Anti-CD7 nanobodies and derivatives thereof and their use in tumor therapy - Patents.com

JP2025511151A5Pending Publication Date: 2025-12-15HEBEI SENLANG BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024557967
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-03-30
Filing Date
2022-12-06
Publication Date
2025-12-15

AI Technical Summary

Technical Problem

Current immunotherapies for cancer, such as CAR-T and CAR-NK cell therapies, face challenges in effectively targeting tumor-associated antigens due to limitations in antibody design, particularly in the antigen-binding region.

Method used

Development of anti-CD7 nanobodies and their derivatives, which are single-domain antibodies with high stability, affinity, and specificity for CD7 antigens, enabling targeted delivery of therapeutic molecules to CD7-positive cells.

Benefits of technology

The use of anti-CD7 nanobodies enhances the specificity and efficacy of cancer immunotherapy by selectively targeting CD7-positive tumor cells, minimizing harm to normal immune cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Anti-CD7 nanobodies and their derivatives are provided. The derivatives include humanized anti-CD7 nanobodies, single nanobody-based chimeric antigen receptors, double nanobody-based chimeric antigen receptors, recombinant expression vectors, engineered host cells, conjugates, pharmaceutical compositions, kits and reagents for detecting CD7 on cell surface. The nanobodies have good affinity to CD7, and the prepared CAR-T cells target and recognize tumor antigens and have high killing activity against tumor cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to the following application documents, the contents of which are incorporated by reference in their entirety: Patent application of invention entitled "ANTI-CD7 NANOBODY, AND DERIVATIVE THEREOF AND USE THEREOF IN TUMOR THERAPY", filed on March 30, 2022, having Application No. 2022103314787.

[0002] The present application is in the field of biomedical technology. In particular, the present application relates to anti-CD7 nanobodies, their derivatives and their use in tumor therapy. [Background technology]

[0003] The CD7 antigen is a single-chain glycoprotein and a signature antigen molecule during T cell development. It is expressed by healthy human thymocytes, T cells, and natural killer cells, as well as by hematopoietic stem and progenitor cells, including lymphoid and myeloid progenitors. Many studies have shown that CD7 molecules are expressed in most human T-lymphocytic leukemias and lymphomas (Karube K, Ohshima K, Tsuchiya T, et al., Non-B, non-T neoplasms with lymphoblast morphology: further clarification and classification[J]. The American journal of surgical pathology, 2003, 27(10):1366-1374; Shiyong Li, Jonathan Juco, Karen P. Mann, et al., Flow Cytometry in the Differential Diagnosis of Lymphocyte-Rich Thymoma From Precursor T-Cell Acute Lymphoblastic Leukemia / Lymphoblastic Lymphoma[J]., American Journal of Clinical Pathology, 2004, 121:268-274) and that CD7 antigen is expressed in about 10% of acute myeloid leukemias (AML) (Foon KA, Todd R F. Immunologic classification of leukemia and lymphoma[J].Blood.1986,68:1~31). In addition, when CD7 molecule binds to its corresponding antibody, endocytosis occurs rapidly. This characteristic makes CD7 a suitable antigen receptor for targeted delivery of various functional molecules to CD7 positive cells. Related studies also show that there is a group of CD7 negative T lymphocytes in the human body, which can maintain the normal immune function of the human body and avoid the decrease in immune function caused by using CD7 nanobody-associated immune cells to eliminate all CD7 positive cells. It can also be understood that targeting CD7 is a promising guide for anti-tumor.

[0004] Chimeric antigen receptor-modified T cells (CAR-T) and chimeric antigen receptor-modified NK cells (CAR-NK) immunotherapy are the two most rapidly developed immunotherapies against cancer cells, and the effective activation of CAR-T / CAR-NK cells is highly dependent on the specificity of the antibody that recognizes the tumor-associated antigen and the affinity of the antibody-antigen binding. Therefore, in the current situation where the design in the intracellular signaling region of CAR-T / CAR-NK cells has matured, the design of the antigen-binding region has become the focus and clue for the development of novel CAR-T technology. There are heavy chain antibodies (HCAbs) that are naturally devoid of light chains in camelids (camels, alpacas) or sharks, and the HCAbs contain only one heavy chain variable region and two conventional CH2 and CH3 regions. The heavy chain variable region of HCAbs has stability and antigen-binding activity comparable to heavy chain antibodies, has a size of only 2.4 × 4 nm, and is the smallest fragment that can bind to antigens, and is called a single domain antibody (the variable domain of the heavy chain of heavy chain antibodies, VHH) or nanobody. Compared with conventional antibodies, VHH single domain antibodies have low molecular weight, high expression level, good chemical stability, high affinity, high homology with human antibodies and low immunogenicity. The low molecular weight makes it easy to carry out genetic engineering and construct bi- or multi-specific single domain antibody combinations to achieve the effect of multiple targets or multiple functions with one molecule. VHH has good tissue penetration and has the potential to access relatively hidden targets that cannot be accessed by conventional antibodies during tumor treatment. Due to these advantages, the use of single domain antibodies as the antigen-binding region of CAR for CAR modification and CAR-T / CAR-NK cell therapy can provide a new tumor treatment strategy in this field. Summary of the Invention [Problem to be solved by the invention]

[0005] In view of the above, it is an object of the present application to provide anti-CD7 nanobodies, their derivatives and their use in tumor therapy. [Means for solving the problem]

[0006] The objectives of this application are achieved through the following technical solutions: A first aspect of the present application provides an anti-CD7 nanobody. Further, the nanobody is any one of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 or VHH20; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH01 are as set forth in SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH03 are as set forth in SEQ ID NO:11, SEQ ID NO:13 and SEQ ID NO:15, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:11, SEQ ID NO:13 and SEQ ID NO:15, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH04 are as set forth in SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH06 are as set forth in SEQ ID NO:27, SEQ ID NO:29 and SEQ ID NO:31, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:27, SEQ ID NO:29 and SEQ ID NO:31, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH07 are as set forth in SEQ ID NO:35, SEQ ID NO:37 and SEQ ID NO:39, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:35, SEQ ID NO:37 and SEQ ID NO:39, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH08 are as set forth in SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:47, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:47, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH09 are as set forth in SEQ ID NO:51, SEQ ID NO:53 and SEQ ID NO:55, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:51, SEQ ID NO:53 and SEQ ID NO:55, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH10 are as set forth in SEQ ID NO:59, SEQ ID NO:61 and SEQ ID NO:63, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:59, SEQ ID NO:61 and SEQ ID NO:63, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH12 are as set forth in SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH13 are as set forth in SEQ ID NO:75, SEQ ID NO:77 and SEQ ID NO:79, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:75, SEQ ID NO:77 and SEQ ID NO:79, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH14 are as set forth in SEQ ID NO:83, SEQ ID NO:85 and SEQ ID NO:87, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:83, SEQ ID NO:85 and SEQ ID NO:87, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH15 are as set forth in SEQ ID NO:91, SEQ ID NO:93 and SEQ ID NO:95, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:91, SEQ ID NO:93 and SEQ ID NO:95, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH16 are as set forth in SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH17 are as set forth in SEQ ID NO:107, SEQ ID NO:109 and SEQ ID NO:111, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:107, SEQ ID NO:109 and SEQ ID NO:111, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH18 are as set forth in SEQ ID NO:115, SEQ ID NO:117 and SEQ ID NO:119, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:115, SEQ ID NO:117 and SEQ ID NO:119, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH19 are as set forth in SEQ ID NO:123, SEQ ID NO:125 and SEQ ID NO:127, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:123, SEQ ID NO:125 and SEQ ID NO:127, respectively; Preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of VHH20 are as set forth in SEQ ID NO:131, SEQ ID NO:133 and SEQ ID NO:135, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:131, SEQ ID NO:133 and SEQ ID NO:135, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH01 are as set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH03 are as set forth in SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH04 are as set forth in SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH06 are as set forth in SEQ ID NO:28, SEQ ID NO:30 and SEQ ID NO:32, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:28, SEQ ID NO:30 and SEQ ID NO:32, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH07 are as set forth in SEQ ID NO:36, SEQ ID NO:38 and SEQ ID NO:40, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:36, SEQ ID NO:38 and SEQ ID NO:40, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH08 are as set forth in SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH09 are as set forth in SEQ ID NO:52, SEQ ID NO:54 and SEQ ID NO:56, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:52, SEQ ID NO:54 and SEQ ID NO:56, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH10 are as set forth in SEQ ID NO:60, SEQ ID NO:62 and SEQ ID NO:64, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:60, SEQ ID NO:62 and SEQ ID NO:64, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH12 are as set forth in SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72, respectively, or are nucleotide sequences that are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH13 are as set forth in SEQ ID NO:76, SEQ ID NO:78 and SEQ ID NO:80, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:76, SEQ ID NO:78 and SEQ ID NO:80, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH14 are as set forth in SEQ ID NO:84, SEQ ID NO:86 and SEQ ID NO:88, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:84, SEQ ID NO:86 and SEQ ID NO:88, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH15 are as set forth in SEQ ID NO:92, SEQ ID NO:94 and SEQ ID NO:96, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:92, SEQ ID NO:94 and SEQ ID NO:96, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH16 are as set forth in SEQ ID NO:100, SEQ ID NO:102 and SEQ ID NO:104, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:100, SEQ ID NO:102 and SEQ ID NO:104, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH17 are as set forth in SEQ ID NO:108, SEQ ID NO:110 and SEQ ID NO:112, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:108, SEQ ID NO:110 and SEQ ID NO:112, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH18 are as set forth in SEQ ID NO:116, SEQ ID NO:118 and SEQ ID NO:120, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:116, SEQ ID NO:118 and SEQ ID NO:120, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH19 are as set forth in SEQ ID NO:124, SEQ ID NO:126 and SEQ ID NO:128, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:124, SEQ ID NO:126 and SEQ ID NO:128, respectively; More preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH20 are as set forth in SEQ ID NO:132, SEQ ID NO:134 and SEQ ID NO:136, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:132, SEQ ID NO:134 and SEQ ID NO:136, respectively; Most preferably, the amino acid sequences of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 and VHH20 are as set forth in SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:25, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:49, SEQ ID NO:57, SEQ ID NO:65, SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121 and SEQ ID NO:129, respectively. or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:25, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:49, SEQ ID NO:57, SEQ ID NO:65, SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121 and SEQ ID NO:129, respectively; Most preferably, the nucleotide sequences of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 and VHH20 are as set forth in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 and SEQ ID NO:130, respectively. or a nucleotide sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 and SEQ ID NO:130, respectively.

[0007] Furthermore, Nanobodies derived from any combination of the amino acid or nucleotide sequences of one or more CDR1, CDR2 and CDR3 of VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 or VHH20 are also within the scope of the application.

[0008] Moreover, CD7 is a very stable marker on the surface of T cells. Both naive T cells and mature T cells express CD7, so that both patients with naive T cell tumors (T-ALL / LBL / NKT cell leukemia) and patients with mature T cell tumors (peripheral T cell lymphoma, NKT cell lymphoma and anaplastic large cell lymphoma) basically express CD7 at high levels. Therefore, CAR-T, which targets this target to treat T lineage blood tumors, is one of the most rapidly developing technologies in clinical practice at present.

[0009] A second aspect of the present application provides a humanized anti-CD7 nanobody. Furthermore, humanized anti-CD7 nanobodies are obtained by humanizing residues at key positions in the nanobodies using the universal humanization framework h-NbBcII10FGLA as a reference through alignment with DP-47; Preferably, the humanized anti-CD7 nanobody is any one of hVHH01, hVHH03, hVHH04, hVHH06, hVHH07, hVHH08, hVHH09, hVHH10, hVHH12, hVHH13, hVHH14, hVHH15, hVHH16, hVHH17, hVHH18, hVHH19 or hVHH20; More preferably, the amino acid sequences of CDR1, CDR2 and CDR3 of hVHH06 are as set forth in SEQ ID NO:139, SEQ ID NO:141 and SEQ ID NO:143, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:139, SEQ ID NO:141 and SEQ ID NO:143, respectively; Most preferably, the nucleotide sequences of CDR1, CDR2 and CDR3 of hVHH06 are as set forth in SEQ ID NO:140, SEQ ID NO:142 and SEQ ID NO:144, respectively, or are at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:140, SEQ ID NO:142 and SEQ ID NO:144, respectively; Most preferably, the amino acid sequence of hVHH06 is as set forth in SEQ ID NO:137, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:137; Most preferably, the nucleotide sequence of hVHH06 is as set forth in SEQ ID NO:138 or is a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:138.

[0010] A third aspect of the present application provides a chimeric antigen receptor based on a single nanobody. Furthermore, the chimeric antigen receptor comprises any one selected from a Nanobody according to the first aspect of the present application or a humanized anti-CD7 Nanobody according to the second aspect of the present application; Preferably, the chimeric antigen receptor further comprises a transmembrane domain; Preferably, the chimeric antigen receptor further comprises an intracellular signaling domain; Preferably, the chimeric antigen receptor further comprises a hinge region; Preferably, the chimeric antigen receptor further comprises a signal peptide; Preferably, the chimeric antigen receptor further comprises a costimulatory signaling domain; Preferably, the chimeric antigen receptor further comprises the promoter EF1α; Preferably, the chimeric antigen receptor further comprises the self-cleaving peptide T2A; Preferably, the chimeric antigen receptor further comprises a detection tag / auxiliary functional element tEGFR; More preferably, the transmembrane domain comprises the transmembrane domain of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; More preferably, the intracellular signaling domain comprises the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d; More preferably, the hinge region comprises the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; More preferably, the signal peptide comprises the signal peptide of the following molecules: the alpha and beta chains of the T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF; More preferably, the costimulatory signaling domain comprises the costimulatory signaling domain of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226; More preferably, the promoter is not limited to the EF1α promoter, but further includes: the CMV promoter, the EFS promoter, the CAG promoter, the CBh promoter, the SFFV promoter, the MSCV promoter, the SV40 promoter, the mPGK promoter, the hPGK promoter and the UBC promoter; More preferably, the self-cleaving peptides are not limited to T2A, but further include: P2A, E2A and F2A; More preferably, the detection tag / auxiliary functional element includes, but is not limited to, tEGFR, as well as: tCD34, tCD19, tCD20, tCD22, immune checkpoint inhibitors (CTLA-4, PD-1 / PD-L1, LAG-3, TIM-3, TIGIT, CD226, CD155, CD47, B7-H3, B7-H4) nanobodies, cytokines and their receptors (IL2, IL2 receptor, IL7, IL7 receptor, IL15 and IL15 receptor); Most preferably, the transmembrane domain is a CD8α transmembrane domain; Most preferably, the intracellular signaling domain is a CD3ζ intracellular signaling domain; Most preferably, the hinge region is a CD8α hinge region; Most preferably, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain; Most preferably, the amino acid sequence of the signal peptide is as set forth in SEQ ID NO:145, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:145; Most preferably, the nucleotide sequence of the signal peptide is as set forth in SEQ ID NO:146, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:146; Most preferably, the amino acid sequence of the CD8α hinge region is as set forth in SEQ ID NO:147, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:147; Most preferably, the nucleotide sequence of the CD8α hinge region is as set forth in SEQ ID NO:148, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:148; Most preferably, the amino acid sequence of the CD8α transmembrane domain is as set forth in SEQ ID NO:149, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:149; Most preferably, the nucleotide sequence of the CD8α transmembrane domain is as set forth in SEQ ID NO:150, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:150; Most preferably, the amino acid sequence of the 4-1BB costimulatory signaling domain is as set forth in SEQ ID NO:151, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:151; Most preferably, the nucleotide sequence of the 4-1BB costimulatory signaling domain is as set forth in SEQ ID NO:152, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:152; Most preferably, the amino acid sequence of the CD3 zeta intracellular signaling domain is as set forth in SEQ ID NO:153, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:153; Most preferably, the nucleotide sequence of the CD3 zeta intracellular signaling domain is as set forth in SEQ ID NO:154, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:154; Most preferably, the amino acid sequence of T2A is as set forth in SEQ ID NO:155, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:155; Most preferably, the nucleotide sequence of T2A is as set forth in SEQ ID NO:156, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:156; Most preferably, the nucleotide sequence of EF1α is as set forth in SEQ ID NO:157, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:157; Most preferably, the amino acid sequence of the tEGFR signal peptide is as set forth in SEQ ID NO:158, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:158; Most preferably, the nucleotide sequence of the tEGFR signal peptide is as set forth in SEQ ID NO:159, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:159; Most preferably, the amino acid sequence of tEGFR is as set forth in SEQ ID NO: 160, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 160; Most preferably, the nucleotide sequence of tEGFR is as set forth in SEQ ID NO:161, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:161; Most preferably, the chimeric antigen receptor is obtained by consecutively linking in order EF1α, a signal peptide, any one selected from a Nanobody according to the first aspect of the present application or a humanized anti-CD7 Nanobody according to the second aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and tEGFR.

[0011] A fourth aspect of the present application provides a chimeric antigen receptor based on a double nanobody. Furthermore, the chimeric antigen receptor comprises any two selected from a Nanobody according to the first aspect of the present application or a humanized anti-CD7 Nanobody according to the second aspect of the present application; Preferably, the chimeric antigen receptor further comprises a transmembrane domain; Preferably, the chimeric antigen receptor further comprises an intracellular signaling domain; Preferably, the chimeric antigen receptor further comprises a hinge region; Preferably, the chimeric antigen receptor further comprises a signal peptide; Preferably, the chimeric antigen receptor further comprises a costimulatory signaling domain; Preferably, the chimeric antigen receptor further comprises the promoter EF1α; Preferably, the chimeric antigen receptor further comprises the self-cleaving peptide T2A; Preferably, the chimeric antigen receptor further comprises a detection tag / auxiliary functional element tEGFR; More preferably, the transmembrane domain comprises the transmembrane domain of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; More preferably, the intracellular signaling domain comprises the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d; More preferably, the hinge region comprises the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; More preferably, the signal peptide comprises the signal peptide of the following molecules: the alpha and beta chains of the T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF; More preferably, the costimulatory signaling domain comprises the costimulatory signaling domain of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226; More preferably, the promoter is not limited to the EF1α promoter, but further includes: the CMV promoter, the EFS promoter, the CAG promoter, the CBh promoter, the SFFV promoter, the MSCV promoter, the SV40 promoter, the mPGK promoter, the hPGK promoter and the UBC promoter; More preferably, the self-cleaving peptides are not limited to T2A, but further include: P2A, E2A and F2A; More preferably, the detection tag / auxiliary functional element is not limited to tEGFR, but further includes: tCD34, tCD19, tCD20, tCD22, immune checkpoint inhibitors (CTLA-4, PD-1 / PD-L1, LAG-3, TIM-3, TIGIT, CD226, CD155, CD47, B7-H3, B7-H4) nanobodies, cytokines and their receptors (IL2, IL2 receptor, IL7, IL7 receptor, IL15 and IL15 receptor); Most preferably, the transmembrane domain is a CD8α transmembrane domain; Most preferably, the intracellular signaling domain is a CD3ζ intracellular signaling domain; Most preferably, the hinge region is a CD8α hinge region; Most preferably, the costimulatory signaling domain is a 4-1BB costimulatory signaling domain; Most preferably, any two Nanobodies selected from a Nanobody according to the first aspect of the application or a humanized anti-CD7 Nanobody according to the second aspect of the application are linked via a connecting peptide linker; Most preferably, the chimeric antigen receptor is obtained by sequentially linking in order: EF1α, a signal peptide, any two selected from a Nanobody according to the first aspect of the present application or a humanized anti-CD7 Nanobody according to the second aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the chimeric antigen receptor is obtained by consecutively linking in order: EF1α, a signal peptide, any one selected from the Nanobodies according to the first aspect of the present application, a linker, any one selected from the Nanobodies according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, any one selected from the Nanobodies according to the first aspect of the application is VHH03, VHH06, VHH10 or VHH12; Most preferably, the chimeric antigen receptor is obtained by consecutively linking in order: EF1α, a signal peptide, VHH06 according to the first aspect of the present application, a linker, VHH03 according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the chimeric antigen receptor is obtained by sequentially linking in order EF1α, a signal peptide, VHH06 according to the first aspect of the present application, a linker, a VHH12 according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the chimeric antigen receptor is obtained by sequentially linking in order EF1α, a signal peptide, a VHH10 according to the first aspect of the present application, a linker, a VHH12 according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the chimeric antigen receptor is obtained by consecutively linking in order EF1α, a signal peptide, a VHH10 according to the first aspect of the present application, a linker, a VHH10 according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the chimeric antigen receptor is obtained by sequentially linking in order EF1α, a signal peptide, a VHH12 according to the first aspect of the present application, a linker, a VHH12 according to the first aspect of the present application, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signalling domain, a CD3ζ intracellular signalling domain, T2A, a tEGFR signal peptide and a tEGFR; Most preferably, the amino acid sequence of the signal peptide is as set forth in SEQ ID NO:145, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:145; Most preferably, the nucleotide sequence of the signal peptide is as set forth in SEQ ID NO:146, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:146; Most preferably, the amino acid sequence of the CD8α hinge region is as set forth in SEQ ID NO:147, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:147; Most preferably, the nucleotide sequence of the CD8α hinge region is as set forth in SEQ ID NO:148, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:148; Most preferably, the amino acid sequence of the CD8α transmembrane domain is as set forth in SEQ ID NO:149, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:149; Most preferably, the nucleotide sequence of the CD8α transmembrane domain is as set forth in SEQ ID NO:150, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:150; Most preferably, the amino acid sequence of the 4-1BB costimulatory signaling domain is as set forth in SEQ ID NO:151, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:151; Most preferably, the nucleotide sequence of the 4-1BB costimulatory signaling domain is as set forth in SEQ ID NO:152, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:152; Most preferably, the amino acid sequence of the CD3 zeta intracellular signaling domain is as set forth in SEQ ID NO:153, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:153; Most preferably, the nucleotide sequence of the CD3 zeta intracellular signaling domain is as set forth in SEQ ID NO:154, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:154; Most preferably, the amino acid sequence of T2A is as set forth in SEQ ID NO:155, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:155; Most preferably, the nucleotide sequence of T2A is as set forth in SEQ ID NO:156, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:156; Most preferably, the nucleotide sequence of EF1α is as set forth in SEQ ID NO:157, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:157; Most preferably, the amino acid sequence of the tEGFR signal peptide is as set forth in SEQ ID NO:158, or an amino acid sequence at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:158; Most preferably, the nucleotide sequence of the tEGFR signal peptide is as set forth in SEQ ID NO:159, or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:159; Most preferably, the amino acid sequence of tEGFR is as set forth in SEQ ID NO: 160, or an amino acid sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 160; Most preferably, the nucleotide sequence of tEGFR is as set forth in SEQ ID NO:161 or a nucleotide sequence that is at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:161.

[0012] Also expressly included within the scope of this application are functional portions of the chimeric antigen receptors (CARs) disclosed herein. When used in reference to chimeric antigen receptors (CARs), the term "functional portion" refers to any portion or fragment of the CAR disclosed herein, which portion or fragment retains the biological activity of the CAR of which it is a part (the parent CAR). A functional portion includes, for example, a portion of a CAR that retains the ability to recognize target cells or detect, treat or prevent disease to a similar extent, to the same extent, or to a greater extent than the parent CAR. With reference to a parent CAR, a functional portion may comprise, for example, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95% or more of the parent CAR.

[0013] A functional moiety may contain additional amino acids at the amino or carboxy terminus of the moiety, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent CAR. Desirably, the additional amino acids do not interfere with the biological function of the functional moiety, such as recognizing target cells, detecting cancer, treating or preventing cancer, etc. More desirably, the additional amino acids enhance the biological activity compared to the biological activity of the parent CAR.

[0014] The scope of this disclosure includes functional variants of the CARs disclosed herein.As used herein, the term "functional variant" refers to a CAR, polypeptide or protein that has substantial or significant sequence identity or similarity with the parent CAR, and the functional variant retains the biological activity of the CAR that is the variant.Functional variants include, for example, variants of the CARs (parent CARs) described herein that retain the ability to recognize target cells to a similar extent, to the same extent, or to a greater extent than the parent CAR.With reference to the parent CAR, the functional variant can be, for example, at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent CAR.

[0015] A functional variant may, for example, comprise the amino acid sequence of a parent CAR with at least one conservative amino acid substitution. Alternatively or additionally, a functional variant may comprise the amino acid sequence of a parent CAR with at least one non-conservative amino acid substitution. In this case, it is preferred that the non-conservative amino acid substitution does not interfere with or inhibit the biological activity of the functional variant. The non-conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased compared to the parent CAR.

[0016] The amino acid substitutions of CAR are preferably conservative amino acid substitutions. Conservative amino acid substitutions are well known in the art and include amino acid substitutions in which an amino acid having certain physical and / or chemical properties is replaced with another amino acid having the same or similar chemical or physical properties. For example, conservative amino acid substitutions can be the substitution of an acidic / negatively charged polar amino acid with another acidic / negatively charged polar amino acid (e.g., Asp or Glu), an amino acid with a nonpolar side chain with another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, Ile, Leu, Met, Phe, Pro, Trp, Cys, Val, etc.), a basic / positively charged polar amino acid with another basic / positively charged polar amino acid (e.g., Lys, His, Arg, etc.), an uncharged amino acid with a polar side chain with another uncharged amino acid with a polar side chain (e.g., Asn, Gln, Ser, Thr, Tyr, etc.), an amino acid with a beta-branched side chain with another amino acid with a beta-branched side chain (e.g., He, Thr and Val), an amino acid with an aromatic side chain with another amino acid with an aromatic side chain (e.g., His, Phe, Trp and Tyr), and the like.

[0017] CARs can essentially consist of a particular amino acid sequence or sequences described herein, such that other components, e.g., other amino acids, do not substantially alter the biological activity of the functional variant. CARs (including functional portions and functional variants) can be of any length, i.e., can contain any number of amino acids, so long as the CARs (or functional portions or functional variants thereof) retain their biological activity, such as the ability to specifically bind to an antigen, detect diseased cells in a mammal, or treat or prevent disease in a mammal. For example, CARs can be about 50 to about 5000 amino acids long, e.g., 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids long.

[0018] CARs (including functional portions and functional variants of the present application) may contain synthetic amino acids in place of one or more naturally occurring amino acids. Such synthetic amino acids are well known in the art and include, for example, aminocyclohexanecarboxylic acid, norleucine, -amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, isopropylaminopropionate ... Lysine-2-carboxylic acid, l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, -aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, γ-diaminobutanoic acid, β-diaminopropionic acid, homophenylalanine and a-tert-butylglycine.

[0019] CARs (including functional portions and functional variants) can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized, e.g., using disulfide bridges or converted to acid addition salts, and / or optionally dimerized or polymerized or conjugated.

[0020] A fifth aspect of the application provides a nucleic acid molecule. Furthermore, the nucleic acid molecule comprises a nucleotide sequence encoding a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, or a chimeric antigen receptor according to the fourth aspect of the application; Preferably, the nucleotide sequence is as set forth in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 or SEQ ID NO:130, or as set forth in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO: 50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 or SEQ ID NO:130.

[0021] As used herein, a "nucleic acid molecule" or "nucleic acid" may contain natural, non-natural or altered nucleotides, and may contain natural, non-natural or altered internucleotide linkages, such as phosphoramidate or phosphorothioate linkages instead of phosphodiesters found between nucleotides of unmodified oligonucleotides. In some embodiments, the nucleic acid does not contain any insertions, deletions, inversions and / or substitutions. However, as discussed herein, in some cases it may be preferred for the nucleic acid to contain one or more insertions, deletions, inversions and / or substitutions, and thus the nucleic acids formed using these insertions, deletions, inversions and / or substitutions are also within the scope of this application.

[0022] In specific embodiments of the present application, nucleic acid molecules include those that may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides (e.g., phosphorothioate derivatives and acridine substituted nucleotides) to increase the biological stability of the molecule or to increase the physical stability of the duplex formed upon hybridization. Examples of modified nucleotides that can be used to generate nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-substituted cytosine, 5-methyl ... adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueuosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine.

[0023] A sixth aspect of the present application provides a recombinant expression vector. Furthermore, the recombinant expression vector comprises a nucleic acid molecule according to the fifth aspect of the present application; Preferably, the expression vector comprises a DNA vector, an RNA vector, a plasmid, a transposon vector, a CRISPR / Cas9 vector or a viral vector; More preferably, the viral vector comprises a lentiviral vector, an adenoviral vector, or a retroviral vector.

[0024] In one embodiment, the recombinant expression vector may be any suitable recombinant expression vector and may be used to transform or transfect any suitable host cell. Suitable vectors include those designed for propagation and growth, or for expression, or both, such as plasmids and viruses. The vector may be selected from the group consisting of pUC series (Fermentas Life Sciences, Glen Bumie, MD), pBluescript series (Stratagene, LaJolla, CA), pET series (Novagen, Madison, WI), pGEX series (Pharmacia Biotech, Uppsala, Sweden) and pEX series (Clontech, Palo Alto, CA).

[0025] Bacteriophage vectors such as λZapII (Stratagene), EMBL4 and λNMI149 may also be used. Examples of plant expression vectors include pBIO1, pBI101.2, pBHO1.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). The recombinant expression vector may be a viral vector, such as a retroviral vector or a lentiviral vector. Lentiviral vectors are vectors derived from at least a portion of the lentiviral genome, including in particular the self-inactivating lentiviral vectors set forth in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that may be used in the clinic include, for example and without limitation, Oxford BioMedica plc's LENTIVECTOR® gene delivery technology, Lentigen's LENTIMAX™ vector system, and the like. Preclinical lentiviral vectors are also available and are known to those of skill in the art.

[0026] Recombinant expression vectors are specific for the type of host cell into which they are introduced (e.g., bacteria, fungi, plants, or animals) and may contain control sequences, such as transcriptional and translational initiation and termination codons, as appropriate, depending on whether the vector is DNA- or RNA-based. Recombinant expression vectors may also contain restriction sites to facilitate cloning.

[0027] The recombinant expression vector may contain one or more marker genes that allow for the selection of transformed or transfected host cells. Marker genes include biocide resistance, resistance to, e.g., antibiotics, heavy metals, etc., complementation in auxotrophic hosts such as providing prototrophy, etc. Suitable marker genes for the expression vector of the present invention include, for example, neomycin / G418 resistance gene, hygromycin resistance gene, histidinol resistance gene, tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, puromycin resistance gene, etc.

[0028] The recombinant expression vector may include a native or non-native promoter operably linked to a nucleotide sequence encoding the CAR (including functional portions and functional variants thereof) or a nucleotide sequence that is complementary to or hybridizes to the nucleotide sequence encoding the CAR. For example, the selection of strong, weak, inducible, tissue-specific and development-specific promoters is within the skill of the art. Similarly, the combination of a nucleotide sequence and a promoter is within the skill of the art. The promoter may be a non-viral promoter or a viral promoter, such as a type III promoter (U6 promoter, H1 promoter), a mammalian constitutive promoter (universal promoter): CMV (cytomegalovirus) promoter; EF1A (elongation factor-1 alpha) promoter; EFS promoter; CAG (composed of the cytomegalovirus enhancer and chicken β-actin promoter) promoter; CBh promoter; SFFV promoter; MSCV promoter; SV40 (from a monkey virus) promoter; mPGK promoter; hPGK (phosphoglycerate kinase) promoter; UBC (ubiquitin C) promoter, RSV promoter or a promoter found in the long terminal repeat of murine stem cell virus.

[0029] Recombinant expression vectors can be designed for either transient expression, for stable expression, or both. Similarly, recombinant expression vectors can be made for constitutive or inducible expression.

[0030] Furthermore, recombinant expression vectors can be made to contain suicide genes. As used herein, the term "suicide gene" refers to a gene that causes the death of the cell that expresses the suicide gene. A suicide gene can be a gene that confers sensitivity to an agent, such as a drug, in the cell in which the gene is expressed, causing the death of the cell when the cell is contacted or exposed to the agent. Suicide genes are well known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004), and include, for example, herpes simplex virus (HSV) thymidine kinase (TK) gene, cytosine deaminase, purine nucleoside phosphorylase and nitroreductase.

[0031] A seventh aspect of the application provides an engineered host cell. Furthermore, the engineered host cell expresses a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, or a chimeric antigen receptor according to the fourth aspect of the application; Preferably, the engineered host cell comprises a recombinant expression vector according to the sixth aspect of the present application; Preferably, the engineered host cell comprises an engineered immune cell; More preferably, the engineered immune cells comprise T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, NKT cells, or any combination thereof.

[0032] As used herein, the term "host cell" refers to any type of cell. The host cell may be a eukaryotic cell, such as a plant, animal, fungus or algae, or a prokaryotic cell, such as a bacterium or protozoan. The host cell may be a cultured cell or a primary cell, i.e., directly isolated from an organism, such as a human. The host cell may be an adherent cell or a suspension cell, i.e., a cell that grows in suspension. Suitable host cells are well known in the art and include, for example, DH5a E.coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, etc. For the purpose of amplifying or replicating a recombinant expression vector, the host cell may be a prokaryotic cell, such as a DH5α cell. For the purpose of producing a recombinant CAR, the host cell may be a mammalian cell. The host cell may be a human cell. The host cell may be any cell type. While the host cells may be from any type of tissue and at any stage of development, they may be peripheral blood lymphocytes (PBLs) or peripheral blood mononuclear cells (PBMCs). In certain embodiments of the present application, the host cells are T cells.

[0033] Furthermore, an engineered host cell includes a population of engineered host cells. Furthermore, the population of engineered host cells comprises host cells that do not express a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, or a chimeric antigen receptor according to the fourth aspect of the application.

[0034] Furthermore, the host cell is an immune cell. Furthermore, immune cells include T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, NKT cells, or any combination thereof.

[0035] An eighth aspect of the present application provides a conjugate. Furthermore, the conjugate comprises a Nanobody according to the first aspect of the application or a humanized anti-CD7 Nanobody according to the second aspect of the application and a modifying moiety tethered to the Nanobody, wherein the modifying moiety comprises a detectable label, a therapeutic agent; Preferably, the detectable label comprises an enzyme, a radionuclide, a fluorescent dye, a luminescent material, biotin, Preferably, the therapeutic agent comprises a cytotoxic agent or a drug with anti-tumor activity.

[0036] A ninth aspect of the present application provides a pharmaceutical composition. Furthermore, the pharmaceutical composition comprises a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, a chimeric antigen receptor according to the fourth aspect of the application, a nucleic acid molecule according to the fifth aspect of the application, a recombinant expression vector according to the sixth aspect of the application, an engineered host cell according to the seventh aspect of the application or a conjugate according to the eighth aspect of the application.

[0037] Additionally, the pharmaceutical composition may further comprise an additional pharma- ceutical active agent; Preferably, the additional pharma- ceutical active agent comprises an additional antibody, a fusion protein or a drug (eg, an anti-tumor drug, such as a drug for radiation therapy or a chemotherapeutic drug).

[0038] Additionally, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier and / or excipient. In addition, pharma- ceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th edition, 1995). These substances are used to aid the stability of drugs or to aid in improving the effectiveness of active ingredients, if necessary. The preparations that can be used in the present pharmaceutical composition can be in the form of their original compounds themselves, or optionally in the form of their pharma- ceutically acceptable salts. Thereby, the pharmaceutical composition that is prepared can be administered in any suitable manner known to those skilled in the art, if necessary.

[0039] The pharma- ceutically acceptable carriers and / or excipients may additionally contain liquids such as water, physiological saline, glycerin, and ethanol. In addition, auxiliary substances such as wetting or emulsifying agents or pH buffering substances may be present in the composition. These carriers allow the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, and suspensions for ingestion by the patient.

[0040] Suitable forms of administration include those suitable for parenteral administration, e.g., by injection or infusion, e.g., by bolus injection or continuous infusion, intravenous, inhaled or subcutaneous forms. If the product is for injection or infusion, it may be in the form of a suspension, solution or emulsion in an oily or aqueous vehicle, and may contain formulation agents such as suspending, preserving, stabilizing and / or dispersing agents. Alternatively, the nanobodies provided by the present application may be in dry form for reconstitution with a suitable sterile liquid before use. Solid forms suitable for dissolution or suspension in a liquid vehicle before injection may also be prepared.

[0041] A tenth aspect of the present application provides a kit. Furthermore, the kit comprises a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, a chimeric antigen receptor according to the fourth aspect of the application, a nucleic acid molecule according to the fifth aspect of the application, a recombinant expression vector according to the sixth aspect of the application, an engineered host cell according to the seventh aspect of the application or a conjugate according to the eighth aspect of the application.

[0042] An eleventh aspect of the present application provides a reagent for detecting CD7 protein or an antigenic fragment thereof. Furthermore, the reagent for detecting CD7 protein or an antigenic fragment thereof comprises a Nanobody according to the first aspect of the present application, a humanized anti-CD7 Nanobody according to the second aspect of the present application, or a conjugate according to the eighth aspect of the present application.

[0043] A twelfth aspect of the present application provides a biological preparation. Furthermore, the biological preparation comprises an engineered host cell according to the seventh aspect of the present application and / or a pharmaceutical composition according to the ninth aspect of the present application.

[0044] Furthermore, the biological preparations described in this application are also known as biological drugs, biological (medical) products or biological products, and are any pharmaceutical products that are semi-synthesized, extracted or made from biological sources. These include, but are not limited to, vaccines, blood or blood components and recombinant therapeutic proteins (e.g., antibodies, cytokines, chemokines and fusion proteins). Biological preparations may be composed of sugars, proteins or nucleic acids or complex combinations of these substances.

[0045] A pharmaceutical composition or biological preparation or composition thereof is provided herein for use in gene therapy, immunotherapy and / or cell therapy, comprising one or more of the disclosed CARs, immune cells expressing a CAR, nanobodies or conjugates that specifically bind to one or more antibodies disclosed herein in a carrier (e.g., a pharma- ceutically acceptable carrier). The pharmaceutical composition or biological preparation or composition thereof may be prepared in a unit dosage form for administration to a subject. The amount and timing of administration to achieve a desired outcome is at the discretion of the treating physician. The composition may be formulated for systemic (e.g., intravenous) or local (e.g., intratumoral) administration. In one example, the CARs, immune cells expressing a CAR (particularly T cells expressing a CAR), nanobodies or conjugates of the present disclosure are formulated for parenteral administration, e.g., intravenous administration. The CARs, immune cells expressing a CAR (particularly T cells expressing a CAR), conjugates or compositions thereof disclosed herein are for use, for example, for the treatment and detection of tumors, e.g., but not limited to, tumors expressing CD7. In some examples, the pharmaceutical composition or biological preparation or composition thereof is useful for treating or detecting tumors. The CARs, CAR-expressing immune cells (particularly CAR-expressing T cells), nanobodies, conjugates or compositions thereof disclosed herein are also for use, for example, for detection of CD7 antigens.

[0046] The pharmaceutical compositions or biological preparations or compositions thereof for administration may comprise a solution of CAR, immune cells expressing CAR (particularly T cells expressing CAR), conjugates, nanobodies dissolved in a pharma- ceutically acceptable carrier (e.g., aqueous carrier). A variety of aqueous carriers may be used, such as, for example, buffered saline. These solutions are sterile and usually free of undesirable substances. These pharmaceutical compositions or biological preparations or compositions thereof may be sterilized by conventional, well-known sterilization techniques. These pharmaceutical compositions or biological preparations or compositions thereof may contain pharma- ceutically acceptable auxiliary substances as necessary to approximate physiological conditions, such as, for example, pH adjusting and buffering agents, toxicity adjusting agents, auxiliary agents, etc., such as, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate. The concentration of CAR, immune cells expressing CAR (particularly T cells expressing CAR), conjugates, nanobodies in these preparations may vary widely and will be selected primarily based on the volume of liquid, viscosity, body weight, etc., depending on the specific mode of administration selected and the needs of the patient. Actual methods for preparing such dosage forms for gene therapy, immunotherapy and / or cell therapy will be well known and apparent to those skilled in the art.

[0047] A typical composition for intravenous administration (pharmaceutical composition or biological preparation or composition thereof) comprises from about 0.01 to about 30 mg / kg of the Nanobody according to the first aspect of the application or the humanized anti-CD7 Nanobody according to the second aspect of the application or the engineered host cell according to the seventh aspect of the application or the conjugate according to the eighth aspect of the application per patient per day. Actual methods for preparing administrable compositions will be well known or apparent to those skilled in the art and are described in further detail in publications such as Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, P (1995).

[0048] The CAR, immune cells expressing a CAR (particularly T cells expressing a CAR), nanobody or conjugate described herein may be provided in lyophilized form and rehydrated with sterile water prior to administration, but may also be provided as a sterile solution of known concentration. The CAR, immune cells expressing a CAR (particularly T cells expressing a CAR), nanobody or conjugate solution is then added to an infusion bag containing 0.9% sodium chloride, USP, and in some cases administered at a dosage of 0.5 to 15 mg per kg of body weight.

[0049] There is a lot of experience available in the art in administering nanobody- and conjugate-related drugs; for example, antibody drugs have been commercially available in the United States since the approval of RITUXAN® in 1997. CARs, immune cells expressing CARs, antibodies, antigen-binding fragments, and conjugates thereof may be administered by slow infusion rather than intravenous push or bolus. In one example, a high initial dose is administered, followed by maintenance doses at lower levels. For example, an initial dose of 4 mg / kg of antibody or antigen-binding fragment (or the corresponding dose of a conjugate comprising the antibody or antigen-binding fragment) may be infused over approximately 90 minutes, followed by weekly maintenance doses of 2 mg / kg infused over 30 minutes for 4-8 weeks if the previous dose is well tolerated.

[0050] Sustained release parenteral formulations can be made as implants, oily injections or particulate systems. For a review of protein delivery systems, see Banga, AJ, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems, Technomic Publishing Company, Inc., Lancaster, PA, (1995). Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres and nanoparticles. Microcapsules contain a therapeutic protein, e.g., a cytotoxin or drug, as a central core. In microspheres, the therapeutic agent is dispersed throughout the particle. Particles smaller than about 1 μm, microspheres and microcapsules are commonly referred to as nanoparticles, nanospheres and nanocapsules, respectively. Capillaries have a diameter of approximately 5 μm, so only nanoparticles are administered intravenously. Microparticles are typically approximately 100 μm in diameter and are administered subcutaneously or intramuscularly. See, e.g., Kreuter, J., Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York, NY, pp. 219-342 (1994); and Tice & Tabibi, Treatise on Controlled Drug Delivery, A. Kydonieus, ed., Marcel Dekker, Inc. New York, NY, pp. 315-339, (1992).

[0051] The polymers can be used for ion-controlled release of the CARs, CAR-expressing immune cells (particularly CAR-expressing T cells), nanobodies, conjugates or compositions thereof disclosed herein. A variety of degradable and non-degradable polymer matrices for use in controlled drug delivery are well known in the art (Langer, Accounts Chem. Res. 26:537-542, 1993). For example, the block copolymer, poloxamer 407, exists as a viscous but mobile liquid at low temperatures, but forms a semi-fluid gel at body temperature. It has been shown to be an effective vehicle for the formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res. 9:425-434, 1992; and Pec et al., J. Parent. Sci. Tech. 44(2):58-65, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for the sustained release of proteins (Ijntema et al., Int. J. Pharm. 112:215-224, 1994). In yet another embodiment, liposomes are used for sustained release and drug targeting of lipid-encapsulated drugs (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA (1993)). Numerous additional systems for controlled delivery of therapeutic proteins are known (see U.S. Pat. No. 5,055,303; U.S. Pat. No. 5,188,837; U.S. Pat. No. 4,235,871; U.S. Pat. No. 4,501,728; U.S. Pat. No. 4,837,028; U.S. Pat. No. 4,957,735; U.S. Pat. No. 5,019,369; U.S. Pat. No. 5,055,303; U.S. Pat. No. 5,514,670; U.S. Pat. No. 5,413,797; U.S. Pat. No. 5,268,164; U.S. Pat. No. 5,004,697; U.S. Pat. No. 4,902,505; U.S. Pat. No. 5,506,206; U.S. Pat. No. 5,271,961; U.S. Pat. No. 5,254,342 and U.S. Pat. No. 5,534,496).

[0052] A thirteenth aspect of the present application provides a method of stimulating an immune response to a target cell population or target tissue in a mammal. Further, the method comprises the following step: administering to the mammal an effective amount of the engineered host cell according to the seventh aspect of the present application, the conjugate according to the eighth aspect of the present application, the pharmaceutical composition according to the ninth aspect of the present application, or the biological preparation according to the twelfth aspect of the present application.

[0053] A fourteenth aspect of the application provides a method of modulating an immune response in a subject. Further, the method comprises the following step: administering to the subject an effective amount of the engineered host cell according to the seventh aspect of the present application, the conjugate according to the eighth aspect of the present application, the pharmaceutical composition according to the ninth aspect of the present application or the biological preparation according to the twelfth aspect of the present application.

[0054] A fifteenth aspect of the present application provides a method for producing a Nanobody according to the first aspect of the application or a humanized anti-CD7 Nanobody according to the fifth aspect of the application. Further, the method comprises the steps of: culturing the engineered host cell according to the seventh aspect of the application, and isolating the Nanobody according to the first aspect of the application or the humanized anti-CD7 Nanobody according to the second aspect of the application from the culture.

[0055] A sixteenth aspect of the present application provides a method for specifically inhibiting CD7 activity. Furthermore, the method comprises the following steps: introducing a nucleic acid molecule according to the fifth aspect of the present application into cells of the organism, and inhibiting CD7 activity by expressing a Nanobody according to the first aspect of the present application or a humanized anti-CD7 Nanobody according to the second aspect of the present application.

[0056] A seventeenth aspect of the present application provides a method of preventing and / or treating a CD7-related disease or condition. Furthermore, the method comprises the following steps: administering to a subject with a CD7-related disease or condition an effective amount of a Nanobody according to the first aspect of the present application, a humanized anti-CD7 Nanobody according to the second aspect of the present application, a nucleic acid molecule according to the fifth aspect of the present application, a recombinant expression vector according to the sixth aspect of the present application, an engineered host cell according to the seventh aspect of the present application, a conjugate according to the eighth aspect of the present application, a pharmaceutical composition according to the ninth aspect of the present application or a biological preparation according to the twelfth aspect of the present application.

[0057] Additionally, a CD7-associated disease or condition includes tumors that express CD7. Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0058] Furthermore, the CD7-related disease or condition mentioned in this application refers to any disease or condition associated with the expression of CD7, including, but not limited to, the diseases listed above, so long as the disease or condition is associated with the expression of CD7, it is within the scope of this application.

[0059] As used herein, the terms "treatment" and "prevention" and words derived therefrom do not necessarily mean 100% or complete treatment or prevention. Rather, there are various degrees of treatment or prevention that those skilled in the art recognize as having a potential benefit or therapeutic effect. In this regard, the method can provide any amount or level of treatment or prevention of cancer in a mammal.

[0060] The treatment or prevention provided by the method can include treatment or prevention of one or more conditions or symptoms of the disease being treated or prevented, e.g., cancer. Similarly, for purposes herein, "prevention" can include delaying the onset of the disease, or a symptom or condition thereof.

[0061] Mammals referred to herein may be any mammal, including, but not limited to, rodent mammals, such as mice and hamsters, and lagomorph mammals, such as rabbits. Mammals may be from the order Carnivora, including felines (cats) and canines (dogs). Mammals may be from the order Artiodactyla, including bovines (cows) and porcines (pigs), or from the order Perissodactyla, including equines (horses). Mammals may be from the orders Primates, Ceboids or Simoids (monkeys), or from Apes (humans and apes). Preferably, in certain embodiments of the present application, the mammal is a human.

[0062] Furthermore, the engineered host cell comprises an immune cell expressing a single nanobody-based anti-CD7 chimeric antigen receptor (CAR) as described in the third aspect of the present application or a dual nanobody-based anti-CD7 chimeric antigen receptor as described in the fourth aspect of the present application; Preferably, the immune cell comprises a T cell, a NK cell, an iNKT cell, a CTL cell, a monocyte, a macrophage, a dendritic cell or a NKT cell; More preferably, the engineered host cell is a CAR-T cell.

[0063] Additionally, the engineered host cells can be administered to a subject suffering from a CD7-associated disease or condition: (1) If the subject weighs less than 100 kilograms (kg) and is under 18 years of age, 0.05 x 10 CAR-T cells per kg of the subject's body weight. 6 or approximately 0.05 x 10 CAR-T cells per kg of subject body weight 6 5.0 × 10 CAR-T cells per kg of subject body weight 7 Approximately 5.0 x 10 CAR-T cells per kg of subject body weight 7 pieces; (2) If the subject weighs more than 100 kilograms (kg) or is more than 18 years of age, 0.05 × 10 CAR-T cells per kg of the subject's body weight. 6Approximately 0.05 x 10 CAR-T cells per kg of subject body weight 6 5.0 × 10 CAR-T cells per kg of subject body weight 8 Approximately 5.0 x 10 CAR-T cells per kg of subject body weight 8 pieces The dosage is administered in an amount selected from the following:

[0064] In some embodiments of the present application, CAR-T cell therapy is performed by autologous transfer, whereby cells are isolated and / or otherwise prepared from the subject receiving the cell therapy or from a sample derived from such a subject, whereby in some aspects the cells are derived from a subject, e.g., a patient, in need of treatment, and the cells are administered to the same subject after isolation and processing.

[0065] In other embodiments of the present application, CAR-T cell therapy is carried out by allogeneic transfer, in which cells are isolated and / or otherwise prepared from a subject other than the subject that will or will eventually receive cell therapy, e.g., a first subject. In such embodiments, the cells are then administered to a different subject of the same species, e.g., a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0066] In specific embodiments of the present application, the CAR-T cells can be administered by any suitable means, for example, by bolus injection, by injection, for example, intravenous or subcutaneous injection, intraocular injection, periocular injection, subretinal injection, intravitreal injection, transseptal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjunctival injection, subconjunctival injection, sub-Tenon's injection, retrobulbar injection, periocular injection, or posterior juxtascleral delivery. In some embodiments, they are administered parenterally, intrapulmonary and intranasally, and by intralesional administration when local treatment is desired. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus of cells. In some embodiments, it is administered by multiple boluses of cells over a period of, for example, 3 days or less, or by continuous infusion of cells. In some embodiments, administration of the cell dose or any additional therapy, such as lymphodepleting therapy, intervention therapy and / or combination therapy, is performed by outpatient delivery.

[0067] Furthermore, for prevention or treatment of disease, the appropriate dosage may depend on the type of disease being treated, the cell type, the severity and course of the disease, whether the cells are administered for prophylactic or therapeutic purposes, previous treatments, the subject's medical history and response to the cells, and the judgment of the attending physician. In some embodiments, the pharmaceutical composition and / or CAR-T cells are suitably administered to the subject at one time or over a series of treatments.

[0068] In some embodiments, the CAR-T cells are administered as part of a combination treatment, such as simultaneously or sequentially in any order with another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. In some embodiments, the cells are co-administered with one or more additional therapeutic agents, or in association with another therapeutic intervention, either simultaneously or sequentially in any order. In some embodiments, the additional therapeutic agent is any intervention preparation or agent known to those skilled in the art that can be used for tumor intervention therapy, and in some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional therapeutic agents include cytokines, such as IL-2, for example, to enhance persistence. In some embodiments, the method includes administering a chemotherapeutic agent. In some embodiments, the method includes administering a chemotherapeutic agent, such as a conditioning chemotherapeutic agent, for example, to reduce tumor burden prior to administration. In some embodiments, preconditioning the subject with an immune depleting (e.g., lymphodepleting) therapy can improve the efficacy of the cell therapy.

[0069] In some embodiments, the methods and uses provided herein include administration of all or part of CAR-T cells or pharmaceutical compositions, where the cells are engineered immune cells expressing a chimeric antigen receptor CAR according to the second aspect of the application or a chimeric antigen receptor according to the third aspect of the application. In some embodiments, a specific amount or number of cells or a specific amount of a pharmaceutical composition comprising a specific amount or number of cells is administered to the subject. In some embodiments, one or more cell doses are administered to the subject, where one or more cell doses contain a specific amount or number of cells or a specific amount of a pharmaceutical composition comprising a specific amount or number of cells. In some embodiments, a specific dose of cells is administered to the subject by the provided methods and / or using the provided preparations or compositions. In some embodiments, the size, amount or timing of the dosage is determined based on the age of the subject. In some embodiments, the size, amount or timing of the dosage is determined based on the weight of the subject. In some embodiments, the size, amount or timing of the dosage is determined based on the specific type of tumor in the subject.

[0070] An eighteenth aspect of the present application provides a method for detecting CD7 protein or an antigenic fragment thereof. Further, the method includes the steps of: (1) obtaining a sample containing a CD7 protein or an antigenic fragment thereof; (2) contacting the sample collected in step (1) with a Nanobody according to the first aspect of the present application, a humanized anti-CD7 Nanobody according to the second aspect of the present application, a conjugate according to the eighth aspect of the present application, a kit according to the tenth aspect of the present application or a reagent for detecting CD7 protein or an antigenic fragment thereof according to the eleventh aspect of the present application; and (3) detecting the presence of an antibody-antigen complex. Includes.

[0071] Furthermore, nanobodies are nanobodies that are labelled with a label that can be used for detection. Additionally, labels that can be used for detection include fluorescent pigments, avidin, paramagnetic atoms, radioisotopes.

[0072] Further, fluorescent pigments are fluorescein, rhodamine, Texas Red, phycoerythrin, phycocyanin, allophycocyanin, peridinin-chlorophyll protein.

[0073] Further, avidin includes biotin, avidin derived from ovalbumin, streptavidin, avidin derived from egg yolk (ovi vitellus), and avidin analogues. Further, the radioisotopes are radioactive iodine, radioactive cesium, radioactive iridium, and radioactive cobalt.

[0074] A nineteenth aspect of the present application provides a method for preparing an engineered host cell according to the seventh aspect of the present application. Further, the method comprises the step of: introducing the recombinant expression vector according to the sixth aspect of the present application into a host cell.

[0075] Further, methods for introduction include lipofection, microinjection, electroporation, DNA vectors, RNA vectors, retroviral vectors, lentiviral vectors, poxvirus vectors, herpes simplex virus vectors, adenovirus vectors, adeno-associated virus vectors.

[0076] A twentieth aspect of the present application provides a method for diagnosing whether a subject has a tumor that expresses CD7. Further, the method includes the steps of: (1) providing a sample from a subject suspected of having a tumor that expresses CD7; (2) contacting the sample with a Nanobody according to the first aspect of the present application, a humanized anti-CD7 Nanobody according to the second aspect of the present application, a conjugate according to the eighth aspect of the present application, a kit according to the tenth aspect of the present application or a reagent for detecting CD7 protein or an antigenic fragment thereof according to the eleventh aspect of the present application; (3) detecting the formation of a complex comprising the nanobody and the antigen to obtain an amount of CD7 in a sample from the subject, comparing the amount of CD7 in the sample from the subject to the amount of CD7 in a known standard or reference sample, and determining whether the CD7 level in the sample from the subject is within the tumor-associated CD7 level; Includes.

[0077] Additionally, the sample in step (1) includes urine, blood, serum, plasma, saliva, ascites, circulating cells, circulating tumor cells, non-tissue associated cells, tissue or histological preparations. Furthermore, CD7-expressing tumors are hematological tumors of the T-lymphocyte lineage.

[0078] Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0079] A twenty-first aspect of the present application provides the use of a Nanobody according to the first aspect of the application or a humanized anti-CD7 Nanobody according to the second aspect of the application in detecting CD7 protein or an antigenic fragment thereof.

[0080] A twenty-second aspect of the present application provides the use of a Nanobody according to the first aspect of the application or a humanized anti-CD7 Nanobody according to the second aspect of the application in the preparation of a reagent or kit for detecting CD7 protein or an antigenic fragment thereof.

[0081] A twenty-third aspect of the present application provides the use of a nucleic acid molecule according to the fifth aspect of the present application or a recombinant expression vector according to the sixth aspect of the present application in the preparation of an engineered host cell. Furthermore, the engineered host cell is an engineered host cell according to the seventh aspect of the present application.

[0082] A twenty-fourth aspect of the present application provides the use of a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, a chimeric antigen receptor according to the fourth aspect of the application, a nucleic acid molecule according to the fifth aspect of the application, a recombinant expression vector according to the sixth aspect of the application, an engineered host cell according to the seventh aspect of the application, a conjugate according to the eighth aspect of the application, a pharmaceutical composition according to the ninth aspect of the application or a biological preparation according to the twelfth aspect of the application in the preparation of an anti-tumor medicament.

[0083] Furthermore, the antitumor drug includes an antitumor immune cell therapeutic agent and an antitumor gene therapeutic agent. Further, the tumor is a CD7 expressing tumor. Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage.

[0084] Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0085] A twenty-fifth aspect of the present application provides the use of a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, a chimeric antigen receptor according to the fourth aspect of the application, a nucleic acid molecule according to the fifth aspect of the application, a recombinant expression vector according to the sixth aspect of the application, an engineered host cell according to the seventh aspect of the application, a conjugate according to the eighth aspect of the application, a pharmaceutical composition according to the ninth aspect of the application or a biological preparation according to the twelfth aspect of the application in the preparation of a kit for preparing immune cells for preventing and / or treating tumors.

[0086] Further, the tumor is a CD7 expressing tumor. Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0087] A twenty-sixth aspect of the present application provides the use of a Nanobody according to the first aspect of the application, a humanized anti-CD7 Nanobody according to the second aspect of the application, a chimeric antigen receptor according to the third aspect of the application, a chimeric antigen receptor according to the fourth aspect of the application, a nucleic acid molecule according to the fifth aspect of the application, a recombinant expression vector according to the sixth aspect of the application, an engineered host cell according to the seventh aspect of the application, a conjugate according to the eighth aspect of the application, or a pharmaceutical composition according to the ninth aspect of the application in the preparation of a biological preparation for preventing and / or treating a tumor.

[0088] Further, the tumor is a CD7 expressing tumor. Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0089] A twenty-seventh aspect of the present application provides the use of an engineered host cell according to the seventh aspect of the present application in the prevention and / or treatment of a tumor. Further, the tumor is a CD7 expressing tumor.

[0090] Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0091] A twenty-eighth aspect of the present application provides the use of the conjugate according to the eighth aspect of the present application in the prevention and / or treatment of tumors. Further, the tumor is a CD7 expressing tumor.

[0092] Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0093] A twenty-ninth aspect of the present application provides the use of the pharmaceutical composition according to the ninth aspect of the present application in the prevention and / or treatment of tumors. Further, the tumor is a CD7 expressing tumor.

[0094] Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0095] A thirtieth aspect of the present application provides the use of the kit according to the tenth aspect of the present application in the preparation of immune cells for preventing and / or treating tumors. Furthermore, the immune cell is an engineered host cell according to the seventh aspect of the present application.

[0096] A thirty-first aspect of the present application provides the use of a reagent for detecting CD7 protein or an antigenic fragment thereof according to the eleventh aspect of the present application in detecting CD7 protein or an antigenic fragment thereof.

[0097] A thirty-second aspect of the present application provides the use of the biological preparation according to the twelfth aspect of the present application in the prevention and / or treatment of tumors. Further, the tumor is a CD7 expressing tumor.

[0098] Furthermore, the tumor is a hematological tumor of the T-lymphocyte lineage. Additionally, tumors include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT cell leukemia, peripheral T cell lymphoma (NHL), NKT cell lymphoma, and anaplastic large cell lymphoma (ALCL).

[0099] Compared with the prior art, the advantages and beneficial effects of the present application are as follows: The present application provides an anti-CD7 nanobody with good affinity to CD7, and the nanobody is used as the antigen-binding region of the CAR to modify the CAR, so that the modified CAR is used in CAR-T cell therapy.Compared with the conventional CAR-T cells constructed based on monoclonal antibodies (scFv), the CAR-T cells constructed based on single nanobody or double nanobody according to the present application not only effectively avoid the shortcomings of the expression difficulty and poor stability of the conventional CAR-T based on scFv, but also have various advantages, such as significantly enhancing the ability of immune cells to target and recognize tumor antigens, enhancing the killing activity in tumor cells, and having broad applicability. [Brief description of the drawings]

[0100] [Figure 1] 1 is a graph showing the SDS-PAGE results of CD7 antigen purification; [Diagram 2] Flowchart showing immunization of alpacas; [Diagram 3] Graph showing the results of the first round of PCR amplification during the construction of a nanobody library; [Figure 4] Graph showing the results of the second round of PCR amplification during the construction of a nanobody library; [Diagram 5] Graph showing PCR results of diversity detection of nanobody library; [Figure 6] Graph showing the results of the ratio of positive to negative groups after phage panning; [Figure 7] 1 is a graph showing the statistical results of OD values ​​of monoclonal screening; [Figure 8] Graph showing statistical results of monoclonal screening and identification; [Figure 9] Schematic structure of single VHH CAR-T; [Figure 10] 1 is a flow chart of lentiviral packaging; [Figure 11] 1 is a flow chart of CAR-T cell culture; [Figure 12] Graph showing representative results of flow cytometry detection of single VHH CAR-T cells; [Figure 13] Graph showing the statistical results of CD7+ mean MFI of single VHH CAR-T cells; [Figure 14] Graph showing the statistical results of the killing rate of single VHH CAR-T cells; [Figure 15] Graph showing statistical results of mean MFI values ​​of single VHH K562 cell lines; [Figure 16] Graph showing the results of single VHH specificity detection; [Figure 17] Graph showing representative results of flow cytometry detection of single VHH CAR-T cells; [Figure 18] Graph showing the results of CD7+ mean MFI of single VHH CAR-T cells; [Figure 19] Graph showing alignment results between humanized sequence, DP-47, template h-NbBcII10PGLA and original sequence, with highlighted sites being mutation sites; [Figure 20] Schematic structure of dual VHH CAR-T; [Figure 21] Graph showing representative results of flow cytometry detection of dual VHH CAR-T cells; [Figure 22] Graph showing the statistical results of CD7+ mean MFI of single VHH CAR-T cells and dual VHH CAR-T cells; [Diagram 23] Graph showing the results of the proliferation curve of dVHH-D CAR-T cells; [Figure 24] Graph showing the killing results of dVHH-D CAR-T cells; [Diagram 25] Graph showing the results of the proliferation curve of dVHH-E CAR-T cells; [Figure 26] This is a graph showing the killing results of dVHH-E CAR-T cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0101] The present application is further described below with reference to specific examples that are used only to illustrate the present application and cannot be construed as limiting the present application. Those skilled in the art will understand that: various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and purposes of the present application, and the scope of the present application is defined by the claims and their equivalents. The experimental methods used in the following examples are conventional methods unless otherwise specified; The experimental methods used in the following examples are conventional methods unless otherwise specified; The reagents, materials, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified. EXAMPLES

[0102] Example 1 Antigen preparation 1. Experimental Method RNA was extracted from T cells using an RNA extraction kit. cDNA was obtained using random primers for reverse transcription, referring to the SuperScript™ II Reverse Transcriptase instruction manual. The gene sequence of the extracellular region of antigen CD7 was obtained through PCR using cDNA as a template. The gene sequence of the CD7 extracellular region was ligated into a protein expression vector for expression, and Ni column purification was performed to obtain purified CD7-His protein.

[0103] 2. Experimental Results The results are shown in Figure 1. The results show that the present application successfully prepared CD7 antigen with a size of 17.2 kDa and a purity of >90% after SDS-PAGE identification, which can be used for subsequent alpaca immunization.

[0104] Example 2 Construction of nanobody libraries 1. Experimental Method (1) The CD7-His protein purified in Example 1 was used for alpaca immunization. A specific alpaca immunization flow chart is shown in Figure 2. Immunizations were performed once a week for a total of six consecutive immunizations; (3) 100 mL of peripheral blood was collected 7 days after the last immunization, peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, RNA was extracted, and cDNA was prepared using a reverse transcription kit; (4) VHH fragments were obtained using SOE-PCR and ligated into pMES4 phage display vector; (5) The ligation product was electrotransformed into electroporation competent cells TG1, and the resulting bacterial library contained 3.37 x 10 8 (6) After completion of library construction, to determine the insertion efficiency of the library, 25 clones were randomly selected, colony PCR was performed using primers MP57 and GIII, and the PCR products were subjected to Sanger sequencing.

[0105] 2. Experimental Results The results of the first round of PCR amplification are shown in Figure 3. The results show that after the first round of PCR is completed, a DNA fragment of approximately 700 bp is recovered. The results of the second round of PCR amplification are shown in Figure 4. The results show that after the second round of PCR is completed, a DNA fragment of approximately 400 bp is recovered. After the library construction is completed, to determine the insertion efficiency of the library, 25 clones were randomly selected, colony PCR was performed using primers MP57 and GIII, and the PCR products were subjected to Sanger sequencing. The results show that the insertion rate is nearly 95% (see Figure 5).

[0106] Example 3 Nanobody enrichment screening 1. Amplification of Phage Nanobody Library (1) The TG1 E. coli nanobody library was taken and transferred to 2-YT liquid medium and cultured at 37°C and 200 rpm until the OD value reached 0.5, then helper phage VCSM13 was added to infect the cells. The mixture was gently mixed and incubated at 37°C for 30 min. The bacterial liquid was centrifuged to remove traces of glucose, then the precipitate was resuspended in 2-YT medium containing both ampicillin and kanamycin and cultured at 37°C and 200 rpm overnight with shaking to amplify the phage-displayed nanobodies. (2) The overnight culture was transferred to a 50 mL centrifuge tube, centrifuged, the supernatant was removed, and a 20% (wt / vol) PEG6000 / 2.5M NaCl solution was added to precipitate the phages. Centrifugation was performed, the supernatant was discarded, the precipitate was resuspended in PBS, centrifuged, the supernatant was transferred to a new centrifuge tube, and 20% (wt / vol) PEG6000 / 2.5M NaCl solution was added to reprecipitate the phages. Centrifugation was performed, the supernatant was discarded, and the precipitate was resuspended in 1 mL of PBS. After centrifugation, the supernatant was transferred to a new centrifuge tube, glycerol was added to a final concentration of 20%, and the resulting mixture was stored at -80°C. (3) To determine the titer of the phage nanobody library, the phages were diluted in a 10-fold gradient. Different dilution factors of the phages were used to infect bacteria TG1 in the logarithmic growth phase and cultured at 37°C overnight. The titer of the phage nanobody library was calculated by the number of plaques on the second day.

[0107] 2. Phage Enrichment and Screening (1) Nanobodies were panned by ELISA, recombinant CD7-His protein was coated on ELISA plates and incubated overnight at 4°C. (2) ELISA plates were washed 3 times with 250 μL PBST, 200 μL blocking solution was added, and then ELISA plates were incubated at room temperature for 2 h. (3) Corresponding phages were added to each well and incubated at room temperature for 2 h. (4) Plates were washed 15 times with 250 μL PBST; (5) 100 μL of trypsin at a concentration of 0.25 mg / mL was added to each well, and ELISA plates were incubated at room temperature for 0.5 h at 700 rpm. (6) Phages were eluted with AEBSF. (7) Eluted phages were used for titer determination and phage infection and amplification. (8) Number of eluted positive phages: Panning was stopped when the number of negative phages was ≧100.

[0108] 3. Experimental Results The panning results are shown in Table 1 and Figure 6. After two rounds of panning, the ratio of the positive group to the negative group reached 438 times, which reached the standard for screening monoclones. Therefore, after two rounds of panning, the panning was stopped and the next step of screening and identifying monoclones was carried out.

[0109] [Table 1] Example 4 Screening and identification of positive monoclones 1. Experimental Method (1) A single clone was selected from the TG1 E. coli library obtained after 2-3 rounds of screening on the expanded culture, and helper phage VCSM13 was used for infection to prepare monoclonal phages. (2) An appropriate amount of nanobody phages and K562-CD7 positive cells were incubated at room temperature for 2 hours. (3) After washing the plate with PBST, HA-HRP antibody was added and incubated at room temperature for 1 hour. (4) After washing the plate with PBST, 100 μL of TMB single component color development solution was added, and the resulting mixture was incubated at room temperature for 30 minutes, and 100 μL of stop solution was added. (5) A microplate reader was used to detect the absorbance at 450 nm. (6) If the ratio of OD450 value of the sample well to the blank control was greater than 2, it was determined to be a positive clone. (7) The positive clone was subjected to bacterial liquid PCR and Sanger sequencing. (8) The Sanger-sequenced monoclones were subjected to sequence alignment using the software DNAMAN to screen for sequence-specific clones.

[0110] 2. Experimental Results In this example, a total of 864 monoclones were screened from nine 96-well plates, and the OD value results of the monoclones are shown in Figure 7. Calculations were performed according to the calculation principle, and 231 positive clones and 17 sequence-specific clones were selected as shown in Figure 8. The sequence-specific nanobodies were numbered as VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11), and VHH01, VHH03, VHH04, VHH06, VHH07, VHH08, VHH09, VHH10, VHH12, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 and VHH20 are numbered as SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 41, SEQ ID NO: 49, SEQ ID NO: 57, SEQ ID NO: 65, having corresponding variable region amino acid sequences as shown in SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121 and SEQ ID NO:129, and having corresponding variable region nucleic acid sequences as shown in SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:26, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 and SEQ ID NO:130, respectively.

[0111] Example 5 Preparation of single VHH CAR-T cells and in vitro functional validation 1. Construction of Single-VHH CAR Constructs (1) Construction of a single VHH CAR construct was performed using sequence-specific clones. First, PCR was used to amplify the VHH sequences of the positive clone lines. The primers for the first round of PCR were: NCAR-F1:5'-CTGCAGGAGTCTGGRGGAGG-3' NCAR-R1:5'-TGAGGAGACGGTGACCTGGG-3' It was.

[0112] After the first round of PCR was completed, the product obtained from the first round of PCR was used as a template to carry out a second round of PCR. The primers for the second round of PCR were: NCAR-F2:5'-TTTCTGCTGATCCCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG-3' NCAR-R2:5'-TAGGAGCCGGGGTGGGCGGCCGCGGTGCTGGGGTAGTTGAGGAGACGGTGACCTGGG-3' It was.

[0113] (2) The product obtained from the second round of PCR was ligated into the vector Senl-S88BZ through homologous recombination, and the vector was digested with a single Not I enzyme. At this point, the CAR structure containing a single VHH targeting CD7 was successfully constructed. A total of 17 single VHH sequences were constructed, named VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11), respectively. The structure diagram of the constructed single VHH CAR-T is shown in Figure 9, where EF1α is the promoter of elongation factor 1α, leader is the coding sequence of the signal peptide, VHH is the coding sequence of the anti-CD7 nanobody, CD8H+TM is the CD8 hinge region and transmembrane region, 4-1BB and CD3ζ intracellular signaling region are intracellular costimulatory domains, and the extracellular region expressing tEGFR is linked via the T2A peptide so that the expression of the CAR can be detected after viral transduction.

[0114] 2. Preparation of Single VHH CAR-T Cells Before preparing CAR-T cells, lentivirus packaging was first carried out: (1) the plasmid of interest and three helper plasmids (pMD2.G, pRSV-REV, pMDLg) were co-transfected into 293FT cells under the action of PEI-Pro. (2) Packaging was carried out for 6 hours, and then the solution was replaced. (3) Lentivirus was collected 48 hours after packaging. (4) The collected lentivirus stock solution was concentrated by ultracentrifugation, and the lentivirus particles were resuspended in DMEM high glucose medium and aliquoted for use. The lentivirus packaging process is shown in Figure 10; After lentivirus packaging was completed, CAR-T cells were prepared: (1) peripheral blood mononuclear cells (PBMCs) were collected from patients or healthy donors. (2) αβ T cells were sorted through CD3 magnetic beads. (3) Sorted αβ T cells were cultured in TexMACS GMP medium (MACS). (4) Lentivirus transduction was performed 2 days later. (5) Culture was continued from day 12 to day 14 for CAR-T cell collection to obtain CD7-targeting VHH NS CAR-T cells (named VHH01 to VHH20, excluding VHH02, VHH05 and VHH11). The CAR-T cell culture process is shown in Figure 11. (6) Flow cytometry was performed during the culture process to determine the percentage of CAR+ cells and the average MFI value of CD7+ cells.

[0115] 3. In vitro Functionality Verification of Single VHH CAR-T Cells To verify the in vitro biological activity of the anti-CD7 VHH CAR-T cells prepared in this example, a verification using an in vitro killing experiment was carried out during the culture process: first, the target cells KG-1a-GFP-Luc were collected, centrifuged at 2000 rpm for 5 min, resuspended in DPBS for counting, and 1 × 10 cells were plated in a 96-well plate. 517 single VHH CAR-T cells were added at 100 / well; then an appropriate amount of effector cells were added to the target cells at E:T=3:1; the effector and target cells were mixed and incubated for 4 hours; the corresponding luciferase substrate was added and the luciferase value was read in a 96-well plate using an electrochemiluminescence microplate reader. The killing rate was calculated based on the value change. In addition, on the 12th day of the culture of the 17 single VHH CAR-T cells, the 17 single VHH CAR-T cells and blank T cells were subjected to cell killing experiments with the CD7-expressing positive cell line KG-1a-GFP-Luc at the ratio of E:T=3:1, respectively.

[0116] 4. Experimental Results Representative results of single VHH CAR-T cells by flow cytometry and CD7+ mean MFI results of single VHH CAR-T cells are shown in Figure 12 and Figure 13, respectively. The results show that the CAR positivity rates of VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11) were: 61.04%, 96.2%, 78.9%, 83%, 85%, 72.72%, 89%, 95.6%, 90.98%, 68.38%, 65%, 84.1%, 79.6%, 54.4%, 89.2%, 72.6% and 62.15%, respectively; CD7 positive cells against blank T cells were: 61.04%, 96.2%, 78.9%, 83%, 85%, 72.72%, 89%, 95.6%, 90.98%, 68.38%, 65%, 84.1%, 79.6%, 54.4%, 89.2%, 72.6% and 62.15%, respectively; The mean MFI value of CD7 positive cells for VHH01 to VHH20 (excluding VHH02, VHH05 and VHH11) CAR-T cells was: 2257, 694, 1281, 498, 1566, 2362, 841, 197, 190, 2010, 1473, 1077, 1300, 2054, 1117, 1391 and 2041, respectively; The results of the in vitro functionality validation are shown in Figure 14. The results show that the killing rate of blank T cells is 13.65%, and the killing rates of VHH01 to VHH20 (VHH02, VHH05 and VHH11) CAR-T cells are 4.79%, 75.7%, 57%, 62.19%, 61.63%, 68.52%, 71.47%, 91.36%, 78.18%, 1.18%, 60.44%, 56.77%, 72.87%, 8.58%, 74.52%, 61.71% and 9.38%, respectively.

[0117] Example 6 Detection of nanobody affinity and specificity 1. Affinity Detection The VHH CAR constructs corresponding to the 17 single VHHs identified through screening in Example 4 were transduced into human myeloid leukemia cell line K562. Four days after transduction, flow cytometry was performed using CD7-His protein to calculate the average MFI value of positive cells. Due to the difference in the affinity of each VHH to CD7, the average MFI value of positive cells is different. The higher the MFI value, the higher the affinity of the corresponding nanobody to the antigen CD7. A total of three parallel experiments were performed.

[0118] 2. Specificity Detection (1) The VHH fragments of different clonal lines obtained by sequencing were cloned into the prokaryotic expression vector PET-28a-SUMO. (2) After sequencing showed that the sequences were correct, the plasmids were extracted and then transformed into E. coli strain BL21, and the proteins were expressed under IPTG induction. (3) The crude proteins were obtained by ultrasonic lysis of bacterial cells. (4) The nanobodies were purified by ion affinity chromatography on a nickel column. (5) The binding of the 17 nanobodies to K562 and K562-CD7 cell lines was detected by flow cytometry using the purified nanobodies as the primary antibody and HIS-FITC antibody as the secondary antibody.

[0119] 3. Experimental Results The affinity detection results of nanobodies are shown in Figure 15. The results show that all 17 single VHH structures specifically bind to CD7-His, among which VHH03, VHH06, VHH10 and VHH12 have stronger affinity, indicating that all 17 single VHHs obtained through screening and identification in Example 4 of this application have good affinity to CD7.

[0120] The results of the detection of nanobody specificity are shown in Figure 16. The results show that all 17 VHHs can specifically bind to CD7, indicating that the 17 single VHHs obtained through screening and identification in Example 4 of this application have good specificity.

[0121] Example 7 Construction of humanized nanobody (hVHH06) 1. Experimental Method (1) Through alignment with DP-47, residues at key positions in VHH06 were humanized using the universal humanized framework h-NbBcII10FGLA reported in the literature (see Vincke, C. et al., General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold. J Biol Chem, 2009. 284(5):3273-3284 for details). The engineered nanobody was named hVHH06, and the sequence alignment of the three constructs (between the humanized sequence and DP-47, the template h-NbBcII10PGLA, and the original sequence) is shown in FIG. 19. The amino acid sequences of CDR1, CDR2 and CDR3 of hVHH06 are shown in SEQ ID NO:139, SEQ ID NO:141 and SEQ ID NO:143, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 are shown in SEQ ID NO:140, SEQ ID NO:142 and SEQ ID NO:144, respectively; the amino acid sequence of hVHH06 is shown in SEQ ID NO:137, and the nucleotide sequence of hVHH06 is shown in SEQ ID NO:138. (2) hVHH06 and VHH06 were simultaneously subjected to lentivirus packaging according to the above-mentioned method to prepare CAR-T cells. (3) Detection was performed by flow cytometry on the 6th day of CAR-T culture. (4) On the 10th day of CAR-T culture, a killing experiment was performed using KG-1a-GFP-Luc as target cells, according to the above-mentioned method, with effector cell: target cell ratios of E:T=5:1, 10:1 and 20:1.

[0122] 2. Experimental Results The flow cytometry detection results are shown in Figure 17. The results show that the transduction rates of VHH06 and hVHH06 are 12.4% and 21%, respectively, and the CD7 positivity rates are 0.249% and 0.157%, respectively. The results of the killing experiment are shown in Figure 18. The results show that when E:T=5:1, 10:1, 20:1, the average killing values ​​of blank T cells against KG-1a-GFP-Luc cells were 27.40%, 28.00%, and 26.80%, respectively; the average killing values ​​of VHH06 against KG-1a-GFP-Luc cells were 69.90%, 79.80%, and 79.70%, respectively; and the average killing values ​​of hVHH06 against KG-1a-GFP-Luc cells were 70.80%, 81.20%, and 89.60%, respectively. It can be seen from the above results that humanization has no effect on the traits of the antibody, indicating that VHH06 was successfully humanized in this example.

[0123] Example 8 Preparation of dual VHH CAR-T cells 1. Construction of Dual VHH CAR Constructs (1) The VHHs with good functions screened in Example 6 (VHH03, VHH06, VHH10 and VHH12) were used to construct the target plasmid for dual VHH CAR construct. The structural diagram is shown in Figure 20. First, PCR was used to amplify the VHH sequences of the positive clone strains. The primers for the first round of PCR were: dNCAR-F1:5'-CAGGTGCAGCTGCAGGAG-3' dNCAR-R1:5'-TGAGGAGACGGTGACCTGG-3' It was.

[0124] After the first round of PCR was completed, the product obtained from the first round of PCR was used as a template to carry out a second round of PCR. The primers for the second round of PCR were: dNCAR-F2 5'-CCAGGTCACCGTCTCCTCAGGAGGAGGAGGATCCGGAGGAGGAGGATCTGGCGGCGGCGGCAGTGGCGGCGGCGGCTCCGGCGGCGGCGGCTCTCAGGTGCAGCTGCAGGAG-3' dNCAR-R2 5'-TAGGAGCCGGGGTGGGCGGCCGCGGTGCTGGGGTAGTTGAGGAGACGGTGACCTGG-3' It was.

[0125] The products obtained from the second round of PCR were then ligated into vector VHH-XX (XX represents the number of single VHH CAR constructs targeting CD7) through homologous recombination, and the vector was digested with a single Not I enzyme. Among them, the dual VHH constructs constructed with VHH03 and VHH12, respectively, using VHH-06 as vector were named dVHH-B and dVHH-C, respectively. The dual VHH constructs constructed with VHH12 and VHH10, respectively, using VHH-10 as vector were named dVHH-D and dVHH-E, respectively. The dual VHH construct constructed with VHH12, using VHH12 as vector was named dVHH-F.

[0126] 2. Preparation of dual VHH CAR-T cells The preparation process of dual VHH CAR-T cells was consistent with that of single VHH CAR-T cells in Example 5. The lentivirus packaging process is shown in Figure 10, and the culture process is shown in Figure 11. CAR-T cells prepared using five dual VHH constructs and transduction of T cells, VHH10 CAR-T cells and VHH12 CAR-T cells were cultured for 6 days and then tested by flow cytometry.

[0127] 3. Experimental Results In this example, a total of five double VHH constructs were constructed, named dVHH-B to dVHH-F (VHH-06+VHH-03, VHH-06+VHH-12, VHH-10+VHH-12, VHH-10+VHH-10, VHH-12+VHH-12), respectively, and the structures are shown in FIG. 20, where EF1α is the promoter of elongation factor 1α, leader is the coding sequence of the signal peptide, VHH is the coding sequence of the anti-CD7 nanobody, CD8H+TM is the CD8 hinge region and transmembrane region, 4-1BB and CD3ζ intracellular signaling region are intracellular costimulatory domains, and the extracellular region expressing tEGFR is linked via T2A peptide so that the expression of CAR can be detected after viral transduction.

[0128] The results corresponding to the percentage of CAR+ cells and CD7 MFI values ​​are shown in Figure 21 and Figure 22, respectively. The results show that the CAR positivity rates of dVHH-B to dVHH-F are: 22.59%, 53.6%, 68.68% and 55.34%, respectively, the positivity rate of VHH10 is 72.2%, and the positivity rate of VHH12 is 86.7%; the average MFI value of CD7-positive cells for blank T cells is 10109, the average MFI values ​​of CD7-positive cells for CAR-T cells of dVHH-B to dVHH-F are: 708, 797, 648, 577 and 1057, respectively, the average MFI value of CD7-positive cells for CAR-T cells of VHH10 is 2302, and the average MFI value of CD7-positive cells for CAR-T cells of VHH12 is 1238.

[0129] Example 9 Cultivation of dual VHH CAR-T cells (dVHH-D) and experimental validation of in vitro functionality 1. Preparation of dVHH-D dual VHH CAR-T cells The dVHH-D, VHH10 and VHH12 constructs were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the fold cell expansion during the culture process was counted.

[0130] 2. Experimental validation of in vitro functionality of dVHH-D dual VHH CAR-T cells To compare the in vitro function of dVHH-D with single VHH CAR-T, on the 12th day of culture of dVHH-D, VHH10 and VHH12 CAR-T cells, CAR-T cells and blank T cells were respectively subjected to cell killing experiments using CD7-expressing positive cell line CCRF-CEM (leukemia T lymphoma cells) at a ratio of E:T=2:1. In the experiment, firstly, target cells were collected, centrifuged at 2000 rpm for 5 min, resuspended in DPBS for counting, stained with CFSE and added to 96-well plate at 1E5 cells / well; then, according to different ratios of target cells to effector cells (E:T=0.5:1, 1:1, 2:1), appropriate amount of effector cells were added to target cells, mixed, incubated for 4 hours, and cell killing rate was detected by flow cytometry.

[0131] 3. Experimental Results The dVHH-D growth curves are shown in Figure 23. The results show that on day 14 of growth, the average growth fold of dVHH-D is 46.35, the average growth fold of VHH-12 is 26.3, and the average growth fold of VHH-10 is 22.75. It can be observed that the growth fold of dVHH-D is significantly better than that of single VHH CAR-T.

[0132] The results of in vitro functional validation of dVHH-D are shown in Figure 24. The results show that when the killing ratio is 0.5:1, 1:1, 2:1, the average killing value of dVHH-D against CCRF-CEM is 86.925%, 92.115% and 94.465%, respectively, the average killing value of VHH10 against CCRF-CEM is 45.55%, 69.95% and 85.85%, respectively, and the killing value of VHH12 against CCRF-CEM is 58.65%, 80.9% and 82.95%, respectively. It can be seen that dVHH-D has higher lethality against CCRF-CEM.

[0133] Example 10 Cultivation of dual VHH CAR-T cells (dVHH-E) and experimental validation of in vitro functionality 1. Preparation of dVHH-E double VHH CAR-T cells The dVHH-E, VHH10 and VHH12 constructs were cultured in vitro using the CAR-T cell preparation method described in Example 8, and the fold cell expansion during the culture process was counted.

[0134] 2. Experimental validation of in vitro functionality of dVHH-E dual VHH CAR-T cells Experimental validation of the in vitro functionality of dVHH-E dual VHH CAR-T was performed using the methods described in Example 9.

[0135] 3. Experimental Results The dVHH-E growth curves are shown in Figure 25. The results show that on day 13 of growth, the average growth fold of dVHH-E is 45.875, the average growth fold of VHH-12 is 19.775, and the average growth fold of VHH-10 is 21.36. It can be observed that the growth fold of dVHH-E is significantly better than that of single VHH CAR-T.

[0136] The results of in vitro functional validation of dVHH-E are shown in Figure 26. The results show that when the killing ratio is 0.5:1, 1:1, 2:1, the average killing value of dVHH-E against CCRF-CEM is 58.15%, 84.385% and 91.775%, respectively, the average killing value of VHH10 against CCRF-CEM is 45.55%, 69.95% and 85.85%, respectively, and the killing value of VHH12 against CCRF-CEM is 58.65%, 80.9% and 82.95%, respectively. It can be seen that dVHH-E shows higher lethality against CCRF-CEM.

[0137] Example 11 Determination of affinity of antibodies (dVHH-D, dVHH-E, VHH10 and VHH12) by SPR method 1. Experimental Method In this example, the affinity of the antibodies was measured using SPR (surface plasmon resonance) by immobilizing the CD7-His protein prepared in Example 1 on a CM5 chip through amino coupling method, and the antibodies (dVHH-D, dVHH-E, VHH10 and VHH12) were used as experimental analytes to detect the affinity of each antibody to the CD7 antigen.

[0138] 2. Experimental Results The results show that the affinity constant between dVHH-D and CD7-His protein is 3.35E-09M, between dVHH-E and CD7-His protein is 4.51E-09M, between VHH10 and CD7-His protein is 9.99E-08M, and between VHH12 and CD7-His protein is 1.34E-09M (see Table 2). The above results further show that dVHH-D, dVHH-E, VHH10 and VHH12 can all specifically bind to the CD7 antigen and have strong affinity.

[0139] [Table 2] The above description of the examples is only for understanding the method and core concept of the present application. Some improvements and modifications can also be made to the present application, and these improvements and modifications are also within the scope of the claims of the present application.

Claims

1. an anti-CD7 nanobody comprising CDR1, CDR2, and CDR3 of any one of VHH10, VHH12, VHH06, VHH01, VHH03, VHH04, VHH07, VHH08, VHH09, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19, or VHH20, or homologous sequences thereof; (a) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH10 are as set forth in SEQ ID NO:59, SEQ ID NO:61 and SEQ ID NO:63, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:59, SEQ ID NO:61 and SEQ ID NO:63, respectively; (b) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH12 are as set forth in SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71, respectively; (c) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH06 are as set forth in SEQ ID NO:27, SEQ ID NO:29 and SEQ ID NO:31, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:27, SEQ ID NO:29 and SEQ ID NO:31, respectively; (d) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH01 are as set forth in SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:7, respectively; (e) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH03 are as set forth in SEQ ID NO:11, SEQ ID NO:13 and SEQ ID NO:15, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:11, SEQ ID NO:13 and SEQ ID NO:15, respectively; (f) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH04 are as set forth in SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23, respectively; (g) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH07 are as set forth in SEQ ID NO:35, SEQ ID NO:37 and SEQ ID NO:39, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:35, SEQ ID NO:37 and SEQ ID NO:39, respectively; (h) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH08 are as set forth in SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:47, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:43, SEQ ID NO:45 and SEQ ID NO:47, respectively; (i) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH09 are as set forth in SEQ ID NO:51, SEQ ID NO:53 and SEQ ID NO:55, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:51, SEQ ID NO:53 and SEQ ID NO:55, respectively; (j) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH13 are as set forth in SEQ ID NO:75, SEQ ID NO:77 and SEQ ID NO:79, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:75, SEQ ID NO:77 and SEQ ID NO:79, respectively; (k) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH14 are as set forth in SEQ ID NO:83, SEQ ID NO:85 and SEQ ID NO:87, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:83, SEQ ID NO:85 and SEQ ID NO:87, respectively; (l) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH15 are as set forth in SEQ ID NO:91, SEQ ID NO:93 and SEQ ID NO:95, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:91, SEQ ID NO:93 and SEQ ID NO:95, respectively; (m) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH16 are as set forth in SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103, respectively; (n) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH17 are as set forth in SEQ ID NO: 107, SEQ ID NO: 109 and SEQ ID NO: 111, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 107, SEQ ID NO: 109 and SEQ ID NO: 111, respectively; (o) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH18 are as set forth in SEQ ID NO:115, SEQ ID NO:117 and SEQ ID NO:119, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:115, SEQ ID NO:117 and SEQ ID NO:119, respectively; (p) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH19 are as set forth in SEQ ID NO: 123, SEQ ID NO: 125 and SEQ ID NO: 127, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 123, SEQ ID NO: 125 and SEQ ID NO: 127, respectively; and (q) the amino acid sequences of CDR1, CDR2 and CDR3 of VHH20 are as set forth in SEQ ID NO: 131, SEQ ID NO: 133 and SEQ ID NO: 135, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 131, SEQ ID NO: 133 and SEQ ID NO: 135, respectively; The anti-CD7 nanobody.

2. the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH10 are as set forth in SEQ ID NO:60, SEQ ID NO:62 and SEQ ID NO:64, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:60, SEQ ID NO:62 and SEQ ID NO:64, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH12 are as set forth in SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH06 are as set forth in SEQ ID NO:28, SEQ ID NO:30 and SEQ ID NO:32, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:28, SEQ ID NO:30 and SEQ ID NO:32, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH01 are as set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH03 are as set forth in SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH04 are as set forth in SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH07 are as set forth in SEQ ID NO:36, SEQ ID NO:38 and SEQ ID NO:40, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:36, SEQ ID NO:38 and SEQ ID NO:40, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH08 are as set forth in SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH09 are as set forth in SEQ ID NO:52, SEQ ID NO:54 and SEQ ID NO:56, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:52, SEQ ID NO:54 and SEQ ID NO:56, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH13 are as set forth in SEQ ID NO:76, SEQ ID NO:78 and SEQ ID NO:80, respectively, or homologous sequences thereof have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:76, SEQ ID NO:78 and SEQ ID NO:80, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH14 are as set forth in SEQ ID NO:84, SEQ ID NO:86 and SEQ ID NO:88, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:84, SEQ ID NO:86 and SEQ ID NO:88, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH15 are as set forth in SEQ ID NO:92, SEQ ID NO:94 and SEQ ID NO:96, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:92, SEQ ID NO:94 and SEQ ID NO:96, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH16 are as set forth in SEQ ID NO:100, SEQ ID NO:102 and SEQ ID NO:104, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:100, SEQ ID NO:102 and SEQ ID NO:104, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH17 are as set forth in SEQ ID NO:108, SEQ ID NO:110 and SEQ ID NO:112, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:108, SEQ ID NO:110 and SEQ ID NO:112, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH18 are as set forth in SEQ ID NO:116, SEQ ID NO:118 and SEQ ID NO:120, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:116, SEQ ID NO:118 and SEQ ID NO:120, respectively; the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH19 are as set forth in SEQ ID NO:124, SEQ ID NO:126 and SEQ ID NO:128, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:124, SEQ ID NO:126 and SEQ ID NO:128, respectively; and the nucleotide sequences of CDR1, CDR2 and CDR3 of VHH20 are as set forth in SEQ ID NO:132, SEQ ID NO:134 and SEQ ID NO:136, respectively, or their homologous sequences have at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:132, SEQ ID NO:134 and SEQ ID NO:136, respectively; 2. The nanobody of claim 1.

3. an amino acid sequence selected from the group consisting of SEQ ID NO:57, SEQ ID NO:65, SEQ ID NO:25, SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:49, SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121 and SEQ ID NO:129, or SEQ ID NO:57, SEQ ID NO:65, SEQ ID NO:25, SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:33, SEQ ID NO:41, SEQ ID NO:4 9, SEQ ID NO:73, SEQ ID NO:81, SEQ ID NO:89, SEQ ID NO:97, SEQ ID NO:105, SEQ ID NO:113, SEQ ID NO:121 and SEQ ID NO:129 or their homologous sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:

129.

4. The nucleotide sequences of VHH10, VHH12, VHH06, VHH01, VHH03, VHH04, VHH07, VHH08, VHH09, VHH13, VHH14, VHH15, VHH16, VHH17, VHH18, VHH19 and VHH20 are as set forth in SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:26, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 and SEQ ID NO:130, respectively, or a sequence similar thereto.

4. The Nanobody of claim 3, wherein said sequence has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:26, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 and SEQ ID NO:

130.

5. 1. A humanized anti-CD7 Nanobody obtained by humanizing residues at key positions in any one of the Nanobodies according to claim 1 using the universal humanization framework h-NbBcII10FGLA as reference through alignment with DP-47, and optionally comprising: the humanized anti-CD7 Nanobody comprises CDR1, CDR2 and CDR3 comprising the amino acid sequences of CDR1, CDR2 and CDR3 of hVHH06 as set forth in SEQ ID NO: 139, SEQ ID NO: 141 and SEQ ID NO: 143, respectively, or homologous sequences thereof having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 139, SEQ ID NO: 141 and SEQ ID NO: 143, respectively; and / or the humanized anti-CD7 Nanobody comprises the amino acid sequence of hVHH06 as set forth in SEQ ID NO: 137, or a homologous sequence thereof having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 137; the humanized anti-CD7 nanobody

6. 10. A chimeric antigen receptor comprising any one or any two of the Nanobody of claim 1 or the humanized anti-CD7 Nanobody of claim 5, optionally comprising: (a) the chimeric antigen receptor further comprises a transmembrane domain, wherein the transmembrane domain comprises the transmembrane domain of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; and / or (b) the chimeric antigen receptor further comprises an intracellular signaling domain, wherein the intracellular signaling domain comprises the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d; and / or (c) the chimeric antigen receptor further comprises a hinge region, the hinge region comprising the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; and / or (d) the signal peptide comprises the signal peptide of the following molecules: the alpha and beta chains of the T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF; and / or (e) the chimeric antigen receptor further comprises a costimulatory signaling domain, optionally comprising the costimulatory signaling domain of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226; and / or (f) the chimeric antigen receptor further comprises EF1α, T2A, tEGFR; and / or (g) the chimeric antigen receptor further comprises a tEGFR signal peptide; and / or (h) the chimeric antigen receptor is obtained by sequentially linking, in order, EF1α, a signal peptide, any one of the Nanobody of claim 1 or the humanized anti-CD7 Nanobody of claim 5, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide, and tEGFR; The chimeric antigen receptor.

7. 10. A dual nanobody-based chimeric antigen receptor, comprising any two selected from the nanobody of claim 1 or the humanized anti-CD7 nanobody of claim 5, optionally (a) the chimeric antigen receptor further comprises a transmembrane domain, wherein the transmembrane domain comprises the transmembrane domain of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; and / or (b) the chimeric antigen receptor further comprises an intracellular signaling domain, optionally comprising the intracellular signaling domain of the following molecules: CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, TCRζ, CD4, CD5, CD8, CD21, CD22, CD79a, CD79b, CD278, FcεRI, DAP10, DAP12, CD66d; and / or (c) the chimeric antigen receptor further comprises a hinge region, optionally comprising the hinge region of the following molecules: CD8α, CD28, IgG1, IgG4, 4-1BB, PD-1, CD34, OX40, CD3ε, IL-2 receptor, IL-7 receptor, IL-11 receptor; and / or (d) the signal peptide comprises the signal peptide of the following molecules: the alpha and beta chains of the T cell receptor, CD3ζ, CD3ε, CD4, CD5, CD8, CD9, CD28, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, GITR, GM-CSF; and / or (e) the chimeric antigen receptor further comprises a costimulatory signaling domain, optionally comprising the costimulatory signaling domain of the following molecules: 4-1BB (CD137), CD27, CD19, CD4, CD28, ICOS (CD278), CD8α, CD8β, BAFFR, HVEM, LIGHT, KIRDS2, SLAMF7, NKp30, NKp46, CD40, CDS, ICAM-1, B7-H3, OX40, DR3, GITR, CD30, TIM1, CD2, CD7, CD226; and / or (f) the chimeric antigen receptor further comprises EF1α, T2A, tEGFR; and / or (g) the chimeric antigen receptor further comprises a tEGFR signal peptide; and / or (h) any two Nanobodies selected from the Nanobody of claim 1 or the humanized anti-CD7 Nanobody of claim 5, linked via a connecting peptide linker; and / or (i) the chimeric antigen receptor is obtained by sequentially linking in order EF1α, a signal peptide, any two selected from the Nanobody of claim 1 or the humanized anti-CD7 Nanobody of claim 5, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide, and tEGFR; and / or (j) the chimeric antigen receptor is obtained by sequentially linking, in order, EF1α, a signal peptide, a first Nanobody selected from any one of the Nanobodies of claim 1 or the humanized anti-CD7 Nanobody of claim 5, a linker, a second Nanobody selected from any one of the Nanobodies of claim 1 or the humanized anti-CD7 Nanobody of claim 5, a CD8α hinge region, a CD8α transmembrane domain, a 4-1BB costimulatory signaling domain, a CD3ζ intracellular signaling domain, T2A, a tEGFR signal peptide and tEGFR; and / or (k) any one of the first and second Nanobodies is any one of the Nanobodies of claim 1 is VHH10, VHH12, VHH06 or VHH03; Depending on the situation, the first nanobody comprises a VHH10 and the second nanobody comprises a VHH10; the first nanobody comprises VHH10 and the second nanobody comprises VHH12; the first nanobody comprises a VHH12 and the second nanobody comprises a VHH12; the first nanobody comprises VHH06 and the second nanobody comprises VHH12; or the first nanobody comprises VHH06 and the second nanobody comprises VHH03; The chimeric antigen receptor.

8. 10. A nucleic acid molecule comprising a nucleotide sequence encoding a Nanobody of claim 1, a humanized anti-CD7 Nanobody of claim 5, or a chimeric antigen receptor of claim 6 or 7, Optionally, the nucleotide sequence is as set forth in SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:26, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 or SEQ ID NO:130, or a homologous sequence thereof is as set forth in SEQ ID NO:58, SEQ ID NO:66, SEQ ID NO:26, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:18, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 or SEQ ID NO:

130. The nucleic acid molecule having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:34, SEQ ID NO:42, SEQ ID NO:50, SEQ ID NO:74, SEQ ID NO:82, SEQ ID NO:90, SEQ ID NO:98, SEQ ID NO:106, SEQ ID NO:114, SEQ ID NO:122 or SEQ ID NO:

130.

9. A recombinant expression vector comprising the nucleic acid molecule of claim 8, optionally, the recombinant expression vector comprises a DNA vector, an RNA vector, a plasmid, a transposon vector, a CRISPR / Cas9 vector, or a viral vector; Optionally, the viral vector comprises a lentiviral vector, an adenoviral vector, or a retroviral vector; The above recombinant expression vector.

10. an engineered host cell expressing a Nanobody of claim 1, a humanized anti-CD7 Nanobody of claim 5, or a chimeric antigen receptor of claim 6 or 7; Optionally, the engineered host cells comprise engineered immune cells; Optionally, the engineered host cells comprise T cells, NK cells, iNKT cells, CTL cells, monocytes, macrophages, dendritic cells, NKT cells, or any combination thereof. The engineered host cell.

11. 10. A conjugate comprising a Nanobody according to claim 1 or a humanized anti-CD7 Nanobody according to claim 5 and a modifying moiety tethered to the Nanobody, wherein the modifying moiety comprises a detectable label, a therapeutic agent, Optionally, the detectable label comprises an enzyme, a radionuclide, a fluorescent dye, a luminescent material, biotin; Optionally, the therapeutic agent comprises a drug or cytotoxic agent with anti-tumor activity. The above conjugate.

12. 12. A pharmaceutical composition or kit comprising a Nanobody according to claim 1, a humanized anti-CD7 Nanobody according to claim 5, a chimeric antigen receptor according to claim 6 or 7, a nucleic acid molecule according to claim 8, a recombinant expression vector according to claim 9, an engineered host cell according to claim 10, or a conjugate according to claim 11.

13. A reagent for detecting a CD7 protein or an antigenic fragment thereof, comprising a nanobody according to claim 1, a humanized anti-CD7 nanobody according to claim 5, or a conjugate according to claim 11.

14. 13. A method for stimulating an immune response to a target cell population or target tissue in a mammal, comprising the following step: administering an effective amount of the engineered host cell of claim 10, the conjugate of claim 11, or the pharmaceutical composition of claim 12.

15. 11. A method for producing a Nanobody of claim 1 or a humanized anti-CD7 Nanobody of claim 5, comprising the steps of: culturing an engineered host cell of claim 10, and isolating the Nanobody of claim 1 or the humanized anti-CD7 Nanobody of claim 5 from the culture.

16. 10. A method for specifically inhibiting CD7 activity, comprising the steps of: introducing a nucleic acid molecule according to claim 8 into cells of an organism, and inhibiting CD7 activity by expressing a Nanobody according to claim 1 or a humanized anti-CD7 Nanobody according to claim 5.

17. 12. A pharmaceutical composition for preventing and / or treating a CD7-related disease or condition, comprising a Nanobody according to claim 1, a humanized anti-CD7 Nanobody according to claim 5, a chimeric antigen receptor according to claim 6 or 7, a nucleic acid molecule according to claim 8, a recombinant expression vector according to claim 9, an engineered host cell according to claim 10, or a conjugate according to claim 11, optionally, the CD7-associated disease or condition comprises a tumor that expresses CD7; optionally, the tumor is a hematological tumor of the T-lymphocyte lineage; Optionally, the tumor comprises acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT-cell leukemia, peripheral T-cell lymphoma (NHL), NKT-cell lymphoma, anaplastic large cell lymphoma (ALCL), The above pharmaceutical composition.

18. 1. A method for detecting CD7 protein or an antigenic fragment thereof, comprising the steps of: (1) obtaining a sample suspected of containing CD7 protein or an antigenic fragment thereof; (2) contacting the sample collected in step (1) with the Nanobody of claim 1, the humanized anti-CD7 Nanobody of claim 5, the conjugate of claim 11, the pharmaceutical composition or kit of claim 12, or the reagent for detecting CD7 protein or an antigenic fragment thereof of claim 13; and (3) detecting the presence of an antibody-antigen complex Including, optionally, the Nanobody is a labeled Nanobody with a label that can be used for detection; Optionally, labels that can be used for said detection include fluorescent pigments, avidin, paramagnetic atoms, radioisotopes; Optionally, the fluorescent pigment is fluorescein, rhodamine, Texas Red, phycoerythrin, phycocyanin, allophycocyanin, peridinin-chlorophyll protein; Optionally, the avidin is biotin, avidin derived from ovalbumin, streptavidin, avidin derived from egg yolk, or an avidin analog; Optionally, the radioisotope is radioactive iodine, radioactive cesium, radioactive iridium, or radioactive cobalt; The above method.

19. 11. A method for preparing an engineered host cell according to claim 10, comprising the steps of: introducing a recombinant expression vector according to claim 9 into a host cell; and / or The method for introducing further includes lipofection, microinjection, electroporation, DNA vector, RNA vector, retroviral vector, lentiviral vector, poxvirus vector, herpes simplex virus vector, adenovirus vector, adeno-associated virus vector; The above method.

20. 14. A composition for diagnosing whether a subject is suspected of having a tumor that expresses CD7, comprising a Nanobody according to claim 1, a humanized anti-CD7 Nanobody according to claim 5, a conjugate according to claim 11, a kit according to claim 12, or a reagent for detecting a CD7 protein or an antigenic fragment thereof according to claim 13, Optionally, samples are used that include urine, blood, serum, plasma, saliva, ascites, circulating cells, circulating tumor cells, non-tissue associated cells, tissue, or histological preparations; optionally, the CD7-expressing tumor is a hematological tumor of T-lymphocyte lineage; Optionally, the tumor comprises acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), lymphoblastic lymphoma (LBL), NKT-cell leukemia, peripheral T-cell lymphoma (NHL), NKT-cell lymphoma, anaplastic large cell lymphoma (ALCL), The above composition.