Cells containing suppressors of gene expression and / or synthetic pathway activators and / or inducible payloads

Abstract

Systems are provided herein that include one or both of a cytokine and / or synthetic pathway activator. Systems are also provided herein that include one or more suppressors of gene expression and one or both of a cytokine and / or synthetic pathway activator. Also provided are systems for at least one of a chimeric priming receptor that binds ALPG and / or ALPP, a chimeric antigen receptor that binds MSLN, and one or more suppressors of gene expression, and / or one or both of a cytokine and / or synthetic pathway activator, cells expressing such systems, and methods of using them.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 333,076, filed April 20, 2022, U.S. Provisional Application No. 63 / 369,656, filed July 27, 2022, U.S. Provisional Application No. 63 / 376,531, filed September 21, 2022, U.S. Provisional Application No. 63 / 376,499, filed September 21, 2022, and U.S. Provisional Application No. 63 / 384,600, filed November 21, 2022, each of which is incorporated by reference herein in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that was submitted through the Patent Center and is incorporated herein by reference in its entirety. The copy was created on April 20, 2023, is named ANB-214WO_SL.xml, and is 358,271 bytes in size. [Background technology]

[0003] background Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches to treating cancer have been attempted, including drug and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells the new ability to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.

[0004] Immunotherapy using CAR-T cells holds promise because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them.

[0005] After engineering T cells with CARs, the resulting CAR-T cells are introduced into patients to attack tumor cells. CAR-T cells can be derived either from T cells in the patient's own blood (autologous) or from T cells from another healthy donor (allogeneic). When CAR-T cells are infused into a patient, they come into contact with target antigens on cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate anti-tumor cytokine production, and target tumor cell killing.

[0006] However, some concerns and limitations remain with CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of the target antigen, resulting in off-target toxicity. Therefore, additional therapies that reduce off-target toxicity are needed. Summary of the Invention

[0007] overview The present disclosure generally relates to systems and methods for enhancing the function of immune cells expressing a CAR (e.g., by using logic gates comprising a CAR and a priming receptor, and a synthetic pathway activator (SPA) that enhances immune cell stimulation by inducing constitutive cytokine signaling). Overall, the systems and methods disclosed herein provide improved efficacy and antigen-specific targeting of CAR immune cells.

[0008] Disclosed herein, in various embodiments, are systems including a system comprising a first chimeric polypeptide comprising a priming receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), and a cytokine.

[0009] Disclosed herein, in various embodiments, are systems including a system comprising a first chimeric polypeptide comprising a priming receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), and a third chimeric polypeptide comprising a synthetic pathway activator (SPA).

[0010] Disclosed herein, in various embodiments, are systems including a system comprising a first chimeric polypeptide comprising a priming receptor, a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), a third chimeric polypeptide comprising a synthetic pathway activator (SPA), and a cytokine.

[0011] In various embodiments, disclosed herein are systems comprising: (a) a first chimeric polypeptide comprising a priming receptor; (b) a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); (c) a suppressor of gene expression; and (d) one or both of (i) a synthetic pathway activator (SPA) and / or (ii) a cytokine. In some embodiments, the priming receptor comprises, from N-terminus to C-terminus, a first extracellular antigen-binding domain, a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites, and an intracellular domain comprising a human or humanized transcriptional effector.

[0012] In some embodiments, the first extracellular antigen-binding domain specifically binds germline alkaline phosphatase (ALPG / P). In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 49, or 50, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5 or 51, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 53. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 9. In some embodiments, binding of ALPG / P by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites within the intracellular domain.

[0013] In some embodiments, the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain. In some embodiments, the first hinge domain comprises a CD8α or truncated CD8α hinge domain. In some embodiments, the first hinge comprises the sequence set forth in SEQ ID NO: 18.

[0014] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain. In some embodiments, the first transmembrane domain comprises the sequence set forth in SEQ ID NO:19.

[0015] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:23.

[0016] In some embodiments, the priming receptor further comprises a stop translocation sequence between the first transmembrane domain and the intracellular domain. In some embodiments, the stop translocation sequence comprises the sequence set forth in SEQ ID NO: 20. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 24.

[0017] In some embodiments, the CAR comprises, from N-terminus to C-terminus, (a) a second extracellular antigen-binding domain, (b) a second transmembrane domain, (c) an intracellular costimulatory domain, and (d) an intracellular activation domain.

[0018] In some embodiments, the second extracellular antigen-binding domain specifically binds to mesothelin (MSLN), and the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein (a) CDR-H1 is selected from the group consisting of: 10, 54, 56, 57, and 71. (b) CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, 61, or 308, (c) CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63, (d) CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67, (e) CDR-L2 comprises the sequence set forth in SEQ ID NO: 15, 68, 69, or 70, and (f) CDR-L3 comprises the sequence set forth in SEQ ID NO: 16 or 72. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the second extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 30.

[0019] In some embodiments, the CAR comprises a second hinge domain. In some embodiments, the second hinge domain comprises a CD8α or truncated CD8α hinge domain. In some embodiments, the second transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain. In some embodiments, the intracellular activation domain comprises a CD3ζ domain. In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 31 or 32.

[0020] In some embodiments, the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3, and / or STAT5 phosphorylation. In some embodiments, the SPA comprises an extracellular domain linked to an intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor. In some embodiments, the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

[0021] In some embodiments, the cytokine receptor comprises interleukin-6 signal transducer (IL6ST). In some embodiments, the extracellular domain transmits constitutive activity to the intracellular signaling domain. In some embodiments, the extracellular domain comprises a dimerization domain, optionally comprising at least one of a cysteine ​​residue and a leucine zipper. In some embodiments, the dimerization domain forms a homodimer.

[0022] In some embodiments, the SPA comprises leucine zipper-gp130 (L-gp130). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 74. In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75.

[0023] In some embodiments, the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism. In some embodiments, the SPA comprises membrane-bound interleukin-15 (mbIL-15). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 76. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 76.

[0024] In some embodiments, the SPA comprises CD34-interleukin-7 receptor (C7R). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 77. In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 78.

[0025] In some embodiments, the cytokine is a secreted cytokine. In some embodiments, the cytokine is an interleukin. In some embodiments, the cytokine comprises at least one of interleukin (IL)-2, Super-2, IL-12, IL-12 / 23p40, IL-7, IL-15, IL-21, and IL-18. In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine is Super-2. In some embodiments, the cytokine is IL-12. In some embodiments, the cytokine is IL-12 / 23p40. In some embodiments, the cytokine is IL-7. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine is IL-21. In some embodiments, the cytokine is IL-18.

[0026] In some embodiments, the cytokine comprises a non-native signal peptide. In some embodiments, the non-native signal peptide comprises a signal peptide derived from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA. In some embodiments, the non-native signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, or 130. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86, 88, 90, 92, 94, 96, 98, or 132.

[0027] In some embodiments, the suppressor of gene expression is an sgRNA or shRNA. In some embodiments, the suppressor of gene expression is an sgRNA. In some embodiments, the sgRNA suppresses expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH. In some embodiments, the sgRNA suppresses expression of PTPN2. In some embodiments, the sgRNA suppresses expression of RASA2. In some embodiments, the sgRNA suppresses expression of SOCS1. In some embodiments, the sgRNA suppresses expression of ZC3H12A. In some embodiments, the sgRNA suppresses expression of CISH. In some embodiments, the sgRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160-164.

[0028] In some embodiments, the suppressor of gene expression is an shRNA. In some embodiments, the shRNA suppresses expression of a gene selected from RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH. In some embodiments, the shRNA suppresses expression of RASA2. In some embodiments, the shRNA suppresses expression of SOCS1. In some embodiments, the shRNA suppresses expression of ZC3H12A. In some embodiments, the shRNA suppresses expression of TGFBR1. In some embodiments, the shRNA suppresses expression of CISH. In some embodiments, the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172.

[0029] In some embodiments, the system comprises two or more suppressors of gene expression. In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas) and an additional suppressor of gene expression. In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas), an shRNA that suppresses expression of TGFBR2, and an additional suppressor of gene expression. In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas), an shRNA that suppresses expression of PTPN2, and an additional suppressor of gene expression.

[0030] In some embodiments, the system comprises an sgRNA that inhibits CISH expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits PTPN2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits ZC3H12A expression and a cytokine that is IL-2. In some embodiments, the system comprises an shRNA that inhibits RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that inhibits ZC3H12A expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that inhibits CISH expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits PTPN2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits SOCS1 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits ZC3H12A expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits CISH expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that inhibits ZC3H12A expression and an SPA that is L-gp130. In some embodiments, the system comprises an shRNA that inhibits RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130.In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130. In some embodiments, the system comprises an shRNA that inhibits RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130.

[0031] In some embodiments, the priming receptor and the CAR are capable of binding to the same target cell. In some embodiments, the target cell is a human cell. In some embodiments, the target cell is a cancer cell. In some embodiments, the cancer cell is a solid cancer cell or a liquid cancer cell. In some embodiments, the cancer cell is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.

[0032] Also disclosed herein are, in various embodiments, one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system disclosed herein.

[0033] Also disclosed herein, in various embodiments, is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain, and a nucleotide sequence encoding a cytokine.

[0034] Also disclosed herein, in various embodiments, is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain, and a nucleotide sequence encoding a synthetic pathway activator.

[0035] Also disclosed herein, in various embodiments, is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain, a nucleotide sequence encoding a synthetic pathway activator, and a nucleotide sequence encoding a cytokine.

[0036] Also disclosed herein are one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising, in various embodiments, a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain, and one or both of a nucleotide sequence for a suppressor of gene expression, a nucleotide sequence encoding a synthetic pathway activator, and / or a nucleotide sequence encoding a cytokine. In some embodiments, the first extracellular antigen-binding domain specifically binds ALPG / P. In some embodiments, the second extracellular antigen-binding domain specifically binds MSLN. In some embodiments, the recombinant nucleic acid comprises two or more nucleic acid fragments.

[0037] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR. In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor. In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding a synthetic pathway activator. In some embodiments, the priming receptor and the synthetic pathway activator are under the control of the same constitutive promoter. In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor, and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor, and a nucleotide sequence encoding a synthetic pathway activator.

[0038] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, a constitutive promoter, a nucleotide sequence encoding a synthetic pathway activator, a nucleotide sequence encoding a priming receptor, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor. In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, an inducible promoter, a nucleotide sequence encoding a chimeric antigen receptor, a constitutive promoter, a nucleotide sequence encoding a priming receptor, and a nucleotide sequence encoding a synthetic pathway activator.

[0039] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the cytokine.

[0040] In some embodiments, the recombinant nucleic acid further comprises (a) an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and the nucleotide sequence encoding the cytokine, and (b) a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0041] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a constitutive promoter, (b) a nucleotide sequence encoding a priming receptor, (c) an inducible promoter, d) a nucleotide sequence encoding a chimeric antigen receptor, and (e) a nucleic acid sequence encoding a cytokine.

[0042] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a constitutive promoter, (b) a nucleotide sequence encoding a priming receptor, (c) an inducible promoter, (d) a nucleotide sequence encoding a cytokine, and (e) a nucleic acid sequence encoding a chimeric antigen receptor.

[0043] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) an inducible promoter, (b) a nucleotide sequence encoding a chimeric antigen receptor, (c) a nucleic acid sequence encoding a cytokine, (d) a constitutive promoter, and (e) a nucleotide sequence encoding a priming receptor.

[0044] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) an inducible promoter, (b) a nucleotide sequence encoding a cytokine, (c) a nucleic acid sequence encoding a chimeric antigen receptor, (d) a constitutive promoter, and (e) a nucleotide sequence encoding a priming receptor.

[0045] In some embodiments, the recombinant nucleic acid comprises (a) a first inducible promoter operably linked to a nucleotide sequence encoding a chimeric antigen receptor, (b) a second inducible promoter operably linked to a nucleotide sequence encoding a cytokine, and (c) a constitutive promoter operably linked to a nucleotide sequence encoding a priming receptor.

[0046] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a constitutive promoter, (b) a nucleotide sequence encoding a priming receptor, (c) a first inducible promoter, (d) a nucleotide sequence encoding a chimeric antigen receptor, (e) a second inducible promoter, and (f) a nucleic acid sequence encoding a cytokine.

[0047] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a constitutive promoter, (b) a nucleotide sequence encoding a priming receptor, (c) a second inducible promoter, (c) a nucleic acid sequence encoding a cytokine, (d) a first inducible promoter, and (e) a nucleotide sequence encoding a chimeric antigen receptor.

[0048] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a first inducible promoter, (b) a nucleotide sequence encoding a chimeric antigen receptor, (c) a second inducible promoter, (d) a nucleic acid sequence encoding a cytokine, (e) a constitutive promoter, and (f) a nucleotide sequence encoding a priming receptor.

[0049] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a first inducible promoter, (b) a nucleotide sequence encoding a chimeric antigen receptor, (c) a constitutive promoter, (d) a nucleotide sequence encoding a priming receptor, (e) a second inducible promoter, and (f) a nucleic acid sequence encoding a cytokine.

[0050] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a second inducible promoter, (b) a nucleic acid sequence encoding a cytokine, (c) a first inducible promoter, (d) a nucleotide sequence encoding a chimeric antigen receptor, (e) a constitutive promoter, and (f) a nucleotide sequence encoding a priming receptor.

[0051] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, (a) a second inducible promoter, (b) a nucleic acid sequence encoding a cytokine, (c) a constitutive promoter, (d) a nucleotide sequence encoding a priming receptor, (e) the first inducible promoter, and (f) a nucleotide sequence encoding a chimeric antigen receptor.

[0052] In some embodiments, the first inducible promoter and the second inducible promoter are the same.

[0053] In some embodiments, the nucleotide sequence encoding the priming receptor comprises the sequence set forth in SEQ ID NO: 35. In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 36. In some embodiments, the nucleotide sequence encoding the synthetic pathway activator comprises the sequence set forth in SEQ ID NO: 79, 80, 81, 82, or 83. In some embodiments, the nucleotide sequence encoding the cytokine comprises the sequence set forth in SEQ ID NO: 87, 89, 91, 93, 95, 97, or 99. In some embodiments, the suppressor of gene expression comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-172.

[0054] In some embodiments, the nucleic acid further comprises 5' and 3' homology-directed repair arms complementary to the insertion site in the host cell chromosome. In some embodiments, the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-cleaving 2A peptide (P2A). In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor. In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the priming receptor.

[0055] In some embodiments, the recombinant nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE). In some embodiments, the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor, or the WPRE is at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor. In some embodiments, the recombinant nucleic acid further comprises an SV40 polyA element.

[0056] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector. In some embodiments, the expression vector is a non-viral vector.

[0057] Also disclosed herein are expression vectors comprising the recombinant nucleic acids disclosed herein in various embodiments. In some embodiments, the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell. In some embodiments, the insertion site is located in the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0058] Also disclosed herein, in various embodiments, are immune cells comprising the system disclosed herein, at least one recombinant nucleic acid disclosed herein, and / or a vector disclosed herein. In some embodiments, the immune cells are primary human immune cells. In some embodiments, the immune cells are allogeneic immune cells. In some embodiments, the immune cells are autologous immune cells. In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors. In some embodiments, the primary immune cells are primary T cells. In some embodiments, the primary immune cells are primary human T cells. In some embodiments, the primary immune cells are virus-free.

[0059] Also disclosed herein are primary immune cells comprising at least one recombinant nucleic acid, in various embodiments, the recombinant nucleic acid comprising a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain, a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain, and a nucleic acid sequence encoding a cytokine and / or synthetic pathway activator, wherein the recombinant nucleic acid is inserted into a target region of the genome of the primary immune cell, and the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell. In some embodiments, the first extracellular antigen-binding domain specifically binds ALPG / P. In some embodiments, the second extracellular antigen-binding domain specifically binds MSLN.

[0060] Also disclosed herein are, in various embodiments, virus-free, viable primary cells comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds ALPG / P, a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds MSLN, and a nucleic acid sequence encoding a synthetic pathway activator that constitutively activates cytokine and / or cytokine signaling, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell. In some embodiments, the first extracellular antigen-binding domain specifically binds ALPG / P. In some embodiments, the second extracellular antigen-binding domain specifically binds MSLN.

[0061] Also disclosed herein are populations of cells that, in various embodiments, comprise a plurality of the immune cells disclosed herein.

[0062] Also disclosed herein, in various embodiments, is a pharmaceutical composition comprising an immune cell disclosed herein or a population of cells disclosed herein and a pharmaceutically acceptable excipient.

[0063] Also disclosed herein, in various embodiments, is a pharmaceutical composition comprising a recombinant nucleic acid disclosed herein or a vector disclosed herein and a pharmaceutically acceptable excipient.

[0064] Also disclosed herein, in various embodiments, is a method of editing an immune cell, comprising: providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a recombinant nucleic acid disclosed herein, wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; and editing the immune cell via insertion of the recombinant nucleic acid disclosed herein into the insertion site in the genome of the immune cell. In some embodiments, the non-virally introducing step comprises electroporation.

[0065] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease. In some embodiments, the target region of the cell's genome is the T-cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus. In some embodiments, the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid. In some embodiments, the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, and optionally, the circular recombinant nucleic acid is a plasmid.

[0066] In some embodiments, the immune cells are primary human immune cells. In some embodiments, the immune cells are autologous immune cells. In some embodiments, the immune cells are allogeneic immune cells. In some embodiments, the immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors. In some embodiments, the immune cells are primary T cells. In some embodiments, the immune cells are primary human T cells. In some embodiments, the immune cells are virus-free. In some embodiments, the method further comprises obtaining the immune cells from the patient and introducing a plasmid with the recombinant nucleic acid.

[0067] Also disclosed herein, in various embodiments, is a method for treating a disease in a subject, the method comprising administering to the subject an immune cell disclosed herein, a primary cell disclosed herein, or a pharmaceutical composition disclosed herein. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid cancer or a liquid cancer. In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.

[0068] In some embodiments, administration of the immune cells enhances an immune response in the subject. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the enhanced immune response is increased expression of at least one cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the improved immune response is increased lysis of target cells. In some embodiments, the method further comprises administering an immunotherapy to the subject simultaneously with or after the immune cells.

[0069] Also disclosed herein, in various embodiments, is a method of modulating the activity of an immune cell, comprising obtaining an immune cell comprising a system disclosed herein, a recombinant nucleic acid disclosed herein, and / or a vector disclosed herein, and contacting the immune cell with a target cell expressing ALPG / P and MSLN, wherein binding of a priming receptor to ALPG / P on the target cell induces activation of the priming receptor and expression of a chimeric antigen receptor, binding of the chimeric antigen receptor to MSLN on the target cell modulates the activity of the immune cell, and cytokine and / or synthetic pathway activators also modulate the activity of the immune cell.

[0070] In some embodiments, modulating immune cell activity comprises enhancing an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the immune cell activity is increased expression of at least one cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the immune cell activity is lysis of target cells.

[0071] Also disclosed herein are systems comprising (a) at least one of a CAR, an SPA, and a cytokine, and (b) a suppressor of RASA2 expression. In various embodiments, the SPA comprises leucine zipper-gp130 (L-gp130). In some embodiments, the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 74. In some embodiments, the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75.

[0072] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the nucleic acid sequence set forth in SEQ ID NO: 86. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 96. In some embodiments, the suppressor of RASA2 expression is an shRNA or sgRNA. In some embodiments, the suppressor of RASA2 is an shRNA. In some embodiments, the shRNA comprises the amino acid sequence of SEQ ID NO: 165. In some embodiments, the suppressor of RASA2 expression is an sgRNA. In some embodiments, the sgRNA comprises the amino acid sequence of SEQ ID NO: 161.

[0073] In some embodiments, the system further comprises an shRNA that suppresses expression of TNFRSF6 (Fas). In some embodiments, the system further comprises an shRNA that suppresses expression of TGFBR2. In some embodiments, the system further comprises an shRNA that suppresses expression of PTPN2.

[0074] Also disclosed herein are, in various embodiments, one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system disclosed herein.

[0075] Also disclosed herein are expression vectors that, in various embodiments, comprise the recombinant nucleic acid sequences provided herein.

[0076] Also disclosed herein are engineered immune cells comprising, in various embodiments, a system disclosed herein, a recombinant nucleic acid sequence disclosed herein, or an expression vector disclosed herein.

[0077] Also disclosed herein are various embodiments of engineered immune cells, including (a) at least one of a CAR, an SPA, and a cytokine, and (b) a suppressor of RASA2 expression. In some embodiments, the SPA comprises leucine zipper-gp130 (L-gp130). In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 74. In some embodiments, the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75.

[0078] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86. In some embodiments, the suppressor of RASA2 expression is an shRNA or sgRNA. In some embodiments, the suppressor of RASA2 is an shRNA. In some embodiments, the shRNA comprises the amino acid sequence of SEQ ID NO: 165. In some embodiments, the suppressor of RASA2 expression is an sgRNA. In some embodiments, the sgRNA comprises the amino acid sequence of SEQ ID NO: 161.

[0079] In some embodiments, the engineered immune cells further comprise an shRNA that suppresses expression of TNFRSF6 (Fas). In some embodiments, the engineered immune cells further comprise an shRNA that suppresses expression of TGFBR2. In some embodiments, the engineered immune cells further comprise an shRNA that suppresses expression of PTPN2.

[0080] In some embodiments, the engineered immune cells are primary human immune cells. In some embodiments, the engineered immune cells are allogeneic immune cells. In some embodiments, the engineered immune cells are autologous immune cells. In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors. In some embodiments, the primary immune cells are primary T cells. In some embodiments, the primary immune cells are primary human T cells. In some embodiments, the primary immune cells are virus-free.

[0081] Also disclosed herein are populations of cells that, in various embodiments, comprise a plurality of the engineered immune cells disclosed herein.

[0082] Also disclosed herein, in various embodiments, is a pharmaceutical composition comprising an engineered immune cell disclosed herein or a population disclosed herein and a pharmaceutically acceptable excipient.

[0083] Also disclosed herein, in various embodiments, are methods of treating a disease in a subject, the method comprising administering to the subject an engineered immune cell disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid cancer or a liquid cancer. In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer. In some embodiments, administration of the engineered immune cells enhances an immune response in the subject. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the enhanced immune response is increased expression of at least one cytokine or chemokine. In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ. In some embodiments, the improved immune response is increased lysis of target cells. In some embodiments, the method further comprises administering to the subject an immunotherapy simultaneously with or after the engineered immune cells.

[0084] Also disclosed herein, in various embodiments, are methods of inhibiting target cells in a subject, comprising administering to the subject an engineered immune cell disclosed herein or a pharmaceutical composition disclosed herein, wherein the engineered immune cell inhibits the target cell. In some embodiments, the target cell is a cancer cell.

[0085] These and other features, aspects, and advantages of the present invention will become better understood in connection with the following description and accompanying drawings. [Brief explanation of the drawings]

[0086] [Figure 1] FIG. 1 shows a schematic diagram of an exemplary logic gate protein expression system using synthetic pathway activators (SPAs).

[0087] [Figure 2A] Figure 1 shows the fold change of T cells expressing various pro-survival receptors cultured in cytokine-free medium over 6 days. The percentage of logic gate-expressing T cells (LG T cells) in the culture is defined by the number of cells expressing the Myc tag on primeR. [Figure 2B] Absolute cell numbers of cells from Figure 2A are shown, expressed as fold change from the first day of culture.

[0088] [Figure 3] Figure 1 shows phosphorylation of STAT1, STAT3, and STAT5 proteins under unstimulated conditions in T cells expressing two synthetic pathway activators compared to T cells expressing an inactive truncated EGFR molecule (EGFRt) on their surface.

[0089] [Figure 4A] A comparison of baseline pSTAT1 levels across LGTs expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules is shown. [Figure 4B] A comparison of baseline pSTAT3 levels across LGTs expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules is shown. [Figure 4C] A comparison of baseline pSTAT5 levels across LGTs expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules is shown.

[0090] [Figure 5A] PrimeR surface expression is shown on T cells expressing the indicated proteins cultured alone or with antigen-negative tumor cells. [Figure 5B] Catalytic CAR surface expression is shown in T cells expressing the indicated proteins cultured alone or with antigen-negative tumor cells.

[0091] [Figure 6A]Figure 1 shows the cytotoxic activity of LG T expressing the pro-survival module or the inactive EGFRt molecule when co-cultured with antigen-positive cells. [Figure 6B] Figure 1 shows the cytotoxic activity of LG T expressing a pro-survival module or an inactive EGFRt molecule when co-cultured with antigen-negative cells.

[0092] [Figure 7A] Continual analysis over a 72-hour period of tumor cell killing by LG T expressing pro-survival molecules at four different effector:target ratios is shown. [Figure 7B] Shown is a continuous analysis over a 72 hour period of T cell expansion during co-culture with antigen-positive tumor cells at four different effector:target ratios.

[0093] [Figure 8A] Shown are cell numbers of logically gated T cells expressing the indicated pro-survival receptors cultured on ALPG / MSLN-expressing RPMI cells over a 10-day period. [Figure 8B] Representative well images of logically gated T cells expressing cleaved EGFR on day 10 are shown. [Figure 8C] Representative well images of logically gated T cells expressing gp130-based SPAs on day 10 are shown.

[0094] [Figure 9] Quantification of flow cytometry staining of various T cell phenotypic markers on prechallenged LG T expressing various pro-survival molecules is shown.

[0095] [Figure 10] Cytotoxicity and T cell expansion are shown over a 15-day repeated stimulation assay in which LG T cells were challenged every 2-3 days with K562 tumor cells.

[0096] [Figure 11A]Summary metrics showing tumor cell expansion throughout a 31-day repeated stimulation assay (in the presence or absence of IL-2-supplemented medium) are shown, with data from two donors indicated (left and right panels). [Figure 11B] Summary metrics showing total T cell expansion across 31 days of repeated stimulation assays (in the presence or absence of IL-2-supplemented media) are shown, with data from the two donors indicated (left and right panels).

[0097] [Figure 12] Cell viability of T cells expressing the indicated pro-survival receptors cultured in cytokine-free medium over a 6-day period following six consecutive tumor challenges is shown.

[0098] [Figure 13A] Quantification of flow cytometry staining of various T cell phenotypic markers on ICTs after six tumor challenges in the absence of IL-2-supplemented medium is shown. [Figure 13B] Quantification of flow cytometry staining of various T cell phenotypic markers on ICTs after six tumor challenges in the presence of IL-2-supplemented medium is shown.

[0099] [Figure 14A] Comparison of cell phenotypes in ICT stimulated with tumor cells in the absence of IL-2. [Figure 14B] Comparison of cell phenotypes in ICT stimulated with tumor cells in the presence of IL-2.

[0100] [Figure 15A] 1 shows a comparison of cell phenotypic changes over time in T cells expressing truncated EGFR stimulated with tumor cells in the absence of IL-2. [Figure 15B] 1 shows a comparison of cell phenotypic changes over time in T cells expressing truncated EGFR stimulated with tumor cells in the presence of IL-2. [Figure 15C]1 shows a comparison of cell phenotypic changes over time in T cells expressing gp130-based SPAs stimulated with tumor cells in the absence of IL-2. [Figure 15D] 1 shows a comparison of cell phenotypic changes over time in T cells expressing gp130-based SPAs stimulated with tumor cells in the presence of IL-2.

[0101] [Figure 16A] Figure 16 shows the phosphorylation of STAT3 (Figure 16A) and STAT1 (Figure 16B) proteins under unstimulated conditions in T cells expressing L-gp130 with or without knockdown of FAS and PTPN2. T cells expressing EGFRt are used as a control. [Figure 16B] Figure 16 shows the phosphorylation of STAT3 (Figure 16A) and STAT1 (Figure 16B) proteins under unstimulated conditions in T cells expressing L-gp130 with or without knockdown of FAS and PTPN2. T cells expressing EGFRt are used as a control.

[0102] [Figure 17A] Figure 1 shows the relative expansion of target cells after incubation with LG T cells expressing EGFRt or L-gp130 with or without knockdown of FAS / PTPN2. [Figure 17B] The relative numbers of SPA-expressing LG T cells expressing the indicated surface markers as measured by flow cytometry are shown.

[0103] [Figure 18A] Heatmap of differential gene expression in SPA-expressing LG T cells before and after challenge by repeated stimulation assay. [Figure 18B] Heatmap of differential expression of selected markers of T cell exhaustion in LG T cells before and after challenge by repeated stimulation assay.

[0104] [Figure 19]Figure 1 shows the accessibility of loci for selected markers of T cell exhaustion (TIGIT and TOX) in LG T cells measured by ATAC-seq before and after challenge with a repeated stimulation assay.

[0105] [Figure 20] Illustrates the SPA interrogation assay design in mice using CAR / primeR logic-gated T cells expressing the indicated SPAs.

[0106] [Figure 21] Illustrates the SPA interrogation assay design in mice using CAR / primeR logic-gated T cells expressing the indicated SPAs.

[0107] [Figure 22A] Tumor burden in mice treated with CAR / primeR LG T cells expressing the indicated SPAs is shown. [Figure 22B] Shown are levels of LG T cells in mice treated with CAR / primeR logic-gated T cells expressing the indicated SPAs. [Figure 22C] Figure 1 shows the cell counts of LG T cells expressing SPA at the indicated experimental endpoints, normalized to the EGFRt control.

[0108] [Figure 23A] Tumor burden in mice treated with CAR / primeR logic-gated T cells expressing the indicated SPAs is shown. [Figure 23B] Shown are levels of logic-gated T cells in mice treated with CAR / primeR logic-gated T cells expressing the indicated SPAs.

[0109] [Figure 24A] 1 shows the effect of SPA-expressing LG T cells in a mouse xenograft model of renal cell carcinoma. Illustrates the experimental design. [Figure 24B]1 shows the effect of SPA-expressing LG T cells in a mouse xenograft model of renal cell carcinoma. 2 shows tumor burden in mice implanted with LG T cells expressing the indicated SPAs. [Figure 24C] 1 shows the effect of SPA-expressing LG T cells in a mouse xenograft model of renal cell carcinoma. The total number of SPA-expressing LG T cells in whole blood at the indicated time points after LG T cell transplantation is shown.

[0110] [Figure 25A] 1 illustrates an assay to test for inducible cytokine secretion in response to logic gate activation. [Figure 25B] Activation of inducible IL-2 secretion in response to logic gate activation.

[0111] [Figure 26A] Illustrates an assay testing CAR-T cell-mediated cytotoxicity in response to logic gate activation with or without inducible cytokine expression. [Figure 26B] Shown is CAR-T cell-mediated cytotoxicity at the indicated effector:target (E:T) ratios in the absence of antigen stimulation. [Figure 26C] Figure 1 shows CAR-T cell-mediated cytotoxicity at E:T ratios in the presence of priming and cytolytic antigen stimulation.

[0112] [Figure 27A] Illustrates flow cytometry analysis of logic gate leakiness in unstimulated LG T cells. [Figure 27B] 1 shows expression of primeR and CAR in the absence of antigen stimulation in LG T cells, with nucleic acid encoding a cytokine "payload" located upstream of the nucleic acid encoding the CAR. [Figure 27C] 1 shows expression of primeR and CAR in the absence of antigen stimulation in LG T cells, with nucleic acid encoding a cytokine "payload" located downstream of the nucleic acid encoding the CAR.

[0113] [Figure 28] Expansion of T cells expressing logic gates in the presence of the indicated cytokines is shown.

[0114] [Figure 29] Expansion of T cells expressing logic gates in the presence of the indicated cytokines is shown.

[0115] [Figure 30] Shown is the secretion of the indicated inducible cytokines in logically gated T cells stimulated with PrimeR and CAR antigens compared to controls.

[0116] [Figure 31] Logical gate + indicates expansion of T cells expressing the indicated inducible cytokines.

[0117] [Figure 32A] We detail the construction of inducible cytokines with non-native signal peptides to allow regulatable secretion. [Figure 32B] Levels of IL-7 secretion in logic-gated T cells with the indicated signal peptides are shown.

[0118] [Figure 33A] Tumor volume over time is shown in mice treated with logically gated T cells expressing the indicated accessory molecules. [Figure 33B] Titers of logically gated T cells expressing the indicated accessory molecules are shown at the indicated time points after tumor injection. [Figure 33C] Shown are titers of logically gated T cells expressing the indicated accessory molecules 15 days after tumor injection.

[0119] [Figure 34A] FIG. 1 is a schematic detailing the workflow for high-throughput screening of synthetic pathway activators (SPAs) and cytokine combinations. [Figure 34B]

[0023] Figure 1 is a schematic detailing the workflow for high-throughput screening of synthetic pathway activators (SPAs) and cytokine combinations.

[0024] Figure 2 details the process for normalizing the edited cells of the screen. [Figure 34C] Figure 1 is a schematic detailing the workflow for high-throughput screening of synthetic pathway activators (SPAs) and cytokine combinations. Figure 2 details the continuous stimulation assay used to screen edited T cells for effects on target cell killing and T cell proliferation.

[0120] [Figure 35A] 1 shows the results of screening LG T cells expressing the indicated SPA and cytokine combinations based on decreased numbers of target cells (lower numbers indicate increased target cell killing). Results of combinations are shown with boxes colored based on the SPA expressed. [Figure 35B] 1 shows the results of screening LG T cells expressing the indicated SPA and cytokine combinations based on decreased numbers of target cells (lower numbers indicate increased target cell killing). Results of combinations are shown with boxes colored based on the cytokine expressed. [Figure 35C] 1 shows the results of screening LG T cells expressing the indicated SPA and cytokine combinations based on reduced numbers of target cells (lower numbers indicate increased target cell killing). Results of the top 20 tested combinations compared to the indicated positive control are shown.

[0121] [Figure 36A] 1 shows a graph detailing combinations that outperform single-module LG T cells. 1 shows combinations that outperform single-module LG T cells based on reduced target cell numbers. [Figure 36B]Graphs detailing combinations that outperform single-module LG T cells are shown. Combinations that outperform single-module LG T cells are shown based on increased T cell expansion.

[0122] [Figure 37A] Graphs are shown detailing combinations that did not show an additive effect on single-module LG T cells. Graphs are shown detailing the effect of combining sgRNA targeting PTPN2 with L-gp130 on T cell expansion compared to the effect of L-gp130 or sgRNA alone. [Figure 37B] Graphs are shown detailing combinations that did not show an additive effect on single-module LG T cells. Graphs are shown detailing the effect of a combination of a CISH-targeting sgRNA and C7R on target cell number compared to the effect of C7R or sgRNA alone. [Figure 37C] Figure 1 shows a graph detailing combinations that showed no additive effect on single-module LG T cells. Figure 2 shows an ANOVA analysis of L-gp130 and IL-2 combinations in LG T cells across different backgrounds. [Figure 37D] Figure 1 shows a graph detailing combinations that showed no additive effect on single-module LG T cells. Figure 2 shows an ANOVA analysis of L-gp130 and IL-12 combinations in LG T cells across different backgrounds.

[0123] [Figure 38] Graph showing the results of a continuous stimulation assay screening of LG T cells expressing the indicated cytokines and sgRNA / ribonucleoproteins and cultured in the presence of the indicated cytokines.

[0124] [Figure 39A]We detail a continuous stimulation assay screen of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs cultured in the presence or absence of TGF-β. We detail the combinations tested. [Figure 39B] We detail a continuous stimulation assay screen of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs cultured in the presence or absence of TGF-β. Results are shown for the indicated combinations, including inducible IL-2 expression. [Figure 39C] We detail a continuous stimulation assay screen of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs cultured in the presence or absence of TGF-β. Results are shown for the indicated combinations, including inducible IL-12 expression.

[0125] [Figure 40A] Figure 1 details a continuous stimulation assay screening of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs. Results of screening LG T cells in the absence of TGF-β (left panel) and selected results for the indicated combinations (right panel) are shown. [Figure 40B] Figure 1 details the sequential stimulation assay screening of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs. Results of screening LG T cells in the presence of TGF-β (left panel) and selected results for the indicated combinations (right panel) are shown. [Figure 40C] Figure 1 details a sequential stimulation assay screen of LG-T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs. The top-performing cytokine, SPA, and sgRNA combinations (left panel) or SPA and sgRNA combinations with control inducible payloads (right panel) are shown.

[0126] [Figure 41A]The mean tumor volume in mice after treatment with the indicated ICT cells is shown. [Figure 41B] Total T cells are shown at 7, 14, 21, and 42 days after T cell injection.

[0127] [Figure 42] Serum levels of IL2 and IFNγ are shown at days 14, 21, and 42 after in vivo injection with the indicated ICT cells.

[0128] [Figure 43A] TCR expansion and tumor lysis rates are shown after incubation of T cells with exogenous IL-2 or IL-15 or after delayed addition of exogenous IL-2 or IL-15. [Figure 43B] The rate of TCR target cell growth after incubation with the indicated cytokines is shown.

[0129] [Figure 44] This shows that the addition of IL-15 expression to ICT cells expressing L-gp130(SPA.I) resulted in increased killing by T cells. DETAILED DESCRIPTION OF THE INVENTION

[0130] Detailed Description definition Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0131] With respect to antibody binding to a target molecule, the terms "binds to," "specific binding to," "specifically binds to," "specific for," "selectively binds to," and "selective for" a particular antigen (e.g., a polypeptide target) or epitope on a particular antigen refer to binding that is measurably different from nonspecific or nonselective interactions (e.g., with non-target molecules). For example, an antibody that "selectively binds to" or "specifically binds to" an antigen is an antigen-binding moiety that binds to the antigen with high affinity and does not significantly bind to other, unrelated antigens. Specific binding can be measured, for example, by measuring binding to the target molecule and comparing it to binding to non-target molecules. Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule. In this case, specific binding is indicated if binding of the antibody to the target molecule is competitively inhibited by the control molecule. In some embodiments, the extracellular antigen-binding domain specifically binds to germline alkaline phosphatase (ALPG). In some embodiments, the extracellular domain comprises an antigen-binding moiety that binds to placental alkaline phosphatase (ALPP).

[0132] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of molecule X with its partner Y can be represented by a dissociation equilibrium constant (KD). The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including, but not limited to, surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0133] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Typically, a naturally occurring four-chain antibody contains six HVRs, three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs typically contain amino acid residues from the hypervariable loops and / or from the complementarity-determining regions (CDRs), the latter being those with the highest sequence variability and / or involved in antigen recognition. With the exception of CDR1 in VH, CDRs typically contain amino acid residues that form the hypervariable loops. Hypervariable regions (HVRs) are also referred to as "complementarity-determining regions" (CDRs), and these terms are used interchangeably herein with respect to the portions of the variable regions that form the antigen-binding region. This particular region is described by Kabat et al., US Department of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and Chothia et al., J Mol Biol 196:901-917 (1987), and the definitions include overlapping or subsets of amino acid residues when compared with each other. However, application of either definition to refer to a CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The exact residue numbers encompassing a particular CDR will vary depending on the sequence and size of the CDR. One of ordinary skill in the art can routinely determine which residues comprise a particular CDR, given the amino acid sequence of the variable region of an antibody.

[0134] The amino acid sequence boundaries of the CDRs can be determined by one of skill in the art using any of several known numbering schemes, including those described by Kabat et al. supra (the "Kabat" numbering scheme), Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (the "Chothia" numbering scheme), MacCallum et al., 1996, J. Mol. Biol. 262:732-745 (the "Contact" numbering scheme), Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 (the "IMGT" numbering scheme), and Honegge and Pluckthun, J. Mol. Biol., 2001, 309:657-70 (the "AHo" numbering scheme), each of which is incorporated by reference in its entirety.

[0135] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat and Chothia schemes. For CDR-H1, residue numbering is provided using both the Kabat and Chothia numbering schemes.

[0136] CDRs can be assigned, for example, using antibody numbering software such as Abnum, available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, which is incorporated by reference in its entirety.

[0137] [Table A]

[0138] The "EU numbering scheme" is generally used when referring to residues in antibody heavy chain constant regions (e.g., as reported in Kabat et al., supra). Unless otherwise stated, the EU numbering scheme is used to refer to residues in antibody heavy chain constant regions described herein.

[0139] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In certain such embodiments, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain in the single-chain Fab molecule. As described in more detail herein, an scFv has a variable domain of a light chain (VL), which is connected from its C-terminus to the N-terminus of the variable domain of a heavy chain (VH) by a polypeptide chain. Alternatively, an scFv comprises a polypeptide chain, and the C-terminus of the VH is connected to the N-terminus of the VL by a polypeptide chain.

[0140] A "Fab fragment" (also called fragment antigen binding) contains the constant domain of the light chain (CL) and the first constant domain of the heavy chain (CH1), as well as the variable domains VL and VH on the light and heavy chains, respectively. The variable domains contain the complementarity-determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0141] An "F(ab')2" fragment contains two Fab' fragments linked by a disulfide bond near the hinge region. F(ab')2 fragments can be produced, for example, by recombinant methods or by pepsin digestion of an intact antibody. F(ab')2 fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0142] An "Fv" fragment comprises a non-covalently associated dimer of one heavy- and one light-chain variable domain.

[0143] A "single-chain Fv" or "scFv" comprises the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of scFvs, see Plückthun in *The Pharmacology of Monoclonal Antibodies*, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO 93 / 16185, U.S. Patent No. 5,571,894, and U.S. Patent No. 5,587,458.

[0144] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen, without the presence of other variable domains. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also known as sdAbs or nanobodies. sdAbs are fairly stable and easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, De Haard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol. Biotechnol. 77(1):13-22).

[0145] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a segment of DNA located along a chromosome that encodes a specific protein or segment of a protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. A gene may further include a terminator, an enhancer, and / or a silencer.

[0146] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0147] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene, as defined herein, may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.

[0148] As used herein, the term "insertion" refers to a nucleotide sequence that is integrated (inserted) into a target locus or a safe harbor site. An insertion can be used to refer to a gene or genetic element that is integrated into a target locus or a safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into a genomic region known to those skilled in the art.

[0149] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create a compatible overlap, and then joining the molecules together using ligase. Those skilled in the art will be very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, drawings, and tables.

[0150] The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are referred to as small guide RNAs (sgRNAs).

[0151] Cas9 homologs are found in a wide variety of fungi, including, but not limited to, bacteria from the following taxa: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737; Nat. Rev. Microbiol. 2011 June;9(6):467-477; Hou, et al., Proc Natl Acad Sci USA. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.

[0152] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin or derived therefrom). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex comprising a Cas9 protein, a tracrRNA, and a crRNA-guide RNA).

[0153] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0154] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, optionally sorted, and used directly, for example, without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-γ, or a combination thereof.

[0155] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and identified a specific foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or mammalian-derived T cells. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +T cells can be any type of T cell, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral T cells, including, but not limited to, blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδ T cells, and the like. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells), and the like. T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem or progenitor cells.

[0156] "CD4+ T cells" refer to a subset of T cells that express CD4 on their surface and are involved in cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II-restricted immune responses. On T lymphocytes, the CD4 antigen defines helper / inducer subsets.

[0157] "CD8+ T cells" refer to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.

[0158] As used herein, the phrase "hematopoietic stem cells" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can also be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells express c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 -、 CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells express CD150 + CD48 - CD244 - is.

[0159] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic cells can be obtained or provided by isolating hematopoietic stem cells and differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into additional cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.

[0160] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.

[0161] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, for example, covalently linking them to a nucleic acid sequence in the chromosomal DNA of the cell. It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" can further include the replacement of the deleted endogenous sequence or nucleotides with one or more inserted nucleotides.

[0162] As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, e.g., by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in connection with expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in connection with expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.

[0163] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequence, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.

[0164] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0165] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a natural polypeptide (e.g., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a natural polypeptide having less than 100% sequence identity to the natural polypeptide) or a fragment thereof.

[0166] As used herein, the terms "complementary" or "complementarity" refer to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described herein can include a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a sequence, e.g., a genomic sequence in a cell.

[0167] As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein that is encoded by a gene (recombinant DNA) and has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g., a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0168] "Protein," "polypeptide," and "peptide" are used interchangeably herein.

[0169] As used herein, the term "operably linked" or "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if it is capable of affecting the expression of the coding sequence or functional RNA (e.g., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a control sequence in both sense and antisense orientations.

[0170] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively developing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).

[0171] As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG) and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of skill in the art.

[0172] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.

[0173] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived entirely from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0174] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.). See, e.g., U.S. Publication No. 2018 / 0127786, the disclosure of which is incorporated herein by reference in its entirety.

[0175] As contemplated herein, gene editing can involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such a knocked-in DNA sequence may include an entire gene or multiple genes, and may include regulatory sequences associated with the gene or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a recombinant protein can be inserted into the genome of a cell harboring a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either deleting or adding a nucleotide sequence, which leads to a disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.

[0176] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nick ends of DNA strands are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination of one or more nucleotides at the repair site.

[0177] As used herein, the term "homology-directed repair" or HDR refers to the cellular process in which the broken or nick ends of DNA strands are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repeat region on the same or different chromosome) located elsewhere in the genome. Alternatively, exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in the sequence at the target site. In this way, specific mutations can be introduced at the break site.

[0178] As used herein, single-stranded DNA template or double-stranded DNA template refers to the DNA oligonucleotide that can be used by cell as template for HDR.Generally, single-stranded DNA template or double-stranded DNA template has at least one region of homology with target site.In some cases, single-stranded DNA template or double-stranded DNA template has two homologous regions adjacent to the region that contains the heterologous sequence that is inserted into target cleavage site.

[0179] The terms "vector" and "plasmid" are used interchangeably and, as used herein, refer to a polynucleotide vehicle useful for introducing genetic material into a cell. A vector can be linear or circular. A vector can integrate into a target genome of a host cell or replicate independently within the host cell. A vector can include, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0180] As used herein, the term "introduce" in the context of introducing a nucleic acid or a complex containing a nucleic acid, such as an RNP-DNA template complex, refers to the translocation of a nucleic acid sequence or an RNP-DNA template complex from outside the cell to inside the cell.In some cases, introducing refers to the translocation of a nucleic acid or complex from outside the cell to the nucleus of the cell.Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.

[0181] As used herein, the term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide construct that includes regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can facilitate transcription of the selected polynucleotide within the host cell, or transcription and translation of the selected polynucleotide within the host cell. The expression cassette can, for example, be integrated into the genome of the host cell or can be present in an expression vector.

[0182] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder described herein.

[0183] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0184] The term "composition" refers to a mixture containing, for example, engineered cells or proteins contemplated herein. In some embodiments, a composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and that does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0185] The term "in situ" refers to processes that occur within living cells grown isolated from an organism, for example, grown in tissue culture.

[0186] The term "in vivo" refers to a process that occurs within a living organism.

[0187] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.

[0188] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0189] The term "percent identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have the same specified percentage of nucleotide or amino acid residues when compared and aligned for maximum correspondence, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0190] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence(s) relative to the reference sequence based on the designated program parameters.

[0191] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally Ausubel et al., infra).

[0192] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0193] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0194] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of the disease.

[0195] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.

[0196] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0197] As used herein, the term "treating" includes any effect that results in the improvement of a condition, disease, disorder, etc., e.g., lessening, reducing, modulating, ameliorating, or eliminating, or the amelioration of a symptom thereof.

[0198] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively activating or increasing, the recited variable.

[0199] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0200] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0201] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0202] Logic Gate System As used herein, "logic gate," "circuit," "circuit receptor," "system," or "system receptor" refers to a bipartite protein expression system comprising a priming receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, and the priming receptor is expressed in the cell. The intracellular domain of the priming receptor is cleaved from the transmembrane domain when the priming receptor binds to its target antigen. The intracellular domain can then translocate into the cell nucleus, where it induces expression of the chimeric antigen receptor. Synthetic pathway activators can also be used to enhance the expansion and activity of T cells expressing logic gates (LG T cells).

[0203] An overview of an exemplary logic gate system using synthetic pathway activators is shown in Figure 1. In various embodiments, the system includes four steps leading to T cell activation: (1) synthetic pathway activator (SPA) and priming receptor (primeR) are constitutively expressed, (2) primeR is triggered, resulting in cleavage of the intracellular domain, (3) the cleaved primeR intracellular domain induces expression of a CAR, and (4) the CAR is activated, resulting in T cell activation.

[0204] In one aspect, provided herein is a system comprising a priming receptor that binds ALPG / P, a chimeric antigen receptor that binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling, wherein a transcription factor in the intracellular domain of the priming receptor is capable of inducing expression of a CAR. Such a system is alternatively referred to as a "logic gate" or "circuit." In some aspects, the system is encoded by a nucleic acid transgene inserted into an immune cell. The system may be encoded on a single nucleic acid insert or fragment that includes both transgenes, or on two nucleic acids that individually encode the system transgenes. The priming receptor, SPA, and CAR of the system may be arranged on a single nucleic acid in any order. For example, the priming receptor can be at the 5' end, the SPA can immediately follow the SPA of the priming receptor, and the CAR can be at the 3' end, or the SPA can be at the 5' end, the priming receptor can immediately follow the SPA, and the CAR can be at the 3' end, or the CAR can be at the 5' end, the SPA can immediately follow the CAR, and the priming receptor can be at the 3' end, or the CAR can be at the 5' end, the priming receptor can follow the CAR, and the SPA can be at the 3' end.

[0205] A constitutive promoter can be operably linked to the nucleotide sequence encoding the priming receptor and / or the SPA. The nucleic acids encoding the SPA and the priming receptor can be under the control of a single promoter. An inducible promoter can also be operably linked to the nucleotide sequence encoding the CAR. The nucleic acids encoding the CAR and the SPA can be under the control of separate inducible promoters (e.g., a first inducible promoter and a second inducible promoter). The first and second inducible promoters can be the same or different. In some embodiments, when the system is encoded on a single nucleic acid insert or fragment containing both transgenes, the nucleic acid can comprise, from 5' to 3', a constitutive promoter, a nucleotide sequence encoding the priming receptor, an inducible promoter, and a nucleotide sequence encoding the chimeric antigen receptor. Alternatively, the nucleic acid can comprise, from 5' to 3', an inducible promoter, a nucleotide sequence encoding the chimeric antigen receptor, a constitutive promoter, and a nucleotide sequence encoding the priming receptor. The SPA can be upstream or downstream of the priming receptor and / or the CAR.

[0206] Priming Receptors Provided herein are priming receptors comprising an extracellular antigen-binding domain that specifically binds placental / germ cell alkaline phosphatase (ALPG / P; ALPP: NCBI Entrez Gene:250, UniProtKB / Swiss-Prot:P05187, SEQ ID NO:176; ALPG: NCBI Entrez Gene:251, UniProtKB / Swiss-Prot:P10696, SEQ ID NO:177). In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds placental alkaline phosphatase (ALPP). In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds germ cell alkaline phosphatase (ALPG). As used herein, "placental / germ cell alkaline phosphatase (ALPG / P)" refers to both placental alkaline phosphatase (ALPP) and germ cell alkaline phosphatase (ALPG). An antigen-binding domain that specifically binds to ALPG / P is capable of specifically binding to ALPG and / or ALPP.

[0207] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 24. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 25.

[0208] In certain embodiments of the present disclosure, the priming receptor is a synthetic receptor based on the Notch protein. Binding of a natural Notch receptor to its cognate ligand, such as one from the Delta family of proteins, causes intramembrane proteolysis, cleaving an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that functions only when cleaved from Notch. Cleavage can occur through sequential proteolysis by ADAM metalloproteases and the gamma-secretase complex. This intracellular fragment enters the cell's nucleus and activates cell-cell signaling genes. In contrast to natural Notch proteins, synthetic Notch priming receptors replace the natural Notch intracellular fragment with one that causes a gene encoding a selected protein, such as a CAR, to be transcribed upon release of the intracellular fragment from the priming receptor.

[0209] Notch receptors have a modular domain organization. The ectodomain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats responsible for ligand binding. In synthetic or priming Notch receptors, the Notch ligand-binding domain is replaced with a ligand-binding domain that binds to a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors and have been widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notch1 is split by furin cleavage, whereby the N-terminal portion terminates the extracellular subunit and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor contains a transmembrane segment and an intracellular domain (ICD) containing transcriptional regulators.

[0210] Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids described herein. One type of priming receptor contemplated for use in the methods and cells herein comprises a linking polypeptide having substantial sequence identity to a Notch receptor, including a heterologous extracellular ligand-binding domain, an NRR, a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity to a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity to a Notch receptor (lacking an NRR), a TMD, and an ICD. A "mini-Linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity to a Notch receptor (lacking an NRR), a TMD, and an ICD. A "mini-Linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide lacking substantial sequence identity to a Notch receptor (e.g., a synthetic (GGS) n A "hinge Notch" receptor comprises a hinge sequence that includes a heterologous extracellular ligand-binding domain, an oligomerization domain (e.g., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or pre-existing host receptors), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature. In some embodiments, the non-naturally occurring receptors disclosed herein bind to a ligand displayed on the target cell surface, which triggers proteolytic cleavage of the receptor and release of a transcriptional regulator that regulates a custom transcriptional program within the cell. In some embodiments, the priming receptor does not include the LIN-12-Notch repeats (LNRs) and / or heterodimerization domain (HD) of a Notch receptor.

[0211] Priming receptor extracellular domain The priming receptor disclosed herein comprises placental / germ cell alkaline phosphatase (ALPG / P). In some embodiments, the extracellular domain comprises a ligand-binding portion of the receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, nanobody, diabody, triabody, or minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0212] Priming receptor CDR, VH, and VL domains In some embodiments, the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 49, or 50, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5 or 51, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 53. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:9.

[0213] In some embodiments, the CDR-H3 of the priming receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 3, 47, or 48; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 2, 43, 44, 45, or 46; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 1, 39, 40, 41, or 42. CDR-L3 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L3 of SEQ ID NO: 6 or 53, CDR-L2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L2 of SEQ ID NO: 5 or 51, and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L1 of SEQ ID NO: 4. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 3, 47, or 48 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; the CDR-H2 is CDR-H2 of SEQ ID NO: 2, 43, 44, 45, or 46 with a maximum of 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; the CDR-H1 is CDR-H1 of SEQ ID NO: 1, 39, 40, 41, or 42 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions; the CDR-L3 is CDR-L3 of SEQ ID NO: 6 or 53 with a maximum of 1, 2, 3, 4, or 5 amino acid substitutions; the CDR-L2 is CDR-L2 of SEQ ID NO: 5 or 51 with a maximum of 1, 2, 3, or 4 amino acid substitutions; and the CDR-L1 is CDR-L1 of SEQ ID NO: 4 with a maximum of 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0214] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 7. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0215] In some embodiments, the priming receptor extracellular antigen-binding domains provided herein comprise a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domains provided herein comprise a VH sequence provided in SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0216] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 8. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the Kabat VH CDRs are provided in the sequences set forth as SEQ ID NOs: 40, 44, and 3, and the Kabat VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the Chothia VH CDRs are provided in the sequences set forth as SEQ ID NOs: 1 and 2, and the Chothia VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the AbM VH CDRs are provided in the sequences set forth as SEQ ID NOs: 39, 43, and 3, and the AbM VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the Contact VH CDRs are provided in the sequences set forth as SEQ ID NOs: 41, 45, and 47, and the Contact VL CDRs are provided in the sequences set forth as SEQ ID NOs: 49, 51, and 53. In some embodiments, the CDRs are IMGT CDRs. In some embodiments, the IMGT VH CDRs are provided in the sequences set forth as SEQ ID NOs: 42, 46, and 48, and the IMGT VL CDRs are provided in the sequences set forth as SEQ ID NOs: 50, 52, and 6.

[0217] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0218] Table B provides the VH and VL CDR sequences of exemplary ALPG / P antigen-binding domains with the numbering scheme shown.

[0219] [Table B]

[0220] Transmembrane domain As noted above, priming receptors contain a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0221] In some embodiments, the TMD comprises a Notch1 transmembrane domain. In some embodiments, the transmembrane domain comprises the sequence set forth in SEQ ID NO:19.

[0222] In general, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor that contains at least one gamma-secretase cleavage site. A detailed description of the structure and function of the gamma-secretase complex and its substrate proteins, including amyloid precursor protein (APP) and Notch, can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, wherein the TMD comprises at least one gamma secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as alcadein alpha and alcadein gamma. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a known TMD for a Notch receptor. In some embodiments, the TMD of a chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a different Notch receptor.For example, in a mini-Notch based on human Notch1, the Notch1 TMD can be replaced with a Notch2 TMD, a Notch3 TMD, a Notch4 TMD, or a Notch TMD from a non-human animal such as zebrafish (Danio rerio), fruit fly (Drosophila melanogaster), African clawed frog (Xenopus laevis), or chicken (Gallus gallus).

[0223] In some embodiments, the priming receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of ADAM10, i.e., MMPs selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences for uPA and tPA include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 182), where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 183), where cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg (SEQ ID NO: 184).Additional suitable linkers that contain a protease cleavage site include sequences cleavable by the following proteases: PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; Examples of receptor-specific proteins include tepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases not native to the host cells in which the receptor is expressed (e.g., TEV) can be used as an additional regulatory mechanism, reducing receptor activation until the protease is expressed or otherwise provided. Additionally, proteases can be tumor- or disease-associated (expressed to a significantly higher degree than normal tissue) and serve as an independent regulatory mechanism. For example, several matrix metalloproteinases are highly expressed in certain cancer types.

[0224] In some embodiments, the amino acid substitution(s) within the TMD comprise one or more substitutions within the "GV" motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. Additional sequences and substitutions are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0225] Intracellular domain In some embodiments, the priming receptor comprises one or more intracellular domains derived from or derived from a transcriptional regulator and / or a DNA binding domain. In some embodiments, the intracellular activation domain comprises a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:23.

[0226] Transcriptional regulators activate or repress transcription from their cognate promoters. Transcriptional activators typically bind to nearby transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and sterically inhibit transcription initiation by RNA polymerase. Other transcriptional regulators function as either activators or repressors, depending on where they bind and the cellular conditions. Thus, as used herein, "transcriptional activation domain" refers to the domain of a transcription factor that interacts with transcriptional control elements and / or transcriptional regulatory proteins (e.g., transcription factors, RNA polymerases, etc.) to increase and / or activate transcription of one or more genes. Non-limiting examples of transcriptional activation domains include herpes simplex virus VP16 activation domain, VP64 (a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcriptional activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to those of skill in the art. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. The transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutated, or derivative version of the original transcriptional activation domain that has the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator can further comprise a nuclear localization signal.

[0227] In some embodiments, the priming receptor comprises one or more intracellular "DNA-binding domains" (or "DB domains"). Such "DNA-binding domains" refer to sequence-specific DNA-binding domains that bind to specific DNA sequence elements. Thus, as used herein, a "sequence-specific DNA-binding domain" refers to a protein domain portion that has the ability to selectively bind to DNA having a specific, predetermined sequence. The sequence-specific DNA-binding domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to the desired sequence. In some embodiments, the sequence-specific DNA-binding domain is engineered to bind to the desired sequence. Non-limiting examples of proteins having sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5', AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins, such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, and Cas9. Examples include as10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, as well as TALES.

[0228] In embodiments in which a CRISPR / Cas-like protein is used, the CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change another property of the protein. For example, the nuclease (e.g., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the systems described herein. For example, a CRISPR enzyme used as a DNA-binding protein or domain thereof can be mutated relative to the corresponding wild-type enzyme so that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing the DNA-binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that lacks substantially all DNA cleavage activity.

[0229] Juxtamembrane domain The ECD and TMD, or the TMD and ICD, can be linked to each other with a linking polypeptide such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including an NRR), a TMD, and an ICD. An "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD but lacking an NRR (a LIN-12-Notch repeat (LNR) module and a heterodimerization domain), a TMD, and an ICD. A "minimal linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide (such as, but not limited to, a synthetic (GGS)) lacking substantial sequence identity with the Notch receptor. n A "hinge Notch" receptor comprises a hinge sequence comprising a heterologous extracellular ligand-binding domain, an oligomerization domain (e.g., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or pre-existing host receptors), a TMD, and an ICD.

[0230] In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of an LWF motif in receptor constructs is described in U.S. Patent No. 10,858,443, which is incorporated herein by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity to the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD but does not include the LIN-12-Notch repeat (LNR) and / or heterodimerization domain (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD. In some embodiments, the JMD peptide comprises an oligomerization domain that promotes the formation of receptor dimers, trimers, or higher order aggregates. Such JMD peptides are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0231] In mini-Notch receptors, the linking polypeptide is derived from the Notch JMD sequence after deletion of the NRR and HD domains. The Notch JMD sequence may be from Notch1, Notch2, Notch3, or Notch4, or may be derived from a non-human homologue, such as from Drosophila, Junglefly, or Danio. The remaining 4-50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptide, such as the level of signal transduction upon ligand induction or in the absence of ligand.

[0232] In minimal linker Notch receptors, the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence (including a Notch JMD sequence from Notch1, Notch2, Notch3, or Notch4, or a non-human homolog thereof). Between 4 and 50 amino acid residues can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve the desired activity of the chimeric polypeptides of the present disclosure. The minimal linker sequence can be designed to include or omit a protease cleavage site and can include or omit a glycosylation site or sites for other types of post-translational modifications. In some embodiments, the minimal linker does not include a protease cleavage site or a glycosylation site.

[0233] In some embodiments, the priming receptor further comprises a hinge. Hinge linkers that can be used in priming receptors can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomerization of chimeric polypeptides through intermolecular disulfide bonds. In these cases, within the chimeric receptors disclosed herein, the hinge domain generally comprises a flexible polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD and also provides a site for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain comprises a motif that promotes dimerization of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain comprises a motif that promotes trimerization of the chimeric polypeptides disclosed herein (e.g., a hinge domain from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure can be naturally occurring hinge polypeptide sequences (e.g., derived from naturally occurring immunoglobulins) or can be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or functional variants thereof. In some embodiments, the hinge polypeptide sequence comprises one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence comprises one or more CPPC motifs (SEQ ID NO: 185).

[0234] The hinge polypeptide sequence may also be derived from the CD8α hinge domain, CD28 hinge domain, CD152 hinge domain, PD-1 hinge domain, CTLA4 hinge domain, OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the IgG4 hinge domain or a functional variant thereof.

[0235] The Fn-Notch-linked polypeptide is derived from the Robo1 JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeat and the TMD. The Fn-Notch-linked polypeptide does not contain a Notch negative regulatory region (NRR) or a Notch HD domain. The Fn-linked polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises an Fn-linked polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeat and the TMD can be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence can be about 5 to about 20 amino acids of any sequence, but with no more than one proline. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with about 50% or more of the amino acids being glycine. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with the amino acids selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn-linked polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptides of the present disclosure.

[0236] Transport stop sequence In some embodiments, the priming receptor further comprises a stop transport sequence (STS) between the transmembrane domain and the intracellular domain. The STS comprises a charged lipophobic sequence. Without being bound by any theory, it is believed that the STS functions as a membrane anchor and prevents the intracellular domain from passing through the plasma membrane. The use of an STS domain in a priming receptor is described in WO2021061872 (incorporated herein by reference in its entirety). Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, S Examples of STS sequences include DC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3, and Notch4. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0237] In some embodiments, the stop migration sequence comprises the sequence set forth in SEQ ID NO:20.

[0238] Chimeric Antigen Receptor In another embodiment, provided herein is a chimeric antigen receptor comprising an extracellular antigen-binding domain that specifically binds to mesothelin (MSLN; NCBI Entrez Gene: 10232; UniProtKB / Swiss-Prot: Q13421, SEQ ID NO: 178). The CAR may be a human CAR comprising a fully human sequence, e.g., a naturally occurring human sequence.

[0239] In some embodiments, a chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain. The antigen-recognition domain of a receptor, such as a CAR, can be linked to one or more intracellular signaling components, such as a signaling component that mimics activation via an antigen receptor complex, e.g., a TCR complex, in the case of a CAR, and / or to a signal via another cell surface receptor. Thus, in some embodiments, the extracellular binding component (e.g., a ligand-binding or antigen-binding domain) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, one of the domains within the receptor, e.g., the transmembrane domain naturally associated with the CAR, is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and minimize interaction with other members of the receptor complex.

[0240] In some embodiments, the chimeric antigen receptor comprises an extracellular portion comprising an antigen-binding domain described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, VH, or single-domain VH antibody, and the intracellular domain comprises an ITAM. In some embodiments, the intracellular signaling domain comprises the signaling domain of the zeta chain of the CD3-zeta (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain connecting the extracellular domain and the intracellular signaling domain.

[0241] In some embodiments, the transmembrane domain comprises the transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane can be directly or indirectly linked. In some embodiments, the extracellular domain and the transmembrane are linked by a spacer, such as any of those described herein. In some embodiments, the chimeric antigen receptor comprises the intracellular domain of a T cell costimulatory molecule, for example, between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB.

[0242] Chimeric antigen receptor CDR, VH, VL domains In some embodiments, the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, 54, 56, 57, or 71, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, 61, or 308, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63, CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67, CDR-L2 comprises the sequence set forth in SEQ ID NO: 15, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 16 or 72. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the antigen-binding domain comprises the sequence set forth in SEQ ID NO: 30.

[0243] In some embodiments, the CDR-H3 of the priming receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 12, 62, or 63; the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 11, 58, 59, 60, 61, or 308; and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 10, 54, 56, 57, or 71. CDR-L3 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L3 of SEQ ID NO: 16 or 72; CDR-L2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L2 of SEQ ID NO: 15, 68, 69 or 70; and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L1 of SEQ ID NO: 14, 65, 66 or 67. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 12, 62, or 63 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; the CDR-H2 is CDR-H2 of SEQ ID NO: 11, 58, 59, 60, 61, or 308 with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; and the CDR-H1 is CDR-H2 of SEQ ID NO: 10, 54, 56 with up to 1, 2, 3, 4, or 5 amino acid substitutions. , 57, or 71, CDR-L3 is CDR-L3 of SEQ ID NO: 16 or 72 with up to 1, 2, 3, 4, or 5 amino acid substitutions, CDR-L2 is CDR-L2 of SEQ ID NO: 15, 68, 69, or 70 with up to 1, 2, 3, or 4 amino acid substitutions, and CDR-L1 is CDR-L1 of SEQ ID NO: 14, 65, 66, or 67 with up to 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0244] In some embodiments, a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 13. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 13. In some embodiments, an antigen-binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 13. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0245] In some embodiments, the priming receptor extracellular antigen-binding domains provided herein comprise a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VH sequence set forth in SEQ ID NO: 13. In some embodiments, the antigen-binding domains provided herein comprise a VH sequence provided in SEQ ID NO: 13 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0246] In some embodiments, a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, an antigen-binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, Kabat VH CDRs are provided in the sequences set forth as SEQ ID NOs: 10, 11, and 12, and Kabat VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 69, and 16. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, Chothia VH CDRs are provided in the sequences set forth as SEQ ID NOs: 71, 308, and 12, and Chothia VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 15, and 16. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the AbM VH CDRs are provided in the sequences set forth as SEQ ID NOs: 54, 58, and 12, and the AbM VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 68, and 16. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the Contact VH CDRs are provided in the sequences set forth as SEQ ID NOs: 56, 60, and 62, and the Contact VL CDRs are provided in the sequences set forth as SEQ ID NOs: 66, 70, and 72. In some embodiments, the CDRs are IMGT CDRs. In some embodiments, the IMGT VH CDRs are provided in the sequences set forth as SEQ ID NOs: 57, 61, and 63, and the IMGT VL CDRs are provided in the sequences set forth as SEQ ID NOs: 67, DT, and 16.

[0247] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the VL sequence set forth in SEQ ID NO: 17. In some embodiments, the antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants." In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0248] Table C provides exemplary MSLN antigen-binding domain CDR sequences of VH of SEQ ID NO: 13 and VL of SEQ ID NO: 17, with the numbering scheme shown.

[0249] [Table C]

[0250] CAR transmembrane domain In some embodiments, the transmembrane domain is derived from either a natural or synthetic source. If the source is natural, in some aspects, the domain is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (e.g., comprising at least the transmembrane region(s) of) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and / or CD154. Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, synthetic transmembrane domains comprise primarily hydrophobic residues such as leucine and valine. In some aspects, triplets of phenylalanine, tryptophan, and valine are found at each end of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain(s).

[0251] In some embodiments, the transmembrane domain of the receptor, e.g., CAR, is the transmembrane domain of human CD28 or a variant thereof, e.g., the 27 amino acid transmembrane domain of human CD28 (Accession Number: P10747.1).

[0252] In some embodiments, the CAR comprises a CD8a TMD. In some embodiments, the CD8a TMD comprises the sequence set forth in SEQ ID NO:27.

[0253] CAR hinge In some embodiments, the CAR further comprises a spacer, which may be or may include at least a portion of an immunoglobulin constant region, or a variant or modified version thereof, such as a hinge region, e.g., a CD8a hinge, an IgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is that of a human IgG, such as IgG4 or IgG1. In some aspects, the portion of the constant region functions as a spacer region between the antigen-recognition component, e.g., an scFv, and the transmembrane domain. The spacer may be of a length that results in increased cellular responsiveness after antigen binding compared to the absence of the spacer. In some examples, the spacer is about 12 amino acids in length, or 12 amino acids or less in length. Exemplary spacers include those having at least about 10-229 amino acids, about 10-200 amino acids, about 10-175 amino acids, about 10-150 amino acids, about 10-125 amino acids, about 10-100 amino acids, about 10-75 amino acids, about 10-50 amino acids, about 10-40 amino acids, about 10-30 amino acids, about 10-20 amino acids, or about 10-15 amino acids, including any integer between any of the endpoints of the recited ranges. In some embodiments, the spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less. Exemplary spacers include a CD8a hinge, an IgG4 hinge alone, an IgG4 hinge linked to CH2 and CH3 domains, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin.Cancer Res., 19:3153 or International Patent Application Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8a hinge. In some embodiments, the CD8a hinge comprises the sequence set forth in SEQ ID NO: 26.

[0254] Some intracellular signaling domains mimic or approximate signaling through natural antigen receptors, signaling through such receptors in combination with costimulatory receptors, and / or signaling through costimulatory receptors alone. In some embodiments, a short oligo- or polypeptide linker, e.g., a linker 2-10 amino acids in length, such as one containing glycine and serine, e.g., a glycine-serine doublet, is present to form the link between the transmembrane domain and the cytoplasmic signaling domain of the receptor.

[0255] CAR intracellular domain In some embodiments, upon ligation of the CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of an immune cell, e.g., a T cell engineered to express the receptor. For example, in some contexts, the receptor induces a T cell function, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, e.g., when it transduces an effector function signal. In some embodiments, the intracellular signaling domain or domains comprise the cytoplasmic sequence of a T cell receptor (TCR), and in some aspects, any derivative or variant of such a molecule that acts in concert with such a receptor in its natural context to signal following antigen receptor engagement, and / or any synthetic sequence having the same functional capability.

[0256] In some embodiments, the receptor comprises a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The stimulatory primary cytoplasmic signaling sequence can comprise a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs that comprise primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d. In some embodiments, the cytoplasmic signaling molecule(s) in the CAR comprise a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta.

[0257] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112 AA cytoplasmic domain of human CD3 zeta isoform 3 (Accession Number: P20963.2) or a CD3 zeta signaling domain described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0258] A receptor, e.g., a CAR, can comprise at least one intracellular signaling component(s). In some embodiments, the receptor comprises an intracellular component of the TCR complex, such as a TCR CD3 chain, e.g., a CD3 zeta chain, which mediates T cell activation and cytotoxicity. Thus, in some embodiments, the extracellular domain is linked to one or more cell signaling modules. In some embodiments, the cell signaling module comprises a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., a CAR, further comprises a portion of one or more additional molecules, such as Fc receptor-gamma, CD8, CD4, CD25, or CD16. For example, in some embodiments, the CAR comprises a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25, or CD16. In some embodiments, the CAR comprises a CD3 zeta activation domain comprising the sequence set forth in SEQ ID NO: 29.

[0259] In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of 41BB, or a functional variant or portion thereof, such as the 42 amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1), or a functional variant or portion thereof.

[0260] In some embodiments, the receptor includes one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., a primary activation domain, in the cytoplasmic portion. Exemplary receptors include CD3-zeta, CD28, and the intracellular component of 4-1BB. In some embodiments, the chimeric antigen receptor comprises the intracellular domain of a T cell costimulatory molecule. In some aspects, the T cell costimulatory molecule is 4-1BB.

[0261] In some embodiments, the receptor comprises the signaling domain and / or transmembrane portion of a costimulatory receptor such as CD28, 4-1BB, OX40, DAP10, and ICOS. In some aspects, the same receptor comprises both an activating component and a costimulatory component.

[0262] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) costimulatory domain linked to a CD3 zeta intracellular domain. In some embodiments, the CAR comprises a 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises the sequence set forth in SEQ ID NO:28.

[0263] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 30, 31, or 32. In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 31.

[0264] In some embodiments, the CAR or other antigen receptor further comprises a marker, such as a cell surface marker, which can be used to confirm the transduction or engineering of cells to express a receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some embodiments, the marker comprises all or a portion (e.g., a truncated form) of CD34, nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a linker sequence, e.g., a cleavable linker sequence or a ribosomal skip sequence, e.g., a polynucleotide encoding T2A. See WO2014031687. In some embodiments, introduction of a construct encoding CAR and EGFRt separated by a T2A ribosomal switch allows expression of the two proteins from the same construct, such that EGFRt can be used as a marker to detect cells expressing such a construct. In some embodiments, the marker, and optionally the linker sequence, can be any of the sequences disclosed in published patent application WO2014031687. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence such as a T2A ribosomal skip sequence.

[0265] In some embodiments, the marker is a molecule that is not naturally found on T cells or that is not naturally found on the surface of T cells, for example, a cell surface protein, or portion thereof.

[0266] In some embodiments, the molecule is a non-self molecule, eg, a non-self protein, eg, a molecule that is not recognized as "self" by the immune system of the host into which the cells are adoptively transferred.

[0267] In some embodiments, the marker does not serve a therapeutic function and / or produce any effect other than being used as a marker for genetic manipulation, e.g., to select successfully engineered cells. In other embodiments, the marker may be a therapeutic molecule or a molecule that exerts some desired effect in other ways, e.g., a ligand for cells encountered in vivo, e.g., a costimulatory or immune checkpoint molecule to enhance and / or attenuate the response of cells upon adoptive transfer and encounter with the ligand.

[0268] A CAR may contain one or more modified synthetic amino acids in place of one or more naturally occurring amino acids. Exemplary modified amino acids include aminocyclohexanecarboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, 3-phenylserine, 3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2, These include, but are not limited to, 3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine, and α-tertbutylglycine.

[0269] For example, in some embodiments, a CAR comprises a single chain antibody (sdAb, e.g., comprising only a VH region), an antibody or fragment thereof comprising a VH domain and an scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain. In some embodiments, a CAR comprises an antibody or fragment thereof comprising a sdAb and an scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.

[0270] The transgenes expressing the priming receptor and CAR system can be introduced into cells, e.g., T cells, using, for example, site-specific techniques. For site-specific integration of the transgene (e.g., the priming receptor and CAR), the transgene can be targeted to a safe harbor locus or TRAC. Examples of site-specific techniques for integration into a safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0271] The engineered cells have applications in immuno-oncology. For example, priming receptors and CARs can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells include blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0272] Synthetic pathway activators In various embodiments, the systems disclosed herein employ one or more "synthetic pathway activators" (SPAs). CAR-expressing immune cells may be limited by the need for in vivo expansion after infusion. For T cells to achieve robust expansion, three signals are required: antigen stimulation, costimulation, and cytokine-induced stimulation. CAR activation is sufficient to induce the first two signals but cannot recapitulate cytokine signaling. Furthermore, the tumor microenvironment is often immunosuppressive and lacks pro-inflammatory cytokines. Therefore, SPAs can be used to stimulate robust in vivo expansion of T cells expressing the priming receptors and / or CARs described herein, enhancing desirable properties (e.g., increased survival, persistence, and efficacy).

[0273] SPA Structure In various embodiments, SPAs mimic the activation of interleukin signaling. Interleukin receptors are cytokine receptors that signal through signal transducer and activator of transcription (STAT) transcription factors (e.g., STAT3 and STAT5). Interleukin receptors typically function by dimerization in response to ligand binding. Once dimerized, the receptor can bind to Janus-associated kinases (JAKs) and induce JAK cross-phosphorylation and downstream "JAK / STAT" signaling. Thus, induced receptor agonism or ligand-independent dimerization of the receptor can be used to induce constitutive receptor activity and, therefore, constitutive cytokine signaling.

[0274] In various embodiments, the SPA comprises an interleukin receptor or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin receptor intracellular signaling domain or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin-6 signal transducer (IL6ST) polypeptide or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin-7 receptor (IL-7R) polypeptide or a functional fragment thereof. In some embodiments, the SPA comprises or is derived from an interleukin-15 (IL-15) polypeptide or a functional fragment thereof.

[0275] In various embodiments, one or more structural modifications can be made to confer constitutive activity on an SPA or functional fragment thereof. In some embodiments, structures or mutations can be added to induce SPA multimerization. In some embodiments, one or more amino acids can be mutated to cysteine, for example, to allow for the formation of one or more disulfide bond(s) between two receptor monomers. In some embodiments, one or more amino acids can be inserted into a wild-type receptor polypeptide, for example, to promote dimerization through the formation of one or more disulfide bond(s).

[0276] In some embodiments, the exogenous polypeptide is operably linked to a cytokine receptor or a functional fragment thereof to cause multimerization thereof. In some embodiments, a leucine zipper polypeptide is operably linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the leucine zipper polypeptide is a c-Jun leucine zipper. In some embodiments, an exogenous scaffold is operably linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the exogenous promoter is a CD34 ectodomain.

[0277] In some embodiments, the SPA can include a ligand agonist (e.g., a cytokine, e.g., an interleukin) that allows for constitutive activation of the SPA. In some embodiments, the cytokine receptor and soluble agonist are co-expressed. In some embodiments, the cytokine receptor and membrane-bound agonist are co-expressed.

[0278] In various embodiments, the SPA is anchored to a cell membrane. In some embodiments, the SPA comprises an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the SPA comprises the transmembrane domain of an interleukin receptor.

[0279] Exemplary SPA In some embodiments, the SPA comprises leucine zipper-gp130 (interchangeably referred to herein as "L-gp130" or "gp130") or the L-gp130 intracellular signaling domain. L-gp130 comprises a homodimer, with each monomer comprising (a) an extracellular domain containing an inserted cysteine ​​residue and a c-Jun leucine zipper that forms a disulfide bond with another monomer, and (b) an IL6ST transmembrane domain and an intracellular signaling domain. The cysteine ​​residues and leucine zipper on each polypeptide can induce the formation of a stable homodimer that mimics constitutive IL-6R activation. Additional details regarding the construction of L-gp130 are described in Stuhlmann-Laeisz et al. Mol Biol Cell. 2006 Jul. 17(7):2986-95 and WO2020200325, which are incorporated herein by reference in their entireties.

[0280] In some embodiments, the L-gp130 intracellular signaling domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. In some embodiments, the L-gp130 intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 74. In some embodiments, L-gp130 comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, L-gp130 comprises the amino acid sequence set forth in SEQ ID NO: 75.

[0281] In some embodiments, the L-gp130 intracellular signaling domain is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 79. In some embodiments, the L-gp130 intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO: 79. In some embodiments, L-gp130 is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 80. In some embodiments, L-gp130 is encoded by the nucleic acid sequence set forth in SEQ ID NO:80.

[0282] In some embodiments, the leucine zipper domain comprises the sequence set forth in SEQ ID NO: 179. In some embodiments, the leucine zipper domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:179.

[0283] In some embodiments, the L-gp130 transmembrane domain comprises a gp130 transmembrane domain. In some embodiments, the L-gp130 transmembrane domain comprises the sequence set forth in SEQ ID NO: 180. In some embodiments, the L-gp130 transmembrane domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180.

[0284] In some embodiments, the SPA comprises membrane-bound interleukin-15 (mbIL-15). mbIL-15 comprises an IL-15 polypeptide linked to the IL15 receptor alpha (IL15Rα), thus allowing constitutive receptor activation. See also, e.g., U.S. Patent No. 9,629,877, which is incorporated herein by reference in its entirety.

[0285] In some embodiments, mbIL-15 comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 76. In some embodiments, mbIL-15 comprises the amino acid sequence set forth in SEQ ID NO: 76. In some embodiments, mbIL-15 is encoded by a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 81. In some embodiments, mbIL-15 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 81.

[0286] In some embodiments, the SPA comprises CD34-interleukin-7 receptor (C7R). C7R comprises a homodimer, with each monomer comprising (a) an extracellular domain comprising a CD34 ectodomain, (b) a transmembrane domain comprising an inserted cysteine ​​residue that forms a disulfide bond with another monomer, and (c) an IL-7R intracellular signaling domain. The CD34 ectodomain and inserted cysteine ​​residue on each polypeptide allow for the formation of a stable homodimer that mimics constitutive IL-7R activation. Additional details regarding the construction of C7R are described in Shum et al. Cancer Discov. 2017 Nov;7(11):1238-1247 and U.S. Publication No. 20190183939, which are incorporated herein by reference in their entireties.

[0287] In some embodiments, the C7R intracellular signaling domain comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77. In some embodiments, the C7R intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO:77. In some embodiments, C7R comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78. In some embodiments, C7R comprises the amino acid sequence set forth in SEQ ID NO: 78. In some embodiments, the C7R intracellular domain and transmembrane domain comprise an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 181. In some embodiments, the C7R extracellular domain and transmembrane domain comprise the amino acid sequence set forth in SEQ ID NO: 181.

[0288] In some embodiments, the C7R intracellular signaling domain is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 82. In some embodiments, the C7R intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO:82. In some embodiments, C7R is encoded by a nucleic acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 83. In some embodiments, C7R is encoded by the nucleic acid sequence set forth in SEQ ID NO:83.

[0289] cytokines In various embodiments, the systems disclosed herein use one or more cytokines. CAR-expressing immune cells may be limited by the need for in vivo expansion after infusion. For T cells to achieve robust expansion, three signals are required: antigen stimulation, costimulation, and cytokine-induced stimulation. CAR activation is sufficient to induce the first two signals but cannot recapitulate cytokine signaling. Furthermore, the tumor microenvironment is often immunosuppressive and lacks pro-inflammatory cytokines. Therefore, cytokines can be used to stimulate robust in vivo expansion of T cells expressing the priming receptors and / or CARs described herein and enhance desirable properties (e.g., increased survival, persistence, and efficacy).

[0290] In various embodiments, the cytokines used in the systems disclosed herein can be members of the interleukin (IL) family of cytokines. Interleukins activate receptors that signal through signal transducer and activator of transcription (STAT) transcription factors (e.g., STAT1, STAT3, and STAT5). Upon activation, interleukin receptors can dimerize and bind Janus-associated kinases (JAKs), inducing JAK cross-phosphorylation and downstream "JAK / STAT" signaling. Thus, inducible cytokine expression can be used to induce receptor activity and, therefore, cytokine signaling.

[0291] In some embodiments, the cytokines used in the systems disclosed herein are secreted into the extracellular environment upon expression. In some embodiments, the cytokines used in the systems disclosed herein are membrane-bound. Membrane-bound ("mb") cytokines can include non-naturally occurring polypeptides that anchor the cytokine to the cell membrane upon expression. Membrane-bound cytokines can improve activation of cytokine signaling, for example, by increasing the proximity of the cytokine to its receptor.

[0292] Exemplary Cytokines Any cytokine that has a beneficial effect on CAR-expressing immune cells can be used in the systems disclosed herein. In various embodiments, cytokines used in the systems disclosed herein can promote memory T cell persistence and / or proliferation (e.g., IL-7, IL-15, and IL-23). ​​In various embodiments, cytokines used in the systems disclosed herein can promote effector cell function (e.g., IL-2 and IL-12). In various embodiments, cytokines used in the systems disclosed herein can reduce immune cell exhaustion (e.g., IL-21 and IL-23). ​​In various embodiments, cytokines used in the systems disclosed herein can promote activation of endogenous immunity (e.g., IL-18). In various embodiments, cytokines used in the systems disclosed herein can reduce inflammatory responses (e.g., IL-10 and TGF-β). In various embodiments, the cytokines used in the systems disclosed herein are selected from IL-2, Super-2, IL-7, IL-21, IL-12, IL-12 / 23p40, IL-15, IL-18, IL-10, and TGF-β.

[0293] In some embodiments, the cytokine used in the systems disclosed herein is IL-2. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 86. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 87.

[0294] In some embodiments, the cytokine used in the systems disclosed herein is IL-7. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 88. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 89.

[0295] In some embodiments, the cytokine used in the systems disclosed herein is IL-21. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 90. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 91.

[0296] In some embodiments, the cytokine used in the systems disclosed herein is IL-12. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 92. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 93.

[0297] In some embodiments, the cytokine used in the systems disclosed herein is IL-12 / 23p40. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 94. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 95.

[0298] In some embodiments, the cytokine used in the systems disclosed herein is IL-15. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 96. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 97.

[0299] In some embodiments, the cytokine used in the systems disclosed herein is IL-18. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 98. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 99.

[0300] In some embodiments, the cytokine used in the systems disclosed herein is Super-2. Further details regarding Super-2 are provided in U.S. Patent No. 10,150,802, which is incorporated herein by reference in its entirety. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 132. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 133.

[0301] In some embodiments, the cytokine used in the systems disclosed herein is IL-10. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 134. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 135.

[0302] In some embodiments, the cytokine used in the systems disclosed herein is TGF-β. In some embodiments, the cytokine used in the systems disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 136. In some embodiments, the nucleic acid encoding the cytokine used in the systems disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 137.

[0303] In some embodiments, one or more cytokines are expressed in the systems disclosed herein. In some embodiments, two or more cytokines are expressed in the systems disclosed herein. In some embodiments, three or more cytokines are expressed in the systems disclosed herein. In some embodiments, four or more cytokines are expressed in the systems disclosed herein. In some embodiments, five or more cytokines are expressed in the systems disclosed herein. In some embodiments, six or more cytokines are expressed in the systems disclosed herein. In some embodiments, seven or more cytokines are expressed in the systems disclosed herein.

[0304] signal peptide In various embodiments, the cytokines used in the systems disclosed herein are operably linked to a non-native signal peptide. Different signal peptides can result in variant levels of secretion of expressed proteins (e.g., cytokines). Further details regarding signal peptides and their effects on protein secretion can be found in Lumangtad LA, Bell TW. The signal peptide as a new target for drug design. Bioorg Med Chem Lett. 2020 May 15;30(10):127115, which is incorporated herein by reference in its entirety. Thus, selection of a specific signal peptide can enable rheostat tuning of cytokine secretion based on the desired downstream signaling level. For example, for cytokines expressed with low efficiency, a signal peptide that results in highly efficient secretion can be selected to improve overall activation of cytokine signaling. In another example, for cytokines that are toxic at high levels, a signal peptide that results in reduced secretion efficiency can be selected to reduce the toxic effects of the cytokine.

[0305] In some embodiments, the non-native signal peptide comprises a signal peptide derived from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.

[0306] In some embodiments, the cytokine used in the systems disclosed herein is linked to a CD44 signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 100. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 101.

[0307] In some embodiments, the cytokine used in the systems disclosed herein is linked to a CD3E signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 102. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 103.

[0308] In some embodiments, the cytokine used in the systems disclosed herein is linked to a CD5 signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 105.

[0309] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IGTAL signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 107.

[0310] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IL-2 signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 108. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 109.

[0311] In some embodiments, the cytokine used in the systems disclosed herein is linked to a GMCSF signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 110. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 111.

[0312] In some embodiments, the cytokine used in the systems disclosed herein is linked to a chymotrypsinogen signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 112. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 113.

[0313] In some embodiments, the cytokine used in the systems disclosed herein is linked to a trypsinogen signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 114. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 115.

[0314] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IgK signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 116. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 117.

[0315] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IgKVIII signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 118. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 119.

[0316] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IgE signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 120. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 121.

[0317] In some embodiments, the cytokines used in the systems disclosed herein are linked to an OSM signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 122. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 123.

[0318] In some embodiments, the cytokine used in the systems disclosed herein is linked to an IgG2H signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 124. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 125.

[0319] In some embodiments, the cytokine used in the systems disclosed herein is linked to a BM40 signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 126. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 127.

[0320] In some embodiments, the cytokine used in the systems disclosed herein is linked to a Secrecon signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 128. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 129.

[0321] In some embodiments, the cytokine used in the systems disclosed herein is linked to a tPA signal peptide. In some embodiments, the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 130. In some embodiments, the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the sequence set forth in SEQ ID NO: 131.

[0322] suppressors of gene expression In various embodiments, one or more suppressors of gene expression can be used in the systems described herein to produce a desired effect on T cells expressing a logic gate. A suppressor of gene expression can be used to suppress the activity of a gene that has an inhibitory effect on a T cell characteristic, such as expansion or target cell killing. A suppressor of gene expression can function via any mechanism known in the art. A suppressor of gene expression can function, for example, by knocking out a genomic sequence, suppressing gene transcription, or suppressing protein translation ("knockdown"). Examples of suppressors of gene expression include, but are not limited to, sgRNA, shRNA, siRNA, TALEN, and zinc finger nucleases (ZFNs).

[0323] In some embodiments, the suppressor of gene expression used in the systems disclosed herein is an sgRNA or shRNA. In some embodiments, the suppressor of gene expression is an sgRNA. In some embodiments, the sgRNA suppresses expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH. In some embodiments, the sgRNA suppresses expression of PTPN2. In some embodiments, the sgRNA suppresses expression of RASA2. In some embodiments, the sgRNA suppresses expression of SOCS1. In some embodiments, the sgRNA suppresses expression of ZC3H12A. In some embodiments, the sgRNA suppresses expression of CISH.

[0324] In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 160-164. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 160. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 161. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 162. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 163. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 164.

[0325] In some embodiments, the suppressor of gene expression is an shRNA. In some embodiments, the shRNA suppresses expression of a gene selected from RASA2, PTPN2, SOCS1, ZC3H12A, CISH, TNFRSF6 (Fas), TGFBR1, and TGFBR2. In some embodiments, the shRNA suppresses expression of RASA2. In some embodiments, the shRNA suppresses expression of PTPN2. In some embodiments, the shRNA suppresses expression of SOCS1. In some embodiments, the shRNA suppresses expression of ZC3H12A. In some embodiments, the shRNA suppresses expression of CISH. In some embodiments, the shRNA suppresses expression of TNFRSF6 (Fas). In some embodiments, the shRNA suppresses expression of TGFBR1. In some embodiments, the shRNA suppresses expression of TGFBR1. In some embodiments, the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 165. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 166. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 167. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 168. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 169. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 170. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 171. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 172.

[0326] Exemplary Combinations Combinations of suppressors of gene expression and SPAs and / or cytokines can be used in the systems described herein to support activation of T cells expressing logic gates. In some embodiments, the SPA is L-gp130 and the cytokine is IL-2. In some embodiments, the SPA is L-gp130 and the cytokine is mbIL-15. In some embodiments, the SPA is C7R and the cytokine is IL-2. In some embodiments, the SPA is C7R and the cytokine is mbIL-15. In some embodiments, the system includes an sgRNA that suppresses CISH expression and a cytokine that is IL-2. In some embodiments, the system includes an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2. In some embodiments, the system includes an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system includes an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system includes an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that inhibits PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that inhibits ZC3H12A expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that inhibits RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an shRNA that inhibits RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an shRNA that inhibits RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an sgRNA that inhibits CISH expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that inhibits PTPN2 expression and an SPA that is C7R.In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is L-gp130.

[0327] In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas) and a further suppressor of gene expression. In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas), an shRNA that suppresses expression of TGFBR2, and a further suppressor of gene expression. In some embodiments, the system comprises an shRNA that suppresses expression of TNFRSF6 (Fas), an shRNA that suppresses expression of PTPN2, and a further suppressor of gene expression.

[0328] Recombinant Nucleic Acids and Vectors In some embodiments, the present disclosure contemplates a recombinant nucleic acid insert comprising one or more transgenes encoding a priming receptor, CAR, cytokine, or SPA described herein. In some embodiments, the nucleic acid is a recombinant nucleic acid. In some embodiments, the insert encodes a priming receptor transgene. In some embodiments, the insert encodes a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene and a cytokine transgene. In some embodiments, the insert comprises a cytokine transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene and an SPA transgene. In some embodiments, the insert comprises an SPA transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene, an SPA transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene, an SPA transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises an SPA, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA, a priming receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene.

[0329] The insert may also contain a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine teschovirus-1 (P2A) peptide, Thosea asigna virus (T2A) peptide, equine rhinitis A virus (E2A) peptide, or foot-and-mouth disease virus (F2A) peptide. Self-cleaving 2A peptides enable the expression of multiple gene products from a single construct. (See, for example, Chang et al. "Cleavage efficient 2A peptides for high-level monoclonal antibody expression in CHO cells," MAbs 7(2):403-412 (2015)).

[0330] The insert may also contain a WPRE element, which is generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007) and Zufferey, R., et al. J Virol. 1999 Apr;73(4):2886-92, both of which are incorporated herein by reference.

[0331] Recombinant cells Also provided herein are recombinant immune cells comprising at least one DNA template nonvirally inserted into a target region of the cell's genome, wherein the DNA template encodes a priming receptor and CAR system described herein, optionally a cytokine, optionally an SPA, and optionally a gene expression suppressor. Also provided herein are recombinant immune cells comprising a priming receptor that specifically binds placental / germ cell alkaline phosphatase (ALPG / P), a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling. Also provided herein are engineered immune cells comprising a priming receptor that specifically binds placental / germ cell alkaline phosphatase (ALPG / P), a chimeric antigen receptor that specifically binds MSLN, and a cytokine. The cells may further comprise a gene expression suppressor, such as an RNAi molecule (e.g., shRNA) or sgRNA, for CRISPR-based knockout of a target gene.

[0332] Cells containing DNA template inserts at target loci or safe harbor sites, as described in this disclosure, may be referred to as engineered cells. In some embodiments, the immune cells are any cells capable of giving rise to pluripotent immune cells. In some embodiments, the immune cells are primary immune cells. In some embodiments, the immune cells may be induced pluripotent stem cells (iPSCs) or human pluripotent stem cells (HSPCs). In some embodiments, the immune cells comprise primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells, or T cell precursors. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD8+ cells. + In some embodiments, the T cells are CD4+ In some embodiments, the T cells are CD4 + CD8 + T cells.

[0333] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, hematopoietic stem cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. Non-limiting examples of immune cells contemplated in this disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated in this disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other stem cells, including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tenocytes, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.

[0334] Also provided herein are populations of cells comprising a plurality of immune cells, in some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more of the genomes of the cells comprise a priming receptor and CAR system, along with an optional cytokine, SPA, and / or gene suppressor described herein.

[0335] How to Treat Cancer In another aspect, the present invention provides a method of treating an immune-related condition (e.g., cancer) in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and optionally, a cytokine and / or a synthetic pathway activator that activates cytokine signaling. The system may further comprise a gene expression suppressor such as an RNAi molecule (e.g., shRNA) or sgRNA for CRISPR-based knockout of a target gene. In another aspect, the present invention provides a method of enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a cytokine and / or a synthetic pathway activator that activates cytokine signaling.

[0336] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0337] In some embodiments, the methods provided herein (e.g., methods of enhancing an immune response) are useful for treating cancer, and thus, an individual receiving a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immunoevasive. In some embodiments, the cancer is immunoresponsive. In certain embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer. In some embodiments, the cancer is ovarian cancer.

[0338] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing cancer volume compared to the cancer volume before administration of the antibody. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing cancer growth rate compared to the cancer growth rate before administration of the antibody. In some embodiments, the treatment is effective in eliminating the cancer.

[0339] In some embodiments, MSLN and ALPG or ALPP are expressed at higher levels in cancer compared to non-cancer cells. The levels of MSLN, ALPG and ALPP can be assessed by any technique known in the art, including, but not limited to, protein or nuclear assays, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technology, and FISH, and combinations thereof.

[0340] Methods for modulating autoimmune diseases In another aspect, provided herein is a method of treating an immune-related condition (e.g., graft-versus-host) in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine. In another aspect, provided herein is a method of suppressing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine. The cytokine can be an inhibitory cytokine such as IL-10.

[0341] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0342] In some embodiments, the methods provided herein (e.g., methods of suppressing an immune response) are useful for treating an autoimmune disease. In some embodiments, the autoimmune disease is graft-versus-host disease. In some embodiments, the autoimmune disease is transplant rejection. In some embodiments, the autoimmune disease is rheumatoid arthritis. In some embodiments, the autoimmune disease is inflammatory bowel disease. In some embodiments, the autoimmune disease is type 1 diabetes.

[0343] Immunomodulatory methods The methods of administering cells described herein, including systems comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling, can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0344] In one aspect, administration of cells comprising a system described herein comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling can result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. Generally, the induced pro-inflammatory molecules are present at levels exceeding those achieved with isotype controls. Such pro-inflammatory molecules then lead to the activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine signaling can induce multiple anti-tumor immune mechanisms that result in tumor destruction.

[0345] In another aspect, provided herein is a method of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a cytokine and / or synthetic pathway activator that activates cytokine signaling. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject cells comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a cytokine and / or synthetic pathway activator that activates cytokine signaling.

[0346] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0347] In any of the aspects of increasing an immune response described herein, the increase, decrease, or alteration of any aspect of characteristic(s) or function(s) is as compared to cells that do not contain a composition comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling.

[0348] Increasing an immune response can be both enhancing an immune response or inducing an immune response. For example, increasing an immune response encompasses both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of cells comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling. In some embodiments, the immune response is enhanced by administration of cells comprising a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokine and / or cytokine signaling.

[0349] In another aspect, the present application provides a method of gene editing a cell using a system comprising a priming receptor that specifically binds ALPG / P, a chimeric antigen receptor that specifically binds MSLN, and a synthetic pathway activator that activates cytokines and / or cytokine signaling, which results in modulation of the immune function of the cell. The modulation can be an increase in the immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in expression of an MSLN CAR. In some embodiments, the modulation of function results in activation of the cell comprising the system.

[0350] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0351] In some embodiments, modulation of the function of cells comprising a priming receptor and a CAR system described herein results in an increase in the ability of the cells to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by cells expressing the priming receptor and a CAR system. In some embodiments, modulation of function enhances or increases the ability of the cells to produce cytokines, chemokines, CARs, or costimulatory or activating receptors. In some embodiments, modulation increases the T cell stimulatory function of cells expressing the priming receptor and a CAR system, where T cell stimulatory function includes, for example, the ability of the cells to trigger T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0352] In some embodiments, the increased immune response is cytokine and chemokine secretion. In some embodiments, the priming receptor and CAR system induces increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells. In some embodiments, the at least one cytokine or chemokine is IL-2 and IFNg. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNg. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2 and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNg and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0353] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0354] In some embodiments, cells expressing the priming receptor and CAR system induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0355] How to edit cells The term "gene editing" or "genome editing," as used herein, refers to a type of genetic manipulation in which DNA is inserted into, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effects of sequence-specific genes or proteins or for modifying cellular behavior (e.g., for therapeutic purposes).

[0356] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0357] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

[0358] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.

[0359] Provided herein is a method for inserting a nucleotide sequence of more than about 5 kilobases in length into the genome of a cell in the absence of a viral vector. In some embodiments, a nucleotide sequence of more than about 5 bases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0360] The integration of large nucleic acids, e.g., nucleic acids greater than 5 kilobases in size, into cells can be limited by low integration efficiency, off-target effects, and / or loss of cell viability. Methods and compositions for achieving integration of nucleotide sequences, e.g., nucleotide sequences greater than about 5 bases in size, into the genome of a cell are described herein. Some methods improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.

[0361] The plasmid can be introduced into immune cells using a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced into a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cleaves the genomic DNA at this specific site. The specific site can be a portion of the genome that encodes an endogenous immune cell receptor. Therefore, by cleaving the genome at this site, the immune cell no longer expresses the endogenous immune cell receptor.

[0362] The plasmid may contain 5' and 3' homology-directed repair arms complementary to sequences at specific sites on the genome of the immune cell. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site on the genome of the immune cell. Once the plasmid is integrated, the cell expresses the priming receptor. However, as described, the design of the transgene cassette ensures that the non-viral delivery system receptor does not express the CAR until the priming receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0363] First, T cells are activated. The T cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells such as T cells are harvested from a patient. Then, a plasmid encoding a CAR and a priming receptor is introduced into the T cells. Advantageously, the plasmid of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. The T cells are then expanded and co-cultured to generate a sufficient amount of engineered immune cells for use as a therapeutic treatment.

[0364] A method for editing the genome of a cell can include a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) an RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the DNA template is greater than about 200 nucleotides in size, the 5' and 3' ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and the molar ratio of RNP to DNA template in the complex is between about 3:1 and about 100:1; and b) introducing the RNP-DNA template complex into the cell.

[0365] In some embodiments, the methods described herein provide an efficiency of delivery of RNP-DNA template complexes of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP-DNA template into cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or nonviable) into which the RNP-DNA template is introduced.

[0366] As another example, the efficiency of delivery can be determined by quantifying the number of genome-edited cells in a cell population (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing are available. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.

[0367] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these. In some embodiments, the off-target effects of integration are reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these.

[0368] In some cases, the methods described herein provide high cell viability of cells into which the RNP-DNA template has been introduced. In some cases, the viability of cells into which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0369] In the methods provided herein, the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 5:1 to about 10:1, from about 5:1 to about 15:1, from 5:1 to about 20:1, from 5:1 to about 25:1, from about 8:1 to about 12:1, from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.

[0370] In some embodiments, the DNA template has a concentration of about 2.5 pM to about 25 pM. For example, the DNA template concentration can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration therebetween.

[0371] In some embodiments, the size or length of the DNA template is about 4.5kb, 5.0kb, 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb, 6.0kb, 6.1kb, 6.2kb, 6.3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.1kb, 7.2kb, 7.3kb, 7.4kb, 7.5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, 10.0kb, 10.1kb, 10.2kb, 10.3kb, 10.4kb, 10.5kb, 10.6kb, 10.7kb, 10.8kb, 10.9kb, 11.0kb, 11.1kb, 11.2kb, 11.4kb, 11.5kb, 11.6kb, 11.7kb, 11. The DNA template may be 5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, or greater than 10kb, or any size in between these sizes. For example, the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about 6 kb to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.

[0372] In some embodiments, the amount of DNA template is about 1 μg to about 10 μg. For example, the amount of DNA template can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0373] In some cases, the size of the DNA template is large enough and sufficient in quantity to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes.

[0374] In some embodiments, the DNA template comprises regulatory sequences, such as promoter and / or enhancer sequences, for regulating expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0375] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of other strands or opposite strands of DNA. "Substantially devoid" means that the pure single-stranded DNA is devoid of one DNA strand at least 100 times more than another DNA strand.

[0376] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about 1 minute to about 30 minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, or any amount of time therebetween. In another example, the RNP can be incubated with the DNA template at a temperature of about 20° C. to about 25° C. for about less than 1 minute to about 1 minute, about less than 1 minute to about 5 minutes, about less than 1 minute to about 10 minutes, about 5 to 10 minutes, about 5 to 15 minutes, about 10 to about 15 minutes, about 10 to about 20 minutes, or about 10 to about 30 minutes. In some embodiments, the RNP-DNA template complex and cells are mixed before introducing the RNP-DNA template complex into the cells.

[0377] In some embodiments, introducing the RNP-DNA template complex comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L. Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.

[0378] In some embodiments, the Cas9 protein can be in an active endonuclease form so that when it binds to a target nucleic acid as part of a complex with a guide RNA or a DNA template, a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or by HDR to introduce specific mutations. Various Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be used. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).

[0379] In some cases, Cas9 protein is a nickase, so that when it binds to target nucleic acid as part of a complex with guide RNA, it introduces single-strand breaks or nicks into target nucleic acid.A pair of Cas9 nickases, each bound to a structurally different guide RNA, can target two adjacent sites in the target genome region, thus introducing a pair of adjacent single-strand breaks into the target genome region.Nickase pairs can increase specificity because off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0380] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.

[0381] In some cases, multiple RNP-DNA templates containing structurally distinct ribonucleoprotein complexes are introduced into cells. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the DNA templates at multiple structurally distinct target genomic regions.

[0382] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. Progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4+ T cells. In some embodiments, the T cells are CD8+ T cells. In some embodiments, the T cells are CD4+CD8+ T cells. In some embodiments, the T cells are CD4-CD8+ T cells. Also provided is any population of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0383] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to the patient. In other cases, any of the constructs described herein are delivered to the patient in vivo. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both incorporated herein by reference).

[0384] In some embodiments, the RNP-DNA template complex is about 1×10 5 ~Approx. 2×10 6For example, the RNP-DNA template complex is introduced into approximately 1 × 10 cells. 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~Approx. 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells, or approximately 1 x 10 6 ~Approx. 2×10 6 can be introduced into

[0385] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express heterologous proteins (e.g., chimeric antigen receptors (CARs) or priming receptors).

[0386] Insertion site Methods for editing the genome of a T cell specifically include methods for editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human T cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the TCR-α transmembrane domain.

[0387] Methods for editing the genome of a T cell also include methods for editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0388] Methods for editing the genome of T cells specifically include methods for editing the genome of human T cells, comprising inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0389] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges, such as low knock-in efficiency, risk of insertional oncogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by identifying and using safe harbor loci or safe harbor sites (SHSs), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0390] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in an increasing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, whose disruption confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, similar to the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are located near many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.)

[0391] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55,625,241-55,629,351. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019):814-828 (the relevant disclosures of which are incorporated herein by reference). Exemplary AAVS1-targeting gRNAs and target sequences are provided below. AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 186) AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 187)

[0392] CCR5, located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus for CCR5 is chr3:46,414,443-46,414,942. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019): 814-828 (the relevant disclosures of which are incorporated herein by reference).

[0393] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12(2007):1477-1482, the relevant disclosure of which is incorporated herein by reference, identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. See Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7(2019):814-828, the relevant disclosure of which is incorporated herein by reference.

[0394] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Additional examples of integration sites are provided in Table D.

[0395] In some embodiments, safe harbor sites allow for high transgene expression (sufficient to enable transgene functionality or treatment of the disease of interest) and stable expression of the transgene over days, weeks, or months. In some embodiments, knockout of the gene at the safe harbor locus confers a benefit to cellular function, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.

[0396] When used, "neighboring genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).

[0397] In some embodiments, the present disclosure contemplates inserts containing one or more transgenes. The transgenes can encode therapeutic proteins, antibodies, peptides, or any other gene of interest. Transgene incorporation can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. Therapeutic properties of immune cells can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells can also be manifested by expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the tumor microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity through reduction, and resistance to treatments such as chemotherapy.

[0398] As used herein, the term "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into a target locus or safe harbor site. In some embodiments, the insert size comprises at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size comprises about 5,000 or more nucleotide base pairs. In some embodiments, the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilobase pairs), or any size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp, or any size therebetween. In some embodiments, the insert size is in the range of 4.5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.8-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.5-20 kbp, or any number within that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, or 9-10 kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp.In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp. In some embodiments, the insert size is 4.5 to 17, 6 to 17, 7 to 17, 8 to 17, 9 to 17, 10 to 17, 11 to 17, 12 to 17, 13 to 17, or 14 to 17, 15 to 17, or 16 to 17 kbp. In some embodiments, the insert size is 4.5 to 18, 6 to 18, 7 to 18, 8 to 18, 9 to 18, 10 to 18, 11 to 18, 12 to 18, 13 to 18, 14 to 18, 15 to 18, 16 to 18, or 17 to 18 kbp. In some embodiments, the insert size is 4.5 to 19, 6 to 19, 7 to 19, 8 to 19, 9 to 19, 10 to 19, 11 to 19, 12 to 19, 13 to 19, 14 to 19, 15 to 19, 16 to 19, 17 to 19, or 18 to 19 kbp. In some embodiments, the insert size is 4.5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, or 19 to 20 kbp.

[0399] An insert, as used herein, refers to a nucleic acid molecule or polynucleotide inserted into a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. Nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or may comprise non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.

[0400] An insert can have coding and / or non-coding regions. An insert can include non-coding sequences (e.g., regulatory elements, e.g., promoter sequences). In some embodiments, an insert encodes a transcription factor. In some embodiments, an insert encodes an antigen-binding receptor, e.g., a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, an insert is a human sequence. In some embodiments, an insert is chimeric. In some embodiments, an insert is a multigene / multimodule therapeutic cassette. A multigene / multimodule therapeutic cassette refers to an insert or cassette having one or more receptors (e.g., synthetic receptors), other exogenous protein-coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0401] In some embodiments, the nucleic acid sequence is inserted into the genome of T cells via non-viral delivery.In non-viral delivery methods, the nucleic acid can be naked DNA or can be in a non-viral plasmid or vector.The non-viral delivery technique can be a site-specific integration technique described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0402] In some embodiments, an insert is integrated into a safe harbor site by introducing into an engineered cell (a) a targeted nuclease that cleaves a target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (the insert), where the insert is integrated into the insertion site, for example, by HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entireties.

[0403] Examples of contemplated integration sites are provided in Table D.

[0404] [Table D] TIFF2025514751000006.tif240165TIFF2025514751000007.tif240165TIFF2025514751000008.tif239165 TIFF2025514751000009.tif235165TIFF2025514751000010.tif240165TIFF2025514751000011.tif171165

[0405] CRISPR / Cas editing One effective example of gene editing is the CRISPR-Cas approach (e.g., CRISPR-Cas9), which incorporates the use of a guide polynucleotide (e.g., a guide ribonucleic acid or gRNA) and a Cas endonuclease (e.g., Cas9 endonuclease).

[0406] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, which is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks in DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0407] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can complex with a Cas endonuclease and enable the Cas endonuclease to recognize and cleave a DNA target site. A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide that contains only ribonucleic acid is also referred to as a "guide RNA." In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g., Cas9 endonuclease).

[0408] The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide sequence that interacts with a Cas endonuclease polypeptide. The guide polynucleotide may be a duplex molecule (also referred to as a double-stranded guide polynucleotide) that comprises a sequence domain (also referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this duplex guide polynucleotide comprises two separate molecules that hybridize along complementary regions. The two separate molecules may be RNA sequences, DNA sequences, and / or RNA-DNA combination sequences.

[0409] Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonuclease). Homology-directed repair (HDR) of these DSBs allows for precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Traditional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homologous arms matching the locus of interest.

[0410] HITI (homology-independent targeted insertion) uses a non-homologous end joining (NHEJ)-based homology-independent strategy, which can be more efficient than HDR. A guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to contain Cas9 cleavage site(s) adjacent to the gene or sequence to be inserted. This results in Cas9 cleavage in both the donor plasmid and the genomic target sequence. Both the target and donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway, which leads to integration into the genomic DSB site. (See, e.g., Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149, the relevant disclosure of which is incorporated herein in its entirety.)

[0411] Methods for gene editing using CRISPR-Cas approaches are known to those skilled in the art. (See, for example, U.S. Application Nos. US16 / 312,676, US15 / 303,722, and US15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties.) Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in U.S. Application No. 13 / 036,343, the disclosure of which is incorporated herein by reference in its entirety.

[0412] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamine or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and lipid moieties such as octadecylamine or hexylamino-carbonyl-t-oxycholesterol moieties. See, e.g., U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0413] therapeutic use For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered in an effective amount to a subject, generally a mammal, generally a human. The engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other modes of administration known to those skilled in the art.

[0414] The engineered cells provided herein find use in gene therapy as well as non-pharmaceutical uses, such as, for example, the production of animal models and the production of recombinant cell lines expressing a protein of interest.

[0415] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by incorporating a transgene at a safe harbor locus as described herein. Exemplary cells are provided in the recombinant cell section.

[0416] The engineered cells, compositions, and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy. In some embodiments, insertion of a sequence encoding a transgene within a safe harbor locus maintains TCR expression relative to the absence of the insertion, allowing transgene expression while maintaining TCR function.

[0417] In some embodiments, the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. This effect can be a partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment includes any treatment of a disease in a subject (e.g., a mammal, e.g., a human). Additionally, treatment can stabilize or reduce undesirable clinical symptoms in a subject (e.g., a patient). The cells, populations thereof, or compositions thereof provided herein can be administered during or after the onset of a disease.

[0418] In certain embodiments, a subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, a subject in need of cell therapy is a subject with an injury, disease, or condition that triggers cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that the severity of at least one symptom associated with the injury, disease, or condition can be treated, ameliorated, and / or reduced.

[0419] Method of administration An effective amount of the immune cells comprising the system can be administered for the treatment of cancer. The appropriate dosage of the immune cells comprising the system can be determined based on the type of cancer being treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0420] Pharmaceutical Compositions The engineered recombinant cells provided herein can be administered as part of a pharmaceutical composition. These compositions can contain, in addition to one or more of the recombinant cells, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those of skill in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal. Pharmaceutical compositions can contain one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and those of skill in the art will be able to select a suitable pharmaceutical excipient. Therefore, the pharmaceutical excipients provided below are intended to be exemplary and not limiting. Additional pharmaceutical excipients include, for example, those described in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.

[0421] Various modes of administering the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.

[0422] The compositions can be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition to be treated.

[0423] Kits and Products The present application provides kits comprising any one or more of the systems or cell compositions described herein and instructions for use. The instructions may be present in the kit as a package insert, on a label on the container of the kit or its components, or in digital form (e.g., on a CD-ROM or via an internet link). The kit may include one or more of a genome-targeting nucleic acid, a polynucleotide encoding the genome-targeting nucleic acid, a site-directed polypeptide, and / or a polynucleotide encoding the site-directed polypeptide. Additional components in the kit, such as buffers (reconstitution buffer, stabilization buffer, dilution buffer, etc.), and / or one or more control vectors, are also contemplated.

[0424] In some embodiments, the kit further comprises a component selected from any of a secondary antibody, a reagent for immunohistochemistry, a pharmaceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein and one or more pharmaceutically acceptable excipients.

[0425] The present application also provides an article of manufacture comprising any one of the antibody compositions or kits described herein. An example of an article of manufacture is a vial (including a sealed vial).

[0426] Additional Embodiments Embodiment 1 a. A first chimeric polypeptide comprising a priming receptor; and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and C. Cytokines and Including, the system. Embodiment 2 a. A first chimeric polypeptide comprising a priming receptor; and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and c. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); Including, the system. Embodiment 3 a. A first chimeric polypeptide comprising a priming receptor; and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and c. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. Cytokines and Including, the system. Embodiment 4 a. A first chimeric polypeptide comprising a priming receptor; and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and C. a suppressor of gene expression; d. Below: i. a third chimeric polypeptide comprising a synthetic pathway activator (SPA), and / or ii. Cytokines with one or both of Including, the system. Embodiment 5: The priming receptor comprises, from N-terminus to C-terminus: a. a first extracellular antigen-binding domain; b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain containing a human or humanized transcriptional effector; The system according to any one of embodiments 1 to 4, comprising: Embodiment 6. The system of embodiment 5, wherein the first extracellular antigen-binding domain specifically binds to germ cell alkaline phosphatase (ALPG / P). Embodiment 7. The first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3; a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42; b. CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46; c. CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48; d. CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 49, or 50; e. CDR-L2 comprises the sequence set forth in SEQ ID NO: 5 or 51; f. CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 53; 7. The system of embodiment 5 or 6. Embodiment 8. The system of embodiment 7, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO:7. Embodiment 9. The system of embodiment 7 or 8, wherein the VL chain sequence comprises the sequence set forth in SEQ ID NO:8. Embodiment 10. The system of any one of embodiments 5 to 9, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO:9. Embodiment 11. The system of any one of embodiments 5 to 10, wherein binding of ALPG / P by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites within the intracellular domain. Embodiment 12. The system of any one of embodiments 5 to 11, wherein the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain. Embodiment 13. The system of embodiment 12, wherein the first hinge domain comprises a CD8α or a truncated CD8α hinge domain. Embodiment 14. The system of embodiment 13, wherein the first hinge comprises the sequence set forth in SEQ ID NO: 18. Embodiment 15. The system of any one of embodiments 5 to 14, wherein the first transmembrane domain comprises a Notch1 transmembrane domain. Embodiment 16. The system of embodiment 15, wherein the first transmembrane domain comprises the sequence set forth in SEQ ID NO: 19. Embodiment 17. The system of any one of embodiments 5 to 16, wherein the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0033] Embodiment 18. The system of embodiment 17, wherein the intracellular domain comprises the sequence set forth in SEQ ID NO:23. Embodiment 19. The system of any one of embodiments 5 to 18, wherein the priming receptor further comprises a stop migration sequence between the first transmembrane domain and the intracellular domain. Embodiment 20. The system of embodiment 19, wherein the stop migration sequence comprises the sequence set forth in SEQ ID NO:20. Embodiment 21. The system of any one of embodiments 1 to 20, wherein the priming receptor comprises the sequence set forth in SEQ ID NO:24. Embodiment 22. The CAR comprises, from N-terminus to C-terminus: a. a second extracellular antigen-binding domain; and b. a second transmembrane domain; c. an intracellular costimulatory domain; d. intracellular activation domain and A system described in any one of embodiments 1 to 21, comprising: Embodiment 23. The second extracellular antigen-binding domain specifically binds mesothelin (MSLN), wherein the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3; a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, 54, 56, 57, or 71; b. CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, or 61; c. CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63; d. CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67; e. CDR-L2 comprises the sequence set forth in SEQ ID NO: 15, 68, 69, or 70; f. CDR-L3 comprises the sequence set forth in SEQ ID NO: 16, 72, or 73; 23. The system of embodiment 22. Embodiment 24. The system of embodiment 23, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13. Embodiment 25. The system of embodiment 23 or 24, wherein the VL chain sequence comprises the sequence set forth in SEQ ID NO: 17. Embodiment 26. The system of any one of embodiments 23 to 25, wherein the second extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 30. Embodiment 27. The system of any one of embodiments 1 to 26, wherein the CAR comprises a second hinge domain. Embodiment 28. The system of embodiment 27, wherein the second hinge domain comprises CD8α or a truncated CD8α hinge domain. Embodiment 29. The system of any one of embodiments 22 to 28, wherein the second transmembrane domain comprises a CD8α transmembrane domain. Embodiment 30. The system of any one of embodiments 22 to 29, wherein the intracellular costimulatory domain comprises a 4-1BB domain. Embodiment 31. The system of any one of embodiments 22 to 30, wherein the intracellular activation domain comprises a CD3 zeta domain. Embodiment 32. The system of any one of embodiments 1 to 31, wherein the CAR comprises the sequence set forth in SEQ ID NO: 31 or 32. Embodiment 33. The system of any one of embodiments 2 to 32, wherein the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3, and / or STAT5 phosphorylation. Embodiment 34. The system of any one of embodiments 2 to 33, wherein the SPA comprises an extracellular domain linked to an intracellular signaling domain.

[0037] Embodiment 35. The system of embodiment 34, wherein the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

[0037] Embodiment 36. The system of embodiment 34 or 35, wherein the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor. Embodiment 37. The system of embodiment 34 or 35, wherein the cytokine receptor comprises interleukin-6 signal transducer (IL6ST). Embodiment 38. The system of any one of embodiments 34-37, wherein the extracellular domain transmits constitutive activity to the intracellular signaling domain. Embodiment 39. The system of any one of embodiments 34-38, wherein the extracellular domain comprises a dimerization region, and optionally, the dimerization region comprises at least one of a cysteine ​​residue and a leucine zipper. Embodiment 40. The system of embodiment 39, wherein the dimerization domain forms a homodimer. Embodiment 41. The system of any one of embodiments 2 to 40, wherein the SPA comprises leucine zipper-gp130 (L-gp130). Embodiment 42. The system of any one of embodiments 2 to 41, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74. Embodiment 43. The system of any one of embodiments 2 to 42, wherein the SPA comprises the amino acid sequence set forth in SEQ ID NO: 74. Embodiment 44. The system of any one of embodiments 2 to 43, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. Embodiment 45. The system of any one of embodiments 2 to 44, wherein the SPA comprises the amino acid sequence set forth in SEQ ID NO: 75. Embodiment 46. The system of embodiment 38, wherein the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism. Embodiment 47. The system of any one of embodiments 2-36, 38, or 46, wherein the SPA comprises membrane-bound interleukin-15 (mbIL-15). Embodiment 48. The system of any one of embodiments 2-38, 46, or 47, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:76. Embodiment 49. The system of embodiments 2-36, 38, or 46-48, wherein the SPA comprises the amino acid sequence set forth in SEQ ID NO: 76. Embodiment 50. The system of any one of embodiments 2 to 36 or 38, wherein the SPA comprises CD34-interleukin-7 receptor (C7R). Embodiment 51. The system of embodiments 2-36, 38, or 50, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:77. Embodiment 52. The system of any one of embodiments 2 to 36, 38, 50, or 51, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 77. Embodiment 53. The system of embodiments 2-36, 38, or 50-52, wherein the SPA comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:78. Embodiment 54. The system of embodiments 2-36, 38, or 50-53, wherein the SPA comprises the amino acid sequence set forth in SEQ ID NO:78. Embodiment 55. The system of any one of embodiments 1 to 32, wherein the cytokine is a secreted cytokine. Embodiment 56. The system of any one of embodiments 1 to 32, wherein the cytokine is a membrane-bound cytokine. Embodiment 57. The system of any one of embodiments 1 to 32, 55, and 56, wherein the cytokine is an interleukin. Embodiment 58. The system of any one of embodiments 1-32 and 55-57, wherein the cytokine comprises at least one of interleukin (IL)-2, Super-2, IL-12, IL-12 / 23p40, IL-7, IL-15, IL-21, and IL-18. Embodiment 59. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-2. Embodiment 60. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is Super-2. Embodiment 61. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-12. Embodiment 62. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-12 / 23p40. Embodiment 63. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-7. Embodiment 64. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-15. Embodiment 65. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-21. Embodiment 66. The system of any one of embodiments 1 to 32 and 55 to 58, wherein the cytokine is IL-18. Embodiment 67. The system of any one of embodiments 1 to 32 and 55 to 66, wherein the cytokine comprises a non-naturally occurring signal peptide.

[0072] Embodiment 68. The system of embodiment 67, wherein the non-native signal peptide comprises a signal peptide derived from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA. Embodiment 69. The system of embodiment 67 or 68, wherein the non-naturally occurring signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, or 130. Embodiment 70. The system of any one of embodiments 1 to 32 and 55 to 69, wherein the cytokine comprises an amino acid sequence set forth in SEQ ID NO: 86, 88, 90, 92, 94, 96, 98, or 132. Embodiment 71. The system of any one of embodiments 3 to 32, wherein the suppressor of gene expression is an sgRNA or an shRNA. Embodiment 72. The system of any one of embodiments 3 to 32 and 71, wherein the suppressor of gene expression is an sgRNA.

[0072] Embodiment 73. The system of embodiment 72, wherein the sgRNA suppresses expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH.

[0072] Embodiment 74. The system of embodiment 72 or 73, wherein the sgRNA suppresses expression of PTPN2.

[0072] Embodiment 75: The system of embodiment 72 or 73, wherein the sgRNA suppresses expression of RASA2.

[0072] Embodiment 76. The system of embodiment 72 or 73, wherein the sgRNA suppresses expression of SOCS1. Embodiment 77. The system of embodiment 72 or 73, wherein the sgRNA suppresses expression of ZC3H12A.

[0072] Embodiment 78. The system of embodiment 72 or 73, wherein the sgRNA suppresses expression of CISH. Embodiment 79: The system of embodiment 72 or 73, wherein the sgRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160 to 164. Embodiment 80. The system of any one of embodiments 3 to 32 and 71, wherein the suppressor of gene expression is an shRNA. Embodiment 81. The system of embodiment 80, wherein the shRNA suppresses expression of a gene selected from RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH.

[0082] Embodiment 82. The system of embodiment 80 or 81, wherein the shRNA suppresses expression of RASA2.

[0082] Embodiment 83. The system of embodiment 80 or 81, wherein the shRNA suppresses expression of SOCS1. Embodiment 84. The system of embodiment 80 or 81, wherein the shRNA suppresses expression of ZC3H12A. Embodiment 85. The system of embodiment 80 or 81, wherein the shRNA suppresses expression of TGFBR1.

[0082] Embodiment 86. The system of embodiment 80 or 81, wherein the shRNA suppresses expression of CISH. Embodiment 87. The system of embodiment 80 or 81, wherein the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172. Embodiment 88. The system of any one of embodiments 3 to 32, comprising two or more suppressors of gene expression. Embodiment 89. The system of embodiment 88, comprising an shRNA that suppresses expression of TNFRSF6 (Fas) and a further suppressor of gene expression. Embodiment 90: The system described in embodiment 88, comprising an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of TGFBR2, and a further suppressor of gene expression. Embodiment 91 The system described in embodiment 88, comprising an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of PTPN2, and a further suppressor of gene expression. Embodiment 92. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses CISH expression, and a cytokine that is IL-2. Embodiment 93. The system of any one of embodiments 3 to 32, comprising an sgRNA that suppresses PTPN2 expression, and a cytokine that is IL-2. Embodiment 94: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses RASA2 expression, and a cytokine that is IL-2. Embodiment 95: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses SOCS1 expression, and a cytokine that is IL-2. Embodiment 96: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses ZC3H12A expression, and a cytokine that is IL-2. Embodiment 97. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses PTPN2 expression, and a cytokine that is IL-21. Embodiment 98. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses ZC3H12A expression, and a cytokine that is IL-21. Embodiment 99. The system of any one of embodiments 3 to 32, comprising an shRNA that suppresses RASA2 expression, and a cytokine that is IL-2. Embodiment 100: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses CISH expression, and an SPA that is C7R. Embodiment 101. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses PTPN2 expression and an SPA that is C7R. Embodiment 102. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses RASA2 expression, and an SPA that is C7R. Embodiment 103: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses SOCS1 expression, and an SPA that is C7R. Embodiment 104: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses ZC3H12A expression, and an SPA that is C7R. Embodiment 105: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses CISH expression, and an SPA that is L-gp130. Embodiment 106: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses RASA2 expression, and an SPA that is L-gp130. Embodiment 107. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses ZC3H12A expression, and an SPA that is L-gp130. Embodiment 108. A system described in any one of embodiments 3 to 32, comprising an shRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130. Embodiment 109. A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130. Embodiment 110. A system described in any one of embodiments 3 to 32, comprising an shRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130. Embodiment 111: A system described in any one of embodiments 3 to 32, comprising an sgRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130. Embodiment 112. The system of any one of embodiments 3 to 112, wherein the priming receptor and the CAR are capable of binding to the same target cell. Embodiment 113. The system of embodiment 112, wherein the target cells are human cells. Embodiment 114: The system of embodiment 112 or 113, wherein the target cells are cancer cells. Embodiment 115: The system of embodiment 114, wherein the cancer cells are solid cancer cells or liquid cancer cells. Embodiment 116: The system of embodiment 114 or 115, wherein the cancer cells are ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer. Embodiment 117. One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a system according to one of embodiments 1 to 116. Embodiment 118 a. A nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; and b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; c. a nucleotide sequence encoding a cytokine; At least one nucleic acid fragment comprising one or more recombinant nucleic acids comprising: Embodiment 119 a. A nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; and b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; c. a nucleotide sequence encoding a synthetic pathway activator; At least one nucleic acid fragment comprising one or more recombinant nucleic acids comprising: Embodiment 120 a. A nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; and b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; c. a nucleotide sequence encoding a synthetic pathway activator; d. a nucleotide sequence encoding a cytokine; At least one nucleic acid fragment comprising one or more recombinant nucleic acids comprising: Embodiment 121 a. A nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; and b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; c. a nucleotide sequence of a suppressor of gene expression; d. Below: i. a nucleotide sequence encoding a synthetic pathway activator, and / or ii. A nucleotide sequence encoding a cytokine with one or both of At least one nucleic acid fragment comprising one or more recombinant nucleic acids comprising: Embodiment 122. The recombinant nucleic acid of any one of embodiments 118 to 121, wherein the first extracellular antigen-binding domain specifically binds to ALPG / P. Embodiment 123. The recombinant nucleic acid of any one of embodiments 118 to 122, wherein the second extracellular antigen-binding domain specifically binds to MSLN. Embodiment 124. The recombinant nucleic acid of any one of embodiments 117 to 123, comprising two or more nucleic acid fragments. Embodiment 125. The recombinant nucleic acid of any one of embodiments 117-124, further comprising an inducible promoter operably linked to the nucleotide sequence encoding the CAR. Embodiment 126. The recombinant nucleic acid of any one of embodiments 117 to 125, further comprising an inducible promoter operably linked to said nucleotide sequence encoding said priming receptor. Embodiment 127. The recombinant nucleic acid of any one of embodiments 117 to 125, further comprising a constitutive promoter operably linked to said nucleotide sequence encoding said priming receptor. Embodiment 128. The recombinant nucleic acid of any one of embodiments 117 to 125, further comprising a constitutive promoter operably linked to said nucleotide sequence encoding a synthetic pathway activator. Embodiment 129. The recombinant nucleic acid of any one of embodiments 117 to 127, further comprising an inducible promoter operably linked to said nucleotide sequence encoding said synthetic pathway activator. Embodiment 130. The recombinant nucleic acid of embodiment 127 or 128, wherein said priming receptor and said synthetic pathway activator are under the control of the same constitutive promoter. Embodiment 131. The recombinant nucleic acid of any one of embodiments 117-124, further comprising an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor, a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor, and a nucleotide sequence encoding the synthetic pathway activator.

[0032] Embodiment 132: The nucleic acid comprises, in a 5' to 3' direction: a. the constitutive promoter; b. a nucleotide sequence encoding the synthetic pathway activator; c. the nucleotide sequence encoding the priming receptor; d. the inducible promoter; e. the nucleotide sequence encoding a chimeric antigen receptor; 132. The recombinant nucleic acid of embodiment 131, comprising:

[0032] Embodiment 133: The nucleic acid comprises, in a 5' to 3' direction: a. the inducible promoter; b. the nucleotide sequence encoding a chimeric antigen receptor; c. the constitutive promoter; d. the nucleotide sequence encoding a priming receptor; e. the nucleotide sequence encoding the synthetic pathway activator; 132. The recombinant nucleic acid of embodiment 131, comprising: Embodiment 134. The recombinant nucleic acid of any one of embodiments 117 to 127, further comprising an inducible promoter operably linked to said nucleotide sequence encoding said cytokine. Embodiment 135: a. An inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and the nucleotide sequence encoding the cytokine; and b. a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor; 135. The recombinant nucleic acid of any one of embodiments 117 to 127, and 134, further comprising:

[0032] Embodiment 136: The nucleic acid comprises, in a 5' to 3' direction: a. the constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the inducible promoter; d. the nucleotide sequence encoding the chimeric antigen receptor; e. the nucleic acid sequence encoding the cytokine and / or the nucleic acid sequence encoding a synthetic pathway activator; 136. The recombinant nucleic acid of embodiment 135, comprising:

[0032] Embodiment 137: The nucleic acid comprises, in a 5' to 3' direction: a. the constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the inducible promoter; d. the nucleic acid sequence encoding the cytokine and / or the nucleic acid sequence encoding a synthetic pathway activator; e. the nucleic acid sequence encoding the chimeric antigen receptor; 136. The recombinant nucleic acid of embodiment 135, comprising:

[0032] Embodiment 138: The nucleic acid comprises, in a 5' to 3' direction: a. the inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the nucleic acid sequence encoding the cytokine and / or the nucleic acid sequence encoding a synthetic pathway activator; d. the constitutive promoter; e. the nucleotide sequence encoding the priming receptor; 136. The recombinant nucleic acid of embodiment 135, comprising:

[0032] Embodiment 139: The nucleic acid comprises, in a 5' to 3' direction: a. the inducible promoter; b. the nucleic acid sequence encoding the cytokine and / or the nucleic acid sequence encoding a synthetic pathway activator; c. the nucleic acid sequence encoding the chimeric antigen receptor; d. the constitutive promoter; e. the nucleotide sequence encoding the priming receptor; 136. The recombinant nucleic acid of embodiment 135, comprising: Embodiment 140. a. A first inducible promoter operably linked to said nucleotide sequence encoding said chimeric antigen receptor; and b. a second inducible promoter operably linked to the nucleotide sequence encoding the cytokine or the synthetic pathway activator; c. a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor; 128. The recombinant nucleic acid of any one of embodiments 117 to 127, further comprising:

[0070] Embodiment 141: The nucleic aci...

Claims

[Claim 1] The invention described in the specification.

Images