LincRNA-p21 and its uses

Short lincRNA-p21 fragments targeting DDB2 protein inhibit DNA repair and enhance chemotherapy sensitivity in cancer cells, addressing chemoresistance by promoting DDB2 degradation and improving treatment outcomes.

JP2025527230AActive Publication Date: 2025-08-20CHINA MEDICAL UNIVERSITY(TW)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2025505548
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-08-02
Filing Date
2023-07-27
Publication Date
2025-08-20
Estimated Expiration
2043-07-27

AI Technical Summary

Technical Problem

Cancer cells develop resistance to chemotherapy due to high DNA repair activity, particularly mediated by the DDB2 protein, leading to chemoresistance, and current therapies lack effective DDB2 inhibitors.

Method used

Utilizing three short RNA fragments derived from lincRNA-p21 that target DDB2, these fragments inhibit DDB2 activity, enhancing the sensitivity of cancer cells to chemotherapy by promoting proteasomal degradation of DDB2 and disrupting DNA repair pathways.

Benefits of technology

The lincRNA-p21 fragments enhance the efficacy of chemotherapeutic agents by reducing chemoresistance and increasing sensitivity to chemotherapy in cancer cells, particularly in those with high DDB2 expression or drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025527230000001
    Figure 2025527230000001
  • Figure 2025527230000002
    Figure 2025527230000002
  • Figure 2025527230000003
    Figure 2025527230000003
Patent Text Reader

Abstract

A composition for treating cancer is provided, comprising a DDB2 inhibitor and a chemotherapeutic agent, wherein the DDB2 inhibitor comprises three RNA fragments derived from lincRNA-p21. Furthermore, the DDB2 inhibitor enhances the chemosensitivity of cancer to chemotherapeutic agents for the treatment of cancers that are unresponsive to chemotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a composition for treating cancer, comprising three RNA fragments derived from lincRNA-p21 and a chemotherapeutic agent. In particular, the three RNA fragments derived from lincRNA-p21 with DDB2 targeting activity improve the cell sensitivity of various cancers to chemotherapeutic agents. [Background technology]

[0002] Description of the Prior Art

[0003] In response to chemotherapy treatment, the DNA damage response (DDR) occurs, and p53 is activated to transcriptionally regulate gene expression, which determines cell fate toward senescence, cell cycle progression, cell apoptosis, or DNA repair. High DNA repair activity in cancer cells through nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR), or non-homologous end joining (NHEJ) contributes to the development of drug resistance to chemotherapy. Targeting diverse DDR or DNA repair components has been considered a promising therapeutic strategy in cancer. The exquisite sensitivity of BRCA1 / 2 mutant tumors to poly(ADP-ribose) polymerase (PARP) inhibition has led to successful clinical treatment with PARP inhibitors. Thus, synthetic lethality through simultaneous targeting of diverse DNA repair / DDR pathways has provided a paradigm for the development of novel potential clinical strategies.

[0004] Among DNA repair mechanisms, NER plays a crucial role in the removal of cisplatin- or doxorubicin-induced DNA damage. Upon chemotherapy stimulation, damaged DNA-binding protein 2 (DDB2) is upregulated by activated p53 and acts as the first protein to recognize damaged DNA. DNA-bound DDB2 is then polyubiquitinated and proteasomal degraded, delivering the damaged DNA site to the second recognition protein, XPC, for further recruitment of other DNA repair proteins involved in NER. DDB2 expression is induced by DNA-damaging agents, including doxorubicin, and confers chemoresistance. Mutation or insufficiency of DDB2 reduces the recognition of damaged DNA and the recruitment of NER-related proteins, leading to DNA repair failure. Furthermore, PARP1 has also been reported to promote NER efficiency by interacting with and stabilizing DDB2 protein expression. Suppression of DDB2 increases cellular sensitivity to PARP inhibitors in triple-negative breast cancer by destabilizing Rad51, suggesting a further role for DDB2 in regulating HR. In addition to DNA repair, DDB2 activity occurs in several stages of tumor progression, including cancer cell proliferation, survival, epithelial-mesenchymal transition, migration and invasion, and cancer stem cell formation. Therefore, targeting DDB2 is a potential strategy to increase chemosensitivity and the anticancer activity of PARP inhibitors. However, no DDB2 inhibitors or modulators are available for cancer therapy.

[0005] Nucleic acid therapy is also applicable to cancer treatment, but challenges of RNA stability, delivery, and structure remain, and RNA therapy still lags behind other therapies in terms of strategies for treating cancer.

[0006] Because most long non-coding RNAs (lncRNAs) are at least 200 nt in length, it is very difficult to use lncRNAs in therapeutic strategies for RNA therapy. Therefore, lncRNAs have received little attention and application in clinical practice, and most lncRNAs are considered as disease markers rather than therapeutic agents. DETAILED DESCRIPTION OF THE INVENTION

[0007] The present invention demonstrates an inverse correlation between lincRNA-p21 and DDB2 in different subtypes of mutp53-expressing breast cancer cell lines and clinical specimens. Increased lincRNA-p21 has been shown to enhance the polyubiquitination and proteasomal degradation of DDB2 by acting as a scaffold for the Cul-4 / DDB1 / DDB2 E3 ligase complex. Downregulation of DDB2 by lincRNA-p21 has been shown to suppress DNA repair. More importantly, three essential elements of lincRNA-p21, including 5'-CUUGUGUCCCCUUCCCACAG-3' (671-690 nt; #3) (SEQ ID NO:1); 5'-CAGGGAACCCCUUCAAUCCC-3' (875-894 nt; #4) (SEQ ID NO:2); and 5'-UGGGAGCCCCCUUCCUAAAA-3' (2,158-2,177 nt; #9) (SEQ ID NO:3), for direct interaction and inhibition of DDB2 protein have been identified in different binding assays. Structural binding affinity calculations have also revealed that short lincRNA-p21 elements may affect DDB2 stability and DNA repair. Co-treatment of cancer cells with short lincRNA-p21 elements or exosomes containing short lincRNA-p21 elements has been found to enhance chemotherapy-induced cytotoxicity.

[0008] Short lincRNA-p21 elements using exosomes as a delivery system function as lncRNA-based DDB2 inhibitors and show potential to enhance chemosensitivity, which may be beneficial for patients with breast cancer or other cancer types who have failed to respond to chemotherapy.

[0009] As used herein, the terms "a" or "an" are used to describe elements and components of the present invention. This is done merely for convenience and to give a general sense of the invention. This description should be interpreted to include one or at least one, and the singular also includes the plural unless it is clear that a different meaning is intended.

[0010] The term "or," as used herein, may mean "and / or."

[0011] The present invention provides a nucleic acid molecule comprising the sequence of a long intergenic non-coding RNA-p21 (lincRNA-p21), wherein the sequence of the lincRNA-p21 is selected from the group consisting of CUUGUGUCCCCUUCCCACAG (SEQ ID NO: 1), CAGGGAACCCCUUCAAUCCC (SEQ ID NO: 2), and UGGGAGCCCCCUUCCUAAAA (SEQ ID NO: 3).

[0012] The present invention also provides a composition comprising a sequence of lincRNA-p21, wherein the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0013] Furthermore, the present invention further provides a method for treating cancer, comprising administering a composition to a subject suffering from cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0014] The present invention provides use of a composition for preparing a medicament for treating cancer, wherein the composition comprises a lincRNA-p21 sequence and a chemotherapeutic agent, and the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0015] The present invention also provides a composition for use in treating cancer, the composition comprising a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0016] The term "subject," as used herein, refers to an animal, particularly a mammal. In a preferred embodiment, the subject is a human.

[0017] Damaged DNA-binding protein 2 (DDB2) is an important protein that recognizes DNA damage, initiates DNA repair, and renders cancer cells resistant to chemotherapy. In the present invention, three short sequences derived from lincRNA-p21 interfere with the DNA damage repair pathway. Furthermore, the lincRNA-p21 sequence can inhibit DDB2-induced DNA repair and enhance the anti-cancer effects of chemotherapy. Therefore, the lincRNA-p21 sequence inhibits DDB2 expression, thereby reversing or reducing cancer cell resistance to chemotherapy and / or enhancing the sensitivity of cancer cells to chemotherapy. In one embodiment, the lincRNA-p21 sequence enhances the sensitivity of cancer cells to chemotherapy by inhibiting DDB2 expression. Therefore, DDB2 can be identified as a therapeutic target for cancer. In one embodiment, the cancer includes cancer with high expression of DDB2. In the present invention, cancer with high expression of DDB2 means that the expression of DDB2 in tumor tissue is 1.5 times higher than that in normal tissue. In another embodiment, the cancer has poor response or drug resistance to chemotherapeutic agents. In a preferred embodiment, the cancer with high expression of DDB2 has poor response or drug resistance to chemotherapeutic agents.

[0018] In some embodiments, the chemotherapeutic agent is an anti-cancer drug. In one embodiment, the cancer is a cancer associated with drug resistance. Thus, the cancer has drug resistance to the chemotherapeutic agent. The present invention provides a method for treating cancer by reducing drug resistance to a chemotherapeutic agent, the method comprising administering a composition to a subject suffering from a cancer associated with drug resistance, the composition comprising a lincRNA-p21 sequence and a chemotherapeutic agent, wherein the lincRNA-p21 sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. The lincRNA-p21 sequence may reverse or reduce cancer cell resistance to the chemotherapeutic agent and / or enhance the sensitivity of cancer cells to the chemotherapeutic agent.

[0019] The term "treating" includes, but is not limited to, reducing, inhibiting or limiting the proliferation of cancer cells, reducing, inhibiting or limiting the metastasis of cancer cells or the invasiveness of cancer cells or metastases, or reducing, inhibiting or limiting one or more symptoms of cancer or its metastases.

[0020] In one embodiment, the cancer comprises breast cancer, liver cancer, cholangiocarcinoma, lung cancer, colon cancer, head and neck squamous cell carcinoma, gastric adenocarcinoma, and esophageal cancer. In a preferred embodiment, the cancer comprises breast cancer and liver cancer. In a preferred embodiment, the cancer comprises breast cancer.

[0021] In another embodiment, the cancer cells of the cancer have mutant p53. In a preferred embodiment, the cancer cells of breast cancer have mutant p53. In a more preferred embodiment, the cancer cells of breast cancer are estrogen receptor (ER) positive and have mutant p53.

[0022] In one embodiment, the breast cancer has a poor response or drug resistance to chemotherapeutic agents.

[0023] As used herein, a chemotherapeutic agent is a compound that can inhibit the growth of cancer cells or tumors. It is understood that one or more chemotherapeutic agents may be used in any of the methods provided herein. For example, two or more chemotherapeutic agents, three or more chemotherapeutic agents, four or more chemotherapeutic agents, etc. may be used in the methods provided herein. Exemplary chemotherapeutic agents include, but are not limited to, anticancer compounds such as cyclophosphamide, doxorubicin, 5-fluorouracil, docetaxel, paclitaxel, methotrexate, epirubicin, cisplatin, carboplatin, vinorelbine, capecitabine, gemcitabine, mitoxantrone, isabepilone, eribulin, carmustine, nitrogen mustard, sulfur mustard, platinum tetranitrate, vinblastine, etoposide, camptothecin, topoisomerase inhibitors, and derivatives or one or more combinations thereof. In one embodiment, the chemotherapeutic agent comprises carboplatin, cisplatin, or doxorubicin.

[0024] In some embodiments, the lincRNA-p21 sequence is effective in enhancing the therapeutic effect of a chemotherapeutic agent. As used herein, the term "enhancing the therapeutic effect" includes any of a number of subjective or objective factors that indicate a beneficial response or improvement in the condition being treated as discussed herein. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes reversing or reducing cancer cell resistance to the chemotherapeutic agent and / or enhancing the sensitivity of a drug-resistant cancer. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes modifying drug-resistant cancer cells so that the cells are not resistant to the chemotherapeutic agent. For example, enhancing the therapeutic effect of a chemotherapeutic agent includes additively or synergistically improving or increasing the activity of the chemotherapeutic agent.

[0025] In the present invention, a composition comprises one or more sequences of lincRNA-p21 and one or more chemotherapeutic agents. In one embodiment, the composition further comprises a pharmaceutically acceptable carrier. The term "carrier" refers to a compound, composition, substance, or structure that, when combined with a compound or composition, aids or enhances the preparation, storage, administration, delivery, efficacy, selectivity, or any other characteristic of the compound or composition for its intended use or purpose. In other embodiments, the pharmaceutically acceptable carrier comprises a liposome, nanoparticle, exosome, micelle, polymeric matrix, or gel matrix. In the present invention, the lincRNA-p21 sequence is contained within or complexed with a liposome, nanoparticle, exosome, micelle, polymeric matrix, or gel matrix. In one embodiment, the pharmaceutically acceptable carrier comprises a liposome or exosome.

[0026] In the present invention, the lincRNA-p21 sequence can be loaded into exosomes. In another embodiment, the pharmaceutically acceptable carrier comprises exosomes, and the lincRNA-p21 sequence is contained within the exosomes. Exosomes containing the lincRNA-p21 sequence are prepared for cancer treatment. Furthermore, exosomes can be bound to anti-human leukocyte antigen G (HLAG) antibodies to form anti-HLAG exosomes. Because HLAG is highly expressed in a wide variety of cancers, the use of anti-HLAG antibodies increases the delivery efficiency of exosomes containing the lincRNA-p21 sequence and a chemotherapeutic agent to cancer cells. In one embodiment, the composition further comprises a targeting molecule for binding to a biomarker on cancer cells. In a preferred embodiment, the targeting molecule comprises an anti-HLAG antibody. Thus, the anti-HLAG antibody can bind to the lincRNA-p21 sequence or exosomes to form a therapeutic complex for use in cancer treatment.

[0027] In the methods provided herein, the lincRNA-p21 sequence may be administered to a subject before, simultaneously with, or after administration of a chemotherapeutic agent. Furthermore, the compositions of the present invention may be administered by any of a variety of routes, including by injection (e.g., subcutaneous, intramuscular, intravenous, intraarterial, or intraperitoneal), by continuous intravenous infusion, cutaneously, dermally, transdermally, orally (e.g., tablet, pill, drench, or edible film strip), by implanted osmotic pump, by suppository, or by aerosol spray. Routes of administration include, but are not limited to, topical, intradermal, intrathecal, intralesional, intratumoral, intravesical, intravaginal, intraocular, intrarectal, intravesicular, intrapulmonary, intracranial, intraventricular, intraspinal, cutaneous, subcutaneous, intraarticular, intrabody cavity placement, nasal inhalation, pulmonary inhalation, skin impression, and electroporation. Administration may be systemic or local. The pharmaceutical composition may be delivered locally to the area in need of treatment, for example, by topical application or local injection. Multiple administrations and / or dosages may also be used.

[0028] In the present invention, a subject is administered a therapeutically effective amount of a composition comprising a lincRNA-p21 sequence and a chemotherapeutic agent. The term "therapeutically effective amount" is defined as any amount necessary to produce a desired physiological response. The dosage range for administration is large enough to produce the desired effect in which one or more symptoms of a disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as undesirable cross-reactions, anaphylactic reactions, etc.

[0029] Dosages of lincRNA-p21 sequences or chemotherapeutic agents typically range from about 0.0001, 0.001, or 0.01 mg / kg / day to about 1000 mg / kg / day, but may be higher or lower depending on, among other factors, the activity of the composition, its bioavailability, the mode of administration, and the various factors discussed above. Dosage amounts and intervals may be adjusted individually to provide local and / or systemic concentrations of exosomes sufficient to maintain therapeutic or prophylactic efficacy. For example, the composition may be administered once a week, several times a week (e.g., every other day), once a day, or multiple times a day, depending on, among other factors, the mode of administration, the specific indication being treated, and the judgment of the prescribing physician. One of skill in the art will be able to optimize effective local dosages without undue experimentation. In one embodiment, a therapeutically effective amount of the composition ranges from 0.01 to 100 mg / kg body weight. In a preferred embodiment, a therapeutically effective amount of the composition ranges from 0.1 to 50 mg / kg body weight. In a more preferred embodiment, the therapeutically effective amount of the composition is in the range of 1 to 10 mg / kg body weight.

[0030] In this context, chemotherapy resistance is a major problem in the clinical treatment of various cancers.Among these, the DNA repair induced by DDB2 protein is one of the main reasons why cancer cells are insensitive to chemotherapy.The present invention mainly finds that lincRNA-p21 can directly bind to DDB2 and cause its degradation, and therefore can be used as the first inhibitor of DDB2, which can improve clinical chemotherapy drugs such as carboplatin, cisplatin and doxorubicin.

[0031] More importantly, using different experimental methods to identify three basic short sequences required for the binding of lincRNA-p21 and DDB2 protein, computer prediction and calculations showed that these three short lincRNA-p21 sequences can bind to the region of DDB2 that interacts with DDB1 protein. The molecular interface between them stabilizes the formation of the Cul-4 / DDB1 / DDB2 complex. These three sequences can also directly bind to DDB2 protein without requiring full-length lincRNA-p21, promoting DDB2 proteolysis and increasing the sensitivity of cancer cells to chemotherapy drugs. Because lincRNA-p21 is over 3,000 nucleotides long, the synthesis, delivery, and stabilization of the product would be extremely difficult if full-length lincRNA-p21 were used as an RNA therapy strategy. Another important breakthrough of the present invention is the demonstration that just three short lincRNA-p21 sequences, each approximately 20 nucleotides long, can directly bind to DDB2, and the mechanism of action can be analyzed using molecular biology and molecular simulation. This may achieve the functions of DDB2 protein degradation, DNA repair inhibition and chemosensitivity enhancement.

[0032] More importantly, the present invention used exosomes as a drug delivery model, coating three short sequences of lincRNA-p21 with the chemotherapy drug doxorubicin (exoLinc-p21s), and demonstrated that exoLinc-p21s can enhance doxorubicin toxicity and growth inhibition in cancer cells. Furthermore, anti-HLAG exosomes were further used as an RNA delivery system to identify cancer cells, and anti-HLAG antibodies loaded onto exosomes can improve the delivery efficiency of exoLinc-p21s and chemotherapy drugs to cancer cells. The results demonstrate that anti-HLAG exosomes can not only promote the degradation of DDB2 protein and tumor cell toxicity caused by exoLinc-p21s, but also increase tumor delivery efficiency and sensitivity to chemotherapy drugs.

[0033] In conclusion, three short sequences of lincRNA-p21 (Linc-p21s), which are essential for binding to DDB2, have been identified and developed as first-in-class DDB2 inhibitors, offering advantages over full-length lincRNA-p21 in terms of low synthesis cost, high stability, and delivery efficiency. Linc-p21s has been shown to stabilize the molecular interface between DDB2 and DDB1 proteins in molecular simulation analyses and has been demonstrated to directly bind to DDB2 protein for its proteasomal degradation. Using exosomes expressing a cancer-targeting αHLAG antibody as a delivery system, exosomal Linc-p21s (exoLinc-p21s) packaged with chemotherapeutic agents has been shown to enhance the cytotoxic and growth-inhibitory effects of doxorubicin against cancer cells in cell lines and animal models. As a first-in-class DDB2 inhibitor, exoLinc-p21s has the potential to be developed as a novel RNA-based chemosensitizer that will benefit patients with diverse cancer types. [Brief explanation of the drawings]

[0034] [Figure 1A] Figures 1A-1C show that lincRNA-p21 expression negatively correlates with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early-stage (stage IIA, n = 12; stage IIB, n = 12) than in late-stage (stage IIIA, n = 8; stage IIIB, n = 8) human breast cancer tumors (Figure 1A) and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n = 27) than in ERα-positive (n = 13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression as calculated by the average number of dots per nucleus. Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. [Figure 1B] Figures 1A-1C show that lincRNA-p21 expression negatively correlates with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early-stage (stage IIA, n = 12; stage IIB, n = 12) than in late-stage (stage IIIA, n = 8; stage IIIB, n = 8) human breast cancer tumors (Figure 1A) and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n = 27) than in ERα-positive (n = 13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression as calculated by the average number of dots per nucleus. Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. [Figure 1C] Figures 1A-1C show that lincRNA-p21 expression negatively correlates with stage, tumor size, and ERα status. Figures 1A and 1B show that lincRNA-p21 expression, quantified by in situ hybridization (ISH) assay, is higher in early-stage (stage IIA, n = 12; stage IIB, n = 12) than in late-stage (stage IIIA, n = 8; stage IIIB, n = 8) human breast cancer tumors (Figure 1A) and negatively correlates with tumor size (Figure 1B). Figure 1C shows that lincRNA-p21 expression, quantified by ISH assay, is higher in ERα-negative (n = 27) than in ERα-positive (n = 13) human breast cancer tumors. Arrows indicate the signal of lincRNA-p21 expression as calculated by the average number of dots per nucleus. Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001.

[0035] [Figure 2A]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2B]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2C]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2D]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2E]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2F]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2G]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2H]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2I]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 2J]Figures 2A-2J show that higher lincRNA-p21 expression is observed in early-stage ERα-negative breast cancers with smaller tumor size, contributing to chemosensitivity in breast cancer. Figure 2A shows an example of the treatment timeline in a Tet-On-LincRNA-p21 tumor xenograft mouse model (arrow: starting point of 0.2 mg / mL tetracycline administration) (top). Figure 2A also shows that the growth rate of T47D human breast xenograft tumors is inhibited by tetracycline-induced lincRNA-p21 expression (bottom). Data are representative of three independent experiments in each group and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. Figures 2B, 2C, and 2D show that ex vivo induction of lincRNA-p21 expression by carboplatin (50 μM) negatively correlated with disease stage (Figure 2B) and tumor size (n = 61) (Figure 2C) and was higher in ERα-negative (n = 14) than in ERα-positive (n = 47) human primary breast cancer tissues (Figure 2D). Welch two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 2E shows that induction of lincRNA-p21 expression negatively correlated with the IC50 of breast cancer cell lines in response to chemotherapy. Figures 2F and 2G show that ectopic expression (Figure 2F) and silencing (Figure 2G) of lincRNA-p21 altered carboplatin-induced apoptotic death of T-47D cancer cells in a fluorescence-activated cell sorting (FACS) assay. Figure 2H shows that lincRNA-p21 silencing reduces carboplatin-induced expression of apoptotic markers in MDA-MB-231 cancer cells. Figures 2I and 2J show that lincRNA-p21 silencing by two independent shRNAs suppresses the chemosensitizing effects of tamoxifen (Figure 2I) and ERα silencing (Figure 2J) in BT-474 cancer cells, as evidenced by the induction of apoptotic death measured by FACS assay. Data in Figures 2F, 2G, 2I, and 2J are representative of at least three experiments and are shown as the mean ± SD.*p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test.

[0036] [Figure 3A] Figures 3A and 3B show that lincRNA-p21 is an intermediate factor in ERα-associated chemoresistance. Figures 3A and 3B show the raw data of Figures 2I and 2J in FACS assays. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 3B] Figures 3A and 3B show that lincRNA-p21 is an intermediate factor in ERα-associated chemoresistance. Figures 3A and 3B show the raw data of Figures 2I and 2J in FACS assays. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test.

[0037] [Figure 4A]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4B]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4C]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4D]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4E]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4F]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4G]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4H]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4I]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4J]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 4K]Figures 4A-4K show that lincRNA-p21 reduces DNA repair and negatively correlates with DDB2 expression. Figure 4A shows that lincRNA-p21 silencing reduces cisplatin (50 μM)-induced cisplatin-DNA adduct (Pt-(GpG) purine dimer) formation in MDA-MB-231 cancer cells in a time-dependent manner in an immunofluorescence assay. Images derived from the immunofluorescence assay are quantified using ImageJ analysis. Figure 4B shows the network of protein-coding genes associated with Erα-positive expression analyzed using STRING and Cytoscape 3.8.0. Figure 4C shows that DDB2 expression, as analyzed in the GSE18908 dataset, is higher in Erα-positive than in Erα-negative human breast cancer tissues. Welch two-sample t-test: *p<0.05, **p<0.01, ***p<0.001. Figure 4D shows that overall survival (OS, n = 187) was poorer in patients with Erα-positive breast cancer receiving neoadjuvant chemotherapy in Kaplan-Meier survival analysis. Figures 4E and 4F show that ex vivo induction of DDB2 mRNA expression by carboplatin (50 μM) was higher in Erα-positive (n = 14) than in Erα-negative (n = 14) human primary breast cancer tissues (Figure 4E) and positively correlated with tumor size (n = 16) (Figure 4F), as determined by Welch's two-sample t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Figure 4G shows chemotherapy response in neoadjuvant patients with induction of lincRNA-p21 and DDB2 levels (CR: complete response (100% reduction), PR: partial response (>=50%, <100% reduction), SD: stable disease (<50% reduction), PD: partial disease (0% reduction)). Figures 4H and 4I show that chemotherapy-induced dynamic protein expression (Figure 4H) and chromatin-binding activity (Figure 4I) of DDB2 are higher in Erα-positive than in Erα-negative breast cancer cell lines. Figure 4J shows that knockdown of DDB2 by two independent shRNAs enhances the expression of carboplatin-induced apoptosis markers in BT-474 cancer cells in a dose- (left) and time- (right) dependent manner by Western blot analysis.Figure 4K shows that knockdown of DDB2 enhances carboplatin-induced apoptotic death of T-47D cancer cells in a FACS assay. Data are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test.

[0038] [Figure 5A] Figures 5A–5E show that DDB2 contributes to DNA repair functions related to chemoresistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows a Kaplan-Meier survival analysis demonstrating that higher DDB2 expression is associated with inferior overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared with ERα-negative / mutp53 breast cancer patients. Figure 5C shows a boxplot of DDB2 expression in each cancer type analyzed from the pan-cancer database, GEPIA. Figure 5D shows the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) examined in a time-dependent manner in an immunofluorescence assay using an anti-cisplatin-modified DNA antibody. Images from the immunofluorescence assay were quantified using ImageJ analysis. FIG. 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive, but not in ERα-negative, breast cancer cells. [Figure 5B]Figures 5A–5E show that DDB2 contributes to DNA repair functions related to chemoresistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows a Kaplan-Meier survival analysis demonstrating that higher DDB2 expression is associated with inferior overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared with ERα-negative / mutp53 breast cancer patients. Figure 5C shows a boxplot of DDB2 expression in each cancer type analyzed from the pan-cancer database, GEPIA. Figure 5D shows the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) examined in a time-dependent manner in an immunofluorescence assay using an anti-cisplatin-modified DNA antibody. Images from the immunofluorescence assay were quantified using ImageJ analysis. FIG. 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive, but not in ERα-negative, breast cancer cells. [Figure 5C]Figures 5A–5E show that DDB2 contributes to DNA repair functions related to chemoresistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows a Kaplan-Meier survival analysis demonstrating that higher DDB2 expression is associated with inferior overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared with ERα-negative / mutp53 breast cancer patients. Figure 5C shows a boxplot of DDB2 expression in each cancer type analyzed from the pan-cancer database, GEPIA. Figure 5D shows the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) examined in a time-dependent manner in an immunofluorescence assay using an anti-cisplatin-modified DNA antibody. Images from the immunofluorescence assay were quantified using ImageJ analysis. FIG. 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive, but not in ERα-negative, breast cancer cells. [Figure 5D]Figures 5A–5E show that DDB2 contributes to DNA repair functions related to chemoresistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows a Kaplan-Meier survival analysis demonstrating that higher DDB2 expression is associated with inferior overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared with ERα-negative / mutp53 breast cancer patients. Figure 5C shows a boxplot of DDB2 expression in each cancer type analyzed from the pan-cancer database, GEPIA. Figure 5D shows the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) examined in a time-dependent manner in an immunofluorescence assay using an anti-cisplatin-modified DNA antibody. Images from the immunofluorescence assay were quantified using ImageJ analysis. FIG. 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive, but not in ERα-negative, breast cancer cells. [Figure 5E]Figures 5A–5E show that DDB2 contributes to DNA repair functions related to chemoresistance. Figure 5A shows the ranking of ERα-related gene expression in human breast tumors in a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Figure 5B shows a Kaplan-Meier survival analysis demonstrating that higher DDB2 expression is associated with inferior overall survival (OS, n=76) in ERα-positive / mutp53 breast cancer patients receiving neoadjuvant chemotherapy compared with ERα-negative / mutp53 breast cancer patients. Figure 5C shows a boxplot of DDB2 expression in each cancer type analyzed from the pan-cancer database, GEPIA. Figure 5D shows the efficiency of DNA repair in T-47D and MDA-MB-231 cancer cells in response to cisplatin (50 μM) examined in a time-dependent manner in an immunofluorescence assay using an anti-cisplatin-modified DNA antibody. Images from the immunofluorescence assay were quantified using ImageJ analysis. FIG. 5E shows that DDB2 expression is induced by chemotherapy in ERα-positive, but not in ERα-negative, breast cancer cells.

[0039] [Figure 6A] Figures 6A and 6B show that lincRNA-p21 can target DDB2 and interfere with its nuclear colocalization for chemosensitization. Figures 6A and 6B show that carboplatin (50 μM)-induced nuclear translocation of protein accumulation (Figure 6A) and doxorubicin (0.5 μM)-induced increased DDB2 levels in triton-resistant (chromatin-bound) lysates (Figure 6B) were observed in ERα-positive breast cancer cell lines, but not in ERα-negative breast cancer cell lines. [Figure 6B]Figures 6A and 6B show that lincRNA-p21 can target DDB2 and interfere with its nuclear colocalization for chemosensitization. Figures 6A and 6B show that carboplatin (50 μM)-induced nuclear translocation of protein accumulation (Figure 6A) and doxorubicin (0.5 μM)-induced increased DDB2 levels in triton-resistant (chromatin-bound) lysates (Figure 6B) were observed in ERα-positive breast cancer cell lines, but not in ERα-negative breast cancer cell lines.

[0040] [Figure 7A]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7B]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7C]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7D]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7E]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7F]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7G]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7H]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7I]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7J]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. [Figure 7K]Figures 7A-7K show that lincRNA-p21 downregulates DDB2 expression by promoting the formation of the Cul-4 / DDB1 / DDB2 E3 ligase complex. Figure 7A shows that carboplatin (50 μM) and doxorubicin (0.5 μM) induce lincRNA-p21 expression in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (top and right), but not in ERα-positive T-47D cancer cells (top and left). In contrast, DDB2 mRNA levels are induced by these chemotherapeutic agents in ERα-positive breast cancer cell lines (bottom and left). Figure 7B shows that nuclear translocation of lincRNA-p21 is induced by carboplatin in a time-dependent manner in ERα-negative MDA-MB-231 cancer cells (right), but not in ERα-positive T-47D cancer cells (left). Figure 7C shows that ectopic expression (left) and silencing (right) of lincRNA-p21 do not affect DDB2 mRNA levels in T-47D and MDA-MB-231 cancer cells by qRT-PCR analysis. Figure 7D shows that DDB2 mRNA levels are not altered by lincRNA-p21 induction in T-47D#Tet-On-LincRNA-p21 cancer cells. Figure 7E shows that treatment with the proteasome inhibitor MG132 (10 μM) increases DDB2 expression in a time-dependent manner. Figure 7F shows the raw data from Figure 8D in a Western blot assay. Figure 7G shows doxorubicin (0.5 μM)-induced in vivo association of lincRNA-p21 with DDB2 (left), DDB1, and Cul-4 (right) in MDA-MB-231 cancer cells by RNA-IP assay. Figure 7H shows that in vitro treatment with RNase A reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 7I shows that knockdown of lincRNA-p21 reduces DDB2 protein levels in anti-Cul-4 and anti-DDB1 immune complexes in response to carboplatin (50 μM) in the presence of MG132.Figure 7J shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different segments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 7K shows carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB1 and Cul-4 at specific regions in T-47D cancer cells by RNA-IP analysis, followed by RNase A digestion. Data in Figures 7A, 7C, 7D, 7G, and 7K are representative of three experiments and are presented as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test.

[0041] [Figure 8A]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8B]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8C]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8D]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8E]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8F]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8G]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8H]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8I]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8J]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8K]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8L]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8M]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements. [Figure 8N]Figures 8A-8N show that lincRNA-p21 enhances DDB2 protein ubiquitination and degradation by acting as a scaffold for the Cul-4 / DDB1 / DDB2 complex. Figure 8A shows that ectopic expression of lincRNA-p21 reduces DDB2 protein levels. Figure 8B shows that knockdown of lincRNA-p21 increases DDB2 protein levels. Figure 8C shows that DDB2 protein expression is suppressed by lincRNA-p21 induction in stable cancer cell clones of the T-47D# Tet-On system. Figure 8D shows that ectopic expression of lincRNA-p21 reduces DDB2 protein stability in the presence of CHX (25 μM). DDB2 protein levels examined in Western blot analysis were quantified using ImageJ and normalized to α-tubulin. Figure 8E shows that pretreatment with MG132 (10 μM) prevents lincRNA-p21-induced DDB2 downregulation. Figure 8F shows that ectopic expression of lincRNA-p21 increases DDB2 polyubiquitination in MG132-treated T-47D cancer cells. Figures 8G and 8H show that RNA-IP assays demonstrate carboplatin (50 μM)-induced in vivo association of lincRNA-p21 with DDB2 (Figure 8G), DDB1, and Cul-4 (Figure 8H) in ERα-negative MDA-MB-231 cancer cells, but not in ERα-positive T-47D cancer cells. Figure 8I shows that knockdown of lincRNA-p21 reduces carboplatin-induced complex formation of DDB2 with DDB1 and Cul-4 in co-IP assays. Figure 8J shows that DDB2, DDB1, and Cul-4 from carboplatin-treated T-47D cancer cell lysates are pulled down in vitro by biotinylated lincRNA-p21 but not by HOTAIR or α-tubulin mRNA. The dot plot reveals equal amounts of biotinylated RNA input. hnRNP-K is used as a positive control for lincRNA-p21-interacting proteins.Figure 8K shows exemplary primer sets for deletion fragments of biotinylated lincRNA-p21 for RNA pull-down assays and different regions for RNA-IP. Figure 8L shows that DDB2 from carboplatin-treated T-47D cancer cell lysates is pulled down in vitro by different deletion fragments of biotinylated lincRNA-p21. Dot plots reveal equal amounts of biotinylated RNA input. Figure 8M shows RNase A digestion patterns after carboplatin (50 μM)-induced in vivo association of lincRNA-p21 and DDB2 at specific regions in T-47D cancer cells by RNA-IP analysis. Data in Figures 8G, 8H, and 8M are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 8N shows an illustration of the predicted secondary structure of lincRNA-p21 (VienaRNA web server) and putative DDB2 binding elements.

[0042] [Figure 9A]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9B]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9C]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9D]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9E]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9F]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9G]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9H]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132. [Figure 9I]Figures 9A-9I show that three short lincRNA-p21 elements, #3, #4, and #9, bind to DDB2 protein in vitro. Figures 9A-9D show that single (Figures 9A and 9B) or multiple (Figures 9C and 9D) deletion mutants of biotinylated lincRNA-p21 were subjected to pull-down assays using DDB2 protein derived from carboplatin-treated T-47D cancer cell lysates in vitro. Dot plots reveal equal amounts of biotinylated RNA input. Figure 9E shows the dose-dependent binding activity of short lincRNA-p21 elements, #3, #4, and #9, to recombinant DDB2 protein in a surface plasmon resonance (SPR) assay. Figure 9F shows the Ct values of gradient concentrations of pure short lincRNA-p21 elements used as a standard curve. Figure 9G shows that the transfection efficiency of short lincRNA-p21 elements #3, #4, and #9 into T-47D cancer cells is comparable at different concentrations. Figure 9H shows that combined cotreatment with all three short lincRNA-p21 elements dramatically enhanced cytotoxicity in the presence or absence of carboplatin, cisplatin, and doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 9I shows that the inhibitory effect was reversed by treatment with MG132.

[0043] [Figure 10A]Figures 10A-10C show the effects of short lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with the three short lincRNA-p21 elements alone increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin or doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 10B shows that combined co-treatment with all three short lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I. [Figure 10B] Figures 10A-10C show the effects of short lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with the three short lincRNA-p21 elements alone increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin or doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 10B shows that combined co-treatment with all three short lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I. [Figure 10C]Figures 10A-10C show the effects of short lincRNA-p21 elements #3, #4, and #9 on chemotherapy-induced cytotoxicity in breast cancer cells. Figure 10A shows that treatment with the three short lincRNA-p21 elements alone increases cytotoxicity only in the presence of carboplatin, but has no effect on cisplatin or doxorubicin. Data are representative of three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control, Student's t-test. Figure 10B shows that combined co-treatment with all three short lincRNA-p21 elements can suppress DDB2 protein expression. Figure 10C shows the raw data from Figure 9I.

[0044] [Figure 11A] Figures 11A-11E show 3D structural modeling of the short lincRNA-p21 element in complex with the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows three 3D structures of the short lincRNA-p21 element calculated and predicted by six databases from RNA Composer: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows 2,000 poses calculated and six angles per pose generated by using the ZDOCK docking program in BIOVIA Discovery Studio. Marked dots indicate potential poses between the two macromolecules, and arrow dots indicate selected short lincRNA-p21 elements with the highest potential interactions with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2 α-helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11B]Figures 11A-11E show 3D structural modeling of the short lincRNA-p21 element in complex with the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows three 3D structures of the short lincRNA-p21 element calculated and predicted by six databases from RNA Composer: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows 2,000 poses calculated and six angles per pose generated by using the ZDOCK docking program in BIOVIA Discovery Studio. Marked dots indicate potential poses between the two macromolecules, and arrow dots indicate selected short lincRNA-p21 elements with the highest potential interactions with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2 α-helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11C]Figures 11A-11E show 3D structural modeling of the short lincRNA-p21 element in complex with the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows three 3D structures of the short lincRNA-p21 element calculated and predicted by six databases from RNA Composer: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows 2,000 poses calculated and six angles per pose generated by using the ZDOCK docking program in BIOVIA Discovery Studio. Marked dots indicate potential poses between the two macromolecules, and arrow dots indicate selected short lincRNA-p21 elements with the highest potential interactions with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2 α-helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11D]Figures 11A-11E show 3D structural modeling of the short lincRNA-p21 element in complex with the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows three 3D structures of the short lincRNA-p21 element calculated and predicted by six databases from RNA Composer: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows 2,000 poses calculated and six angles per pose generated by using the ZDOCK docking program in BIOVIA Discovery Studio. Marked dots indicate potential poses between the two macromolecules, and arrow dots indicate selected short lincRNA-p21 elements with the highest potential interactions with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2 α-helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure. [Figure 11E]Figures 11A-11E show 3D structural modeling of the short lincRNA-p21 element in complex with the N-terminal α-helix of DDB2 by computational molecular docking. Figure 11A shows three 3D structures of the short lincRNA-p21 element calculated and predicted by six databases from RNA Composer: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Figure 11B shows 2,000 poses calculated and six angles per pose generated by using the ZDOCK docking program in BIOVIA Discovery Studio. Marked dots indicate potential poses between the two macromolecules, and arrow dots indicate selected short lincRNA-p21 elements with the highest potential interactions with DDB2. Figure 11C shows a cluster of potential poses around the N-terminal α-helix of DDB2. Figure 11D shows three 3D structural models of the short lincRNA-p21 element coil around the DDB2 α-helix involved in the interaction with DDB1. Figure 11E shows the interaction site between the short lincRNA-p21 element and DDB2 in the 3D structure.

[0045] [Figure 12A]Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12B] Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12C]Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12D] Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12E]Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12F] Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12G]Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8). [Figure 12H] Figures 12A-12H show the location of the short lincRNA-p21 element in a complex containing DDB2 by computational molecular docking. Figures 12A-12E show docking results from other databases, with selected poses shown as marked dots, indicating potential poses between the two macromolecules. Figures 12F-12H show the most likely conformational predictions between the short lincRNA-p21 element and DDB2 in other databases. In Figure 12F, aquamarine indicates five databases (pose 22), and pink indicates contextFold (pose 27). In Figure 12G, aquamarine indicates four databases (pose 19), pink indicates contextFold (pose 2), and yellow indicates RNAstructure (pose 1). In Figure 12H, aquamarine indicates four databases (pose 8), pink indicates contextFold (pose 40), and yellow indicates RNAstructure (pose 8).

[0046] [Figure 13A]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13B]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13C]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13D]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13E]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13F]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13G]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test. [Figure 13H]Figures 13A-13H show that exosome-packaged short lincRNA-p21 elements #3, #4, and #9 (exoLinc-p21s) enhance chemotherapy-induced cytotoxicity in breast cancer cells. Figure 13A shows exosome particles imaged by TEM. Figures 13B-13F show that all three short lincRNA-p21 elements (#3, #4, and #9) were packaged in exosomes (exoLinc-p21s) for exosome-based therapy and exhibited DNA repair inhibitory functions (Figure 13B), DDB2 protein inhibitory functions (Figure 13C), proliferation inhibitory functions (Figure 13D), enhanced cytotoxicity (Figure 13E), and tumor size inhibition in a xenograft mouse model (Figure 13F). Figures 13G and 13H show the cytotoxic effect (Figure 13G) and DDB2 protein inhibitory function (Figure 13H) of exoLinc-p21s with and without anti-HLAG coating. Data in Figures 13D, 13E, and 13G are representative of at least three experiments and are shown as mean ± SD. *p<0.05; **p<0.01; ***p<0.001 vs. control group, Student's t-test.

[0047] [Figure 14A] Figures 14A and 14B show the delivery efficiency of exosomes with and without anti-HLAG. Figure 14A shows the colony area and average colony size in the growth inhibitory function of exoLinc-p21s. Figure 14B shows the delivery efficiency of exosomes with and without anti-HLAG in a time-dependent manner by immunofluorescence assay. [Figure 14B] Figures 14A and 14B show the delivery efficiency of exosomes with and without anti-HLAG. Figure 14A shows the colony area and average colony size in the growth inhibitory function of exoLinc-p21s. Figure 14B shows the delivery efficiency of exosomes with and without anti-HLAG in a time-dependent manner by immunofluorescence assay.

[0048] [Example]

[0049] The present invention may be embodied in many different forms and should not be construed as limited to the examples set forth herein. The described embodiments are not intended to limit the scope of the present invention as defined in the claims.

[0050] material and method

[0051] clinical specimen

[0052] A total of 61 residual breast cancer tissue specimens were collected from patients undergoing surgery for different breast cancer subtypes at Chung Shan Medical University Hospital, Taichung, Taiwan, after obtaining informed consent. The sample collection included unselected subtypes and was used in accordance with a protocol (CS2-18150) approved by the Institutional Review Board of Chung Shan Medical University, Taichung, Taiwan. Tissues were homogenized and cultured with or without carboplatin for 5 days. After treatment, total RNA and protein lysates were prepared using TRIzol™ Reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0053] Tissue microarrays and in situ hybridization

[0054] Breast cancer tissue microarrays were purchased from SuperBioChips Laboratories (Seoul, Korea) and used to detect lincRNA-p21 for in situ hybridization experiments. The tissue microarray specimens included different breast cancer subtypes from 40 patients. RNAscope lincRNA-p21 (TP53COR1) probes for use in in situ hybridization assays were designed and purchased from Advanced Cell Diagnostics, Inc. (Newark, CA, USA). We screened for lincRNA-p21 signaling in breast cancer tissues using the RNAscope 2.5HD Detection Kit-BROWN according to the manufacturer's protocol. Signals related to lincRNA-p21 expression were quantified using Fiji ImageJ and normalized to the nucleus to calculate the area and percentage of the probe count.

[0055] cell culture

[0056] Breast cancer cell lines, MCF7 (RRID: CVCL_0031), T-47D (RRID: CVCL_0553), BT-474 (RRID: CVCL_0179), SK-BR-3 (RRID: CVCL_0033), MDA-MB-468 (RRID: CVCL_0419), and MDA-MB-231 (RRID: CVCL_0062), and hepatoma cell line, HepG2 (RRID: CVCL_0027) were cultured in Dulbecco's modified Eagle's medium:nutrient mixture F-12 (DMEM / F12, HyClone™, Thermo Fisher Scientific Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) and HyClone™ penicillin-streptomycin solution. All cell lines were purchased from the American Type Culture Collection (ATCC), incubated at 37°C in a humidified incubator containing 5% CO2, and tested for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (LT07-318, Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0057] Inhibitors and reagents

[0058] Carboplatin (41575-94-4), (Z)-4-hydroxytamoxifen (68047-06-3), cycloheximide (CHX, 66-81-9), (S)-MG132 (133407-82-6), and tetracycline (hydrochloride, 64-75-5) were purchased from Cayman Chemical (Michigan, USA). Cisplatin (cis-diammineplatinum(II), P4394) and doxorubicin hydrochloride (Sigma-Aldrich, D1515) were purchased from Merck KGaA (Darmstadt, Germany). Clarity™ Western enhanced chemiluminescence (ECL) substrate was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA, USA).

[0059] antibody

[0060] Antibodies against DDB2 (#5416, RRID: AB_10694497), Ac-p53 (K382, #2525S, RRID: AB_330083), p-ERα (Ser118, #2511), HA-Tag (#3724, RRID: AB_1549585), PARP (#9542, RRID: AB_2160739), and histone H3 (#9715, RRID: AB_331563) were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). Antibodies against DDB1 (sc-25367, RRID: AB_639050), Cul-4 (sc-377188), hnRNP-K (sc-28380), p53 (sc-126, RRID: AB_628082), and ERα (sc-8002, RRID: AB_627558) were purchased from Santa Cruz Biotechnology, Inc. (CA, USA). Antibodies against ubiquitin (P4D1-A11), p21WAF1 (Calbiochem, OP64, RRID: AB_2335868), α-tubulin (T5168, RRID: AB_477579), and β-actin (A2228, RRID: AB_476697) were purchased from Merck KGaA (Darmstadt, Germany). Antibody against caspase 3 (Imgenex IMG-144A, RRID: AB_316677) was purchased from Novus Biologicals, LLC. (Centennial, CO, USA). Antibody against p-histone H2AX (Ser139, AF2288, RRID: AB_2114989) was purchased from R&D Systems Inc. (Minneapolis, MN, USA).

[0061] Western blot assay

[0062] Total protein lysate concentration was determined using the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and 30 μg of protein lysate was heated to 95°C for 5 minutes in sample buffer. Denatured proteins were separated by SDS-PAGE in running buffer and transferred to PVDF membranes (0.45 μM, Millipore, Merck KGaA, Darmstadt, Germany) or NC membranes (0.22 μM, Amersh™, GE Healthcare Life Science, Pittsburgh, PA, USA) in transfer buffer. The transferred membranes were blocked with 5% milk or BSA in TBST buffer and stained with the indicated primary antibodies overnight at 4°C, followed by incubation with HRP-conjugated secondary antibodies. ECL signaling was detected using a ChemiDoc™ Touch Imaging System (Bio-Rad).

[0063] RNA extraction and RT-PCR

[0064] After the indicated treatments, cells were washed three times with ice-cold PBS and lysed with TRIzol™ Reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). Total RNA was isolated by adding 0.2 mL of chloroform per mL of TRIzol™ Reagent and centrifuging at 12,000 g for 15 minutes to separate the aqueous, interphase, and organic phases. RNA was then precipitated from the aqueous phase by mixing with 0.25–0.5 mL of isopropanol and centrifuging at 12,000 g for 15 minutes. After removing the supernatant, the gel-like pellet was washed twice with 1 mL of 75% ethanol, air-dried, and then dissolved in DEPC-treated water. Reverse transcription polymerase chain reaction (RT-PCR) was performed using 1 μg of total RNA, Invitrogen™ M-MLV reverse transcriptase (Thermo Fisher Scientific Inc., Waltham, MA, USA), random hexamers, dNTPs, 5× M-MLV buffer, and DTT.

[0065] Quantitative real-time PCR

[0066] For qRT-PCR, the expression of target genes was detected with specific primers using the KAPA SYBR FAST qPCR Master Mix (2X) kit (Kapa Biosystems, Wilmington, MA, USA). Threshold cycle or Ct values were analyzed using a LightCycler 480 Real-Time PCR System (Roche Molecular Systems, Inc., Pleasanton, CA, USA) or an Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA). ddCt was calculated by normalizing to a housekeeping gene as a reference.

[0067] RNA Immunoprecipitation (RNA-IP) Assay Protocol

[0068] Cells were fixed with 1% formaldehyde, neutralized with 1 M glycine, washed twice with ice-cold PBS, and then scraped and vortexed in lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM DTT, cOmplete™ protease inhibitor cocktail (one tablet contains sufficient protease inhibitors for 10 mL cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA), and 200 U / mL RNaseOUT™ (Thermo Fisher Scientific Inc., Waltham, MA, USA). After three freeze-thaw cycles on ice, the lysates were centrifuged at 14,000 rpm for 30 minutes, and the supernatants were collected for immunoprecipitation. Agarose protein A / G was preblocked for 1 hour, then mixed and incubated overnight with antibodies in NT2 buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM MgCl2, and 0.5% NP-40). They were then washed three times with NT2 buffer, and the lysates were incubated with NT2 buffer (1 mM DTT, 200 U / mL RNaseOUT™, and 20 mM EDTA) and rotated overnight. The immune complexes were washed three times and then reverse-crosslinked with 100 μL of NT2 buffer at 70°C for 5 hours. Finally, the samples were incubated with 0.25 mg / mL Sigma-Aldrich Protease K (Merck KGaA, Darmstadt, Germany) at 55°C for 30 minutes and lysed with TRIzol™ Reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) for RNA extraction and qRT-PCR.

[0069] Preparation of biotinylated RNA in vitro transcription

[0070] To investigate the in vitro interaction of RNA with target proteins, including DDB1, DDB2, Cul-4, and hnRNP-K, biotinylated RNA was prepared with Invitrogen™ T7 RNA polymerase (Thermo Fisher Scientific Inc., Waltham, MA, USA), and biotin RNA labeling mix (Roche Molecular Systems, Inc., Pleasanton, CA, USA) was used for biotin pull-down assays. Biotinylated lincRNA-p21, HOTAIR, and tubulin RNA were generated by using their synthesized DNA templates in PCR with T7-containing primer sets.

[0071] Biotin pull-down assay protocol

[0072] For in vitro pull-down assays, 3 μg of biotin-labeled RNA was heated to 90 °C for 2 min and reconstituted in reconstitution buffer (10 mM Tris-HCl pH 7.0, 0.1 M KCl, and 10 mM MgCl) at room temperature for 20 min. 7 ) were treated with or without chemotherapy and then resuspended in nuclear isolation buffer (1.28 M sucrose, 40 mM Tris-HCl pH 7.5, 20 mM MgCl2, and 4% Triton X-100). Nuclear pellets were hybridized to folded DNA or RNA in RIP buffer (150 mM KCl, 25 mM Tris-HCl pH 7.4, 0.5 mM DTT, 0.5% NP-40, 1 mM PMSF, and cOmplete™ protease inhibitor cocktail (one tablet contains enough protease inhibitors for 10 mL cell extract) (Roche Molecular Systems, Inc., Pleasanton, CA, USA)) for 1 hour. RNA-protein complexes were then pulled down using Novagen streptavidin agarose beads (Novagen Corporation, San Diego, CA, USA) and analyzed by Western blot.

[0073] Nuclear and cytoplasmic RNA fractionation

[0074] Cells were washed twice with TD buffer (137 mM NaCl, 5 mM KCl, 0.7 mM NaHPO, and 25 mM Tris-HCl, pH 7.4) and then detached with TD buffer. Then, the cells were centrifuged at maximum speed for 30 seconds at room temperature. The pellet was washed with 200 μL of TD buffer and resuspended in 100 μL of vanadyl ribonucleoside complex buffer (20 mM VRC in TD buffer, pH 8.6; S1402S, New England BioLabs Inc., Ipswich, MA, USA; 10 mM Tris-HCl, 0.14 M NaCl, 1.5 mM MgCl, 1 mM DTT, and 0.5% NP-40). The cells were vortexed for 10 seconds and then incubated on ice for 5 minutes. The cells were then vortexed again and centrifuged at maximum speed for 30 seconds, after which the supernatant was transferred to a new Eppendorf tube and lysed with TRIzol™ reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) to isolate cytoplasmic RNA. To isolate nuclear RNA, the pellet was washed with 200 μL of 0.5% NP-40 / TD buffer, resuspended in 100 μL of 0.5% NP-40 / TD buffer, and then lysed with Invitrogen TRIzol™ reagent.

[0075] Triton extraction assay

[0076] After treatment with carboplatin, cells were lysed in Triton extraction buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 10 mM PIPES pH 6.8, 1 mM EGTA pH 6.8, 0.2% Triton X-100, freshly added 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin) for 30 min at 4 °C. The supernatant was collected as the Triton-extractable fraction (chromatin-free proteins), while the pellet was collected as the Triton-resistant fraction (chromatin-bound proteins), which was washed twice with Triton extraction buffer and then further lysed in NETN buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, freshly added 1 mM NaVO4, 1 mM PMSF, 10 mM NaF, and 1 ng / mL aprotinin). Both fractions were used to examine the free and DNA-bound forms of DDB2, respectively.

[0077] Cell Viability Assay Protocol

[0078] MTT assay was used to detect cell viability. Cells (5x10) grown in 96-well plates were 3 ) were treated with different concentrations of the indicated chemotherapy treatments for 48 or 72 hours. The medium was then replaced with serum-free medium containing 5x Sigma-Aldrich MTT solution (Merck KGaA, Darmstadt, Germany) and incubated for 2.5 hours. Cells were then lysed with DMSO, and the optical density (OD) at 570 nm was detected by an ELISA reader.

[0079] Quantification of cisplatin adducts in nuclear DNA by immunocytochemical assay

[0080] The effects of lincRNA-p21 and DDB2 on DNA repair were examined by immunofluorescence staining with anti-cisplatin-modified DNA antibody to detect cisplatin adducts. After inducing DNA damage by treatment with cisplatin (50 μM) for the indicated times, cells were fixed with 4% paraformaldehyde, washed with PBS, and covered with 1% Triton X-100 for 5–7 minutes at room temperature. Cells were then blocked with 1% BSA in PBS for 1 hour at room temperature and stained with anti-cisplatin-modified DNA antibody (Abcam, plc., Cambridge, England) for 1 hour at room temperature in the dark. This was followed by staining with a secondary antibody, goat anti-rat IgG H&L (Abcam, plc., Cambridge, England), for an additional hour at room temperature in the dark. Finally, cells were mounted with DAPI mounting medium (Thermo Fisher Scientific Inc., Waltham, MA, USA), and staining was observed under a fluorescence microscope (Leica DMIL LED, Leica Microsystems, Wetzlar, Germany). Cisplatin adduct signaling was quantified using ImageJ software and normalized to the nuclear DAPI signal.

[0081] Macromolecular Docking

[0082] The schematic diagram of DDB2 (4E54) was found in the Protein Data Bank (PDB). The 3D structures of short lincRNA-p21#3, #4, and #9 were predicted and generated by the RNAcomposer database and further used for ZDOCK docking between DDB2 through BIOVIA Discovery Studio software (RRID: SCR_015651). The docking results were presented in 3D structure by BIOVIA Discovery Studio and PyMoL software (RRID: SCR_000305).

[0083] Xenograft mouse model

[0084] Using a breast tumor xenograft mouse model, we demonstrated the growth effect of lincRNA-p21 and the synergistic effect between exoLinc-p21s and exoDox through the Tet-On system. T-47D breast cancer cells were injected into the mammary fat pads of 5-week-old female BALB / c nude mice, which had been subcutaneously implanted with a 60-day release pellet containing 0.7 mg 17β-estradiol (Innovative Research of America) three days prior to subcutaneous inoculation. After tumor growth in the mice for one month, the inhibitory effects of combined treatment with exo-scramble, exoLinc-p21s, and exoDox on tumor growth were determined. During the treatment period, mouse activity was monitored, and survival curves were calculated among the four treatment groups. Tumor diameters were serially measured with a vernier caliper using the formula: volume = length x width. 2 Tumor volume was calculated using ρ / 2.

[0085] statistical analysis

[0086] Differences between two categorical variables were analyzed using Student's t-test or Welch's two-sample t-test, while differences between more than two categorical variables were analyzed by one-way ANOVA. Results are presented as mean ± SD, n ≥ 3. p-values were calculated by two-tailed test, and statistically significant differences were defined as p < 0.05. All statistical analyses were performed using SigmaPlot 10.0, GraphPad Prism 8, or SPSS 21 software.

[0087] result

[0088] LincRNA-p21 suppresses ERα / DDB2-associated DNA repair and chemoresistance.

[0089] The role of lincRNA-p21 in regulating DDB2-mediated DNA repair and chemoresistance remains unclear. Basal levels of lincRNA-p21 were relatively higher in early-stage (Figures 1A and 1B), smaller-sized (Figure 1B), and ERα-negative (Figure 1C) breast tumors. Induction of lincRNA-p21 by a tetracycline-inducible expression system in ERα-positive T47D breast cancer cells suppressed tumor growth in a xenograft mouse model (Figure 2A), revealing its tumor-suppressive role in breast cancer. In response to ex vivo treatment with carboplatin, induction of lincRNA-p21 in primary human breast tumor tissues decreased concomitantly with disease stage progression (Figure 2B), tumor size (Figure 2C), and ERα-positive status (Figure 2D). These clinical observations suggest a clinical role for lincRNA-p21 in determining chemosensitivity in breast cancer patients. Indeed, chemotherapy-induced lincRNA-p21 levels in various cell lines negatively correlated with their IC50 values against the corresponding chemotherapeutic agents (Figure 2E). Transient overexpression of lincRNA-p21 increased carboplatin-induced apoptotic death in ERα-positive T-47D cancer cells (Figure 2F). In contrast, silencing lincRNA-p21 expression in ERα-negative MDA-MB-231 cancer cells resulted in reduced cell apoptosis (Figure 2G) and PARP and caspase-3 cleavage (Figure 2H) in response to carboplatin. Furthermore, silencing lincRNA-p21 also attenuated the sensitizing effects of tamoxifen (Figures 2I and 3A) and ERα shRNA (Figures 2J and 3B) against carboplatin-induced apoptotic death. Thus, overexpression of lincRNA-p21 can overcome ERα-associated chemoresistance.

[0090] To further verify the inhibitory effect of lincRNA-p21 on DNA repair for chemosensitization, we examined cisplatin-DNA adducts in an immunocytochemical assay using an anti-cisplatin-modified DNA antibody. The results revealed that the induction of cisplatin-DNA adducts was suppressed by silencing lincRNA-p21 with shRNA in cisplatin-treated MDA-MB-231 cancer cells (Figure 4A), indicating that lincRNA-p21 can increase chemosensitivity by suppressing DNA repair function. To determine the mechanism by which lincRNA-p21 reduces ERα-mediated DNA repair, we analyzed the differential gene expression profiles between human ERα-positive and -negative breast cancers using the GSE18908 dataset. Among ERα-related pathways analyzed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (Figure 5A), two highly important pathways in the regulation of DNA repair and chemosensitivity, nucleotide excision repair (NER) and p53 signaling, were upregulated in response to ERα expression. STRING network analysis further revealed that the expression of DDB2, a well-known p53-targeted downstream component of NER, was increased in ERα-positive breast cancers (Figure 4B), potentially implicating the chemosensitivity and DNA repair functions regulated by the ERα / lincRNA-p21 axis. Furthermore, DDB2 levels were statistically higher in ERα-positive breast cancer tissues (Figure 4C). More importantly, Kaplan-Meier plot analysis revealed a correlation between higher DDB2 expression and poorer overall survival in all breast cancer patients receiving neoadjuvant chemotherapy (Figure 4D), even with p53 mutation status (Figure 5B). Furthermore, DDB2 is more highly expressed in several different cancer types, such as lung cancer (LUSC), liver cancer (LIHC), cholangiocarcinoma (CHOL), colon cancer (COAD), head and neck squamous cell carcinoma (HNSC), gastric adenocarcinoma (STAD), and esophageal cancer (ESCA) (Figure 5C).Ex vivo induction of DDB2 protein expression by carboplatin was also dramatically higher in ERα-positive tumor tissues than in ERα-negative tumor tissues (Figure 4E) and correlated with tumor size (Figure 4F). Furthermore, breast tumors from patients with higher induction of lincRNA-p21 but lower induction of DDB2 upon ex vivo treatment with carboplatin correlated with better clinical responses to adjuvant chemotherapy (Figure 4G), suggesting that lincRNA-p21 may negatively regulate DDB2 expression and suppress NER for chemosensitization in breast cancer patients.

[0091] We next investigated the involvement of DDB2-dependent NER in ERα-associated chemoresistance. Cisplatin-DNA adducts were induced within 2 h of treatment with cisplatin in both ER-negative / chemosensitive MDA-MB-231 and ER-positive / chemoresistant T-47D cancer cells. These DNA lesions persisted for more than 18 h in MDA-MB-231 cancer cells, but rapidly disappeared in T-47D cancer cells (Figure 5D). Both carboplatin (Figures 4H and 5E) and doxorubicin (Figure 5E) increased DDB2 expression in ERα-positive (T-47D and BT-474) breast cancer cell lines, but not in ERα-negative (MDA-MB-231 and SK-BR-3) breast cancer cell lines. As an essential initiator, DDB2 recognizes damaged DNA sites in the nucleus, binds to these sites, and further recruits other regulatory factors involved in NER, followed by proteosomal degradation for the formation of DNA repair complexes. Accordingly, chemotherapy-induced nuclear translocation (Figure 6A) and chromatin-binding activity (Figures 4I and 6B) of DDB2 were also observed in ERα-positive cancer cell lines, but not in ERα-negative cancer cell lines. Furthermore, silencing DDB2 expression increased PARP or caspase-3 cleavage in a dose- and time-dependent manner (Figure 4J) and sensitized ERα-positive cancer cells to carboplatin-induced apoptotic cell death (Figure 4K). Taken together, these results suggest that DDB2 is a critical NER initiator in mediating ERα-associated chemoresistance, which can be targeted by lincRNA-p21.

[0092] LincRNA-p21 acts as a scaffold for the Cul-4 E3 ligase complex for DDB2 proteasomal degradation.

[0093] Treatment with carboplatin or doxorubicin increased lincRNA-p21 expression in a time-dependent manner in chemosensitive MDA-MB-231 cancer cells, but not in chemoresistant T-47D cancer cells, and negatively correlated with chemotherapy-induced DDB2 mRNA expression (Figure 7A). Nuclear accumulation of lincRNA-p21 was also increased by carboplatin in MDA-MB-231 cancer cells, but not in T-47D cancer cells (Figure 7B), and inversely correlated with nuclear translocation of DDB2 (Figure 6A). Therefore, we next investigated whether lincRNA-p21 regulates DDB2 expression and the underlying molecular mechanism. Interestingly, DDB2 protein levels were dose-dependently suppressed by lincRNA-p21 overexpression in T-47D cancer cells (Figure 8A) without affecting its mRNA levels (Figure 7C), and were enhanced by silencing lincRNA-p21 in MDA-MB-231 cancer cells (Figure 8B). Similarly, lincRNA-p21 induced by the Tet-On control system also suppressed DDB2 protein, but not RNA levels (Figures 7D and 8C), suggesting posttranscriptional downregulation of DDB2 by lincRNA-p21. The proteasome inhibitor MG132 enhanced DDB2 expression in lincRNA-p21-increased MDA-MB-231 cancer cells (Figure 7E). DDB2 protein stability was reduced by lincRNA-p21 overexpression in the presence of cycloheximide (CHX) (Figures 7F and 8D) and restored by MG132 (Figure 8E), suggesting the involvement of lincRNA-p21 in regulating DDB2 proteasomal degradation. LincRNA-p21 overexpression enhanced DDB2 polyubiquitination in T-47D cancer cells (Figure 8F). Therefore, we addressed the role of lincRNA-p21 in regulating the complex formation of DDB2 with the E3 ligase Cul-4 and the adaptor protein DDB1. In RNA-IP assays, physical interaction between lincRNA-p21 and DDB2 in response to carboplatin (Figure 8G) and doxorubicin (Figure 7G) was observed in ERα-negative breast cancer cells but not in ERα-positive breast cancer cells.Carboplatin (Figure 8H) and doxorubicin (Figure 7G) also strongly increased the association of lincRNA-p21 with DDB1 in vivo but only moderately increased its association with Cul-4. The interaction of DDB2 with DDB1 and Cul-4 complexes was attenuated by RNase A treatment in vitro, but was disrupted in vivo by silencing of lincRNA-p21 in anti-DDB2 (Figure 8I), anti-DDB1, and anti-Cul-4 (Figure 7I) immune complexes. Next, the specific interaction of lincRNA-p21 with DDB2, DDB1, and Cul-4 in vitro was also demonstrated in RNA pull-down assays using biotinylated oligonucleotides (Figure 8J). Together, these data indicate that lincRNA-p21 directly binds to DDB2 / DDB1 / Cul-4 and acts as a scaffold for E3 complex formation.

[0094] To investigate the specific and essential regions of lincRNA-p21 for binding to DDB2, we next synthesized different segments of lincRNA-p21 (S1: exon 1, S2: intron, S3: exon 2) (Figure 7J) or deletion fragments (F1–F8) (Figure 8K) and analyzed their binding activity to DDB2. In in vitro RNA pull-down assays, S1 and F3–F8 showed stronger binding efficiencies to DDB2, suggesting that the region 526–926 is required for DDB2 binding activity. In RNA-IP analysis, the pulled-down RNA from anti-DDB2 immunoprecipitates was digested in vitro with or without RNase, followed by RT-qPCR using various primer sets to amplify different regions (P1–P10), as illustrated in Figure 8K. Regions P3, P4, P6, P7, and P9 of lincRNA-p21 were resistant to RNase A digestion, likely due to protection by binding to DDB2, further revealing potential DDB2-binding regions in vivo (Figure 8M). Interestingly, the binding regions of lincRNA-p21 for DDB1 and Cul-4 were similar to those for DDB2 (Figure 7K). DDB2 has been reported as a transcription factor with binding affinity to specific consensus elements in the promoters of target genes. It is noteworthy that this consensus sequence was found within regions P3, P4, and P9 of lincRNA-p21 and could fold into a secondary structure (P3, P4, and P9), suggesting these elements as potential binding sites for DDB2 (Figure 8N). These results suggest that two regions of lincRNA-p21 (527-926 and 2099-2287) containing elements #3, #4, and #9 are required for interaction with DDB2.

[0095] A potential short lincRNA-p21 element acts as a DDB2 inhibitor for chemosensitization

[0096] To verify the necessity of the putative elements (P3, P4, and P9) of lincRNA-p21 for interacting with DDB2 in vitro, we deleted these essential elements, indicated by asterisks in Figures 9A and 9C. The protein level of DDB2 pulled down by a biotinylated lincRNA-p21 full-length probe was slightly attenuated by individual deletion (Del1, Del2, or Del3) of P3, P4, or P9 (Figure 9B) and nearly abolished by combined mutations in all three elements (Del 1+2+3) (Figure 9D). Furthermore, synthetic RNA oligonucleotides corresponding to these DDB2-binding elements (#3, #4, and #9) of lincRNA-p21 exhibited a 10-fold increase in DDB2-binding activity in SPR analysis. -9 ~10 -8 K of M D The short lincRNA-p21 elements showed strong binding activity to recombinant DDB2 protein in a dose-dependent manner (Figure 9E). The synthesized short lincRNA-p21 elements showed comparable levels to the scrambled control in a dose-dependent manner in vitro (Figure 9F). Next, we transiently transfected the short lincRNA-p21 elements into T-47D cancer cells and detected the delivery efficiency by qRT-PCR analysis (Figure 9G). Compared to the scrambled control, the mixed three short lincRNA-p21 elements (#3 + #4 + #9) (Linc-p21s) enhanced the chemosensitivity of ER-positive / chemoresistant T-47D cancer cells to platinum drugs and doxorubicin in a dose-dependent manner (Figure 9H), whereas the single short lincRNA-p21 elements (#3, #4, and #9 alone) only showed a slight chemosensitizing effect (Figure 10A). Furthermore, the DDB2-targeting effect of Linc-p21s was evident by the downregulation of DDB2 protein expression 24 h after treatment (Fig. 10B), which was prevented by pretreatment with MG132 (Figs. 9I and 10C).

[0097] To further explore the potential conformations between these three short lincRNA-p21 elements and DDB2 in silico, we predicted the 3D structure of the short lincRNA-p21 elements (Linc-p21s) using RNAComposer, which includes six databases: CentroidFold, CONTRAfold, IPknot, RNAfold, RNAstructure, and ContextFold. Interestingly, the same structural conformations predicted by at least four databases (CentroidFold, CONTRAfold, IPknot, and RNAfold) were obtained (Figure 11A), which were then utilized for further molecular docking analysis with the DDB2 protein (PDB: 4E54). We calculated macromolecular docking using the ZDOCK docking program, and considered potential DDB2-binding poses of short lincRNAs from different prediction databases with lower Z-rank scores and higher Z-dock scores (Figures 11B and 12A-12E). These potential poses were then classified into different clusters (Figure 11C), representing similar binding regions but different interaction models. Furthermore, the poses with the best Z-rank and Z-dock scores, which indicated the interaction between the short lincRNA-p21 element and DDB2, were selected from the largest clusters (Figures 11D and 12F–12H). The interaction sites and distances between the short lincRNA-p21 element and DDB2 were also calculated (Figure 11E). In the 3D structure, the central nucleotides (C8, C9, C10, C11, U12, and U13) of the short lincRNA-p21 element interacted with the most likely amino acids (Lys-35, Pro-44, Cys-48, Cys-52, and Leu-53) or other amino acids of DDB2 via hydrogen bonds and Pi-alkyl interactions, respectively (Figure 11E). In the resulting complex structure, all three short lincRNA-p21 elements form a coil with the α-helix of the DDB2 N terminus, which is important for and participates in interacting with DDB1 to accommodate the E3 ligase Cul-4 ( Figure 11D ).It was plausible that short lincRNA-p21 coiled with DDB2, stabilizing the formation of the DDB2 / DDB1 / Cul-4 E3 ligase complex and enhancing the polyubiquitination and degradation of DDB2.

[0098] Short lincRNA p21s packaged with chemotherapeutic drugs in exosomes showed promising chemosensitizing effects

[0099] The delivery efficiency, tumor targeting specificity, and stability of Linc-p21s in vivo are crucial for developing RNA-based therapeutic strategies for cancer patients. To increase the delivery efficiency of Linc-p21s in humans, we used exosomes as a delivery system for this therapeutic strategy. Transmission electron microscopy (TEM) analysis revealed no differences in size or shape between empty and lincRNAp21-packaged exosomes (Figure 13A). To demonstrate the function of exosomally packaged Linc-p21s (exoLinc-p21s) in DNA repair, we performed a cisplatin-DNA adduct assay and found that exoLinc-p21s prolonged the presence of cisplatin-DNA adducts from 3 hours to 24 hours, suggesting that exoLinc-p21s may increase chemosensitivity by reducing DNA repair (Figure 13B). Western blot analysis confirmed the ability of exoLinc-p21s to inhibit doxorubicin-induced DDB2 expression in exosomes packaged with or without doxorubicin (exoDox) (Figure 13C). Furthermore, exoLinc-p21s reduced the proliferation of T-47D breast cancer cells and HepG2 (high DDB2 expression) liver cancer cells in colony formation assays (Figures 13D and 14A). Similar to the results from the transient transfection system, exoLinc-p21s containing 1 ng of short-chain Linc-p21s synergized with the cytotoxicity of doxorubicin (Figure 13E). In a xenograft mouse model, Exo-Linc-p21s also enhanced the antitumor activity of doxorubicin in vivo (Figure 13F). To enhance the tumor-targeting specificity of exoLinc-p21s, we engineered an antibody against HLAG, which is highly expressed in most tumors, onto the surface of exoLinc-p21s to increase tumor specificity. Indeed, exoLinc-p21s with anti-HLAG antibody showed earlier uptake and longer accumulation in T-47D cancer cells (Figure 14B).Importantly, anti-HLAG engineered exoLinc-p21s exhibited better cytotoxicity effect (Fig. 13G) and stronger suppression of DDB2 protein expression (Fig. 13H) than exoLinc-p21s without anti-HLAG.

[0100] Taken together, our data demonstrate that Linc-p21s packaged with chemotherapeutic drugs in exosomes (exoLinc-p21s) effectively targets DDB2 protein and inhibits DNA repair for chemosensitization, and may be a potentially novel RNA-based DDB2 inhibitor that enhances chemosensitivity in patients with diverse DDB2-expressing tumors.

[0101] Those skilled in the art will recognize the foregoing outline as a description of methods for communicating with hosted application information. Those skilled in the art will recognize that these are examples only and that many equivalents are possible.

Claims

1. A composition comprising a sequence of long intergenic non-coding RNA-p21 (lincRNA-p21), wherein the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

2. Use of a composition for preparing a medicament for treating cancer, wherein the composition comprises a sequence of long intergenic non-coding RNA-p21 (lincRNA-p21) and a chemotherapeutic agent, and the sequence of lincRNA-p21 is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

3. The use of claim 2, wherein the sequence of lincRNA-p21 inhibits the expression of DDB2, thereby increasing the sensitivity of the cancer to the chemotherapeutic agent.

4. The use of claim 2, wherein the cancer is a cancer associated with high expression of DDB2.

5. 3. The use of claim 2, wherein the cancer has a poor response or drug resistance to the chemotherapeutic agent.

6. The use of claim 2, wherein the cancer comprises breast cancer and liver cancer.

7. The use of claim 6, wherein the cancer cells of the breast cancer have mutant p53.

8. 8. The use of claim 7, wherein the cancer cells of the breast cancer are estrogen receptor positive and have mutant p53.

9. 3. The use of claim 2, wherein the chemotherapeutic agent comprises carboplatin, cisplatin, or doxorubicin.

10. 3. The use of claim 2, wherein the composition further comprises a pharmaceutically acceptable carrier.

11. 11. The use of claim 10, wherein the pharmaceutically acceptable carrier comprises a liposome, nanoparticle, exosome, micelle, polymeric matrix, or gel matrix.

12. The use of claim 11, wherein the sequence of lincRNA-p21 is contained in the exosome.

13. The use of claim 2, wherein the composition further comprises a target molecule for binding to a biomarker on cancer cells.

14. The use of claim 13, wherein the target molecule comprises an anti-HLAG antibody.

Citation Information

Patent Citations

  • Diagnostic, prognostic and therapeutic uses of long non-coding rnas for cancer and regenerative medicine

    US20120289581A1

  • Pathogenic control of apoptosis

    WO2016024257A1

  • Correlation between long non-coding RNA h19 and cancer platinum-based chemotherapeutic drug resistance

    WO2017031993A1