Method for spatial tracking and sequencing of cells or organelles

The method of labeling cells with identification nucleic acids and using triangulation principles addresses the lack of spatial localization in single-cell sequencing, enabling spatially resolved single-cell analysis and improved understanding of tumor-microenvironment interactions.

JP2025524563APending Publication Date: 2025-07-30PARIS SCI & LETTRES +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500033
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-12
Filing Date
2023-07-12
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

Current single-cell sequencing techniques fail to provide spatial localization of cells within tissues, leading to a loss of localization information and limited understanding of tumor-microenvironment interactions, as they require cell dissociation and lack correlation between molecular signals and tissue space localization.

Method used

A method involving labeling individual cells or organelles with identification nucleic acid sequences using emitter and receptor nucleic acids, followed by isothermal amplification and diffusion, allowing reconstruction of spatial arrangements and sequencing with positional mapping based on triangulation principles.

Benefits of technology

Enables single-cell 'omics' analysis with spatial resolution, reconstructing cell networks and mapping individual cells' positions within biological samples, facilitating better understanding of tumor adaptation mechanisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524563000016
    Figure 2025524563000016
  • Figure 2025524563000017
    Figure 2025524563000017
  • Figure 2025524563000018
    Figure 2025524563000018
Patent Text Reader

Abstract

The present invention relates to a labeling solution on or in a biological sample that enables the assignment of identification tags to regions of a biological sample containing single or multiple cells or organelles, such as about 2 to 10 cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a labeling solution on or in a biological sample that enables the assignment of identification tags to regions of a biological sample containing single or multiple cells or organelles, such as about 2 to 10 cells.

Background Art

[0002] Current single-cell sequencing techniques are very powerful, for example, enabling access to "omics" information (genome, epigenome, transcriptome, proteomics, etc.) for each cell in a sample, but require dissociation of the cells, which leads to loss of localization information for each cell in the starting sample.

[0003] Indeed, a major problem in, for example, oncology is how to accurately characterize tumor / microenvironment interactions, which require access to both molecular signals and the tissue space localization of the cells that exchange these signals. These interactions can play a major role in the survival or death of tumor cells. Better understanding of these interactions will help to overcome the adaptive mechanisms that occur in tumor systems.

[0004] "Omics" technologies have revolutionized molecular biology by enabling very large-scale genomic, transcriptomic, epigenomic, and proteomic analyses. However, until recently, only "average" profiles of multiple cells that do not take into account the heterogeneity of cells present in healthy and diseased tissues have been obtained. Recently, many technologies for single-cell analysis have been developed. In particular, droplet microfluidic systems in which individual cells are co-encapsulated in droplets with beads having barcoded primers to enable RNA sequencing at the single-cell level (scRNA-seq) from thousands of cells. However, in these systems, the cells in the tissue are dissociated before analysis, and there is no correlation between the single-cell sequencing data and the localization of these same cells in the original tissue.

[0005] Single-cell analysis techniques that enable spatial localization of measured signals are currently very limited with respect to both the number of targets (immunohistochemistry, in situ RNA hybridization) and the number of cells (e.g., sequencing of individual cells after laser capture microdissection (LCM)). "Spatial transcriptomics" (Vickovic, Sanja, et al. Nature methods 16.10(2019):987-990.), "Slide-seq" (Rodriques, Samuel G., et al. Science 363.6434(2019):1463-1467) and "DNA nanoball stereo-sequencing" (Chen et al., "Large Field of View-Spatially Resolved Transcriptomics at Nanoscale Resolution" bioRxiv 2021.01.17.427004) systems enable spatial resolution in individual tissue sections but do not provide access to single-cell data. "XYZ-seq" (Lee et al., Sci Adv. 2021 Apr 21;7(17):eabg4755) measures single-cell expression across the genome but has low spatial resolution (500 μm resolution) and has fewer mRNA reads and fewer detected genes than standard scRNA-seq. Fluorescent in situ sequencing (FISSEQ) uses in situ sequencing to spatially localize the expression of multiple genes in fixed tissue with short reads (30 bases) and only about 200 mRNA reads per cell (compared to about 40,000 in scRNA-seq). The Digital Spatial Profiler (DSP) is a platform developed by Nanostring based on the sequencing of photocleavable oligonucleotide markers released from target tissue regions by UV exposure. Data on the localization of cells in tissue provide numerical and spatial profiles of RNA or target abundance. However, this technique does not provide access to the complete transcriptome, does not have single-cell resolution, and enables analysis of only a few regions.

[0006] In summary, current technological tools for studying cell-cell interactions, at the single-cell level, in an organization are still limited because they only allow for the spatial localization of signals from a limited number of molecular targets for a large number of cells, or the measurement of a large number of molecular targets for a limited number of localized (microdissected) cells, or the measurement of a large number of molecular targets on thousands of non-localized cells.

[0007] Currently, linking (i) intra-tissue spatial localization information of each cell and (ii) measurement of molecular signals from each of these same cells for thousands of individual cells represents a major technical challenge and, for example, a clinical need to better understand the adaptation mechanisms that occur in tumors and accordingly adjust the treatment of patients.

[0008] The methods and kits provided by the present invention meet this need for a system that enables single-cell "omics" analysis of thousands of cells with spatial resolution of up to dozens of cells derived from an organization.

Summary of the Invention

[0009] The present invention is a method for labeling individual cells or organelles in a biological sample with an identification nucleic acid sequence, the method comprising: a) providing a first set of nucleic acids ("emitter nucleic acids"), each nucleic acid molecule comprising an amplification sequence, an identification sequence, and a capture sequence; b) providing a second set of nucleic acids ("receptor nucleic acids"), each receptor nucleic acid being covalently or non-covalently coupled to a ligand of a cell target or organelle target, the receptor nucleic acid comprising i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement; c) contacting a set of emitter nucleic acid and receptor nucleic acid in solution with a biological sample such that individual cells or organelles within the biological sample are labeled with at least the receptor nucleic acid; d) releasing a plurality of nucleic acid molecules (the "released nucleic acid") that are copies of regions of the emitter nucleic acid that include an amplification sequence, a discrimination sequence, and a capture sequence, or reverse complements thereof, and hybridizing the released nucleic acid to the receptor nucleic acid; e) dissociating the biological sample and recovering individualized cells or organelles, wherein at least a subpopulation of the individualized cells or organelles is labeled with the released nucleic acid.

[0010] In a second aspect, the present invention is a method for mapping and sequencing individual cells or organelles of a biological sample, the method comprising: a) providing individualized cells labeled with (i) a nucleic acid comprising an amplification sequence, a discrimination sequence, and a capture sequence, or (ii) the reverse complement of (i), obtainable by a method for labeling individual cells or organelles according to the present invention; b) capturing the individualized cells or organelles labeled with the nucleic acid or its reverse complement within a compartment, the compartment comprising a compartment-specific nucleic acid and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site; c) optionally, analyzing the captured cells, organelles, and / or molecules secreted by them using optical detection; d) lysing the captured cells, or cells and organelles, thereby releasing nucleic acid from the cells or organelles within the compartment; e) associating (i) the compartment-specific sequence, (ii) the nucleic acid released from the cells or organelles within the compartment, and (iii) a nucleic acid comprising an amplification sequence, a discrimination sequence, and a capture sequence, or reverse complements thereof; f) recovering the nucleic acid produced in step e) from the compartment and sequencing the recovered nucleic acid. g) Define a nucleic acid comprising the same compartment-specific sequence as that derived from the same single cell, and map the position of the original single cell on the biological sample based on the identification sequence or its reverse complementary sequence contained in the nucleic acid generated in step e), thereby combining the mapping and sequencing information of individual cells in the biological sample; h) Determine the relative ratio of the same identification sequence or its reverse complementary sequence contained in the nucleic acid generated in step e), and map the position of the original single cell on the biological sample by estimating the distance between cells based on the principle of triangulation; i) Optionally, map and return the sequencing information onto the microscopic image of the biological sample obtained before dissociation.

[0011] In a third aspect, the present invention relates to a) An emitter nucleic acid, wherein each emitter nucleic acid comprises an amplification sequence, an identification sequence, and a capture sequence; b) A receptor nucleic acid, wherein each receptor nucleic acid comprises i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement; c) A ligand for a cell target or an organelle target; d) Optionally, a nicking endonuclease and a polymerase having strand displacement activity, and relates to a kit comprising the same.

Mode for Carrying Out the Invention

[0012] The present invention relates to a solution for assigning identification nucleic acids by diffusion into regions of biological samples, such as tissue sections containing multiple cells or organelles, through cells (optionally permeabilized), for example, about 2 to 10 cells. Since cells carrying the same identification nucleic acid are in the same region, it enables the reconstruction of the network of adjacent cells after dissociation of the biological sample and the single-cell analysis of cellular nucleic acids, and thus the reconstruction of the spatial arrangement of the cells before dissociation. Different ratios of specific identification nucleic acids make it possible to estimate the original distances between cells based on the principle of triangulation. The present invention relies on the local isothermal amplification or pre-amplification of the identification nucleic acid sequences followed by their diffusion. The identification nucleic acid sequences can be associated with surrounding cells via ligands modified to conjugate with the generated nucleic acids.

[0013] Accordingly, the present invention enables the use of current technologies (droplet microfluidics, valve microfluidics, microplates, thermally actuated hydrogels) to dissociate (single cells), analyze, and sequence the cells of a biological sample individually, with each cell having the potential to determine its position in the starting biological sample.

[0014] Method for labeling individual cells or organelles In a first aspect, a method is provided for labeling individual cells or organelles within a biological sample with identification nucleic acid sequences.

[0015] In a first embodiment, a solution containing a ligand carrying a first set of nucleic acids called "emitter nucleic acids" that include an identification sequence, and a ligand carrying a second set of nucleic acids called "receptor nucleic acids" is contacted with a biological sample. After conjugation of the ligand to cells or organelles, the biological sample is rinsed before adding to the surface of the tissue a second solution containing a nickase, a polymerase having strand displacement activity, and optionally, additional nucleic acids for improving local amplification in a buffer compatible with the enzymatic activities. By the action of the endonuclease and polymerase on the emitter nucleic acids, some copies of these nucleic acids containing the identification sequence are released. Then, copies of these "released nucleic acids" containing the identification sequence are captured onto the "receptor" ligand by hybridization on the receptor nucleic acids.

[0016] In a second embodiment, the emitter nucleic acids containing an identification sequence are amplified using rolling circle amplification (RCA) to form concatemers of the same nucleic acid before contacting the biological sample with a restriction enzyme to break the concatemers. The ligand carrying the receptor nucleic acids is also contacted with the biological sample. The cleaved concatemer fragments become associated with the cells or organelles by hybridization on the receptor nucleic acids. Alternatively, in this second embodiment, the nucleic acids containing an identification sequence can be provided in the form of beads having a plurality of emitter nucleic acids containing the same identification sequence.

[0017] As used herein, a biological sample includes any network of adjacent cells such as a tissue sample, an organoid, a 2D cell culture (particularly a 2D confluent cell culture), or a 3D cell culture. The biological sample can be any of fresh, frozen, or fixed. According to one embodiment, the biological sample is a tumor tissue sample.

[0018] In the framework of the method, a first set of nucleic acids ("emitter nucleic acids") is provided in which each nucleic acid molecule preferably contains, in the 5'-3' direction, an amplification sequence, an identification sequence, and a capture sequence in succession.

[0019] At least a part of the nucleic acid molecules of the set of emitter nucleic acids is different from other nucleic acid molecules by at least a discriminant sequence. According to one embodiment, at least a part of each nucleic acid molecule of the set of emitter nucleic acids is different from other nucleic acid molecules by at least a discriminant sequence. The different discriminant sequences can be barcode sequences or can include both a constant sequence and a barcode sequence. A "barcode sequence" means a nucleic acid sequence that presents a random or defined (i.e., known) sequence.

[0020] According to some embodiments, the amplification sequences are identical in all or part (preferably all) of the nucleic acid molecules of the set of emitter nucleic acids.

[0021] According to some embodiments, the capture sequences are identical in all or part (preferably all) of the nucleic acid molecules of the set of emitter nucleic acids.

[0022] The emitter nucleic acids are preferably at most 110, 100, 90, 80, 70 or preferably 60 nucleotides in length, although longer sequences can also be used. Typically, each of the amplification sequence, the discriminant sequence and the capture sequence is 10 - 30 nucleotides in length, preferably 12 - 25 nucleotides in length.

[0023] In some embodiments, the emitter nucleic acid further includes a nicking site (for a nicking endonuclease), as well as several consecutive nucleotides adjacent to the nicking site (forming a priming site), enabling priming for amplification by polymerization and nicking.

[0024] The emitter nucleic acid is preferably a DNA molecule and can be single-stranded DNA or partially double-stranded DNA (hairpin DNA).

[0025] For example, the emitter nucleic acid

[0026] [Table 1] comprises or consists of, wherein the underlined nucleotides represent the capture array, the italicized nucleotides represent the barcode array which is the identification array, and the bold nucleotides represent the amplification array together with the nicking site, the priming site, the loop and the reverse complement of the priming site (for self-priming).

[0027] According to a first embodiment of the method, each emitter nucleic acid is bound to a ligand of a cellular target or an organellar target.

[0028] According to this embodiment, the emitter nucleic acid further comprises a sequence complementary to the nicking site at the 3' of the amplification array.

[0029] According to a second embodiment of the method, a set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids, and all emitter nucleic acids of the group contain the same identification array. According to this embodiment, each emitter nucleic acid is not bound to a ligand of a cellular target or an organellar target.

[0030] In particular, the group of emitter nucleic acids can be provided in the form of a concatemer of emitter nucleic acids generated by rolling circle replication, wherein each concatemer contains the same emitter nucleic acid. The group of emitter nucleic acids can also be provided in the form of beads carrying emitter nucleic acids containing the same identification array or beads carrying the same emitter nucleic acid.

[0031] In this second embodiment, the sequence of the emitter nucleic acid then contains a restriction site or a cleavage site (e.g., via photocleavage, diol bond, peptide bond, or modified bases such as uracil, methylation or RNA) in order to release the region of the emitter nucleic acid containing the amplification array, the identification array, and the capture array from the concatemer or the beads, particularly in the case of a restriction site, under the action of a restriction enzyme.

[0032] In the framework of this method, a second set of nucleic acids ("receptor nucleic acids") is provided, each receptor nucleic acid being covalently or non-covalently coupled to a ligand of a cell target or an organelle target.

[0033] The receptor nucleic acid is designed to include i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement.

[0034] As used herein, the term "matches" indicates that one sequence has perfect identity with another sequence over a stretch of contiguous nucleotides, preferably over at least 8, 10, 12, 14, 16, or more contiguous nucleotides, and more preferably over the entire length of the shorter of the two sequences.

[0035] According to some embodiments, the receptor nucleic acid can further include a restriction site (for an endonuclease) or a cleavage site (e.g., via photocleavage, diol bond, peptide bond, or modified bases such as uracil, methylation, or RNA) such that, at an appropriate time point, e.g., after isolation in a compartment for single-cell barcoding, the receptor nucleic acid can release an identifying sequence to which it was captured.

[0036] For example, the receptor nucleic acid can be AACACCAAACCCTTCTAAAGCCCAAACCTC (SEQ ID NO: 3, which can include or consist of the capture sequence of the emitter nucleic acid of SEQ ID NO: 2) or

[0037] [Table 2] It may comprise or consist of. At SEQ ID NO: 4, the bold nucleotides represent the sequence that hybridizes to the quencher, the stretch of nucleotides in standard letters consists of SEQ ID NO: 3, and the underlined nucleotides represent the spacer with biotin.

[0038] The receptor nucleic acid is typically 10 - 30 nucleotides in length, preferably 12 - 25 nucleotides in length.

[0039] The receptor nucleic acid is preferably a DNA molecule, more preferably single-stranded DNA. The receptor nucleic acid can also be double-stranded and partially single-stranded DNA to enable ligation with the released sequence.

[0040] The ligand binds to a cellular target or an organellar target in a biological sample. According to one embodiment, the ligand binds to one or more receptors on the surface or inside of a cell. According to another embodiment, the ligand binds to one or more receptors on the surface or inside of a cellular organelle. As used herein, organelles include, but are not limited to, mitochondria, chloroplasts, endoplasmic reticulum, flagella, Golgi apparatus, nucleus, and vacuoles.

[0041] For example, the target present on the surface or inside of a cell or organelle is selected from the group consisting of cell or organelle surface proteins (e.g., CD45, CD3, CD19, CD98, CD298, β2 microglobulin), carbohydrates (e.g., mannose, galactose, N-acetylglucosamine), and components of the lipid bilayer of the cell or organelle.

[0042] Preferably, the ligand is selected from the group consisting of antibodies, aptamers, lectins, and peptides.

[0043] According to one embodiment, the cell target or organelle target bound by the ligand is a target that ubiquitously exists on the surface or inside all or most of the cells or cell organelles in the biological sample (e.g., CD98, CD298, β2 microglobulin, lectin, mannose, galactose, lipid bilayer).

[0044] According to another embodiment, the cell target or organelle target bound by the ligand exists only on the inside or surface of a subset of cells or organelles in the tissue sample (e.g., CD45, CD3, CD19).

[0045] The ligands of the receptor nucleic acids may all be the same or different, and preferably all are the same.

[0046] The ligands of the emitter nucleic acids may all be the same or different, and preferably all are the same.

[0047] In one embodiment, the ligands of the emitter nucleic acid and the receptor nucleic acid are the same.

[0048] According to the method for labeling individual cells or organelles, the set of emitter nucleic acid and receptor nucleic acid is contacted with the biological sample in solution so as to label at least the receptor nucleic acid the individual cells or organelles within the biological sample.

[0049] In the case of organelle analysis, the biological sample (e.g., tissue sample) may need to be permeabilized in order to allow the copies of the nucleic acid to diffuse through the permeabilized cells and reach the organelles. To enable the nucleic acid to reach the organelles, alternative methods known to those skilled in the art may be used, such as beads carrying an emitter nucleic acid having a permeable peptide at one end, or an antibody specific for a cell surface receptor that induces receptor-mediated endocytosis and results in internalization of the antibody when bound.

[0050] According to a first embodiment of a method in which each emitter nucleic acid is bound to a ligand of a cellular target or an organellar target, both the receptor nucleic acid and the emitter nucleic acid label the cells or organelles of a biological sample.

[0051] In this first embodiment of the method, the production of the released nucleic acid containing the amplification sequence, the discrimination sequence, and the reverse complement of the capture sequence is carried out by isothermal amplification of the emitter nucleic acid by nicking and polymerization, catalyzed by a nicking endonuclease and a polymerase having strand displacement activity. Thus, step c) of the method further comprises adding a nicking endonuclease and a polymerase having strand displacement activity to a solution containing the set of emitter nucleic acid and receptor nucleic acid and contacting the biological sample. The 3' portion of the emitter nucleic acid can be directly self-primed for polymerization or can be primed by the addition of a free oligonucleotide that hybridizes to the 3' portion of the emitter nucleic acid to improve local amplification.

[0052] According to a second embodiment of the method in which the set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids having the same discrimination sequence, only the receptor nucleic acid labels the cells or organelles of the biological sample.

[0053] In this second embodiment, the emitter nucleic acids of the group (concatemer or beads) are cleaved by a restriction endonuclease to release multiple copies of the region of the emitter nucleic acid containing the amplification sequence, the discrimination sequence, and the capture sequence ("released nucleic acid").

[0054] In both embodiments of the method, the biological sample is typically incubated with the emitter nucleic acid, the acceptor nucleic acid, and (i) a nicking endonuclease and polymerase, or (ii) a restriction endonuclease (optionally), at 25°C to 37°C for 10 to 60 minutes. The solution contains a buffer compatible with enzyme activity. If a cleavage site (such as via photocleavage, diol bond, peptide bond, or modified base such as uracil, methylation, or RNA, as described above) is present, the biological sample is typically exposed to UV light or an adapted chemical agent capable of cleaving such bond.

[0055] After contacting / incubation, the biological sample is preferably rinsed.

[0056] In some embodiments, an image of the biological sample is taken by a microscope, optionally a fluorescent microscope, before dissociation. Labeling of the biological sample, for example, fluorescent labeling, can be performed before, simultaneously with, or even after labeling with the receptor nucleic acid and the released nucleic acid. In some embodiments, fluorescent probes specific to one or several recognition sequences are used to facilitate mapping of the reconstructed network with the actual image.

[0057] The image of the biological sample may be taken by a microscope before step d), or before step e), or between steps d) and e).

[0058] The method further includes dissociating the biological sample and recovering the individualized cells or organelles, wherein at least a subpopulation of the individualized cells or organelles is labeled with released nucleic acid comprising the amplification sequence, the discrimination sequence, and the capture sequence, or their reverse complements.

[0059] Dissociation of biological samples can be achieved using, for example, collagenase I, Dnase I, and hyaluronidase.

[0060] Methods for mapping and sequencing individual cells or organelles Can it be obtained by the above method of mapping individual cells or organelles, or can the individualized cells labeled with the released nucleic acid obtained be further used for sequencing? According to one embodiment, a method for mapping and sequencing individual cells or organelles includes performing the labeling method of the present invention to provide individual cells or organelles labeled with the released nucleic acid. Thus, the individualized cells are labeled with (i) a nucleic acid comprising an amplification sequence, an identification sequence, and a capture sequence, or (ii) their reverse complements.

[0061] The method of mapping and sequencing (further) includes capturing individualized cells or organelles labeled with the released nucleic acid within a compartment, the compartment comprising a compartment-specific nucleic acid and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site.

[0062] In one embodiment, a single cell or a single organelle is captured within the compartment.

[0063] The compartment may include a plurality of compartment-specific nucleic acids for specifically targeting different nucleic acids. Preferably, the compartment-specific nucleic acid includes a barcode specific to the compartment. Preferably, the compartment-specific nucleic acid contained in the compartment is DNA.

[0064] The compartment-specific nucleic acid may include, for example, the 3' region of an oligo d(T) or oligo d(T)VN sequence for hybridization to the poly(A) tail of mRNA (for mRNA sequencing), the 3' region of a sequence complementary to a specific RNA (for targeted RNA sequencing) or DNA (for targeted DNA sequencing), or a random sequence, such as the 3' region of d(N)6 (for RNA or DNA sequencing). More specifically, it is the constant region of a primer containing a compartment-specific sequence that hybridizes to the nucleic acid released from the captured cell or organelle.

[0065] In one embodiment, the partition-specific nucleic acid contains a primer sequence complementary to all or part of an amplification or capture sequence present in a nucleic acid containing an amplification sequence, an identification sequence, and a capture sequence, or in its reverse-complementary nucleic acid.

[0066] As used herein, the term "partition" refers to, for example, a droplet, a hydrogel matrix, a microfabricated chamber separated by an air valve, a microfabricated chamber made of a functional hydrogel, a microfabricated well, a functional hydrogel cage, or a microplate well.

[0067] According to one embodiment, the partition is a well of a microplate, each well contains a plurality of oligonucleotides, the aforementioned oligonucleotides contain a partition-specific sequence specific to the well, and individualized cells labeled with a nucleic acid containing an identification sequence are captured within the well.

[0068] According to another embodiment, the partition is a microfabricated chamber made of a functional hydrogel. In this embodiment of the microfabricated chamber made using a functional hydrogel, the partition is preferably a partition of a microfluidic device as defined in the following "Microfluidic Device" section.

[0069] According to one embodiment, the compartment comprises or consists of a hydrogel matrix in which labeled and individualized cells or organelles are embedded to form separate biological units. According to this embodiment, the labeled and individualized cells or organelles are contacted with a plurality of barcode units to form a biological unit / barcode unit complex, the aforementioned biological unit / barcode unit complex is contacted with a hydrogel solution, and then this is polymerized to embed the aforementioned biological unit / barcode unit complex in the hydrogel matrix, each of the aforementioned biological unit / barcode unit complexes containing a unique barcode. Hydrogels suitable for forming the hydrogel matrix are as described in International Patent Application Publication No. WO 2018 / 203141, the entire content of which is incorporated herein by reference. The hydrogel is, in particular, a thermosensitive or thermoreversible hydrogel, i.e., a hydrogel that depolymerizes when the temperature rises above the melting point of the polymer contained in the hydrogel after formation.

[0070] According to one embodiment, after capturing the individualized cells or organelles and prior to their subsequent lysis, the method includes analyzing the captured cells, organelles, and / or molecules secreted by them using imaging, including fluorescence imaging, or optical detection such as fluorescence detection.

[0071] The method then includes lysing the captured cells, or cells and organelles, thereby releasing nucleic acids from the cells or organelles within the compartment. Lysis can be performed by any suitable method known to those skilled in the art. For example, a solution of low-salt water, SDS, or Triton X-100 is injected into the compartment to lyse the cells and / or organelles by osmotic shock.

[0072] The method further includes associating (i) compartment-specific nucleic acids with (ii) nucleic acids released from the cells or organelles within the compartment. The association particularly includes (i) hybridizing the compartment-specific nucleic acids to the nucleic acids released from the cells or organelles by complementarity, ii) hybridizing a compartment-specific nucleic acid to the nucleic acid released from the cell or organelle by complementarity, and using a DNA polymerase to extend the compartment-specific nucleic acid hybridized to the released nucleic acid to produce a complementary strand of the released nucleic acid having the associated compartment-specific sequence; iii) hybridizing a compartment-specific nucleic acid by complementarity to the 3'-end of cDNA generated by reverse transcription of RNA from the cell or organelle, and using a DNA polymerase to extend the cDNA hybridized to the compartment-specific nucleic acid to produce a complementary strand of the compartment-specific nucleic acid having the associated compartment-specific sequence; iv) ligating the compartment-specific nucleic acid to the DNA present in the compartment, or v) recombining the compartment-specific nucleic acid with the DNA present in the compartment, and includes one of them.

[0073] The compartment-specific sequence and / or nucleic acid released from the cell or organelle further associates with the released nucleic acid comprising an amplification sequence, an identification sequence, and a capture sequence, or the reverse complement thereof. For this purpose, the compartment-specific nucleic acid can be designed to contain a primer sequence complementary to all or part of the amplification or capture sequence present in the released nucleic acid comprising the amplification sequence, the identification sequence, and the capture sequence, or in its reverse-complementary nucleic acid. The method then further comprises hybridizing the compartment-specific nucleic acid to all or part of the amplification or capture sequence present in the released nucleic acid, and using a DNA polymerase to extend one or both of the hybridized DNA strands to produce a DNA molecule comprising both the identification sequence or its reverse complement and the compartment-specific sequence or its complement. Alternatively, instead of the hybridization and extension steps, the method further comprises ligating the compartment-specific nucleic acid to all or part of the amplification or capture sequence present in the released nucleic acid, or recombining the compartment-specific nucleic acid with all or part of the amplification or capture sequence present in the released nucleic acid.

[0074] Next, recover and sequence the nucleic acids resulting from the association of (i) compartment-specific nucleic acids, (ii) nucleic acids released from cells or organelles within the compartment, and (iii) the released nucleic acids.

[0075] Nucleic acids containing the same compartment-specific sequence are defined or identified as being from the same compartment (i.e., when a single cell or single organelle is trapped in a compartment, from the same single cell or organelle). Mapping the position of the original single cells or organelles in / on the biological sample is based on the identification sequence or its reverse complement sequence contained in the nucleic acids thus generated, thereby combining the mapping and sequencing information of the individual cells of the biological sample. In practice, by determining the relative ratio of the same identification sequence or its reverse complement sequence contained in the nucleic acids generated in step e) and estimating the distance between cells based on the principle of triangulation, the position of the original single cells or organelles (or multiple cells or organelles contained in a single compartment) in the biological sample is mapped.

[0076] The sequencing information can be remapped onto the microscope image of the biological sample obtained before dissociation.

[0077] Microfluidic device In this embodiment, the compartment is a compartment of a microfluidic device comprising: - a first wall (12) comprising a first substrate (14) on which a plurality of closed patterns (16) are grafted thereon; - a second wall (18) opposite the first wall (12) and comprising a second substrate (20); - a plurality of nucleic acids (22) grafted on either the first substrate (14) or the second substrate (20), each nucleic acid (22) comprising a barcode encoding the position of the nucleic acid on the first substrate (14) or the second substrate (20). At least said plurality of closed patterns (16) or said second substrate (20) is made of an operable hydrogel that can swell between a contracted state and a swollen state in which the closed pattern (16) and the second substrate (20) are in contact.

[0078] In the swollen state, the closed pattern and the second substrate of the device are in contact. Thus, the device comprises a plurality of cages, each cage being defined by side walls made of a closed pattern and end walls composed of the first and second substrates.

[0079] In the contracted state, the closed pattern and the second substrate are no longer in contact. The gap between the closed pattern and the second substrate allows fluids and cells to circulate freely within the device.

[0080] Between the contracted state and the swollen state, the device according to the invention passes through a number of intermediate states in which the operable hydrogel is only partially swollen. In these configurations, a gap still exists between the closed pattern and the second substrate. However, the height of the gap is reduced sufficiently with respect to the contracted state so that the cells trapped within the cage are retained within the cage. These intermediate configurations can typically be used to allow selective passage of fluids rather than cells.

[0081] Thus, each closed pattern defines a cell capture site where closure and opening are initiated by an external stimulus. In a preferred embodiment, the external stimulus is a change in pH, light intensity, temperature or current intensity. In a highly preferred embodiment, the external stimulus is a temperature change.

[0082] The microfluidic device includes at least two closed patterns. Preferably, the microfluidic device includes a number of closed patterns, typically 100, 1,000, 10,000, 100,000... thereof.

[0083] The first wall and the second wall are made of a rigid material that can withstand temperature fluctuations in the range of -20 to 100 °C. According to the first embodiment, the wall (the first and / or the second wall) is made of a unique and homogeneous material. Thus, the wall consists of a substrate.

[0084] According to the second embodiment, the wall further includes a support material on which the substrate is fixed / coated. Typically, the wall consists of a support material made of glass or polydimethylsiloxane coated with a substrate layer.

[0085] Equivalently, the microfluidic device can include two single-layer walls, two multi-layer walls, or one single-layer wall and one multi-layer wall.

[0086] The first substrate is typically made of a material selected from thermoplastic substances such as silicon, quartz, glass, polydimethylsiloxane, cyclic olefin copolymer, and polycarbonate, preferably glass and polydimethylsiloxane. Preferably, the first substrate is made of polydimethylsiloxane.

[0087] According to one embodiment, at least a part of the surface of the first substrate is structured and / or functionalized.

[0088] "Structured" means that the surface of the substrate is irregular. The surface of the substrate may be porous or microscopically structured. In particular, it can include microscopic stripes, columns, etc.

[0089] The structuring of the substrate can be carried out according to any known process. For example, well-established standard soft lithography techniques can be mentioned.

[0090] "Functionalized" means fixing chemical functional groups on the surface of the substrate. Typically, the surface of the first substrate is functionalized with a chemical group selected from hydroxide groups, silanol groups, and mixtures thereof, preferably silanol groups.

[0091] The structuring and / or functionalization of the substrate enables the promotion of closed patterns and / or the grafting of nucleic acids onto their surfaces.

[0092] According to a preferred embodiment, the first wall is made of a structured and / or functionalized polydimethylsiloxane substrate, preferably a structured and functionalized polydimethylsiloxane substrate.

[0093] The closed pattern can have a wide variety of shapes. Preferably, the closed pattern is rectangular, square, circular or hexagonal.

[0094] Preferably, the closed pattern is covalently grafted to the first substrate.

[0095] According to a particular embodiment, the second substrate is made of a hydrogel and the closed pattern is made of a non-swellable material. Preferably, according to this particular embodiment, the second wall comprises a non-swellable support material on which a swellable hydrogel is deposited. The non-swellable support material may be structured and / or functionalized. The structuring and / or functionalization of the non-swellable material is made in the same way as described above in relation to the first substrate. Thus, according to this embodiment, the closed pattern is non-swellable and it is the swelling of the second substrate that enables the closing of the cage.

[0096] Preferably, according to this embodiment, the closed pattern is made of a material selected from thermoplastic materials such as silicon, quartz, glass, polydimethylsiloxane, cyclic olefin copolymer and polycarbonate, preferably glass or polydimethylsiloxane.

[0097] Preferably, the closed pattern has a height in the range of 0.1 to 100 μm, preferably 1 to 30 μm.

[0098] Preferably, the walls of the closed pattern have a thickness in the range of 0.1 to 500 μm, preferably 1 to 20 μm.

[0099] Advantageously, according to this embodiment, the second substrate has a thickness in the range of 1 to 500 μm, preferably 1 to 100 μm, as measured in the swollen state in contact with the closed pattern.

[0100] Advantageously, further according to this embodiment, the second substrate containing the hydrogel has a thickness in the range of 0.5 to 150 μm, preferably 0.5 to 50 μm, as measured in the dry state.

[0101] According to a preferred embodiment, the closed pattern is made of a hydrogel and the second substrate is made of a non-swellable material. Thus, according to this embodiment, the second substrate is non-swellable and the closed pattern swells to close the cage.

[0102] Preferably, according to this preferred embodiment, the second substrate is made of a material selected from thermoplastic substances such as silicon, quartz, glass, polydimethylsiloxane, cyclic olefin copolymer, and polycarbonate, preferably glass or polydimethylsiloxane. Advantageously, the hydrogel pattern has a height in the range of 0.1 μm to 500 μm, preferably 1 μm to 250 μm, more preferably 1 μm to 100 μm, as measured in the swollen state when the hydrogel pattern is in contact with the second wall.

[0103] Advantageously, the hydrogel pattern has a height in the range of 0.1 μm to 150 μm, preferably 0.5 μm to 100 μm, more preferably 0.5 μm to 50 μm, as measured in the dry state.

[0104] Preferably, the wall of the hydrogel pattern has a resolution in the range of 0.1 μm to 100 μm, preferably 1 μm to 10 μm, as measured in the swollen state when the hydrogel pattern is in contact with the second wall.

[0105] Preferably, the wall of the hydrogel pattern has a resolution in the range of 0.1 μm to 100 μm, preferably 0.5 μm to 5 μm, as measured in the dry state.

[0106] "Hydrogel" refers to a polymer matrix that forms a three-dimensional network structure capable of swelling in the presence of water under specific physicochemical conditions in the context of a gel. The swelling of the hydrogel can be initiated, for example, by thermal, optical, chemical, or electrical stimuli.

[0107] For example, the swelling (or shrinking) of the hydrogel can be initiated by a change in the temperature, pressure, or pH value of the medium in which it is placed.

[0108] Preferably, the hydrogel is a temperature-responsive swelling hydrogel. "Temperature-responsive swelling hydrogel" refers to a hydrogel in which swelling or shrinking is induced by changing the temperature in the context of the present invention. Temperature-responsive swelling hydrogels typically exhibit a dramatic change in water solubility with temperature.

[0109] In a specific temperature range, the hydrogel is water-soluble and absorbs a large amount of water.

[0110] Conversely, by changing the temperature of the medium, the hydrogel becomes no longer water-soluble. Then, the hydrogel releases water and shrinks.

[0111] "Swelling state" refers to the state of the hydrogel in which the closed pattern and the second substrate are in contact such that the device includes a plurality of hermetically sealed cages in the context of the present invention.

[0112] "Shrinking state" refers to the state of the hydrogel in which the closed pattern and the second substrate are not in contact, there is a gap between the closed pattern and the second substrate, and it enables free circulation of fluids and cells inside the microfluidic device. The "shrinking state" is different from the "dry state" defined below in that the hydrogel does not completely contain no water. In the shrinking state, the hydrogel is still at least partially hydrated.

[0113] In the context of the present invention, the "dry state" refers to a state in which the hydrogel contains almost no water. Typically, the hydrogel is in a dry state during the manufacture of the microfluidic device, particularly during the coating of the second wall by the hydrogel substrate during the grafting of the hydrogel pattern.

[0114] The temperature at which the water-soluble properties of the hydrogel change dramatically is referred to as the critical solution temperature (CST).

[0115] Preferably, the hydrogel has a critical solution temperature (CST) in the range of 4°C to 98°C, more preferably 20°C to 50°C, and even more preferably 25°C to 40°C.

[0116] According to the first variant form, the critical solution temperature (CST) of the hydrogel is the lower critical solution temperature (LCST). At temperatures higher than the LSCT, the hydrogel is in a contracted state, and at temperatures lower than the LCST, the hydrogel is in a swollen state.

[0117] According to the second variant form, the critical solution temperature (CST) of the hydrogel is the upper critical solution temperature (UCST). At temperatures higher than the UCST, the hydrogel is in a swollen state, and at temperatures lower than the USCT, the hydrogel is in a contracted state.

[0118] The polymer constituting the polymer matrix of the hydrogel is typically selected from homopolymers, copolymers, and terpolymers of acrylic acid, alkyl (meth)acrylate, alkyl (meth)acrylamide, oligoethylene (meth)acrylate, sulfobetaine (meth)acrylate, and N-acryloylglycinamide, preferably selected from homopolymers, copolymers, and terpolymers of alkyl (meth)acrylamide and any mixtures thereof, and more preferably, the hydrogel contains poly(N-isopropylacrylamide).

[0119] The polymer can be selected from LCST polymers, UCST polymers, and mixtures thereof.

[0120] Similar to what was described above in the context of hydrogels, - The expression "LCST polymer" refers to a thermoresponsive polymer having a lower critical solution temperature, - The expression "UCST polymer" refers to a thermoresponsive polymer having an upper critical solution temperature.

[0121] The overall behavior of the hydrogel (UCST and / or LCST behavior) depends on the nature and amount of the different polymers present in the hydrogel.

[0122] When the polymer is selected from UCST polymers, it is preferably selected from homopolymers, copolymers, and terpolymers of acrylic, alkyl (meth)acrylate, alkyl (meth)acrylamide, oligoethylene (meth)acrylate, sulfobetaine (meth)acrylate, N-acryloylglycinamide, and mixtures thereof.

[0123] Preferably, the UCST polymer is a terpolymer of methacrylamide, acrylamide, and allyl methacrylate.

[0124] When the polymer is selected from LCST polymers, it is preferably selected from homopolymers, copolymers, and terpolymers of acrylic, alkyl (meth)acrylate, alkyl (meth)acrylamide, oligoethylene (meth)acrylate, and mixtures thereof, more preferably from homopolymers, copolymers, and terpolymers of alkyl (meth)acrylamide, and even more preferably the LCST polymer is poly(N-isopropylacrylamide).

[0125] Preferably, the LCST polymer is poly(N-isopropylacrylamide).

[0126] Advantageously, the polymer comprises, preferably consists of, one or several UCST or LCST polymers.

[0127] Advantageously, the microfluidic device further comprises at least one inlet (24) and at least one outlet (26) enabling respectively the introduction and the removal of reactants into the device.

[0128] Preferably, heating means are incorporated into the device according to the invention.

[0129] According to one embodiment, each cage comprises independent heating means. This embodiment is particularly advantageous in that each cage can be opened and closed independently.

[0130] For example, the local heating means can be composed of nanoparticles that become hot when irradiated with light (plasmon effect). The nanoparticles can be deposited, for example, between the hydrogel and the wall on which it is coated, or dispersed in the polymer matrix of the hydrogel. Preferably, the nanoparticles are selected from metal nanoparticles and plasmonic nanoparticles, preferably including gold, graphene, silver, copper and titanium nitride.

[0131] In another example, local heating is carried out using microresistors. For example, a microresistor including a chromium / gold bilayer or a TiO2 structure.

[0132] The microfluidic device further comprises a plurality of compartment-specific nucleic acids grafted on either the first substrate or the second substrate, each nucleic acid comprising a sequence barcode encoding the position of the nucleic acid on the first or second substrate.

[0133] Advantageously, the nucleic acids are grafted so as to be arranged inside the cage when the hydrogel is in a swollen state.

[0134] More advantageously, the nucleic acids are grafted either on the first substrate inside the closed pattern or on the second substrate on the opposite side of the closed pattern.

[0135] Preferably, when the closed pattern is made of a hydrogel, the nucleic acid is grafted onto the surface of the second substrate. Preferably, when the second substrate is made of a hydrogel, the nucleic acid is grafted onto the surface of the first substrate.

[0136] The grafted nucleic acid is RNA or DNA, preferably DNA. The grafted nucleic acid can be single-stranded, double-stranded or partially double-stranded.

[0137] The grafted nucleic acid is preferably 60 to 100 nucleotides in length.

[0138] The grafted nucleic acid can be attached to the substrate either directly or via a linker, at either the 3'-end or the 5'-end.

[0139] According to one embodiment, grafted nucleic acids sharing the same barcode have multiple sequences. According to another embodiment, grafted nucleic acids sharing the same barcode have the same sequence.

[0140] According to one embodiment, all or part of the grafted nucleic acid hybridizes to another nucleic acid or multiple nucleic acids to form partial or complete double-stranded DNA, double-stranded DNA / RNA, or double-stranded RNA.

[0141] According to one embodiment, the grafted nucleic acid includes one or any combination of the following sequences: 1) A restriction site or a photocleavable site for nucleic acid release, 2) A sequence complementary to an amplification primer for further amplification, 3) A T7 RNA polymerase promoter sequence for further in vitro transcription (IVT), 4) A hybridization site for nucleic acid labeling, a ligation site for nucleic acid labeling, or a recombination site for nucleic acid labeling, and (5) A sequence of randomized nucleotide residues that functions as a unique molecular identifier (UMI).

[0142] Preferably, the grafted nucleic acid comprises at least i) a sequence barcode encoding the position of the nucleic acid on the first or second substrate, and ii) a restriction site or a photocleavable site, and optionally further iii) a primer sequence, and / or a T7 sequence and / or a hybridization, ligation or recombination site.

[0143] According to one embodiment, the grafted nucleic acid of the microfluidic device comprises a constant sequence, i.e., a sequence present in all grafted nucleic acids. The grafted nucleic acid of the microfluidic device can hybridize to a DNA comprising a sequence complementary to all or part of the constant sequence of the grafted nucleic acid. One or more different DNAs comprising a sequence complementary to all or part of the constant sequence can be hybridized to the grafted nucleic acid.

[0144] The microfluidic device may further comprise a structure capable of capturing cells or organelles. Such structures are typically selected from the descriptions in publications such as Vigneswaran N. et al, 2017, Microfluidic hydrodynamic trapping for single cell analysis: mechanisms, methods and applications, Anal. Methods, 9, 3751 - 3772.

[0145] Preferably, the structure capable of capturing cells or organelles is localized either on the first substrate inside the closed pattern or on the second substrate on the opposite side of the closed pattern.

[0146] Preferably, each cage comprises at least one structure capable of capturing cells or organelles.

[0147] According to certain embodiments, a plurality of ligands are grafted directly or indirectly, covalently or non-covalently, onto the first substrate (14) and / or the second substrate (20) on the opposite side of the closed pattern.

[0148] Advantageously, the ligands are grafted such that they are disposed inside the cage when the hydrogel is in a swollen state.

[0149] In particular, when grafted onto the first substrate (14), the ligands are typically grafted inside the closed pattern (16).

[0150] Alternatively, when grafted onto the second substrate (20), the ligands face the closed pattern.

[0151] All of the ligands may be grafted onto the same substrate. Alternatively, some of the ligands are grafted onto the first substrate (14) and others are grafted onto the second substrate (20).

[0152] Preferably, when grafted directly onto the first substrate (14) or the second substrate (20), the plurality of ligands are covalently grafted onto the first substrate (14) or the second substrate (20).

[0153] According to a more specific embodiment, the plurality of ligands are grafted indirectly, i.e., the plurality of ligands are grafted onto an intermediate structure, and the intermediate structure is grafted directly onto the first substrate (14) or the second substrate (20). Thus, according to this particular embodiment, there is no direct bond between the plurality of ligands and the substrates (14, 20).

[0154] Preferably, when grafted indirectly onto the first substrate (14) or the second substrate (20), the plurality of ligands are non-covalently grafted onto the first substrate (14) or the second substrate (20).

[0155] According to the first example, a plurality of ligands are conjugated to a nucleic acid and are associated by hybridization to at least a part of the grafted nucleic acid (22).

[0156] According to another example, a plurality of ligands are non-covalently grafted to an adhesion coating pre-coated on the first substrate (14) or the second substrate (20). As the adhesion coating, a streptavidin coating can be particularly mentioned.

[0157] In these embodiments, preferably, each ligand is independently selected from the group consisting of an antibody, an antibody fragment, a lectin, and an aptamer.

[0158] The ligand is usually one or more analytes secreted or released by lysis of cells or organelles captured in a cage formed by the first wall (14) and the second wall (20) of the microfluidic device (10), and is selected to bind to the closed pattern (16) of the swollen hydrogel.

[0159] The aforementioned microfluidic device can be manufactured by a method including the following steps: 1) Providing a first substrate; 2) Grafting a plurality of closed patterns on the surface of the first substrate; 3) Providing a second substrate; 4) Grafting a plurality of nucleic acids on either the surface of the first substrate or the surface of the second substrate, wherein each nucleic acid includes a barcode encoding the position of the nucleic acid on the first or second substrate; 5) Positioning the first substrate and the second substrate by arranging the closed pattern and the nucleic acid between the first substrate and the second substrate; 6) Bonding the first and second substrates.

[0160] The grafting of the closed pattern can be carried out according to any known process.

[0161] When the closing pattern is made of a non-swellable material, the grafting of the closing pattern is typically carried out by soft lithography techniques.

[0162] According to certain embodiments, the first substrate and the closing pattern are prepared together in one unique step.

[0163] When the closing pattern is made of a hydrogel, the grafting of the closing pattern is typically carried out by photopatterning, preferably under UV (ultraviolet) radiation. The photopatterning method lies in the surface grafting of the polymer matrix of the hydrogel onto the first substrate and the simultaneous crosslinking of the polymer matrix of the hydrogel.

[0164] Preferably, the polymer is crosslinked covalently.

[0165] More preferably, the crosslinking of the polymer is carried out in the presence of a crosslinking agent selected from dithiol molecules such as dithioerythritol, for example.

[0166] The patterning of the hydrogel is typically carried out by standard photolithography techniques or using a direct laser writing device.

[0167] These techniques are disclosed in particular in Chollet, B., D’Eramo, L., Martwong, E., Li, M., Macron, J., Mai, T.Q., Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp.24870-24879.

[0168] The grafting of nucleic acids is typically carried out by spotting or in situ light-directed synthesis, as detailed in DeRisi, J. et al. Use of a cDNA microarray to analyse gene expression. Nat. Genet 14, 457-460 (1996) and Fodor, S. P. et al. Light-directed, spatially addressable parallel chemical synthesis. Science(80-.). 251, 767-773 (1991), respectively.

[0169] Advantageously, during step 5), the first and second substrates are arranged such that when the hydrogel is in a swollen state, the nucleic acid can be inside the cage.

[0170] More advantageously, the nucleic acid is grafted either on the first substrate inside the closed pattern or on the second substrate on the opposite side of the closed pattern.

[0171] The binding step can be carried out according to any known method.

[0172] According to a first embodiment, the binding step is carried out by oxygen plasma treatment. Preferably, the oxygen plasma treatment is carried out at room temperature, typically in the range of 5 to 50 °C, more preferably 10 to 40 °C, even more preferably 15 to 30 °C. Preferably, the duration of the oxygen plasma treatment is in the range of 10 seconds to 2 minutes, more preferably 30 seconds to 1 minute.

[0173] Preferably, according to this first embodiment, the method further comprises a preparation step of depositing a mask on the nucleic acid that can protect the nucleic acid during exposure to oxygen plasma before step 6). The mask is typically made of adhesive tape and is preferably made of a material selected from plastic film, paper, cloth, foam, or foil coated with an adhesive. The mask is finally removed, typically by peeling, after the plasma treatment.

[0174] According to the second embodiment, the bonding step is carried out by applying pressure on the surface of the device. Preferably, according to this embodiment, the pressure on the surface of the device is carried out by applying a negative pressure in an external microfluidic channel surrounding the main design.

[0175] According to the third embodiment, the bonding step is carried out by using a crosslinkable composition comprising at least one polymer and optionally at least one crosslinking agent. According to this third embodiment, the bonding step is carried out as follows: a) bringing together the first wall and the second wall, b) depositing a layer of a composition comprising at least one polymer and at least one crosslinking agent between the two walls to fill the gap between the first wall and the second wall, c) crosslinking, preferably self-crosslinking, at least one polymer.

[0176] Preferably, the polymer is selected from among polyepoxides.

[0177] The process may further include the following: - an intermediate step of structuring and / or functionalizing the surface of the first substrate between step 1) and step 2), and / or - an intermediate step of structuring and / or functionalizing the surface of the second substrate between step 3) and step 4).

[0178] When the substrate is made of hydrogel, the functionalization of the substrate can typically be carried out by following the protocol disclosed in Chollet, B., D’eramo, L., Martwong, E., Li, M., Macron, J., Mai, T.Q., Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp. 24870-24879.

[0179] When the structure is not made of hydrogel, the functionalization can typically be carried out by following the protocol detailed in Beal, John H L et al. “A rapid, inexpensive surface treatment for enhanced functionality of polydimethylsiloxane microfluidic channels.” Biomicrofluidics vol. 6, 3 36503.30 Jul. 2012.

[0180] When the substrate is made of hydrogel, the structuring of the substrate can typically be carried out by following the protocol disclosed in Chollet, B., D’eramo, L., Martwong, E., Li, M., Macron, J., Mai, T.Q., Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp. 24870-24879.

[0181] When the substrate is made of a non-swellable material, the structuring of the substrate can typically be carried out by following standard lithography protocols, particularly standard photolithography protocols.

[0182] According to certain embodiments, the method may further comprise an additional step consisting of depositing a nanoparticle layer, preferably a patterned chromium / gold bilayer, onto the surface of a substrate prior to the deposition of the hydrogel material.

[0183] The deposition of the patterned layer may be carried out, for example, by standard photolithography.

[0184] According to certain embodiments, the method further comprises at least one of the following steps: a) (Directly) grafting a plurality of ligands onto the surface of a first substrate (14) and / or onto the surface of a second substrate (20), and / or b) (Indirectly) grafting a plurality of ligands onto the surface of a first substrate (14) and / or onto the surface of a second substrate (20).

[0185] Step a) as defined above may be carried out at any point in the manufacturing method as defined above. In particular, step a) may be carried out before or after the grafting of the closed pattern (16), and before or after the grafting of the nucleic acid (22).

[0186] According to a first embodiment, the indirect grafting of the ligands is carried out by associating a plurality of ligands with the grafted nucleic acids (22) by hybridization, and the plurality of ligands are conjugated to a nucleic acid having complementarity with at least a part of the grafted nucleic acid (22).

[0187] According to this first embodiment, step b) is preferably carried out after the grafting of the nucleic acid (22). Step b) can be carried out until the conditions are modified so as to bring the hydrogel into a swollen state, thereby capturing cells or organelles within the cage formed by the first wall (14) and the second wall (20) of the microfluidic device (10) and the closed pattern (16) of the swollen hydrogel.

[0188] According to the second embodiment, the indirect grafting of the ligand comprises: i) coating an adhesion coating on at least a part of the surface of the first substrate (14) and / or the second substrate (20); and ii) grafting the ligand onto the adhesion coating.

[0189] Step i) can be carried out before or after the grafting of the closed pattern (16), and before or after the grafting of the nucleic acid (22).

[0190] Step ii) is preferably carried out after the deposition of the adhesion coating. Step ii) can be carried out until the conditions are modified to operate the hydrogel in a swollen state, thereby capturing cells or organelles within the cage formed by the first wall (14) and the second wall (20) of the microfluidic device (10) and the closed pattern (16) of the swollen hydrogel.

[0191] The method for manufacturing the microfluidic device further comprises one or more of the following steps: 1) Hybridizing a DNA containing a sequence complementary to all or part of the constant sequence present in the grafted nucleic acid, in particular, hybridizing a DNA present in all or part of the grafted nucleic acid. In particular, one or more different DNAs containing a sequence complementary to all or part of the constant sequence can be used. 2) Extending the hybridized DNA by polymerization (for example, using Maxima, SuperScript RT, Phusion or Q5 polymerase). 3) Ligating the grafted nucleic acid, in particular the grafted DNA, to a certain DNA sequence or another DNA sequence, and / or 4) Optionally, releasing all or part of the grafted nucleic acid, which has been pre-modified by hybridization, extension or ligation according to 1), 2) or 3), from the surface of the first substrate or the second substrate by cleavage (for example, photocleavage or cleavage catalyzed by an endonuclease).

[0192] In some embodiments, the hybridizing DNA forms, together with the grafted nucleic acid, a double-stranded DNA containing a restriction site for an endonuclease.

[0193] The method may also include a further step of fixing a structure capable of capturing cells or organelles.

[0194] This additional step is typically achieved by standard photolithography.

[0195] The microfluidic device of the present invention can be used in a method for sequencing cells or organelles, and has the potential to combine phenotypic information of single cells with phenotypic information and omics information from optical imaging of single cells or organelles, or, for example, two or more interacting cells, and this can be done simultaneously for thousands of cells.

[0196] A method for analyzing cells or organelles includes the following: a) providing a microfluidic device and a preparation of cells or organelles labeled with a released nucleic acid that can be obtained by the method of mapping individual cells or organelles of the present invention or that contains an identified sequence (or its reverse complement); b) optionally associating all or part of the cells or organelles labeled with a released nucleic acid containing an identified sequence (or its reverse complement) with a common labeled nucleic acid sequence or a plurality of different labeled nucleic acid sequences; c) injecting, under conditions where the hydrogel is in a contracted state, cells or organelles labeled with a released nucleic acid containing an identified sequence in suspension into the microfluidic device; d) modifying the conditions to operate the hydrogel in a swollen state, thereby capturing the cells or organelles within a cage formed by a first wall and a second wall of the microfluidic device and a closed pattern of the swollen hydrogel; e) Optionally, analyzing the captured cells or organelles and / or the molecules they secrete using optical imaging; f) Optionally, releasing the grafted nucleic acid from the surface of the first or second substrate of the microfluidic device into the cage; g) Optionally, lysing the captured cells or organelles, thereby releasing the cellular nucleic acid or organellar nucleic acid into the cage; h) Associating the barcode of the compartment-specific nucleic acid with either the released cellular nucleic acid or organellar nucleic acid and / or the released nucleic acid sequence, thereby forming a barcoded nucleic acid; i) Modifying the conditions to activate the hydrogel to the contracted state; j) If not released in f), releasing the grafted nucleic acid from the first or second substrate of the microfluidic device; k) Recovering and sequencing the barcoded nucleic acid; l) Optionally, mapping the barcoded sequencing data onto the data from the optical imaging obtained in e). A method comprising these steps.

[0197] According to one embodiment of the method, steps b) and e) are performed. In some aspects, step b) further includes labeling the cells with a fluorescent marker that is analyzed in step e).

[0198] In step c), injecting into the microfluidic device cells or organelles labeled with a released nucleic acid comprising an identification sequence (or its reverse complement) in suspension, under conditions where the hydrogel is in a contracted state, is typically carried out by setting the temperature, pressure, or pH according to the properties of the operable hydrogel such that the hydrogel is in a contracted state. For example, if the microfluidic device comprises a lower critical solution temperature (LCST) temperature-responsive hydrogel, the temperature of the microfluidic device is raised above the lower critical solution temperature (LCST) to contract the hydrogel. For a temperature-responsive hydrogel comprising or consisting of poly(N-isopropylacrylamide) (PNIPAM), the hydrogel is fully swollen at ≤28 °C, fully contracted at ≥36 °C, partially swollen between these temperatures, and at 37 °C the cage is fully open and loading of cells or organelles is possible (D’Eramo et al., Microsystems & Nanoengineering (2018) 4, 17069). For example, if the microfluidic device comprises an upper critical solution temperature (UCST) temperature-responsive hydrogel, the temperature of the microfluidic device is lowered below the upper critical solution temperature (UCST) to contract the hydrogel. In the case of a temperature-responsive hydrogel comprising or consisting of P(MA-AM-AMA), the hydrogel is fully contracted at ≤10 °C, fully swollen at ≥50 °C, partially swollen between these temperatures, and at 10 °C the cage is fully open and loading of cells or organelles is possible. According to one embodiment, in step d), a single cell or a single organelle is captured within the cage. According to another embodiment, two (or more) interacting cells, e.g., a plasma cell and a reporter cell, a cytotoxic T cell (or CAR T cell) and a target cell (e.g., a tumor cell), a T cell and an antigen-presenting cell, are captured within the cage.

[0199] To activate the hydrogel to a swollen state, the temperature, pressure or pH (depending on the nature of the operable hydrogel) is modified such that the hydrogel swells and contacts the second substrate. For example, if the microfluidic device contains a lower critical solution temperature (LCST) temperature-responsive hydrogel, the temperature of the microfluidic device is lowered below the lower critical solution temperature (LCST) to expand the hydrogel. For a temperature-responsive hydrogel comprising or consisting of poly(N-isopropylacrylamide) (PNIPAM), the temperature can typically be set to ≦28° C., where the hydrogel fully swells (D’Eramo et al., Microsystems & Nanoengineering (2018) 4, 17069). For example, if the microfluidic device contains an upper critical solution temperature (UCST) temperature-responsive hydrogel, the temperature of the microfluidic device is raised above the upper critical solution temperature (UCST) to expand the hydrogel. In a temperature-responsive hydrogel comprising or consisting of P(MA-AM-AMA), the hydrogel fully swells at ≧50° C.

[0200] The method may further comprise varying the ambient conditions of the cell or organelle between steps d) and h). Varying the ambient conditions includes, for example, circulating an aqueous phase containing salts, surfactants, proteins, and / or nucleic acid sequences within the microfluidic device. Varying the ambient conditions includes, when the cage also includes a structure capable of capturing the cell or organelle, exchanging molecules such as salts that pass through the hydrogel of the closed cage by fully opening the cage or by partially opening the cage.

[0201] According to one embodiment, the method further comprises, optionally but preferably, for example, after step e) and before step f): e1) binding the analyte(s) secreted or released by the captured cell or organelle to a ligand grafted directly or indirectly onto the surface of the first substrate (14) and / or the surface of the second substrate (20); Detecting the one or more analytes bound to the grafted ligand by binding it to a labeled second ligand (s) specific for the analyte (s) combined.

[0202] According to a first embodiment, in step e2, the detection is carried out directly using one or more second ligands labeled with a fluorescent label.

[0203] According to a second embodiment, in step e2, the detection is carried out indirectly using one or more second ligands labeled with a ligand - identifying nucleic acid to one or more analytes bound to the grafted ligand, and the sequence of the ligand - identifying nucleic acid enables the identification of the ligand and one or more analytes bound to the grafted ligand.

[0204] According to this second embodiment, the method may further comprise amplifying the sequence of the ligand - identifying nucleic acid. The amplification preferably consists of linear amplification, more preferably by using at least one polymerase and at least one restriction enzyme or nicking enzyme.

[0205] According to this second embodiment of the method, in step h), the method may further comprise associating a barcode of the nucleic acid (22) with the ligand - identifying nucleic acid, thereby forming a barcoded nucleic acid.

[0206] According to one embodiment, the common labeled DNA sequence or plurality of different labeled DNA sequences provided in step b) are used in a DNA toolbox reaction (or dynamic DNA reaction network) for phenotypic sorting of cells or organelles, thereby activating the release of the transplanted nucleic acid in step f) or j). The principle of the DNA toolbox reaction is described, for example, in WO 2017 / 141068 and WO 2017 / 141067.

[0207] According to one embodiment, in step g), the captured cells or organelles are lysed by osmotic shock. This can be readily implemented by those skilled in the art by circulating a low- or high-osmotic aqueous phase within the microfluidic device. The cage may remain closed for this operation.

[0208] According to one embodiment, step h) involves hybridizing a barcode-containing compartment-specific nucleic acid that can still be grafted onto the surface of the first or second substrate of the microfluidic device or can be released from the surface of the first or second substrate of the microfluidic device, by complementarity to the released cellular or organellar nucleic acid and / or the released nucleic acid sequence. In particular, when the barcode-containing compartment-specific nucleic acid is DNA, step h) [or the method between steps i) and j)] may further include the step of extending the DNA containing the barcode hybridized to the released cellular or organellar nucleic acid (or the released nucleic acid sequence) using DNA polymerase to generate a complementary strand of the released cellular or organellar nucleic acid (or labeled nucleic acid sequence) containing the barcode. The nucleic acid may include, for example, a 3' region of oligo d(T) or oligo d(T)VN for hybridization to the poly(A) tail of mRNA (for mRNA sequencing), a 3' region of a sequence complementary to a specific RNA (for targeted RNA sequencing) or DNA (for targeted DNA sequencing), a random sequence, such as a 3' region of d(N)6 (for RNA or DNA sequencing), a 3' region having three ribo(G) nucleotides for reverse transcriptase template switching (for RNA sequencing), or a 3' region complementary to a nucleotide sequence introduced by recombination after "tagmentation" catalyzed, for example, by Tn5 transposase. The latter can be used, for example, for genomic DNA sequencing, or for epigenetic analysis of DNA methylation (using Methyl-seq or bisulfite sequencing) or chromatin structure (using transposase-accessible chromatin with sequencing, ATAC-Seq), or for RNA sequencing after tagmentation of the RNA-DNA duplex formed after first-strand cDNA synthesis for RNA released by cells or organelles or the double-stranded DNA formed after first-strand and second-strand cDNA synthesis.

[0209] According to another embodiment, the compartment-specific nucleic acid containing the barcode is DNA, which may be fully or partially double-stranded, and step h) includes ligating the DNA containing the barcode to the DNA released by the cell or organelle. For example, the barcode can be ligated to genomic DNA, for example, after restriction digestion (for genomic DNA sequencing or analysis of DNA methylation), or after digestion with micrococcal nuclease (for metagenomic analysis using MNase-seq or ChIP-seq).

[0210] According to yet another embodiment, the compartment-specific nucleic acid containing the barcode is DNA, which may be fully or partially double-stranded, and step h) includes recombining the DNA containing the barcode with the DNA released by the cell or organelle. For example, the barcode can be recombined with genomic DNA for genomic DNA sequencing, or for epigenomic analysis of DNA methylation (using Methyl-seq or bisulfite sequencing) or chromatin structure (using sequencing, transposase-accessible chromatin with ATAC-Seq). Alternatively, the nucleic acid containing the barcode recombines with the RNA-DNA duplex formed after first-strand cDNA synthesis on the RNA released by the cell or organelle, or with the double-stranded DNA formed after first-strand and second-strand cDNA synthesis on the RNA released by the cell or organelle (for RNA sequencing). In a preferred embodiment, the oligonucleotide contains a Mosaic End (ME) sequence that recombines with DNA catalyzed by Tn5 transposase.

[0211] According to one embodiment, the method further includes, between steps d) and h), releasing the compartment-specific nucleic acid containing the barcode when there is cell or organelle material (e.g., surface molecules, secreted molecules, or lysates) in the cage, for example, by a proximity ligation assay or a proximity extension assay.

[0212] Kit for mapping and sequencing individual cells or organelles The present invention further relates to a kit for carrying out the above-described mapping and sequencing method, which kit comprises the components of a kit for labeling the individual cells or organelles defined above and the compartments defined above.

[0213] The kit comprises a) an emitter nucleic acid comprising an amplification sequence, a discrimination sequence, and a capture sequence, and b) a receptor nucleic acid comprising i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement, and c) a ligand for a cell target or an organelle target, and d) optionally, a nicking endonuclease and a polymerase having strand displacement activity.

[0214] In some embodiments, the set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids, and all of the emitter nucleic acids in the group comprise the same discrimination sequence. In this embodiment, the kit further comprises an endonuclease.

[0215] The present invention will be further described with reference to the following drawings and examples.

Brief Description of the Drawings

[0216]

Figure 1

Figure 2

Chemical formula

Chemical formula

Chemical formula

Figure 3-1

Chemical formula

Chemical formula

Figure 3-2

Figure 3-3

Chemical formula

Chemical formula

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Example

[0217] Example 1: Preserved DNA That Couples with Cells during Dissociation To achieve a proof of concept applicable to a cohort of biological samples, the inventors demonstrated that using an antibody, lectin, or cholesterol tag as a ligand can preserve the coupling of DNA nucleic acids and cells from tissue sections during dissociation regardless of cell type.

[0218] Cell Culture Culture Jurkat human T lymphocytes ATCC® TIB - 152 and Ramos human B lymphocytes ATCC® CRL - 1923 in RPMI 1640 medium (Gibco 61870044) supplemented with 10% heat - inactivated fetal bovine serum (Gibco 10082147) and 1% penicillin - streptomycin (Gibco 15140122). Seed the cells into 25 cm2 or 75 cm2 culture flasks at 37 °C with 5% CO2 according to ATCC recommendations. Dilute the cells when they reach 75 - 80% confluence. After harvesting from the cell culture, finally resuspend the cells in 1×TBS at a concentration of 2.10 6 cells / mL -1 .

[0219] Antibody and Lectin Conjugation Using the Streptavidin Conjugation Kit Protocol (ab102921), first conjugate the purified antibody (Biolegend) and lectin (Eurobio Scientific) to streptavidin. Then, mix the conjugated marker with biotinylated oligonucleotide at a ratio of 1:12 in 1× Tris - buffered saline (TBS, VWR CAYM600232 - 500) and store protected from light for 12 hours (overnight) at a temperature controlled room at 20 - 25 °C. Purchase the biotinylated oligonucleotide from IDT at a concentration of 100 μM in IDTE buffer (pH 8.0) with standard desalting. The sequence of the biotinylated fluorescent oligonucleotide is / 56 - FAM / CACAGGGTGATCAGGT / 3Bio / (SEQ ID NO: 1). 56 - FAM represents the fluorescein fluorescent dye conjugated to the 5’ end of the oligo, and 3Bio represents the biotin conjugated to the 3’ end of the oligo.

[0220] Tissue Dissociation Take approximately 2 g of fresh colon sample and cut it into approximately 1 mm 2It was cut into small pieces. Before proceeding with the staining, the tissue pieces were washed three times with 10 mL of 1× phosphate-buffered saline (PBS, Gibco 10010023), and then washed three times with cell staining buffer (Biolegend 420201) containing 400 μg / mL of DSS (Sigma D8906) and 5 mM EDTA (Sigma 03690). The tissue was stained with 1 - 10 μg of antibody or lectin conjugated to a fluorophore or fluorescent oligonucleotide in 500 μl of cell staining buffer (Biolegend 420201) at 4°C for 30 minutes. Then, the small pieces were washed with 10 mL of 1× phosphate-buffered saline and dissociation was carried out using a gentleMACS Octo Dissociator and Tumor Dissociation Kit (Miltenyi Biotec 130 - 095 - 929). After dissociation, the cells were filtered through a 40 μm filter, washed with 10 mL of Tris-buffered saline (TBS, VWR CAYM600232 - 500), and resuspended in 1 mL of TBS. Optionally, the cells were stained with DAPI to distinguish live cells from dead cells.

[0221] Cell staining 200,000 cells were resuspended in 100 μL of cell staining buffer (Biolegend 420201) containing 400 μg / mL of DSS (Sigma D8906) and 5 mM of EDTA (Sigma 03690). The cells were incubated with 5 μL of Fc receptor blocking solution (Biolegend 422301) in the dark at 4°C for 10 minutes, and then 0.2 - 2 μg of antibody or lectin conjugated to a fluorophore or fluorescent oligonucleotide or an equal amount of cholesterol-modified oligonucleotide was added. The cells were incubated in the dark at 4°C for 30 minutes and then rinsed twice with the aforementioned cell staining buffer mix and twice with Tris-buffered saline (TBS, VWR CAYM600232 - 500). For each wash, the cells were centrifuged at 130 rcf and 4°C for 5 minutes, the supernatant except for 50 μl was removed, and 200 μl of clean buffer was added. After the final wash, the cells were resuspended in 200 μl of TBS.

[0222] Cell staining is usually performed after tissue dissociation, but in order to label cells according to their original positions in the tissue, staining needs to be performed before dissociation.

[0223] The inventors selected a universal external cell marker to label all cells of the tissue without the need for permeabilization.

[0224] The inventors first used flow cytometry (Guava easyCyte 12 HT) markers to demonstrate the non-specificity and absence of marker exchange after staining for Jurkat and Ramos cell lines. Universal cell markers were selected from anti-human CD98 (BioLegend 315603, 315602), anti-human CD298 (BioLegend 341709) or anti-human β2-microglobulin (BioLegend 316317, 316302), lectin jacalin, lectin LCA, lectin PHA-E, and cholesterol modification at the 3' end of the oligo instead of biotin modification (3CholTeg at IDT with HPLC purification).

[0225] After staining each population with one of the markers, a portion of each stained population was mixed together for 30 minutes and analyzed by flow cytometry. The inventors were able to still distinguish each population after mixing, regardless of the type of label, indicating no cross-contamination after staining (data not shown). When using oligos with cholesterol modification, separation is not as critical as with antibodies or lectins, but still exists.

[0226] The inventors also demonstrated that antibody-conjugated oligonucleotides do not exchange their oligonucleotides via biotin-streptavidin binding by mixing a population stained with a marker conjugated to a fluorescent oligonucleotide and a population stained with a marker conjugated to a non-fluorescent oligonucleotide (data not shown).

[0227] Finally, the inventors demonstrated the resistance of selected cell markers to tissue dissociation. Each time, unstained tissue was compared to stained tissue before and after dissociation, and the presence of staining was evaluated by flow cytometry (Guava easyCyte 12HT).

[0228] Using antibodies or lectins and conjugation with fluorophores or fluorescent oligonucleotides, the labeling was partially retained during tissue dissociation (Figure 1). The difference in staining between the pre-dissociation and post-dissociation conditions can be explained by the marker's inability to fully stain the inner part of the tissue block.

[0229] In parallel, the inventors confirmed that both the transcriptome and labeled nucleic acid information associated with the same cells can be recovered in a manner similar to the Cite-seq method (Stoeckius et al., Nat Methods. 2017 Sep;14(9):865-868).

[0230] Example 2: Isothermal amplification of emitter nucleic acids The inventors also tested several isothermal amplifications using reagents and nucleic acids of a similar size as those used for tissues, with the aim of obtaining more than a 1000-fold amplification of oligonucleotides. An example of a procedure for such amplification is described in Figure 2.

[0231] Oligonucleotide Oligonucleotides were designed in silico and checked using RNA Structure and PrimerBlast to limit unwanted hairpin, homodimer, or heterodimer structures. Oligonucleotides were purchased from IDT at a concentration of 100 μM in IDTE buffer (pH 8.0) with standard desalting. The / iBiodT / modification represents internal biotin, the / 56-FAM / modification represents 5'-fluorescein, the / 3Bio / modification represents 3'-biotin, the / 3IABkFQ / modification represents a 3'-quencher with an absorbance spectrum in the range of 420 - 620 nm with a peak absorbance at 531 nm, and the / 5ATTO488N / modification represents a 5'-ATTO 488 fluorophore.

[0232]

Table 3

[0233] Reaction mixture assembly All reactants were incubated at 37 °C for 90 minutes in a thermocycler (CFX384 Touch, Biorad), and SYBR fluorescence was measured every 30 seconds. The reaction mixture was prepared according to Table 2.

[0234]

Table 4

[0235] Under these conditions, the inventors found that the emitter oligonucleotide can generate more than 1 million sequences starting from concentrations up to 0.1 pM (Figure 3).

[0236] The consistency of amplification was confirmed by Sanger sequencing (using LightRun type Eurofins and primers (SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8)) after DNA extraction from agarose gel electrophoresis (similar to that shown in Figure 3c).

[0237] The inventors also tested other polymerases (bst, bsu, phi29), nicking endonucleases (Nt.AlwI, Nb.BtsI) using different buffers (NEB Cutsmart). The inventors also designed and tested other oligonucleotide designs based on the same amplification strategy and also using different amplification strategies (described in Figure 2). The results indicate that these embodiments can also be performed accurately.

[0238] Example 3: Isothermal amplification of emitter nucleic acids and capture on receptor nucleic acids based on 2D layers of live cells. Next, the inventors demonstrated the ability to generate and capture random barcodes directly on 2D layers of live cells.

[0239] Cell culture HEPG2 (ATCC HB-8065) is cultured in DMEM (41965039) containing 10% heat-inactivated fetal bovine serum (Gibco 10082147) and 1% penicillin-streptomycin (Gibco 15140122). Cells are seeded into 25 cm2 or 75 cm2 culture flasks at 37 °C with 5% CO2 according to ATCC recommendations. When 75 - 80% confluence is reached, the cells are passaged.

[0240] HUVEC (Lonza C2519A) cells are cultured in endothelial cell growth medium (Promocel C-22010) and 1% penicillin-streptomycin (Gibco 15140122). Cells are seeded into 12.5 cm2 or 25 cm2 culture flasks at 37 °C with 5% CO2 according to Lonza recommendations. Every 48 hours, half of the medium is exchanged and when 75 - 80% confluence is reached, the cells are passaged.

[0241] Next, HUVEC are passaged in 48-well plates in 250 μl from the aforementioned medium. After 48 hours, half of the medium is exchanged and HEPG2 is added at 0.3% of a 25 cm2 culture per well. After 48 - 72 hours, the co-cultures are ready for staining.

[0242] Antibody conjugation Using a streptavidin conjugation kit (Abcam 102921), purify anti-human CD146 (Biolegend 361002) and purify anti-human CD326 (Biolegend 324202) are conjugated with streptavidin. Then, the conjugated antibodies are mixed with biotinylated oligonucleotides at a ratio of 1:12 in 1× Tris-buffered saline (TBS, VWR CAYM600232-500) and stored protected from light for 12 hours (overnight) at a temperature controlled room of 20-25 °C. The purified anti-human CD146 is conjugated with the sequence consisting of SEQ ID NO: 8, and the purified anti-human CD146 is conjugated with the sequence consisting of SEQ ID NO: 1.

[0243] SEQ ID NO: 9 is the same as SEQ ID NO: 4 from the previous example, but the fluorescein modification at the 5' end of the oligo is replaced with a modification less sensitive to photobleaching, the ATTO 488 fluorophore, and the spacer sequence between the biotin modification and a PCR primer called A is removed (not necessary for this method, data not shown).

[0244] Cell staining Cells in the wells of a 48-well plate are washed with 1 mL of cell staining buffer (Biolegend 420201). A mixture of 20 μl of each antibody-conjugated oligonucleotide (0.1 μg / μl of antibody), 1 μl of Alexa Fluor 647 (Al647) anti-human CD146 antibody (Biolegend 361013) and 2 μl of Brilliant Violet 421 (BV421) anti-human CD326 (Biolegend 324219) in a total of 200 μl of cell staining buffer is added to the cells. The cells are incubated at 4 °C for 30 minutes in the dark. After removing the antibody mixture, 1 mL of cell staining buffer is added.

[0245] The anti-human CD146 antibody is specific for endothelial cells including HUVEC cells, while the anti-human CD326 antibody is specific for epithelial cells including HEPG2 cells. This means that HUVEC cells are stained with the Al647 fluorophore and the reporter sequence (SEQ ID NO: 9), while HEPG2 cells are stained with the BV421 fluorophore and the emitter sequence (SEQ ID NO: 2).

[0246] Reaction Mixture Assembly Prepare the reaction mixture according to Table 3 and add it to each well after removing the cell staining buffer.

[0247] [Table 5]

[0248] Cover the plate and incubate it under an inverted Nikon Ti-2 microscope equipped with a 10x objective lens (MRD70170), a filter wheel (TI2-P-FWB-E), a four-band dichroic and emission filter (Semrock, FF409 / 493 / 573 / 632-Di03-25×3,6 and FF01-432 / 515 / 595 / 730-25), a fluorescence light source (Lumencor SPECTRA X), and a heating stage (Tokai Hit TP-TIZH26) set to 40°C to reach a temperature of 37°C at the cell position.

[0249] During the 2-hour incubation, take 5-by-5 stitch images every 10 minutes in each well in the bright field, BV421, ATTO 488, and Al647 channels.

[0250] Therefore, HUVEC cells are observed in the Al647 channel, HEPG2 is observed in the BV421 channel, and the reporter signal is observed in the ATTO488 channel.<0,

[0251] The fluorescent reporter (SEQ ID NO: 9) present on the surface of HUVEC cells is partially hybridized to a sequence carrying a quencher (SEQ ID NO: 5), preventing the observation of fluorescence. The self-primed emitter (SEQ ID NO: 2) carried by HEPG2 cells releases nucleic acids. After diffusion and amplification, the released nucleic acids hybridize to the fluorescent reporter (SEQ ID NO: 9). Subsequently, the sequence carrying the quencher is released by the polymerization of the released nucleic acids on the reporter, causing the appearance of a fluorescent signal.

[0252] The inventors observed the appearance of signals in ATTO488 co-localized with HUVEC staining in the Al647 channel 40 minutes after the start of incubation (Figure 5).

[0253] Example 4: Staining and Dissociation of Fresh Tissue Using a streptavidin conjugation kit (Abcam 102921), a purified anti-human β2-microglobulin antibody (Biolegend 316302) is conjugated to streptavidin. Subsequently, the conjugated antibody is mixed with biotinylated oligonucleotide in a ratio of 1:12 in 1× Tris-buffered saline (TBS, VWR CAYM600232-500) and stored protected from light for 12 hours (overnight) at a temperature controlled between 2°C and 5°C. After conjugation with streptavidin, the anti-human β2-microglobulin antibody is mixed with SEQ ID NO: 1 in one tube and SEQ ID NO: 10 in the other tube.

[0254] After washing the tissue slides in cell staining buffer (Biolegend 420201), they are incubated at 4°C for 15 - 20 minutes with a mixture in cell staining buffer of 0.5 μg / mL of SEQ ID NO: 1 and 5 μg / mL of the anti-human β2-microglobulin antibody conjugated with SEQ ID NO: 10. Subsequently, the slides are washed with cell staining buffer.

[0255] Prepare the reaction mixture according to Table 4 and add it to the tissue slide after removing the cell staining buffer. The volume can be adjusted to cover the surface of the tissue while taking into account the final concentration.

[0256]

Table 6

[0257] To avoid evaporation, place the tissue slide in a sealed environment and incubate at 37 °C for 1 hour. The strategy for amplification and capture of emitter nucleic acids is detailed in Figure 2.1.

[0258] After washing in HBSS (Thermo 14175053) + 5% FBS (Thermo 16140071), cut the biopsy into the smallest possible pieces (approx. 1 mm).

[0259] Next, transfer the sample to a tube containing 200 μL of 20 mg / mL collagenase I (final: 2 mg / mL, Sigma C0130), 5 μL of 10 mg / mL Dnase I (final: 25 μg / mL, Sigma 11284932001), and 80 μL of 50 mg / mL hyaluronidase (final: 2 mg / mL, Sigma H3506). Adjust the final volume to 2 mL with HBSS. After gently stirring at 37 °C for 50 minutes while pipetting up and down regularly, filter the digested sample through a cell strainer (100 μm) and wash with 1× TBS (Thermo 14190169) containing 1% HS (Thermo 26050088) and 2 mM EDTA (Thermo 15575020). Resuspend the cells in 1× TBS.

[0260] Example 5: Spatially resolved scRNA-seq in a microcage To obtain spatially resolved scRNA-seq through the use of a thermally activatable cage, single cell isolation, barcoding, and sequencing are performed on the chip using the resuspended cells from Example 4 of the present invention.

[0261] The overall method is as follows.

[0262] Synthesis of thermally actuating hydrogels The en-functionalized poly(n-isopropylacrylamide) is synthesized according to the steps described in the additional information of D’Eramo L.; et al., Microsystems & Nanoengineering, 2018, 4, 17069, doi:10.1038.

[0263] The swelling properties of the resulting polymer are evaluated as a function of temperature in various aqueous solutions: pure water, phosphate buffered saline buffers at pH 2 and pH 9. The results are shown in Figure 7.

[0264] Preparation of the first substrate The first substrate made of polydimethylsiloxane (PDMS) is prepared by standard soft lithography techniques and includes microstructures and chambers. The height of the structures and chambers depends on the objective lens and can be from a few tenths of a micron to 100 microns in height.

[0265] Functionalization of the first substrate After washing the PDMS substrate with isopropanol, it is exposed to oxygen plasma for 50 seconds. Immediately after surface activation, a solution of anhydrous toluene containing 3 vol% mercaptopropyltrimethoxysilane (ABCR Gelest) is brought into contact with the substrate in a reactor under nitrogen for 3 hours. Following thiol modification of the surface, the substrate is rinsed with toluene and finally dried with a nitrogen stream.

[0266] Photo-patterning of the hydrogel film onto the first substrate Pre-formed functionalized pNIPAM (which is ene-reactive) is thiol-modified using a dithiol crosslinker and spin-coated onto a thiol-modified and microstructured PDMS substrate. A solution of a few hundred μL of butanol and methanol (V / V = 1 / 1) containing functionalized pNIPAM at a concentration of 3 - 15 wt% and a dithioerythritol (purchased from Sigma Aldrich, CAS number 3483-12-3) crosslinker at a concentration of 3 - 10 wt% is deposited onto the substrate. The spin-coating conditions are fixed at an angular velocity varying between 500 rpm and 3000 rpm for a spin time of 30 seconds. The spread film is dried by heating in an oven at 90 °C for 5 minutes. The thickness of the resulting layer varies from a few tenths of a micron to 15 microns.

[0267] A chromium mask presenting a large number of microstructured cages is aligned with the chamber design and placed under a UV lamp for deep UV exposure (8 watts, 250 nm wavelength). After exposure, the substrate is washed in an ultrapure water bath for 5 minutes to wash away free polymer chains. The hydrogel-patterned substrate is dried in a nitrogen stream.

[0268] Preparation of the second substrate The second substrate used is a slide glass spotted with DNA strands (purchased from Agilent, referred to as Agilent Microarray Format).

[0269] This item presents up to one million unique spots grafted with different DNA strands and provides different barcodes on each spot. Each spot contains millions of DNA strands and each spot has a different barcode.

[0270] A localization system is incorporated during the design of the array. Among the large number of unique spots, some of them have specific sequences for the capture of fluorescently labeled DNA oligonucleotides (two or more) by hybridization. They are arranged to form a plurality of shapes including triangles, squares, and circles.

[0271] Closure of the device The bonding between the first substrate and the second substrate is carried out by using O2 plasma treatment for 50 seconds. To avoid the activation of oxygen plasma there, a protective layer is tapped on the region of interest. After the end of the exposure, the PDMS substrate is placed on top of the DNA array such that the region of interest faces the hydrogel structure. A curing step is applied for at least 30 minutes by storing the chip in an oven at 70 °C.

[0272] Preparation of the chip for specific capture: whole scRNA-seq Oligonucleotides were designed in silico and purchased from IDT at a concentration of 25 - 100 μM in IDTE buffer (pH 8.0) with standard desalting.

[0273] A solution of 100 mM potassium acetate, 30 mM HEPES, pH 7.5 and 10 μM of oligonucleotides Q, R and S is injected into the microfluidic chamber at 40 °C (cage open) to hybridize additional capture sequences to the immobilized DNA strands and proceed to the localization step. The flow is stopped, the chip with the mixed oligonucleotides is heated above 60 °C for 2 minutes, then incubated at room temperature for 10 minutes and rinsed with 1×SSC solution (Thermo Scientific #15413549) at 40 °C. Oligonucleotides Q, R and S are the following sequences: Q:Pre_BclI_P5:CATGCTTGATCAGACCACCGAGATCTAC (SEQ ID NO: 12) R:Phos_Rd1_Nxt_UMI12_PolydT30VN: 5Phos / TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 13) S:Fluo_4.2_3Cy5Sp:CATACTCGGTCTGCG / 3Cy5Sp / (SEQ ID NO: 14).

[0274] Perform bright-field fluorescence imaging (excitation at 650 nm and emission at 670 nm) of the main chamber. Conduct informatic identification of the DNA array spots and the cages. The identification is based on the overlay of both images. The bright-field image enables the identification of the cages. The fluorescence image enables the identification of the specific spots onto which the fluorescent DNA probes have been pre-hybridized. The relative positions of these circles define the unique positions on the chip and enable mapping onto the image overlaid with the original configuration of the DNA array. Finally, thanks to this identification, spot-specific barcodes can be associated with each cage.

[0275] Primer synthesis. Inject a mixture containing Sulfolobus DNA polymerase IV (NEB#M0327S) and Hi-T4 ligase (NEB#M2622S) into Thermopol 1× (NEB#B9004S) supplemented with 1 mM ATP (NEB#P0756S) at 40 °C, then incubate in the chamber at 50 °C for 2 hours to polymerize and ligate the barcoded primers. Then rinse the contents with a 1× SSC solution (Thermo Scientific#15413549) at 40 °C.

[0276] Single-cell capture Prepare a cell suspension at a concentration of 10 million cells per mL containing 1% BSA in TBS. Inject the cells into the chip at 100 μl / h and heat the chip to 37 °C to open the cages. Once the cells have circulated around and above the cages, stop the flow and lower the temperature to 20 °C to close the cages. The cells are captured inside the cages.

[0277] To perform lysis, inject a solution of 0.2% SDS (Sigma 71736) in PBS into the chamber through an additional inlet not blocked by the swollen hydrogel cages.

[0278] The RNA strands of the cells then hybridize to the grafted capture sequences as the aqueous phase around the cage is exchanged with PBS.

[0279] After a 10-minute flow stop, the cage is opened (temperature raised to 37 °C), and a washing step is performed by flowing PBS through the chamber.

[0280] Barcoded cDNA synthesis The cage is opened at 37 °C, and a washing step is performed by flowing RT buffer (Thermo Scientific#EP0742) in a volume equivalent to 20 times the internal volume of the chamber through the chamber for 3 minutes.

[0281] After washing, a mixture containing 10 U / μl reverse transcriptase (Thermo Scientific#EP0742), 0.5 mM dNTP (NEB#N0447S), and 1 U / μl RNase inhibitor (Thermo Scientific#11581505) in 1× RT buffer is injected into the chamber, followed by immobilization of the flow and reverse transcription of the captured strands at 50 °C for 2 hours. The enzyme is immediately flushed with 1× SSC solution to stop the reverse transcription.

[0282] A second mixture containing 2 U / μl exonuclease I in 1× Exonuclease I reaction buffer (NEB#M0293S) is injected and incubated at 37 °C for 30 minutes. The enzyme is immediately flushed with 1× SSC solution to stop the reaction.

[0283] DNase / RNase-free distilled water (Invitrogen#10977023) is injected into the chamber and heated to 98 °C to denature the synthesized cDNA. The contents are then recovered by flowing additional water.

[0284] 10 μL of NEB2 buffer (NEB#M0212L) and 10 μL of 10 μM oligonucleotide T are added to the 65 μL of recovered sample.

[0285] Incubate the solution at 95 °C for 2 minutes and immediately transfer it to ice. Then add 8 μL of 10 nm dNTP and 7 μL of Klenow exo (NEB#M0212L).

[0286] Place the mixture in a thermocycler pre-cooled to 4 °C, slowly raise the temperature to 37 °C, and hold for 30 minutes to perform second-strand synthesis.

[0287] Next, purify the cDNA using SPRIselect magnetic beads (Beckman#B23317) according to the manufacturer's instructions.

[0288] Next, perform 15 cycles of two-step PCR amplification with 30-second extension on the purified sample using primers U and V and Q5 High-Fidelity DNA Polymerase (NEB#M0491).

[0289] Oligonucleotides U and V have the following sequences: U: P5: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 15) V: P7_i05_Rd2_Nxt: CAAGCAGAAGACGGCATACGAGATCCAGGAAGGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16).

[0290] Purify and quantify the PCR product using SPRIselect magnetic beads (Beckman#B23317), and then sequence it using the Illumina sequencing platform.

[0291] Demultiplexing of the sequencing data is performed by searching for the barcode from positions 1 to 15 of the Index1 read, the UMI from positions 1 to 12 of the Read1 read, and the RNA transcript starting from position 1 of the Read2 read for each read.

[0292] By replacing 10% of the oligonucleotide Q with a similar oligonucleotide having a capture sequence for the emitter nucleic acid (SEQ ID NO: 3) at its 3'-end instead of the polyT tail, after cell lysis in the thermo-activated cage, the emitter nucleic acid that was previously present on the cell surface hybridizes with the cage-specific primer and associates with the cage barcode in the same way as mRNA after DNA synthesis.

[0293] Amplification is performed on a sub-part of the cDNA solution using a complementary primer to U, which is V and contains at its 3'-end the amplification sequence of the emitter nucleic acid represented by SEQ ID NO: 11.

[0294] After sequencing, the identification sequences of the emitter nucleic acids of the cells can be linked to the mRNA transcripts of the same cells thanks to the cage barcodes. The presence and their relative amounts of the same identification sequences are used to reconstruct the cell neighborhood.

[0295] Example 6: Spatially resolved scRNA-seq on the Drop-seq platform To obtain spatially resolved scRNA-seq, Drop-seq is performed with modifications using the resuspended cells from Example 4 as described in (Macosko, E.Z. et al. Cell 161, 1202 - 1214 (2015)). 10% of the oligonucleotides on the hydrogel beads carry at their 3'-ends a capture sequence for the emitter nucleic acid (SEQ ID NO: 3) that replaces the polyT tail. Thus, the emitter nucleic acids are associated with the same droplet barcodes as the mRNAs.

[0296] cDNA is isolated and amplified with modifications as described in Stoeckius, M et al. Simultaneous epitope and transcriptome measurement in single cells. Nat Methods 14, 865 - 868 (2017). Barcoded emitter nucleic acids are amplified using an auxiliary primer containing an amplification sequence of the emitter nucleic acid represented by SEQ ID NO: 11 at the 3′ end. After sequencing, the identification sequences of the emitter nucleic acids of the cells can be linked to the mRNA transcripts of the same cells thanks to the cage barcodes. The presence and relative amounts of the same identification sequences are used to reconstruct the cell neighborhood.

Claims

1. A method for labeling individual cells or organelles in a biological sample with a discriminant nucleic acid sequence, comprising: a) providing a first set of nucleic acids (“emitter nucleic acids”), each nucleic acid molecule comprising an amplification sequence, a discriminant sequence, and a capture sequence; b) providing a second set of nucleic acids (“receptor nucleic acids”), each receptor nucleic acid being covalently or non-covalently coupled to a ligand of a cell target or organelle target, said receptor nucleic acid comprising i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement; c) contacting a set of emitter nucleic acids and receptor nucleic acids in solution with a biological sample so as to label said individual cells or organelles in the biological sample with at least said receptor nucleic acid; d) releasing a plurality of nucleic acid molecules (“released nucleic acids”) that are copies of regions of said emitter nucleic acids comprising said amplification sequence, said discriminant sequence, and said capture sequence, or their reverse complements, and hybridizing said released nucleic acids to receptor nucleic acids; e) dissociating said biological sample and recovering individualized cells or organelles, wherein at least a subpopulation of said individualized cells or organelles is labeled with said released nucleic acids.

2. The method according to claim 1, wherein each emitter nucleic acid is bound to a ligand of a cell target or organelle target.

3. The method according to claim 2, wherein in step c), the biological sample is rinsed after being contacted with the set of emitter nucleic acids and receptor nucleic acids.

4. The method according to any one of claims 1 to 3, wherein said emitter nucleic acid further comprises a sequence complementary to a nicking site, and in step c), the production of the released nucleic acid is carried out by isothermal amplification by nicking and polymerization catalyzed by a nicking endonuclease and a polymerase having strand displacement activity.

5. The method according to any one of claims 1 to 3, wherein the set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids, and all emitter nucleic acids in the group comprise the same discriminant sequence.

6. The group of emitter nucleic acids is (a) A concatemer of emitter nucleic acids generated by rolling circle replication, wherein each concatemer contains the same emitter nucleic acid, or (b) The method according to claim 5, comprising beads carrying emitter nucleic acids containing the same identification sequence.

7. The method according to claim 5 or 6, wherein in step d), the group of emitter nucleic acids is cleaved by a restriction endonuclease to release a plurality of copies of the released nucleic acids.

8. The method according to any one of claims 1 to 7, wherein the receptor nucleic acid further comprises a restriction site or a cleavage site.

9. The method according to any one of claims 1 to 8, wherein the cell target or organelle target is a target ubiquitously present on the surface or inside all or most of the cells or any organelles of the cells in the biological sample.

10. The method according to any one of claims 1 to 9, wherein an image of the biological sample is taken by a microscope before step d) or before step e).

11. A method for mapping and sequencing individual cells or organelles of a biological sample, comprising: a) providing (i) a nucleic acid comprising an amplification sequence, an identification sequence, and a capture sequence, or (ii) individualized cells labeled with the reverse complement of (i), obtainable by the method according to any one of claims 1 to 10; b) capturing the individualized cells or organelles labeled with the nucleic acid or its reverse complement within a compartment, wherein the compartment comprises a compartment-specific nucleic acid and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site; c) optionally, analyzing the captured cells, organelles, and / or molecules secreted by them using optical detection; d) lysing the captured cells, or cells and organelles, thereby releasing nucleic acids from the cells or organelles within the compartment; e) associating (i) the compartment-specific sequence, (ii) the nucleic acid released from the cells or organelles within the compartment, and (iii) the nucleic acid comprising the amplification sequence, the identification sequence, and the capture sequence, or their reverse complements; f) recovering the nucleic acid generated in step e) from the compartment and sequencing the recovered nucleic acid. g) defining a nucleic acid comprising the same compartment-specific sequence as that derived from the same single cell, and mapping the position of the original single cell on the biological sample based on the identification sequence or its reverse complementary sequence contained in the nucleic acid generated in step e), thereby combining the mapping and sequencing information of the individual cells of the biological sample; h) determining the relative ratio of the same identification sequence or its reverse complementary sequence contained in the nucleic acid generated in step e), and mapping the position of the original single cell on the biological sample by estimating the distance between cells based on the principle of triangulation; i) optionally, mapping the sequencing information back onto the microscopic image of the biological sample obtained before dissociation. A method comprising the above steps. **Claim 12** The mapping and sequencing method according to claim 11, wherein the compartment is a droplet, a hydrogel matrix, a microfabricated chamber separated by an air valve, a microfabricated well, an operable hydrogel cage or a microplate well. **Claim 13** The mapping and sequencing method according to any one of claims 11 to 12, wherein the compartment-specific nucleic acid contained in the compartment is DNA. **Claim 14** Step e) is any of the following: i) hybridizing the compartment-specific nucleic acid to the released nucleic acid from the cell or organelle by complementarity; ii) hybridizing the compartment-specific nucleic acid to the released nucleic acid from the cell or organelle by complementarity, and using DNA polymerase to extend the compartment-specific nucleic acid hybridized to the released nucleic acid to produce a complementary strand of the released nucleic acid having an associated compartment-specific sequence; iii) hybridizing the compartment-specific nucleic acid by complementarity to the 3'-end of cDNA generated by reverse transcription of RNA from the cell or organelle, and using DNA polymerase to extend the cDNA hybridized to the compartment-specific nucleic acid to produce the complementary strand of the compartment-specific nucleic acid having an associated compartment-specific sequence; iv) ligating the compartment-specific nucleic acid to the DNA present in the compartment, or v) recombining the compartment-specific nucleic acid with the DNA present in the compartment. The mapping and sequencing method according to any one of claims 11 to 13, comprising the above steps.

15. - The compartment-specific nucleic acid contains a primer sequence complementary to all or part of the amplification or capture sequence present in the nucleic acid containing the amplification sequence, the identification sequence, and the capture sequence, or in its reverse-complementary nucleic acid, - Step e) further comprises hybridizing the compartment-specific nucleic acid to all or part of the amplification sequence or the capture sequence present in the nucleic acid containing the amplification sequence, the identification sequence, and the capture sequence, or in its reverse-complementary nucleic acid, and extending one or both of the hybridized DNA strands using DNA polymerase to produce a DNA molecule containing both the identification sequence or its reverse-complement and the compartment-specific sequence or its complement, or alternatively, instead of the hybridization and extension steps, step e) further comprises ligating the compartment-specific nucleic acid to all or part of the amplification or capture sequence present in the nucleic acid, or recombining the compartment-specific nucleic acid with all or part of the amplification or capture sequence present in the nucleic acid. The method for mapping and sequencing according to any one of claims 11 to 14.

16. a) Each emitter nucleic acid is an emitter nucleic acid containing an amplification sequence, an identification sequence, and a capture sequence, b) Each receptor nucleic acid is a receptor nucleic acid containing i) an amplification sequence that matches all or part of the amplification sequence of the set of emitter nucleic acids, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the set of emitter nucleic acids, or its complement, c) A ligand for a cell target or an organelle target, d) Optionally, a nicking endonuclease and a polymerase having strand displacement activity. A kit comprising the same.