Use of aspartate decarboxylase in the production of vitamin B5 by fermentation
Patent Information
- Application Number
- JP2024553525
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-03-07
- Filing Date
- 2023-02-16
- Publication Date
- 2025-12-12
AI Technical Summary
The current chemical synthesis method for vitamin B5 production is highly polluting, generating toxic byproducts and wastewater that are difficult to treat, leading to environmental concerns and market supply shortages.
The use of enhanced expression of the L-aspartate α-decarboxylase gene panD from Bacillus licheniformis in microbial fermentation to produce vitamin B5, which eliminates the metabolic bottleneck of β-alanine synthesis and reduces production costs.
This approach enables efficient fermentative production of vitamin B5 without the need for external β-alanine supplementation, reducing environmental impact and improving market supply by utilizing renewable resources and easily treatable waste products.
Abstract
Description
Technical Field
[0001] This application relates to the technical field of microorganisms, and specifically to the use of aspartate decarboxylase in the fermentative production of vitamin B5.
Background Art
[0002] Vitamin B5 (VB5), also known as D-pantothenic acid, is a water-soluble vitamin and a component of coenzyme A and acyl carrier protein. As a cofactor for more than 70 enzymes, vitamin B5 is involved in the metabolism of sugars, fats, proteins, and energy and has important physiological metabolic regulation. VB5 is mainly used in animal feed additives, food additives, and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of the application technology field, its market demand still shows a steady increasing trend.
[0003] China is the largest producer and exporter of VB5, and the industrial production method of VB5 is chemical synthesis. Enterprises basically synthesize DL-pantolactone using the isobutyraldehyde-formaldehyde-hydrogen cyanide method. DL-pantolactone is further separated by chemical or enzymatic methods to obtain L-pantolactone. Finally, β-alanine produced using acrylonitrile as a raw material and L-pantolactone synthesize VB5. The main raw materials for the chemical synthesis of VB5 are flammable, explosive, and highly toxic, and cyanide wastewater will be generated in the production process. The wastewater is difficult to treat, and as a result, VB5 has become a highly polluting industry.
[0004] In recent years, China's economic development has entered a new normal of environmentally friendly protection, and the impact of environmental protection on the VB5 industry is gradually emerging. Under large-scale and high-intensity environmental protection and management, the production of highly polluting VB5 enterprises is limited and even stopped, the market supply is insufficient, and the price is soaring. This restricts the sound development of the downstream feed, food, and pharmaceutical industries. Such a supply and demand situation will continue for a long time until the highly polluting VB5 production technology is significantly improved. Therefore, the innovation of environmentally friendly manufacturing technology for VB5 is urgent.
[0005] The microbial fermentation method for VB5 production not only uses renewable glucose as a raw material, but also the waste residues, waste water, and waste gas formed in the production process are easy to treat and utilize as resources, thereby effectively solving the problem of high pollution in the VB5 industry. The metabolic pathway of VB5 synthesis by microorganisms using glucose has a complex control mechanism and the fermentation yield is extremely low. β-alanine is used together with D-pantothenic acid as a C3 substrate to synthesize VB5. β-alanine is produced from aspartic acid and is catalyzed by L-aspartic acid α-decarboxylase encoded by the panD gene. The initially translated and synthesized panD is a zymogen without catalytic activity, and the zymogen self-cleaves at the Gly-Ser bond to produce two subunits. Among these, the N-terminal subunit containing a pyruvoyl group has a catalytic effect. The pyruvoyl group of mature panD forms a substrate and a transition intermediate state. This is prone to aminotransfer, which results in an irreversible loss of enzyme activity. In addition, the accumulation of β-alanine is also controlled by the concentration of coenzyme A of the downstream metabolite of VB5. The protein complex formed by coenzyme A and PanD / PanZ negatively controls the expression of PanD by feedback. PanD not only has a slow maturation process of post-translational modification, but also has problems of catalytic inactivation and feedback inhibition, resulting in a very low synthesis efficiency of the VB5 C3 precursor β-alanine and limiting the efficient synthesis of VB5. To improve the fermentation yield of VB5, a large amount of beta-alanine needs to be supplemented from the outside into the fermentation medium (Non-Patent Documents 1 to 3). Therefore, the biosynthesis of β-alanine is a metabolic bottleneck in the production of VB5 by fermentation.
Prior Art Documents
Non-Patent Documents
[0006]
Non-Patent Document 1
[0007] In view of the above, in order to break through the metabolic bottleneck of highly efficient β - alanine synthesis, the inventors screened 16 key enzymes, L - aspartate α - decarboxylases, from different genera with large evolutionary differences. L - aspartate α - decarboxylase is encoded by the panD gene, which catalyzes the decarboxylation of L - aspartate to produce β - alanine. [Means for Solving the Problems]
[0008] To achieve the object of the present invention, the present application provides the following technical solutions.
[0009] In a first aspect, the present application provides the use of enhanced expression of the L - aspartate α - decarboxylase gene panD in the production of vitamin B5, wherein the L - aspartate α - decarboxylase is derived from Bacillus licheniformis.
[0010] In some embodiments of the present application, the L-aspartic acid α-decarboxylase gene panD has the following: (I) a nucleotide sequence shown as SEQ ID NO: 3, or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I), and having the same or similar function as the nucleotide sequence shown as (I), or (III) a nucleotide sequence having at least 80% homology to the nucleotide sequence shown as (I) or (II).
[0011] In some embodiments of the present application, it further includes the following: (1) inserting a strong promoter and / or a strong RBS into the avtA gene, where the strong promoter is PPL and the strong RBS is BCD2, and / or (2) expressing the ilvGM gene derived from Escherichia coli BL21, and / or (3) increasing the copy number of the panB gene, panC gene, and / or panE gene.
[0012] In a second aspect, the present application also provides an expression vector containing the L-aspartic acid α-decarboxylase gene panD, and the L-aspartic acid α-decarboxylase is derived from Bacillus licheniformis.
[0013] In some embodiments of the present application, the expression vector further includes the following: (i) a strong promoter and / or a strong RBS, and / or (ii) the ilvGM gene derived from Escherichia coli BL21, and / or (iii) the panB gene, panC gene, and / or panE gene with an increased copy number.
[0014] In a third aspect, the present application also provides a host that expresses the L-aspartic acid α-decarboxylase gene panD derived from Bacillus licheniformis.
[0015] In some embodiments of the present application, the host further comprises the following: (i) A strong promoter and / or a strong RBS, and / or (ii) The ilvGM gene derived from Escherichia coli BL21, and / or (iii) The panB gene, panC gene, and / or panE gene with an increased copy number.
[0016] In some embodiments of the present application, the host is transfected or transformed with an expression vector according to claim 4 or 5. Preferably, the host is derived from Escherichia coli, preferably, the host is derived from Escherichia coli K12, and more preferably, the host is derived from the Escherichia coli K12MG1655 strain.
[0017] In a fourth aspect, the present application also provides the use of an expression vector and a host in the production of vitamin B5.
[0018] In a fifth aspect, the present application also provides a method for the production of vitamin B5. The host is used as a fermentation strain without the addition of β-alanine, fermented, the fermentation broth is collected, and the supernatant is centrifuged to obtain vitamin B5.
[0019] This application discloses an aspartic acid decarboxylase having high activity and a method for its use in the production of vitamin B5. This application screened the L-aspartic acid α-decarboxylase derived from Bacillus licheniformis. This has significantly higher activity in catalytically producing β-alanine than panD from other sources. The panD derived from B. licheniformis was used to construct a genetically engineered bacterium for the fermentative production of vitamin B5. This eliminated the metabolic bottleneck of β-alanine for the biosynthesis of vitamin B5. Compared with the highly polluting chemical method for vitamin B5 production, the biological method for vitamin B5 production in this application has advantages such as renewable raw materials, easy treatment and resource utilization of waste residues, wastewater, and waste gas. Therefore, it can be used in the industrial production of actual vitamin B5 and has important application value.
Embodiments for Carrying Out the Invention
[0020] This application discloses the use of aspartic acid decarboxylase in the fermentative production of vitamin B5. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in this application. The methods and uses of this application are described by preferred embodiments, and those in charge can, obviously, without departing from the content, spirit, and scope of this application, modify or appropriately change and combine the methods and uses described in this specification to achieve and utilize the technology of this application.
[0021] The panD gene of the present application is derived from Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis, Chlorobium phaeobacteroides, Corynebacterium efficiens, Corynebacterium glutamicum, Corynebacterium marinum, Escherichia coli, Haloquadratum walsbyi, hydrothermal vent metagenome, Methanocaldococcus jannaschii, Magnetospirillum magneticum, Metarhizium robertsii, mine wastewater metagenome, Rhodopirellula baltica, and Thermotoga maritima.
[0022] Regarding the screening of highly efficient L-aspartate α-decarboxylase, the present invention controls the translation initiation levels of L-aspartate α-decarboxylases from the above 16 different origins using the same bicistronic design element BCD2 (Nature Methods, 2013, Vol. 10(4): p. 354-360). The BCD element introduces a leader cistron sequence in front of the foreign structural gene. When the ribosome passes through the cistron and occupies the next cistron RBS sequence, it can avoid forming a stem-loop structure with the coding sequence at the front end of the gene, and thus can avoid interfering with the translation of a part of the panD gene. The translation strength of BCD is highly correlated with the affinity between the RBS core sequence and the ribosome subunit, and hardly correlated with the gene coding sequence, thus avoiding interference of 16 different panD gene sequences with the same translation initiation element.
[0023] Regarding the screening of highly efficient L-aspartate α-decarboxylase, the present application ligates the above 16 BCD2-panD sequences to a plasmid to construct 16 recombinant plasmids pET28a-BCD2-panD. These control transcription using the same promoter. The plasmid vectors used in the present application can be pET series vectors, such as pET28a, pET32a, pET3, etc. It can also be a pQE series vector or other E. coli expression vectors. The promoter of the present application can be a T7 promoter, etc.
[0024] In the present invention, the above recombinant plasmid was transformed into an Escherichia coli B derivative strain including BL21, BL21-Codonplus(RIL), BL21(DE3), BL21Star, C41(DE3), BL21(DE3)pLysS / E, BL21-CodonPlus(DE3) strain, Origami(DE3) strain, Rosetta-gammi(DE3), etc. to obtain a whole-cell catalyst gene recombinant bacterium. The recombinant vector is usually constructed by restriction endonuclease digestion and T4 ligase ligation of the obtained target gene and vector. The recombinant vector can be transformed into a host cell by conventional calcium chloride chemical transformation or electroporation transformation in molecular biology experiments to obtain a gene recombinant bacterium. This can be used for whole-cell catalysis.
[0025] This application screens for efficient L-aspartic acid α-decarboxylase using a whole-cell catalysis method. In the whole-cell catalysis process of this application, bacterial cells are first cultured in a liquid medium, and the expression of L-aspartic acid α-decarboxylase is induced at an appropriate time. The medium used for the growth of the gene recombinant bacterium can be a rich nutrient medium or an inorganic salt medium. The medium contains a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutrient factors. As the carbon source, for example, sugars such as glucose, lactose, and galactose, alcohols such as glycerol and mannitol can be used, and organic acids such as gluconic acid, citric acid, and succinic acid can be used. As the nitrogen source, for example, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used. Organic nitrogen sources such as corn syrup, soybean meal hydrolyzate, hair powder, yeast extract, peptone, and other organic nitrogen sources can also be used. The inorganic ions include one or more of ions such as iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium. Other nutrient factors include vitamins such as vitamin B1, pyridoxal, biotin, and other vitamins.
[0026] The cultivation process is suitable for implementing cultivation for about 5 to 48 hours under aerobic conditions. The cultivation temperature is usually controlled at 25 to 45 °C, and the pH is usually controlled at 5 to 8. Cultivate for 3 to 40 hours and start adding at least one inducer selected from IPTG, lactose, and allolactose. The addition of the inducer can be a one-time, intermittent, or continuous addition. The addition amount of the inducer is 0.01 to 1 mmol.
[0027] Substrates such as L-aspartic acid, typically preferably L-aspartic acid, sodium L-aspartate, potassium L-aspartate, ammonium L-aspartate, etc., are added in a one-time manner after the inducer has been added for 0.5 to 30 hours.
[0028] During the L-aspartic acid decarboxylation reaction for the production of β-alanine, the pH of the catalyst solution continues to rise, and an acid needs to be added to maintain the pH within a favorable range for the whole-cell catalyst. Usually, the pH is above 4.0, preferably above 5.0, more preferably above 5.5, and usually, the pH is below 8.0, preferably below 7.5, more preferably below 6.8. The acid used herein is L-aspartic acid. It can be supplemented in the form of a solid powder, suspension, or solution. It can be supplemented intermittently or continuously to maintain the pH within the above range, or it can be supplemented to maintain the pH at a constant value by feedback from the pH electrode signal of the bioreactor.
[0029] The temperature of the catalytic reaction is typically between 25 °C and 60 °C, preferably between 30 °C and 45 °C. The temperature during the catalytic process can be set to a fixed value within the above range, or it can vary from low to high.
[0030] This application further constructs genetically recombinant bacteria for the production of vitamin B5 by a fermentation method using a screened and efficient L-aspartic acid α-decarboxylase. This eliminates the bottleneck in the metabolism of β-alanine for the biosynthesis of vitamin B5.
[0031] The Escherichia coli described in the present application for VB5 production by fermentation expresses the panB, panC, and panE genes of the terminal synthesis pathway of VB5. The panB gene of Escherichia coli encodes ketopantoic acid hydroxymethyltransferase, which catalyzes the addition of a methyl group to the substrate a-ketoisovaleric acid to form ketopantoinic acid. Ketopantoinic acid is reduced to pantothenic acid by ketopantoinic acid reductase encoded by the panE gene. Pantothenic acid synthase encoded by the panC gene further catalyzes the condensation of pantothenic acid and β-alanine to form VB5.
[0032] The genome of Escherichia coli K12MG1655 was used as a template for PCR amplification of the panBC gene. It was designed such that the strong promoter Ptrc was introduced onto the amplification primer, and BamHI and SphI restriction endonuclease sites were designed at both ends of the primer. The Ptrc-panBC product amplified by PCR was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI. The pACYC184 plasmid was simultaneously double-digested with the restriction endonucleases BamHI and SphI. The double-digested Ptrc-panBC and pACYC184 plasmids were recovered by gel electrophoresis, ligated with T4 ligase, and the ligation product was chemically transformed into Escherichia coli DH5α competent cells. These were cultured for recovery for 1 hour and plated on chloramphenicol plates. The plated plates were placed in a 37 °C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-Ptrc-panBC.
[0033] The genome of Escherichia coli K12MG1655 was used as a template for PCR amplification of the panE gene. A strong promoter PJ23119 was designed to be introduced onto the amplification primers, and SphI and BsaBI restriction endonuclease sites were designed at both ends of the primers. The PJ23119-panE product obtained from PCR amplification was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI. The pACYC184-Ptrc-panBC plasmid was simultaneously double-digested with restriction endonucleases BamHI and SphI. The double-digested PJ23119-panE and pACYC184-Ptrc-panBC plasmids were recovered by gel electrophoresis, ligated with T4 ligase, and the ligation product was chemically transformed into Escherichia coli DH5α competent cells. These were cultured for recovery for 1 hour and plated on chloramphenicol plates. The plated plates were placed in a 37 °C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE. This overexpresses the genes for the vitamin B5 terminal synthesis pathway.
[0034] The ilvG gene of Escherichia coli K12MG1655 was inactivated by mutation, and the present application introduced the active ilvG gene of Escherichia coli BL21 to improve the synthesis and supply of the VB5 precursor. The present application inserts the ilvG + M gene onto the chromosome of Escherichia coli K12MG1655 and uses a strong trc promoter to control the transcription initiation of ilvG + M and uses a terminator Ter to control the transcription termination of ilvG + M. The insertion site of the ilvG + M gene on the chromosome was the coding sequence of the avtA gene. This led to the inactivation of AvtA, weakened the synthesis of valine, thereby weakening the competing pathway of VB5 and promoting VB5 biosynthesis. The recombinant bacterium Escherichia coli MG1655 avtA:ilvG + M was constructed to enhance the synthesis pathway of the VB5 precursor acetolactate and weaken the competing valine pathway.
[0035] The three more active panD genes screened above were integrated onto the avtA gene of Escherichia coli K12MG1655. These were derived from Bacillus subtilis, Bacillus licheniformis, and Corynebacterium glutamicum, respectively. Transcription and translation initiation of these three genes are controlled using the same strong promoter PPL and the same BCD2, respectively.
[0036] To obtain genetically engineered bacteria for VB5 production by fermentation, the above-constructed recombinant plasmid pACYC184-Ptrc-panBC-PJ23119-panE was transformed into genetically engineered bacteria Escherichia coli MG1655 avtA:panDBs-ilvG + M, genetically engineered bacteria Escherichia coli MG1655 avtA:panDBl-ilvG + M, and genetically engineered bacteria Escherichia coli MG1655 avtA:panDCg-ilvG + M. The optimal panD was confirmed by comparing the VB5 yields of the genetically engineered bacteria through shake flask fermentation.
[0037] For the fermentation method for producing VB5, the medium contains a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutritional factors. As the carbon source, for example, sugars such as glucose, lactose, and galactose can be used. As the inorganic nitrogen source, for example, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride can be used. As the organic nitrogen source, for example, organic nitrogen sources such as corn syrup, soybean meal hydrolyzate, hair powder, yeast extract, and peptone can be used. The inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium, and other ions.
[0038] Through two-step verification of the catalytic production of β-alanine and the fermentative production of VB5, the L-aspartic acid α-decarboxylase with the highest activity was screened from 16 candidate enzymes from different origins with large sequence differences. VB5 can be efficiently produced by fermentation without the addition of β-alanine. This eliminates the biosynthetic bottleneck and reduces the production cost.
[0039] The experimental methods of the following embodiments are conventional methods unless otherwise specified. The experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following embodiments were set up in triplicate and the results were averaged. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art, as well as commercially available equipment and reagents. Refer to "Molecular Cloning (3rd Edition)" (Science Press), "Microbiology Experiments (4th Edition)" (Higher Education Press), and the manuals of the manufacturers of the corresponding equipment and reagents.
[0040] If the sequences in this specification do not match the sequences in the sequence listing, the sequences in this specification shall prevail.
[0041] This application will be further described below in conjunction with the embodiments.
Example
[0042] Embodiment 1 Detection Method The accumulation of β-alanine in the fermentation broth was quantitatively determined by HPLC. The specific method is as follows. The supernatant of the fermentation broth was taken, diluted to an appropriate concentration with pure water, and filtered through a 0.22 μm filter membrane. The concentration of β-alanine was determined by on-line pre-column derivatization with o-phthalaldehyde (OPA). The chromatographic column used was an Agilent AdvanceBio-AAA-C18 column (4.6 × 100 mm, 2.7 μm), the column temperature was 40 °C, the detection wavelength was 338 nm, and the flow rate of the mobile phase was 1 mL / min. Mobile phase A was 10 mM Na 2 HPO 4and 10 mM of Na 2 B 4 O 7 and the pH was adjusted to 8.2. The mobile phase B was acetonitrile:methanol:water = 45:45:10. Using β-alanine purchased from Sigma as a standard, a standard curve of the concentration and absorbance of alanine was measured under the chromatographic conditions.
[0043] The yield of VB5 in the fermentation broth was quantitatively determined by HPLC as follows. The supernatant of the fermentation broth was diluted to an appropriate concentration with pure water and filtered through a 0.22 μm filter membrane. The chromatographic column used was an Agilent ZORBAX-SB-Aq column (4.6×250 mm), the column temperature was 30 °C, the detection wavelength was 210 nm, and the flow rate of the mobile phase was 1 mL / min. The mobile phase was 3.12 g / L of NaH 2 PO 4 -2H 2 O, and the pH was adjusted to 2.2 with phosphoric acid. Using calcium pantothenate purchased from Sigma as a standard, a standard curve of the concentration and absorbance values of 0.1 - 0.5 g / L calcium pantothenate was determined.
[0044] Embodiment 2 Construction of a vector overexpressing L-aspartate α-decarboxylase and β-alanine production by whole-cell catalysis of genetically recombinant bacteria The 16 L-aspartate α-decarboxylase genes panD synthesized by a gene synthesis company are derived from Bacillus amyloliquefaciens (shown by SEQ ID NO: 1), Bacillus subtilis (shown by SEQ ID NO: 2), Bacillus licheniformis (shown by SEQ ID NO: 3), Chlorobium phaeobacteroides (shown by SEQ ID NO: 4), Corynebacterium efficiens (shown by SEQ ID NO: 5), Corynebacterium glutamicum (shown by SEQ ID NO: 6), Corynebacterium marinum (shown by SEQ ID NO: 7), Escherichia coli (shown by SEQ ID NO: 8), Haloquadratum walsbyi (shown by SEQ ID NO: 9), hydrothermal vent metagenome (shown by SEQ ID NO: 10), and Methanocaldococcus jannaschii (shown by SEQ ID NO: 11), Magnetospirillum magneticum (shown by SEQ ID NO: 12), Metallosphaera sedula (shown by SEQ ID NO: 13), mine wastewater metagenome (shown by SEQ ID NO: 14), Rhodopirellula baltica (shown by SEQ ID NO: 15), and Thermotoga maritima (shown by SEQ ID NO: 16). During the customization and synthesis of the above panD gene sequences, the XbaI and HindIII restriction endonuclease sequences were removed by synonymous codon substitution.
[0045] In this application, the above 16 BCD2-panD sequences were ligated into a plasmid to construct 16 recombinant plasmids pET28a-BCD2-panD. When the above panD gene sequence was customized and synthesized, the same BCD2 sequence (shown in SEQ ID NO: 17) was simultaneously synthesized in front of each panD sequence, and at the same time, XbaI and HindIII restriction enzyme cleavage sites were added to both ends of the BCD2-panD sequence. The synthesized sequence was ligated into a vector. The above synthesized BCD2-panD vector and pET28a(+) plasmid were double digested using restriction endonucleases XbaI and HindIII. The digested gene fragment of BCD2-panD and the linearized vector segment were recovered by gel electrophoresis, and the two fragments were further ligated using T4 ligase. The ligation product was transformed into Escherichia coli DH5α competent cells, and transformants containing the recombinant plasmid were screened using an LB plate containing 50 mg / L kanamycin. After amplifying the plasmid by amplicon, it was extracted and sent for sequencing, and 16 correct plasmids pET28a-BCD2-panDBa, pET28a-BCD2-panDBs, pET28a-BCD2-panDBl, pET28a-BCD2-panDCp, pET28a-BCD2-panDCe, pET28a-BCD2-panDCg, pET28a-BCD2-panDCm, pET28a-BCD2-panDEc, pET28a-BCD2-panDHw, pET28a-BCD2-panDHv, pET28a-BCD2-panDMj, pET28a-BCD2-panDMm, pET28a-BCD2-panDMr, pET28a-BCD2-panDMd, pET28a-BCD2-panDRb, pET28a-BCD2-panDTm were obtained. In the 16 recombinant vectors, 16 panD genes of different origins controlled the start of transcription using the same promoter (T7), and controlled the start of translation using the same BCD2 sequence.
[0046] Sixteen extracted pET28a-BCD2-panD plasmids expressing panD genes of different origins were transformed into Escherichia coli BL21(DE3) competent cells and screened on LB plates containing 50 mg / L kanamycin to obtain 16 strains of genetically recombinant bacteria Escherichia coli BL21 / pET28a-BCD2-panDBa, Escherichia coli BL21 / pET28a-BCD2-panDBs, Escherichia coli BL21 / pET28a-BCD2-panDBl, Escherichia coli BL21 / pET28a-BCD2-panDCp, Escherichia coli BL21 / pET28a-BCD2-panDCe, Escherichia coli BL21 / pET28a-BCD2-panDCg, Escherichia coli BL21 / pET28a-BCD2-panDCm, Escherichia coli BL21 / pET28a-BCD2-panDEc, Escherichia coli BL21 / pET28a-BCD2-panDHw, Escherichia coli BL21 / pET28a-BCD2-panDHv, Escherichia coli BL21 / pET28a-BCD2-panDMj, Escherichia coli BL21 / pET28a-BCD2-panDMm, Escherichia coli BL21 / pET28a-BCD2-panDMr, Escherichia coli BL21 / pET28a-BCD2-panDMd, Escherichia coli BL21 / pET28a-BCD2-panDRb, and Escherichia coli BL21 / pET28a-BCD2-panDTm for β-alanine whole-cell catalysis.
[0047] Embodiment 3 Whole-cell catalysis screening of the optimal panD gene The above 16 genetically recombinant bacteria Escherichia coli BL21 / pET28a-BCD2-panD bacterial lawns were scraped and inoculated into a 50 mL sterile vented-cap test tube containing 3 mL of LB culture medium (containing 50 mg / L kanamycin), placed on a shaker at 37 °C at 220 rpm, and cultured for 12 hours to obtain an OD of 4 - 5. 600The inoculum solution was obtained. The inoculum solution obtained from the culture was inoculated at a 2% inoculum volume into a 500 mL baffled shake flask containing 30 mL of LB medium (containing 50 mg / L kanamycin) and placed on a shaker at 37 °C at 220 rpm for 2 hours of culture. Then 0.3 mM IPTG was added and induction was continued for 4 hours under the same conditions. 30 mL of aspartic acid solution was added to the baffled shake flask after induction (the pH was adjusted to 6.0 with sodium hydroxide), and the baffled shake flask was placed on a shaker at 37 °C at 220 rpm for 30 minutes. After centrifugation, the supernatant was taken and the yield of β-alanine was measured. Three parallel experiments were set up for each recombinant bacterium and the average value was taken. The β-alanine yields of recombinant bacteria overexpressing the panD gene from different origins are shown in Table 1. The β-alanine yields of recombinant bacteria overexpressing the panD gene derived from Bacillus subtilis (shown by SEQ ID NO: 2), Bacillus licheniformis (shown by SEQ ID NO: 3), C. glutamicum, and M. magnetotica are approximately 10 times higher than those of other recombinant bacteria. Among these, the L-aspartic acid α-decarboxylase from Bacillus licheniformis has the highest catalytic efficiency.
[0048]
Table 1
[0049] The catalytic performance of the recombinant bacterium Escherichia coli BL21 / pET28a-BCD2-panDBl was further confirmed using a 5 L bioreactor. The bacterial lawn of Escherichia coli BL21 / pET28a-BCD2-panDBl was scraped and inoculated into a 500 mL Erlenmeyer flask containing 50 mL of LB medium (containing 50 mg / L kanamycin (5 - 200 mg / L is acceptable)) and cultured on a shaker at 37 °C at 220 rpm for 4 hours to obtain an OD of 4 - 5. 600An inoculum solution was obtained. The inoculum solution obtained from the culture was inoculated into a 5 L bioreactor containing 2 L of inorganic salt medium at an inoculation amount of 2%. The culture temperature was 37 °C, the DO was controlled above 30%, and the tank pressure was controlled at 0.02 - 0.10 MPa. The pH was maintained at 6.9 under the control of ammonia feedback supplementation, and the glucose concentration in the culture medium was maintained at 5 g / L or less by a glucose supply reservoir. The OD of bacteria in the culture medium 600 When reached 30, 0.1 mM of the inducer IPTG was added. The OD of bacteria in the culture medium 600 reached approximately 80 after 4 hours. 10 g / L of L-aspartic acid was added as a substrate, and the pH was not controlled during the catalytic process. When the pH no longer increased, 10 g / L of L-aspartic acid was added. Solid aspartic acid was added intermittently 25 times, and the yield of β-alanine reached 140.5 g / L after 36 hours of catalytic reaction.
[0050] The inorganic salt medium components and the glucose reservoir components were as follows. Inorganic salt medium: 2 g / L (NH 4 ) 2 HPO 4 , 4 g / L of KH 2 PO 4 , 0.85 g / L of citric acid, 0.7 g / L of MgSO 4 ·7H 2 O, 10 mg / L of FeSO 4 ·7H 2 O, 2.25 mg / L of ZnSO 4 ·7H 2 O, 0.2 mg / L of CuSO 4 ·5H 2 O, 0.5 mg / L of MnSO 4 ·5H 2 O, 0.23 mg / L of NaB 4 O 7 ·10H 2 O, 2.0 mg / L of CaCl 2 ·2H 2 O, 0.1 mg / L of NH 4 Mo 7 O 2 , 0.15 mg / L of CoCl 2 ·6H2 O. The remaining amount was water. The glucose reservoir contained 700 g / L glucose and 20 g / L of MgSO4·7H2O, and the remaining amount was water.
[0051] Embodiment 4 Construction of Recombinant Bacteria for the Production of VB5 by Fermentation Using the high-fidelity polymerase KAPA-HiFi™ HotStar, with P1 and P2 as primers and the genomic DNA of the wild-type Escherichia coli strain K12MG1655 as a template, the nucleotide sequence amplified by PCR is shown in SEQ ID NO: 18. Here, 10 nt to 45 nt is the promoter trc, 74 nt to 868 nt is the coding sequence of the panB gene, and 880 nt to 1731 nt is the coding sequence of the panC gene. Primer P1 was designed to introduce a strong promoter trc, and primers P1 and P2 were designed to introduce BamHI and SphI restriction endonuclease sites at the 5'-ends of primers P1 and P2, respectively. The PCR program was as follows: denaturation at 98 °C for 30 seconds, annealing at 65 °C for 15 seconds, extension at 72 °C for 90 seconds, for 26 cycles. A fragment of the P trc -panBC gene was obtained.
[0052]
Chemical formula
[0053] The PCR-amplified P trc -panBC product was identified and recovered by gel electrophoresis, and then the Ptrc-panBC product and the pACYC184 plasmid were double-digested with BamHI and SphI. The above-mentioned PCR electrophoresis band was recovered by gel excision, and the amplified P trc- The DNA fragments of the panBC gene and the pACYC184 plasmid were double-digested with the restriction endonucleases BamHI and SphI. The double-digested Ptrc-panBC and pACYC184 plasmids were recovered by gel electrophoresis, ligated with T4 ligase, and the ligation product was chemically transformed into Escherichia coli DH5α competent cells. After culturing the transformed competent cells for 1 hour for recovery, they were plated on chloramphenicol plates. The plated plates were placed in a 37°C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBC.
[0054] Using P3 and P4 as primers, the nucleotide sequence amplified by PCR with the genomic DNA of Escherichia coli strain K12MG1655 as a template is shown in SEQ ID NO: 19. Here, 11nt - 45nt is the promoter of PJ23119, 66nt - 977nt is the coding sequence of the panE gene, and 988nt - 1731nt is the terminator sequence. The promoter PJ23119 was designed on the amplification primer P3, the terminator L3S2P56 sequence was designed on the primer P4, and SphI and BsaBI restriction endonuclease sites were designed at the 5' ends of primers P3 and P4, respectively. Using the above PCR reaction conditions, the PJ23119 - panE product obtained by amplification was identified and recovered by gel electrophoresis, and then double - digested with SphI and BsaBI. The pACYC184 - Ptrc - panBC plasmid was simultaneously double - digested with SphI and BsaBI. The double - digested PJ23119 - panE and pACYC184 - panBC plasmids were recovered by gel electrophoresis and ligated with T4 ligase, and the ligation product was chemically transformed into Escherichia coli DH5α competent cells. These were recovered and cultured for 1 hour and plated on chloramphenicol plates. The plated plates were placed in a 37°C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184 - panBCE. Thus, a recombinant plasmid overexpressing the vitamin B5 terminal synthesis pathway gene was obtained.
[0055]
Chem.
[0056] Use of the previously reported CRISPR-Cas9 gene editing system containing the pCas9 and pTargetF vectors (Y. Jiang, B. Chen, C.L. Duan, B.B. Sun, J.J. Yang, and S. Yang (2015) "Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system", Applied and Environmental Microbiology, Vol. 81, p. 2506-2514) The pTargetF vector was mutated with primers P5 and P6 designed according to the kit instructions using the Q5® Site-Directed Mutagenesis Kit (Product No. E0552S) from NEB. The mutated N20 sequence is CTTTTCCAAGC TGGGTCTACC and targets the avtA gene. The mutated pTargetF is designated pTargetFavtA.
[0057]
Chemical formula
[0058] The upstream sequence of the avtA gene was amplified using primers P7 and P8, and the PL promoter was amplified using primers P9 and P10. The BCD2-panDBs-Ter, BCD2-panDBL-Ter, and BCD2-panDCg gene fragments were amplified using primers P11 and P12, respectively, with pET28a-BCD2-panDBs, pET28a-BCD2-panDBl, and Escherichia coli BL21 / pET28a-BCD2-panDCg as templates. The downstream sequence of the avtA gene was amplified using primers P13 and P14. The above four fragments were ligated by overlap PCR to obtain the assembly of four DNA fragments, DonorBs (shown in SEQ ID NO: 20), DonorBl (shown in SEQ ID NO: 21), and DonorCg (shown in SEQ ID NO: 22). This served as a template for gene editing. Here, 1nt - 312nt of SEQ ID NOs: 20, 21, and 22 is the upstream sequence of the avtA gene of the target gene, 313nt - 474nt is the PL promoter, and 475nt - 560nt is the BCD2 sequence. 560nt - 943nt of SEQ ID NO: 20 is the panDBs sequence, 944nt - 995nt is the terminator sequence, and 996 - 1261nt is the downstream sequence of the avtA gene. 560nt - 943nt of SEQ ID NO: 21 is the panDBl sequence. 944nt - 995nt is the terminator sequence, and 996 - 1261nt is the downstream sequence of the avtA gene. 560nt - 970nt of SEQ ID NO: 22 is the panDCg sequence, 971nt - 1022nt is the terminator sequence, and 1023 - 1288nt is the downstream sequence of the avtA gene.
[0059] The pCas9 plasmid was transformed into MG1655, and then plated on a kanamycin-resistant plate containing 50 mg / L and incubated at 30 °C to obtain the strain MG655 / pCas9. The MG1655 / pCas9 bacterial lawn was picked into 50 mL of kanamycin-containing LB in a 500 mL shaking flask and cultured at 30 °C and 220 rpm. When the OD 600 of the medium reached 0.2, arabinose with a final concentration of 10 mM was added for induction. The OD 600Competent cells were prepared when it reached 0.45. 2 microliters of pTargetFavtA plasmid and 10 microliters of DonorBs template DNA were taken and electrotransformed into MG655 / pCas9 competent cells. These were coated on a double resistance plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30 °C. Single colonies with PL-BCD2-panD-Ter integrated on the avtA gene were identified using primers P15 and P16, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected and cultured with 0.2 mM IPTG to eliminate the pTargetFavtA plasmid, obtaining recombinant bacteria Escherichia coli MG1655 avtA:panDBs / pCas, Escherichia coli MG1655 avtA:panDBl / pCas, Escherichia coli MG1655 avtA:panDCg / pCas, and still preparing competent cells that could be used according to the above method.
[0060] Recombinant bacteria Escherichia coli MG1655 avtA:panDBs / pCas, Escherichia coli MG1655 avtA:panDBl / pCas, and Escherichia coli MG1655 avtA:panDCg were inoculated into non-resistant LB liquid medium and cultured at 37 °C for 12 hours. Then, the liquid medium was diluted and coated on LB plates to obtain recombinant bacteria Escherichia coli MG1655 avtA:panDBs, Escherichia coli MG1655 avtA:panDBl, and Escherichia coli MG1655 avtA:panDCg with the pCas plasmid eliminated respectively. The gene panD was inserted into the coding sequence of the chromosomal avtA gene. This led to the inactivation of avtA and weakened the competing valine metabolic pathway.
[0061] Wild-type Escherichia coli K12MG1655 has a mutation in the ilvG gene, which encodes an inactive acetolactate synthase. In this application, the active ilvG gene of Escherichia coli BL21 was introduced onto the chromosome of Escherichia coli MG1655. This improved the synthesis of the VB5 precursor acetolactate. ilvG derived from Escherichia coli BL21 +The M gene was inserted into the chromosome of Escherichia coli K12 MG1655, and the transcription start of ilvG + M was controlled using the strong trc promoter, and the transcription termination of ilvG + M was controlled using the terminator Ter. ilvG + The M gene was integrated onto another N20 target sequence of the avtA gene. The pTargetF vector was mutated using the Q5® Site-Directed Mutagenesis Kit and primers P17 and P18. The mutated pTargetF was designated pTargetFavtA1.
[0062]
Chemical formula
[0063] The upstream sequence of the avtA gene was amplified using primers P19 and P20, the ilvG + M sequence of Escherichia coli BL21 was amplified using primers P21 and P22, and the downstream sequence of the avtA gene was amplified using primers P23 and P24.
[0064]
Chemical formula
[0065] The above three fragments were ligated using overlap PCR. The assembled DonorilvGM (shown in SEQ ID NO: 23) was obtained as a template for gene editing. 1-305 nt of SEQ ID NO: 23 is the upstream sequence of the avtA gene of the target gene, 306 nt - 341 nt is the trc promoter, 367 nt - 2013 nt is the ilvG+ gene derived from the Escherichia coli BL21 coding sequence, 2010 nt - 2273 nt is the coding sequence of the ilvM gene, 2274 - 2328 is the terminator sequence, and 2329 - 2629 is the downstream sequence of the avtA gene.
[0066] Take 2 microliters of pTargetFavtA1 plasmid and 10 microliters of DonorilvGM template DNA, and electrotransform them into competent cells of Escherichia coli MG1655 avtA:panDBs / pCas, Escherichia coli MG1655 avtA:panDBl / pCas, and Escherichia coli MG1655 avtA:panDCg / pCas, respectively. Then, coat them on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubate at 30 °C. Ptrc-ilvG on the avtA gene + Single colonies incorporating M-Ter were identified using primers P25 and P26, and the PCR products of the correct size were confirmed by sequencing. Single colonies with the correct sequence were selected and cultured with 0.2 mM IPTG to eliminate the pTargetFavtA1 plasmid. Further add non-resistant LB liquid medium, culture at 37 °C for 12 hours, dilute, and coat on LB plates respectively to eliminate the pCas plasmid, obtaining recombinant bacteria Escherichia coli MG1655 avtA:panDBs-ilvG + M, Escherichia coli MG1655 avtA:panDBL-ilvG + M, and Escherichia coli MG1655 avtA:panDCg-ilvG + M. The synthesis of the VB5 precursor acetolactate was improved by the integration of active ilvG + M on the chromosome.
[0067] Transform the above-constructed vector pACYC184-panBCE into the above recombinant bacteria Escherichia coli MG1655 avtA:panDBs-ilvG + M, Escherichia coli MG1655 avtA:panDBl-ilvG + M, and Escherichia coli MG1655 avtA:panDCg-ilvG + M to obtain recombinant bacteria Escherichia coli MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE, Escherichia coli MG1655 avtA:panDBl-ilvG +M / pACYC184-panBCE and Escherichia coli MG1655 avtA:panDCg-ilvG + M / pACYC184-panBCE was obtained.
[0068] Some of them: SEQ ID NO:1: ATGATGGCCGGAAAACTGCACCGCGCTACCGTGACGGAAGCCAATTTAAACTATGTCGGC AGCATAACGATTGATGAAGATCTTTTAGATGCCGTCGGAATGCTCGCTAATGAAAAAGTT CAGATTGTGAATAATAATAACGGAGCGAGACTTGAAACGTATATTATTCCCGGTAAGCGG GGGAGCGGCGTCATCTGTTTAAATGGAGCTGCCGCCCGTCTCGTCCAAGAAGGAGATAAA GTCATTATTATTTCTTATCAAATGATGTCTGATCAGGAAGCAAAAAGCCATCAGCCGAAG GTGGCCGTTCTGGATGATCAGAATAAAATCGAGCAGATGCTGGGCCAGGAGCCGGCACAC ACGATTTTGTAA
[0069] SEQ ID NO:2: ATGTATCGAA CAATGATGAG CGGCAAACTT CACAGGGCAA CTGTTACGGA AGCAAACCTG AACTATGTGG GAAGCATTAC AATTGATGAA GATCTCATTG ATGCTGTGGG AATGCTTCCT AATGAAAAAG TACAAATTGT GAATAATAAT AATGGAGCAC GTCTTGAAAC GTATATTATT CCTGGTAAAC GGGGAAGCGG CGTCATATGC TTAAACGGTG CAGCCGCACG CCTTGTGCAG GAAGGAGATA AGGTCATTAT TATTTCCTAC AAAATGATGT CTGATCAAGA AGCGGCAAGC CATGAGCCGA AAGTGGCTGT TCTGAATGAT CAAAACAAAA TTGAACAAAT GCTGGGGAAC GAACCAGCCC GTACAATTTT GTAA
[0070] Sequence number 3: ATGTACCGTA CGTTAATGAG CGCAAAACTT CACAGAGCGA GAGTGACGGA AGCCAATTTG AACTACGTCG GCAGCGTGAC AATTGATGAA GATTTGCTGG ATGCTGTCGG AATGATGGCA AATGAAAAAG TGCAAATTGT GAATAATAAT AACGGGGCCC GGCTGGAAAC GTACATTATT CCCGGTGAAA GGGGCAGCGG CGTCGTTTGT TTAAACGGAG CTGCCGCCCG CCTTGTCCAG GTTGGAGATG TCGTCATCAT CGTGTCTTAT GCGATGATGT CTGAAGAGGA AGCAAAGACC CATAAGCCGA AGGTTGCCGT TTTGAACGAG AGAAACGAAA TCGAGGAAAT GCTGGGTCAG GAGCCAGCCC GTACCATTCT GTAA
[0071] Sequence number 4: ATGAAGCTGCACCTGCTGAAGAGCAAAATTCACAACGCGCGTGTTACCAGCGGTGACCTGGAGTACGAAGGCAGCATTACCATCGATCAGGAGCTGCTGCTGCTGGCGGAGATGATCCCGAACGAAAAAGTTCTGGTGGTGAACAACAACAACGGCGAGCGTTTCGAAACCTATATCATTAACGGTGAACCGGGCAGCCGTGTTATTCAGCTGAACGGTGCGGCGGCGCGTTGCGCGCTGCCGGGCGACGAGATCATTATCATGACCTTCGCGGTGATGGATGAAAAGAAAGCGCGTACCTTTCAACCGATGGTGCTGATCGTTGACCACCTGAACAACCCGAAGCGTCGTCACCGTATTGGCCAGGAAGACGAACAACTGAGCAGCAGCATCTAA
[0072] SEQ ID NO: 5: ATGCTGCGCACCATCCTCGGTAGCAAGATTCACCGCGCCACCGTCACCCAGGCCGACCTT GACTATGTCGGCTCCATCACCATCGACGCCGACCTGGTCAATGCCGCCGGCCTCATCGAG GGCGAGAAGGTCGCCGTCGTGGACATCACCAACGGCGCCCGCATTGAGACCTATGTGATC ACCGGCGATGCCGGAACCGGCAGCATCTGCATCAATGGTGCCGCCGCCCATCTGATCAAC CCGGGTGATCTGGTCATCATCATGAGCTATCTGCAGGCCACCGATGCCGAGGCCCGCGCC TACCAGCCCAATATCGTCCACGTGGATGCCGACAACCGGATCGTCGCCCTGGGCAACGAC GCCGGCGAGCCCATCCCGGGTTCCAGCTTGCTGTCCTCGCGCTCCCTCTAA
[0073] SEQ ID NO: 6: ATGCTGCGCA CCATCCTCGG AAGTAAGATT CACCGAGCCA CTGTCACTCA AGCTGATCTA GATTATGTTG GCTCTGTAAC CATCGACGCC GACCTGGTTC ACGCCGCCGG ATTGATCGAA GGCGAAAAAG TTGCCATCGT AGACATCACC AACGGCGCTC GTCTGGAAAC TTATGTCATT GTGGGCGACG CCGGAACGGG CAATATTTGC ATCAATGGTG CCGCTGCACA CCTTATTAAT CCTGGCGATC TTGTGATCAT CATGAGCTAC CTTCAGGCAA CTGATGCGGA AGCCAAGGCG TATGAGCCAA AGATTGTGCA CGTGGACGCC GACAACCGCA TCGTTGCGCT CGGCAACGAT CTTGCGGAAG CACTACCTGG ATCCGGGCTT TTGACGTCGA GAAGCATTTAA
[0074] SEQ ID NO: 7: ATGCTCAGAACCATCCTCGGCAGCAAAATCCACCGCGCCACGGTCACCCAGGCAGACCTC AACTACGTGGGGTCCGTCACGGTCGACGCCGACCTGCTCGCGGCCGCCGGCCTCATCGAG GGCGAAAAGGTGGCCATCGTCGACGTCACCAACGGTGCCAGGCTGGAGACCTACGTCATC ACCGGTCGCCCGGGCACCGGCGAGATCTGCATCAACGGTGCGGCGGCGCACCTGATCCAC CCGGGCGACATCGTCATCCTCATCTCCTACCTGCAGGCCACCCTGGACGAGGCCCTCGAA TACGAGCCGCGCATCGTCCACGTCGACGAGAACAACCGCATCGTCGCCCTGGGCAATGAC ATCGCCGAGGCCGTCCCGGGCTCCGACACCGTCTCCGCCCGGAACATCTAA
[0075] SEQ ID NO: 8 ATGATTCGCA CGATGCTGCA GGGCAAACTC CACCGCGTGA AAGTGACTCA TGCGGACCTG CACTATGAAG GTTCTTGCGC CATTGACCAG GATTTTCTTG ACGCAGCCGG TATTCTCGAA AACGAAGCCA TTGATATCTG GAATGTCACC AACGGCAAGC GTTTCTCCAC TTATGCCATC GCGGCAGAAC GCGGTTCGAG AATTATTTCT GTTAACGGTG CGGCGGCCCA CTGCGCCAGT GTCGGCGATA TTGTCATCAT CGCCAGCTTC GTTACCATGC CAGATGAAGA AGCTCGCACC TGGCGACCCA ACGTCGCCTA TTTTGAAGGC GACAATGAAA TGAAACGTAC CGCGAAAGCG ATTCCGGTAC AGGTTGCTTAA
[0076] SEQ ID NO: 9 ATGCGTCGTTGGCTGCTGAAGAGCAAACTGCACCGTGCGCGTGTGACCGGTACCGAGAAGGACTACGAAGGCAGCATCAGCATTGATGCGGCGCTGCTGAGCGAGGCGGACATTGCGGTGGGTGAACAGGTTCAAGTGGTTAACGTTACCAACGGCGAGCGTTTCGAAACCTATACCATTGAGGGTGAAAGCCGTCAGATGGAGCTGAACGGTGCGGCGGCGCGTCTGGCGGAAACCGGTGATGTGATCATTGTTATCAGCTACGGCCTGTATGTGAAAGATGAGCAACCGGAACCGACCGTTCTGCTGCTGGACGAGGAAAACCGTATTAGCGAGCGTGAATAA
[0077] SEQ ID NO: 10: ATGCAGCGTACCTTCCTGAAGAGCAAACTGCACCGTCTGACCACCACCATCCGTGGCAAGGAGAACAGCGGCGTGATTCTGGTTAACGGTGTGGCGCCGCACAAAGTTGCGGGCGACCTGCTGATCATTGCGGCGTACAGCAGCTATAGCGAGGATGAACTGCGTAACTACCAACCGGCGCTGTGCTATGTTGACGAAAAGAACGTGCTGACCCGTATCAGCCGTTAA
[0078] SEQ ID NO: 11:
[0079] SEQ ID NO: 12: ATGATGAAGATCATTCGTGCGAAACTGCACGGCATCCGTGTGACCAACGCGGATCTGAACTACCACGGCAGCATTACCCTGGACCCGGAGCAGTGCGAAATGGCGGGTATCTATCCGATGGAGTTCGTTGATATTTGGAACAAGAACAGCGCGGCGCGTATCAGCACCTACGTGATTTTTGGTGAACCGGGCAGCCGTTGCTGCGTTCTGAACGGTGCGGCGGCGCGTACCTGCCAAAAAGGCGACGAGCTGATCATTGCGGCGAGCGCGGATATCAGCGGTCCGGAAAAGCTGTACGACATCAAACCGCGTATTCTGACCTTCCTGCCGGACAACCACGTGGATCAGGTTCTGTACTATGATGTGTTCCAAAGCGAGAAGCGTCCGTATGACTTTCGTATCGTTGACGCGGATAAACACACCATTGAAAGCTGCCACACCTGGCCGAACGTGGACATCACCAAGCTGCGTAGCGATCTGGCGGCGAAAGGTTGGAGCGAGGCGGAAATCGACAGCTTCATTGCGAGCCACTTTAGCCTGTAA
[0080] SEQ ID NO: 13:
[0081] SEQ ID NO: 14: ATGCTGAACATCACCACCGGTGCGCGTTTCACCACCTACGCGATCGAAGCGCCGCGTGGCAGCAAAGTGATTGGTGTGAACGGTGCGGCGGCGCGTCTGGTGCAGAAGGGTGACAAAGTTATCGTGGTTACCTACGGCATGCTGCCGGAGGAAGAGGCGCGTAACTATAACCCGACCGTGGTTCTGCTGGACGATGGTAACCTGATTAAACGTGCGGCGTAA
[0082] SEQ ID NO: 15: ATGGTGGACACCCCGTACCGTAAGATGCTGGCGGCGAAAATCCACCGTGCGACCGTGACCGGTGCGGATGTTAACTATGAAGGCAGCCTGACCGTGCCGCCGGAACTGCTGGTTGCGGCGAAGATCCACCCGTACGAGAGCCTGCACGTGTGGAACGTTACCCGTGGTACCCGTCTGGAGACCTATGCGATTGAAGGCCTGCCGAACAGCAACGACGTGTGCGCGAACGGTGCGGCGGCGCACCTGATTCGTCCGGGTGACCATGTGATTCTGGCGGCGTATGCGATGGTTCCGGAGGCGGATGCGGCGACCCACAAACCGCGTCTGATCTTCGTGGACGATAACAACCAGCTGAGCCACGTTGGTCCGGAAATTGCGGGTCCGAACCTGCGTAGCGACAGCGACGATACCCACCTGGTTCGTAGCACCGAGATGACCCCGGATGGTCAACCGCTGGCGGAAGGCTGCTAA
[0083] SEQ ID NO: 16: ATGCTGAACATCTACCTGAAGAGCAAAATCCACATGGCGACCATTACCCGTAAAGAGGTGTACTATGAAGGTAGCATCGAGATTGACGAGGAACTGATGGGTAAAGCGGGCATTAGCGAGGGCGAACTGGTTCTGGTGGTGAACGTTAACAACGCGGAACGTTTCGTGACCTACGTTATCAAGGGTAAACGTGGCAGCCGTGAGATTAACCTGTATGGTGCGGCGGCGCGTCTGGGCGAGGAAGGCGACCGTGTGATCATTATGGCGTTCACCTTTAGCGATAAGCCGGTGAAGGCGAAAACCATCGTTCTGAACGAGAAGAACGAAATTGTTCAGGAAAAATAA
[0084] Sequence number 17: CCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACATCTTAATCATGCTAAGGAGGTTTTCTAATG
[0085]
Chem.
[0086]
Chem.
[0087]
Chem.
[0088]
Chem.
[0089]
Chem.
[0090] [Chemistry]
[0091] [Chemistry]
[0092] [Chemistry]
[0093] [Chemistry]
[0094] [Chemistry]
[0095] [Chemistry]
[0096] [Chemistry]
[0097] Embodiment 5 Fermentation Experiment of VB5 Gene-Recombinant Bacteria Test strain Escherichia coli MG1655 avtA:panDBs-ilvG + M / pACYC184-panBCE, Escherichia coli MG1655 avtA:panDBl-ilvG + M / pACYC184-panBCE, and Escherichia coli MG1655 avtA:panDCg-ilvG +M / pACYC184-panBCE was streaked onto a solid LB agar plate containing 34 mg / L chloramphenicol and incubated at 37 °C for 12 h. The bacterial lawn on the plate was picked up, inoculated into an LB agar slant, and incubated at 37 °C for 10–12 h. The bacterial lawn on the plate was picked up, inoculated into a liquid LB medium, and cultured at 37 °C with shaking at 220 rpm for 12 h to obtain a seed culture solution. The seed culture solution was inoculated into the fermentation medium at an inoculum size of 3%, and cultured at 37 °C with shaking at 220 rpm.
[0098] Fermentation medium: 80 g / L MOPS, 20.0 g / L glucose, 10.0 g / L ammonium sulfate, 2.0 g / L potassium dihydrogen phosphate, 2.0 g / L magnesium sulfate heptahydrate, 5.0 g / L yeast extract, 5 mL / L trace element mixed solution. The remaining amount was water. Trace element mixed solution: 10 g / L FeSO 4 -7H 2 O, 1.35 g / L CaCl 2 , 2.25 g / L ZnSO 4 -7H 2 O, 0.5 g / L MnSO 4 -4H 2 O, 1 g / L CuSO 4 -5H 2 O, 0.106 g / L (NH 4 ) 6 Mo 7 O 24 -4H 2 O, 0.23 g / L Na 2 B 4 O 7 -10H 2 O, 0.48 g / L CoCl 2 -6H 2 O, 10 mL / L 35% HCl. The remaining amount was water.
[0099] During the incubation, the pH value of the reaction system was adjusted with ammonia and maintained at 6.8 - 7.0. During the incubation, samples were taken every 4 hours, and the glucose content was detected by using a biosensor analyzer SBA - 40D. When the glucose content in the system was lower than 5 g / L, glucose was supplemented to make the glucose concentration in the system reach 20 g / L. After incubating the sample for 24 hours, the supernatant was centrifuged at 12000 g for 2 minutes, and the supernatant was taken to detect the VB5 content (Table 2).
[0100]
Table 2
[0101] This application confirms that the screened panD derived from Bacillus licheniformis has the highest activity and can significantly improve the fermentation yield of VB5 by both β - alanine whole - cell catalysis and VB5 fermentation.
[0102] It should be noted that the foregoing are only preferred embodiments of this application, and those skilled in the art can make some improvements and modifications without departing from the principle of this application, and these improvements and modifications are also regarded as within the protection scope of this application.
Claims
1. Use of enhanced expression of the L-aspartate α-decarboxylase gene panD in the production of vitamin B5, The L-aspartate α-decarboxylase is derived from Bacillus licheniformis. use.
2. The use according to claim 1, wherein the L-aspartate α-decarboxylase gene panD has: (I) the nucleotide sequence set forth as SEQ ID NO: 3; or (II) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence shown as (I) and having the same or similar function as the nucleotide sequence shown as (I); or (III) A nucleotide sequence having at least 80% homology to the nucleotide sequence designated as (I) or (II).
3. 3. The use according to claim 1 or 2, further comprising: (1) inserting a strong promoter and / or a strong RBS into the avtA gene, wherein the strong promoter is PPL and the strong RBS is BCD2; and / or (2) expressing the ilvGM gene from Escherichia coli BL21; and / or (3) Increasing the copy number of the panB gene, panC gene, and / or panE gene.
4. An expression vector comprising the L-aspartate α-decarboxylase gene panD, The L-aspartate α-decarboxylase is derived from Bacillus licheniformis. vector.
5. The expression vector of claim 4, further comprising: (I) a strong promoter and / or a strong RBS, and / or (II) the ilvGM gene derived from Escherichia coli BL21, and / or (III) Increased copy number of panB, panC, and / or panE genes.
6. A host in which the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis is expressed.
7. The host of claim 6 further comprising: (I) a strong promoter and / or a strong RBS, and / or (II) the ilvGM gene derived from Escherichia coli BL21, and / or (III) Increased copy number of panB, panC, and / or panE genes.
8. The expression vector according to claim 4 or 5 is transfected or transformed, Preferably, the host is derived from Escherichia coli; More preferably, the host is derived from Escherichia coli K12; More preferably, the host is derived from the Escherichia coli K12 MG1655 strain. The host according to claim 6 or 7.
9. Use of the expression vector of claim 4 and the host of claim 6 in the production of vitamin B5.
10. A method for producing vitamin B5, wherein the host according to claim 6 is used as a fermentation strain without the addition of β-alanine, and is fermented, the fermentation broth is collected, and the supernatant is centrifuged to obtain vitamin B5.