucleic acid mRNA. The assay incorporates some aspects of the Ribosome Association Detection Assay (REDA) to measure mRNA bound to ribosomes during the translation step in cells. The assay does not require actual protein expression, but rather indicates the effectiveness of nucleic acids such as mRNA in intracellular protein production by demonstrating effective mRNA uptake and association with ribosomes, and therefore effective intracellular translation.

[0362] Thus, in some embodiments, any of the 3'UTR sequences described herein comprise a sequence that can be detected by qPCR in REDA.

[0363] An RNA species (e.g., an RNA having a given coding sequence) can contain a REDA sequence that differs from the REDA sequences of other RNA species (e.g., RNA(s) having different coding sequence(s)). Thus, because each REDA sequence identifies a particular RNA species, the abundance of the REDA sequences can be measured to determine the abundance of each RNA species in a composition. The use of different REDA sequences to distinguish RNA species enables the analysis of polyvalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths that may otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNA.

[0364] Each RNA species in a multivalent RNA composition can contain an REDA sequence that is not a sequence isomer of the REDA sequence of another RNA species in the multivalent RNA composition (e.g., an IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides as another REDA sequence in the composition, even if those sequences have different sequences). Having identical nucleotide composition causes sequence isomers to have the same mass, making it challenging to distinguish between sequence isomers using mass-based discrimination methods (e.g., mass spectrometry).

[0365] Each RNA species in the multivalent RNA composition can comprise a REDA sequence with a mass that is different from the mass of the REDA sequence of each other RNA species in the multivalent RNA composition.For example, the mass of each REDA sequence can be different from the mass of other REDA sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da.Using REDA sequences with different masses makes it possible to distinguish the RNA fragments that contain different IDR sequences using mass-based analysis methods (such as mass spectrometry) that do not require reverse transcription, amplification, or sequencing of RNA.

[0366] Each RNA species in an RNA composition can contain a different length of IDR sequence. For example, each IDR sequence can have a length independently selected from 0 to 25 nucleotides. Because nucleic acid length affects the rate at which a nucleic acid passes through a chromatography column, using different lengths of IDR sequences for different RNA species allows for the use of chromatography-based methods (e.g., LC-UV) to distinguish between RNA fragments with different IDR sequences.

[0367] The REDA sequence may be selected so that there is no REDA sequence containing the start codon "AUG." The lack of a start codon in the IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the REDA sequence.

[0368] The REDA sequence can be selected so that there are no REDA sequences containing restriction enzyme recognition sites. In one example, there are no REDA sequences containing the XbaI recognition site "UCUAG." The lack of a restriction enzyme recognition site (e.g., the XbaI recognition site "UCUAG") allows the use of restriction enzymes to generate and modify DNA templates for in vitro transcription without affecting the IDR sequence or the sequence of the transcribed RNA.

[0369] 8. Start codon region The present invention also includes polynucleotides that contain both a start codon region and a polynucleotide described herein. In some embodiments, polynucleotides of the present invention may have a region that is similar to or functions like a start codon region.

[0370] In some embodiments, translation of a polynucleotide may initiate at a codon other than the AUG start codon. Translation of a polynucleotide may initiate at alternative start codons, including, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, and TTG / UUG (see Touriol et al., Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro, PLoS ONE, 2010 5:11, the contents of each of which are incorporated herein by reference in their entirety).

[0371] As a non-limiting example, polynucleotide translation may begin at the alternative start codon ACG. As another non-limiting example, polynucleotide translation may begin at the alternative start codon CTG or CUG. As yet another non-limiting example, polynucleotide translation may begin at the alternative start codon GTG or GUG.

[0372] Nucleotides adjacent to a codon that initiates translation (such as, but not limited to, an initiation codon or an alternative initiation codon) are known to affect the translation efficiency, length, and / or structure of a polynucleotide (see, e.g., Matsuda and Mauro PLoS ONE, 2010 5:11, the contents of which are incorporated herein by reference in their entirety). Masking any of the nucleotides adjacent to a codon that initiates translation can be used to alter the translation initiation position, translation efficiency, length, and / or structure of a polynucleotide.

[0373] In some embodiments, a masking agent may be used near the start codon or alternative start codon to mask or conceal the codon to reduce the likelihood of translation initiation at the masked or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acid (LNA) polynucleotides and exon-junction complexes (EJCs) (see, e.g., Matsuda and Mauro (PLoS ONE, 2010 5:11), which describes masking agent LNA polynucleotides and EJCs, the contents of which are incorporated herein by reference in their entirety).

[0374] In another embodiment, a masking agent may be used to mask the start codon of a polynucleotide to increase the likelihood that translation will initiate at an alternative start codon, hi some embodiments, a masking agent may be used to mask the initial start codon or alternative start codon to increase the likelihood that translation will initiate on a start codon or alternative start codon downstream of the masked start codon or alternative start codon.

[0375] In some embodiments, the start codon or alternative start codon can be located within the full complement of the miRNA binding site. The full complement of the miRNA binding site can help control the translation, length, and / or structure of the polynucleotide, similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the center of the full complement of the miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide, or twenty-first nucleotide.

[0376] In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence to cause translation of the polynucleotide to begin at a codon other than the start codon. Translation of the polynucleotide can begin at the codon after the removed start codon or at a downstream start codon or alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first three nucleotides of the polynucleotide sequence to cause translation to begin at the downstream start codon or alternative start codon. A polynucleotide sequence from which the start codon has been removed can further include at least one masking agent for the downstream start codon and / or alternative start codon to control or attempt to control translation initiation, the length of the polynucleotide, and / or the structure of the polynucleotide.

[0377] 9. Combination of mRNA elements Any of the polynucleotides disclosed herein can include one, two, three, or all of the following elements: a 5' UTR (e.g., as described herein), a coding region, a termination element plus a 3' UTR (e.g., as described herein), and optionally a 3' stabilizing region (e.g., as described herein). Also disclosed herein are LNP compositions comprising them.

[0378] In one embodiment, a polynucleotide of the disclosure comprises a 5' UTR or a variant or fragment thereof set forth in Table 1 and a termination element plus a 3' UTR or a variant or fragment thereof comprising the sequence of SEQ ID NO: 139. In one embodiment, the polynucleotide further comprises a cap structure (e.g., as described herein) or a polyA tail (e.g., as described herein). In one embodiment, the polynucleotide further comprises a 3' stabilizing region (e.g., as described herein).

[0379] In one embodiment, a polynucleotide of the disclosure comprises a 5' UTR comprising the sequence of SEQ ID NO: 50, or a variant or fragment thereof, and a termination element plus a 3' UTR comprising the sequence of SEQ ID NO: 139, or a variant or fragment thereof. In one embodiment, the polynucleotide further comprises a cap structure (e.g., as described herein) or a polyA tail (e.g., as described herein). In one embodiment, the polynucleotide further comprises a 3' stabilizing region (e.g., as described herein).

[0380] In one embodiment, a polynucleotide of the disclosure comprises a 5' UTR comprising the sequence of SEQ ID NO: 56, or a variant or fragment thereof, and a termination element plus a 3' UTR comprising the sequence of SEQ ID NO: 139, or a variant or fragment thereof. In one embodiment, the polynucleotide further comprises a cap structure (e.g., as described herein) or a polyA tail (e.g., as described herein). In one embodiment, the polynucleotide further comprises a 3' stabilizing region (e.g., as described herein).

[0381] In some embodiments, the 5' UTR is SEQ ID NO: 50 and the 3' UTR is SEQ ID NO: 139 or SEQ ID NO: 144. For example, the 5' UTR is SEQ ID NO: 50 and the 3' UTR is SEQ ID NO: 139, or the 5' UTR is SEQ ID NO: 50 and the 3' UTR is SEQ ID NO: 144. In one embodiment, the polynucleotide further comprises a cap structure (e.g., as described herein) or a polyA tail (e.g., as described herein). In one embodiment, the polynucleotide further comprises a 3' stabilizing region (e.g., as described herein).

[0382] In some embodiments, any one or more of the miRNA binding site sequences selected from Table 3 may be combined with any one of the termination cassettes shown in Table 4. Additionally, in some embodiments, a TENT recruit sequence may be combined with any one or more of the miRNA binding site sequences selected from Table 3 and any one of the termination cassettes shown in Table 4. Furthermore, in some embodiments, a FUT8 sequence may be combined with any one or more of the miRNA binding site sequences selected from Table 3 and any one of the termination cassettes shown in Table 4.

[0383] 10. Therapeutic or prophylactic payloads Disclosed herein, inter alia, are polynucleotides having a coding region comprising a 5' UTR described herein, a 3' UTR described herein, and / or a termination element, wherein the coding region further comprises a sequence encoding a payload (e.g., a therapeutic or prophylactic payload). In one embodiment, the coding region encodes one payload. In one embodiment, the coding region encodes two or more payloads (e.g., two, three, four, five, six, or more payloads, e.g., the same or different payloads). In one embodiment, the sequences encoding each payload are contiguous within the polynucleotide. In one embodiment, the sequences encoding each payload are separated by at least 1-1000 nucleotides. In some embodiments, the therapeutic or prophylactic payload is comprised of an mRNA encoding a secreted, membrane-bound, or intracellular protein, or a peptide, polypeptide, or biologically active fragment thereof.

[0384] Also disclosed herein are LNPs comprising a polynucleotide comprising a coding region that encodes a payload (e.g., a therapeutic or prophylactic payload). In some embodiments, the therapeutic or prophylactic payload is comprised of an mRNA that encodes a secreted, membrane-bound, or intracellular protein, or a peptide, polypeptide, or biologically active fragment thereof.

[0385] In some embodiments, the therapeutic or prophylactic payload is comprised of an mRNA encoding a secreted protein, or a peptide, polypeptide, or biologically active fragment thereof. In some embodiments, the secreted protein includes a cytokine, or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes an antibody, or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes an enzyme, or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes a hormone, or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes a ligand, or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes a vaccine (e.g., an antigen, immunogenic epitope), or a component, variant, or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the vaccine is a prophylactic vaccine. In some embodiments, the vaccine is a therapeutic vaccine (e.g., a cancer vaccine). In some embodiments, the secreted protein includes a growth factor, or a component, variant, or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the secreted protein includes an immune modulator (e.g., an immune checkpoint agonist or antagonist).

[0386] In some embodiments, the therapeutic or prophylactic payload is comprised of an mRNA encoding a membrane-bound protein, or a peptide, polypeptide, or biologically active fragment thereof. In some embodiments, the membrane-bound protein includes a vaccine (e.g., an antigen, immunogenic epitope), or a component, variant, or fragment (e.g., biologically active fragment) thereof. In some embodiments, the vaccine is a prophylactic vaccine. In some embodiments, the vaccine is a therapeutic vaccine (e.g., a cancer vaccine). In some embodiments, the membrane-bound protein includes a ligand, a variant, or fragment (e.g., biologically active fragment) thereof. In some embodiments, the membrane-bound protein includes a membrane transporter, a variant, or fragment (e.g., biologically active fragment) thereof. In some embodiments, the membrane-bound protein includes a structural protein, a variant, or fragment (e.g., biologically active fragment) thereof. In some embodiments, the membrane-bound protein includes an immunomodulator (e.g., an immune checkpoint agonist or antagonist).

[0387] In some embodiments, the therapeutic or prophylactic payload is comprised of an mRNA encoding an intracellular protein, or a peptide, polypeptide, or biologically active fragment thereof. In some embodiments, the intracellular protein includes an enzyme or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the intracellular protein includes a transcription factor or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the intracellular protein includes a nuclease or a variant or fragment (e.g., a biologically active fragment) thereof. In some embodiments, the intracellular protein includes a structural protein or a variant or fragment (e.g., a biologically active fragment) thereof.

[0388] In some embodiments, the therapeutic or prophylactic payload is selected from a cytokine, an antibody, a vaccine (e.g., an antigen, an immunogenic epitope), a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, a growth factor, an immunomodulator, or a component, variant, or fragment (e.g., a biologically active fragment) thereof.

[0389] In some embodiments, the therapeutic or prophylactic payload comprises a protein or peptide.

[0390] It will be understood that the regulatory elements disclosed herein (e.g., 5' UTRs, termination elements, 3' UTRs, stabilizing regions (e.g., idT or modified polyA tails)) can be used in conjunction with the ORFs encoding the payloads described herein. It will further be understood that the regulatory elements disclosed herein can be used in a modular manner, i.e., in mRNA constructs combined with other regulatory elements in the art (e.g., 5' UTRs of the present invention combined with ORFs and other regulatory regions in the art), or in combination with other regulatory elements disclosed herein (e.g., 5' UTRs of the present invention combined with 3' UTRs of the present invention, etc.). It will further be understood that the termination elements of the present invention can be used in conjunction with a desired ORF that lacks a stop codon. It will also be understood that if the desired ORF includes a stop codon, the final construct will not include an additional stop codon or termination element. In some embodiments, the stop codon of the desired ORF can be replaced with a stop element described herein.

[0391] 11. Methods for producing polynucleotides The present disclosure also provides methods of making the polynucleotides disclosed herein or their complements. In some aspects, the polynucleotides (e.g., mRNA) disclosed herein can be constructed using in vitro transcription.

[0392] In other aspects, the polynucleotides (e.g., mRNA) disclosed herein can be constructed by chemical synthesis using oligonucleotide synthesis. In other aspects, the polynucleotides (e.g., mRNA) disclosed herein are produced by using host cells. In certain aspects, the polynucleotides (e.g., mRNA) disclosed herein are produced by a combination of one or more of IVT, chemical synthesis, host cell expression, or any other method known in the art.

[0393] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof can be fully or partially substituted for the natural nucleosides present in a candidate nucleotide sequence and incorporated into sequence-optimized nucleotide sequences (e.g., mRNAs) encoding therapeutic or prophylactic payloads. The resulting mRNAs can then be tested for their ability to produce proteins and / or their ability to produce a therapeutic outcome.

[0394] While RNA can be made synthetically using methods well known in the art, in one embodiment, an RNA transcript (e.g., an mRNA transcript) is synthesized by contacting a DNA template with an RNA polymerase (e.g., T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of the RNA transcript.

[0395] In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, the methods comprising contacting a DNA template with an RNA polymerase (e.g., T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and a buffer under conditions that result in the production of an RNA transcript.

[0396] Another aspect of the present disclosure provides a capping method, such as a co-transcriptional capping method or other methods known in the art. In one embodiment, the capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce an RNA transcript.

[0397] IVT conditions typically require a purified linear DNA template containing a promoter, a buffer system containing nucleoside triphosphates, dithiothreitol (DTT) and magnesium ions, and an RNA polymerase. The exact conditions used for the transcription reaction depend on the amount of RNA required for a particular application. A typical IVT reaction is performed by incubating a DNA template with RNA polymerase and nucleoside triphosphates (including GTP, ATP, CTP, and UTP (or nucleotide analogs)) in a transcription buffer. RNA transcripts with 5'-terminal guanosine triphosphates result from this reaction.

[0398] Deoxyribonucleic acid (DNA) is simply a nucleic acid template for an RNA polymerase. The DNA template can include a polynucleotide encoding a polypeptide of interest (e.g., an antigenic polypeptide). In some embodiments, the DNA template includes an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from the polynucleotide encoding the polynucleotide of interest and operably linked to the polynucleotide. The DNA template can also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest.

[0399] Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins. The term "protein" encompasses peptides.

[0400] In some embodiments, the RNA transcript is the product of an IVT reaction, and as will be understood by those skilled in the art, the DNA template for generating the RNA molecule is known based on base complementarity. In some embodiments, the RNA transcript is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest linked to a poly-A tail. In some embodiments, the mRNA is a modified mRNA (mmRNA), which includes at least one modified nucleotide.

[0401] A nucleotide contains a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) contains a nucleobase linked to a ribose and a single phosphate, a nucleoside diphosphate (NDP) contains a nucleobase linked to a ribose and two phosphates, and a nucleoside triphosphate (NTP) contains a nucleobase linked to a ribose and three phosphates. A nucleotide analog is a compound that has a general nucleotide structure or is structurally similar to a nucleotide. For example, a nucleotide analog can include an analog of the nucleobase, sugar, and / or phosphate group(s) of a nucleotide.

[0402] Nucleosides contain a nitrogenous base and a pentose sugar. Thus, adding a phosphate group to a nucleoside converts it into a nucleotide. Nucleoside analogs are compounds that have the general nucleoside structure or are structurally similar to a nucleoside. For example, nucleoside analogs include nucleobase analogs and / or sugar analogs of the nucleoside.

[0403] Unless otherwise indicated, the term "nucleotide" should be understood to include naturally occurring nucleotides, synthetic nucleotides, and modified nucleotides. Examples of naturally occurring nucleotides used, for example, in the production of RNA in IVT reactions as provided herein, include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (mTP). 5 In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used.

[0404] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, cap analogs, or precursors / substrates for enzymatic capping (e.g., vaccinia or ligase), nucleotides labeled with functional groups to facilitate ligation / conjugation of the cap or 5' portion (IRES), nucleotides labeled with 5'PO4 to facilitate ligation of the cap or 5' portion, or nucleotides labeled with functional groups / protecting groups that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, ganciclovir, entecavir, telbivudine, vidarabine, and cidofovir.

[0405] Modified nucleotides can include modified nucleobases. For example, RNA transcripts (e.g., mRNA transcripts) of the present disclosure can include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine (mo5U), and 2'-O-methyluridine. In some embodiments, an RNA transcript (e.g., an mRNA transcript) comprises a combination of at least two (e.g., two, three, four, or more) of the aforementioned modified nucleobases.

[0406] Nucleoside triphosphates (NTPs) as provided herein may include unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, the NTPs of the IVT reaction include unmodified ATP. In some embodiments, the NTPs of the IVT reaction include modified ATP. In some embodiments, the NTPs of the IVT reaction include unmodified UTP. In some embodiments, the NTPs of the IVT reaction include modified UTP. In some embodiments, the NTPs of the IVT reaction include unmodified GTP. In some embodiments, the NTPs of the IVT reaction include modified GTP. In some embodiments, the NTPs of the IVT reaction include unmodified CTP. In some embodiments, the NTPs of the IVT reaction include modified CTP.

[0407] The concentrations of nucleoside triphosphate and cap analog included in the IVT reaction can vary. In some embodiments, the NTP and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphate in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphate in the reaction can be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphate in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphate in the reaction can be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100.

[0408] The composition of NTPs in an IVT reaction can also vary. For example, ATP can be used in excess of GTP, CTP, and UTP. As a non-limiting example, an IVT reaction can contain 7.5 mmol of GTP, 7.5 mmol of CTP, 7.5 mmol of UTP, and 3.75 mmol of ATP. The same IVT reaction can contain 3.75 mmol of a cap analog (e.g., a trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5.

[0409] In some embodiments, the RNA transcript (e.g., mRNA transcript) contains at least one nucleotide sequence selected from the group consisting of pseudouridine (ψ), 1-methylpseudouridine (m 1 ψ), 5-methoxyuridine (mo 5U), 5-methylcytidine (m 5 C), α-thio-guanosine and α-thio-adenosine. In some embodiments, an RNA transcript (e.g., an mRNA transcript) comprises a combination of at least two (e.g., two, three, four, or more) of the foregoing modified nucleobases.

[0410] In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises pseudouridine (ψ). In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises 1-methylpseudouridine (m 1 In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises 5-methoxyuridine (mo 5 In some embodiments, the RNA transcript (e.g., mRNA transcript) contains 5-methylcytidine (mU). 5 In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises α-thio-guanosine. In some embodiments, the RNA transcript (e.g., mRNA transcript) comprises α-thio-adenosine.

[0411] In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) are uniformly modified (e.g., fully modified, i.e., modified throughout the entire sequence) for a particular modification. For example, the polynucleotides may contain 1-methylpseudouridine (m 1 ψ), which means that all uridine residues in the mRNA sequence are uniformly modified with 1-methylpseudouridine (m 1 ψ). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacing it with a modified residue such as any of those described above. Alternatively, a polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) can be non-uniformly modified (e.g., partially modified, i.e., a portion of the sequence is modified). Each possibility represents a separate embodiment of the present invention.

[0412] In some embodiments, the buffer system contains Tris. The Tris concentration used in the IVT reaction can be, for example, at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM, or at least 110 mM phosphate. In some embodiments, the phosphate concentration is 20-60 mM or 10-100 mM.

[0413] In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in the IVT reaction can be, for example, at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 1 to 50 mM or 5 to 50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 5 mM.

[0414] In some embodiments, the buffer system contains magnesium. In some embodiments, the NTP countermeasure against magnesium ions (Mg 2+ For example, the molar ratio of NTP to magnesium ions can be 1:1, 1:2, 1:3, 1:4, or 1:5.

[0415] In some embodiments, the ratio of NTP plus cap analog (e.g., trinucleotide cap such as GAG) to magnesium ion (Mg 2+ For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions can be 1:1, 1:2, 1:3, 1:4, or 1:5.

[0416] In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON® X-100 (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether) and / or polyethylene glycol (PEG).

[0417] The addition of nucleoside triphosphates (NTPs) to the 3'-end of a growing RNA chain is catalyzed by a polymerase, such as a T7 RNA polymerase, such as any one or more of the T7 RNA polymerase variants (e.g., G47A) disclosed herein. In some embodiments, the RNA polymerase (e.g., a T7 RNA polymerase variant) is present in the reaction (e.g., an IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in the reaction at a concentration of 0.01 mg / ml, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml, or 1.0 mg / ml.

[0418] In some embodiments, the polynucleotides of the present disclosure are IVT polynucleotides. Conventionally, the basic components of an mRNA molecule include at least a coding region, a 5' UTR, a 3' UTR, a 5' cap, and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNAs, but are distinguished from wild-type mRNAs in their functional and / or structural design features that help overcome existing problems, for example, in effective polypeptide production using nucleic acid-based therapeutics.

[0419] The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides flanked by a first flanking region and a second flanking region. This first region may contain, but is not limited to, an encoded therapeutic or prophylactic payload. The first flanking region may comprise a sequence of linked nucleosides that functions as a 5' untranslated region (UTR), for example, the native 5' UTR of a polypeptide, or the 5' UTR of a nucleic acid encoding a non-native 5' UTR, such as, but not limited to, a heterologous 5' UTR or a synthetic 5' UTR. An IVT encoding a therapeutic or prophylactic payload may include a signal sequence region at its 5' end encoding one or more signal sequences. The flanking region may comprise a region of linked nucleotides containing one or more complete or incomplete 5' UTR sequences. The flanking region may also include a 5' terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3'UTRs, which can encode the native 3'UTR of the therapeutic or prophylactic payload, or a non-native 3'UTR, such as, but not limited to, a heterologous or synthetic 3'UTR. The flanking region can also comprise a 3' tail sequence. The 3' tailing sequence can be, but is not limited to, a poly-A tail, a poly-AG quartet, and / or a stem-loop sequence.

[0420] Additional and exemplary IVT polynucleotide structural features and methods of making the polynucleotides are disclosed in International PCT Application WO2017 / 201325, filed May 18, 2017, the entire contents of which are incorporated herein by reference.

[0421] 12. Purification In other aspects, the polynucleotides (e.g., mRNA) disclosed herein can be purified. Purification of polynucleotides (e.g., mRNA) described herein can include, but is not limited to, polynucleotide cleanup, quality assurance, and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), polyT beads, LNA™ OligoT capture probes (EXIQON® Inc., Vedbaek, Denmark), or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). When used in reference to polynucleotides, such as "purified polynucleotide," the term "purified" refers to one that has been separated from at least one contaminant. As used herein, a "contaminant" is any substance that renders another substance unsuitable, impure, or adulterated. Thus, purified polynucleotides (e.g., DNA and RNA) are present in a form or environment that is different from that in which they are found in nature or that is different from that in which they existed prior to being subjected to a treatment or purification method.

[0422] In some embodiments, purification of the polynucleotides (e.g., mRNA) of the present disclosure removes impurities, which may reduce or eliminate unwanted immune responses (e.g., reduced cytokine activity).

[0423] In some embodiments, polynucleotides (e.g., mRNA) of the disclosure are purified prior to administration using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)). In some embodiments, polynucleotides encoding therapeutic or prophylactic payloads disclosed herein purified by column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) exhibit increased expression of the therapeutic or prophylactic payload compared to polynucleotides encoding the therapeutic or prophylactic payloads purified by a different purification method.

[0424] In some embodiments, the polynucleotide purified by column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) encodes a therapeutic or prophylactic payload. In some embodiments, the purified polynucleotide encodes a therapeutic or prophylactic payload.

[0425] In some embodiments, the purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure.

[0426] Quality assurance and / or quality control testing may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0427] In another embodiment, the polynucleotides may be sequenced by methods including, but not limited to, reverse transcriptase PCR.

[0428] 13. Chemical Modification of Polynucleotides As described above, modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids) can be included in polynucleotides of the present invention. A "nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized in any useful manner, for example, chemically, enzymatically, or recombinantly, to include one or more modified or unnatural nucleosides. A nucleic acid can include a region(s) of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would include a region of nucleotides.

[0429] Base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard base and a standard base, or between two complementary non-standard base structures, for example, in nucleic acids having at least one chemical modification. One example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker can be incorporated into the nucleic acids of the present disclosure.

[0430] In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) comprise N1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) comprise 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, a polyribonucleotide comprises a combination of at least two (e.g., two, three, four, or more) of any of the foregoing modified nucleobases, including, but not limited to, chemical modifications.

[0431] In some embodiments, an RNA nucleic acid of the present disclosure comprises N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0432] In some embodiments, an RNA nucleic acid of the present disclosure comprises N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0433] In some embodiments, an RNA nucleic acid of the present disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0434] In some embodiments, an RNA nucleic acid of the present disclosure comprises pseudouridine (ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0435] In some embodiments, an RNA nucleic acid of the present disclosure comprises a uridine at one or more or all uridine positions of the nucleic acid.

[0436] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacing it with a modified residue such as those described above.

[0437] The nucleic acids of the present disclosure may be partially or completely modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purines or pyrimidines, or one or more or all of A, G, U, C) may be uniformly modified in the nucleic acids of the present disclosure, or in a given sequence region thereof (e.g., in an mRNA, including or excluding a poly-A tail). In some embodiments, every nucleotide X in the nucleic acid of the present disclosure (or in the sequence region thereof) is a modified nucleotide, where X may be any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0438] Nucleic acids may contain from about 1% to about 100% modified nucleotides (either with respect to overall nucleotide content or with respect to any one or more types of nucleotides, i.e., A, G, U, or C), or any intervening percentage (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 10%-95%, 10%-10 ... It may contain 0%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

[0439] A nucleic acid may contain as little as 1% and as much as 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, a nucleic acid may contain modified pyrimidines such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in a nucleic acid are replaced with modified uracils (e.g., 5-substituted uracils). The modified uracils may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines can be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0440] 14. Array optimization and its method In some embodiments, a polynucleotide of the disclosure comprises a sequence-optimized nucleotide sequence that encodes a polypeptide disclosed herein (e.g., a polynucleotide that encodes a therapeutic or prophylactic payload). In some embodiments, a polynucleotide of the disclosure comprises an open reading frame (ORF) that encodes a therapeutic or prophylactic payload, and the ORF is sequence-optimized.

[0441] The sequence-optimized nucleotide sequences disclosed herein differ from the corresponding wild-type nucleotide acid sequences and other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.

[0442] In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence is altered (e.g., decreased) relative to the percentage of uracil or thymine nucleobases in a reference wild-type nucleotide sequence. Such sequences are referred to as uracil-modified or thymine-modified sequences. The uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in the sequence by the total number of nucleotides and multiplying by 100. In some embodiments, a sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in a reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence of the present disclosure is greater than the uracil or thymine content in a reference wild-type sequence, yet still maintains a beneficial effect (e.g., increased expression level and / or signaling response) when compared to the reference wild-type sequence.

[0443] In some embodiments, the optimized sequences of the present disclosure contain a unique range of uracil or thymine (in the case of DNA) in the sequence. The uracil or thymine content of the optimized sequence can be expressed in various ways (e.g., relative to the theoretical minimum (%UTM or %TTM), relative to the wild type (%UWT or %TWT), and relative to the total nucleotide content (%UTL or %TTL)). In DNA, thymine (T) is recognized to occur in place of uracil (U), and where U appears, it should be substituted with T. In RNA, uracil (U) is recognized to occur in place of thymine (T). One skilled in the art can readily derive an RNA sequence given a DNA sequence by substituting uracil for thymine in the DNA sequence. Thus, for example, all disclosures regarding %UTM, %UWT, or %UTL for RNA are equally applicable to %TTM, %TWT, or %TTL for DNA.

[0444] Uracil or thymine content relative to the theoretical minimum refers to a parameter determined by dividing the number of uracils or thymines in a sequence-optimized nucleotide sequence by the total number of uracils or thymines in a hypothetical nucleotide sequence, where all codons in the hypothetical sequence have been replaced with synonymous codons with the lowest possible uracil or thymine content. This parameter is abbreviated herein as %UTM or %TTM.

[0445] In some embodiments, the number of consecutive uracils in the uracil-modified sequences of the present disclosure is reduced relative to the corresponding wild-type nucleic acid sequence. For example, two consecutive leucines can be encoded by the sequence CUUUUG, which contains a cluster of four uracils. Such a subsequence can be substituted with, for example, CUGCUC, which removes the uracil cluster. Phenylalanine can be encoded by UUC or UUU. Thus, even if a phenylalanine encoded by UUU is replaced with UUC, the synonymous codon still contains a uracil pair (UU). Therefore, the number of phenylalanines in a sequence establishes the minimum number of uracil pairs (UU) that cannot be eliminated without changing the number of phenylalanines in the encoded polypeptide.

[0446] In some embodiments, the uracil modified sequences of the present disclosure have a reduced number of uracil triplets (UUU) relative to the wild-type nucleic acid sequence. In some embodiments, the uracil modified sequences have a reduced number of uracil pairs (UU) relative to the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, the uracil modified sequences of the present disclosure have a number of uracil pairs (UU) that corresponds to the minimum possible number of uracil pairs (UU) in the wild-type nucleic acid sequence.

[0447] The phrase "uracil pairs (UU) relative to uracil pairs (UU) in a wild-type nucleic acid sequence" refers to a parameter determined by dividing the number of uracil pairs (UU) in a sequence-optimized nucleotide sequence by the total number of uracil pairs (UU) in the corresponding wild-type nucleotide sequence and multiplying by 100. This parameter is abbreviated herein as %UUwt. In some embodiments, a uracil-modified sequence has a %UUwt of less than 100%.

[0448] In some embodiments, the polynucleotide of the present disclosure comprises a uracil-modified sequence. In some embodiments, the uracil-modified sequence comprises at least one chemically modified nucleobase (e.g., 5-methoxyuracil). In some embodiments, at least 95% of the nucleobases (e.g., uracil) in the uracil-modified sequence of the present disclosure are modified nucleobases. In some embodiments, at least 95% of the uracils in the uracil-modified sequence are 5-methoxyuracil.

[0449] In some embodiments, the polynucleotides of the present disclosure are sequence-optimized.

[0450] A sequence-optimized nucleotide sequence (a nucleotide sequence is also referred to herein as a "nucleic acid") comprises at least one codon modification relative to a reference sequence (e.g., a wild-type sequence encoding a therapeutic or prophylactic payload). Thus, in a sequence-optimized nucleic acid, at least one codon differs from the corresponding codon in the reference sequence (e.g., the wild-type sequence).

[0451] Generally, sequence-optimized nucleic acids are generated by steps that include at least replacing codons in a reference sequence with synonymous codons (i.e., codons that encode the same amino acid). Such replacements can be achieved, for example, by applying a codon substitution map (i.e., a table providing the codons that encode each amino acid in the codon-optimized sequence) or by applying a set of rules (e.g., glycine is encoded by one particular codon when it is next to a neutral amino acid, but by a different codon when it is next to a polar amino acid). In addition to codon substitution (i.e., "codon optimization"), the sequence optimization methods disclosed herein include additional optimization steps that are not strictly aimed at codon optimization, such as removal of deleterious motifs (destabilizing motif substitution). Compositions and formulations containing such sequence-optimized nucleic acids (e.g., RNA, e.g., mRNA) can be administered to a subject in need thereof to promote in vivo expression of the encoded functionally active therapeutic or prophylactic payload.

[0452] Additional exemplary sequence optimization methods are disclosed in International PCT Application WO2017 / 201325, filed May 18, 2017, the entire contents of which are incorporated herein by reference.

[0453] 15. Lipid content of lipid nanoparticles As noted above, with respect to lipids, LNPs for use as delivery vehicles disclosed herein include (i) ionizable lipids, (ii) sterol or other structured lipids, (iii) non-cationic helper lipids or phospholipids, and, optionally, (iv) PEG lipids. These categories of lipids are described in more detail below.

[0454] In some embodiments, the nucleic acids of the present invention are formulated as lipid nanoparticle (LNP) compositions. Lipid nanoparticles typically comprise an amino lipid, a phospholipid, a structural lipid, and a PEG-lipid component along with the nucleic acid cargo of interest. Lipid nanoparticles of the present invention can be produced using components, compositions, and methods generally known in the art (e.g., PCT / US2016 / 052352, PCT / US2016 / 068300, PCT / US2017 / 037551, PCT / US2015 / 027400, PCT / US2016 / 047406, PCT / US2016000129, PCT / US2016 / 01428 ... 038426, PCT / US2014 / 027077, PCT / US2014 / 055394, PCT / US2016 / 52117, PCT / US2012 / 069610, PCT / US2017 / 027492, PCT / US2016 / 059575, PCT / US2016 / 069491, PCT / US2016 / 069493, and PCT / US2014 / 66242, all of which are incorporated by reference in their entirety.

[0455] In some embodiments, lipid nanoparticles contain 20-60% amino lipids by molar ratio relative to other lipid components. For example, lipid nanoparticles may contain 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, 30-40%, 40-60%, 40-50%, or 50-60% amino lipids by molar ratio. In some embodiments, lipid nanoparticles contain 20%, 30%, 40%, 50, or 60% amino lipids by molar ratio.

[0456] In some embodiments, lipid nanoparticles contain 5-25% phospholipids by molar ratio relative to other lipid components. For example, lipid nanoparticles may contain 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25%, or 25-30% phospholipids by molar ratio. In some embodiments, lipid nanoparticles contain 5%, 10%, 15%, 20%, 25%, or 30% non-cationic lipids by molar ratio.

[0457] In some embodiments, lipid nanoparticles contain 25-55% structural lipids by molar ratio relative to other lipid components. For example, lipid nanoparticles may contain 10-55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45-50%, or 50-55% structural lipids. In some embodiments, lipid nanoparticles contain 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55% structural lipids by molar ratio.

[0458] In some embodiments, lipid nanoparticles contain 0.5-15% PEG-lipid molar ratio relative to other lipid components. For example, lipid nanoparticles may contain 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15% PEG-lipid molar ratio. In some embodiments, lipid nanoparticles contain 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-lipid molar ratio.

[0459] In some embodiments, the lipid nanoparticles are composed of a molar ratio of 20-60% amino lipid, 5-25% phospholipid, 25-55% structural lipid, and 0.5-15% PEG lipid.

[0460] In some embodiments, the lipid nanoparticles are composed of a molar ratio of 20-60% amino lipid, 5-30% phospholipid, 10-55% structural lipid, and 0.5-15% PEG lipid.

[0461] Ionized Amino Lipids In some embodiments, the present disclosure provides a compound of formula (I): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is an R' branch, The R´ branch is [ka] (where: [ka] indicates the point of attachment, Raα, Raβ, Raγ, and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0462] In some embodiments of the compounds of Formula (I), R'a is R' branched; The R´ branch is [ka] and [ka] indicates a point of attachment, Raα, Raβ, Raγ, and Raδ are each H, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 5, and m is 7.

[0463] In some embodiments of the compounds of Formula (I), R'a is R' branched; The R´ branch is [ka] and [ka] indicates a point of attachment, Raα, Raβ, Raγ, and Raδ are each H, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 3, and m is 7.

[0464] In some embodiments of the compounds of Formula (I), R'a is R' branched; The R´ branch is [ka] and [ka] indicates a point of attachment, Raα is C2-12 alkyl, Raβ, Raγ, and Raδ are each H, R2 and R3 are each C1-14 alkyl, and R4 is [ka] wherein R10 is NH(C1-6 alkyl), n2 is 2, R5 is H, each R6 is H, M and M' are each -C(O)O-, R' is C1-12 alkyl, l is 5, and m is 7.

[0465] In some embodiments of the compounds of Formula (I), R'a is R' branched; The R´ branch is [ka] and [ka] indicates a point of attachment, Raα, Raβ, and Raδ are each H, Raγ is C2-12 alkyl, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 5, and m is 7.

[0466] In some embodiments, the compound of formula (I) is [ka] is selected from.

[0467] In some embodiments, the compound of formula (I) is [ka] is.

[0468] In some embodiments, the compound of formula (I) is [ka] is.

[0469] In some embodiments, the compound of formula (I) is [ka] is.

[0470] In some embodiments, the compound of formula (I) is [ka] is.

[0471] In some embodiments, the present disclosure provides a compound of formula (Ia): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is an R' branch, The R´ branch is [ka] (where: [ka] indicates the point of attachment, Raβ, Raγ, and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0472] In some embodiments, the present disclosure provides a compound of formula (Ib): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is an R' branch, The R´ branch is [ka] (where: [ka] indicates the point of attachment, Raα, Raβ, Raγ, and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is —(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0473] In some embodiments of Formula (I) or (Ib), R'a is an R' branch, and the R' branch is: [ka] and [ka] indicates a point of attachment, Raβ, Raγ, and Raδ are each H, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 5, and m is 7.

[0474] In some embodiments of Formula (I) or (Ib), R'a is an R' branch, and the R' branch is: [ka] and [ka] indicates a point of attachment, Raβ, Raγ, and Raδ are each H, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 3, and m is 7.

[0475] In some embodiments of Formula (I) or (Ib), R'a is an R' branch, and the R' branch is: [ka] and [ka] indicates a point of attachment, Raβ and Raδ are each H, Raγ is C2-12 alkyl, R2 and R3 are each C1-14 alkyl, R4 is —(CH2)nOH, n is 2, each R5 is H, each R6 is H, M and M′ are each —C(O)O—, R′ is C1-12 alkyl, 1 is 5, and m is 7.

[0476] In some embodiments, the present disclosure provides a compound of formula (Ic): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is an R' branch, The R´ branch is [ka] (where: [ka] indicates the point of attachment, Raα, Raβ, Raγ, and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0477] In some embodiments, R'a is an R' branch, wherein the R' branch is: [ka] and [ka] indicates a point of attachment, Raβ, Raγ, and Raδ are each H, Raα is C2-12 alkyl, R2 and R3 are each C1-14 alkyl, and R4 is [ka] and [ka] indicates a point of attachment, R10 is NH(C1-6 alkyl), n2 is 2, each R5 is H, each R6 is H, M and M' are each -C(O)O-, R' is C1-12 alkyl, l is 5, and m is 7.

[0478] In some embodiments, the compound of Formula (Ic) is [ka] is.

[0479] In some embodiments, the present disclosure provides a compound of formula (II): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and the R' ring is [ka] ), R´b is [ka] or [ka] and (where, [ka] indicates the point of attachment, Raγ and Raδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, and at least one of Raγ and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγ and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, and at least one of Rbγ and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R' is independently C alkyl or C alkenyl; Ya is a C3-6 carbocyclic ring; R*"a is selected from the group consisting of C1-15 alkyl and C2-15 alkenyl; s is 2 or 3, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0480] In some embodiments, the present disclosure provides a compound of formula (II-a): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] or [ka] and where: [ka] indicates the point of attachment, Raγ and Raδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, and at least one of Raγ and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγ and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, and at least one of Rbγ and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R' is independently C alkyl or C alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0481] In some embodiments, the present disclosure provides a compound of formula (II-b): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] or [ka] and where: [ka] indicates the point of attachment, Raγ and Rbγ are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R' is independently C alkyl or C alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0482] In some embodiments, the present disclosure provides a compound of formula (II-c): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] and where: [ka] indicates the point of attachment, Raγ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R' is C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0483] In some embodiments, the present disclosure provides a compound of formula (II-d): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] and where: [ka] indicates the point of attachment, Raγ and Rbγ are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl, R4 is -(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5, and [ka] (where, [ka] indicates the point of attachment, R10 is N(R)2, where each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R' is independently C alkyl or C alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0484] In some embodiments, the present disclosure provides a compound of formula (II-e): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] and where: [ka] indicates the point of attachment, Raγ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4 is —(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9.

[0485] In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5.

[0486] In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R' is independently C alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R' is independently C alkyl.

[0487] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R′b is [ka] and R2 and R3 are each independently C1-14 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R'b is [ka] and R2 and R3 are each independently C6-10 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R'b is [ka] and R2 and R3 are each C8 alkyl.

[0488] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] and Ra is C1-12 alkyl, and R2 and R3 are each independently C6-10 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] and Ra is C2-6 alkyl, and R2 and R3 are each independently C6-10 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] where Raγ is a C2-6 alkyl, and R2 and R3 are each a C8 alkyl.

[0489] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] and R a and R b are each C 1-12 alkyl. In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] and Raγ and Rbγ are each C2-6 alkyl.

[0490] In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6, and each R' is independently C alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5, and each R' is independently C alkyl.

[0491] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] wherein m and l are each independently selected from 4, 5, and 6, each R' is independently C1-12 alkyl, and Ra and Rb are each C1-12 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] wherein m and l are each 5, each R' is independently C2-5 alkyl, and Raγ and Rbγ are each C2-6 alkyl.

[0492] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] wherein m and l are each independently selected from 4, 5, and 6, R' is C1-12 alkyl, Ra is C1-12 alkyl, and R2 and R3 are each independently C6-10 alkyl. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] wherein m and l are each 5, R' is a C2-5 alkyl, Raγ is a C2-6 alkyl, and R2 and R3 are each a C8 alkyl.

[0493] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4 is [ka] wherein R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4 is [ka] where R10 is NH(CH3) and n2 is 2.

[0494] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] wherein m and l are each independently selected from 4, 5, and 6; each R' is independently C1-12 alkyl; Raγ and Rbγ are each C1-12 alkyl; and R4 is [ka] where R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] wherein m and l are each 5, each R' is independently C2-5 alkyl, Raγ and Rbγ are each C2-6 alkyl, and R4 is [ka] where R10 is NH(CH3) and n2 is 2.

[0495] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] wherein m and l are each independently selected from 4, 5, and 6; R' is C1-12 alkyl; R2 and R3 are each independently C6-10 alkyl; Raγ is C1-12 alkyl; and R4 is [ka] where R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] wherein m and l are each 5, R' is a C2-5 alkyl, Ra is a C2-6 alkyl, R2 and R3 are each a C8 alkyl, and R4 is [ka] where R10 is NH(CH3) and n2 is 2.

[0496] In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4 is —(CH2)nOH and n is 2, 3, or 4. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4 is —(CH2)nOH and n is 2.

[0497] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is [ka] and R'b is [ka] wherein m and l are each independently selected from 4, 5, and 6, each R' is independently C alkyl, Ra and Rb are each C alkyl, R is -(CH)OH, and n is 2, 3, or 4. In some embodiments of a compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R' branch is [ka] and R'b is [ka] wherein m and l are each 5, each R' is independently C2-5 alkyl, Raγ and Rbγ are each C2-6 alkyl, R4 is -(CH2)nOH, and n is 2.

[0498] In some embodiments, the present disclosure provides a compound of formula (II-f): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R'a is R'-branched or R'-cyclic, The R´ branch is [ka] and R'b is [ka] and where: [ka] indicates the point of attachment, Raγ is C1-12 alkyl, R2 and R3 are each independently C1-14 alkyl; R4 is —(CH2)nOH, where n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C1-12 alkyl, m is selected from 4, 5, and 6; 1 is selected from 4, 5, and 6.

[0499] In some embodiments of compounds of Formula (II-f), m and l are each 5; and n is 2, 3, or 4.

[0500] In some embodiments of compounds of Formula (II-f), R' is C2-5 alkyl, Ra is C2-6 alkyl, and R2 and R3 are each C6-10 alkyl.

[0501] In some embodiments of compounds of Formula (II-f), m and l are each 5; n is 2, 3, or 4; R' is C2-5 alkyl; Ra is C2-6 alkyl; and R2 and R3 are each C6-10 alkyl.

[0502] In some embodiments, the present disclosure provides a compound of formula (II-g): [ka] In the compound of formula Raγ is a C2-6 alkyl, R' is a C2-5 alkyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 3, 4, and 5, and [ka] (where, [ka] indicates a point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3).

[0503] In some embodiments, the present disclosure provides a compound of formula (II-h): [ka] In the compound of formula Raγ and Rbγ are each independently C2-6 alkyl, each R' is independently C2-5 alkyl; R4 is -(CH2)nOH, where n is selected from the group consisting of 3, 4, and 5, and [ka] (where, [ka] indicates a point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3).

[0504] In some embodiments of compounds of Formula (II-g) or (II-h), R4 is [ka] where: R10 is NH(CH3) and n2 is 2.

[0505] In some embodiments of compounds of Formula (II-g) or (II-h), R4 is -(CH2)2OH.

[0506] In some embodiments, the present disclosure provides a compound of formula (III): [ka] or a salt or isomer thereof, wherein R1, R2, R3, R4, and R5 are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R"MR', -R*YR", -YR" and -R*OR"; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, an aryl group, and a heteroaryl group; X1, X2, and X3 are independently selected from the group consisting of a bond, —CH2—, —(CH2)2—, —CHR—, —CHY—, —C(O)—, —C(O)O—, —OC(O)—, —C(O)—CH2—, —CH2—C(O)—, —C(O)O—CH2—, —OC(O)—CH2—, —CH2—C(O)O—, —CH2—OC(O)—, —CH(OH)—, —C(S)—, and —CH(SH)—; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and C3-6 carbocycle; each R' is independently selected from the group consisting of C1-12 alkyl, C2-12 alkenyl, and H; Each R″ is independently selected from the group consisting of C3-12 alkyl and C3-12 alkenyl, wherein: i) at least one of X1, X2, and X3 is not -CH2-; and / or ii) At least one of R1, R2, R3, R4, and R5 is -R"MR'.

[0507] In some embodiments, R1, R2, R3, R4, and R5 are each C5-20 alkyl, X1 is -CH2-, and X2 and X3 are each -C(O)-.

[0508] In some embodiments, the compound of formula (III) is [ka] or a salt or isomer thereof.

[0509] phospholipids The lipid composition of the lipid nanoparticle compositions disclosed herein can include one or more phospholipids, such as one or more saturated or (poly)unsaturated phospholipids, or a combination thereof. Generally, a phospholipid comprises a phospholipid moiety and one or more fatty acid moieties.

[0510] The phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0511] The fatty acid moiety may be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0512] Certain phospholipids can promote fusion with membrane.For example, cationic phospholipids can interact with one or more negatively charged phospholipids of membrane (for example, cell membrane or intracellular membrane).By fusion of phospholipid with membrane, one or more components (for example, therapeutic agent) of lipid-containing composition (for example, LNP) can pass through the membrane, for example, one or more components can be delivered to target tissue.

[0513] Non-natural phospholipid species are also contemplated, including natural species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. For example, phospholipids can be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, alkyne groups can undergo copper-catalyzed cycloaddition when exposed to azide. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to promote membrane penetration or cell recognition, or for conjugating nanoparticle compositions to useful components such as targeting moieties or imaging moieties (e.g., dyes).

[0514] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include phosphosphingolipids such as sphingomyelin.

[0515] In some embodiments, the phospholipids of the present invention are selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0516] In certain embodiments, phospholipids useful or potentially useful in the present invention are analogs or variants of DSPC. In certain embodiments, phospholipids useful or potentially useful in the present invention have the formula (IV): [ka] or a salt thereof, wherein each R is independently an optionally substituted alkyl, or optionally, two Rs, together with intervening atoms, are joined to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl, or optionally, three Rs, together with intervening atoms, are joined to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula: [ka] It is of each instance of L2 is independently a bond or an optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced by O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each instance of R2 is independently an optionally substituted C1-30 alkyl, an optionally substituted C1-30 alkenyl, or an optionally substituted C1-30 alkynyl, and optionally, one or more methylene units of R2 are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C( =NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R replaced by N)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O, each instance of R is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; p is 1 or 2; However, the compound has the formula: [ka] wherein each instance of R2 is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.

[0517] In some embodiments, the phospholipid may be one or more of the phospholipids described in US Application No. 62 / 520,530.

[0518] i) Modification of phospholipid head groups In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise modified phospholipid head groups (for example, modified choline groups).In certain embodiments, the phospholipids with modified head groups are DSPCs or analogs thereof with modified quaternary amines.For example, in the embodiment of formula (IV), at least one of R1 is not methyl.In certain embodiments, at least one of R1 is not hydrogen or methyl.In certain embodiments, the compound of formula (IV) has the following formula: [ka] or a salt thereof, wherein each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; Each v is independently 1, 2, or 3.

[0519] In certain embodiments, the compound of formula (IV) has the formula (IV-a): [ka] or a salt thereof.

[0520] In certain embodiments, the phospholipid that is useful or potentially useful in the present invention comprises a cyclic moiety instead of a glyceride moiety.In certain embodiments, the phospholipid that is useful in the present invention is DSPC or its analogue, which has a cyclic moiety instead of a glyceride moiety.In certain embodiments, the compound of formula (IV) is represented by formula (IV-b): [ka] or a salt thereof.

[0521] (ii) Modification of phospholipid tails In certain embodiments, the phospholipid that is useful or potentially useful in the present invention comprises modified tail.In certain embodiments, the phospholipid that is useful or potentially useful in the present invention is DSPC or its analog with modified tail.As described herein, " modified tail " can be the tail that has shorter or longer aliphatic chain, the aliphatic chain that is introduced with branching, the aliphatic chain that is introduced with substituent, the aliphatic chain that one or more methylenes are replaced by cyclic or heteroatom group, or any combination thereof. For example, in certain embodiments, the compound of (IV) is a compound of formula (IV-a), or a salt thereof, wherein at least one instance of R2, each instance of R2 is an optionally substituted C1-30 alkyl, and one or more methylene units of R2 are independently selected from optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S , SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O , N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN )S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O.

[0522] In certain embodiments, the compound of formula (IV) has formula (IV-c): [ka] or a salt thereof, wherein each x is independently an integer from 0 to 30, inclusive; In each instance, G is independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(═NRN), C(═NRN)N(RN), NRNC(═NRN), NRNC(═NRN)N(RN). , C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O), S(O)O, OS(O)O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O), N(RN)S(O)2, S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), or N(RN)S(O)O. Each possibility represents a separate embodiment of the present invention.

[0523] In certain embodiments, phospholipids useful or potentially useful in the present invention comprise a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in certain embodiments, phospholipids useful or potentially useful in the present invention are compounds of formula (IV), where n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, compounds of formula (IV) have the following formula: [ka] or a salt thereof.

[0524] alternative lipids In certain embodiments, phospholipids useful or potentially useful in the present invention contain a modified phosphocholine moiety, in which the alkyl chain connecting the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in certain embodiments, phospholipids are useful.

[0525] In certain embodiments, alternative lipids are used in place of the phospholipids of the present disclosure.

[0526] In certain embodiments, the lipid substitute of the present invention is oleic acid.

[0527] In certain embodiments, the replacement lipid is one of the following: [ka] [ka]

[0528] structured lipids The lipid composition of the pharmaceutical composition disclosed herein can comprise one or more structured lipids. As used herein, the term "structured lipid" refers to sterol, and also refers to lipids containing sterol moieties.

[0529] Incorporating structured lipids into lipid nanoparticles can help reduce aggregation of other lipids within the particles. The structured lipids can be selected from the group including, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structured lipid is a sterol. As defined herein, "sterol" is a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structured lipid is a steroid. In certain embodiments, the structured lipid is cholesterol. In certain embodiments, the structured lipid is a cholesterol analog. In certain embodiments, the structured lipid is alpha-tocopherol.

[0530] In some embodiments, the structured lipid may be one or more of the structured lipids described in US Application No. 62 / 520,530.

[0531] Polyethylene glycol (PEG) lipids The lipid composition of the pharmaceutical compositions disclosed herein may include one or more polyethylene glycol (PEG) lipids.

[0532] As used herein, the term "PEG lipid" refers to a lipid modified with polyethylene glycol (PEG). Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0533] In some embodiments, PEG lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA).

[0534] In one embodiment, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

[0535] In some embodiments, the lipid portion of the PEG-lipid has a length of about C14 to about C22, preferably about C14 to about C16. In some embodiments, the PEG portion, e.g., mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In one embodiment, the PEG-lipid is PEG2k-DMG.

[0536] In one embodiment, the lipid nanoparticles described herein can include a PEG lipid that is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0537] PEG lipids are known in the art, such as those described in U.S. Pat. No. 8,158,601 and International Publication No. WO2015 / 130584 A2, which are incorporated herein by reference in their entireties.

[0538] Generally, some of the other lipid components (e.g., PEG lipids) of the various formulas described herein can be synthesized as described in International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled "Compositions and Methods for Delivery of Therapeutic Agents," which is incorporated by reference in its entirety.

[0539] The lipid component of the lipid nanoparticle composition may include one or more molecules containing polyethylene glycol, such as PEG or PEG-modified lipids. Such species may alternatively be referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol. The PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0540] In some embodiments, the PEG-modified lipid is a modified form of PEG-DMG, which has the following structure: [ka]

[0541] In one embodiment, the PEG lipid useful in the present invention can be a PEGylated lipid described in International Publication No. WO2012099755 (the contents of which are incorporated herein by reference in their entirety). Any of these exemplary PEG lipids described herein can be modified to include a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, the PEG-OH or hydroxy-PEGylated lipid includes an -OH group at the end of the PEG chain. Each possibility represents a separate embodiment of the present invention.

[0542] In certain embodiments, the PEG lipid useful in the present invention is a compound of formula (V): [ka] or a salt thereof, wherein: R3 is -ORO; RO is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L1 is an optionally substituted C1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10 alkylene is independently replaced by optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); D is a moiety obtained by click chemistry or cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula: [ka] It is of each instance of L2 is independently a bond or an optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced by O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); Each instance of R2 is independently an optionally substituted C1-30 alkyl, an optionally substituted C1-30 alkenyl, or an optionally substituted C1-30 alkynyl, and optionally, one or more methylene units of R2 are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C( =NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R replaced by N)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O, each instance of R is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; p is 1 or 2.

[0543] In certain embodiments, the compound of formula (V) is a PEG-OH lipid (i.e., R3 is -ORO and RO is hydrogen). In certain embodiments, the compound of formula (V) is of formula (V-OH): [ka] or a salt thereof.

[0544] In certain embodiments, the PEG lipid useful in the present invention is a PEGylated fatty acid. In certain embodiments, the PEG lipid useful in the present invention is a compound of formula (VI). As used herein, the formula (VI): [ka] or a salt thereof, wherein: R3 is -ORO; RO is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R5 is an optionally substituted C10-40 alkyl, an optionally substituted C10-40 alkenyl, or an optionally substituted C10-40 alkynyl, and optionally, one or more methylene groups of R5 is optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN) , C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S (O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O, Each instance of R N is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0545] In certain embodiments, the compound of formula (VI) has the formula (VI-OH): [ka] or a salt thereof. In some embodiments, r is 45.

[0546] In yet another embodiment, the compound of formula (VI) is [ka] or a salt thereof.

[0547] In one embodiment, the compound of formula (VI) is [ka] is.

[0548] In some embodiments, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG lipid.

[0549] In some embodiments, the PEG-lipid can be one or more of the PEG-lipids described in US Application No. 62 / 520,530.

[0550] In some embodiments, the PEG-modified lipids of the present invention include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0551] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of any of Formula I, II, or III, a phospholipid comprising DSPC, a structured lipid, and a PEG lipid comprising PEG-DMG.

[0552] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of any of Formula I, II, or III, a phospholipid comprising DSPC, a structured lipid, and a PEG lipid comprising a compound having Formula VI.

[0553] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of formula I, II, or III, a phospholipid comprising a compound having formula IV, a structured lipid, and a PEG-lipid comprising a compound having formula V or VI.

[0554] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of formula I, II, or III, a phospholipid comprising a compound having formula IV, a structured lipid, and a PEG-lipid comprising a compound having formula V or VI.

[0555] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of formula I, II, or III, a phospholipid having formula IV, a structured lipid, and a PEG-lipid comprising a compound having formula VI.

[0556] In some embodiments, the LNPs of the invention comprise: [ka] and a PEG lipid comprising Formula VI.

[0557] In some embodiments, the LNPs of the invention comprise: [ka] and a lipid substitute comprising oleic acid.

[0558] In some embodiments, the LNPs of the invention comprise: [ka] ionizable cationic lipids, alternative lipids including oleic acid, structured lipids including cholesterol, and PEG lipids including compounds having formula VI.

[0559] In some embodiments, the LNPs of the invention comprise: [ka] the ionizable cationic lipid, a phospholipid comprising DOPE, a structured lipid comprising cholesterol, and a PEG-lipid comprising a compound having formula VI.

[0560] In some embodiments, the LNPs of the invention comprise: [ka] the ionizable cationic lipid, a phospholipid comprising DOPE, a structured lipid comprising cholesterol, and a PEG-lipid comprising a compound having formula VI.

[0561] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 2:1 to about 30:1.

[0562] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 6:1.

[0563] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 3:1.

[0564] In some embodiments, the LNPs of the invention comprise a wt / wt ratio of ionizable cationic lipid component to RNA of about 10:1 to about 100:1.

[0565] In some embodiments, the LNPs of the invention comprise a wt / wt ratio of ionizable cationic lipid component to RNA of about 20:1.

[0566] In some embodiments, the LNPs of the invention comprise a wt / wt ratio of ionizable cationic lipid component to RNA of about 10:1.

[0567] In some embodiments, the LNPs of the invention have an average diameter of about 50 nm to about 150 nm.

[0568] In some embodiments, the LNPs of the invention have an average diameter of about 70 nm to about 120 nm.

[0569] As used herein, the terms "alkyl," "alkyl group," or "alkylene" mean a straight- or branched-chain saturated hydrocarbon containing one or more carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms), which is optionally substituted. The designation "Ci_i4 alkyl" means a straight- or branched-chain saturated hydrocarbon containing 1 to 14 carbon atoms, which is optionally substituted. Unless otherwise specified, alkyl groups described herein refer to both unsubstituted and substituted alkyl groups.

[0570] As used herein, the terms "alkenyl," "alkenyl group," or "alkenylene" refer to an optionally substituted straight- or branched-chain hydrocarbon containing two or more carbon atoms (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms) and at least one double bond. The term "C2-14 alkenyl" refers to an optionally substituted straight- or branched-chain hydrocarbon containing 2 to 14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may contain one, two, three, four, or more carbon-carbon double bonds. For example, a C18 alkenyl may contain one or more double bonds. A C18 alkenyl group containing two double bonds may be a linoleyl group. Unless otherwise specified, alkenyl groups described herein refer to both unsubstituted and substituted alkenyl groups.

[0571] As used herein, the terms "alkynyl," "alkynyl group," or "alkynylene" refer to an optionally substituted, straight- or branched-chain hydrocarbon containing two or more carbon atoms (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms) and at least one carbon-carbon triple bond. The term "C2-14 alkynyl" refers to an optionally substituted, straight- or branched-chain hydrocarbon containing 2 to 14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may contain one, two, three, four, or more carbon-carbon triple bonds. For example, a C18 alkynyl may contain one or more carbon-carbon triple bonds. Unless otherwise specified, alkynyl groups described herein refer to both unsubstituted and substituted alkynyl groups.

[0572] As used herein, the term "carbocycle" or "carbocyclic group" refers to an optionally substituted monocyclic or polycyclic ring system containing one or more rings of carbon atoms. The ring may be 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-membered. The term "C3-6 carbocycle" refers to a carbocycle containing a monocyclic ring having 3 to 6 carbon atoms. A carbocycle may contain one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., a cycloalkyl or aryl group). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2-dihydronaphthyl groups. As used herein, the term "cycloalkyl" refers to a non-aromatic carbocycle, which may or may not contain double or triple bonds. Unless otherwise specified, carbocycles described herein refer to both unsubstituted and substituted carbocyclic groups, ie, carbocycles that are optionally substituted.

[0573] As used herein, the term "heterocycle" or "heterocyclic group" refers to an optionally substituted monocyclic or polycyclic ring system containing one or more rings, at least one of which contains at least one heteroatom. The heteroatom may be, for example, a nitrogen, oxygen, or sulfur atom. The ring may be 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered. The heterocycle may contain one or more double or triple bonds and may be non-aromatic or aromatic (e.g., a heterocycloalkyl group or a heteroaryl group). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. As used herein, the term "heterocycloalkyl" refers to a non-aromatic heterocycle, and may or may not contain double or triple bonds. Unless otherwise specified, the heterocycles described herein refer to both unsubstituted and substituted heterocycles, i.e., optionally substituted heterocycles.

[0574] As used herein, the terms "heteroalkyl," "heteroalkenyl," or "heteroalkynyl" refer to an alkyl, alkenyl, or alkynyl group, as defined herein, that further includes one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus), where one or more heteroatoms are inserted between adjacent carbon atoms in the parent carbon chain and / or where one or more heteroatoms are inserted between a carbon atom and the parent molecule, i.e., the point of attachment. Unless otherwise specified, a heteroalkyl, heteroalkenyl, or heteroalkynyl described herein refers to both unsubstituted heteroalkyl and substituted heteroalkyl, unsubstituted heteroalkenyl and substituted heteroalkenyl, or both unsubstituted heteroalkynyl and substituted heteroalkynyl, i.e., an optionally substituted heteroalkyl, heteroalkenyl, or heteroalkynyl.

[0575] As used herein, a "biodegradable group" is a group that may promote more rapid metabolism of lipids in mammalian organisms. The biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group containing one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group containing one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' may be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the formulas herein, M and M' may be independently selected from the list of biodegradable groups above. Unless otherwise specified, the aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.

[0576] Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents include halogen atoms (e.g., chloride, bromide, fluoride, or iodide), carboxylic acids (e.g., C(O)OH), alcohols (e.g., hydroxyl, OH), esters (e.g., C(O)OR), and the like. OC(O)R), aldehydes (e.g., C(O)H), carbonyls (e.g., represented by C(O)R, or alternatively C═O), acyl halides (e.g., C(O)X, where X is a halide selected from bromide, fluoride, chloride, and iodide), carbonates (e.g., OC(O)OR), alkoxy (e.g., OR), acetals (e.g., C(OR)R″″, where each OR is an alkoxy group which can be the same or different, and R″″ is an alkyl or alkenyl group), phosphates (e.g., P(O)4 3-), thiols (e.g., SH), sulfoxides (e.g., S(O)R), sulfinic acids (e.g., S(O)OH), sulfonic acids (e.g., S(O)OH), thials (e.g., C(S)H), sulfates (e.g., S(O) 42-), sulfonyl (e.g., S(O)2), amido (e.g., C(O)NR2, or N(R)C(O)R), azido (e.g., N3), nitro (e.g., NO2), cyano (e.g., CN), isocyano (e.g., NC), acyloxy (e.g., OC(O)R), amino (e.g., NR2, NRH, or NH2), carbamoyl (e.g., OC(O)NR2, OC(O)NR In some embodiments, the substituent may be selected from the group consisting of, but not limited to, an alkyl group, an alkenyl group, and a cyclyl group (e.g., a carbocyclyl group or a heterocyclyl group). In some embodiments, the substituent may itself be further substituted, for example, with 1, 2, 3, 4, 5, or 6 substituents as defined herein.For example, a C1-6 alkyl group may be further substituted with 1, 2, 3, 4, 5 or 6 substituents as defined herein.

[0577] Nitrogen-containing compounds of the present disclosure can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxide) to yield other compounds of the present disclosure. Thus, all nitrogen-containing compounds shown and claimed are considered to include both the compound as shown and its N-oxide derivative (which may be represented as N→O or N+-O-), where valence and structure permit. Furthermore, in other examples, nitrogen in compounds of the present disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine with an oxidizing agent such as mCPBA. All nitrogen-containing compounds shown and claimed are also considered to include, where valence and structure allow, both the compounds as shown and their N-hydroxy (i.e., N—OH) and N-alkoxy (i.e., N—OR, where R is a substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3- to 14-membered carbocycle, or 3- to 14-membered heterocycle) derivatives.

[0578] mRNA-lipid adducts It has been found that certain ionic lipids are prone to form lipid-polynucleotide adducts.In particular, ionic lipids containing tertiary amine groups can decompose into one or both of secondary amines and reactive aldehyde species that can interact with polynucleotides (such as mRNA), forming impurities called ionic lipid-polynucleotide adducts, which can be detected by reversed-phase ion-pair chromatography (RP-IP HPLC).For example, oxidation of tertiary amines can form N-oxides, which can undergo acid / base catalyzed hydrolysis at the amine to produce aldehydes and secondary amines that can form adducts with mRNA.Therefore, in some embodiments, the impurities called ionic lipid-polynucleotide adducts are impurities called aldehyde-mRNA adducts.

[0579] It has also been found that such adducts can interfere with mRNA translation and affect the activity of mRNA products formulated in lipid nanoparticles (LNPs). Therefore, it may be advantageous to prepare and use LNP compositions with reduced levels of ionic lipid-polynucleotide adduct impurities, for example, less than about 20%, less than about 10%, less than about 5%, or less than about 1% of the mRNA in the form of ionic lipid-polynucleotide adduct impurities that can be measured by RP-IP HPLC. Thus, in some embodiments, LNP compositions are provided with less than about 10%, less than about 5%, or less than about 1% of the mRNA in the form of ionic lipid-polynucleotide adduct impurities that can be measured by RP-IP HPLC, including less than 10%, less than 5%, or less than 1%.

[0580] In some embodiments, the amount of lipid aldehyde in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of N-oxide compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of transition metal, such as Fe, in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of alkyl halide compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of aldehyde compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of ketone compound in the composition is less than about 50 ppm, including less than 50 ppm.In addition, or alternatively, in some embodiments, the amount of conjugated diene compound in the composition is less than about 50 ppm, including less than 50 ppm.

[0581] In some embodiments, the composition is stable against the formation of an ionic lipid-polynucleotide adduct impurity. In some embodiments, the amount of ionic lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 2% per day when stored at a temperature of about 25° C. or less, including an average rate of less than 2% per day. In some embodiments, the amount of ionic lipid-polynucleotide addu...

Claims

1. A messenger RNA (mRNA) comprising a 5'UTR, an open reading frame encoding a polypeptide, and a 3'UTR, wherein the 3'UTR is: (i) A nucleotide sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, or (ii) A nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, or a deletion variant thereof, wherein the deletion variant has 1 to 75 consecutive nucleotides deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, and the nucleic acid sequence or the deletion variant thereof is as follows: a) One or more miRNA binding sites inserted into the nucleic acid sequence or the deletion variant thereof, and / or b) Modified to include, within the nucleic acid sequence or the deletion variant thereof, a TENT recruit sequence, a FUT8 recruit sequence, one or more identification and ratio determination (IDR) sequences, one or more ribosome association detection assay (REDA) sequences, or a combination of one or more IDR sequences and one or more REDA sequences, Messenger RNA (mRNA).

2. (a) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 139, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

139. (b) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 140, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

140. (c) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 141, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

141. (d) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 142, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

142. (e) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 143, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

143. (f) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 144, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

144. (g) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 145, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

145. (h) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 146, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 146, or (i) The 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO: 147, and optionally the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

147. mRNA according to claim 1.

3. The 3'UTR includes a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, (A) The nucleic acid sequence is modified to include one or more miRNA binding sites inserted within the nucleic acid sequence, and optionally, (a) The one or more miRNA binding sites are selected from SEQ ID NOs: 148 to 157. (b) The one or more miRNA binding sites include at least one copy of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150 (c) The one or more miRNA binding sites include at least three copies of sequence number 150, (d) The one or more miRNA binding sites include at least two copies of SEQ ID NO: 149, (e) The one or more miRNA binding sites include at least two copies of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150, or (f) The one or more miRNA binding sites include at least three copies of SEQ ID NO: 148, and / or (B) (a) The nucleic acid sequence is modified to include a TENT recruit sequence that is inserted into the nucleic acid sequence. (b) The nucleic acid sequence is modified to include a FUT8 recruit sequence inserted into the nucleic acid sequence. (c) The nucleic acid sequence is modified to include one or more IDR sequences inserted into the nucleic acid sequence, or (d) The nucleic acid sequence is modified to include one or more REDA sequences inserted within the nucleic acid sequence. mRNA according to claim 1.

4. (a) In the deletion variant, 1 to 60 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 (b) In the deletion variant, 1 to 50 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO:

147. (c) In the deletion variant, 1 to 40 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO:

147. (d) In the deletion variant, 1 to 30 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO:

147. (e) In the deletion variant, 1 to 20 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO:

147. (f) In the deletion variant, one to ten consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, or (g) In the deletion variant, fewer than 10 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO:

147. mRNA according to claim 1.

5. The 5'UTR comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 50, and optionally the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 50, and further optionally, (a) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 139, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (b) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 140, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (c) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 141, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (d) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 142, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (e) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 143, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (f) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 144, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. (g) The 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 145, and the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50. (h) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 146, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO: 50, or (i) The 3'UTR includes the nucleic acid sequence shown in SEQ ID NO: 147, and the 5'UTR includes the nucleic acid sequence shown in SEQ ID NO:

50. mRNA according to claim 1.

6. (a) The mRNA comprises a stop cassette, which optionally is selected from SEQ ID NOs: 158 to 174, and optionally the stop cassette is UAAAGCUCCCCGGGGG (SEQ ID NO: 165) or UAAGCCCCUCUCCGGGGG (SEQ ID NO: 164). (b) The mRNA includes a 5' terminal cap, and optionally the 5' terminal cap is m ７ GpppG ２´ＯＭｅ m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5'methyl G cap, or analogs thereof. (c) The mRNA includes a polyA region, and optionally, (i) The poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length, (ii) The polyA region has a length of about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides, and optionally the polyA region comprises A100-UCUAG-A20-inverted deoxythymidine and / or (d) The mRNA comprises at least one chemically modified nucleic acid base, sugar, backbone, or any combination thereof, wherein the at least one chemically modified nucleic acid base is selected from the group consisting of pseudouracil (ψ), N1-methylpseudracil (m1ψ), 1-ethylpseudracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof. mRNA according to claim 1.

7. The mRNA according to claim 1, wherein the polypeptide comprises a secretory protein, a membrane-bound protein, or an intercellular protein, and optionally the polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, or a component, variant, or fragment thereof.

8. A pharmaceutical composition comprising mRNA according to any one of claims 1 to 7 and a pharmaceutically acceptable carrier.

9. Lipid nanoparticles comprising mRNA according to any one of claims 1 to 7, wherein the lipid nanoparticles optionally include: (i) Ionized lipids, (ii) Phospholipids, (iii) Structural lipids, and (iv) PEG-lipids Lipid nanoparticles comprising, and optionally, the lipid nanoparticles comprising a molar ratio of approximately 20-60% ionized lipids, 5-25% phospholipids, 25-55% cholesterol, and 0.5-15% PEG lipids.

10. (A) The lipid nanoparticles are of formula (I): 【Chemistry 1】 The compound or its N-oxide, or its salt or isomer, In the formula, R' ａ is, R' 分枝 And here, R' 分枝 teeth, 【Chemistry 2】 (Here, 【Transformation 3】 This indicates a connection point. R ａα 、R ａβ 、R ａγ 、and R ａδ are each independently selected from the group consisting of H, C ２～１２ alkyl, and C ２～１２ alkenyl). R ２ and R ３ Each of them is independent of C １～１４ Alkyl and C ２～１４ Selected from the group consisting of alkenils, R ４ is, -(CH ２ ) ｎ OH (where n is selected from the group consisting of 1, 2, 3, 4, and 5), and 【Chemistry 4】 (Here, 【Transformation 5】 This indicates a connection point. R １０ is N(R) ２ And each R is independent of C １～６ Alkyl, C ２～３ n2 is selected from the group consisting of alkenyl and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Each R ５ Independently, C １～３ Alkyl, C ２～３ Selected from the group consisting of alkenyls and H, Each R ６ Independently, C １～３ Alkyl, C ２～３ Selected from the group consisting of alkenyls and H, M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-, R' is C １～１２ Alkyl or C ２～１２ It is alkenyl, l is selected from the group consisting of 1, 2, 3, 4, and 5. m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. (B) The lipid nanoparticles are as follows: (a) (i) Compound II, (ii) Cholesterol, and (iii) PEG-DMG or Compound I, (b) (i) Compound VI, (ii) Cholesterol, and (iii) PEG-DMG or Compound I (c) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG-DMG or Compound I, (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG-DMG or Compound I, (e) (i) Compound II, (ii) Cholesterol, and (iii) Compound I, (f) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I, (g) (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG-DMG or Compound I (h)(i) Compound B, (ii) Cholesterol, and (iii) Compound I, or (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I including and / or (C) (a) The lipid nanoparticles comprise compound II and compound I, (b) The lipid nanoparticles comprise compound B and compound I, or (c) The lipid nanoparticles comprise compound II, DSPC, cholesterol, and compound I. Lipid nanoparticles according to claim 9.

11. The lipid nanoparticles according to claim 9, wherein the lipid nanoparticles are formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, lung, or oral delivery.

12. A pharmaceutical composition comprising lipid nanoparticles as described in claim 9.

13. A cell comprising lipid nanoparticles as described in claim 9.

14. A method for delivering lipid nanoparticles according to claim 9 to cells, comprising contacting the cells with the lipid nanoparticles in vitro or ex vivo.

15. Lipid nanoparticles according to claim 9 for use in a method for treating, preventing, or preventing symptoms of a disease or disorder in a human subject requiring treatment, prevention, or prevention of symptoms of said disease or disorder, wherein the method comprises administering an effective amount of lipid nanoparticles to the human subject.

Images