Hepatoprotective Compositions and Methods

Abstract

Orally administered low-dose formulations of medium-chain dicarboxylic acids have many unexpectedly beneficial cytoprotective effects in various cells. In particular, contemplated formulations, compositions, and methods reduce, reverse, and / or prevent liver inflammation, fatty liver, and / or liver fibrosis in NASH, improve glycemic control, and provide additional cytoprotective benefits, such as stimulation of mitochondrial biogenesis, increased SIRT and NAMPT levels, increased NAD+, antioxidant capacity, and / or reduced DNA damage.

Description

[Technical field]

[0001] Claiming priority This application claims priority to Applicant's co-pending U.S. Provisional Patent Application No. 63 / 341,913, filed May 13, 2022, and U.S. Provisional Patent Application No. 63 / 359,587, filed July 8, 2022, each of which is incorporated by reference herein in its entirety.

[0002] Sequence Listing The contents of the Sequence Listing XML text file named 104026.0081PCT.xml, which is 11,610 bytes in size, was created on April 28, 2023, and was submitted electronically via EFS-Web with the present application and is incorporated by reference in its entirety.

[0003] The field of this invention is compositions and methods for treating and preventing the sequelae of lipid accumulation in the liver, particularly with respect to low dose medium chain dicarboxylic acid mediated effects. [Background technology]

[0004] The Background Description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the claimed invention, or that any publication mentioned, explicitly or implicitly, is prior art.

[0005] All publications and patent applications in this specification are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. In the event that a definition or use of a term in an incorporated reference is inconsistent or contrary to a definition of that term set forth herein, the definition of that term set forth herein shall apply and the definition of that term in the reference shall not apply.

[0006] Besides its well-known role in preservatives, paints, coating materials, corrosion inhibitors, surfactants, and engineering plastics, dodecanoic diacid (DDDA, also known as DDA) has also been reported as a readily convertible source of various energy substrates, e.g., succinyl-CoA and acetyl-CoA, and ATP, when DDDA is administered orally in large amounts. Notably, relatively large oral doses (>20 g) of DDDA also had a hypoglycemic effect in individuals diagnosed with non-insulin-dependent diabetes mellitus (NIDDM), but without a corresponding effect in healthy individuals (see U.S. Patent Publication No. 2011 / 0002900). Similarly, when DDDA was administered by intravenous infusion (intravenous injection) to individuals diagnosed with NIDDM, the plasma glucose levels of NIDDM patients were significantly reduced during the infusion (see, e.g., Nutrition 1998 April;14(4):351-7).

[0007] In particular, there are no published reports on the physiological effects of DDDA on hepatocytes and liver tissue, given the rapid metabolic conversion of DDDA in the liver. However, the corresponding monocarboxylic acids (i.e., lauric acid and palmitic acid), which are very closely related chemically, have been reported to have significant adverse effects (side effects) on the liver and other tissues. In particular, lauric acid and palmitic acid have been reported to increase adipose tissue inflammation, induce insulin resistance, and induce non-alcoholic fatty liver disease (see, for example, Biology (Basel). 2020 October 22; 9 (11): 346).

[0008] Nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) have become common conditions and are associated with liver fibrosis that can progress to cirrhosis and liver cancer. In the United States alone, the number of cases of NAFLD is expected to increase from 83 million in 2015 to 101 million in 2030, with 27% of cases meeting the criteria for NASH. The rising disease prevalence is accompanied by an increase in the number of individuals with both cirrhosis and end-stage liver disease requiring liver transplantation. Nonalcoholic steatohepatitis (NASH) is a pro-inflammatory state that leads to activation of hepatocytes, Kupffer cells (KCs), and hepatic stellate cells (HSCs). Activated HSCs undergo a phenotypic switch and deposit excessive amounts of extracellular matrix, which alters normal liver architecture and leads to liver fibrosis.

[0009] Unfortunately, there are currently no FDA-approved drugs to treat or reverse these conditions, although a number of herbal extracts have been reported to have at least some beneficial effects (see, e.g., US20100074975, US20120171312, US20100086627), but such preparations are often poorly defined and tend to be less effective than expected. Summary of the Invention [Problem to be solved by the invention]

[0010] Thus, although there are various compositions and methods for treating and preventing hepatic lipid accumulation and liver damage caused by lipid accumulation, all or almost all of them have some disadvantages.Therefore, there remains a need for improved compositions and methods for treating and preventing hepatic lipid accumulation and liver damage caused by lipid accumulation. [Means for solving the problem]

[0011] The subject of the present invention is directed to various nutritional and / or pharmacologic acceptable compositions and methods using medium-chain dicarboxylic acids at low doses to prevent and even significantly reduce liver fibrosis in NASH. Such findings were particularly unexpected, since the therapeutically effective doses were significantly lower than those used in NIDDM treatment. In addition to reducing fibrosis, it was unexpectedly discovered that the low doses also had significant auxiliary protective effects that provided significant benefits to hepatocytes and other cell types. Furthermore, the inventors have discovered that medium-chain dicarboxylic acids are also effective in preventing and / or reducing and / or reversing the severity of non-alcoholic steatohepatitis (NASH), and even in treating NASH. Furthermore, the inventors contemplate that medium-chain dicarboxylic acids may be effective in preventing hepatocellular carcinoma (HCC) in healthy liver and in livers of NASH / NAFLD individuals.

[0012] In one aspect of the present subject matter, the inventors contemplate a hepatoprotective composition comprising a nutritionally or pharma- ceutically acceptable carrier in combination with a medium chain dicarboxylic acid, wherein a therapeutically effective unit dose of the medium chain dicarboxylic acid provides 5% or less of a mammal's standard daily caloric intake.

[0013] In some embodiments, the composition is formulated for oral administration.For example, the contemplated composition may be formulated as a ready-to-use beverage or as a solid supplement or powder.Although not limiting the subject matter of the present invention, it is generally preferred that the medium chain dicarboxylic acid is dodecane dicarboxylic acid (DDA or DDDA) or decane dicarboxylic acid (sebacic acid).

[0014] In some cases, the therapeutically effective unit dose provides 3% or less, or less than 2%, or less than 1% of the normal daily caloric intake of a mammal. From a different perspective, the therapeutically effective unit dose can be an amount of medium chain dicarboxylic acid of 5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less. The therapeutically effective unit dose can be an amount of medium chain dicarboxylic acid of 3-5 g, or 2-4 g, or 1-3 g, or 0.1-2 g, or 0.01-0.1 g. If desired, the composition may further comprise an additional hepatoprotectant (e.g., silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives (pyruvate derivatives), selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin, etc.).

[0015] Advantageously, a therapeutically effective dose may reduce the risk or even reverse the progression of liver fibrosis in non-alcoholic steatohepatitis (NASH) and / or reduce postprandial glucose spikes and / or postprandial blood glucose AUC (e.g., in healthy or prediabetic individuals).Furthermore, a therapeutically effective dose may stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity, and / or reduce DNA damage.

[0016] Therefore, the present inventors also contemplate a method for reducing the risk or progression of liver inflammation, fatty liver, and / or liver fibrosis in an individual with non-alcoholic steatohepatitis (NASH). Such a method typically comprises administering a therapeutically effective dose of a medium-chain dicarboxylic acid to an individual in need thereof, the therapeutically effective dose resulting in 5% or less of the individual's normal daily caloric intake. The present inventors further contemplate a method for reversing liver inflammation, fatty liver, and / or liver fibrosis in an individual with non-alcoholic steatohepatitis (NASH), comprising administering a therapeutically effective dose of a medium-chain dicarboxylic acid to an individual in need thereof, the therapeutically effective dose resulting in 5% or less of the individual's normal daily caloric intake.

[0017] Preferably, but not necessarily, the medium chain dicarboxylic acid is dodecane dicarboxylic acid and / or the individual is a human. Furthermore, it is generally preferred that the therapeutically effective dose is administered orally. Most typically, the therapeutically effective dose provides 3% or less, or 1% or less of the normal daily caloric intake of a mammal. Thus, a therapeutically effective unit dose can be an amount of medium chain dicarboxylic acid of 5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less. A therapeutically effective unit dose can be an amount of medium chain dicarboxylic acid of 3-5 g, or 2-4 g, or 1-3 g, or 0-2 g, or 0.01-0.1 g. As noted above, contemplated compositions may further include additional hepatoprotectants, such as silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.

[0018] Beneficially, administration of a therapeutically effective dose may also reduce postprandial glucose spikes and / or postprandial total blood glucose AUC (e.g., in healthy or prediabetic individuals), and in some embodiments, administration of a therapeutically effective dose may stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity, and / or reduce DNA damage.

[0019] In a further aspect, the inventors contemplate a method of regulating blood glucose without affecting body weight, comprising administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof, wherein the therapeutically effective dose provides 5% or less of the normal daily caloric intake of a mammal, and wherein the regulation of blood glucose is a reduction in post-prandial glucose spikes and / or post-prandial total blood glucose AUC (e.g., in a healthy individual or a pre-diabetic individual).

[0020] Most typically, the medium chain dicarboxylic acid is formulated for oral administration, for example, as a ready-to-use beverage or as a solid supplement or powder. Preferably, but not necessarily, the medium chain dicarboxylic acid is dodecane dicarboxylic acid. In further embodiments, the therapeutically effective dose provides 3% or less of the mammal's normal daily caloric intake, and / or the therapeutically effective dose comprises 3 g or less of the medium chain dicarboxylic acid.

[0021] In the contemplated methods, administration can also stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+ levels, maintain antioxidant capacity, and / or reduce DNA damage. Advantageously, administration can also reduce the risk or progression of liver fibrosis in non-alcoholic steatohepatitis (NASH).

[0022] In yet a further aspect, the inventors also contemplate a method of increasing the resilience and / or lifespan of a cell, comprising exposing the cell to a medium chain dicarboxylic acid for a time (e.g., at least 6 hours) and in an amount effective to stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+, maintain antioxidant capacity, and / or reduce DNA damage. Most typically, the medium chain dicarboxylic acid is dodecane dicarboxylic acid, and / or the cell is exposed in vivo following oral administration of the medium chain dicarboxylic acid.

[0023] In a further aspect of the subject matter of the present invention, the inventors contemplate a method of preventing or reducing the severity of non-alcoholic steatohepatitis (NASH) in an individual, in which a therapeutically effective dose of a medium-chain dicarboxylic acid is administered to the individual, and the therapeutically effective dose prevents or reduces the severity of non-alcoholic steatohepatitis (NASH) in the individual. Similarly, the inventors contemplate a method of treating non-alcoholic steatohepatitis (NASH) in an individual, in which a therapeutically effective dose of a medium-chain dicarboxylic acid is administered to the individual, and the therapeutically effective dose reduces lipid deposits in the liver of an individual diagnosed with or suspected of having non-alcoholic steatohepatitis (NASH).

[0024] Most typically, the medium chain dicarboxylic acid is dodecane dicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof, and / or the individual is a human. It is further contemplated that the therapeutically effective dose is administered orally. Without limiting the subject matter of the present invention, it is generally preferred that the therapeutically effective dose results in 5% or less, or 3% or less, or 1% or less of the individual's normal daily caloric intake. From a different perspective, the therapeutically effective unit dose may be an amount of medium chain dicarboxylic acid of 5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less. The therapeutically effective unit dose may be an amount of medium chain dicarboxylic acid of 3-5 g, or 2-4 g, or 1-3 g, or 0-2 g, or 0.01-0.1 g.

[0025] Therefore, the inventors also contemplate a hepatoprotective composition comprising a nutritionally or pharma- ceutically acceptable carrier in combination with a medium-chain dicarboxylic acid, the composition being formulated for oral administration at a therapeutically effective dose to prevent or treat nonalcoholic steatohepatitis (NASH) in an individual taking the composition.If desired, the composition can also include at least one additional hepatoprotectant (e.g., silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin).

[0026] Advantageously, a therapeutically effective dose may further reduce the risk or progression of liver inflammation and / or liver fibrosis, and / or may further reduce insulin resistance in the individual.

[0027] In a further aspect of the subject matter of the present invention, the inventors contemplate a method of preventing hepatocellular carcinoma, comprising administering a therapeutically effective dose of a medium-chain dicarboxylic acid to an individual in need thereof. In a preferred embodiment, the individual is a patient with non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD). Most typically, the medium-chain dicarboxylic acid is dodecane dicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof. It is further contemplated that the therapeutically effective dose is administered orally. It is generally preferred that the therapeutically effective amount results in 5% or less, or 4% or less, or 3% or less, or 2% or less, or 1% or less of the individual's standard daily caloric intake. From a different perspective, a therapeutically effective unit dose may be an amount of medium-chain dicarboxylic acid of 5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less. A therapeutically effective unit dose can be an amount of medium chain dicarboxylic acid between 3 and 5 g, or between 2 and 4 g, or between 1 and 3 g, or between 0 and 2 g, or between 0.01 and 0.1 g.

[0028] Various objects, features, aspects and advantages of the present subject matter will become more apparent from the following detailed description of preferred embodiments, taken in conjunction with the accompanying drawings. [Brief description of the drawings]

[0029] [Figure 1] FIG. 1 is a schematic diagram of an exemplary study protocol using Wistar rats fed a high fat / high cholesterol diet with or without low concentrations (1% of caloric intake) of dodecanedioic acid. [Diagram 2] FIG. 2 shows exemplary glycemic challenge and body weight results for the animals of FIG. 1 with and without low concentrations of dodecanedioic acid in the diet. [Diagram 3] FIG. 2 shows exemplary results regarding liver histology of the animals of FIG. 1 after diets with and without low concentrations of dodecanedioic acid. [Figure 4] FIG. 1 shows exemplary in vitro results regarding lipid accumulation in hepatocytes exposed to oleic acid with or without low concentrations of dodecanedioic acid. [Diagram 5] FIG. 1 shows exemplary data regarding the antioxidant effect of DDA (dodecanedioic acid) in liver cells. [Figure 6] FIG. 1 shows exemplary data regarding global SIRT activity in DDA-exposed liver cells. [Figure 7] FIG. 1 shows exemplary data regarding PGC-1α levels in DDA-exposed liver cells. [Figure 8] FIG. 1 shows exemplary data regarding NAMPT activity in DDA-exposed liver cells. [Figure 9] FIG. 1 shows exemplary data regarding SIRT3 activity in DDA-exposed liver cells. [Figure 10] FIG. 1 shows exemplary data regarding SIRT1 activity in DDA-exposed liver cells. [Figure 11] FIG. 1 shows exemplary data regarding DNA damage in DDA-exposed liver cells. [Figure 12]FIG. 1 shows exemplary data regarding the antioxidant effect of DDA (dodecanedioic acid) in endothelial cells. [Figure 13] FIG. 1 shows exemplary data regarding global SIRT activity in DDA-exposed endothelial cells. [Figure 14] FIG. 1 shows exemplary data regarding PGC-1α levels in DDA-exposed liver cells. [Figure 15] FIG. 1 shows exemplary data regarding NAMPT activity in DDA-exposed endothelial cells. [Figure 16] FIG. 1 shows exemplary data regarding SIRT3 activity in DDA-exposed endothelial cells. [Figure 17] FIG. 1 shows exemplary data regarding DNA damage in DDA-exposed endothelial cells. [Figure 18] Schematic diagram of the experimental design of the studies. In study 1 (A), DODA was administered for 4 weeks along with a high-fat, high-cholesterol diet, whereas in study 2 (B), rats were first fed a high-fat, high-cholesterol diet for 9 weeks to develop NASH, and then administered DODA for 4 weeks to evaluate its reversal. [Figure 19] Figure 1 shows exemplary results demonstrating that DODA administration prevents diet-induced insulin resistance and NASH. Panels A, B show the time course and AUC of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. Panel C shows hepatic insulin resistance assessed by HOMA-IR. Data are the mean ± SEM of data from 10 rats per group. ***P<0.0001, ***P<0.004, ***P<0.015. [Figure 20] FIG. 1 shows exemplary results demonstrating that DODA administration prevents diet-induced NASH. Panels A-F are representative examples of hematoxylin and eosin (A, B), Oil Red O for lipid staining (C, D), and Picrosirius Red for fibrosis (E, F) staining of liver sections. Magnification 20×. Scale bar: 0.10 mm. [Figure 21]Figure 1 shows exemplary results demonstrating that DODA administration reverses diet-induced insulin resistance. Panels A, B: Time course and AUC of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. Panel C: Hepatic insulin resistance and insulin sensitivity assessed by HOMA-IR. Data are mean ± SEM of data from 10 rats per group. ***P<0.004, ***P<0.04. [Figure 22] FIG. 1 shows exemplary results demonstrating that DODA administration reverses diet-induced insulin-mediated NASH. Panels A-F: Representative hematoxylin and eosin (A, B), Oil Red O for lipid staining (C, D), and Picrosirius Red for fibrosis (E, F) staining of liver sections. Magnification 20×. Scale bar: 0.10 mm. [Diagram 23] Figure 1 shows in vitro lipid droplet accumulation in primary hepatocytes by Nile red staining of palmitate treated (0.4 mM) primary hepatocytes incubated with or without DODA 1% (w / vol). Magnification 60x. Scale bar: 50 μm. [Figure 24-1] Figure 1 shows exemplary results demonstrating that DODA induces HSC apoptosis contributing to the resolution of liver fibrosis. Panels A, B: Flow cytometry analysis of myofibroblast differentiation of hepatic stellate cells exposed for 3 days to CM from palmitate-treated hepatocytes with (B) or without (A) DODA 1% (w / vol) for 24 hours. Panels C, D: Flow cytometry-based analysis of HSC apoptosis following incubation with CM from palmitate-treated hepatocytes with (D) or without (C) DODA 1% (w / vol) using propidium iodide staining. [Figure 24-2]Figure 1 shows exemplary results demonstrating that DODA induces HSC apoptosis contributing to the resolution of liver fibrosis. Panels A, B: Flow cytometry analysis of myofibroblast differentiation of hepatic stellate cells exposed for 3 days to CM from palmitate-treated hepatocytes with (B) or without (A) DODA 1% (w / vol) for 24 hours. Panels C, D: Flow cytometry-based analysis of HSC apoptosis following incubation with CM from palmitate-treated hepatocytes with (D) or without (C) DODA 1% (w / vol) using propidium iodide staining. [Diagram 25] FIG. 1 shows exemplary study designs for in vivo study 1 (prevention, panel A) and in vivo study 2 (reversal, panel B) demonstrating the prevention or reversal of NAFLD using compositions disclosed herein. [Figure 26] FIG. 1 shows that C12 administration prevents diet-induced insulin resistance and NASH. Panels A and B show the time course and AUC of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. Panel C shows hepatic insulin resistance assessed by HOMA-IR. [Figure 27] Figure 1: C12 administration prevents diet-induced NASH. Panels A-F: Representative hematoxylin and eosin (A, B), Oil Red O (C, D), and picrosirius red (E, F) staining of liver sections. Magnification 20x. Scale bar: 0.10 mm. [Figure 28] Figure 1 shows exemplary results showing that C12 administration reverses diet-induced insulin resistance. Panels A, B: Time course and AUC of blood glucose and plasma insulin concentrations during an oral glucose tolerance test. Panel C: Hepatic insulin resistance assessed by HOMA-IR. ***P<0.0001, ***P<0.004, ***P<0.015. [Figure 29]Figure 1: C12 administration reverses diet-induced insulin-mediated NASH. Panels A-F: Representative hematoxylin and eosin (A, B), Oil Red O (C, D), and picrosirius red (E, F) staining of liver sections. Magnification 20x. Scale bar: 0.10 mm. [Figure 30-1] C12 induces HSC apoptosis contributing to the resolution of liver fibrosis. Panels A, B: Flow cytometry analysis of myofibroblast differentiation of hepatic stellate cells exposed for 3 days to CM from palmitate-treated hepatocytes with (B) or without (A) C12 1% (w / vol) for 24 hours. Panels C, D: Flow cytometry-based analysis of HSC apoptosis after incubation with CM from palmitate-treated hepatocytes with (D) or without (C) C12 1% (w / vol) using propidium iodide staining. Panel E: qReal time-PCR analysis of genes associated with fibrosis performed on rat livers from in vivo studies 1 and 2. [Figure 30-2] C12 induces HSC apoptosis contributing to the resolution of liver fibrosis. Panels A, B: Flow cytometry analysis of myofibroblast differentiation of hepatic stellate cells exposed for 3 days to CM from palmitate-treated hepatocytes with (B) or without (A) C12 1% (w / vol) for 24 hours. Panels C, D: Flow cytometry-based analysis of HSC apoptosis after incubation with CM from palmitate-treated hepatocytes with (D) or without (C) C12 1% (w / vol) using propidium iodide staining. Panel E: qReal time-PCR analysis of genes associated with fibrosis performed on rat livers from in vivo studies 1 and 2. [Figure 30-3]C12 induces HSC apoptosis contributing to the resolution of liver fibrosis. Panels A, B: Flow cytometry analysis of myofibroblast differentiation of hepatic stellate cells exposed for 3 days to CM from palmitate-treated hepatocytes with (B) or without (A) C12 1% (w / vol) for 24 hours. Panels C, D: Flow cytometry-based analysis of HSC apoptosis after incubation with CM from palmitate-treated hepatocytes with (D) or without (C) C12 1% (w / vol) using propidium iodide staining. Panel E: qReal time-PCR analysis of genes associated with fibrosis performed on rat livers from in vivo studies 1 and 2. [Diagram 31] Figure 1: C12 inhibits citrate uptake and reduces the citrate transporter SLC13A5. Panel A: In vitro citrate uptake performed in primary human hepatocytes treated with or without a constant concentration of citrate (150 μM) and C12 (0.1-1.5% v / w). Panel B: Solute carrier family 13 member 5 (SLC13A5) assessed by qReal time-PCR in primary human hepatocytes treated with or without palmitate (0.4 mM) and C12 1% (v / w). [Diagram 32] Figure 1: C12 reduces lipid droplet accumulation and DNL in primary hepatocytes. Panel A: Nile red staining of primary human hepatocytes treated with palmitic acid (0.4 mM) with or without C12 1% (w / vol). Magnification 60x. Scale bar: 50 μm. Panel B: De novo lipid biosynthetic enzymes (i.e., diacylglycerol O-acyltransferase 1 (DGAT1), fatty acid synthase (FASN), and stearoyl-CoA desaturase (SCD1)) assessed in primary human hepatocytes treated with or without palmitic acid (0.4 mM) and C12 1% (v / w). Panel C: The key fatty acid beta-oxidation enzyme (i.e., carnitine palmitoyltransferase 1A (CPT1A)) assessed in primary human hepatocytes treated with or without palmitic acid (0.4 mM) and C12 1% (v / w). [Diagram 33] Figure 1 shows that C12 affects DNL, ​​FAO, and citrate uptake in vivo. Panel A: De novo lipid biosynthesis enzymes (i.e., diacylglycerol O-acyltransferase 1 (DGAT1), fatty acid synthase (FASN), and stearoyl-CoA desaturase (SCD1)) assessed by qReal Time-PCR in rat livers from in vivo studies 1 and 2. Panel B: Key fatty acid beta-oxidation enzymes (i.e., carnitine palmitoyltransferase 1A (CPT1A)) assessed by qReal Time-PCR in rat livers from in vivo studies 1 and 2. Panel C: Solute carrier family 13 member 5 (SLC13A5) assessed by qReal Time-PCR in rat livers from in vivo studies 1 and 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] The inventors have unexpectedly discovered that oral administration of low doses of medium-chain dicarboxylic acids has various cytoprotective effects, and that low doses are particularly effective in reducing or even reversing liver fibrosis in NASH, as well as reducing postprandial glucose spikes and postprandial total blood glucose AUC in nondiabetic individuals.Furthermore, it has been unexpectedly observed that oral administration of low doses stimulates mitochondrial biogenesis, increases global SIRT and NAMPT levels (which in turn increases intracellular NAD+), helps maintain antioxidant capacity, and reduces DNA damage.Furthermore, the inventors have discovered that medium-chain dicarboxylic acids are also effective in preventing and / or reducing and / or reversing the severity of nonalcoholic steatohepatitis (NASH) in individuals, and can even be used to treat NASH in individuals by reducing lipid deposition in the liver of individuals diagnosed with or suspected of having nonalcoholic steatohepatitis.

[0031] As a result, and based on the data presented in more detail below, the inventors contemplate that medium chain dicarboxylic acids may be used in oral dosage forms to combat liver fibrosis, prevent or reduce the severity of NASH, treat NASH, enhance cellular health, and / or help maintain blood glucose levels (e.g., by reducing insulin resistance, particularly in non-diabetic individuals). Additionally, and particularly over extended periods of administration, contemplated compositions may also be effective in promoting weight loss (particularly in overweight or obese populations).

[0032] For example, in one exemplary embodiment, the dietary supplement is formulated as a ready-to-use beverage or bulk powder containing about 3 g of dodecanedicarboxylic acid (DDDA) in a single dosage unit. The beverage is preferably formulated as a flavored non-alcoholic aqueous solution, while the ready-to-use powder may be formulated with an edible and preferably non-caloric or low-caloric carrier (e.g., soluble prebiotic fiber) that can be mixed with fluids or other foods. In another example, the pharmaceutical formulation for oral administration is formulated as a solid tablet(s) providing a daily dosage of 0.05 g to 5 g of dodecanedicarboxylic acid.

[0033] As will be readily appreciated, various medium chain dicarboxylic acids other than DDDA may be used in the contemplated compositions, with a particularly preferred alternative dicarboxylic acid being sebacic acid, and generally, the dicarboxylic acid may be any of the following: (CH 2 ) n (CO 2 H) 2wherein n is preferably an integer between 6 and 12. It should further be understood that combinations of various medium chain dicarboxylic acids having different molecular weights are also considered suitable. It should further be understood that various modifications of the medium chain dicarboxylic acids are also considered suitable, with exemplary modifications including the addition of functional groups (e.g., hydroxyl groups, halogens, amino groups, thiol groups, etc.) or replacement of hydrogens of the medium chain dicarboxylic acids with functional groups. Similarly, contemplated medium chain dicarboxylic acids may be modified to form mono- or diesters with various groups to modulate absorption, serum half-life, etc. It should further be recognized that the medium chain dicarboxylic acids contemplated herein include any metabolites of the medium chain dicarboxylic acids and mixtures thereof.

[0034] Furthermore, we found that administration of DDDA to tumor-bearing mice was beneficial for hepatoblastoma and potential NASH-related cancers. Therefore, low doses (5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less) of DDDA may be used for chemoprevention of HCC in healthy liver or liver of NASH / NAFLD individuals, possibly by reducing chronic subacute inflammation.

[0035] Throughout this disclosure, the terms "dodecanedicarboxylic acid", "DDA", "DDDA", "C12", and "DODA" are used interchangeably and have the formula (CH 2 ) 10 (COOH) 2 It refers to a dicarboxylic acid having the formula:

[0036] With regard to suitable carriers, it should be noted that all carriers are suitable as long as they are nutritionally and / or pharma- ceutically acceptable. Thus, particularly preferred carriers would include materials suitable for human and animal consumption, which may be solid or liquid. For example, solid carriers would typically include all excipients commonly used in the nutritional and pharmaceutical arts, such as fillers, binders, disintegrants, etc., when the composition is formulated as a powder, tablet, capsule, or other orally administrable form. On the other hand, when the composition is formulated as a snack or food, particularly preferred formulations would include snack bars, cookies, gummies, etc. Furthermore, solid carriers would also include all baked goods, when the medium chain dicarboxylic acid is used to fortify baked goods to blunt blood glucose spikes and / or insulin spikes that would otherwise be observed after a meal. In further examples, liquid carriers would include aqueous formulations, as well as soft drinks, syrups, fruit juices, and flavored drinks, which may or may not be carbonated, all of which may be filled into small ready-to-use / disposable containers or containers that store multiple dose units.

[0037] Regardless of the specific formulation, it should be understood that the contemplated compositions and products include at least one therapeutically effective unit dose of a medium chain dicarboxylic acid, which unit dose typically (but not necessarily) provides 5% or less of a mammal's standard daily caloric intake. From a different perspective, a therapeutically effective unit dose will generally be a dose effective to provide a physiologically desirable effect, as described in more detail below. Among other desirable effects, administration of a therapeutically effective unit dose for at least 1 week, or at least 2 weeks, or at least 4 weeks, and longer, will include prevention and / or reduction of liver inflammation, NAFLD, NASH, fatty liver, and / or liver fibrosis in individuals diagnosed with NAFLD or NASH, prevention and / or reduction of hepatic lipid accumulation in healthy individuals or individuals at risk of developing NAFLD or NASH, treatment of NAFLD or NASH, reduction of postprandial total blood glucose levels (especially in non-diabetic or pre-diabetic individuals) as determined by postprandial glucose spikes and / or AUC measurements. Further desirable effects include various cytoprotective effects, such as increasing mitochondrial biogenesis, increasing SIRT levels, increasing NAMPT levels, increasing intracellular NAD+ levels, maintaining antioxidant capacity, and / or reducing DNA damage.In further embodiments, it is contemplated that the compositions presented herein may also be used to address, alleviate, and / or treat conditions and diseases associated with elevated lipid load, including PCOS.

[0038] As a result, and in at least some embodiments, it should be understood that administration of DDDA (and other dicarboxylic acids) can be a good way to not only treat but also reverse NASH (and therefore NAFLD). In particular, and as shown in more detail below, liver fibrosis can also be resolved with dicarboxylic acids. Of course, it should be noted that dicarboxylic acids other than DDDA can provide similar benefits given their similar properties. Moreover, it has been unexpectedly discovered that dicarboxylic acids have significant effects at low concentrations or low doses, and especially against liver disease.

[0039] Thus, in certain embodiments, contemplated therapeutically effective unit doses provide 10% or less, or 9% or less, or 8% or less, or 7% or less, or 6% or less, or 5% or less, or 4% or less, or 3% or less, or 2% or less, or 1% or less of the normal daily caloric intake of a mammal. Most typically, the daily caloric intake of a human is about 2,000 calories / day for an adult female and about 2,500 calories / day for an adult male. When contemplated compositions are used in pet food, the typical caloric intake of a cat is about 200 calories / day for a 10 lb cat and 200-1,000 calories for a dog weighing 10-70 lbs.

[0040] Viewed from a different perspective, contemplated therapeutically effective unit doses will typically be 6 g or less, or 5 g or less, or 4 g or less, or 3 g or less, or 2 g or less, or 1 g or less, or 0.5 g or less, or 0.3 g or less of medium chain dicarboxylic acid.

[0041] In this context, it should be particularly understood that the metabolic or physiological role of the contemplated medium-chain dicarboxylic acid varies greatly depending on the dose administered. This was not recognized or expected by those skilled in the art. Indeed, while relatively large amounts (e.g., 40 g) of orally administered DDDA functioned primarily as a source of acetyl-CoA, succinyl-CoA, and ATP, while low doses of intravenous DDDA improved glycemic control in individuals with NIDDM, the very low doses presented herein prevented and even reversed liver fibrosis, hepatocellular lipid accumulation, and NASH in NASH, and also reduced glycemic excursions and total serum concentrations (measured by AUC) in non-diabetic individuals. Moreover, the low doses also significantly provided significant cytoprotective effects, as described in more detail below. Thus, it should be recognized that medium-chain dicarboxylic acids have dose-dependent and diverse effects. Without limiting the subject matter of the present invention, the inventors contemplate that the beneficial effects described herein may be due to the interaction of medium-chain dicarboxylic acids (and DDDA in particular) with NR1I3 (nuclear receptor subfamily 1 group I member 3), a known master regulator of xenobiotic and endogenous metabolism. Additionally or alternatively, the beneficial effects described herein may also be due to the interaction of medium-chain dicarboxylic acids (and DDDA in particular) with HDAC9 (histone deacetylase 9), a member of the histone deacetylase enzymes known to play a regulatory role depending on the metabolic state of the cell. Still further, the inventors note that DDDA and compositions containing DDDA promoted mitochondrial fatty acid oxidation. Mitochondrial fatty acid oxidation is believed to aid in weight loss and reducing the lipid load of the liver and / or adipocytes.

[0042] As can be easily understood, the contemplated composition can also include one or more additional functional ingredients that help maintain cell health, and especially liver cell health.For example, the contemplated hepatoprotective agents include silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, capsaicin, capsaicin derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.Similarly, the additional agent can also help control normal blood sugar levels, and exemplary ingredients would include cinnamon, ginseng, various probiotics, powder form and extract from Aloe vera, Gymnema sylvestre, and alpha lipoic acid, and berberine, and trivalent chromium complexed with one or more ligands. Further contemplated additional agents include those that promote and / or maintain a ketogenic state, with particularly preferred agents including beta-hydroxybutyrate, butyric acid, tributyrin, acetoacetate, and the like.

[0043] Most typically, the contemplated composition is administered for a long period of time using at least one therapeutically effective dose per day.For example, the composition can be administered for at least 3 days, or at least 7 days, or at least 2 weeks, or at least 4 weeks, or at least 2 months, or at least 3 months, and even longer.Preferably, but not necessarily, administration is with food, but can also be used on an empty stomach. EXAMPLES

[0044] [Example] The following examples are provided to illustrate selected physiological markers and / or processes that may be beneficially, and in at least some cases synergistically, modulated by the compositions presented herein.However, these examples are not intended to limit the subject matter of the present invention, and additional and / or alternative markers and processes are expressly contemplated herein.Unless otherwise noted, the measurement of these markers is known in the art and follows well-known protocols.

[0045] Animal studies. All in vivo studies used Wistar rats fed a high-fat / high-cholesterol diet for 9 weeks. The animals were then divided into two groups, the control group continued on the high-fat / high-cholesterol diet and plain water, whereas the treatment group continued on the high-fat / high-cholesterol diet and water containing DDA (dodecanedioic acid) at 1% of the caloric intake. A schematic diagram of the study is shown in Figure 1. After all animals were divided into their respective test groups, their body weights were recorded and a glucose tolerance test was performed. Notably, as can be seen from Figure 1 and Figure 2, no significant differences in body weight were observed between both groups. However, the response to the glucose challenge clearly revealed that glucose metabolism was positively affected by the very low concentration of DDA in the diet. Notably, blood glucose spikes were significantly blunted in the DDA group, and the AUC blood glucose was also significantly reduced as shown in Figure 2. Such an effect is particularly unexpected, since the amount of DDA in the food was far below any amount that would be reasonably expected.

[0046] Furthermore, the inventors also unexpectedly discovered that low concentrations of DDA in a high fat / high cholesterol diet have substantial hepatoprotective effects as shown by the histopathological analysis in Figure 3. More specifically, the cell size / expansion of lipid vesicles and overall tissue morphology were characteristic of non-alcoholic steatohepatitis (NASH) in liver tissue under H&E staining from rats fed a high fat / high cholesterol diet, whereas the cells and liver tissue from rats fed a high fat / high cholesterol diet and DDA were significantly closer to normal liver histology. Similarly, when liver tissue was stained with ORO red to demonstrate the presence of fatty deposits, significant fatty deposits were observed in liver tissue from rats fed a high fat / high cholesterol diet, whereas liver tissue from rats fed the same high fat / high cholesterol diet and a small amount of DDA had a normal or near-normal microscopic appearance.

[0047] Similarly, when tissue sections were stained with Sirius red, which indicates hepatic collagen (a marker of fibrosis), it was again evident that rats fed a high fat / high cholesterol diet had significantly increased fibrosis compared to rats whose diet contained low concentrations of DDA. Without wishing to be bound by any particular theory or hypothesis, the inventors contemplate that low levels of DDA inhibit the transdifferentiation of hepatic stellate cells into myofibroblasts that produce extracellular matrix proteins (including collagen), possibly by protecting them from damage by reactive oxygen species (ROS). Thus, it should be appreciated that a small amount of DDA in the presence of a fat / high cholesterol diet had a substantial hepatoprotective effect, despite seemingly not making a meaningful contribution to caloric intake.

[0048] Previous experimental data demonstrated that DDA has a regulatory effect on metabolism when it contributes significantly to caloric intake (about 15%, equivalent to a daily DDA intake of about 40 g in the human diet). Indeed, these large amounts of DDA provided a substantial source of production of acetyl-CoA, succinyl-CoA, and ATP. Therefore, based on these high DDA amounts, any metabolic effects at the amounts above (about 1% of caloric intake) were not reasonably expected. Nevertheless, and as demonstrated by the results in Figure 2, small amounts of DDA had a profound effect on glycemic control even in the presence of a high-fat / high-cholesterol diet.

[0049] Based on these unexpected results, we then sought to determine whether DDA also has an effect on oxidative stress resilience, protection against DNA damage under oxidative stress, and whether DDA may have beneficial effects on epigenetic modification (and in particular acetylation by SIRT) and mitochondrial biogenesis. From a different perspective, we hypothesized that DDA also affects processes associated with maintaining health during aging and / or oxidative injury.

[0050] To that end, we used endothelial cells (EOMA cells) and liver cells (AML-12 cells) in vitro to quantify various markers in response to exposure of cells to environmental challenges in the presence and absence of low concentrations of DDA. Unless otherwise indicated, the DDA concentration in the in vitro experiments was 5 mcg per microliter. More specifically, we measured p-H2AX protein levels as a marker of DNA damage, PGC-1α protein levels as a marker of mitochondrial biogenesis, NAMPT enzyme levels as a marker of NAD+ production potential, and total antioxidant capacity as a marker of cell health. In addition, we also measured overall SIRT activity as a measure of the activity of all SIRT enzymes, and in particular SIRT1 enzyme levels as a marker of various beneficial processes and autophagy that are associated with a calorie-restricted diet, and SIRT3 levels as a marker of mitochondrial function and lifespan.

[0051] Antioxidant activity in liver cells was tested and exemplary results are shown in FIG. 5. As can be easily seen, the data indicates that 6 hours of DDDA (in the presence of hydrogen peroxide) preserves the total antioxidant capacity of the cells (p=0.001). The same trend was evident after 24 hours of treatment in the presence of hydrogen peroxide, although this did not reach significance levels (N=5-6 plates per treatment). Thus, at least in an acute setting, DDA (also referred to herein as DDDA) was observed to have potent antioxidant activity after 6 hours. This suggests that DDA provides significant protection and supports cellular health.

[0052] In further experiments, liver cells were also tested for overall SIRT activity, and exemplary results are shown in FIG. 6. Here, the data show that 6 hours of DDDA (in the presence of hydrogen peroxide) increased overall SIRT activity in a statistically significant manner (p<0.001). The same trend was also evident after 24 hours without hydrogen peroxide treatment (p=0.065), but this did not reach significance (N=5-6 plates per treatment). Thus, and once again, at least in the acute phase, DDA significantly increased overall SIRT activity, indicating improvements in stress resilience, autophagy, and extended lifespan.

[0053] We also evaluated the activity of DDA on energy metabolism, and in particular on mitochondrial health and / or mitochondrial biogenesis. The protein tracked was PGC-1α, a known marker of mitochondrial biogenesis, and exemplary results are shown in FIG. 7. Here, the data show that after 6 hours, DDDA increased PGC1a levels (p=0.001). Notably, this pattern was paradoxically reversed after 24 hours of treatment (N=5-6 plates per treatment). Taken together, these data indicate that the rapid DDDA-induced upregulation of this marker may have led to a negative feedback that returned this metric to baseline (by 24 hours post-treatment). Such a finding is not entirely unexpected, as PGC-1α is a transcriptional coactivator and therefore tightly regulated. Thus, the data suggest that DDDA may provide a strong positive stimulus to mitochondrial biogenesis.

[0054] To evaluate the effect of DDDA on energy metabolism, and in particular NAD+ synthesis, we also tested the effect of DDDA on NAMPT in liver cells. Figure 8 shows exemplary results. As can be seen from the graph, the data show that 6 hours after DDDA, NAMPT enzyme levels were significantly increased (p=0.001, N=5-6 plates per treatment). Notably, this pattern was paradoxically reversed 24 hours after treatment. Similar to the PGC-1α data in Figure 7 above, the data suggest that the rapid DDDA-induced upregulation of this marker may have led to a negative feedback that returned this metric to baseline (by 24 hours after treatment). Thus, DDDA may have a potential stimulatory effect on NAMPT enzyme regulation and thus on NAD+ levels.

[0055] In further experiments, we also investigated whether DDDA could have a stimulatory effect on selected SIRT proteins. More specifically, we tested the effect of DDDA on SIRT3 and SIRT1. Exemplary results are shown in Figures 9 and 10, respectively. As can be seen in Figure 9, the data show that after 24 hours of DDDA exposure, SIRT3 protein levels were significantly increased (p=0.028). This may have been the reason why an upward trend in overall SIRT activity was observed in 24 hour DDDA treated cells in Figure 10 (p=0.065). N=5-6 plates per treatment. Meanwhile, and as shown in Figure 10, the data show that after 6 hours of DDDA exposure, SIRT1 levels tended to increase (p=0.127). However, no other observations beyond this trend were evident. N=5-6 plates per treatment.

[0056] Finally, we also investigated whether DDDA could have a protective effect against peroxide-induced DNA damage. Exemplary results are shown in Figure 11. Here, it can be easily seen that after 6 hours of DDDA exposure, a trend towards reduced DNA damage was observed (p=0.068), consistent with the data in Figure 5 regarding the antioxidant effect. N=5-6 plates per treatment.

[0057] In a further set of experiments, we also sought to determine whether DDDA has a regulatory effect on endothelial cells using the same markers and experimental conditions described above.

[0058] Regarding antioxidant capacity, Figure 12 shows exemplary results. As can be seen from the data, after 24 hours of DDDA exposure (in the presence of hydrogen peroxide), the total antioxidant capacity of the cells was maintained (p=0.001). These data confirm and replicate what was found in liver cells and warrant investigation of how DDDA protects against oxidative stress in vivo. N=5-6 plates per treatment.

[0059] Global SIRT activity was measured in endothelial cells and exemplary results are shown in FIG. 13. Here, the data demonstrate that after 6 hours of DDDA exposure (in the presence of hydrogen peroxide) and 24 hours of DDDA exposure (without hydrogen peroxide), global SIRT activity was significant (p=0.03 and p=0.044, respectively). These data confirm and replicate those found in liver cells and warrant investigation of how DDDA affects SIRT activity in vivo. N=5-6 plates per treatment.

[0060] FIG. 14 shows exemplary results for PGC-1α. Notably, PGC-1α was affected by exposure to DDDA, whereas endothelial cells showed no statistically significant difference (N=5-6 plates per treatment). On the other hand, when endothelial cells were exposed to DDDA, significant differences in NAMPT enzyme levels were observed, as exemplarily shown in FIG. 15. Here, the data show that 6 hours of DDDA increased NAMPT enzyme levels (p=0.018, N=5-6 plates per treatment). Similar to hepatocytes, these data strongly suggest a potential effect of DDDA on NAMPT enzyme regulation and NAD+ levels.

[0061] Regarding specific SIRT proteins, we tested SIRT3 and exemplary results are shown in Figure 16. Here, exposure to DDDA led to a strong and rapid increase in SIRT3 followed by a large decrease at the 24 hour time point, suggesting tight control of SIRT3 expression. Nevertheless, the 6 hour data here may explain why an upregulation in overall SIRT activity was observed in 24 hour DDDA treated cells in Figure 13 (p=0.044). N=5-6 plates per treatment.

[0062] Finally, we have 2 O 2DNA damage in endothelial cells after oxidative injury with DDDA was also evaluated, and exemplary results are shown in Figure 17. These data show that 6 h of DDDA numerically reduced DNA damage, but with a p-value >0.100. These data are in principle consistent with the antioxidant data in endothelial cells and the DNA damage and antioxidant data in liver cells. N=5-6 plates per treatment.

[0063] Based on its favorable safety and solubility profile, as well as its significant antioxidant potential, we further hypothesized that oral administration of dodecanedioic acid (e.g., as the sodium salt) may prevent and reverse NASH development by reducing oxidative stress in the liver. To this end, we conducted two separate studies in rats to understand whether dodecanedioic acid (DODA) may protect against NASH (study 1) and / or reverse NASH (study 2). In the first study, DODA was administered together with a high-fat, high-cholesterol diet for 4 weeks, whereas in the second study, rats were first fed a high-fat, high-cholesterol diet for 9 weeks to induce NASH, and then administered DODA for 4 weeks to evaluate the possibility of reversal. In both studies, the presence of NASH was confirmed by liver histology. Furthermore, using primary hepatocytes and HSCs, we investigated the role of DODA in hepatic stellate cell activation.

[0064] Animal testing Study Design: All animal procedures were approved by the Catholic University of Rome Institutional Animal Care and Use Committee. The study design is summarized in Figure 18, panels A and B.

[0065] Study 1: Twenty adult Wistar rats aged 8-10 weeks were included in the study. Rats were housed in individual cages at 22°C with a 12-h light cycle and had free access to food and water. Rats were fed a high-fat, high-cholesterol diet (44% carbohydrate, 14% protein, 42% fat + 0.2% cholesterol) (Mucedola, Milan, IT) for 4 weeks in the presence or absence of 1% dodecanedioic acid, sodium salt (w / vol) dissolved in water (Figure 18, Panel A). Body weight and food / water intake were monitored weekly.

[0066] Study 2: Twenty adult Wistar rats, 8-10 weeks of age, were included in the study. The rats were housed in individual cages at 22°C with a 12-h light cycle and had free access to food and water. The rats were fed a high-fat, high-cholesterol diet (44% carbohydrate, 14% protein, 42% fat + 0.2% cholesterol) (Mucedola, Milan, IT). After 9 weeks on the diet, the rats were randomly assigned to one of the following groups: 4 weeks of high-fat, high-cholesterol diet, or 4 weeks of high-fat, high-cholesterol diet and 1% dodecanedioic acid, sodium salt (w / v) dissolved in water (Figure 18, Panel B). Body weight and food / water intake were monitored weekly.

[0067] Oral glucose tolerance test (OGTT): All animals underwent an OGTT at the end of the study. After an overnight fast, rats received a 50% D-glucose solution (1 g / kg body weight) by oral gavage. Blood samples were taken by tail bleeding and collected in EDTA tubes. All blood samples were immediately centrifuged and plasma was divided into appropriate subsamples and stored at -20°C for further analysis. Blood glucose was measured at 0, 20, 40, 60, 80, 100 and 120 min, and plasma insulin at 0, 60 and 120 min. Blood glucose levels were measured by a glucometer (Accu-Chek, Roche Diagnostics Division, Grenzacherstrasse, CH). Plasma insulin was measured by ELISA (EMD Millipore Corporation, Billerica, MA) with a sensitivity of 0.1 ng / ml and intra- and inter-assay precision of 1.9% and 7.6%, respectively.

[0068] Histology: On the day of sacrifice, fresh sections of liver were cut, embedded in OCT and snap frozen in liquid nitrogen. Biopsies were cut (5 μm) using a cryostat and slides were stored at -20°C until analysis.

[0069] Hematoxylin and eosin staining was performed to assess hepatic steatosis: slides were fixed in 95% ethanol for 10 min, stained with hematoxylin for 1 min, washed in distilled water, stained with eosin for 30 s, and cleared through two changes of absolute ethanol and two changes of xylene.

[0070] Oil red O was performed to evaluate intracellular lipid accumulation. Slides were fixed in 4% formalin overnight and stained with Oil red O solution for 1 h. Counterstaining was performed with hematoxylin solution.

[0071] Sirius red was used to identify liver fibrosis. Slides were fixed in 4% formalin for 10 min, stained with Direct red 80 for 1 h, washed in acidic water, and dehydrated in three changes of absolute ethanol. After a brief clearing in xylene, slides were mounted in resin medium. Images were taken under a light microscope (Leica DM2000, Wetzlar, DE). All reagents for histological analysis were obtained from Sigma-Aldrich (St. Louis, MO).

[0072] In vitro experiments Primary hepatocytes: Hepatocytes were isolated by a two-step collagenase perfusion method (6). Briefly, the inferior vena cava (IVC) was cannulated with a 24-gauge 3 / 4-inch angiocatheter (BD) and the portal vein was cut. The liver was perfused via the IVC with 100 mL of Liver Perfusion medium (Invitrogen) at 37°C, followed by 100 mL of collagenase type IV (Sigma-Aldrich, St. Louis, MO) in Hank's balanced salt solution (HBSS, with calcium and magnesium, GIBCO). After digestion, the liver was dissected, cut into small pieces, and passed through a 100 μm strainer (Falcon). Hepatocytes were separated from nonparenchymal cells (NPCs) by low-speed centrifugation (50 g × 5 min) and further purified by Percoll gradient centrifugation (50% v / v, Sigma).

[0073] Nile Red: Cells were cultured for 24 h in DMEM containing 10% FBS. Before stimulation, cells were incubated overnight in serum-free DMEM. To assess lipid droplet accumulation, primary hepatocytes were stimulated for 24 h in complete DMEM medium supplemented with palmitic acid (0.4 mM) and with or without 1% (w / vol) dodecanedioic acid, sodium salt. After stimulation, cells were stained with Nile Red (100 ng / mL) for 45 min. Stained cells were used for immunofluorescence to quantify lipid droplet deposition. Nuclear staining was performed with DAPI, and images of lipid droplets were taken using a Nikon A1 RHD25 confocal microscope, and images were analyzed using NIS-Elements imaging software.

[0074] Palmitate treatment and preparation of conditioned medium: A 100 mM palmitate stock solution was prepared in 0.1 mM NaOH by heating at 70°C. A 10% (w / v) FFA-free BSA (Sigma) solution was prepared in ddH2O and kept in a water bath at 55°C. A 10 mM FFA / 1% BSA solution was obtained by complexing the appropriate amount of palmitate stock solution to 10% BSA at 55°C for an additional 30 minutes. The above solution was then cooled to 25°C, filter-sterilized, and stored at -20°C until use. Primary hepatocytes were grown in DMEM supplemented with palmitate (0.4 mM). After 24 hours, the CM was clarified by centrifugation at 6000g to remove cell debris, sterile-filtered through a 0.45 μm pore size membrane filter, and stored in aliquots at -20°C until use.

[0075] Hepatic stellate cells: Primary hepatic stellate cells were isolated from Wistar rats as previously described (7). Briefly, rats were surgically dissected under anesthesia and the liver was perfused with 0.5 mM EGTA through the IVC, after which the portal vein was cut and the upper IVC was clamped. After 2 min, the liver was perfused with pronase (Roche, Basilea, CH) solution for 5 min and then collagenase B (11088831001, Roche) solution for 7 min. The liver was removed and minced in pronase / collagenase / DNAse-I (Roche, Basilea, CH) solution for 24 min and then passed through a 70 μm cell strainer. Liver cells were centrifuged and washed twice with Gey's balanced salt solution (GBSS), followed by density gradient separation of HSCs using Histodenz (Sigma-Aldrich, St. Louis, MO) solution. After centrifugation, HSCs at the interface were collected. Cells were cultured in DMEM containing 10% FBS for 48 h. To induce fibrogenic activation and mitochondrial oxidative stress, primary HSCs were incubated for 3 days with conditioned medium obtained from steatotic primary hepatocytes (8). HSC activation was assessed by flow cytometry by evaluating alpha-smooth muscle actin (α-SMA) and collagen type I alpha 1 (COL1A1) protein expression. α-SMA and COL1A1 antibodies were obtained from Thermo Fisher scientific (Waltham, MA). Flow cytometry analysis was performed using CytoFlex (Beckman Coulter, Brea, CA), and data were analyzed with Kaluza software (Beckman Coulter, Brea, CA).

[0076] Statistical analysis: Because the number of animals was relatively small and many variables were not normally distributed, we used non-parametric tests. To compare the results between the two groups, we used the Mann-Whitney U test. Repeated measures ANOVA was used to compare blood glucose and insulin plasma levels during OGTT. Data are expressed as mean ± SEM unless otherwise stated. Statistical significance was set at P<0.05 (two-tailed).

[0077] result DODA administration prevents the development of insulin resistance and NASH: To test the hypothesis that DODA can prevent the development of diet-induced insulin resistance and NASH, we administered DODA 1% (w / vol) in drinking water together with a high-fat-high-cholesterol diet for 4 weeks. Rats fed a high-fat-high-cholesterol diet without DODA were included as controls.

[0078] Compared to controls, rats treated with DODA showed decreased blood glucose and plasma insulin concentrations during an oral glucose tolerance test (Figure 19, panels A and B). Hepatic insulin resistance, assessed by HOMA-IR, was consistently decreased in the DODA group (Figure 19, panel C). Histological analysis of liver features of NASH showed that DODA treatment reduced hepatic steatosis, triglyceride deposition, and fibrosis (Figure 20, panels A-F).

[0079] Taken together, these data suggest that DODA treatment could prevent diet-induced insulin resistance and NASH.

[0080] DODA administration reverses insulin resistance and NASH: To evaluate whether DODA can reverse the development of diet-induced insulin resistance and NASH, rats were first fed a high-fat, high-cholesterol diet for 9 weeks to develop insulin resistance and NASH. After the 9 weeks of diet, DODA was administered for 4 weeks to evaluate the reversal of insulin resistance and NASH. Rats fed a high-fat, high-cholesterol diet without DODA were included as controls.

[0081] DODA treatment resulted in a reduction in blood glucose and plasma insulin concentrations during an oral glucose tolerance test (Figure 21, panels A and B) and reversed insulin resistance as assessed by HOMA-IR (Figure 21, panel C). Histological analysis revealed that DODA treatment reversed the effects of diet-induced NASH by reducing hepatic steatosis, triglycerides, and fibrosis (Figure 22, panels A-F).

[0082] These results demonstrated that DODA treatment could reverse both diet-induced insulin resistance and NASH.

[0083] DODA induces HSC apoptosis that contributes to the resolution of liver fibrosis: Previous studies have demonstrated that reversal of liver fibrosis leads to a decrease in myofibroblasts, and that this decrease is associated with an increase in myofibroblast apoptosis. Furthermore, induction of myofibroblast apoptosis by pharmacological approaches promotes the resolution of fibrosis, suggesting that apoptosis contributes causally to this process.

[0084] To investigate the effect of DODA treatment on HSCs, the main fibrogenic cell type in the liver, we used conditioned medium (CM) from steatotic hepatocytes to induce HSC activation with or without DODA 1% (w / vol). Two days after isolation, rat primary HSCs were exposed to CM from palmitate-treated hepatocytes for 3 days, and then incubated with DODA for 24 hours. Figure 23 shows exemplary results of in vitro lipid droplet accumulation in primary hepatocytes by Nile Red staining of palmitate-treated (0.4 mM) primary hepatocytes incubated with or without DODA 1% (w / vol).

[0085] Then, the protein expression of two established markers of HSC activation, namely collagen type I (COLA1A) and alpha-smooth muscle actin (αSMA), was determined by flow cytometry analysis. HSCs exposed to CM from steatotic hepatocytes in combination with DODA revealed lower expression of COLA1A and α-SMA compared to HSCs incubated without DODA (9.18% vs. 25.15%) (Figure 24, panels A and B). Next, we analyzed the effect of DODA on HSC apoptosis. HSCs treated with CM from steatotic hepatocytes together with DODA showed increased cell death assessed by propidium iodide staining using flow cytometry (16.16% vs. 8.39%) (Figure 24, panels C and D).

[0086] As described in more detail below, further studies can be conducted to evaluate the effects of contemplated compounds and compositions on metabolism, the gut microbiome, and aging.

[0087] Metabolism: Contemplated compositions can be administered to healthy subjects or subjects suffering from metabolic disorders, such as dyslipidemia, loss of insulin sensitivity, prediabetes, type 2 diabetes, obesity, fatty liver (NASH), or diagnosed with a metabolic disorder. It should also be noted that such subjects may have a normal average daily caloric intake or dietary behaviors characteristic of overnutrition (see, e.g., J Gerontol A Biol Sci Med Sci. 2021 Sep. 13; 76(10):1714-1725). As a result, one or more of the following biomarkers will be tracked on an acute (e.g., T0, 30 min, 60 min, 90 min, 120 min, 180 min, 240 min) and longitudinal (e.g., T0, 1 day, 3 days, 7 days, 14 days, 21 days, 30 days) basis: fasting / average, postprandial glucose and insulin levels, HbA1c, HOMA-IR, triglycerides, total / HDL / oxLDL / LDL cholesterol, lipid particle size, homocysteine, FGF21 expression, SIRT1 expression, weight, BMI, visceral fat, serum levels of ALT, AST, GST, BUN, creatinine, ketones, and blood pressure.

[0088] Intestinal microbiome: The effects of the contemplated compounds can be evaluated in vitro using the Simulator of the Human Intestinal Microbial Ecosystem (SHIME: see e.g. Chapter 27 in "The Impact of Food Bioactives on Health: in vitro and ex vivo models" by Verhoeckx K, Cotter P, Lopez-Exposito I et al., editors, Cham (CH): Springer; 2015). Such in vitro models advantageously reduce the influence of other physiological processes that may interfere with the effects of polyamines on the microbiota. However, it should be understood that if observation of in vivo conditions is preferred, the microbiome can be tracked using fecal sampling and 16S rRNA sequencing, as is well known in the art. Thus, microbiome testing will reveal changes in microbial species / families / orders (e.g., increased abundance of Firmicutes, decreased abundance of Bacteroides), and overall microbial diversity. Furthermore, additional parameters that can be obtained from such in vivo and in vitro tests include, inter alia, the quantification of short chain fatty acids (SCFAs), butyrate- or bifidobacteria-producing bacteria, and ketone bodies, such as (hydroxy)butyrate, acetic acid (acetate), acetoacetic acid (acetoacetate), propionic acid (propionate), in the intestine.

[0089] The aging process can also be quantitatively tracked by measuring various markers that are often associated with caloric restriction, with particular contemplated markers including sirtuin 1 activation and inhibition of insulin / insulin growth factor signaling (see, e.g., Cell. 2011 Sep. 2;146(5):682-95).

[0090] Efficacy of dodecanedioic acid treatment for preventing and reversing NASH In the United States alone, the number of NAFLD cases is expected to grow from 83 million in 2015 to 101 million in 2030, with 27% of cases meeting the criteria for NASH. The rising disease prevalence is accompanied by an increase in the number of individuals with both cirrhosis and end-stage liver disease requiring liver transplants.

[0091] Nonalcoholic steatohepatitis (NASH) is a pro-inflammatory state that leads to activation of hepatocytes, Kupffer cells (KCs) and hepatic stellate cells (HSCs). Although the exact cause of NAFLD is unclear, recent studies have shown that an increased rate of hepatic mitochondrial oxidation leads to increased reactive oxygen species (ROS) formation, which may promote the progression of NAFLD to NASH by activating hepatic stellate cells (HSCs). ROS-activated HSCs undergo a phenotypic switch and deposit excessive amounts of extracellular matrix, which alters normal liver architecture and leads to liver fibrosis.

[0092] Hepatic fat accumulation, a histological hallmark of NASH, is often associated with increased fatty acid delivery, enhanced de novo lipid synthesis (DNL), and reduced lipid deposition by fatty acid oxidation. Several clinical studies have shown that the proportion of DNL is increased in NASH, accounting for approximately 20-30% of hepatic fat accumulation, whereas it is approximately 5-10% in physiological conditions, underlying the essential role of DNL in the progression of NASH.

[0093] Cytoplasmic citrate, the main precursor and regulator of de novo fatty acid synthesis, is considered a key metabolite linking glucose and lipid metabolism. Indeed, citrate inhibits phosphofructokinase (PFK), thereby reducing glycolytic flux and promoting polymerization, thus promoting the activation of acetyl-CoA carboxylase (ACC), which catalyzes the rate-limiting step of DNL synthesis. The Na+-coupled dicarboxylate transporter from the SLC13 family, NaCT (gene SLC13A5), mediates the transport of citrate into cells and plays a key role in determining the cytoplasmic citrate concentration.

[0094] SLC13a5 knockout (KO) mice show improved glycemic control, which may be due to the suppression of glucose production. Moreover, SLC13a5 KO mice fed a high-fat diet (HFD) show reduced body weight and liver lipid concentration compared to wild-type mice. Furthermore, dicarboxylates may be able to inhibit NaCT-mediated cellular uptake of citrate in vitro and in vivo. Therefore, inhibition of NaCT may be a beneficial strategy for treating metabolic disorders and NASH.

[0095] Currently, there is no FDA-approved drug treatment for NAFLD. In recent years, dicarboxylic acids (DA) have attracted great interest for their potential health benefits due to the possibility of a wide range of therapeutic actions. Unlike its homologous fatty acids, DA is soluble in water as a salt and has been proven safe in both experimental animals and humans. Dodecanedioic acid (herein referred to as C12 or DDDA, and these terms are used interchangeably throughout this disclosure), which belongs to the family of linear dicarboxylic acids, is beta-oxidized to CO2 and H2O via the formation of acetyl-CoA and succinyl-CoA. The inventors investigated whether oral administration of dodecanedioic acid, sodium salt, could prevent and / or reverse the development of NASH. The inventors contemplated that C12 could inhibit NaCT and reduce citrate uptake, thereby attenuating ectopic fat accumulation in the liver.

[0096] To this end, we performed two separate studies in rats to understand whether C12 can protect against NASH (study 1) and / or reverse NASH (study 2). In the first study, C12 was administered together with a high-fat-high cholesterol diet for 4 weeks, while in the second study, rats were first fed a high-fat-high cholesterol diet for 9 weeks to develop NASH, and then administered C12 for 4 weeks to evaluate its reversal. In both studies, the presence of NASH was assessed by liver histology. Finally, we performed two in vitro studies to investigate the role of C12 in primary human hepatic stellate cell activation, and to understand whether C12 can reduce citrate uptake into primary human hepatocytes by reducing the expression of the citrate transporter NaCT.

[0097] method Animal studies, study design The study design is summarized in FIG. 25, panels A and B.

[0098] Study 1: Twenty adult Wistar rats aged 8-10 weeks were included in the study. Rats were housed in individual cages at 22°C with a 12-hour light cycle and had free access to food and water. Rats were fed a high-fat, high-cholesterol diet (44% carbohydrate, 14% protein, 42% fat + 0.2% cholesterol) for 4 weeks in the presence or absence of 1% dodecanedioic acid, sodium salt dissolved in water (Figure 25, Panel A). Body weight and food / water intake were monitored weekly.

[0099] Study 2: Twenty adult Wistar rats aged 8-10 weeks were included in the study. The rats were housed in individual cages at 22°C with a 12-hour light cycle and had free access to food and water. The rats were fed a high-fat-high-cholesterol diet (44% carbohydrate, 14% protein, 42% fat + 0.2% cholesterol). After 9 weeks on the diet, the rats were randomly assigned to one of the following groups: 4 weeks of high-fat-high-cholesterol diet, or 4 weeks of high-fat-high-cholesterol diet and 1% dodecanedioic acid, sodium salt dissolved in water (Figure 25, Panel B). Body weight and food / water intake were monitored weekly.

[0100] Oral glucose tolerance test (OGTT): All animals underwent OGTT at the end of the study. After an overnight fast, all rats received 50% D-glucose solution (1 g / kg body weight) by oral gavage. Blood samples were taken by tail bleeding and collected in EDTA tubes. All blood samples were immediately centrifuged and plasma was divided into appropriate subsamples and stored at -20°C for further analysis. Blood glucose and plasma insulin were measured at 0, 20, 40, 60, 80, 100 and 120 min. Blood glucose levels were measured by a glucometer. Plasma insulin was measured by ELISA with a sensitivity of 0.1 ng / ml and intra- and inter-assay precision of 1.9% and 7.6%, respectively.

[0101] Histology: On the day of sacrifice, fresh portions of liver were cut, embedded in OCT and snap frozen in liquid nitrogen. Biopsies were cut (5 μm) using a cryostat and slides were stored at -20°C until analysis.

[0102] Hematoxylin and eosin staining was performed to assess hepatic steatosis: slides were fixed in 95% ethanol for 10 min, stained with hematoxylin for 1 min, washed in distilled water, stained with eosin for 30 s, and cleared through two changes of absolute ethanol and two changes of xylene.

[0103] Oil red O was performed to evaluate intracellular lipid accumulation. Slides were fixed in 4% formalin overnight and stained with Oil red O solution for 1 h. Counterstaining was performed with hematoxylin solution.

[0104] Sirius red was used to identify liver fibrosis. Slides were fixed in 4% formalin for 10 min, stained with Direct red 80 for 1 h, washed in acidic water, and dehydrated in three changes of absolute ethanol. After a brief clearing in xylene, slides were mounted in resin medium. Images were taken under a light microscope. All reagents for histological analysis were obtained from Sigma-Aldrich.

[0105] Quantitative real-time PCR analysis Total RNA from human primary hepatocytes was extracted using the RNeasy Plus Mini Kit according to the instructions provided by the company. Small aliquots (3 μl) of the resulting total RNA were subjected to qualitative and quantitative controls using microdrops. Qualitative and quantitative assessment of individual samples was determined using dedicated software. Total RNA was counter-transcribed into cDNA using iScript RT. SYBR Green gene expression assays were performed using iQ™ SYBR Green Supermix and the CFX96 Touch Real-Time PCR Detection System according to the manufacturer's instructions. For this purpose, the following primer pairs were used: solute carrier family 13 member 5 (SLC13A5) (forward 5' AGAGGCAGTGGTAGTCGTGT 3' (SEQ ID NO:1) and reverse 5' TCCCCTTTAGCCCTTGTTCC 3' (SEQ ID NO:2)), diacylglycerol O-acyltransferase 1 (DGAT1) (forward 5' CTACAGGGACTGGTGGAATGC 3' (SEQ ID NO:3) and reverse 5' AGCAGGAGTAGGCCCCATAG 3' (SEQ ID NO:4)), fatty acid synthase (FASN) (forward 5' GAATCCGCACAGGCTACCAA 3' (SEQ ID NO:5) and reverse 5' CTGGGCTTCACCATCACCAT 3' (SEQ ID NO:6)), carnitine palmitoyltransferase 1A (CPT1A) (forward 5' TGGGGAAGAGACAGACACCA 3' (SEQ ID NO:7) and reverse 5' ATCGTGGTAGAGCCAGACCT 3' (SEQ ID NO:8)), and acetyl-CoA carboxylase (ACC1) (forward 5' CCACAACTACCATCACGCCT 3' (SEQ ID NO:9) and reverse 5' CAGGAACTCAGAAGCCCAGAA 3' (SEQ ID NO:10)).mRNA expression levels were normalized to β2-microglobulin (forward 5′ AGGACTGGTCTTTCTATCTCTTGT 3′ (SEQ ID NO: 11) and reverse 5′ ACCTCCATGATGCTGCTTACA 3′ (SEQ ID NO: 12)) and quantification of relative gene expression, expressed as a percentage of the associated baseline, was calculated using the 2-ΔCT (comparison threshold) method.

[0106] In vitro experiments Isolation of primary rat hepatocytes: Hepatocytes were isolated by a two-step collagenase perfusion method. Briefly, the inferior vena cava (IVC) was cannulated with a 24-gauge 3 / 4-inch angiocatheter and the portal vein was cut. The liver was perfused via the IVC with 100 mL of Liver Perfusion medium at 37°C, followed by 100 mL of collagenase type IV in Hank's balanced salt solution (HBSS, with calcium and magnesium, GIBCO). After digestion, the liver was dissected, cut into small pieces, and passed through a 100 μm strainer (Falcon). Hepatocytes were separated from non-parenchymal cells (NPCs) by low-speed centrifugation (50 g × 5 min) and further purified by Percoll gradient centrifugation (50% v / v, Sigma).

[0107] Nile Red: Cells were cultured for 24 h in DMEM containing 10% FBS. Before stimulation, cells were incubated overnight in serum-free DMEM. To assess lipid droplet accumulation, primary hepatocytes were stimulated for 24 h in complete DMEM medium supplemented with palmitic acid (0.4 mM) and with or without 1% (w / vol) dodecanedioic acid, sodium salt. After stimulation, cells were stained with Nile Red (100 ng / mL) for 45 min. Stained cells were used for immunofluorescence to quantify lipid droplet deposition. Nuclear staining was performed with DAPI, and images of lipid droplets were taken using a Nikon A1 RHD25 confocal microscope, and images were analyzed using NIS-Elements imaging software.

[0108] Preparation of palmitate treatment and conditioned medium: A 100 mM palmitate stock solution was prepared in 0.1 mM NaOH by heating at 70°C. A 10% (w / v) FFA-free BSA solution was prepared in ddH2O and kept in a water bath at 55°C. A 10 mM FFA / 1% BSA solution was obtained by complexing the appropriate amount of palmitate stock solution to 10% BSA at 55°C for an additional 30 minutes. The above solution was then cooled to 25°C, filter sterilized, and stored at -20°C until use.

[0109] Primary rat hepatocytes were grown in DMEM supplemented with palmitate (0.4 mM). FFA-free BSA-treated cells (0.4% w / v) served as control. After 24 h, CM was clarified by centrifugation at 6000 g to remove cellular debris, sterile filtered through a 0.45 μm pore size membrane filter, and stored in aliquots at -20°C until use.

[0110] Isolation of primary rat hepatic stellate cells: Primary hepatic stellate cells were isolated from Wistar rats. Rats were surgically dissected under anesthesia and the liver was perfused with 0.5 mM EGTA through the inferior vena cava (IVC), after which the portal vein was cut and the upper IVC was clamped. After 2 min, the liver was perfused with pronase solution for 5 min and then collagenase B solution for 7 min. The liver was removed and minced in pronase / collagenase / DNAse-I (10104159001, Roche) solution for 24 min, then passed through a 70 μm cell strainer. Liver cells were centrifuged and washed twice with Gey's balanced salt solution (GBSS), followed by density gradient separation of HSCs using Histodenz solution. After centrifugation, HSCs at the interface were collected. Cells were cultured in DMEM containing 10% FBS for 48 h. To induce fibrogenic activation and mitochondrial oxidative stress, primary HSCs were incubated with conditioned medium from steatotic primary hepatocytes for 3 days.

[0111] HSC activation was assessed by flow cytometry by evaluating alpha-smooth muscle actin (α-SMA) and collagen type I alpha 1 (COL1A1) protein expression. α-SMA and COL1A1 antibodies were obtained from Thermo Fisher scientific. Flow cytometry analysis was performed using CytoFlex and data were analyzed with Kaluza software.

[0112] Isolation of human primary hepatocytes: Tissue obtained during percutaneous liver biopsy was diced (<3 mm) and washed with HBSS to remove excess blood. The tissue was then transferred to a tube containing pre-warmed EGTA buffer (HBSS, 0.5 mM EGTA, 0.5% fatty acid-free bovine serum albumin (BSA)) and stirred (100 rpm) at 37 °C in a water bath with a shaking bed for 10 min. After three washes, the tissue was placed in pre-warmed digestion buffer (HBSS, 0.05% collagenase IV, 0.5% fatty acid-free BSA, 10 mM CaCl2) and stirred (100 rpm) at 37 °C in a water bath with a shaking bed for 30 min to remove residual blood and EGTA. The digested tissue was filtered through a 100 μm cell strainer, and the remaining tissue was digested again with fresh digestion buffer (20). The cell suspensions were pooled and centrifuged at 80 g for 5 min at 4 °C, and the supernatant was discarded. Cells were grown to confluence and used for citrate uptake assays.

[0113] In vitro citrate uptake: Primary human hepatocytes were incubated with or without dodecanedioic acid, sodium salt (0.1-0.25-0.5-1-1.5% w / vol) for 30 min. After the incubation step, citrate was added to a final concentration of 150 μM for 40 min. At the end of the stimulation, citrate uptake was assessed by a commercial citrate assay kit and data were analyzed on a Varioskan LUX multimode microplate reader.

[0114] In vitro palmitate stimulation: Primary human hepatocytes were stimulated with or without palmitate (0.4 mM) and dodecanedioic acid, sodium salt (1% w / vol) for 24 h. At the end of stimulation, de novo lipid biosynthesis, fatty acid beta-oxidation, and SLC13A5 gene expression were assessed by quantitative real-time PCR analysis.

[0115] Deuterium water for assessment of de novo lipid biosynthesis: Cells were incubated with or without palmitic acid (0.4 mM) and dodecanedioic acid, sodium salt (1% w / vol) for 24 h. Cell culture medium was enriched with 10% deuterium water to assess de novo lipid synthesis and gluconeogenesis. Cell extracts and medium samples were immediately frozen in nitrogen and stored at -80°C for further analysis.

[0116] Statistical analysis: Non-parametric tests were used because the number of animals was relatively small and many variables were not normally distributed. To compare the results between the two groups, we used the Mann-Whitney U test. Repeated measures ANOVA was used to compare blood glucose and insulin plasma levels during OGTT. Data are expressed as mean ± SEM unless otherwise stated. Statistical significance was set at P<0.05 (two-tailed).

[0117] result C12 administration prevents the development of insulin resistance and NASH: To test the hypothesis that C12 can prevent the development of diet-induced insulin resistance and NASH, we administered C12 1% (w / vol) in drinking water together with a high-fat-high-cholesterol diet for 4 weeks. Rats fed a high-fat-high-cholesterol diet without C12 administration were included as controls.

[0118] Compared to controls, rats treated with C12 showed decreased blood glucose and plasma insulin concentrations during an oral glucose tolerance test (Figure 26, panels A and B). Hepatic insulin resistance assessed by HOMA-IR was consistently decreased in the C12 group (Figure 26, panel C). Histological analysis of liver features of NASH showed that C12 treatment reduced hepatic steatosis, triglyceride deposition, and fibrosis (Figure 27, panels A-F). Taken together, these data suggest that C12 treatment could prevent diet-induced insulin resistance and NASH.

[0119] C12 Administration Reverses Insulin Resistance and NASH: To evaluate whether C12 can reverse the development of diet-induced insulin resistance and NASH, rats were fed a high-fat-high cholesterol diet for 9 weeks to develop insulin resistance and NASH. After 9 weeks of diet, C12 was administered for 4 weeks to evaluate the reversal of insulin resistance and NASH. Rats fed a high-fat-high cholesterol diet without C12 were included as controls. C12 treatment led to a decrease in blood glucose concentration and plasma insulin concentration during an oral glucose tolerance test (Figure 28, panels A and B) and reversed insulin resistance as assessed by HOMA-IR (Figure 28, panel C). Histological analysis revealed that C12 treatment counteracted the effects of diet-induced NASH by reducing hepatic steatosis, triglyceride accumulation, and fibrosis (Figure 29, panels A-F). These results indicated that C12 treatment could reverse both diet-induced insulin resistance and NASH.

[0120] C12 induces HSC apoptosis that contributes to the resolution of pulmonary fibrosis: Previous studies have demonstrated that reversal of liver fibrosis leads to a reduction in myofibroblasts, and that this reduction is associated with an increase in myofibroblast apoptosis. Furthermore, induction of myofibroblast apoptosis by pharmacological approaches promotes the resolution of fibrosis, suggesting that apoptosis contributes causally to this process. To investigate the effect of C12 treatment on HSCs, the main fibrogenic cell type in the liver, we used conditioned medium (CM) of steatotic rat primary hepatocytes to induce HSC activation with or without C12 1% (w / vol). Two days after isolation, rat primary HSCs were exposed to CM from palmitate-treated hepatocytes for 3 days and then incubated with C12 for 24 hours. Protein expression of two established markers of HSC activation, namely collagen type I (COLA1A) and alpha-smooth muscle actin (αSMA), was then determined by flow cytometric analysis. HSCs exposed to CM from steatotic hepatocytes in combination with C12 revealed lower expression of COLA1A and α-SMA compared to HSCs incubated without C12 (9.18% vs. 25.15%) (Figure 30, panels A and B). Next, we analyzed the effect of C12 on HSC apoptosis. HSCs treated with CM from steatotic hepatocytes together with C12 showed increased cell death assessed by flow cytometry using propidium iodide staining (16.16% vs. 8.39%) (Figure 30, panels C and D). Concomitantly, compared to the control group, rats treated with C12 showed decreased expression of genes associated with fibrosis (αSMA, COLA1A, and TGFβ) (Figure 30, panel E).

[0121] C12 inhibits citrate uptake and reduces gene expression of the citrate transporter SLC13A5: To test the hypothesis that C12 can inhibit citrate uptake, human primary hepatocytes were incubated with or without C12 (0.1-1.5% v / w) and a fixed concentration of citrate (150 μM). Compared to untreated cells, cells treated with 1 and 1.5% (v / w) C12 showed a significant decrease in citrate uptake (Figure 31, panel A). Furthermore, compared to cells treated with palmitate (0.4 mM) alone, human hepatocytes stimulated with C12 1% (v / w) in combination with palmitate (0.4 mM) showed a significant decrease in gene expression of the citrate transporter SLC13A5 (Figure 31, panel B).

[0122] C12 reduces de novo lipid biosynthesis and increases fatty acid oxidation in vitro and in vivo: To test the hypothesis that C12 can affect de novo lipid biosynthesis and fatty acid beta-oxidation, human primary hepatocytes were stimulated with palmitic acid (0.4 mM) in the presence or absence of C12 1% (v / w). We observed a decrease in lipid droplet deposition in human primary hepatocytes stimulated with C12 1% (v / w) in combination with palmitic acid (0.4 mM) compared to cells treated with palmitic acid (0.4 mM) alone (Figure 32, panels A and B). Concomitantly, we observed a significant reduction in three key enzymes involved in de novo lipid biosynthesis (ACC1, DGAT and FASN) and a significant increase in the key enzyme involved in fatty acid beta-oxidation (CPT1A) in primary human hepatocytes treated with C12 1% (v / w) and palmitic acid (0.4 mM) compared to cells treated with palmitic acid (0.4 mM) alone (Figure 32, panels C and D). Similar results were also observed in our in vivo experiments. Indeed, compared to the control group, rats treated with C12 showed a decrease in the key enzymes involved in de novo lipid biosynthesis (ACC1, DGAT and FASN) and a significant increase in the key enzyme in fatty acid beta-oxidation (CPT1A) (Figure 33, panels A and B). Furthermore, compared to the control group, rats treated with C12 showed a decrease in the gene expression of the citrate transporter SLC13A5 (Figure 33, panel C). Data from in vivo studies 1 and 2 were pooled together.

[0123] In some embodiments, numbers expressing amounts of ingredients, properties, such as concentrations, reaction conditions, etc., used to describe and claim certain embodiments of the present invention should be understood to be optionally modified by the term "about". Thus, in some embodiments, the numerical parameters set forth in the specification and appended claims are approximations that may vary depending on the desired properties sought to be obtained by a particular embodiment. The recitation of ranges of values ​​herein is only intended to serve as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated herein as if it were individually set forth herein.

[0124] As used herein, the term "administering" a pharmaceutical composition or drug refers to both direct and indirect administration of the pharmaceutical composition or drug, where direct administration of the pharmaceutical composition or drug is typically performed by a medical practitioner (e.g., a doctor, a nurse, etc.), and indirect administration includes providing or making the pharmaceutical composition or drug available to a medical practitioner for direct administration (e.g., by injection, infusion, oral delivery, topical delivery, etc.). It should be further noted that the term "prognosing" or "predicting" a condition, susceptibility to development of a disease, or response to an intended treatment is meant to cover the act or forecast of (but not treatment or diagnosis of) a condition, susceptibility, and / or response, including the rate of progression, rate of improvement, and / or duration of a subject's condition.

[0125] All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "such as") provided in connection with certain embodiments herein is intended merely to further clarify the invention and does not limit the scope of the invention as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0126] As used in this description and throughout the claims which follow, the meanings of "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Also, as used in this description, the meaning of "in" includes "in" and "on," unless the context clearly dictates otherwise. Also, as used herein, and unless the context clearly dictates otherwise, the term "coupled to" is intended to include both direct coupling (wherein the two elements that are coupled to each other are in contact with each other) and indirect coupling (wherein at least one additional element is interposed between the two elements). Thus, the terms "coupled to" and "coupled with" are used interchangeably.

[0127] It should be apparent to one skilled in the art that many more modifications are possible without departing from the inventive concept herein, beyond what has already been described. Thus, the subject matter of the present invention should not be limited except as by the scope of the appended claims. Moreover, in interpreting both the specification and the claims, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms "comprises" and "comprising" should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the mentioned element, component, or step may be present, utilized, or combined with other elements, components, or steps not expressly mentioned. When the specification or claims refer to at least one of anything selected from the group consisting of A, B, C... and N, the text should be interpreted as requiring only one element from the group, not A plus N, or B plus N, etc.

Claims

1. 1. A hepatoprotective composition comprising a nutritionally or pharma- ceutically acceptable carrier in combination with a medium chain dicarboxylic acid, A composition, wherein a therapeutically effective unit dose of a medium chain dicarboxylic acid provides 5% or less of the normal daily caloric intake of a mammal.

2. 10. The composition of claim 1 formulated for oral administration.

3. 3. The composition of claim 2, formulated as a ready-to-use beverage or as a solid supplement or powder.

4. 4. The composition of claim 1, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

5. 5. The composition of any one of claims 1 to 4, wherein the therapeutically effective unit dose provides no more than 3% of the normal daily caloric intake of a mammal.

6. 6. The composition of any one of claims 1 to 5, wherein the therapeutically effective unit dose provides 2% or less of the normal daily caloric intake of a mammal.

7. 7. The composition of any one of claims 1 to 6, wherein the therapeutically effective unit dose provides 1% or less of the normal daily caloric intake of a mammal.

8. 8. The composition of claim 1, wherein the therapeutically effective unit dose comprises 5 g or less of medium chain dicarboxylic acid.

9. 9. The composition of any one of claims 1 to 8, wherein the therapeutically effective unit dose comprises 3 g or less of medium chain dicarboxylic acid.

10. 10. The composition of any one of claims 1 to 9, wherein the therapeutically effective unit dose comprises 1 g or less of medium chain dicarboxylic acid.

11. 11. The composition of any one of claims 1 to 10, further comprising an additional hepatoprotectant.

12. 12. The composition of claim 11, wherein the additional hepatoprotectant is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.

13. 13. The composition of any one of claims 1 to 12, wherein a therapeutically effective dose reduces the risk or progression of liver inflammation, hepatic steatosis, and / or liver fibrosis in nonalcoholic steatohepatitis (NASH).

14. 14. The composition of any one of claims 1 to 13, wherein a therapeutically effective dose reduces postprandial glucose spikes and / or postprandial total blood glucose AUC.

15. 15. The composition of any one of claims 1 to 14, wherein a therapeutically effective dose stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity, and / or reduces DNA damage.

16. 1. A method of reducing the risk or progression of liver inflammation, hepatic steatosis, and / or liver fibrosis in nonalcoholic steatohepatitis (NASH) in an individual, comprising: Administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof Including, A method wherein the therapeutically effective dose provides 5% or less of an individual's normal daily caloric intake.

17. 17. The method of claim 16, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

18. 18. The method of any one of claims 16 to 17, wherein the individual is a human.

19. 19. The method of any one of claims 16 to 18, wherein the therapeutically effective dose is administered orally.

20. 20. The method of any one of claims 16 to 19, wherein the therapeutically effective dose provides no more than 3% of the normal daily caloric intake of a mammal.

21. 20. The method of any one of claims 16 to 19, wherein the therapeutically effective dose provides 1% or less of the normal daily caloric intake of a mammal.

22. 20. The method of any one of claims 16 to 19, wherein the therapeutically effective dose comprises 5 g or less of medium chain dicarboxylic acid.

23. 20. The method of any one of claims 16 to 19, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

24. 25. The method of any one of claims 16 to 24, wherein the composition further comprises an additional hepatoprotectant.

25. 25. The method of claim 24, wherein the additional hepatoprotectant is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.

26. 26. The method of any one of claims 16 to 25, wherein administration of a therapeutically effective dose reduces postprandial glucose spikes and / or postprandial total blood glucose AUC.

27. 27. The method of any one of claims 16 to 26, wherein administration of a therapeutically effective dose stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity, and / or reduces DNA damage.

28. 1. A method for regulating blood glucose without affecting body weight, comprising: Administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof Including, a therapeutically effective dose providing 5% or less of the normal daily caloric intake of a mammal; The method, wherein regulating blood glucose is reducing postprandial glucose spikes and / or postprandial total blood glucose AUC.

29. 30. The method of claim 28, wherein the medium chain dicarboxylic acid is formulated for oral administration.

30. 29. The method of claim 28, wherein the medium chain dicarboxylic acid is formulated as a ready-to-use beverage or as a solid supplement or powder.

31. 31. The method of any one of claims 28 to 30, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

32. 32. The method of any one of claims 28 to 31, wherein the therapeutically effective dose provides no more than 3% of the normal daily caloric intake of a mammal.

33. 32. The method of any one of claims 28 to 31, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

34. 34. The method of any one of claims 28 to 33, wherein administration also stimulates mitochondrial biogenesis, increases SIRT levels, increases NAMPT levels, increases intracellular NAD+ levels, maintains antioxidant capacity, and / or reduces DNA damage.

35. 35. The method of any one of claims 28 to 34, wherein the administration also reduces the risk or progression of liver fibrosis in nonalcoholic steatohepatitis (NASH).

36. 36. The method of any one of claims 28 to 35, wherein the blood glucose regulation is a reduction in postprandial glucose spikes and postprandial total blood glucose AUC.

37. 1. A method for increasing the resilience and / or longevity of a cell, comprising: Exposing the cells to a medium-chain dicarboxylic acid for a time and in an amount effective to stimulate mitochondrial biogenesis, increase SIRT levels, increase NAMPT levels, increase intracellular NAD+, maintain antioxidant capacity, and / or reduce DNA damage. A method comprising:

38. 38. The method of claim 37, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

39. 39. The method of any one of claims 37 to 38, wherein the cells are exposed in vivo following oral administration of the medium chain dicarboxylic acid.

40. 40. The method of any one of claims 37 to 39, wherein the cells are exposed for at least 6 hours.

41. 1. A method for preventing or reducing the severity of non-alcoholic steatohepatitis (NASH) in an individual, comprising: Administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof Including, The method, wherein the therapeutically effective dose prevents or reduces the severity of nonalcoholic steatohepatitis (NASH) in the individual.

42. 42. The method of claim 41, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof.

43. 43. The method of any one of claims 41 to 42, wherein the individual is a human.

44. 44. The method of any one of claims 41 to 43, wherein the therapeutically effective dose is administered orally.

45. 45. The method of any one of claims 41 to 44, wherein the therapeutically effective dose provides 5% or less of an individual's normal daily caloric intake.

46. 45. The method of any one of claims 41 to 44, wherein the therapeutically effective dose provides no more than 3% of an individual's normal daily caloric intake.

47. 45. The method of any one of claims 41 to 44, wherein the therapeutically effective dose comprises 5 g or less of medium chain dicarboxylic acid.

48. 45. The method of any one of claims 41 to 44, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

49. 49. The method of any one of claims 41 to 48, wherein the therapeutically effective dose further reduces the risk or progression of liver inflammation and / or liver fibrosis.

50. 49. The method of any one of claims 41 to 48, wherein the therapeutically effective dose further reduces insulin resistance.

51. 1. A method of treating nonalcoholic steatohepatitis (NASH) in an individual, comprising: administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof; A method, wherein the therapeutically effective dose reduces lipid deposits in the liver of an individual diagnosed with or suspected of having nonalcoholic steatohepatitis (NASH).

52. 52. The method of claim 51, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof.

53. 53. The method of any one of claims 51 to 52, wherein the individual is a human.

54. 54. The method of any one of claims 51 to 53, wherein the therapeutically effective dose is administered orally.

55. 55. The method of any one of claims 51 to 54, wherein the therapeutically effective dose provides no more than 5% of an individual's normal daily caloric intake.

56. 55. The method of any one of claims 51 to 54, wherein the therapeutically effective dose provides no more than 3% of an individual's normal daily caloric intake.

57. 55. The method of any one of claims 51 to 54, wherein the therapeutically effective dose comprises 5 g or less of medium chain dicarboxylic acid.

58. 55. The method of any one of claims 51 to 54, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

59. 59. The method of any one of claims 51 to 58, wherein the therapeutically effective dose further reduces the risk or progression of liver inflammation and / or liver fibrosis.

60. 59. The method of any one of claims 51 to 58, wherein the therapeutically effective dose further reduces insulin resistance.

61. 1. A hepatoprotective composition comprising a nutritionally or pharma- ceutically acceptable carrier in combination with a medium chain dicarboxylic acid, A composition formulated for oral administration that is therapeutically effective in preventing or treating non-alcoholic steatohepatitis (NASH) in an individual ingesting the composition.

62. 62. The composition of claim 61, formulated as a solid.

63. 62. The composition of claim 61, formulated to provide a daily dosage of 0.05 g to 5.0 g of medium chain dicarboxylic acid.

64. 65. The composition of any one of claims 61 to 64, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof.

65. 65. The composition of any one of claims 61 to 64, optionally further comprising at least one additional hepatoprotectant selected from the group consisting of silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.

66. 1. A method of reversing liver inflammation, hepatic steatosis, and / or liver fibrosis in nonalcoholic steatohepatitis (NASH) in an individual, comprising: Administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof Including, A method wherein the therapeutically effective dose provides 5% or less of an individual's normal daily caloric intake.

67. 67. The method of claim 66, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid.

68. 68. The method of any one of claims 66 to 67, wherein the individual is a human.

69. 69. The method of any one of claims 66 to 68, wherein the therapeutically effective dose is administered orally.

70. 70. The method of any one of claims 66 to 69, wherein the therapeutically effective dose provides no more than 3% of the normal daily caloric intake of a mammal.

71. 70. The method of any one of claims 66 to 69, wherein the therapeutically effective dose provides 1% or less of the normal daily caloric intake of a mammal.

72. 70. The method of any one of claims 66 to 69, wherein the therapeutically effective dose comprises 5 g or less of medium chain dicarboxylic acid.

73. 70. The method of any one of claims 66 to 69, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

74. 74. The method of any one of claims 66 to 73, wherein the composition further comprises an additional hepatoprotectant.

75. 75. The method of claim 74, wherein the additional hepatoprotectant is silymarin, milk thistle extract, taurine, guarana, ginseng, tauroursodeoxycholic acid, leucine, erythritol, pyruvate, pyruvic acid derivatives, selenium, N-acetylcysteine, glutamine, superoxide dismutase, glutathione, theacrine, and / or methylliberin.

76. 1. A method for preventing hepatocellular carcinoma, comprising: Administering a therapeutically effective dose of a medium chain dicarboxylic acid to an individual in need thereof A method comprising:

77. 77. The method of claim 76, wherein the medium chain dicarboxylic acid is dodecanedicarboxylic acid or a pharma- ceutically or nutraceutical acceptable salt thereof.

78. 78. The method of any one of claims 76 to 77, wherein the individual is a human.

79. 79. The method of claim 78, wherein the individual has nonalcoholic steatohepatitis (NASH) or nonalcoholic fatty liver disease (NAFLD).

80. 80. The method of any one of claims 76 to 79, wherein the therapeutically effective dose is administered orally.

81. 81. The method of any one of claims 76 to 80, wherein the therapeutically effective dose provides no more than 5% of an individual's normal daily caloric intake.

82. 81. The method of any one of claims 76 to 80, wherein the therapeutically effective dose provides no more than 3% of an individual's normal daily caloric intake.

83. 81. The method of any one of claims 76 to 80, wherein the therapeutically effective dose comprises 5 g or less of medium chain dicarboxylic acid.

84. 81. The method of any one of claims 76 to 80, wherein the therapeutically effective dose comprises 3 g or less of medium chain dicarboxylic acid.

85. 85. The method of any one of claims 76 to 84, wherein the therapeutically effective dose further reduces chronic subacute inflammation.

Images