Deformable polymer containing immobilized primers

Abstract

The present invention relates to deformable polymers comprising immobilized primers for use in nucleic acid sequencing, particularly simultaneous sequencing.

Description

[Technical Field]

[0001] The present invention relates to deformable polymers comprising immobilized primers for use in nucleic acid sequencing, particularly simultaneous sequencing. [Background technology]

[0002] In some types of next-generation sequencing (NGS) technologies, nucleic acid clusters are created on a flow cell by amplifying the original template nucleic acid strand. Sequencing cycles can be performed as the complementary strand of the template nucleic acid is synthesized, i.e., using a sequencing-by-synthesis (SBS) process.

[0003] In each sequencing cycle, a deoxyribonucleic acid analog conjugated with a fluorescent label is hybridized to a template nucleic acid, and an excitation light source is used to excite the fluorescent label on the deoxyribonucleic acid analog. A detector captures the fluorescent emission from the fluorescent label and identifies the deoxyribonucleic acid analog. As a result, the sequence of the template nucleic acid can be determined by repeatedly performing such sequencing cycles.

[0004] NGS allows for the simultaneous sequencing of several different template nucleic acids, which has significantly reduced the cost of sequencing over the last two decades.

[0005] One difficulty is sequencing the forward and reverse strands (or the forward strand and the forward complement, or the reverse strand and the reverse complement) because they have a tendency to form self-hybridizing structures. Current methods typically first sequence the forward strand in the absence of the reverse strand (e.g., by removing the reverse strand), resynthesize the reverse strand, remove the forward strand, and then subsequently sequence the reverse strand in the absence of the forward strand.

[0006] However, there remains a desire to develop new strategies for sequencing, particularly for higher efficiency, throughput and speed. Summary of the Invention

[0007] According to one aspect of the present invention, a plurality of first immobilized primers; a plurality of second immobilized primers; a plurality of first immobilized primers and a plurality of second immobilized primers occupy a first set of locations on the deformable polymer; A deformable polymer is provided, wherein the deformable polymer is configured such that when the deformable polymer is exposed to a deformation trigger, a plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0008] According to one aspect of the present invention, a deformable polymer; a plurality of first immobilized primers; a plurality of second immobilized primers, a plurality of first immobilized primers and a plurality of second immobilized primers occupy a first set of locations on the deformable polymer; Subject compositions are provided wherein the compositions are configured such that, when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0009] In one embodiment, the deformation trigger causes a volume expansion of the deformable polymer.

[0010] In one embodiment, the expansion is at least a 20% increase in volume.

[0011] In one embodiment, the expansion is a volume increase of at least 50%.

[0012] In one embodiment, the expansion is a volume increase of at least 100%.

[0013] In one embodiment, the deformation trigger causes a volumetric contraction of the deformable polymer.

[0014] In one embodiment, the shrinkage is a volume reduction of at least 20%.

[0015] In one embodiment, the shrinkage is a volume reduction of at least 50%.

[0016] In one embodiment, the shrinkage is a volume reduction of at least 100%.

[0017] In one embodiment, the deformation trigger causes shuffling of the first immobilized primer and the second immobilized primer.

[0018] In one embodiment, shuffling involves a 20% volume decrease to a 20% volume increase of the deformable polymer.

[0019] In one embodiment, shuffling involves a 10% volume decrease to a 10% volume increase of the deformable polymer.

[0020] In one embodiment, shuffling involves a 5% volume decrease to a 5% volume increase of the deformable polymer.

[0021] In one embodiment, the transformation trigger is a physical trigger and / or a (bio)chemical trigger.

[0022] In one embodiment, the physical trigger comprises a temperature change in a deformable polymer.

[0023] In one embodiment, the (bio)chemical trigger comprises a change in salt concentration.

[0024] In one embodiment, the (bio)chemical trigger comprises a change in pH.

[0025] In one embodiment, the first immobilized primer and / or the second immobilized primer are covalently attached to the deformable polymer.

[0026] In one aspect, the covalent bond comprises a cycloadduct, an alkenylene bond, an ester, an amide, an acetal, a hemiaminal ether, an aminal, an imine, a hydrazone, a sulfide bond, a boron-based bond, a silicon-based bond, or a phosphorus-based bond.

[0027] In one embodiment, the cycloadduct comprises a 1,2,3-triazole linkage.

[0028] In one embodiment, the deformable polymer is composed of a plurality of particles.

[0029] In one embodiment, the particles are nanoparticles.

[0030] In one embodiment, the deformable polymer comprises a hydrogel.

[0031] In one embodiment, the deformable polymer is formed from acrylamide-based monomers.

[0032] According to a further aspect of the present invention there is provided a solid support comprising a deformable polymer as described herein.

[0033] In one aspect, the solid support is a flow cell.

[0034] According to a further aspect of the present invention there is provided a kit comprising a deformable polymer as described herein, or a solid support as described herein.

[0035] According to a further aspect of the present invention there is provided the use of a deformable polymer as described herein, or a solid support as described herein, in nucleic acid sequencing.

[0036] According to a further aspect of the present invention there is provided a process for producing a deformable polymer comprising the steps of: (a) immobilizing a plurality of first precursor primers on a deformable polymer to form a plurality of first immobilized primers; (b) immobilizing a plurality of second precursor primers on the deformable polymer to form a plurality of second immobilized primers; A process is provided in which the deformable polymer is configured such that when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0037] In one aspect, steps (a) and (b) are performed sequentially or simultaneously.

[0038] In one aspect, step (b) is performed after step (a).

[0039] In one aspect, step (a) is performed after step (b).

[0040] In one embodiment, steps (a) and (b) are performed simultaneously.

[0041] In one embodiment, immobilizing comprises forming a covalent bond between the solid support and each of the plurality of first precursor primers and between the solid support and each of the plurality of second precursor primers.

[0042] In one aspect, forming the covalent bond comprises using a Click reaction.

[0043] In one embodiment, forming a covalent bond comprises forming a 1,2,3-triazole bond.

[0044] According to a further aspect of the present invention there is provided a method for preparing a polynucleotide sequence for identification comprising the steps of: (a) providing a deformable polymer as described herein; (b) synthesizing at least one first polynucleotide sequence, each comprising a first portion, each extended from a first immobilized primer, and at least one second polynucleotide sequence, each comprising a second portion, each extended from a second immobilized primer, wherein the second polynucleotide sequences are substantially complementary to the first polynucleotide sequences.

[0045] In one aspect, the method comprises: (c) exposing the deformable polymer to a deformation trigger.

[0046] In one aspect, the deformation trigger causes the expansion of a deformable polymer.

[0047] In one embodiment, the deformation trigger causes the contraction of a deformable polymer.

[0048] In one aspect, the deformation trigger causes the deformable polymer to expand and then contract, or the deformable polymer to contract and then expand.

[0049] In one embodiment, the transformation trigger is a physical trigger and / or a (bio)chemical trigger.

[0050] In one embodiment, the physical trigger comprises a temperature change in a deformable polymer.

[0051] In one embodiment, the (bio)chemical trigger comprises a change in salt concentration.

[0052] In one embodiment, the (bio)chemical trigger comprises a change in pH.

[0053] In one aspect, the method further comprises preparing the first portion and the second portion for simultaneous sequencing.

[0054] In one embodiment, the method comprises simultaneously contacting a first sequencing primer binding site located after the 3' end of the first portion with a first primer and a second sequencing primer binding site located after the 3' end of the second portion with a second primer.

[0055] In one aspect, the method further comprises processing at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion such that a proportion of the first portion is capable of generating a first signal and a proportion of the second portion is capable of generating a second signal.

[0056] In one embodiment, the treatment comprises selective treatment that causes the intensity of the first signal to be greater than the intensity of the second signal.

[0057] In one embodiment, the concentration of the first moiety capable of producing the first signal is greater than the concentration of the second moiety capable of producing the second signal.

[0058] In one embodiment, the ratio between the concentration of the first moiety capable of generating a first signal and the concentration of the second moiety capable of generating a second signal is 1.25:1 to 5:1.

[0059] In one embodiment, the ratio is from 1.5:1 to 3:1.

[0060] In one embodiment, the ratio is about 2:1.

[0061] In one aspect, selective processing includes preparing for or performing selective sequencing.

[0062] In one aspect, the selective processing comprises selective amplification.

[0063] In one aspect, the selective treatment comprises contacting a first sequencing primer binding site located after the 3' end of the first portion with a first primer, and contacting a second sequencing primer binding site located after the 3' end of the second portion with a second primer, the second primer comprising a mixture of blocked and unblocked second primers.

[0064] In one embodiment, the blocked second primer comprises a blocking group at the 3' end of the blocked second primer.

[0065] In one aspect, the blocking group is selected from the group consisting of a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom in place of the 3'-OH group, a phosphate group, a phosphorothioate group, a propyl spacer, a modification that blocks the 3'-hydroxyl group, or an inverted nucleobase.

[0066] In one aspect, the selective treatment comprises selectively removing some or substantially all of the second immobilized primer that has not yet been extended, and performing additional amplification cycles to selectively amplify the first polynucleotide sequence relative to the second polynucleotide sequence.

[0067] In one aspect, the selective treatment comprises selectively blocking some or substantially all of the second immobilized primer that has not yet been extended using a primer blocking agent configured to limit or prevent synthesis of an extending strand from the second immobilized primer, and performing additional amplification cycles to selectively amplify the first polynucleotide sequence relative to the second polynucleotide sequence.

[0068] In one embodiment, a primer blocking agent is added while the first polynucleotide sequence hybridizes to the second immobilized primer.

[0069] In one aspect, the method includes contacting a portion or substantially all of the second immobilized primer with an extended primer sequence, the extended primer sequence being substantially complementary to the second immobilized primer and further comprising an additional 5' nucleotide, and adding a primer blocking agent, the primer blocking agent being complementary to the additional 5' nucleotide.

[0070] In one embodiment, the primer blocking agent is a blocked nucleotide.

[0071] In one embodiment, the blocked nucleotide comprises a blocking group at the 3' end of the blocked nucleotide.

[0072] In one aspect, the blocking group is selected from the group consisting of a hairpin loop, a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom in place of the 3'-OH group, a phosphate group, a phosphorothioate group, a propyl spacer, a modification that blocks the 3'-hydroxyl group, or an inverted nucleobase.

[0073] In one embodiment, the blocked nucleotide is A or G.

[0074] In one embodiment, the first signal and the second signal are spatially resolved.

[0075] In one embodiment, the first signal and the second signal are not spatially resolved.

[0076] According to a further aspect of the present invention there is provided a method for sequencing a polynucleotide sequence comprising the steps of: preparing a polynucleotide sequence for identification using the methods described herein; and sequencing the nucleobases in the first portion and the second portion.

[0077] In one aspect, the step of sequencing the nucleobases in the first portion and the second portion comprises simultaneous sequencing of the nucleobases in the first portion and the second portion.

[0078] In one aspect, the step of sequencing the nucleobases comprises performing sequencing by synthesis or sequencing by ligation.

[0079] In one aspect, the method further comprises performing paired-end reading.

[0080] In one aspect, the step of simultaneously sequencing the nucleobases comprises: (a) acquiring first intensity data including a combined intensity of a first signal component acquired based on each first nucleobase in a first portion and a second signal component acquired based on each second nucleobase in a second portion, wherein the first and second signal components are acquired simultaneously; (b) acquiring second intensity data including a combined intensity of a third signal component acquired based on each first nucleic acid base in the first portion and a fourth signal component acquired based on each second nucleic acid base in the second portion, wherein the third and fourth signal components are acquired simultaneously; (c) selecting one of a plurality of classifications based on the first and second intensity data, each classification representing a possible combination of a respective first and second nucleobase; (d) base-calling each of the first and second nucleobases based on the selected classification.

[0081] In one embodiment, selecting a classification based on the first and second intensity data includes selecting a classification based on a combined intensity of the first and second signal components and a combined intensity of the third and fourth signal components.

[0082] In one aspect, the plurality of classes comprises 16 classes, each class representing one of 16 unique combinations of first and second nucleobases.

[0083] In one embodiment, the first signal component, the second signal component, the third signal component and the fourth signal component are generated based on luminescence associated with each nucleobase.

[0084] In one embodiment, the luminescence is detected by a sensor, the sensor being configured to provide a single output based on the first and second signals.

[0085] In one aspect, the sensor comprises a single sensing element.

[0086] In one aspect, the method further comprises repeating steps (a)-(d) for each of a plurality of base-calling cycles.

[0087] According to a further aspect of the present invention, there is provided a kit comprising instructions for preparing polynucleotide sequences for identification as described herein and / or for sequencing the polynucleotide sequences as described herein.

[0088] According to a further aspect of the present invention there is provided a data processing device comprising means for performing the methods described herein.

[0089] In one aspect, the data processing device is a polynucleotide sequencer.

[0090] According to a further aspect of the present invention there is provided a computer program product comprising instructions which, when executed by a processor, cause the processor to carry out the methods described herein.

[0091] According to a further aspect of the present invention, there is provided a computer-readable storage medium comprising instructions that, when executed by a processor, cause the processor to perform the methods described herein.

[0092] According to a further aspect of the present invention there is provided a computer readable data carrier having stored thereon a computer program product as described herein.

[0093] According to a further aspect of the present invention there is provided a data carrier signal carrying a computer program product as described herein. [Brief explanation of the drawings]

[0094] [Figure 1] The forward strand, reverse strand, forward complement, and reverse complement of the polynucleotide molecule are shown. [Figure 2] An example of a polynucleotide sequence (or insert) with 5' and 3' adapter sequences is shown. [Figure 3] An exemplary polynucleotide with 5' and 3' adapter sequences is shown. [Figure 4] A typical solid support is shown. [Figure 5-1] The diagram shows the steps of bridge amplification and generation of amplified clusters, including (A) hybridization of a library strand to an immobilized primer, (B) generation of a template strand from the library strand, (C) dehybridization and washing away of the library strand, (D) hybridization of the template strand to another immobilized primer, (E) generation of a template-complementary strand from the template strand via bridge amplification, (F) dehybridization of the sequence bridge, (G) hybridization of the template strand and template-complementary strand to an immobilized primer, and (H) subsequent bridge amplification to provide multiple templates and template-complementary strands. [Figure 5-2]The diagram shows the steps of bridge amplification and generation of amplified clusters, including (A) hybridization of a library strand to an immobilized primer, (B) generation of a template strand from the library strand, (C) dehybridization and washing away of the library strand, (D) hybridization of the template strand to another immobilized primer, (E) generation of a template-complementary strand from the template strand via bridge amplification, (F) dehybridization of the sequence bridge, (G) hybridization of the template strand and template-complementary strand to an immobilized primer, and (H) subsequent bridge amplification to provide multiple templates and template-complementary strands. [Figure 5-3] The diagram shows the steps of bridge amplification and generation of amplified clusters, including (A) hybridization of a library strand to an immobilized primer, (B) generation of a template strand from the library strand, (C) dehybridization and washing away of the library strand, (D) hybridization of the template strand to another immobilized primer, (E) generation of a template-complementary strand from the template strand via bridge amplification, (F) dehybridization of the sequence bridge, (G) hybridization of the template strand and template-complementary strand to an immobilized primer, and (H) subsequent bridge amplification to provide multiple templates and template-complementary strands. [Figure 6] 1 shows the detection of nucleobases using 4-channel, 2-channel and 1-channel chemistries. [Figure 7] 1 shows a method for selective sequencing. [Figure 8-1] A method of selective amplification is shown that involves (A) selective cleavage of one type of immobilized primer from the support, (B) only template (or template component) strands complementary to the free immobilized primer anneal and undergo bridge amplification, (C) generating different ratios of template and template-complementary strands, and (D) subsequent standard (non-selective) sequencing occurring at different ratios that allow for signal differentiation. [Figure 8-2]A method of selective amplification is shown that involves (A) selective cleavage of one type of immobilized primer from the support, (B) only template (or template component) strands complementary to the free immobilized primer anneal and undergo bridge amplification, (C) generating different ratios of template and template-complementary strands, and (D) subsequent standard (non-selective) sequencing occurring at different ratios that allow for signal differentiation. [Figure 9-1] Illustrated is a method of selective amplification that includes (A) template and template-complementary strands annealing to immobilized primers, (B) the addition of a primer-blocking agent that binds to only one type of immobilized primer and prevents extension from that one type of immobilized primer, (C) generating different ratios of template and template-complementary strands, and (D) subsequent standard (non-selective) sequencing occurring at different ratios that allow for signal differentiation. [Figure 9-2] Illustrated is a method of selective amplification that includes (A) template and template-complementary strands annealing to immobilized primers, (B) the addition of a primer-blocking agent that binds to only one type of immobilized primer and prevents extension from that one type of immobilized primer, (C) generating different ratios of template and template-complementary strands, and (D) subsequent standard (non-selective) sequencing occurring at different ratios that allow for signal differentiation. [Figure 10] 1 illustrates a method of selective amplification that includes (A) flowing one (or more) extended primer sequences containing at least one additional 5' nucleotide across the surface of a solid support, and (B) adding a primer-blocking agent that binds only to one type of immobilized primer and is complementary to the additional 5' nucleotide of the extended primer sequence, preventing extension from one type of immobilized primer. [Figure 11] 1 is a plot showing a graphical representation of 16 distributions of signals generated by polynucleotide sequences, according to one embodiment. [Figure 12] FIG. 1 is a flow diagram illustrating a method for base calling, according to one embodiment. [Figure 13]Figure 1 conceptually illustrates how physical separation of forward and reverse strand polynucleotide sequences can be achieved by extending a deformable polymer. The left side of the figure shows the forward and reverse strands hybridized together after clustering is complete. The right side of the figure shows that after extension and denaturation, the tethered strands have physically moved apart from each other, effectively preventing rehybridization. This makes both strands available for priming and SBS sequencing. [Figure 14] Examples of deformable polymers are shown: (A) shows the grafting of free "precursor" primers (P5 / P7) onto a polymer to form a deformable polymer containing a first immobilized primer and a second immobilized primer in the form of particles; (B) shows the thermal response of the original polymer without the primers grafted (left) and the thermal response of the deformable polymer with the primers grafted onto it (right). DETAILED DESCRIPTION OF THE INVENTION

[0095] All patents, patent applications, and other publications mentioned herein, including all sequences disclosed within these references, are expressly incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. All cited documents are, in relevant part, incorporated herein by reference in their entirety for the purposes indicated by the context of the citation herein. However, the citation of any document should not be construed as an admission that it is prior art to the present disclosure.

[0096] The present invention can be used in sequencing, particularly in simultaneous sequencing.Methods applicable to the present invention are described in WO 08 / 041002, WO 07 / 052006, WO 98 / 44151, WO 00 / 18957, WO 02 / 06456, WO 07 / 107710, WO 05 / 068656, U.S. Patent Application No. 13 / 661,524 and U.S. Patent Application No. 2012 / 0316086, the contents of which are incorporated herein by reference. Further information can be found in U.S. Patent Application No. 20060024681, U.S. Patent Application No. 20060292611, WO 06 / 110855, WO 06 / 135342, WO 03 / 074734, WO 07 / 010252, WO 07 / 091077, WO 00 / 179553, WO 98 / 44152, and WO 2022 / 087150, the contents of which are incorporated herein by reference.

[0097] As used herein, the term "variant" refers to a variant polypeptide sequence or portion of a polypeptide sequence that retains the desired function of the complete, non-variant sequence. For example, the desired function of an immobilized primer is to retain the ability to bind (i.e., hybridize) to a target sequence.

[0098] As used in any embodiment described herein, a "variant" means a nucleic acid sequence that is at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 1110, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 1 %, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity. Sequence identity of variants can be determined using any number of sequence alignment programs known in the art. As an example, Emboss Stretcher from EMBL-EBI can be used: https: / / www.ebi.ac.uk / Tools / psa / emboss_stretcher / (using default parameters: for proteins, paired output format, Matrix=BLOSUM62, Gap open=1, Gap extend=1; for nucleotides, paired output format, Matrix=DNAfull, Gap open=16, Gap extend=4).

[0099] As used herein, the term "fragment" refers to a functionally active, contiguous stretch of nucleic acid derived from a longer nucleic acid sequence. A fragment can be at least 99%, at least 95%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% of the length of the longer nucleic acid sequence. In one embodiment, a fragment as used herein also retains the ability to bind (i.e., hybridize) to a target sequence.

[0100] Sequencing generally involves four basic steps: 1) library preparation to form a plurality of target polynucleotides for identification, 2) cluster generation to form an array of amplified template polynucleotides, 3) sequencing the cluster array of amplified template polynucleotides, and 4) data analysis to identify features of target polynucleotides from the amplified template polynucleotide sequences. These steps are described in more detail below.

[0101] Library Strand and Template Terminology For a given double-stranded polynucleotide sequence 100 to be identified, the polynucleotide sequence 100 comprises a forward strand of sequence 101 and a reverse strand of sequence 102. See FIG.

[0102] When polynucleotide sequence 100 is replicated (e.g., using DNA / RNA polymerase), complementary versions of forward strand 101 of sequence 100 and reverse strand 102 of sequence 100 are generated. Replication of polynucleotide sequence 100 thus provides double-stranded polynucleotide sequence 100a, which comprises the forward strand of sequence 101 and the forward complement of sequence 101', and double-stranded polynucleotide sequence 100b, which comprises the reverse strand of sequence 102 and the reverse complement of sequence 102'.

[0103] The term "template" may be used to describe a complementary version of double-stranded polynucleotide sequence 100. Thus, "template" includes the forward complement of sequence 101' and the reverse complement of sequence 102'. Thus, by using the forward complement of sequence 101' as a template for complementary base pairing, a sequencing process (e.g., a sequencing-by-synthesis or sequencing-by-ligation process) recreates the information that was present in the original forward strand of sequence 101. Similarly, by using the reverse complement of sequence 102' as a template for complementary base pairing, a sequencing process (e.g., a sequencing-by-synthesis or sequencing-by-ligation process) recreates the information that was present in the original reverse strand of sequence 102.

[0104] The two strands in the template may also be referred to as the forward strand of template 101' and the reverse strand of template 102'. The complement of the forward strand of template 101' is referred to as the forward complementary strand of template 101, and the complement of the reverse strand of template 102' is referred to as the reverse complementary strand of template 102.

[0105] In general, when the terms forward strand, reverse strand, forward complement, and reverse complement are used herein without limitation as to whether they are relative to the original polynucleotide sequence 100 or to the "template," these terms may be construed to refer to the "template."

[0106] [Table 1]

[0107] Library preparation Library preparation is the first step in any high-throughput sequencing platform. These libraries allow templates to be generated through complementary base pairing, which can then be clustered and amplified. During library preparation, nucleic acid sequences (e.g., genomic DNA samples, or cDNA or RNA samples) are converted into a sequencing library, which can then be sequenced. Using a DNA sample as an example, the first step in library preparation is random fragmentation of the DNA sample. The sample DNA is first fragmented, and fragments of a specific size (typically 200-500 bp, but can be larger) are ligated, subcloned, or "inserted" between two oligo adapters (adapter sequences). The original sample DNA fragments are referred to as "inserts." Target polynucleotides can also be advantageously size-fragmented prior to modification with adapter sequences.

[0108] As described herein, the generated templates typically comprise distinct polynucleotide sequences, particularly a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion. The generation of these templates from a particular library can be carried out according to methods known to those skilled in the art. However, several exemplary approaches for preparing libraries suitable for generating such templates are described below.

[0109] In some embodiments, libraries can be prepared by ligating adapter sequences to double-stranded polynucleotide sequences, each comprising a forward strand of sequence and a reverse strand of sequence, as described in more detail, for example, in International Publication No. WO 07 / 052006, which is incorporated herein by reference. In some cases, "tagmentation" can be used to attach sample DNA to adapters, as described in more detail, for example, in International Publication No. WO 10 / 048605, U.S. Patent Application Publication No. 2012 / 0301925, U.S. Patent Application Publication No. 2013 / 0143774, and International Publication No. WO 2016 / 189331, each of which is incorporated herein by reference. In tagmentation, double-stranded DNA is simultaneously fragmented and tagged with adapter sequences and PCR primer binding sites. The combined reaction eliminates the need for a separate mechanical shearing step during library preparation. These procedures can be used, for example, to prepare a template comprising a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion, where the first portion is the forward strand of the template and the second portion is the forward complement of the template (i.e., a copy of the forward strand) (or alternatively, the first portion is the reverse strand of the template and the second portion is the reverse complement of the template).

[0110] When features herein are described with respect to the "forward" strand, it should be considered that these features may be equally applied to the "reverse strand."

[0111] If the library is prepared by ligating adapter sequences to the double-stranded polynucleotide sequence as described above, the library preparation may include ligating a first primer binding sequence 301′ (e.g., P5′, e.g., SEQ ID NO: 3) and a second terminal sequencing primer binding site 304 (e.g., SBS3′, e.g., SEQ ID NO: 8) to the 3′ end of the forward strand of sequence 101. See FIG. 2. The library preparation may be configured such that the second terminal sequencing primer binding site 304 is attached (e.g., directly attached) to the 3′ end of the forward strand of sequence 101, and such that the first primer binding sequence 301′ is attached (e.g., directly attached) to the 3′ end of the second terminal sequencing primer binding site 304.

[0112] The library preparation may further include ligating a complement (also referred to herein as first terminal sequencing primer binding portion phase complement 303') of first terminal sequencing primer binding site 303' (e.g., SBS12, such as SEQ ID NO: 9) and a second primer binding sequence 302 (also referred to herein as second primer binding complement sequence 302) (e.g., P7, such as SEQ ID NO: 2) to the 5' end of the forward strand of sequence 101. The library preparation may be configured such that first terminal sequencing primer binding portion phase complement 303' is attached (e.g., directly attached) to the 5' end of the forward strand of sequence 101, and such that second primer binding complement sequence 302 is attached (e.g., directly attached) to the 5' end of first terminal sequencing primer binding portion phase complement 303'.

[0113] Thus, one strand of a polynucleotide in a polynucleotide library may comprise, in a 5' to 3' direction, a second primer binding complementary sequence 302 (e.g., P7), a first terminal sequencing primer binding portion phase complementary sequence 303' (e.g., SBS12), the forward strand of sequence 101, a second terminal sequencing primer binding portion 304 (e.g., SBS3'), and a first primer binding sequence 301' (e.g., P5') (Figure 2 - bottom strand).

[0114] Although not shown in Figure 2, a strand may further include one or more index sequences. Thus, a first index sequence (e.g., i7) may be provided between the second primer binding complement sequence 302 (e.g., P7) and the first terminal sequencing primer binding site topological complement 303' (e.g., SBS12). Separately, or in addition, a second index complement sequence (e.g., i5') may be provided between the second terminal sequencing primer binding site 304 (e.g., SBS3') and the first primer binding sequence 301' (e.g., P5'). Thus, in some embodiments, one strand of a polynucleotide in a polynucleotide library may comprise, in a 5' to 3' direction, a second primer binding complementary sequence 302 (e.g., P7), a first index sequence (e.g., i7), a first terminal sequencing primer binding site phase complementary sequence 303' (e.g., SBS12), the forward strand of sequence 101, a second terminal sequencing primer binding site 304 (e.g., SBS3'), a second index complementary sequence (e.g., i5'), and a first primer binding sequence 301' (e.g., P5'). An exemplary polynucleotide is shown in Figure 3 (bottom strand).

[0115] When double-stranded sequence 100 is used, the library preparation may also include ligating a second primer binding sequence 302′ (e.g., P7′) and a first terminal sequencing primer binding site 303 (e.g., SBS12′) to the 3′ end of the reverse strand of sequence 102. The library preparation may be configured such that the first terminal sequencing primer binding site 303 is attached (e.g., directly attached) to the 3′ end of the reverse strand of sequence 102, and the second primer binding sequence 302′ is attached (e.g., directly attached) to the 3′ end of the first terminal sequencing primer binding site 303.

[0116] The library preparation may further include ligating a complement (also referred to herein as second terminal sequencing primer binding portion phase complement 304') of second terminal sequencing primer binding portion 304' (e.g., SBS3) and a first primer binding sequence 301 (also referred to herein as first primer binding complement sequence 301) (e.g., P5) to the 5' end of the reverse strand of sequence 102. The library preparation may be configured such that second terminal sequencing primer binding portion phase complement 304' is attached (e.g., directly attached) to the 5' end of the reverse strand of sequence 102, and such that first primer binding complement sequence 301' is attached (e.g., directly attached) to the 5' end of second terminal sequencing primer binding portion phase complement 304'.

[0117] Thus, the other strand of a polynucleotide in a polynucleotide library may comprise, in a 5' to 3' direction, a first primer binding complementary sequence 301 (e.g., P5), a second terminal sequencing primer binding site complementary sequence 304' (e.g., SBS3), the reverse strand of sequence 102, a first terminal sequencing primer binding site 303 (e.g., SBS12'), and a second primer binding sequence 302' (e.g., P7') (Figure 2 - top strand).

[0118] Although not shown in Figure 2, the other strand may further include one or more index sequences. Thus, a second index sequence (e.g., i5) may be provided between the first primer binding complement sequence 301 (e.g., P5) and the second terminal sequencing primer binding site topological complement 304' (e.g., SBS3). Separately, or in addition, a first index complement sequence (e.g., i7') may be provided between the first terminal sequencing primer binding site 303 (e.g., SBS12') and the second primer binding sequence 302' (e.g., P7'). Thus, in some embodiments, the other strand of a polynucleotide in a polynucleotide library may comprise, in a 5' to 3' direction, a first primer binding complement sequence 301 (e.g., P5), a second index sequence (e.g., i5), a second terminal sequencing primer binding site phase complement 304' (e.g., SBS3), the reverse strand of sequence 102, a first terminal sequencing primer binding site 303 (e.g., SBS12'), a first index complement sequence (e.g., i7'), and a second primer binding sequence 302' (e.g., P7'). An exemplary polynucleotide is shown in Figure 3 (top strand).

[0119] As will be understood by those skilled in the art, double-stranded nucleic acids are typically formed from two complementary polynucleotide strands composed of deoxyribonucleotides or ribonucleotides linked by phosphodiester bonds, but may further contain one or more ribonucleotides and / or non-nucleotide chemical moieties and / or non-naturally occurring nucleotides and / or non-naturally occurring backbone linkages. In particular, double-stranded nucleic acids may contain non-nucleotide chemical moieties, such as linkers or spacers, at the 5' end of one or both strands. By way of non-limiting example, double-stranded nucleic acids may contain methylated nucleotides, uracil bases, phosphorothioate groups, peptide conjugates, and the like. Such non-DNA or non-natural modifications may be included to impart certain desirable properties to the nucleic acid, such as to enable covalent, non-covalent, or metal-coordinate binding to a solid support, or to act as a spacer to position the cleavage site at an optimal distance from the solid support. A single-stranded nucleic acid consists of one such polynucleotide strand. When a polynucleotide strand is only partially hybridized to a complementary strand, for example, a long polynucleotide strand hybridized to a short nucleotide primer, it may be referred to herein as a single-stranded nucleic acid.

[0120] A sequence comprising at least a primer binding sequence (a primer binding sequence and a sequencing primer binding site, or in another embodiment, a combination of a primer binding sequence, an index sequence, and a sequencing primer binding site) may be referred to herein as an adapter sequence, and the insert is flanked by a 5' adapter sequence and a 3' adapter sequence. The primer binding sequence may also comprise a sequencing primer for the index read.

[0121] As used herein, "adapter" refers to a sequence comprising short sequence-specific oligonucleotides that are ligated to the 5' and 3' ends of each DNA (or RNA) fragment in a sequencing library as part of library preparation. The adapter sequence may further comprise a non-peptide linker.

[0122] In further embodiments, the P5' and P7' primer binding sequences are complementary to short primer sequences (or lone primers) present on the surface of a flow cell. For example, binding of P5' and P7' to their complements (P5 and P7) on the surface of a flow cell allows for nucleic acid amplification. As used herein, "'" indicates the complementary strand.

[0123] Primer binding sequences within the adapter that allow hybridization to an amplification primer (e.g., a lone primer) will typically be approximately 20-40 nucleotides in length, although the present invention is not limited to sequences of this length. The exact identity of the amplification primer (e.g., a lone primer), and therefore the homologous sequence within the adapter, is generally not a subject of the present invention, so long as the primer binding sequence is capable of interacting with the amplification primer to induce PCR amplification. While the sequence of the amplification primer can be specific to the particular target nucleic acid desired to be amplified, in other embodiments, these sequences can be "universal" primer sequences that allow amplification of any target nucleic acid, of known or unknown sequence, modified to allow amplification by a universal primer. The criteria for PCR primer design are generally well known to those of skill in the art.

[0124] An index sequence (also known as a barcode or tag sequence) is a unique short DNA (or RNA) sequence added to each DNA (or RNA) fragment during library preparation. The unique sequences allow many libraries to be pooled together and sequenced simultaneously. Sequencing reads from the pooled libraries are identified and computer-sorted based on their barcodes before final data analysis. Library multiplexing is also a useful technique when working with small genomes or targeting genomic regions of interest. Barcode-based multiplexing can exponentially increase the number of samples analyzed in a single run without significantly increasing execution costs or run times. Examples of tag sequences can be found in WO 05 / 068656, the contents of which are incorporated herein by reference in their entirety. Tags can be read, for example, at the end of the first read, or equivalently, at the end of the second read, using a sequencing primer complementary to the strand marked P7. The present invention is not limited to the number of reads per cluster (e.g., two reads per cluster); three or more reads per cluster can be obtained simply by dehydrogenating the first extension sequence primer and rehybridizing the second primer before or after the cluster reassembly / strand resynthesis step. Methods for preparing samples suitable for indexing are described, for example, in International Publication No. 2008 / 093098, incorporated herein by reference. Single or dual indexing can also be used. With single indexing, up to 48 unique 6-base indexes can be used to generate up to 48 uniquely tagged libraries. With dual indexing, up to 24 unique 8-base Index1 sequences and up to 16 unique 8-base Index2 sequences can be used in combination to generate up to 384 uniquely tagged libraries. Pairs of indexes can also be used such that each i5 index and each i7 index is used only once.These unique dual indexes can be used to identify and filter indexed hopped reads, providing even greater confidence in multiplexed samples.

[0125] The sequencing primer binding site is the sequencing and / or index primer binding site and indicates the starting point of a sequencing read. During the sequencing process, the sequencing primer anneals (i.e., hybridizes) to at least a portion of the sequencing primer binding site on the template strand. A polymerase enzyme binds to this site and incorporates complementary nucleotides, base by base, into the growing opposite strand.

[0126] Cluster generation and amplification Once the double-stranded nucleic acid library is formed, the library is typically subjected to denaturing conditions in advance to provide single-stranded nucleic acids.Suitable denaturing conditions will be clear to skilled readers by referring to standard molecular biology protocols (Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds. Ausubel et al.).In one embodiment, chemical denaturation can be used.

[0127] After denaturation, the single-stranded library may be contacted in free solution onto a solid support containing surface capture moieties (eg, P5 and P7 lawn primers).

[0128] Thus, embodiments of the present invention can be performed on a solid support 200 such as a flow cell. However, in alternative embodiments, seeding and clustering can be performed outside of a flow cell using other types of solid supports.

[0129] The solid support 200 may include a substrate 204. See Figure 4. The substrate 204 includes at least one well 203 (e.g., a nanowell), and typically includes a plurality of wells 203 (e.g., a plurality of nanowells). For example, the substrate 204 may be a planar array of wells 203.

[0130] In one embodiment, the solid support comprises a plurality of first immobilized primers and a plurality of second immobilized primers.

[0131] Thus, each well 203 may contain a plurality of first immobilized primers 201. In addition, each well 203 may contain a plurality of second immobilized primers 202. Thus, each well 203 may contain a plurality of first immobilized primers 201 and a plurality of second immobilized primers 202.

[0132] When the deformable polymer is utilized in the form of particles (eg, nanoparticles), each particle can be considered to be a single well 203 .

[0133] The first immobilized primer 201 can be attached to the solid support 200 via the 5' end of its polynucleotide strand. When extension occurs from the first immobilized primer 201, the extension can be in a direction away from the solid support 200.

[0134] The second immobilized primer 202 can be attached to the solid support 200 via the 5' end of its polynucleotide strand. When extension occurs from the second immobilized primer 202, the extension can be in a direction away from the solid support 200.

[0135] The first immobilized primer 201 may be different from the second immobilized primer 202 and / or the complement of the second immobilized primer 202. The second immobilized primer 202 may be different from the first immobilized primer 201 and / or the complement of the first immobilized primer 201.

[0136] The first immobilized primer 201 (or each of them) may comprise the sequence defined in SEQ ID NO: 1 or 5, or a variant or fragment thereof. The second immobilized primer 202 (or each of them) may comprise the sequence defined in SEQ ID NO: 2, or a variant or fragment thereof. Although the first immobilized primer 201 is shown here as corresponding to P5 and the second immobilized primer 202 is shown here as corresponding to P7, these definitions may be interchanged; in other words, the first immobilized primer 201 may instead correspond to P7 and the second immobilized primer 202 may correspond to P5.

[0137] In some embodiments, the first immobilized primer 201 and the second immobilized primer 202 in the well 203 can be spatially separated from each other. In other words, the first immobilized primer 201 can occupy a first region, and the second immobilized primer 202 can occupy a second region, where the first and second regions do not overlap. A suitable approach is described in International Publication No. WO 2020 / 005503, the contents of which are incorporated herein by reference. For example, the first immobilized primer 201 can be grafted onto a first polymer, and the second immobilized primer 202 can be grafted onto a second polymer (e.g., a second polymer having a different backbone from the first polymer); alternatively, the first immobilized primer 201 can be grafted onto one region of a polymer (e.g., a block copolymer), and the second immobilized primer 202 can be grafted onto another region of the same polymer. This means that any signals generated (eg, the first and second signals referred to herein) are spatially resolved.

[0138] In other embodiments, the first immobilized primer 201 and the second immobilized primer 202 in the well 203 may not be spatially separated from each other. In other words, the first immobilized primer 201 may occupy a first region and the second immobilized primer 202 may occupy a second region, and the first region and the second region may correspond to the same region or may substantially overlap. This means that any signals generated (e.g., the first and second signals referred to herein) are not spatially resolved.

[0139] As a simple example, following attachment of the P5 and P7 primers to the solid support, the solid support can be contacted with the template to be amplified under conditions that allow hybridization (or annealing—such terms can be used interchangeably) between the template and the immobilized primers. The template is usually added to the free solution under suitable hybridization conditions, which will be apparent to those skilled in the art. Typically, hybridization conditions are, for example, 5xSSC at 40°C. However, other temperatures, such as about 50°C to about 75°C, about 55°C to about 70°C, or about 60°C to about 65°C, may also be used during hybridization. Solid-phase amplification can then proceed. The first step of amplification is a primer extension step, in which nucleotides are added to the 3' end of the immobilized primer using the template to generate a fully extended complementary strand. The template is then typically washed from the solid support. This complementary strand will contain a primer binding sequence (i.e., either P5' or P7') at its 3' end that can crosslink and bind to a second primer molecule immobilized on a solid support. Further rounds of amplification (similar to a standard PCR reaction) result in the formation of clusters or colonies of template molecules bound to the solid support. This is called clustering.

[0140] Solid-phase amplification by methods similar to those of either WO 98 / 44151 or WO 00 / 18957 (the contents of which are incorporated herein by reference in their entireties) will result in the generation of a clustered array of colonies of "bridged" amplification products. This process is known as bridge amplification. Both strands of the amplification product will be immobilized on a solid support at or near their 5' ends, and this attachment will originate from the original attachment of the amplification primer. Typically, the amplification product within each colony will be derived from the amplification of a single template molecule. Other amplification procedures can be used and will be known to those skilled in the art. For example, amplification can be isothermal amplification using a strand-displacing polymerase or exclusion amplification as described in WO 2013 / 188582. Further information regarding amplification can be found in WO 02 / 06456 and WO 07 / 107710, the contents of which are incorporated herein by reference in their entireties.

[0141] Such an approach results in the formation of a cluster of template molecules that contain copies of the template strand and copies of the complement of the template strand.

[0142] The steps of cluster generation and amplification for a template comprising a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion are shown below and in FIG.

[0143] When (separate) polynucleotide strands are used, each first polynucleotide sequence may be attached to a first immobilized primer (via the 5' end of the first polynucleotide sequence), and each second polynucleotide sequence may be attached to a second immobilized primer (via the 5' end of the second polynucleotide sequence). Each first polynucleotide sequence may comprise a second adapter sequence, which comprises a portion that is substantially complementary to the second immobilized primer (or that is substantially complementary to the second immobilized primer). The second adapter sequence may be located at the 3' end of the first polynucleotide sequence. Each second polynucleotide sequence may comprise a first adapter sequence, which comprises a portion that is substantially complementary to the first immobilized primer (or that is substantially complementary to the first immobilized primer). The first adapter sequence may be located at the 3' end of the second polynucleotide sequence.

[0144] In one embodiment, a solution containing a polynucleotide library prepared by ligating adapter sequences to double-stranded polynucleotide sequences as described above can be flowed across a flow cell.

[0145] A specific polynucleotide strand from the polynucleotide library to be sequenced, comprising, in a 5' to 3' direction, a second primer binding complement sequence 302 (e.g., P7), a first terminal binding site topological complement 303' (e.g., SBS12), the forward strand of sequence 101, a second terminal sequencing primer binding site 304 (e.g., SBS3'), and a first primer binding sequence 301' (e.g., P5'), can anneal (via first primer binding sequence 301') to a first immobilized primer 201 (e.g., P5 primer) located within a specific well 203 (Figure 5A).

[0146] The polynucleotide library may include other polynucleotide strands having different forward strands of sequence 101. Such other polynucleotide strands may anneal to corresponding first immobilized primers 201 (e.g., P5 lawn primers) in different wells 203, thus allowing for parallel processing of various different strands within the polynucleotide library.

[0147] A new polynucleotide strand can then be synthesized, extending from the first immobilized primer 201 (e.g., P5 lone primer) in a direction away from the substrate 204. Using complementary base pairing, this produces a template strand that includes, in a 5' to 3' direction, the first immobilized primer 201 (e.g., P5 lone primer) attached to the solid support 200, the second terminal sequencing primer binding site topological complement 304' (e.g., SBS3), the forward strand of template 101' (representing a type of "first portion"), the first terminal sequencing primer binding site 303 (representing a type of "first sequencing primer binding site") (e.g., SBS12'), and the second primer binding sequence 302' (e.g., P7') (Figure 5B). Such a process can utilize an appropriate polymerase (e.g., DNA polymerase or RNA polymerase).

[0148] If a polynucleotide in the library contains an index sequence, the corresponding index sequence is also generated in the template.

[0149] The polynucleotide strands from the polynucleotide library can then be dehybridized and washed away, leaving the template strand bound to the first immobilized primer 201 (eg, P5 lawn primer) (Figure 5C).

[0150] A second primer binding sequence 302' (e.g., P7') on the template strand can then anneal to a second immobilized primer 202 (e.g., P7 lawn primer) located in well 203. This forms a "bridge" (Figure 5D).

[0151] A new polynucleotide strand can then be synthesized by bridge amplification, extending (initially) from the second immobilized primer 202 (e.g., a P7 loan primer) away from the substrate 204. Using complementary base pairing, this produces a template strand that includes, in a 5' to 3' direction, the second immobilized primer 202 (e.g., a P7 loan primer) attached to the solid support 200, a first terminal sequencing primer binding site topological complement 303' (e.g., SBS12), a forward complement of the template 101 (representing a type of "second portion"), a second terminal sequencing primer binding site 304 (representing a type of "second sequencing primer binding site") (e.g., SBS3'), and a first primer binding sequence 301' (e.g., P5') (Figure 5E). Again, such a process can utilize a suitable polymerase (e.g., a DNA polymerase or an RNA polymerase).

[0152] The strand bound to the second immobilized primer 202 (e.g., P7 loan primer) can then be dehybridized from the strand bound to the first immobilized primer 201 (e.g., P5 loan primer) (Figure 5F).

[0153] Subsequent bridge amplification cycles can then result in amplification of the strand bound to the first immobilized primer 201 (e.g., P5 loan primer) and the strand bound to the second immobilized primer 202 (e.g., P7 loan primer). Similar to Figure 5D, the second primer binding sequence 302' (e.g., P7') on the template strand bound to the first immobilized primer 201 (e.g., P5 loan primer) can then anneal to another second immobilized primer 202 (e.g., P7 loan primer) located in the well 203. Similarly, the first primer binding sequence 301' (e.g., P5') on the template strand bound to the second immobilized primer 202 (e.g., P7 loan primer) can then anneal to another first immobilized primer 201 (e.g., P5 loan primer) located in the well 203 (Figure 5G).

[0154] Completion of bridge amplification and dehybridization can then provide an amplified (duoclonal) cluster, thus providing a plurality of first polynucleotide sequences (i.e., "first portion") comprising the forward strand of template 101', and a plurality of second polynucleotide sequences (i.e., "second portion") comprising the forward complementary strand of template 101 (Figure 5H).

[0155] If desired, additional bridge amplification cycles may be performed to increase the number of first and second polynucleotide sequences in well 203.

[0156] Further approaches to achieve clustering and amplification include exclusion amplification (e.g., as described in WO 2013 / 188582), helicase-dependent amplification (e.g., as described in Vincent et al., EMBO Rep., 2004, 5(8), pp. 795-800), and rolling circle amplification (e.g., as described in Mohsen et al., Acc. Chem. Res., 2016, 49, 11, pp. 2540-2550), the contents of which are incorporated herein by reference.

[0157] The methods for clustering and amplification described above generally involve performing non-selective amplification. However, methods of the invention involving selective processing can include performing selective amplification, which is described in more detail below under selective processing.

[0158] Sequencing As described herein, the template provides information about the original target polynucleotide sequence (e.g., identification of gene sequences, identification of epigenetic modifications). For example, a sequencing process (e.g., a sequencing-by-synthesis or sequencing-by-ligation process) can recreate the information that was present in the original target polynucleotide sequence by using complementary base pairing.

[0159] In one embodiment, sequencing can be performed using any suitable "sequencing-by-synthesis" technique, in which nucleotides are added sequentially in cycles to a free 3' hydroxyl group, resulting in the synthesis of a polynucleotide chain in the 5' to 3' direction. The nature of the added nucleotide can be determined after each addition. One particular sequencing method relies on the use of modified nucleotides that can act as reversible chain terminators. Such reversible chain terminators contain a removable 3' blocking group. When such a modified nucleotide is incorporated into a growing polynucleotide chain complementary to the region of the template being sequenced, no free 3'-OH group is available to guide further sequence extension, and therefore the polymerase cannot add additional nucleotides. Once the nature of the base incorporated into the growing chain is determined, the 3' block can be removed to allow the addition of the next successive nucleotide. By sequencing the products derived using these modified nucleotides, it is possible to deduce the DNA sequence of the DNA template. If each modified nucleotide is attached to a different label known to correspond to a specific base, to facilitate discrimination between the bases added at each incorporation step, such reactions can be performed in a single experiment. Suitable labels are described in PCT Application No. PCT / GB2007 / 001770, the contents of which are incorporated herein by reference in their entirety. Alternatively, separate reactions may be carried out containing each of the individually added modified nucleotides.

[0160] Modified nucleotides may carry a label to facilitate their detection. Such a label may be configured to emit a signal, such as an electromagnetic signal or a (visible) light signal.

[0161] In certain embodiments, the label is a fluorescent label (e.g., a dye). Accordingly, such labels can be configured to emit electromagnetic or (visible) light signals. One method for detecting fluorescently labeled nucleotides involves the use of laser light of a wavelength specific to the labeled nucleotide, or other suitable illumination sources. Fluorescence from the label on the incorporated nucleotide may be detected by a CCD camera or other suitable detection means. Suitable detection means are described in PCT / US2007 / 007991, the contents of which are incorporated herein by reference in their entirety.

[0162] However, the detectable label does not have to be a fluorescent label: any label that allows for detection of incorporation of a nucleotide into a DNA sequence can be used.

[0163] Each cycle can involve the simultaneous delivery of four different nucleotide types to an array of template molecules. Alternatively, different nucleotide types can be added sequentially, with images of the array of template molecules being obtained during each addition step.

[0164] In some embodiments, each nucleotide type can have a (spectrally) distinct label. In other words, four channels can be used to detect four nucleobases (also known as four-channel chemistry) (Figure 6-left). For example, a first nucleotide type (e.g., A) can include a first label (e.g., configured to emit a first wavelength, such as red light), a second nucleotide type (e.g., G) can include a second label (e.g., configured to emit a second wavelength, such as blue light), a third nucleotide type (e.g., T) can include a third label (e.g., configured to emit a third wavelength, such as green light), and a fourth nucleotide type (e.g., C) can include a fourth label (e.g., configured to emit a fourth wavelength, such as yellow light). Four images can then be obtained, each using a detection channel selective for one of the four different labels. For example, a first nucleotide type (e.g., A) may be detected in a first channel (e.g., configured to detect a first wavelength such as red light), a second nucleotide type (e.g., G) may be detected in a second channel (e.g., configured to detect a second wavelength such as blue light), a third nucleotide type (e.g., T) may be detected in a third channel (e.g., configured to detect a third wavelength such as green light), and a fourth nucleotide type (e.g., C) may be detected in a fourth channel (e.g., configured to detect a fourth wavelength such as yellow light). Although specific pairings of bases to signal types (e.g., wavelengths) are described above, different signal types (e.g., wavelengths) and / or permutations may also be used.

[0165] In some embodiments, detection of each nucleotide type may be performed using fewer than four different labels. For example, sequencing by synthesis may be performed using the methods and systems described in U.S. Patent Application Publication No. 2013 / 0079232, which is incorporated herein by reference.

[0166] Thus, in some embodiments, two channels can be used to detect four nucleobases (also known as two-channel chemistry) (Figure 6-center). For example, a first nucleotide type (e.g., A) may contain a first label (e.g., configured to emit a first wavelength, such as green light) and a second label (e.g., configured to emit a second wavelength, such as red light); a second nucleotide type (e.g., G) may contain neither a first label nor a second label; a third nucleotide type (e.g., T) may contain a first label (e.g., configured to emit a first wavelength, such as green light) and a second label; and a fourth nucleotide type (e.g., C) may contain neither a first label nor a second label (e.g., configured to emit a second wavelength, such as red light). Two images can then be obtained using the detection channels for the first and second labels. For example, a first nucleotide type (e.g., A) may be detected in both a first channel (e.g., configured to detect a first wavelength, such as red light) and a second channel (e.g., configured to detect a second wavelength, such as green light); a second nucleotide type (e.g., G) may not be detected in the first channel and may not be detected in the second channel; a third nucleotide type (e.g., T) may be detected in the first channel (e.g., configured to detect a first wavelength, such as red light) and may not be detected in the second channel; and a fourth nucleotide type (e.g., C) may not be detected in the first channel and may be detected in the second channel (e.g., configured to detect a second wavelength, such as green light). Although specific pairings of bases for combinations of signal types (e.g., wavelengths) and / or channels are described above, different signal types (e.g., wavelengths) and / or permutations may also be used.

[0167] In some embodiments, one channel can be used to detect four nucleobases (also known as one-channel chemistry) (Figure 6-right). For example, a first nucleotide type (e.g., A) may include a cleavable label (e.g., configured to emit a wavelength such as green light), a second nucleotide type (e.g., G) may not include a label, a third nucleotide type (e.g., T) may include a non-cleavable label (e.g., configured to emit a wavelength such as green light), and a fourth nucleotide type (e.g., C) may include a label-free label acceptor site. A first image can then be obtained, and subsequent processing is performed to cleave the label attached to the first nucleotide type and attach a label to the label acceptor site on the fourth nucleotide type. A second image can then be obtained. For example, a first nucleotide type (e.g., A) may be detected in a channel in a first image (e.g., configured to detect a wavelength such as green light) and not detected in a channel in a second image; a second nucleotide type (e.g., G) may not be detected in a channel in the first image and not detected in a channel in the second image; a third nucleotide type (e.g., T) may not be detected in a channel in the first image (e.g., configured to detect a wavelength such as green light) and may be detected in a channel in the second image; and a fourth nucleotide type (e.g., C) may not be detected in a channel in the first image and may be detected in a channel in the second image (e.g., configured to detect a wavelength such as green light). Although specific pairings of bases to combinations of signal types (e.g., wavelengths) and / or images are described above, different signal types (e.g., wavelengths), images, and / or permutations may also be used.

[0168] In one embodiment, the sequencing process includes a first sequencing read and a second sequencing read. The first sequencing read and the second sequencing read can be performed simultaneously. In other words, the first sequencing read and the second sequencing read can be performed simultaneously.

[0169] The first sequencing read may include binding of a first sequencing primer (also known as a Read 1 sequencing primer) to a first sequencing primer binding site (e.g., a first end sequencing primer binding site 303 in a template comprising a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion). The second sequencing read may include binding of a second sequencing primer (also known as a Read 2 sequencing primer) to a second sequencing primer binding site (e.g., a second end sequencing primer binding site 304 in a template comprising a first polynucleotide sequence comprising a first portion and a second polynucleotide sequence comprising a second portion).

[0170] This results in sequencing of the first portion (e.g., the forward strand of template 101' in a template comprising a first polynucleotide sequence comprising the first portion and a second polynucleotide sequence comprising the second portion) and the second portion (e.g., the forward complementary strand of template 101 in a template comprising a first polynucleotide sequence comprising the first portion and a second polynucleotide sequence comprising the second portion).

[0171] Alternative methods of sequencing include sequencing by ligation as described, for example, in US Pat. No. 6,306,597 or WO 06 / 084132, the contents of which are incorporated herein by reference.

[0172] The methods for sequencing described above generally involve performing non-selective sequencing. However, methods of the invention involving selective processing can include performing selective sequencing, which is described in more detail below under selective processing.

[0173] In particular, when simultaneous sequencing is performed, the generated signals may be spatially resolved or may not be spatially resolved.When the generated signals are spatially resolved, the signals generated by the first part and the second part can be analyzed by interpreting these signals separately taking into account spatial separation, and non-selective processing methods (such as non-selective amplification and non-selective sequencing) can be used.However, when the signals generated by the first part and the second part are not spatially resolved, other methods may be required to analyze the generated information, and therefore, the non-spatially resolved signals may include selective processing methods (such as selective amplification and / or selective sequencing).

[0174] Selective Processing Methods In some embodiments, a selective processing method may be used to generate signals of different intensities. Thus, in some embodiments, a method may include selectively processing at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion such that a proportion of the first portion can generate a first signal and a proportion of the second portion can generate a second signal, wherein the selective processing causes the intensity of the first signal to be greater than the intensity of the second signal.

[0175] The method can include selectively processing a plurality of first polynucleotide sequences, each comprising a first portion, and a plurality of second polynucleotide sequences, each comprising a second portion, such that a proportion of the first portions can generate a first signal and a proportion of the second portions can generate a second signal, wherein the selective processing causes the intensity of the first signal to be greater than the intensity of the second signal.

[0176] "Selective processing," as used herein, means performing an action that changes the relative properties of the first and second portions in at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion (or a plurality of first polynucleotide sequences, each comprising a first portion, and a plurality of second polynucleotide sequences, each comprising a second portion), such that the intensity of the first signal is greater than the intensity of the second signal. The property may be, for example, the concentration of a first portion capable of generating a first signal relative to the concentration of a second portion capable of generating a second signal. The action may include, for example, performing selective amplification, performing selective sequencing, or preparing for selective sequencing.

[0177] In one embodiment, the selective treatment results in a higher concentration of a first moiety capable of generating a first signal than a second moiety capable of generating a second signal. In other words, the method of the invention results in an altered ratio of R1:R2 molecules within, for example, a single cluster or a single well.

[0178] In one embodiment, the ratio may be from 1.25:1 to 5:1. In a further embodiment, the ratio may be from 1.5:1 to 3:1. In a further embodiment, the ratio may be about 2:1.

[0179] Selective processing can refer to performing selective sequencing. Alternatively, selective processing can refer to preparing for selective sequencing. As shown in Figure 7, in one example, selective sequencing can be achieved using a mixture of unblocked and blocked sequencing primers.

[0180] When the methods of the present invention involve (separate) polynucleotide strands having a first polynucleotide strand having a first portion and a second polynucleotide strand having a second portion, the first polynucleotide strand may comprise a first sequencing primer binding site and the second polynucleotide strand may comprise a second sequencing primer binding site, wherein the first sequencing primer binding site and the second sequencing primer binding site are different sequences from each other and bind to different sequencing primers.

[0181] In one embodiment, binding of a first sequencing primer to a first sequencing primer site generates a first signal, and binding of a second sequencing primer to a second sequencing primer site generates a second signal, where the intensity of the first signal is greater than the intensity of the second signal. This may apply to embodiments in which a first polynucleotide strand contains a first sequencing primer binding site and a second polynucleotide strand contains a second sequencing primer binding site. This is achieved using a mixed population of blocked and unblocked second sequencing primers that bind to the second sequencing primer site. Any ratio of blocked to unblocked second primers that generates a second signal of lower intensity than the first signal can be used; for example, the ratio of blocked to unblocked primers can be 20:80 to 80:20. In further embodiments, the ratio can be 1:2 to 2:1.

[0182] In still further embodiments, a 50:50 ratio of blocked second primer to unblocked second primer is used, which in turn produces a second signal that is about 50% of the intensity of the first signal.

[0183] The first and second sequencing primers can be added to the flow cell simultaneously or separately but sequentially.

[0184] By "blocked" is meant that the sequencing primer comprises a blocking group at the 3' end of the sequencing primer. Suitable blocking groups include a hairpin loop (a polynucleotide attached to the 3' end that comprises, in a 5' to 3' direction, a cleavable site such as uracil, a loop portion, and a nucleotide comprising a complementary portion, where the complementary portion is substantially complementary to all or a portion of the immobilized primer), deoxynucleotides, deoxyribonucleotides, a hydrogen atom in place of the 3'-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g., -O-(CH2)3-OH in place of the 3'-OH group), a nucleotide that blocks the 3'-hydroxyl group, and a nucleotide that blocks the 3'-hydroxyl group. Blocking modifications include, for example, hydroxyl protecting groups such as silyl ether groups (e.g., trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), ether groups (e.g., benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or acyl groups (e.g., acetyl, benzoyl), or inverted nucleobases. However, a blocking group may be any modification that prevents extension (i.e., elongation) of the primer by a polymerase.

[0185] The sequence of the sequencing primer and the sequencing primer binding site are not important to the methods of the present invention, so long as the sequencing primer is capable of binding to the sequencing primer binding site and allowing amplification and sequencing of the identified region.

[0186] In one embodiment, the unblocked second sequencing primer and the blocked second sequencing primer are present in the sequencing composition at equal concentrations. That is, the ratio of blocked second sequencing primer to unblocked second sequencing primer is about 50:50. The sequencing composition may further comprise at least one additional (first) sequencing primer. In one example, the sequencing composition comprises a blocked second sequencing primer, an unblocked second sequencing primer, and at least one first sequencing primer.

[0187] As shown in Figure 7, selective sequencing can be performed on the amplified (duoclonal) cluster (in this case, after an additional round of amplification has been performed on the cluster shown in Figure 5H), as described in more detail below. A plurality of first sequencing primers 501 are added. These sequencing primers 501 anneal to the first terminal sequencing primer binding site 303. A plurality of second unblocked sequencing primers 502a and a plurality of second blocked sequencing primers 502b are added either simultaneously with the first sequencing primer 501 or sequentially (e.g., before or after the addition of the first sequencing primer 501). These second unblocked sequencing primers 502a and second blocked sequencing primers 502b anneal to the second terminal sequencing primer binding site 304. This then allows the forward strand of template 101' (i.e., the "first portion") to be sequenced and the forward complementary strand of template 101 (i.e., the "second portion") to be sequenced, with a greater proportion of the forward strand of template 101' (gray arrow) being sequenced compared to the proportion of the forward complementary strand of template 101 (black arrow).

[0188] In other embodiments, the locations of the first and second sequencing primers may be swapped, i.e., the first sequencing binding primer may instead anneal to the second terminal sequencing primer binding site 304, and the second sequencing binding primer may instead anneal to the first terminal sequencing primer binding site 303.

[0189] Alternatively, or in addition, selective treatment can refer to selective amplification, i.e., selectively amplifying one portion (e.g., the first or second portion) on a first or second polynucleotide strand.

[0190] In one example, the selective treatment comprises selectively removing some or substantially all of the second immobilized primer that has not yet been extended (i.e., extended to form a second polynucleotide strand) and performing at least one additional amplification cycle to selectively amplify the first polynucleotide sequence relative to the second polynucleotide sequence. The immobilized primer that has not yet been extended may be referred to herein as a free or unextended second immobilized primer.

[0191] Thus, in this example, selective removal of some or substantially all of the free second immobilized primers is performed before at least one further bridge amplification and before any sequencing of the target region. As a result, the ratio of the first polynucleotide capable of generating a first signal to the second polynucleotide capable of generating a second signal is changed, which then results in two signals of different intensities, allowing simultaneous sequencing of both sequences (or target regions within those sequences).

[0192] By "partial or substantially all" it is meant that at least 75%, at least 80%, at least 90%, or 95% to 100% of the free second immobilized primers are removed.

[0193] Selective removal of all or substantially all free second immobilized primers can be performed using a reagent capable of cleaving the immobilized primers from the solid support. This reagent can be added after at least 5, at least 10, at least 15, or at least 20-24 rounds of bridge amplification. The reagent can be added separately or together with the amplification reagents to perform at least one additional round of amplification.

[0194] As described above and in further detail in WO 2008 / 041002, the first and second immobilized primers can be attached to the surface of the solid support via a linker. The linker can be different for the first and second immobilized primers. The linker can be any cleavable linker, i.e., the linker can include one or more moieties, such as modified nucleotides, that allow selective cleavage of the immobilized primers from the surface of the solid support. As non-limiting examples, the linker can include uracil bases, phosphorothioate groups, ribonucleotides, diol bonds, disulfide bonds, peptides, etc., which can be included not only to allow covalent attachment to the solid support but also to allow selective cleavage of the linker.

[0195] In one example, the first immobilized primer is attached to the solid support via a first linker, where the linker comprises uracil or 2-deoxyuridine. In this example, the free first immobilized primer (i.e., the unextended primer) can be removed using uracil glycosylase. In one embodiment, the free first immobilized primer can be removed using the USER Enzyme Mix (a cocktail of uracil glycosylase and endonuclease VIII).

[0196] In one example, the sequence of the first immobilized primer comprises a variant of the following sequence or a fragment thereof: 5'-PS-TTTTTTTTTTAATGATACGGCGACCACCGAUCTACAC-3', where U=2-deoxyuridine (SEQ ID NO: 11).

[0197] In another example, the second immobilized primer is attached to the solid support via a second linker, where the linker comprises 8-oxoguanine. In this example, the free second immobilized primer (i.e., the unextended primer) can be removed using FPG glycosylase.

[0198] In one example, the sequence of the second immobilized primer comprises a variant of the following sequence or a fragment thereof: 5'-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGA[G オキソ ]AT-3' (where [G オキソ ]=8-oxoguanine (SEQ ID NO: 12).

[0199] One example of this method is shown schematically in Figure 8. Selective amplification can be performed on the amplified (duoclonal) clusters, as shown in Figure 5H. Solid support 200 comprises a free first immobilized primer 201 and a free second immobilized primer 202. Free second immobilized primer 202 is cleaved from solid support 200, thus leaving free first immobilized primer 201 (Figure 8A).

[0200] A first primer binding sequence 301' (e.g., P5') on one set of template strands can then anneal to a free first immobilized primer 201 (e.g., P5 lawn primer) located in well 203. In contrast, because the free second immobilized primer 202 (e.g., P7 lawn primer) has been removed, a second primer binding sequence 302' (e.g., P7') cannot anneal (Figure 8B).

[0201] After cycles of bridge amplification, this results in selective amplification of the template strand containing the forward strand of template 101' and the first terminal sequencing primer binding site 303 compared to the template strand containing the forward complementary strand of template 101 and the second terminal sequencing primer binding site 304 (Figure 8C).

[0202] Standard (non-selective) sequencing is then performed, allowing the forward strand of template 101' (i.e., the "first portion") to be sequenced and the forward complementary strand of template 101 (i.e., the "second portion") to be sequenced, resulting in a greater proportion of the forward strand of template 101' (gray arrow) being sequenced compared to the proportion of the forward complementary strand of template 101 (black arrow) (Figure 8D).

[0203] In another example, the selective treatment involves selectively blocking extension of some or substantially all of the second immobilized primers that have not yet been extended (i.e., extended to form a second polynucleotide strand). Again, these primers may be referred to herein as free or unextended second immobilized primers. The method may include using a primer blocking agent configured to limit or prevent synthesis of an extending strand (i.e., a polynucleotide strand) from the second immobilized primer. The method may further include performing at least one additional amplification cycle. Because the free second immobilized primers are blocked from extension by the primer blocking agent, only the first immobilized primer can be extended. This results in amplification of only the first polynucleotide strand (i.e., not the second polynucleotide strand), resulting in an increased amount of the first polynucleotide sequence compared to the second polynucleotide sequence.

[0204] By "partial or substantially all" it is meant that at least 75%, at least 80%, at least 90%, or 95% to 100% of the free second immobilized primers are blocked.

[0205] The primer blocking agent can be flowed across the solid support after bridge amplification, hi one embodiment, the primer blocking agent is flowed across the solid support after at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cycles, at least 15, at least 20, or at least 25 cycles of bridge amplification.

[0206] In one embodiment, the primer blocking agent is added while the first polynucleotide sequence hybridizes to the second immobilized primer. That is, the primer blocking agent is added at least during amplification and subsequent extension of the first polynucleotide strand. During this step, the extended first polynucleotide strand bends (crosslinks) and hybridizes at its 5' end to the second immobilized primer. Addition of the primer blocking agent at this step typically prevents extension of the second immobilized primer using the first polynucleotide strand as its template.

[0207] In one embodiment, the primer blocking agent is a blocked nucleotide. In one example, the blocked nucleotide can be A, C, T, or G, but can be selected from A or G.

[0208] Again, "blocked" means that the sequencing primer contains a blocking group at the 3' end of the sequencing primer. Suitable blocking groups include a hairpin loop (e.g., a 3'-terminally attached polynucleotide comprising, in a 5' to 3' direction, a cleavable site such as uracil, a loop portion, and a nucleotide comprising a complementary portion, wherein the complementary portion is substantially complementary to all or a portion of an immobilized primer), a deoxynucleotide, a deoxyribonucleotide, a hydrogen atom in place of the 3'-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g., -O-(CH2)3-OH in place of the 3'-OH group), a modification that blocks the 3'-hydroxyl group (e.g., a hydroxyl protecting group such as a silyl ether group (e.g., trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), an ether group (e.g., benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or an acyl group (e.g., acetyl, benzoyl)), or an inverted nucleobase. However, a blocking group may be any modification that prevents extension (i.e., elongation) of a primer by a polymerase. Blocking may be reversible or irreversible.

[0209] The blocked nucleotides can be added as part of a mixture containing both blocked and unblocked nucleotides. Alternatively, the blocked nucleotides can be added separately to the flow cell, either before or after the unblocked nucleotides are added. Following the addition of the blocked nucleotides, at least one more round of bridge amplification is performed.

[0210] An example of this method is shown in Figure 9. Selective amplification can be performed on the amplified (duoclonal) clusters, as shown in Figure 5H. A first primer binding sequence 301' (e.g., P5') on one set of template strands can anneal to a first immobilized primer 201 (e.g., P5 lone primer), and a second primer binding sequence 302' (e.g., P7') on another set of template strands can anneal to a second immobilized primer 202 (e.g., P7 lone primer) (Figure 9A).

[0211] While the second primer binding sequence 302' (e.g., P7') is annealed to the second immobilized primer 202, the primer blocking agent 601 is selectively introduced onto the 3' end of the second immobilized primer 202, but not onto the 3' end of the first immobilized primer 201 (Figure 9B).

[0212] Performing cycles of bridge amplification results in selective amplification of the forward strand of template 101' and the template strand containing the first terminal sequencing primer binding site 303 compared to the forward complementary strand of template 101 and the template strand containing the second terminal sequencing primer binding site 304. Primer blocking agent 601 prevents extension from the second immobilized primer 202. (Figure 9C).

[0213] Standard (non-selective) sequencing is then performed, allowing the forward strand of template 101' (i.e., the "first portion") to be sequenced and the forward complementary strand of template 101 (i.e., the "second portion") to be sequenced, resulting in a greater proportion of the forward strand of template 101' (gray arrow) being sequenced compared to the proportion of the forward complementary strand of template 101 (black arrow) (Figure 9D).

[0214] In an alternative embodiment, the method includes: (a) flowing at least one or more extended primer sequences across the surface of a solid support (e.g., a flow cell), where such sequences are capable of binding (e.g., hybridizing) to a free, immobilized primer (e.g., P5 or P7) and further comprise at least one 5' additional nucleotide; and (b) adding a primer blocking agent, where the primer blocking agent is complementary to the 5' additional nucleotide.

[0215] The extended primer sequence may be substantially complementary to the first or second immobilized primer (e.g., P5 or P7), or may be substantially complementary to a portion of the first or second immobilized primer.

[0216] The 5' additional nucleotide may be selected from A, T, C, or G, but may also be selected from T (or U) or C. In one embodiment, the 5' additional nucleotide is not the complement of the 3' nucleotide of the second immobilized primer (if the extended primer sequence binds to the first immobilized primer) or is not the complement of the 3' nucleotide of the first immobilized primer (if the extended primer sequence binds to the second immobilized primer). For example, if the first immobilized primer is P5 (e.g., as defined by SEQ ID NO: 1 or 5) and the second immobilized primer is P7 (e.g., as defined by SEQ ID NO: 2), and the extended primer sequence binds to the first immobilized primer, the 5' additional nucleotide is not A. Similarly, if the extended primer sequence binds to the second immobilized primer, the 5' additional nucleotide is not G.

[0217] In one embodiment, the primer blocking agent is a blocked nucleotide, e.g., as described above. In one embodiment, the blocked nucleotide may be A, C, T, or G, but may also be selected from A or G. Thus, if the 5' additional nucleotide is T or U, the primer blocking agent is A, and if the 5' additional nucleotide is C, the primer blocking agent is G.

[0218] Again, the extended primer sequence and primer blocking agent can be flowed across the solid support after bridge amplification, hi one embodiment, the primer blocking agent can be flowed across the solid support after at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, or at least 25 rounds of bridge amplification.

[0219] In one embodiment, the extension primer sequence is selected from SEQ ID NOs: 13-24 or a variant or fragment thereof.

[0220] An example of this method is shown in Figure 10. Selective amplification can be performed on the amplified (duoclonal) clusters, as shown in Figure 5H. After several rounds of amplification, a cluster is formed that contains both the extended first (e.g., P5) and second (e.g., P7) immobilized polynucleotide strands. Prior to the next round of amplification, one (or more) extended primer sequences are washed across the surface of the solid support 200. The extended primer sequence 701 is substantially complementary to at least a portion, if not all, of the immobilized primer (e.g., either P5 or P7), as shown in Figure 10A, and binds to the immobilized primer (e.g., P5 or P7). Also shown in Figure 10A, the extended primer sequence 701 includes at least one additional 5' nucleotide.

[0221] Following the addition of extended primer sequence 701, a primer blocking agent 601 is added and flowed across the surface of a solid support (e.g., a flow cell). Because the primer blocking agent 601 is complementary to the 5' additional nucleotides of extended primer sequence 701, the primer blocking agent 601 binds to the 3' end of the immobilized strand that hybridizes to extended primer sequence 701, as shown in Figure 10B. As a result, the addition of primer blocking agent 601 not only prevents extension of the immobilized strand (e.g., P5 or P7), but also makes the immobilized primer (P5 or P7) unavailable for hybridization and subsequent bridge amplification for the other extended strand (e.g., 101') (see Figure 10B).

[0222] Performing at least one more cycle of bridge amplification results in selective amplification of template strands, including the forward strand of template 101' (2:1 ratio of 101' to 101). Again, similar to Figure 9D, performing standard (non-selective) sequencing allows the forward strand of template 101' (i.e., the "first portion") to be sequenced and the forward complementary strand of template 101 (i.e., the "second portion") to be sequenced, resulting in a greater proportion of the forward strand of template 101' (gray arrow) being sequenced compared to the proportion of the forward complementary strand of template 101 (black arrow) (Figure 9D).

[0223] The extension primer sequence can be added as part of the amplification mixture described above. Alternatively, the blocked immobilized primer binding sequence can be added separately to the flow cell, or before the amplification mixture is added. Following the addition of the blocked immobilized primer binding sequence, at least one more round of bridge amplification is performed.

[0224] Data Analysis Using 16 QAM FIG. 11 is a scatter plot showing 16 example distributions of signals generated by the polynucleotide sequences disclosed herein.

[0225] The scatter plot in FIG. 11 shows 16 distributions (or bins) of intensity values ​​from a composite of a brighter signal (i.e., a first signal described herein) and a dimmer signal (i.e., a second signal described herein), where the two signals may be co-localized or may not be optically resolved as described above. The intensity values ​​shown in FIG. 11 may be up to a scale or normalization factor, and the units of the intensity values ​​may be arbitrary or relative (i.e., representing the ratio of the actual intensity to a reference intensity). The sum of the brighter signal generated by the first portion and the dimmer signal generated by the second portion results in a composite signal. The composite signal may be captured by a first optical channel and a second optical channel. Because the brighter signal can be A, T, C, or G, and the dimmer signal can be A, T, C, or G, there are 16 possibilities for the composite signal, corresponding to 16 distinct patterns when optically captured. That is, each of the 16 possibilities corresponds to a bin shown in FIG. 11. The computer system can map the generated composite signal into one of 16 bins and thus determine the additional nucleobases in the first portion and the additional nucleobases in the second portion, respectively.

[0226] For example, if a composite signal is mapped to bin 1612 for a base-calling cycle, the computer processor base calls both the additional nucleobase in the first portion and the additional nucleobase in the second portion as C. If a composite signal is mapped to bin 1614 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as C and the additional nucleobase in the second portion as T. If a composite signal is mapped to bin 1616 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as C and the additional nucleobase in the second portion as G. If a composite signal is mapped to bin 1618 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as C and the additional nucleobase in the second portion as A.

[0227] If the composite signal is mapped to bin 1622 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as T and the additional nucleobase in the second portion as C. If the composite signal is mapped to bin 1624 for a base-calling cycle, the processor base calls both the additional nucleobase in the first portion and the additional nucleobase in the second portion as T. If the composite signal is mapped to bin 1626 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as T and the additional nucleobase in the second portion as G. If the composite signal is mapped to bin 1628 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as T and the additional nucleobase in the second portion as A.

[0228] If the composite signal is mapped to bin 1632 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as G and the additional nucleobase in the second portion as C. If the composite signal is mapped to bin 1634 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as G and the additional nucleobase in the second portion as T. If the composite signal is mapped to bin 1636 for a base-calling cycle, the processor base calls both the additional nucleobase in the first portion and the additional nucleobase in the second portion as G. If the composite signal is mapped to bin 1638 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as G and the additional nucleobase in the second portion as A.

[0229] If the composite signal is mapped to bin 1642 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as A and the additional nucleobase in the second portion as C. If the composite signal is mapped to bin 1644 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as A and the additional nucleobase in the second portion as T. If the composite signal is mapped to bin 1646 for a base-calling cycle, the processor base calls the additional nucleobase in the first portion as A and the additional nucleobase in the second portion as G. If the composite signal is mapped to bin 1648 for a base-calling cycle, the processor base calls both the additional nucleobase in the first portion and the additional nucleobase in the second portion as A.

[0230] In this particular example, T is configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, A is configured to emit a signal only in the IMAGE 1 channel, C is configured to emit a signal only in the IMAGE 2 channel, and G emits no signal in either channel. However, the same effect can be achieved by performing a dye swap using a different permutation of the nucleobases. For example, A may be configured to emit a signal in both the IMAGE 1 channel and the IMAGE 2 channel, T may be configured to emit a signal only in the IMAGE 1 channel, C may be configured to emit a signal only in the IMAGE 2 channel, and G may be configured to emit no signal in either channel.

[0231] Further details regarding performing base calling based on a scatterplot with 16 bins can be found in U.S. Patent Application Publication No. 2019 / 0212294, the disclosure of which is incorporated herein by reference.

[0232] 12 is a flow diagram illustrating a method 1700 of base calling according to the present disclosure. The described method allows for simultaneous sequencing of two (or more) portions (e.g., a first portion and a second portion) in a single sequencing run from a single composite signal obtained from the first portion and the second portion, thus requiring less sequencing reagent consumption and faster generation of data from both the first portion and the second portion. Furthermore, the simplified method may reduce the number of workflow steps while producing the same yield compared to existing next-generation sequencing methods. Thus, the simplified method may result in reduced sequencing runtime.

[0233] 12, the disclosed method 1700 may begin at block 1701. The method may then move to block 1710.

[0234] In block 1710, intensity data is acquired. The intensity data includes first intensity data and second intensity data. The first intensity data includes a combined intensity of a first signal component obtained based on each first nucleobase in the first portion and a second signal component obtained based on each second nucleobase in the second portion. Similarly, the second intensity data includes a combined intensity of a third signal component obtained based on each first nucleobase in the first portion and a fourth signal component obtained based on each second nucleobase in the second portion.

[0235] Thus, the first portion can generate a first signal comprising a first signal component and a third signal component, and the second portion can generate a second signal comprising a second signal component and a fourth signal component.

[0236] As described above, the first and second portions may be arranged on the solid support such that the signals from the first and second portions are detected by a single sensing moiety, and / or may comprise a single cluster such that the first and second signals from each respective first and second portion cannot be spatially resolved.

[0237] In one example, acquiring intensity data includes selecting intensity data corresponding to two (or more) distinct portions (e.g., a first portion and a second portion). In one example, the intensity data is selected based on a chastity score. The chastity score may be calculated as the brightest base intensity divided by the sum of the brightest base intensity and the second brightest base intensity. The desired chastity score may vary depending on the expected intensity ratio of the light emissions associated with the distinct portions. As described above, it may be desirable to generate a cluster including a first portion and a second portion that produce signals in a 2:1 ratio. In one example, high-quality data corresponding to two portions having a 2:1 intensity ratio may have a chastity score of approximately 0.8-0.9.

[0238] After the intensity data is obtained, the method may proceed to block 1720. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents a possible combination of a respective first nucleobase and second nucleobase. In one example, the plurality of classifications includes 16 classifications as shown in FIG. 11, each representing a unique combination of the first and second nucleobases. When two moieties are present, there are 16 possible combinations of the first and second nucleobases. Selecting a classification based on the first and second intensity data includes selecting a classification based on a combined intensity of the first and second signal components and a combined intensity of the third and fourth signal components.

[0239] The method may then proceed to block 1730, where each of the first and second nucleobases is base-called based on the classification selected in block 1720. A signal generated during the sequencing cycle indicates the identity of the additional nucleobase during sequencing (e.g., using sequencing by synthesis). It will be understood that there is a direct correspondence between the identity of the incorporated nucleobase and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Thus, any reference herein to base-calling of each nucleobase in the two portions encompasses base-calling of the nucleobase hybridized to the template sequence, and alternatively or additionally, identification of the corresponding nucleobase in the template sequence. The method may then end at block 1740.

[0240] Deformable Polymer According to one embodiment of the present invention, a plurality of first immobilized primers; a plurality of second immobilized primers; a plurality of first immobilized primers and a plurality of second immobilized primers occupy a first set of locations on the deformable polymer; A deformable polymer is described, wherein the deformable polymer is configured such that, when the deformable polymer is exposed to a deformation trigger, a plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0241] In one embodiment, the second immobilized primer differs in sequence from the first immobilized primer.

[0242] According to one embodiment, the subject composition comprises: a deformable polymer; a plurality of first immobilized primers; a plurality of second immobilized primers; a plurality of first immobilized primers and a plurality of second immobilized primers occupy a first set of locations on the deformable polymer; The deformable polymer is configured such that, when the composition is exposed to a deformation trigger, the plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0243] In some embodiments, the composition may include a plurality of immobilized primers. In some embodiments, the plurality of primers may be bound to a deformable polymer. In some embodiments, the composition may include a deformable polymer operably bound to a plurality of immobilized primers. In some embodiments, the immobilized entity may be immobilized on a deformable polymer. In some embodiments, the composition may be in contact with a solution containing a free solution polymer. In some embodiments, the composition may be in chemical equilibrium with the free primer in solution in contact with the immobilized primer. In some embodiments, the immobilized primer may be covalently bound to a deformable polymer in the composition.

[0244] When the template and template-complementary strands are generated, they tend to form self-hybridizing structures (e.g., when bridge amplification is performed, the template and template-complementary strands form a double-stranded bridge structure). In a typical sequencing process, one group of strands is cleaved and washed away (e.g., all of the template strands or all of the template-complementary strands), thus leaving single-stranded portions available for sequencing. However, in the sequencing method according to the present invention (e.g., when it is desired to sequence both the template and the template-complementary strands, i.e., simultaneously sequence the template forward strand and the template forward-complementary strand, or the template forward strand and the template reverse strand), self-hybridization can interfere with the sequencing process due to the lack of single-stranded portions.

[0245] Advantageously, the ability of the deformable polymer to shift the first immobilized primer and the second immobilized primer located at a first set of positions to a second set of positions different from the first set of positions allows the template and the template-complementary strand (once extended from the first immobilized primer and the second immobilized primer) to separate from each other. This allows the template and the template-complementary strand to become single-stranded upon exposure to a deformation trigger and thus become available for priming and sequencing. Thus, the forward strand and the forward-complementary strand of the template (or the forward strand and the reverse strand of the template) can be sequenced without the problem of self-hybridization.

[0246] The first set of positions may correspond to the spatial locations of the 5' ends of the first and second immobilized primers on the deformable polymer (e.g., the attachment points of the first and second immobilized primers to the deformable polymer), and similarly, the second set of positions may correspond to the spatial locations of the 5' ends of the first and second immobilized primers on the deformable polymer (e.g., the attachment points of the first and second immobilized primers to the deformable polymer), which are different from the first set of positions. Alternatively, the first set of positions may correspond to the spatial locations of the 3' ends of the first and second immobilized primers on the deformable polymer, and similarly, the second set of positions may correspond to the spatial locations of the 3' ends of the first and second immobilized primers on the deformable polymer, which are different from the first set of positions. Alternatively, the first set of positions may correspond to the spatial positions of the central portion of the first immobilized primer and the central portion of the second immobilized primer on the deformable polymer, and similarly, the second set of positions may correspond to the spatial positions of the central portion of the first immobilized primer and the central portion of the second immobilized primer on the deformable polymer, where these spatial positions are different from the first set of positions.

[0247] Provided that the second set of positions is different from the first set of positions, the type of shift is not particularly limited. For example, the shift can include expanding the deformable polymer or contracting the deformable polymer, and / or shuffling the first immobilized primer and the second immobilized primer.

[0248] In one embodiment, the deformation trigger can cause a volumetric expansion of the deformable polymer. In other words, the deformable polymer can be expandable. The volumetric expansion can be at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% increase in volume.

[0249] In further embodiments, the expansion may be at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% increase in volume. In still further embodiments, the expansion may be at least a 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% increase in volume. In still further embodiments, the expansion may be at least a 100%, 110%, 120%, 130%, 140%, or 150% increase in volume. Generally, the greater the expansion, the less likely the template and template-complementary strand will remain hybridized to one another.

[0250] In some embodiments, the upper limit of the volume expansion of the deformable polymer may be up to a 2000%, 1500%, 1000%, 950%, 900%, 850%, 800%, 750%, 700%, 650%, 600%, 550%, 500%, 450%, 400%, 350%, or 300% increase in volume.

[0251] In further embodiments, the expansion may be at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% increase in volume, up to a 2000% increase in volume. In still further embodiments, the expansion may be at least a 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% increase in volume, up to a 800% increase in volume. In still further embodiments, the expansion may be at least a 100%, 110%, 120%, 130%, 140%, or 150% increase in volume, up to a 400% increase in volume.

[0252] In one embodiment, the deformation trigger can cause a volumetric contraction of the deformable polymer. In other words, the deformable polymer can be contractile. The volumetric contraction can be a volume reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150%.

[0253] In further embodiments, shrinkage can be at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% volume reduction. In still further embodiments, shrinkage can be at least a 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% volume reduction. In still further embodiments, shrinkage can be at least a 100%, 110%, 120%, 130%, 140%, or 150% volume reduction. Generally, the greater the shrinkage, the less likely the template and template complement strands will remain hybridized to one another.

[0254] In some embodiments, the upper limit of the volumetric shrinkage of the deformable polymer may be up to a 2000%, 1500%, 1000%, 950%, 900%, 850%, 800%, 750%, 700%, 650%, 600%, 550%, 500%, 450%, 400%, 350%, or 300% volume reduction.

[0255] In further embodiments, shrinkage may be at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% volume reduction, up to a 2000% volume reduction. In still further embodiments, shrinkage may be at least a 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, or 150% volume reduction, up to an 800% volume reduction. In still further embodiments, shrinkage may be at least a 100%, 110%, 120%, 130%, 140%, or 150% volume reduction, up to a 400% volume reduction.

[0256] In one embodiment, the deformation trigger can cause shuffling of the first immobilized primer and the second immobilized primer. In other words, shuffling can refer to where the first immobilized primer and the second immobilized primer undergo spatial rearrangement (e.g., random spatial rearrangement). This can occur in embodiments where the deformable polymer is expandable, in embodiments where the deformable polymer is contractible, or in embodiments where the deformable polymer having the first immobilized primer and the second immobilized primer at the second set of positions has a similar volume to the deformable polymer having the first immobilized primer and the second immobilized primer at the first set of positions.

[0257] In one embodiment, when a deformable polymer having a first immobilized primer and a second immobilized primer at a second set of locations has a similar volume to a deformable polymer having a first immobilized primer and a second immobilized primer at a first set of locations, shuffling may involve a 20% volume decrease to a 20% volume increase of the deformable polymer. In a further embodiment, shuffling may involve a 10% volume decrease to a 10% volume increase of the deformable polymer. In yet a further embodiment, shuffling may involve a 5% volume decrease to a 5% volume increase of the deformable polymer.

[0258] Shuffling can be caused by expanding the deformable polymer and then contracting the deformable polymer, or by contracting the deformable polymer and then expanding the deformable polymer, in which case after expansion and contraction, or contraction and expansion, the first immobilized primer and the second immobilized primer can be located in different positions compared to before expansion and contraction, or contraction and expansion.

[0259] The type of deformation trigger is not particularly limited and may include or be, for example, a physical trigger and / or a (bio)chemical trigger.

[0260] In one embodiment, the physical trigger may include a temperature change of the deformable polymer. For example, the physical trigger may include heating or cooling the deformable polymer. Suitable thermoresponsive polymers are known to those skilled in the art and can be utilized as the deformable polymer once primers are immobilized on the deformable polymer (i.e., to form a plurality of first and second immobilized primers).

[0261] In some embodiments, the deformable polymer may have an upper critical solution temperature and / or a lower critical solution temperature.

[0262] For example, the physical trigger may include heating the deformable polymer from below the upper critical solution temperature to above the upper critical solution temperature. In other embodiments, the physical trigger may include heating the deformable polymer from below the lower critical solution temperature to above the lower critical solution temperature.

[0263] In other embodiments, the physical trigger may include cooling the deformable polymer from above the upper critical solution temperature to below the upper critical solution temperature. In other embodiments, the physical trigger may include cooling the deformable polymer from above the lower critical solution temperature to below the lower critical solution temperature.

[0264] In one embodiment, the physical trigger may include cooling the deformable polymer from a temperature of 50°C to 100°C (in a further embodiment, a temperature of 55°C to 95°C, and in yet a further embodiment, a temperature of 60°C to 90°C) to a temperature of 10°C to 40°C (in a further embodiment, a temperature of 15°C to 35°C, and in yet a further embodiment, a temperature of 20°C to 30°C). In another embodiment, the physical trigger may include heating the deformable polymer from a temperature of 10°C to 40°C (in a further embodiment, a temperature of 15°C to 35°C, and in yet a further embodiment, a temperature of 20°C to 30°C) to a temperature of 50°C to 100°C (in a further embodiment, a temperature of 55°C to 95°C, and in yet a further embodiment, a temperature of 60°C to 90°C).

[0265] In one embodiment, the (bio)chemical trigger may comprise a change in salt concentration. Suitable polymers that are responsive to salt concentration are known to those skilled in the art and may be utilized as the deformable polymer once the primers are immobilized on the deformable polymer (i.e., to form a plurality of first and second immobilized primers).

[0266] For example, the (bio)chemical trigger may include exposure to a solution comprising a salt concentration of greater than 10 mM, greater than 20 mM, greater than 50 mM, greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM. In some embodiments, the salt may be sodium chloride. Thus, the (bio)chemical trigger may include exposure to a solution comprising a sodium chloride concentration of greater than 10 mM, greater than 20 mM, greater than 50 mM, greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM.

[0267] In some embodiments, the upper limit of the salt concentration can be up to 1000 mM, 900 mM, 800 mM, 700 mM, or 600 mM. The upper limit of the sodium chloride concentration can be up to 1000 mM, 900 mM, 800 mM, 700 mM, or 600 mM.

[0268] In further embodiments, the salt concentration may be greater than 10 mM, greater than 20 mM, greater than 50 mM, greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 1000 mM. In still further embodiments, the salt concentration may be greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 800 mM. In still further embodiments, the salt concentration may be greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 600 mM.

[0269] In further embodiments, the sodium chloride concentration may be greater than 10 mM, greater than 20 mM, greater than 50 mM, greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 1000 mM. In still further embodiments, the sodium chloride concentration may be greater than 100 mM, greater than 150 mM, greater than 200 mM, greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 800 mM. In still further embodiments, the sodium chloride concentration may be greater than 250 mM, greater than 300 mM, greater than 350 mM, greater than 400 mM, greater than 450 mM, or greater than 500 mM, up to 600 mM.

[0270] In one embodiment, the (bio)chemical trigger may comprise a change in pH. Suitable polymers that are responsive to pH are known to those skilled in the art and may be utilized as the deformable polymer once the primers are immobilized on the deformable polymer (i.e., to form a plurality of first and second immobilized primers).

[0271] In some embodiments, the deformable polymer may comprise a polyelectrolyte or may be a copolymer comprising a polyelectrolyte. In further embodiments, the polyelectrolyte may be an anionic polyelectrolyte, a cationic polyelectrolyte, or an amphiphilic polyelectrolyte.

[0272] For example, the (bio)chemical trigger may include exposure to an acidic pH. In one embodiment, the (bio)chemical trigger may include exposure to a pH below 7, a pH below 6.5, a pH below 6, a pH below 5.5, a pH below 5, a pH below 4.5, a pH below 4, a pH below 3.5, or a pH below 3. In a further embodiment, the (bio)chemical trigger may include exposure to a pH between 2 and 7, a pH between 2.5 and 6.5, or a pH between 3 and 6. In another example, the (bio)chemical trigger may include exposure to an alkaline pH. In one embodiment, the (bio)chemical trigger may include exposure to a pH greater than 7, a pH greater than 7.5, a pH greater than 8, a pH greater than 8.5, a pH greater than 9, a pH greater than 9.5, a pH greater than 10, a pH greater than 10.5, or a pH greater than 11. In a further embodiment, the (bio)chemical trigger may include exposure to a pH between 9 and 14, a pH between 9.5 and 13.5, or a pH between 10 and 13.

[0273] Non-limiting examples of suitable deformable polymers include poly(N-isopropylacrylamide) (PNiPAm), poly(N-isopropylmethacrylamide) (PNiPMAm), poly(acrylic acid) (PAAc), poly(methacrylic acid), poly(4-vinylpyridine), and / or poly(vinylamine). Thus, in some embodiments, the deformable polymer may comprise poly(N-isopropylacrylamide) (PNiPAm), poly(N-isopropylmethacrylamide) (PNiPMAm), poly(acrylic acid) (PAAc), poly(methacrylic acid), poly(4-vinylpyridine), and / or poly(vinylamine), or may be a copolymer comprising poly(N-isopropylacrylamide) (PNiPAm), poly(N-isopropylmethacrylamide) (PNiPMAm), poly(acrylic acid) (PAAc), poly(methacrylic acid), poly(4-vinylpyridine), and / or poly(vinylamine).

[0274] In one embodiment, the first immobilized primer and / or the second immobilized primer can be covalently bonded to the deformable polymer. In further embodiments, the covalent bond can include a cycloadduct, an alkenylene bond, an ester, an amide, an acetal, a hemiaminal ether, an aminal, an imine, a hydrazone, a sulfide bond, a boron-based bond, a silicon-based bond, or a phosphorus-based bond. In yet further embodiments, the cycloadduct can include a 1,2,3-triazole bond.

[0275] In one embodiment, the deformable polymer may be comprised of a plurality of particles. In a further embodiment, the particles may be nanoparticles.

[0276] For example, the nanoparticles may have an (average) particle size of about 50 nm to about 500 nm. In further embodiments, the nanoparticles may have an (average) particle size of about 200 nm to about 400 nm. (Average) particle size may refer to particle size measured at room temperature (25°C). Particle size analysis may be performed, such as by light scattering, to obtain an associated particle size distribution or Z-average.

[0277] In one embodiment, the deformable polymer may include a hydrogel.

[0278] In one embodiment, the deformable polymer may be a copolymer comprising a polymer responsive to a deformable trigger and a polymer that has formed a covalent bond with each of the first immobilized primers and each of the second immobilized primers. In a further embodiment, the deformable polymer may be a copolymer comprising a polymer responsive to a deformable trigger and a polymer that has formed a cycloadduct with each of the first immobilized primers and each of the second immobilized primers. In yet a further embodiment, the deformable polymer may be a copolymer comprising a polymer responsive to a deformable trigger and a polymer that has formed a 1,2,3-triazole bond with each of the first immobilized primers and each of the second immobilized primers.

[0279] In one embodiment, the deformable polymer may be formed from an acrylamide-based monomer.

[0280] In one embodiment, the deformable polymer may be a copolymer including a polymer formed from an acrylamide-based monomer, a polymer responsive to a deformable trigger, and a polymer that forms a covalent bond with each of the first immobilized primers and each of the second immobilized primers. In a further embodiment, the deformable polymer may be a copolymer including a polymer formed from an acrylamide-based monomer, a polymer responsive to a deformable trigger, and a polymer that forms a cycloadduct with each of the first immobilized primers and each of the second immobilized primers. In yet a further embodiment, the deformable polymer may be a copolymer including a polymer formed from an acrylamide-based monomer, a polymer responsive to a deformable trigger, and a polymer that forms a 1,2,3-triazole bond with each of the first immobilized primers and each of the second immobilized primers.

[0281] The deformable polymers described herein are useful as surfaces or coatings on solid supports, particularly solid supports utilized in nucleic acid sequencing.

[0282] Thus, in another aspect of the present invention, there is provided a solid support comprising a deformable polymer as described herein.

[0283] In one embodiment, the solid support may be a flow cell.

[0284] As mentioned above, the deformable polymers and / or solid supports described herein are useful in nucleic acid sequencing, particularly simultaneous sequencing.

[0285] Thus, in another aspect of the present invention there is provided the use of a deformable polymer as described herein, or a solid support as described herein, in nucleic acid sequencing.

[0286] In another aspect of the invention, there is provided a process for making a deformable polymer, comprising the steps of: (a) immobilizing a plurality of first precursor primers on a deformable polymer to form a plurality of first immobilized primers; (b) immobilizing a plurality of second precursor primers on the deformable polymer to form a plurality of second immobilized primers; A process is provided in which the deformable polymer is configured such that when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions.

[0287] In one embodiment, the second precursor primer differs in sequence from the first precursor primer.

[0288] The deformable polymer produced may be a deformable polymer as described herein, and therefore, aspects relating to deformable polymers and other properties of deformable polymers described herein apply equally to the processes described herein for producing deformable polymers.

[0289] The term "first precursor primer" refers to the state of the first immobilized primer on the solid support before it is immobilized on the solid support. Thus, the first precursor primer may be provided as a "free" primer in solution. After immobilization, the "first precursor primer" is referred to as the "first immobilized primer."

[0290] The term "second precursor primer" refers to the state of the second immobilized primer on the solid support before it is immobilized on the solid support. Thus, the second precursor primer may be provided as a "free" primer in solution. After immobilization, the "second precursor primer" is referred to as a "second immobilized primer."

[0291] Steps (a) and (b) can be carried out sequentially or simultaneously.

[0292] For example, in one embodiment, when steps (a) and (b) are performed sequentially, step (b) may be performed after step (a). Alternatively, step (a) may be performed after step (b).

[0293] In one embodiment, steps (a) and (b) may be performed simultaneously.

[0294] The immobilization method is not particularly limited, so long as the first immobilized primer and the second immobilized primer remain on the solid support during amplification, clustering, and sequencing.

[0295] In one embodiment, immobilizing can include forming covalent bonds between the solid support and each of the plurality of first precursor primers and between the solid support and each of the plurality of second precursor primers. In a further embodiment, forming covalent bonds includes using a click reaction (e.g., a metal-catalyzed azide-alkyne cycloaddition reaction, such as copper-catalyzed azide-alkyne cycloaddition and strain-promoted azide-alkyne cycloaddition).

[0296] In particular, forming a covalent bond can include forming a 1,2,3-triazole bond. The solid support prior to immobilization can include an azide moiety (e.g., PAZAM), while the first and second precursor primers can each include an alkyne moiety (e.g., terminal alkyne, cycloalkyne). A click reaction between the azide moiety on the solid support and the alkyne moiety on the first and second precursor primers allows the 1,2,3-triazole bond to be formed. The composition of the azide and alkyne moieties can also be interchanged, for example, by including an alkyne moiety on the solid support prior to immobilization and an azide moiety in each of the first and second precursor primers.

[0297] The deformable polymers described herein can be useful in methods for preparing polynucleotide sequences for identification.

[0298] Thus, in another aspect of the invention there is provided a method of preparing a polynucleotide sequence for identification, comprising the steps of: (a) providing a deformable polymer as described herein; (b) synthesizing at least one first polynucleotide sequence, each comprising a first portion, each extended from a first immobilized primer, and at least one second polynucleotide sequence, each comprising a second portion, each extended from a second immobilized primer, wherein the second polynucleotide sequences are substantially complementary to the first polynucleotide sequences.

[0299] As used herein, "identification" refers to obtaining genetic information from a polynucleotide strand. This may include identifying the genetic sequence of a polynucleotide strand (i.e., sequencing). Furthermore, this may alternatively or additionally include identifying mismatched base pairs. Furthermore, this may alternatively or additionally include identifying any epigenetic modifications, such as methylation. Thus, "identification" may refer to identifying the genetic sequence of a polynucleotide strand, mismatched base pairs, and / or identifying any epigenetic modifications.

[0300] In one embodiment, step (b) may comprise synthesizing a plurality of first polynucleotide sequences, each comprising a first portion and each extending from a first immobilized primer, and a plurality of second polynucleotide sequences, each comprising a second portion and each extending from a second immobilized primer. Thus, in one embodiment, there is provided a method of preparing polynucleotide sequences for identification, comprising: (a) providing a deformable polymer as described herein; (b) synthesizing a plurality of first polynucleotide sequences, each comprising a first portion and each extended from a first immobilized primer, and a plurality of second polynucleotide sequences, each comprising a second portion and each extended from a second immobilized primer, wherein the second polynucleotide sequences are substantially complementary to the first polynucleotide sequences.

[0301] The present invention can be applied to (separate) polynucleotide strands, where the first strand comprises a first portion to be identified and the second strand comprises a second portion to be identified.

[0302] The (separate) polynucleotide strands may comprise a first strand comprising a first portion that may (or may be) the forward strand of the polynucleotide sequence (e.g., the forward strand of the template), and a second strand comprising a second portion that may (or may be) the reverse strand of the polynucleotide sequence (e.g., the reverse strand of the template) or the forward complement of the polynucleotide sequence (e.g., the forward complement of the template). As a further alternative, the (separate) polynucleotide strands may comprise a first strand comprising a first portion that may (or may be) the reverse strand of the polynucleotide sequence (e.g., the reverse strand of the template), and a second strand comprising a second portion that may (or may be) the forward strand of the polynucleotide sequence (e.g., the forward strand of the template) or the reverse complement of the polynucleotide sequence (e.g., the reverse complement of the template).

[0303] Because the forward strand and the reverse strand (or the forward strand and the forward complementary strand, or the reverse strand and the reverse complementary strand) are substantially complementary to each other, they tend to self-hybridize. When a deformable polymer is used, the deformable polymer is configured such that, when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and the second immobilized primers shift to a second set of positions on the deformable polymer that is different from the first set of positions, and the deformable primers are ready to separate these self-hybridized structures as soon as the deformable polymer is exposed to the deformation trigger. This therefore allows these strands to become single-stranded and available for priming and sequencing.

[0304] The first portion may be referred to herein as Read 1 (R1), and the second portion may be referred to herein as Read 2 (R2).

[0305] In one embodiment, the first portion is at least 25 base pairs or at least 50 base pairs and the second portion is at least 25 base pairs or at least 50 base pairs.

[0306] The deformable polymer can be provided on a solid support (e.g., on the surface of a solid support). In a further embodiment, the solid support can be a flow cell. In a further embodiment, each of the first strand and the second strand is located in a single well of the solid support.

[0307] The polynucleotide strands may form or be part of a cluster on a solid support.

[0308] As used herein, the term "cluster" can refer to a group of (substantially) clones of template polynucleotides (e.g., DNA or RNA) bound within a single well of a solid support (e.g., a flow cell). Thus, a cluster can refer to a population of polynucleotide molecules within a well that are then sequenced. A "cluster" can contain a sufficient number of copies of the template polynucleotide so that the cluster can output a signal (e.g., an optical signal) that allows sequencing reads to be performed on the cluster. A "cluster" can contain, for example, about 500 to about 2000 copies, about 600 to about 1800 copies, about 700 to about 1600 copies, about 800 to about 1400 copies, about 900 to about 1200 copies, or about 1000 copies of the template polynucleotide.

[0309] The clusters can be formed by bridge amplification, as described above.

[0310] The clusters formed may be duoclonal clusters.

[0311] A "duoclonal" cluster refers to a population of polynucleotide sequences that are subsequently sequenced (as a next step) that are essentially of two types (e.g., a first sequence and a second sequence). Thus, a "duoclonal" cluster can refer to a population of a single first sequence and a single second sequence in a well that are subsequently sequenced. A "duoclonal" cluster may contain a sufficient number of copies of a single first sequence and a single second sequence such that the cluster can output a signal (e.g., an optical signal) that allows sequencing reads to be performed on a "monoclonal" cluster. A "duoclonal" cluster can contain, for example, about 500 to about 2000 combined copies, about 600 to about 1800 combined copies, about 700 to about 1600 combined copies, about 800 to about 1400 combined copies, about 900 to about 1200 combined copies, or about 1000 combined copies of a single first sequence and a single second sequence. Copies of a single first sequence and a single second sequence may together comprise at least about 50%, at least about 60%, at least about 70%, even at least about 80%, at least about 90%, or even about 95%, 98%, 99% or 100% of all polynucleotides within a single well of a flow cell, thus providing a substantially duoclonal "cluster."

[0312] The method may further include preparing the first portion and the second portion for simultaneous sequencing.

[0313] For example, the method can include simultaneously contacting a first sequencing primer binding site located after the 3' end of the first portion with a first primer and a second sequencing primer binding site located after the 3' end of the second portion with a second primer, thus primed for simultaneous sequencing of the first and second portions.

[0314] In some embodiments, the method may include processing at least one first polynucleotide sequence comprising a first portion and at least one second polynucleotide sequence comprising a second portion such that a proportion of the first portion is capable of generating a first signal and a proportion of the second portion is capable of generating a second signal.

[0315] In some embodiments, the first signal and the second signal may be spatially resolved. In other embodiments, the first signal and the second signal may not be spatially resolved.

[0316] In some embodiments (e.g., when spatially resolvable signals are used), a percentage of the first portion can generate a first signal and a percentage of the second portion can generate a second signal, and the intensity of the first signal is substantially the same as the intensity of the second signal.

[0317] In other embodiments (e.g., when selective processing methods are used as described herein), a percentage of the first portion may be capable of generating a first signal and a percentage of the second portion may be capable of generating a second signal, and the selective processing causes the intensity of the first signal to be greater than the intensity of the second signal. The first and second signals may not be spatially resolved (e.g., generated from the same or substantially overlapping regions).

[0318] Further aspects relating to selective processing methods (e.g., performing selective amplification, performing selective sequencing, or preparing for selective sequencing) have been previously described herein and apply to the methods of preparing polynucleotide sequences for identification described herein.

[0319] In one embodiment, the method comprises: (c) exposing the deformable polymer to a deformation trigger.

[0320] Step (c) of exposing the deformable polymer to a deformation trigger may be performed after step (b) of synthesizing at least one first polynucleotide sequence, each comprising a first portion and each extending from a first immobilized primer, and at least one second polynucleotide sequence, each comprising a second portion and each extending from a second immobilized primer.

[0321] By actuating the deformable primer upon exposure to a deformation trigger, this shifts the first and second immobilized primers from a first set of positions to a second set of positions, thus also physically moving the first and second polynucleotide sequences and separating any self-hybridized structures.

[0322] As mentioned above, the type of shift is not particularly limited, provided that the second set of positions is different from the first set of positions.

[0323] In one embodiment, the deformation trigger may cause the expansion of a deformable polymer.

[0324] In another embodiment, the deformation trigger may cause the contraction of a deformable polymer.

[0325] In other embodiments, the deformation trigger may cause the deformable polymer to expand and then contract, or the deformable polymer to contract and then expand. For example, the deformation trigger may include two or more changes in reaction conditions, such as heating and then cooling, cooling and then heating, exposure to high salt concentration and then low salt concentration, exposure to lower pH and then higher pH, or exposure to higher pH and then lower pH. Different types of deformation triggers, such as changes in temperature, salt concentration, and pH, may also be combined.

[0326] Inducing extension and then contraction (or contraction and then extension) in this manner can cause shuffling of the first immobilized primer and the second immobilized primer, as described above.

[0327] Suitable types of deformation triggers (e.g., physical and / or (bio)chemical triggers such as a change in temperature, a change in salt concentration, or a change in pH) are described herein in relation to deformable polymers and apply equally to the types of deformation triggers that may be used in the methods of preparing polynucleotide sequences for identification described herein.

[0328] Sequencing methods Also described herein is a method for sequencing a polynucleotide sequence, comprising preparing a polynucleotide sequence for identification using a method described herein and sequencing the nucleobases in the first portion and the second portion.

[0329] In one embodiment, the step of sequencing the nucleobases in the first portion and the second portion may comprise simultaneous sequencing of the nucleobases in the first portion and the second portion.

[0330] In one embodiment, sequencing may be performed by sequencing by synthesis or sequencing by ligation.

[0331] In one embodiment, the method may further comprise performing paired-end reading.

[0332] In some embodiments, the data may be analyzed using 16 QAM as referred to herein.

[0333] Thus, the step of simultaneously sequencing the nucleic acid bases comprises: (a) acquiring first intensity data including a combined intensity of a first signal component acquired based on each first nucleobase in a first portion and a second signal component acquired based on each second nucleobase in a second portion, wherein the first and second signal components are acquired simultaneously; (b) acquiring second intensity data including a combined intensity of a third signal component acquired based on each first nucleic acid base in the first portion and a fourth signal component acquired based on each second nucleic acid base in the second portion, wherein the third and fourth signal components are acquired simultaneously; (c) selecting one of a plurality of classifications based on the first and second intensity data, each classification representing a possible combination of a respective first and second nucleobase; (d) base-calling each of the first and second nucleobases based on the selected classification.

[0334] In one embodiment, selecting a classification based on the first and second intensity data may include selecting a classification based on a combined intensity of the first and second signal components and a combined intensity of the third and fourth signal components.

[0335] In one embodiment, the plurality of classes may include 16 classes, each class representing one of 16 unique combinations of first and second nucleobases.

[0336] In one embodiment, the first signal component, the second signal component, the third signal component and the fourth signal component can be generated based on luminescence associated with each nucleobase.

[0337] In one embodiment, the luminescence may be detected by a sensor, the sensor configured to provide a single output based on the first and second signals.

[0338] In one embodiment, the sensor may comprise a single sensing element.

[0339] In one embodiment, the method may further include repeating steps (a)-(d) for each of a plurality of base-calling cycles.

[0340] kit The methods described herein may be physically performed by a user, in other words, a user may perform the methods of preparing polynucleotide sequences for identification described herein themselves, and therefore, the methods described herein may not need to be performed on a computer.

[0341] According to another aspect of the present invention, there is provided a kit comprising a deformable polymer as described herein, or a solid support as described herein.

[0342] In another aspect of the invention, kits are provided that include instructions for preparing polynucleotide sequences for identification according to the methods described herein and / or for sequencing polynucleotide sequences according to the methods described herein.

[0343] Computer programs and products In other embodiments, the methods described herein can be implemented by a computer, i.e., a computer can contain instructions for performing the methods of preparing polynucleotide sequences for identification described herein, and thus the methods described herein can be implemented on a computer.

[0344] Thus, in another aspect of the present invention there is provided a data processing device comprising means for performing the methods described herein.

[0345] The data processing device may be a polynucleotide sequencer.

[0346] The data processing device may include reagents used in the methods described herein.

[0347] The data processing device may include a solid support as described herein, such as a flow cell.

[0348] In another aspect of the present invention, there is provided a computer program product comprising instructions which, when executed by a processor, cause the processor to carry out the methods described herein.

[0349] In another aspect of the present invention, a computer-readable storage medium is provided that includes instructions that, when executed by a processor, cause the processor to perform the methods described herein.

[0350] In another aspect of the present invention, there is provided a computer readable data carrier having stored thereon a computer program product as described herein.

[0351] In another aspect of the present invention, there is provided a data carrier signal carrying a computer program product as described herein.

[0352] The various illustrative imaging or data processing techniques described in connection with the embodiments disclosed herein can be implemented as electronic hardware, computer software, or a combination of both. To illustrate this interchangeability of hardware and software, various illustrative components, blocks, modules, and steps have been described above generally in terms of their functionality. Whether such functionality is implemented as hardware or software depends on the particular application and design constraints imposed on the overall system. The described functionality may be implemented in various ways for each particular application, and such implementation decisions should not be interpreted as causing a departure from the scope of the present disclosure.

[0353] The various exemplary detection systems described in connection with the embodiments disclosed herein may be implemented or performed by a mechanical apparatus such as a processor configured with specific instructions, a digital signal processor (DSP), an application specific integrated circuit (ASIC), a field programmable gate array (FPGA), or other programmable logic device, discrete gate or transistor logic, discrete hardware components, or any combination thereof designed to perform the functions described herein. The processor may be a microprocessor, but alternatively, the processor may be a controller, microcontroller, or state machine, combinations thereof, etc. A processor may also be implemented as a combination of computing devices, e.g., a DSP and a microprocessor, multiple microprocessors, one or more microprocessors in association with a DSP core, or any other such configuration. For example, the systems described herein may be implemented using discrete memory chips, a portion of memory within a microprocessor, flash, EPROM, or other types of memory.

[0354] Elements of a method, process, or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware, in a software module executed by a processor, or in a combination of the two. The software module may reside in RAM memory, flash memory, ROM memory, EPROM memory, EEPROM memory, registers, a hard disk, a removable disk, a CD-ROM, or any other form of computer-readable storage medium known in the art. An exemplary storage medium may be coupled to the processor such that the processor can read information from, and write information to, the storage medium. Alternatively, the storage medium may be integral to the processor. The processor and the storage medium may reside in an ASIC. The software module may include computer-executable instructions that cause a hardware processor to execute the computer-executable instructions.

[0355] The computer-executable instructions may be stored in a computer-readable storage medium (e.g., memory, storage system, etc.) that stores code or computer-readable instructions (either transient or non-transient).

[0356] Additional Notes The embodiments described herein are exemplary. Modifications, rearrangements, alternative processes, etc. may be made to these embodiments and still fall within the teachings described herein. One or more of the steps, processes, or methods described herein may be performed by one or more suitably programmed processing and / or digital devices.

[0357] In particular, conditional language used herein, such as "can," "might," "may," "for example," and the like, is intended to generally convey that certain embodiments include certain features, elements, and / or conditions, while other embodiments do not include certain features, elements, and / or conditions, unless otherwise specified or understood differently within the context in which it is used. Thus, such conditional language generally does not imply that features, elements, and / or conditions are required in any manner for one or more embodiments, or that one or more embodiments necessarily include logic for determining, with or without author input or prompting, whether these features, elements, and / or conditions are included or performed in any particular embodiment. Terms such as "comprise," "including," "having," and "involving" are synonymous and used in an inclusive, open-ended manner and do not exclude additional elements, features, acts, operations, etc. Also, the term "or," when used to connect a list of elements, is used in its inclusive sense (rather than its exclusive sense), so that the term "or" refers to one, some, or all of the elements in the list. The term "comprising" can be considered to encompass "consisting of."

[0358] Disjunctive language, such as the phrase "at least one of X, Y, or Z," is understood differently in contexts where it is generally used to indicate that an item, term, etc. can be either X, Y, or Z, or any combination thereof (e.g., X, Y, and / or Z), unless specifically stated otherwise. Thus, such disjunctive language is generally not intended to, and should not, imply that a particular embodiment requires that at least one of X, at least one of Y, or at least one of Z, respectively, be present.

[0359] Terms such as "about" or "approximately" are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, which may be ±20%, ±15%, ±10%, ±5%, or ±1%. The term "substantially" is used to indicate that a result (e.g., a measurement) is close to a target value, where close may mean, for example, that the result is within 80% of the value, within 90% of the value, within 95% of the value, or within 99% of the value. The term "partially" is used to indicate that an effect is only partial or to a limited extent.

[0360] Unless otherwise specified, articles such as "a" or "an" should generally be construed to include one or more listed items. Thus, phrases such as "a device configured to" or "a device for" are intended to include one or more listed devices. Such one or more listed devices may also be collectively configured to perform the described detailed descriptions. For example, "a processor configured to perform detailed descriptions A, B, and C" may include a first processor to perform operations in conjunction with a second processor configured to perform detailed description A and to perform operations in conjunction with a second processor configured to perform detailed descriptions B and C.

[0361] While the foregoing detailed description has illustrated, described, and pointed out novel features applied to the exemplary embodiments, it will be understood that various omissions, substitutions, and changes in the form and details of the devices or algorithms shown may be made without departing from the spirit of the present disclosure. It will be recognized that certain embodiments described herein may be embodied in forms that do not provide all of the features and advantages described herein, since some features may be used or practiced separately from others. All changes that come within the meaning and range of equivalency of the claims are intended to be embraced within their scope.

[0362] It is to be understood that all combinations of the foregoing concepts (provided such concepts are not mutually inconsistent) are intended to be part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated to be part of the inventive subject matter disclosed herein.

[0363] The invention will now be illustrated by the following non-limiting examples. [Example]

[0364] Example 1: Investigating the effect of different extensions on the ability of the forward and reverse strands to self-hybridize Polymers typically behave as randomly coiled spaghetti balls, the dimensions of which are determined by the persistence length of the molecule. Some simple estimates of the work of extending a polymer by a new extension distance can be made. See the calculations in the table below. The work of extension can be used to estimate the likelihood that a DNA molecule will spontaneously extend to that distance and bind to its complementary strand. As can be seen in the table below, the likelihood decreases significantly with extension.

[0365] [Table 2]

[0366] At low tension, ssDNA behaves roughly like a hook spring described by:

[0367]

number

[0368] For a system in equilibrium in the canonical ensemble, the probability that the system is in a state with energy E is e -ΔE / kT is proportional to.

[0369] Example 2: Synthesis of P5 / P7-grafted nanogels Synthesis of azide-containing polymer particles. The particles were synthesized using suspension polymerization in aqueous media. Sodium dodecyl sulfate (SDS) was used as the anionic surfactant. In a typical procedure, a monomer mixture consisting of N-isopropylacrylamide, acrylic acid, N-(5-(2-azidoacetamido)pentyl)acrylamide, and N,N'-methylenebisacrylamide was added to deionized water in a reaction flask, followed by the addition of SDS. The mixture was degassed under nitrogen at 70°C, followed by the addition of a free radical initiator (ammonium persulfate). The reaction was carried out at 70°C under nitrogen. At the end of the reaction, the mixture was exposed to air and quenched in an ice bath. The particles were purified using dialysis against deionized water with a 14,000 Da molecular weight cut-off (MWCO) membrane.

[0370] Synthesis of P5 / P7-grafted nanogels. P5 / P7 primers were grafted onto particles using a strain-promoted azide-alkyne cycloaddition reaction between (1R,8S,9S)-bicyclo[6.1.0]nonyne (BCN) and azide (N3). P5 / P7 containing BCN end groups was added to a solution of nanogel particles. The reaction was carried out at room temperature for 18 hours. The particles were purified using dialysis against deionized water with a 14,000 Da molecular weight cutoff (MWCO) membrane.

[0371] Further examples are described in US Pat. No. 63 / 407,852, the contents of which are incorporated herein by reference.

[0372] Sequence Listing Sequence number 1P5 AATGATACGGCGACCACCGAGATCTACAC SEQ ID NO: 2: P7 sequence CAAGCAGAAGACGGCATACGAGAT SEQ ID NO: 3: P5' sequence (complementary to P5) GTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO: 4: P7' sequence (complementary to P7) ATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 5: Alternative P5 sequence AATGATACGGCGACCGA SEQ ID NO: 6: Alternative P5' sequence (complementary to alternative P5 sequence) TCGGTCGCCGTATCATT SEQ ID NO: 7: SBS3 ACACTCTTTCCCTACACGACGCTCTTCCGATCT SEQ ID NO: 8: SBS3' AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT SEQ ID NO: 9: SBS12 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT SEQ ID NO: 10: SBS12' AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC SEQ ID NO: 11: Removable P5 sequence TTTTTTTTTTAATGATACGGCGACCACCGAUCTACAC (wherein U=2-deoxyuridine) SEQ ID NO: 12: Removable P7 sequence TTTTTTTTTTCAAGCAGAAGACGGCATACGA[G オキソ ]AT (In the formula, [G オキソ ]=8-oxoguanine) SEQ ID NO: 13: Extension primer sequence with A as the 5' additional nucleotide and P5' sequence (complementary to P5) AGTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO: 14: Extension primer sequence with T as the 5' additional nucleotide and P5' sequence (complementary to P5) TGTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO: 15: Extension primer sequence with C as the 5' additional nucleotide and P5' sequence (complementary to P5) CGTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO: 16: Extension primer sequence with G as the 5' additional nucleotide and P5' sequence (complementary to P5) GGTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO: 17: Extension primer sequence with A as the 5' additional nucleotide and P7' sequence (complementary to P7) AATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 18: Extension primer sequence with T as the 5' additional nucleotide and P7' sequence (complementary to P7) TATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 19: Extension primer sequence with C as the 5' additional nucleotide and P7' sequence (complementary to P7) CATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 20: Extension primer sequence with G as the 5' additional nucleotide and P7' sequence (complementary to P7) GATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 21: Extension primer sequence with A as the 5' additional nucleotide and alternative P5' sequence (complementary to alternative P5) ATCGGTCGCCGTATCATT SEQ ID NO: 22: Extension primer sequence with T as the 5' additional nucleotide and alternative P5' sequence (complementary to alternative P5) TTCGGTCGCCGTATCATT SEQ ID NO: 23: Extension primer sequence with C as the 5' additional nucleotide and alternative P5' sequence (complementary to alternative P5) CTCGGTCGCCGTATCATT SEQ ID NO: 24: Extension primer sequence with G as the 5' additional nucleotide and alternative P5' sequence (complementary to alternative P5) GTCGGTCGCCGTATCATT

Claims

1. A deformable polymer, a plurality of first immobilized primers; a plurality of second immobilized primers; the plurality of first immobilized primers and the plurality of second immobilized primers occupy a first set of locations on the deformable polymer; The deformable polymer is configured such that when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and the second immobilized primer shift to a second set of positions on the deformable polymer that is different from the first set of positions.

2. The deformable polymer of claim 1 , wherein a deformation trigger causes a volumetric expansion of the deformable polymer.

3. The deformable polymer of claim 2 , wherein the expansion is at least a 20% volume increase, at least a 50% volume increase, or at least a 100% volume increase.

4. The deformable polymer of claim 1 , wherein the deformation trigger causes a volumetric contraction of the deformable polymer.

5. 5. The deformable polymer of claim 4, wherein the shrinkage is at least a 20% volume reduction, at least a 50% volume reduction, or at least a 100% volume reduction.

6. The deformable polymer of any one of claims 1 to 5, wherein the deformation trigger causes shuffling of the first immobilized primer and the second immobilized primer.

7. 7. The deformable polymer of claim 6, wherein the shuffling involves a 20% volume decrease to a 20% volume increase of the deformable polymer, a 10% volume decrease to a 10% volume increase of the deformable polymer, or a 5% volume decrease to a 5% volume increase of the deformable polymer.

8. The deformable polymer according to any one of claims 1 to 7, wherein the deformation trigger is a physical trigger and / or a (bio)chemical trigger.

9. 9. The deformable polymer of claim 8, wherein the physical trigger comprises a change in temperature of the deformable polymer, the (bio)chemical trigger comprises a change in salt concentration, or the (bio)chemical trigger comprises a change in pH.

10. The deformable polymer according to any one of claims 1 to 9, wherein the first immobilized primer and / or the second immobilized primer is covalently attached to the deformable polymer.

11. 11. The deformable polymer of claim 10, wherein the covalent bond comprises a cycloadduct, an alkenylene bond, an ester, an amide, an acetal, a hemiaminal ether, an aminal, an imine, a hydrazone, a sulfide bond, a boron-based bond, a silicon-based bond, or a phosphorus-based bond.

12. The deformable polymer of claim 11, wherein the cycloadduct comprises a 1,2,3-triazole linkage.

13. A deformable polymer according to any one of claims 1 to 12, wherein the deformable polymer is composed of a plurality of particles.

14. A solid support comprising a deformable polymer according to any one of claims 1 to 13.

15. A kit comprising a deformable polymer according to any one of claims 1 to 13 or a solid support according to claim 14.

16. 1. A process for producing a deformable polymer, comprising: (a) immobilizing a plurality of first precursor primers on a deformable polymer to form a plurality of first immobilized primers; (b) immobilizing a plurality of second precursor primers on the deformable polymer to form a plurality of second immobilized primers; the deformable polymer is configured such that, when the deformable polymer is exposed to a deformation trigger, the plurality of first immobilized primers and the second immobilized primer shift to a second set of positions on the deformable polymer that is different from the first set of positions.

17. 17. The process of claim 16, wherein steps (a) and (b) are performed sequentially or simultaneously.

18. 18. The process of claim 16 or 17, wherein step (b) occurs after step (a), step (a) occurs after step (b), or steps (a) and (b) occur simultaneously.

19. 19. The process of any one of claims 16 to 18, wherein immobilizing comprises forming a covalent bond between a solid support and each of the plurality of first precursor primers, and between the solid support and each of the plurality of second precursor primers.

20. 20. The process of claim 19, wherein forming the covalent bond comprises using a click reaction.

21. 21. The process of claim 19 or 20, wherein forming a covalent bond comprises forming a 1,2,3-triazole bond.

22. 1. A method for preparing a polynucleotide sequence for identification, comprising: (a) providing a deformable polymer according to any one of claims 1 to 13; (b) synthesizing at least one first polynucleotide sequence, each comprising a first portion and each extended from said first immobilized primer, and at least one second polynucleotide sequence, each comprising a second portion and each extended from said second immobilized primer, wherein the second polynucleotide sequence is substantially complementary to the first polynucleotide sequence.

23. The method comprises:

23. The method of claim 22, further comprising the step of: (c) exposing the deformable polymer to the deformation trigger.

24. 24. The method of claim 22 or 23, wherein the deformation trigger causes the deformable polymer to expand, the deformation trigger causes the deformable polymer to contract, the deformation trigger causes the deformable polymer to expand and then contract, or the deformable polymer to contract and then expand.

25. The method according to any one of claims 22 to 24, wherein the deformation trigger is a physical trigger and / or a (bio)chemical trigger.

26. 26. The method of claim 25, wherein the physical trigger comprises a change in temperature of the deformable polymer, the (bio)chemical trigger comprises a change in salt concentration, or the (bio)chemical trigger comprises a change in pH.

27. The method of any one of claims 22 to 26, wherein the method further comprises preparing the first portion and the second portion for simultaneous sequencing.

28. 28. The method of any one of claims 22 to 27, wherein the method comprises simultaneously contacting a first sequencing primer binding site located after the 3' end of the first portion with a first primer and a second sequencing primer binding site located after the 3' end of the second portion with a second primer.

29. 29. The method of any one of claims 22 to 28, wherein the method further comprises processing at least one first polynucleotide sequence comprising said first portion and at least one second polynucleotide sequence comprising said second portion such that a proportion of said first portions are capable of generating a first signal and a proportion of said second portions are capable of generating a second signal.

30. 30. The method of claim 29, wherein the processing comprises selective processing that causes the intensity of the first signal to be greater than the intensity of the second signal.

31. 31. The method of claim 30, wherein the concentration of the first moiety capable of producing the first signal is greater than the concentration of the second moiety capable of producing the second signal.

32. 32. The method of claim 31 , wherein the ratio of the concentration of the first moiety capable of producing the first signal to the concentration of the second moiety capable of producing the second signal is between 1.25:1 and 5:1, wherein the ratio is between 1.5:1 and 3:1, or wherein the ratio is about 2:

1.

33. The method of any one of claims 30 to 32, wherein the selective treatment comprises preparing for selective sequencing or performing selective sequencing.

34. The method according to any one of claims 30 to 32, wherein the selective treatment comprises selective amplification.

35. 34. The method of any one of claims 30 to 33, wherein the selective treatment comprises contacting a first sequencing primer binding site located after the 3' end of the first portion with a first primer, and contacting a second sequencing primer binding site located after the 3' end of the second portion with a second primer, the second primer comprising a mixture of blocked and unblocked second primers.

36. 36. The method of claim 35, wherein the blocked second primer comprises a blocking group at the 3' end of the blocked second primer.

37. 35. The method of any one of claims 30-32 or 34, wherein the selective treatment comprises selectively removing some or substantially all of the second immobilized primer that has not yet been extended, and performing additional amplification cycles to selectively amplify the first polynucleotide sequence relative to the second polynucleotide sequence.

38. 35. The method of any one of claims 30-32 or 34, wherein the selective treatment comprises selectively blocking some or substantially all of the second immobilized primer that has not yet been extended using a primer blocking agent configured to limit or prevent synthesis of an extending strand from the second immobilized primer, and performing further amplification cycles to selectively amplify the first polynucleotide sequence relative to the second polynucleotide sequence.

39. 39. The method of claim 38, wherein the primer blocking agent is added while the first polynucleotide sequence hybridizes to the second immobilized primer.

40. 39. The method of claim 38, wherein the method comprises contacting a portion or substantially all of the second immobilized primer with an extended primer sequence, the extended primer sequence being substantially complementary to the second immobilized primer and further comprising a 5' additional nucleotide, and adding the primer blocking agent, the primer blocking agent being complementary to the 5' additional nucleotide.

41. 41. The method of any one of claims 38 to 40, wherein the primer blocking agent is a blocked nucleotide.

42. 42. The method of claim 41, wherein the blocked nucleotide comprises a blocking group at the 3' end of the blocked nucleotide.

43. 43. The method of claim 41 or 42, wherein the blocked nucleotide is A or G.

44. 44. The method of any one of claims 22 to 43, wherein the first signal and the second signal are spatially resolved or the first signal and the second signal are not spatially resolved.

45. 1. A method for sequencing a polynucleotide sequence, comprising: Preparing a polynucleotide sequence for identification using the method of any one of claims 22 to 44; and sequencing the nucleobases in said first portion and said second portion.

46. 46. ​​The method of Claim 45, wherein sequencing the nucleobases in said first portion and said second portion comprises simultaneous sequencing of the nucleobases in said first portion and said second portion.

47. 47. The method of claim 45 or 46, wherein the step of sequencing the nucleobases comprises performing sequencing by synthesis or sequencing by ligation.

48. A kit comprising instructions for preparing a polynucleotide sequence for identification according to any one of claims 22 to 44 and / or for sequencing a polynucleotide sequence according to any one of claims 45 to 47.

49. A data processing device comprising means for carrying out the method of any one of claims 22 to 47.

50. A computer program product comprising instructions which, when executed by a processor, cause the processor to carry out the method of any one of claims 22 to 47.

51. A computer readable storage medium comprising instructions which, when executed by a processor, cause the processor to perform the method of any one of claims 22 to 47.

52. 51. A computer readable data carrier having stored thereon a computer program product according to claim 50.

53. 51. A data carrier signal carrying a computer program product according to claim 50.

Images