Genetically recombinant bacteria expressing aspartic acid dehydrogenase, and a method for producing vitamin B5 by fermentation

JP2025516089A5Pending Publication Date: 2025-12-12INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024553524
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-03-07
Filing Date
2023-02-17
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

The existing chemical synthesis method for producing vitamin B5 is highly polluting, generating toxic waste and posing environmental challenges, while microbial fermentation methods face low fermentation yields due to complex metabolic pathways.

Method used

The use of a genetically recombinant bacterium expressing aspartate dehydrogenase (aspDH) from Delftia sp. Csl-4, combined with the overexpression of three L-aspartic acid synthesis pathways, to enhance the fermentation yield of vitamin B5.

Benefits of technology

This approach significantly improves the fermentation yield of vitamin B5 compared to traditional methods, while also offering a more environmentally friendly production process by utilizing renewable raw materials and reducing waste treatment challenges.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This application relates to the technical field of microorganisms, specifically, to Escherichia coli expressing aspartate dehydrogenase aspDH and a method for producing vitamin B5 by fermentation. The overexpression of the aspDH gene shows the best results by comparing the fermentation yields of VB5. Compared with the highly polluting chemical methods for the production of vitamin B5, the biological method for the production of vitamin B5 in this application has the advantages of renewable raw materials, easy treatment and resource utilization of waste residues, waste water, and waste gas, and therefore can be used in the actual industrial production of vitamin B5, which has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of microorganisms, and specifically, to a genetically recombinant bacterium expressing aspartate dehydrogenase and a method for producing vitamin B5 by fermentation.

Background Art

[0002] Vitamin B5 (VB5), also known as D-pantothenic acid, is a water-soluble vitamin and a component of coenzyme A and acyl carrier protein. As a cofactor for 70 enzymes, vitamin B5 is involved in the metabolism of sugars, fats, proteins, and energy, and plays an important role in physiological metabolism regulation. VB5 is mainly used in animal feed additives, food additives, and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of the application technology field, the market demand for VB5 still shows a steady increasing trend.

[0003] China is the largest producer and exporter of VB5, and the industrial production method of VB5 is chemical synthesis. Enterprises basically synthesize DL-pantolactone using the isobutyraldehyde-formaldehyde-hydrogen cyanide method. DL-pantolactone is further separated by chemical or enzymatic methods to obtain L-pantolactone. Finally, β-alanine produced by using acrylonitrile as a raw material and L-pantolactone synthesize VB5. The main raw materials for the chemical synthesis of VB5 are flammable, explosive, and highly toxic, and cyanide wastewater will be generated in the production process. The wastewater is difficult to treat, and as a result, VB5 becomes a highly polluting industry.

[0004] In recent years, China's economic development has entered a new normal of green environmental protection, and the impact of environmental protection on the VB5 industry is gradually emerging. Under large-scale and high-intensity environmental protection and management, the production of highly polluting VB5 enterprises is limited or even stopped, the market supply is insufficient, and the price is soaring. This restricts the sound development of downstream feed, food, and pharmaceutical industries. Such a supply and demand situation will continue for a long time until the highly polluting VB5 production technology is significantly improved. Therefore, the innovation of VB5 green manufacturing technology is urgent.

[0005] The microbial fermentation method for VB5 production not only uses renewable glucose as a raw material, but also the waste residues, waste water, and waste gas formed in the production process are easy to treat and utilize for resource recovery, thereby effectively solving the problem of high pollution in the VB5 industry. The metabolic pathway of VB5 synthesis by microorganisms using glucose has a complex control mechanism, and the fermentation yield is extremely low. β-alanine is used together with D-pantothenic acid as a C3 substrate to synthesize VB5. In order to increase the fermentation yield of VB5, it is necessary to externally add a large amount of β-alanine to the fermentation medium (Non-Patent Documents 1-3). β-alanine can be produced by the decarboxylation of L-aspartic acid. Therefore, enhancing the biosynthesis of aspartic acid is expected to increase the yield of VB5 produced by fermentation.

Prior Art Documents

Non-Patent Documents

[0006]

Non-Patent Document 1

Non-Patent Document 2

[0007] In view of this, in the present application, it has been found that three enzymes are each overexpressed in Escherichia coli for producing VB5 by means of fermentation, and AspDH is beneficial for improving the fermentation yield of VB5 compared to AspC and AspA. [Means for Solving the Problems]

[0008] To achieve the object of the present invention, the present application provides the following technical solutions.

[0009] In a first aspect, the present application provides the use of enhanced expression of the aspartate dehydrogenase gene aspDH in the production of vitamin B5, preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4.

[0010] In some embodiments of the present application, the aspartate dehydrogenase gene aspDH has the following: (I) a nucleotide sequence shown as SEQ ID NO: 56, or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I), and having the same or similar function as the nucleotide sequence shown as (I), or A nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (III), (I), or (II).

[0011] In some embodiments of the present application, it further includes the following: (1) Insert a strong promoter and / or a strong RBS onto the cadA gene, where the strong promoter is PgapA and the strong RBS is BCD2. Preferably, BCD2 has the following: (A) The nucleotide sequence shown as SEQ ID NO: 2, or (B) A nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B). And / or (2) Express the ilvGM gene derived from Escherichia coli BL21. And / or (3) Express the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis, and / or Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has the following: (A) The nucleotide sequence shown as SEQ ID NO: 1, or (B) A nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B), and / or (4) Increase the copy number of the panB gene, the panC gene, and / or the panE gene.

[0012] In a second aspect, the present application provides an expression vector comprising the aspartate dehydrogenase aspDH gene.

[0013] Preferably, the aspartate dehydrogenase aspDH gene is derived from Delftia sp. Csl-4.

[0014] Preferably, the aspartate dehydrogenase aspDH gene has the following: (I) a nucleotide sequence shown as SEQ ID NO: 56, or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I), and having the same or similar function as the nucleotide sequence shown as (I), or (III) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (I) or (II).

[0015] In some embodiments of the present application, the expression vector further comprises the following: (I) a strong promoter and / or a strong RBS, wherein the strong promoter is PgapA and the strong RBS is BCD2, Preferably, BCD2 has the following: (A) a nucleotide sequence shown as SEQ ID NO: 2, or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B), and / or (II) the ilvGM gene derived from Escherichia coli BL21, and / or (III) The L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis, and / or Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has the following: (A) The nucleotide sequence shown as SEQ ID NO: 1, or (B) A nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B), and / or (IV) The panB gene, panC gene, and / or panE gene with an increased copy number.

[0016] In a third aspect, the present application provides a host, where the host expresses the aspartate dehydrogenase gene aspDH.

[0017] Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4.

[0018] Preferably, the aspartate dehydrogenase gene aspDH has the following: (I) The nucleotide sequence shown as SEQ ID NO: 56, or (II) A nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I), and having the same or similar function as the nucleotide sequence shown as (I), or (III) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (I) or (II).

[0019] In some embodiments of the present application, the host further includes the following: (I) A strong promoter and / or a strong RBS, wherein the strong promoter is PgapA and the strong RBS is BCD2, preferably, BCD2 has the following: (A) a nucleotide sequence shown as SEQ ID NO: 2, or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B), and / or (II) the ilvGM gene derived from Escherichia coli BL21, and / or (III) the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis, and / or preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has the following: (A) a nucleotide sequence shown as SEQ ID NO: 1, or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A), and having the same or similar function as the nucleotide sequence shown as (A), or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B), and / or (IV) the panB gene, panC gene, and / or panE gene with an increased copy number.

[0020] In some embodiments of the present application, the host is transfected or transformed by an expression vector according to claim 4 or 5. Preferably, the host is derived from Escherichia coli, more preferably, the host is derived from Escherichia coli K12, and even more preferably, the host is derived from Escherichia coli K12 MG1655 strain.

[0021] In a fourth aspect, the present application provides the use of an expression vector or a host in the production of vitamin B5.

[0022] In a fifth aspect, the present application provides a method for the production of vitamin B5, wherein the host is used as a fermentation strain, fermented, the fermentation broth is collected, and the supernatant is centrifuged to obtain vitamin B5.

[0023] The present application discloses Escherichia coli expressing the aspartate dehydrogenase gene aspDH and a method for producing vitamin B5 (VB5) by fermentation. The present application enhances three L-aspartic acid synthesis pathways in VB5 gene recombinant bacteria, respectively. The three L-aspartic acid synthesis pathways are, respectively, that aspartate aminotransferase encoded by the aspC gene transfers the amino group of glutamic acid to oxaloacetic acid to produce L-aspartic acid and ketoglutaric acid, that aspartate ammonia-lyase encoded by the aspA gene catalyzes the production of aspartic acid from ammonium and fumaric acid, and that aspartate dehydrogenase encoded by the aspDH gene catalyzes the synthesis of aspartic acid from oxaloacetic acid and ammonium. By comparing the fermentation yields of VB5, the overexpression of the aspDH gene shows the best effect. Compared with the highly polluting chemical method for the production of vitamin B5, the biological method of the present application for the production of vitamin B5 has advantages such as renewable raw materials, easy treatment and resource utilization of waste residues, waste water, and waste gas. Therefore, it can be used in the actual industrial production of vitamin B5 and has important application value.

Embodiments for Carrying out the Invention

[0024] This application discloses a genetically recombinant bacterium expressing aspartate dehydrogenase and a method for producing vitamin B5 by fermentation. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art, and all of them are considered to be included in this application. The methods and uses of this application are described by preferred embodiments, and those in charge can, obviously, without departing from the content, spirit, and scope of this application, modify or appropriately change and combine the methods and uses described in this specification to achieve and utilize the technology of this application.

[0025] There are two pathways for producing aspartic acid in Escherichia coli. One pathway is that aspartate aminotransferase encoded by the aspC gene transfers the amino group of glutamic acid to oxaloacetic acid to produce L-aspartic acid and ketoglutaric acid. The other is that aspartate ammonia-lyase encoded by the aspA gene catalyzes the production of aspartic acid from ammonium and fumaric acid. In addition, aspartate dehydrogenase (AspDH), which catalyzes the synthesis of aspartic acid from oxaloacetic acid and ammonium, has been found in some archaea. In this application, the above three enzymes are overexpressed respectively in Escherichia coli for producing VB5 by fermentation, and it is found that AspDH is more advantageous than AspC and AspA in improving the fermentation yield of VB5.

[0026] In order to break through the metabolic bottleneck of the efficient synthesis of VB5, the inventors compared three pathways for improving the synthesis of aspartic acid and found that heterologous aspartic acid dehydration (encoded by the aspDH gene) is more suitable for its own aspartic acid amino group transfer pathway (encoded by the aspC gene) and aspartic acid ammonia cleavage pathway (encoded by the aspA gene).

[0027] Aspartic acid dehydrogenase (AspDH) catalyzes the reversible reaction of oxaloacetic acid with ammonium and NAD(P)H to form aspartic acid, water, and NAD(P) + and is produced by one or more of the following microorganisms: Pseudomonas aeruginosa, Klebsiella pneumoniae, Serratia proteamaculans, Thermotoga maritima, Chromohalobacter salexigens, Acinetobacter baumannii, Delftia sp. Csl-4, Ochrobactrum anthropi, Caulobacter sp., Methanohalophilus mahii, Dinoroseobacter shibae, Methanosphaerula palustris, and Methanobrevibacter ruminantium, etc.

[0028] With respect to the expressed aspartic acid dehydrogenase, the present application controls the expression of the aspDH gene using a strong promoter. The promoter can be a strong promoter and can be the following promoter or variants thereof: L promoter, trc promoter, T5 promoter, lac promoter, tac promoter, T7 promoter, or gapA promoter. In addition, the present application uses a more active RBS sequence to control the translation initiation of the aspDH gene.

[0029] This application incorporates the aspDH gene controlled by the above high-intensity translation initiation and transcription initiation into the Escherichia coli chromosome for VB5 production by fermentation methods, thereby realizing the expression of foreign genes. The integration site is the cadA gene, which encodes lysine decarboxylase and theoretically has no effect on VB5 biosynthesis.

[0030] The aspA, aspC, and aspDH genes were respectively incorporated into the same cadA gene locus on the Escherichia coli chromosome, and VB5 was produced there by fermentation methods, and the transcription was controlled using the same promoter, and the effects of overexpressing the aspA, aspC, and aspDH genes on VB5 synthesis were compared.

[0031] The Escherichia coli described in this application for VB5 production by fermentation also overexpresses the panB, panC, and panE genes of the VB5 terminal synthesis pathway. The panB gene of Escherichia coli encodes ketopantoic acid hydroxymethyltransferase, which catalyzes the addition of a methyl group to the substrate α-ketoisovaleric acid to form ketopantoic acid. Ketopantoic acid is reduced to pantothenic acid by ketopantoic acid reductase encoded by the panE gene. Pantothenate synthetase encoded by the panC gene further catalyzes the condensation of pantothenic acid and β-alanine to form VB5.

[0032] The Escherichia coli used in this application is the K12MG1655 strain, which has an inactivating mutation of the ilvG gene. Therefore, this application introduces the active ilvG gene of Escherichia coli BL21, which improves the supply of the VB5 precursor acetolactate synthesis. In this application, the ilvG + M gene is inserted into the chromosome of Escherichia coli K12MG1655, and the strong trc promoter is used to control the transcription initiation of ilvG + M, and the terminator Ter is used to control the transcription termination of ilvG + M. The ilvG on the chromosome +The insertion site of the M gene is the coding sequence of the avtA gene, which leads to the inactivation of AvtA, weakens the synthesis of valine, thereby weakening the competitive pathway of VB5 and promoting VB5 biosynthesis.

[0033] The panD gene derived from Bacillus licheniformis was also integrated onto the avtA gene of the recombinant bacterium. The same strong promoters PPL and BCD2 were used to control transcription and translation initiation, respectively.

[0034] A method for producing VB5 by fermentation, the culture medium contains a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutritional factors. As the carbon source, for example, sugars such as glucose, lactose, and galactose can be used. As the inorganic nitrogen source, for example, inorganic nitrogen sources such as aqueous ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used. As the organic nitrogen source, for example, organic nitrogen sources such as corn syrup, hydrolyzed soybean meal, hair powder, yeast extract, and peptone can be used. The inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium, and other ions.

[0035] The experimental methods in the following embodiments are conventional methods unless otherwise specified. The experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following embodiments were set up in triplicate and the results were averaged. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art and commercially available equipment and reagents. Refer to "Molecular Cloning Experiment Guide (3rd Edition)" (Science Press), "Microbiology Experiment (4th Edition)" (Higher Education Press), and the manuals of the manufacturers of the corresponding equipment and reagents.

[0036] If the sequences in this specification do not match the sequences in the sequence listing, the sequences in this specification shall prevail.

[0037] Escherichia coli K12 MG1655: ATCC number 700926. pACYC184 plasmid: NEB, catalog number E4152S. Plasmid pcas9 was purchased from Addgene: catalog number 62225. Plasmid pTargetF was purchased from Addgene: catalog number 62226.

[0038] The present application will be further illustrated below in conjunction with embodiments.

Example

[0039] Embodiment 1 Detection method The yield of VB5 in the fermentation broth was quantitatively determined using HPLC. The specific method is as follows. The supernatant of the fermentation broth was diluted to an appropriate concentration with pure water and filtered through a 0.22 μm membrane. The chromatography column was Agilent ZORBAX-SB-Aq, 4.6 × 250 mm at a column temperature of 30 °C, the detection wavelength was 210 nm, the flow rate of the mobile phase was 1 mL / min, and the mobile phase was 3.12 g / L of NaH 2 PO 4 -2H 2 O, and the pH was adjusted to 2.2 with phosphoric acid. The standard curve of the concentration and absorbance of 0.1 - 0.5 g / L calcium pantothenate was determined using calcium pantothenate (VB5) purchased from Sigma as a standard.

[0040] Embodiment 2 Construction of genetically engineered bacteria for the fermentative production of VB5 The nucleotide sequence amplified by PCR is shown in SEQ ID NO: 3. Using P1 and P2 as primers and the genomic DNA of wild-type Escherichia coli strain K12MG1655 as a template, high-fidelity polymerase KAPA-HiFi™ HotStar was used. Here, 10 nt to 45 nt is the promoter trc, 74 nt to 868 nt is the coding sequence of the panB gene, and 880 nt to 1731 nt is the coding sequence of the panC gene. Primer P1 was designed to introduce a strong promoter trc, and primers P1 and P2 were designed to introduce BamHI and SphI restriction endonuclease sites at the 5' ends of primers P1 and P2, respectively. The PCR program was as follows: denaturation at 98 °C for 30 seconds, annealing at 65 °C for 15 seconds, extension at 72 °C for 90 seconds, for 26 cycles. A P trc -panBC gene fragment of about 1800 bp was obtained.

[0041] [Chemical formula]

[0042] The P amplified by PCR trc -panBC product was identified and recovered by gel electrophoresis and then double-digested with BamHI and SphI. The pACYC184 plasmid was simultaneously double-digested with the restriction endonucleases BamHI and SphI. The double-digested P trc -panBC and pACYC184 plasmid were recovered by gel electrophoresis, ligated with T4 ligase, and the ligation product was chemically transformed into Escherichia coli DH5α competent cells. These were cultured for recovery for 1 hour and plated on chloramphenicol plates. The plated plates were placed in a 37 °C incubator for 12 hours, single colonies were picked for subculture, the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBC.

[0043] Using the genome of Escherichia coli K12MG1655 as a template, the sequence obtained by PCR amplification using P3 and P4 as primers was designated as SEQ ID NO: 4. Herein, 11 nt to 45 nt is the promoter of PJ23119, 66 nt to 977 nt is the coding sequence of the panE gene, and 988 nt to 1731 nt is the terminator sequence. The promoter PJ23119 was designed on the amplification primer P3, the sequence of the terminator L3S2P56 was designed on the primer P4, and SphI and BsaBI restriction endonuclease sites were designed at the 5'-ends of the primers P3 and P4, respectively. The PJ23119-panE product obtained by amplification was identified using the above-described PCR reaction conditions, recovered by gel electrophoresis, and then digested with SphI and BsaBI. At the same time, the pACYC184-Ptrc-panBC plasmid was double-digested with SphI and BsaBI. The plasmid PJ23119-panE and pACYC184-Ptrc-panBC after enzymatic digestion were recovered by gel electrophoresis. After ligation using T4 ligase, the ligation product was chemically transformed into Escherichia coli DH5α competent cells. These were cultured for recovery for 1 hour and plated on chloramphenicol plates. The plated plates were placed in a 37°C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBCE. Thereby, a recombinant plasmid overexpressing the vitamin B5 terminal synthesis pathway gene was obtained.

[0044]

Chem.

[0045] Use of the previously reported CRISPR-Cas9 gene editing system containing the pCas9 and pTargetF vectors (by Y. Jiang, B. Chen, C.L. Duan, B.B. Sun, J.J. Yang, and S. Yang (2015) "Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system", Applied and Environmental Microbiology, Vol. 81, p. 2506-2514) The pTargetF vector was mutated with primers P5 and P6 designed according to the kit instructions using the Q5® Site-Directed Mutagenesis Kit (product number E0552S) from NEB. The mutated N20 sequence is CTTTTCCAAGC TGGGTCTACC, targeting the avtA gene. The mutated pTargetF was designated pTargetFavtA.

[0046]

Chemical formula

[0047] The licheniformis aspartate α-decarboxylase gene panD (shown in SEQ ID NO: 1) derived from Bacillus licheniformis was synthesized by a gene synthesis company. During the customization and synthesis of the above panD gene sequence, the XbaI and HindIII restriction endonuclease sequences were removed by synonymous codon substitution. When customizing and synthesizing the above panD gene sequence, the same BCD2 sequence (shown in SEQ ID NO: 2) was simultaneously synthesized in front of each panD sequence, and in the meantime, XbaI and HindIII restriction enzyme cleavage sites were added to both ends of the BCD2-panD sequence. The synthesized sequence was ligated into a vector. The above synthesized BCD2-panD vector and pET28a(+) plasmid were double digested with restriction endonucleases XbaI and HindIII. The gene fragment of BCD2-panD and the linearized vector segment after enzyme digestion were recovered by gel electrophoresis, and the two fragments were further ligated using T4 ligase, and the ligation product was transformed into Escherichia coli DH5α competent cells. Using an LB plate containing 50 mg / L kanamycin, transformants containing the recombinant plasmid were screened. After amplifying the transformants, the plasmid was extracted and sent for sequencing to confirm that the correct plasmid pET28a-BCD2-panDBl was obtained.

[0048] The upstream sequence of the avtA gene was amplified using primers P7 and P8, the PL promoter was amplified using primers P9 and P10, and the BCD2-panDBl-Ter gene fragment was obtained by amplification using primers P11 and P12 with pET28a-BCD2-panDBl as the template. The downstream sequence of the avtA gene was amplified using primers P13 and P14. The above four fragments were ligated by overlap PCR to obtain an assembly DonorBl of the four DNA fragments (shown in SEQ ID NO: 5). This was used as a template for gene editing. Among them, 1nt - 312nt of SEQ ID NO: 5 is the upstream sequence of the avtA gene of the target gene, 313nt - 474nt is the PL promoter, 475nt - 560nt is the BCD2 sequence, 560nt - 943nt is the panDBl sequence, 944nt - 995nt is the terminator sequence, and 996 - 1261nt is the downstream sequence of the avtA gene.

[0049] The pCas9 plasmid was transformed into MG1655, coated on a kanamycin-resistant plate containing 50 mg / L kanamycin, and cultured at 30 °C to obtain the strain MG655 / pCas9. The MG1655 / pCas9 bacterial lawn was picked into 50 mL of kanamycin-containing LB in a 500 mL shaking flask and cultured at 30 °C and 220 rpm. When the culture medium reached an OD 600 of 0.2, arabinose with a final concentration of 10 mM was added for induction. When the culture medium reached an OD 600When it became so, competent cells were prepared. 2 microliters of pTargetFavtA plasmid and 10 microliters of DonorBs template DNA were taken and electrotransformed into MG655 / pCas9 competent cells. These were coated on a double resistance plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Single colonies with PPL-BCD2-panD-Ter integrated on the avtA gene were identified using primers P15 and P16, and PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected and cultured by adding 0.2 mM IPTG to each to eliminate the pTargetFavtA plasmid, obtaining the recombinant bacterium Escherichia coli MG1655 avtA:panDBl / pCas, and still preparing competent cells that could be used according to the above method.

[0050] The recombinant bacterium Escherichia coli MG1655 avtA:panDBl / pCas was inoculated into a non-resistant LB liquid medium and cultured at 37 °C for 12 hours. Then, the medium was diluted and coated on an LB plate. The recombinant bacterium Escherichia coli MG1655 avta:panDBL with the pCas plasmid eliminated was obtained respectively. The gene panD was inserted onto the coding sequence of the chromosomal avtA gene, which led to the inactivation of AvtA and weakened the competing valine metabolic pathway.

[0051] Wild-type Escherichia coli K12MG1655 has a mutation in the ilvG gene, which encodes an inactive acetolactate synthase. In this application, the active ilvG gene of Escherichia coli BL21 was introduced onto the chromosome of Escherichia coli MG1655, which improved the synthesis of the VB5 precursor acetolactate. ilvG + The M gene was inserted onto the chromosome of Escherichia coli K12MG1655, and the strong trc promoter was used to control the transcription initiation of ilvG + M, and the terminator Ter was used to control the transcription termination of ilvG + M. ilvG +The M gene was integrated onto another N20 target sequence of the avtA gene. The pTargetF vector was mutated using the Q5® Site-Directed Mutagenesis Kit and primers P17 and P18. The mutated pTargetF was designated as pTargetFavtA1.

[0052]

Chemical formula

[0053] The upstream sequence of the avtA gene was amplified using primers P19 and P20, and the ilvG of Escherichia coli BL21 + The M sequence was amplified using primers P21 and P22, and the downstream sequence of the avtA gene was amplified using primers P23 and P24. The trc promoter TTGACAATTAATCATCCGGCTCGTATAATGTGTGTGGA was introduced by primers P20 and P21.

[0054]

Chemical formula

[0055] The above three fragments were ligated using overlap PCR to obtain the assembled DonorilvGM (shown in SEQ ID NO: 6). This was used as a template for gene editing. The 1-305 nt of SEQ ID NO: 6 is the upstream sequence of the target gene avtA, 306 nt - 341 nt is the trc promoter, 367 nt - 2013 nt is the coding sequence of the ilvG gene derived from Escherichia coli BL21 + The coding sequence of the gene, 2010 nt - 2273 nt is the coding sequence of the ilvM gene, 2274 - 2328 is the terminator sequence, and 2329 - 2629 is the downstream sequence of the avtA gene.

[0056] 2 microliters of pTargetFavtA1 plasmid and 10 microliters of DonorilvGM template DNA were taken and electrotransformed into Escherichia coli MG1655 avtA:panDBl / pCas competent cells. These were coated onto double-resistant plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Ptrc-ilvG + Single colonies incorporating M-Ter were identified using primers P25 and P26, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected and cultured with 0.2 mM IPTG to eliminate the pTargetFavtA1 plasmid. Additional non-resistant LB liquid medium was added and cultured at 37 °C for 12 hours, then diluted and coated onto LB plates respectively to obtain recombinant bacteria Escherichia coli MG1655 avtA:panDBl-ilvG + M that had eliminated the pCas plasmid. The synthesis of the VB5 precursor acetolactate was improved by the integration of active ilvG + M on the chromosome.

[0057] The N20 sequence of the pTargetF vector was mutated using the above Q5® Site-Directed Mutagenesis Kit and primers P27 and P28. The mutated pTargetF was designated pTargetFcadA.

[0058]

Chemical formula

[0059] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30. The gapA promoter was amplified using primers P31 and P32, and the downstream sequence of the cadA gene was amplified using primers P35 and P36. The aspDH gene containing the RBS and terminator was synthesized by a gene synthesis company, and the RBS-aspDH-Ter sequence was amplified by using primers P33 and P34. The above four fragments were ligated by overlap PCR to obtain the assembled DonoraspDH (shown in SEQ ID NO: 7). This was used as a template for gene editing. 1-210 nt of SEQ ID NO: 7 is the upstream sequence of the cadA gene of the target gene, 211 nt-480 nt is the gapA promoter, 481 nt-509 nt is the RBS sequence. 510 nt-1307 nt is the coding sequence of the aspDH gene derived from Delftia sp. Csl-4 (shown in SEQ ID NO: 56), 1308 nt-1360 nt is the terminator sequence, and 1361-1535 is the downstream sequence of the cadA gene.

[0060] 2 microliters of pTargetFcadA plasmid and 10 microliters of DonoraspDH template DNA were taken and electrotransformed into Escherichia coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells. This was coated on a double resistance plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Single colonies with PgapA-aspDH-Ter integrated on the cadA gene were identified by using primers P37 and P38, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected, cultured with 0.2 mM IPTG to eliminate the pTargetFcadA plasmid. Further non-resistant LB liquid medium was added, cultured at 37 °C for 12 hours, then diluted and coated on LB plates to eliminate the pCas plasmid recombinant bacterium Escherichia coli MG1655 avtA:panDBl-ilvG +M-aspDH was obtained.

[0061] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30, the gapA promoter was amplified using primers P31 and P39, the aspC gene was amplified using primers P40 and P41, and the downstream sequence of the cadA gene was amplified using primers P42 and P36. The above four fragments were ligated by overlap PCR to obtain assembled DonoraspC (shown by SEQ ID NO: 8). This was used as a template for gene editing. 1 - 210 nt of SEQ ID NO: 8 is the upstream sequence of the target gene cadA, 211 nt - 480 nt is the gapA promoter, 611 nt - 1801 nt is the coding sequence of the aspC gene, and 1992 - 2166 is the downstream sequence of the cadA gene.

[0062] 2 microliters of pTargetFcadA plasmid and 10 microliters of DonoraspC template DNA were taken and electrotransformed into Escherichia coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells. This was coated on a double - resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Single colonies with PgapA - aspC integrated onto the cadA gene were identified by using primers P37 and P38, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected, cultured with 0.2 mM IPTG to eliminate the pTargetFcadA plasmid. Non - resistant LB liquid medium was further added, cultured at 37 °C for 12 hours, then diluted and coated on LB plates to obtain gene - recombinant bacteria Escherichia coli MG1655 avtA:panDBl-ilvG + M - aspC was obtained.

[0063]

Chemical formula

[0064] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30. The gapA promoter was amplified using primers P31 and P43, the aspA gene was amplified using primers P44 and P45, and the downstream sequence of the cadA gene was amplified using primers P46 and P36. The above four fragments were ligated by overlap PCR to obtain the assembled DonoraspA (shown in SEQ ID NO: 9). This was used as a template for gene editing. 1-210 nt of SEQ ID NO: 9 is the upstream sequence of the cadA gene of the target gene, 211 nt-480 nt is the gapA promoter, 504 nt-1940 nt is the coding sequence of the aspA gene, and 2004-2178 is the downstream sequence of the cadA gene.

[0065] 2 microliters of pTargetFcadA plasmid and 10 microliters of DonoraspA template DNA were taken and electrotransformed into Escherichia coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells. This was coated on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Single colonies with PgapA-aspA integrated onto the cadA gene were identified by using primers P37 and P38, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected and incubated with 0.2 mM IPTG to eliminate the pTargetFcadA plasmid. Additional non-resistant LB liquid medium was added and cultured at 37 °C for 12 hours, then diluted and coated on an LB plate to obtain the gene-recombinant bacterium Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspA.

[0066]

Chemical formula

[0067] The constructed vector pACYC184-panBCE was transformed into the above-mentioned genetically engineered bacterium Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspDH, Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspC, and Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspA, respectively. Escherichia coli MG1655 avtA:panDBl-ilvG for fermentation to produce VB5 + M-aspDH / pACYC184-panBCE, Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspC / pACYC184-panBCE, and Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspA / pACYC184-panBCE was obtained.

[0068] SEQ ID NO: 1 ATGTACCGTA CGTTAATGAG CGCAAAACTT CACAGAGCGA GAGTGACGGA AGCCAATTTG AACTACGTCG GCAGCGTGAC AATTGATGAA GATTTGCTGG ATGCTGTCGG AATGATGGCA AATGAAAAAG TGCAAATTGT GAATAATAAT AACGGGGCCC GGCTGGAAAC GTACATTATT CCCGGTGAAA GGGGCAGCGG CGTCGTTTGT TTAAACGGAG CTGCCGCCCG CCTTGTCCAG GTTGGAGATG TCGTCATCAT CGTGTCTTAT GCGATGATGT CTGAAGAGGA AGCAAAGACC CATAAGCCGA AGGTTGCCGT TTTGAACGAG AGAAACGAAA TCGAGGAAAT GCTGGGTCAG GAGCCAGCCC GTACCATTCT GTAA

[0069] Array number 2 CCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACATCTTAATCATGCTAAGGAGGTTTTCTAATG

[0070]

Chem.

[0071]

Chem.

[0072]

Chem.

[0073]

Chem.

[0074]

Chem.

[0075]

Chem.

[0076]

Chem.

[0077]

Chem.

[0078]

Chem.

[0079]

Chem.

[0080]

Chem.

[0081] Accession No. 56 ATGAATATTGCTGTGATTGGCTGCGGTGCGATTGGCGCCA GCGTGCTCGAACTGCTCAAGGGCCATGCCGCGGTGCAGGTGGGCTGGGTGCTTGTGCCCG AAGTGACGGACGCCGTGCGCGCCACCCTGGCCCGGCATGCGCCCCAGGCGCGCGCACTGC CTGCGCTGACGACTGAAGACCGGCCCGACCTTATCGTCGAATGCGCAGGCCATACCGCCA TCGAAGAGCATGTGCTGCCCGCCCTGCGGCGCGGCATTCCTGCCGTCGTGGCCTCCATCG GCGCACTCAGCGCCCCCGGCATGGCCGAGGCCGTTCAGGCCGCGGCCGAGGCCGGAGGCA CCCAGGTGCAATTGCTGTCGGGCGCCATCGGCGGCGTGGATGCGCTGGCCGCAGCCCGCA TCGGCGGCCTGGACGAAGTGGTCTACACCGGCCGCAAGCCGCCCCTGGCCTGGACCGGCA CGCCCGCAGAACAGCGCTGCGACCTCGCCAGCCTCAAGGAAGCCTTCTGCATCTTCGAAG GCAGCGCACGCGAGGCCGCCCAGCTCTACCCCAAGAACGCCAACGTGGCCGCCACCCTGT CGCTGGCCGGCATGGGCCTGGACCGCACCACGGTGCGCCTGTACGCCGACCCGGCCGTGG ACGAAAACGTGCACCATGTGGCCGCGCGCGGCGCCTTCGGTTCCATGGAATTGACCATGC GCGGCAAGCCGCTGGAGGCCAACCCCAAGACCTCGGCCCTCACCGTCTACAGCGTGGTGC GCGCCGTGCTCAACCAGGCCACGGCCATCGCCATCTAA

[0082] Embodiment 3 Fermentation Experiment of VB5 Gene-Recombinant Bacteria The gene-recombinant bacterium Escherichia coli MG1655 avtA:panDBl-ilvG of the test strain + M-aspDH / pACYC184-panBCE, Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspC / pACYC184-panBCE, and Escherichia coli MG1655 avtA:panDBl-ilvG + M-aspA / pACYC184-panBCE was streak-inoculated onto a solid LB medium plate containing 34 mg / L chloramphenicol and incubated at 37 °C for 12 hours. The bacterial lawn on the plate was picked up, inoculated into an LB medium slant, and incubated at 37 °C for 10 - 12 hours. The bacterial lawn on the plate was picked up, inoculated into a liquid LB medium, and cultured with shaking at 37 °C and 220 rpm for 12 hours to obtain a seed culture solution. The seed culture solution was inoculated into the fermentation medium at an inoculation amount of 3% and cultured with shaking at 37 °C and 220 rpm.

[0083] Fermentation medium: 80 g / L of MOPS, 20.0 g / L of glucose, 10.0 g / L of ammonium sulfate, 2.0 g / L of potassium dihydrogen phosphate, 2.0 g / L of magnesium sulfate heptahydrate, 5.0 g / L of yeast extract, 5 mL / L of trace element mixed solution. The remaining amount was water. Trace element mixed solution: FeSO 4 ·7H 2 O was 10 g / L, CaCl 2 was 1.35 g / L, ZnSO 4 ·7H 2 O was 2.25 g / L, MnSO 4 ·4H 2O at 0.5 g / L, CuSO 4 ·5H 2 O at 1 g / L (NH 4 ) 6 Mo 7 O 24 ·4H 2 O at 0.106 g / L, Na 2 B 4 O 7 ·10H 2 O at 0.23 g / L, CoCl 2 ·6H 2 O at 0.48 g / L, 35% HCl at 10 mL / L. The remaining amount was water.

[0084] During the incubation process, samples were taken every 4 hours. The pH of the reaction system was adjusted with ammonia to maintain it at 6.8 - 7.0. The glucose content was detected using a biosensor analyzer SBA - 40D. When the glucose content in the system was lower than 5 g / L, glucose was added to make the glucose concentration in the system 20 g / L. Samples were taken after 24 - hour incubation, centrifuged at 12000 g for 2 minutes, and the supernatant was taken to detect the VB5 content. The supernatant was taken and tested for VB5 content (as follows).

[0085]

Table 1

[0086] This application has found that for the production of VB5 by fermentation, in Escherichia coli, enhancing three different pathways for aspartic acid production and overexpressing the aspDH gene is advantageous for increasing the fermentation yield of VB5 compared to overexpressing aspC and aspA.

[0087] It should be noted that the foregoing are only preferred embodiments of this application, and those skilled in the art can make some improvements and modifications without departing from the principles of the present invention, and these improvements and modifications are also considered to be within the protection scope of the present invention.

Claims

1. Use of enhanced expression of the aspartate dehydrogenase gene aspDH in the production of vitamin B5, comprising: Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4. use.

2. 2. The use according to claim 1, wherein the aspartate dehydrogenase gene aspDH comprises: (I) the nucleotide sequence set forth as SEQ ID NO: 56; or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I) and having the same or similar function as the nucleotide sequence shown as (I); or (III) A nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (I) or (II).

3. 3. The use according to claim 1 or 2, further comprising: (1) inserting a strong promoter and / or a strong RBS into the cadA gene, wherein the strong promoter is PgapA and the strong RBS is BCD2; Preferably, said BCD2 comprises: (A) the nucleotide sequence set forth as SEQ ID NO:2; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (A) or (B); and / or (2) expressing the ilvGM gene derived from Escherichia coli BL21; and / or (3) expressing the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis; and / or Preferably, the L-aspartate α-decarboxylase gene derived from Bacillus licheniformis has: (A) the nucleotide sequence set forth as SEQ ID NO: 1; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (A) or (B); and / or (4) Increasing the copy number of the panB gene, panC gene, and / or panE gene.

4. An expression vector comprising an aspartate dehydrogenase gene aspDH, Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4; Preferably, the aspartate dehydrogenase gene aspDH has: (I) the nucleotide sequence shown as SEQ ID NO: 56; or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I) and having the same or similar function as the nucleotide sequence shown as (I); or (III) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (I) or (II); Expression vector.

5. The expression vector of claim 4, further comprising: (I) a strong promoter and / or a strong RBS; wherein the strong promoter is PgapA and the strong RBS is BCD2; Preferably, said BCD2 comprises: (A) the nucleotide sequence set forth as SEQ ID NO:2; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (A) or (B); and / or (II) the ilvGM gene derived from Escherichia coli BL21; and / or (III) the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis, and / or Preferably, the L-aspartate α-decarboxylase gene panD from Bacillus licheniformis has: (A) the nucleotide sequence set forth as SEQ ID NO: 1; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (A) or (B); and / or (IV) Increased copy number of panB, panC, and / or panE genes.

6. a host, wherein said host expresses an aspartate dehydrogenase gene aspDH; Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4; Preferably, the aspartate dehydrogenase gene aspDH has: (I) the nucleotide sequence shown as SEQ ID NO: 56; or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I) and having the same or similar function as the nucleotide sequence shown as (I); or (III) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (I) or (II); host.

7. The host of claim 6 further comprising: (I) a strong promoter and / or a strong RBS; wherein the strong promoter is PgapA and the strong RBS is BCD2; Preferably, said BCD2 comprises: (A) the nucleotide sequence set forth as SEQ ID NO:2; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (A) or (B); and / or (II) the ilvGM gene derived from Escherichia coli BL21; and / or (III) the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis, and / or Preferably, the L-aspartate α-decarboxylase gene panD from Bacillus licheniformis has: (A) the nucleotide sequence set forth as SEQ ID NO: 1; or (B) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (A) and having the same or similar function as the nucleotide sequence shown as (A); or (C) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (A) or (B); and / or (IV) Increased copy number of panB, panC, and / or panE genes.

8. The expression vector according to claim 4 or 5 is transfected or transformed, Preferably, the host is derived from Escherichia coli; More preferably, the host is derived from Escherichia coli K12; More preferably, the host is derived from the Escherichia coli K12 MG1655 strain. The host according to claim 6 or 7.

9. Use of the expression vector of claim 4 and the host of claim 6 in the production of vitamin B5.

10. A method for the production of vitamin B5, wherein the host according to claim 6 is used as a fermentation strain and fermented, the fermentation broth is collected, and the supernatant is centrifuged to obtain vitamin B5.