Integration and Selection System

The system addresses the inefficiency of generating stable producer cell lines by using site-specific recombination and split inteins to ensure precise integration of therapeutic proteins, thereby reducing time and cost through reduced clone screening.

JP2025531410APending Publication Date: 2025-09-19ANTIBODY ANALYTICS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025517440
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-21
Filing Date
2023-09-20
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

The process of generating stable producer cell lines for therapeutic proteins is time-consuming and expensive due to the need for extensive screening of large numbers of clones.

Method used

A system comprising a landing pad nucleic acid, a delivery nucleic acid, and an integration enzyme that utilizes site-specific recombination and split inteins to facilitate rapid and cost-effective generation of stable producer cell lines by ensuring integration of the gene of interest only at the correct location, thereby reducing the number of clones that need to be screened.

Benefits of technology

The system significantly reduces the time and cost associated with generating stable producer cell lines by ensuring precise integration of the gene of interest, minimizing the number of clones that require screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025531410000028
    Figure 2025531410000028
  • Figure 2025531410000029
    Figure 2025531410000029
  • Figure 2025531410000030
    Figure 2025531410000030
Patent Text Reader

Abstract

The present invention relates to a system comprising a landing pad, a delivery nucleic acid and an integration enzyme that allows for the selection of a specific gene of interest. The invention further relates to cells comprising the system, methods for providing a gene of interest and selecting cells containing the gene of interest, landing pad nucleic acids, delivery nucleic acids and kits for providing and selecting cells containing the gene of interest.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a system comprising a landing pad, a delivery nucleic acid and an integration enzyme that allows for the selection of a specific gene of interest. The invention further relates to cells comprising the system, methods for providing a gene of interest and selecting cells containing the gene of interest, landing pad nucleic acids, delivery nucleic acids and kits for providing and selecting cells containing the gene of interest. [Background technology]

[0002] Many of the current and emerging therapeutic agents are therapeutic proteins, such as monoclonal antibodies, peptides, and recombinant proteins. The production of such therapeutic proteins is particularly challenging because they require complex post-translational modifications in order to be functional. To ensure that the proper post-translational modifications are created during production, mammalian cells are often used for the production of such proteins. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Xu Z., Thomas L., Davies B. et al., BMC Biotechnol 13, p. 87 (2013), https: / / doi.org / 10.1186 / 1472-6750-13-87 [Non-patent document 2] Altschul et al. (1990) J.Mol.Biol.215:403~10 [Non-patent document 3] Tatusova and Madden 1999, FEMS Microbiol Lett 174:247-250 [Non-patent document 4] Smith and Waterman (1981) Adv. Appl. Math. 2:482 [Non-patent document 5] Needleman and Wunsch (1970) J. Mol. Biol. 48:443 [Non-patent document 6] Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444 [Non-Patent Document 7] Higgins and Sharp (1988) Gene 73:237-44 [Non-patent document 8] Higgins and Sharp (1989) CABIOS 5:151-3 [Non-Patent Document 9] Corpet et al. (1988) Nucleic Acids Res. 16:10881~90 [Non-Patent Document 10] Huang et al. (1992) Comp. Appl. Biosci. 8: 155-65. [Non-Patent Document 11] Pearson et al. (1994) Methods Mol.Biol.24:307~31 [Non-Patent Document 12] Tatiana et al. (1999) FEMS Microbiol.Lett.174:247~50 Summary of the Invention [Problem to be solved by the invention]

[0004] To facilitate the continuous production of therapeutic proteins, stable producer cell lines are commonly generated. However, the process of generating stable producer cell lines is time-consuming and expensive because it requires screening of large numbers of clones. Thus, there is a need for a system for generating stable producer cell lines in a rapid and cost-effective manner, for example, by reducing the number of clones that need to be screened. [Means for solving the problem]

[0005] In a first aspect of the present invention, - a landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a first split intein, and a split selectable marker in combination; - a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. A system is provided that includes:

[0006] In some embodiments, the first split intein and split selectable marker combination comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein. In some embodiments, the second split intein and split selectable marker combination comprises, in a 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker. In some embodiments, the first split intein and split selectable marker combination comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein, and the second split intein and split selectable marker combination comprises, in a 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker. In some embodiments, the system comprises: - a landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting machinery, an N-terminal portion of a split selectable marker, and an N-terminal portion of a split intein; - a delivery nucleic acid comprising, in a 5' to 3' direction, a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker, a second transcriptional or translational splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. Includes:

[0007] In some embodiments, the first split intein and split selectable marker combination comprises, in a 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker. In some embodiments, the second split intein and split selectable marker combination comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein. In some preferred embodiments, when the first split intein and split selectable marker combination comprises, in a 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker, the second split intein and split selectable marker combination comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein. In some preferred embodiments, the system comprises: - a landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting machinery, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker; - a delivery nucleic acid comprising, in the 5' to 3' direction, an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. Includes:

[0008] In some embodiments, the C-terminal portion of a split intein and the N-terminal portion of a split intein are configured to recombine the C-terminal portion of a split selectable marker and the N-terminal portion of a split selectable marker into a functional selectable marker.

[0009] The landing pad nucleic acid can be for integration into the genome of a cell. The landing pad nucleic acid can be configured for integration into the genome of a cell. When the landing pad nucleic acid is integrated into the genome of a cell, a landing pad cell line is generated. The landing pad cell line can be used as a platform for subsequent integration of delivered nucleic acids. For example, one landing pad cell line can be used for subsequent integration of different delivered nucleic acids containing different genes of interest (e.g., a population of cells derived from the landing pad cell line can be used for integration of a delivered nucleic acid containing a first gene of interest, and another population of cells derived from the landing pad cell line can be used for integration of a different delivered nucleic acid containing a second gene of interest). The system according to the present invention can be used to generate landing pad cell lines.

[0010] The system according to the present invention can be used to generate cell lines that express a gene of interest. The delivery nucleic acid can be for integration of the gene of interest into a landing pad nucleic acid. The delivery nucleic acid can be configured for integration of the gene of interest into the landing pad nucleic acid. In some embodiments, integration of the landing pad nucleic acid into the genome of interest and subsequent integration of the delivery nucleic acid into the landing pad nucleic acid results in reconstitution of the selectable marker after translation of multiple portions of the split selectable marker. One of the advantages of the system herein is that in the absence of subsequent integration of the delivery nucleic acid into the landing pad nucleic acid, only the C-terminal portion of the split selectable marker (as shown in FIG. 1A) or only the N-terminal portion of the split selectable marker (as shown in FIG. 4A) would be present in the cell, and therefore the selectable marker cannot be reconstituted. In some embodiments, the expression termination signal in the landing pad nucleic acid ensures that the combination of the first split intein and split selectable marker (e.g., the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker or the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein) cannot be expressed from the landing pad nucleic acid alone (i.e., without integration of the delivery nucleic acid within the landing pad nucleic acid).

[0011] One of the advantages of the system of the present invention is that only integration of the delivered nucleic acid at the correct location and orientation within the landing pad nucleic acid will result in post-translational reconstitution of the split selectable marker portion, which in turn will reduce the number of clones that need to be screened as part of generating a stable cell line, and will reduce the time and costs involved in generating a stable cell line.

[0012] In some embodiments, the second split intein and split selectable marker combination is operably linked to a second promoter. In some embodiments, the second split intein and split selectable marker combination is operably linked to a first promoter that controls expression of a gene of interest. In such embodiments, the second split intein and split selectable marker combination can be split from the gene of interest via a third transcriptional or translational splitting mechanism. The third transcriptional or translational splitting mechanism can be an internal ribosome entry site (IRES), a furin cleavage site, or a 2A peptide. In some preferred embodiments, the third transcriptional or translational splitting mechanism is an internal ribosome entry site (IRES).

[0013] In some embodiments, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker are operably linked to a second promoter. In some embodiments, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker are operably linked to a first promoter that controls expression of a gene of interest. In such embodiments, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker can be split from the gene of interest via a third transcriptional or translational splitting mechanism. The third transcriptional or translational splitting mechanism can be an internal ribosome entry site (IRES), a furin cleavage site, or a 2A peptide. In some preferred embodiments, the third transcriptional or translational splitting mechanism is an internal ribosome entry site (IRES).

[0014] In some embodiments, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein are operably linked to a second promoter. In some embodiments, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein are operably linked to a first promoter that controls expression of a gene of interest. In such embodiments, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein can be split from the gene of interest via a third transcriptional or translational splitting mechanism. The third transcriptional or translational splitting mechanism can be an internal ribosome entry site (IRES), a furin cleavage site, or a 2A peptide. In some preferred embodiments, the third transcriptional or translational splitting mechanism is an internal ribosome entry site (IRES).

[0015] In some embodiments, after catalysis of site-specific recombination between the first and second site-specific recombination sites by the integration enzyme, the resulting nucleic acid (referred to herein as the retargeting nucleic acid) comprises, in a 5' to 3' direction, an expression termination signal, a first promoter operably linked to the gene of interest, a second promoter operably linked to the N-terminal portion of the split selectable marker, the N-terminal portion of the split intein, a second transcription or translation splitting mechanism, the first transcription or translation splitting mechanism, the C-terminal portion of the split intein, and the C-terminal portion of the split selectable marker. The retargeting nucleic acid can further comprise one or more nucleic acid sequences resulting from recombination between the first and / or second site-specific recombination sites or the first and second site-specific recombination sites. The retargeting nucleic acid can further comprise attL and attR (see below). In some embodiments, the retargeting nucleic acid comprises, from 5' to 3', an expression termination signal, attL, a first promoter operably linked to the gene of interest, a second promoter operably linked to the N-terminal portion of the split selectable marker, an N-terminal portion of the split intein, a second transcription or translation splitting machinery, attR, a first transcription or translation splitting machinery, a C-terminal portion of the split intein, and a C-terminal portion of the split selectable marker. In some embodiments, the retargeting nucleic acid comprises or consists of SEQ ID NO: 11 or SEQ ID NO: 21, or a functional variant thereof.

[0016] In some embodiments, after catalysis of site-specific recombination between the first and second site-specific recombination sites by the integration enzyme, the resulting nucleic acid (referred to herein as the retargeting nucleic acid) comprises, in a 5' to 3' direction, an expression termination signal, a first promoter operably linked to the gene of interest, a second promoter operably linked to the C-terminal portion of the split intein, a C-terminal portion of the split selectable marker, a first transcription or translation splitting mechanism, a second transcription or translation splitting mechanism, an N-terminal portion of the split selectable marker, and an N-terminal portion of the split intein. The retargeting nucleic acid can further comprise one or more nucleic acid sequences resulting from recombination between the first and / or second site-specific recombination sites or the first and second site-specific recombination sites. The retargeting nucleic acid can further comprise attL and attR (see below). In some embodiments, the retargeting nucleic acid comprises, from 5' to 3', an expression termination signal, attL, a first promoter operably linked to a gene of interest, a second promoter operably linked to the C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker, a first transcription or translation split machinery, attR, a second transcription or translation split machinery, an N-terminal portion of the split selectable marker, and an N-terminal portion of the split intein. In some embodiments, after catalysis of site-specific recombination between the first and second site-specific recombination sites by the integration enzyme, the resulting nucleic acid (referred to herein as the retargeting nucleic acid) comprises, in the 5' to 3' direction, an expression termination signal, a first promoter operably linked to the gene of interest, a third transcription or translation splitting mechanism, an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, the first transcription or translation splitting mechanism, a C-terminal portion of the split intein, and a C-terminal portion of a split selectable marker. The retargeting nucleic acid can further comprise one or more nucleic acid sequences resulting from recombination of the first and / or second site-specific recombination sites or the first and second site-specific recombination sites.The retargeting nucleic acid can further comprise attL and attR (see below). In some embodiments, the retargeting nucleic acid comprises, from 5' to 3', an expression termination signal, attL, a first promoter operably linked to a gene of interest, a third transcription or translation splitting mechanism, an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, attR, a first transcription or translation splitting mechanism, a C-terminal portion of the split intein, and a C-terminal portion of a split selectable marker.

[0017] In some embodiments, the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. In some embodiments, the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site, resulting in integration of the delivery nucleic acid into the landing pad nucleic acid. In some embodiments, the integration enzyme is a unidirectional integrase. In some embodiments, the integration enzyme is a serine integrase. In some embodiments, the integrase is a unidirectional serine integrase. A unidirectional serine integrase is a phage-encoded recombinase that promotes conservative recombination between two short DNA fragments—the phage attachment site attP and the bacterial attachment site attB. The product of recombination between attP and attB is integration of the nucleic acid of interest flanked by two new recombination sites, attL and attR, each of which contains half sites from attP and attB. Unidirectional serine integrases result in unidirectional, i.e., irreversible, integration, which may be particularly preferable in generating stable producer cell lines expressing a gene of interest, as unidirectional integration cannot be reversed by subsequent integration events.

[0018] The integration enzyme can be selected from the group of unidirectional serine integrases consisting of Bxb1, Wβ, BL3, R4, A118, TG1, MR11, Φ370, SPBc, TP901-1, ΦRV, FC1, K38, ΦBT1, and ΦC31. The integration enzyme can be selected from the group of unidirectional serine integrases consisting of Bxb1, ΦC31, R4, and ΦBT1. In some preferred embodiments, the integration enzyme is BxB1. BXB1 has been found to be functional in a wide range of mammalian cells and is typically considered to be the most efficient and most accurate of the currently known unidirectional serine integrases. In some embodiments, the nucleic acid encoding the integration enzyme comprises or consists of SEQ ID NO: 13 or a functional variant thereof.

[0019] In some embodiments, the first site-specific recombination site is the attB of the respective unidirectional serine integrase. For example, if the integrase is BXB1, the first site-specific recombination site is the BXB1 attB. Preferably, the first site-specific recombination site can be selected from the group consisting of Bxb1 attB, Wβ attB, BL3 attB, R4 attB, A118 attB, TG1 attB, MR11 attB, ΦC370 attB, SPBc attB, TP901 attB, RV attB, FC1 attB, ΦK38 attB, ΦBT1 attB, and C31 attB. The sequences of these recombination sites can be found in Table 2 of Xu Z., Thomas L., Davies B. et al. Accuracy and efficiency define Bxb1 integrase as the best of 15 candidate serine recombinases for DNA integration into the human genome. BMC Biotechnol 13, 87 (2013), https: / / doi.org / 10.1186 / 1472-6750-13-87, incorporated herein by reference. In some embodiments, the first site-specific recombination site is BXB1 attB. In some embodiments, the first site-specific recombination site comprises or consists of SEQ ID NO: 1 or a functional variant thereof.

[0020] In some embodiments, the second site-specific recombination site is an attP of each unidirectional serine integrase. For example, if the integrase is BXB1, the second site-specific recombination site is a BXB1 attP. Preferably, the second site-specific recombination site is selected from the group consisting of Bxb attP, Wβ attP, BL3 attP, R4 attP, A118 attP, TG1 attP, MR11 attP, ΦC370 attP, SPBc attP, TP901 attP, RV attP, FC1 attP, ΦK38 attP, ΦBT1 attP, and C31 attP. In some embodiments, the second site-specific recombination site is a Bxb attP. In some embodiments, the Bxb1 attP further comprises an in-frame stop codon. A stop codon within BxB1 attP can be added to terminate translation from the N- or C-terminal portion of the split selectable marker in the delivery nucleic acid. In the retargeting construct, this stop codon is moved outside the coding sequence. In some embodiments, the second site-specific recombination site comprises or consists of SEQ ID NO:2 or a functional variant thereof.

[0021] In some embodiments, the first and second site-specific recombination sites may be reversed, preferably such that the first site-specific recombination site may be attB of the respective unidirectional serine integrase, and the second site-specific recombination site may be attP of the respective unidirectional serine integrase. Preferably, the attB and attP sites are as defined above.

[0022] The integration enzyme may be a tyrosine recombinase. Preferably, the tyrosine recombinase may be a Cre recombinase. Preferably, when the integration enzyme is a Cre recombinase, the first site-specific recombination site is LoxP. Preferably, when the integration enzyme is a Cre recombinase, the second site-specific recombination site is LoxP. Preferably, the tyrosine recombinase may be an Flp. Preferably, when the integration enzyme is an Flp recombinase, the first site-specific recombination site is FRT. Preferably, when the integration enzyme is an Flp recombinase, the second site-specific recombination site is FRT.

[0023] The C-terminal portion of the split intein can be the C-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein. In some embodiments, the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE intein. In some embodiments, the C-terminal portion of the split intein comprises or consists of SEQ ID NO: 4 or a functional variant thereof.

[0024] The N-terminal portion of the split intein can be the N-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein. In some embodiments, the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE intein. In some embodiments, the N-terminal portion of the split intein comprises or consists of SEQ ID NO: 5 or a functional variant thereof.

[0025] The C-terminal portion of the split intein and the N-terminal portion of the split intein can be any pair of split inteins that can enable ligation of adjacent exteins into a new protein. The C-terminal portion of the split intein and the N-terminal portion of the split intein can be any pair of split inteins configured for protein splicing. The C-terminal portion of the split intein and the N-terminal portion of the split intein can be any pair of split inteins configured for recombining adjacent exteins into a new protein. The C-terminal portion of the split intein and the N-terminal portion of the split intein can be any pair of split inteins configured for recombining the C-terminal portion of a split selectable marker and the N-terminal portion of a split selectable marker into a functional selectable marker. The C-terminal portion of the split intein can be the C-terminal portion of an SspDnaB intein, and the N-terminal portion of the split intein can be the N-terminal portion of an SspDnaB intein. The C-terminal portion of the split intein can be the C-terminal portion of an SspDnaE intein, and the N-terminal portion of the split intein can be the N-terminal portion of an SspDnaE intein. In some embodiments, the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE intein, and the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE intein. In some embodiments, the C-terminal portion of the split intein comprises or consists of SEQ ID NO:4 or a functional variant thereof, and the N-terminal portion of the split intein comprises or consists of SEQ ID NO:5 or a functional variant thereof.

[0026] The first transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid. The first transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid via transcription machinery. For example, the nucleic acids encoding each of the proteins can be operably linked to separate promoters. The first transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid via translation machinery. The translation machinery can be during or after translation. The first transcription or translation division mechanism can enable translation initiation in a cap-independent manner, thereby enabling two separate proteins to be produced from a single nucleic acid. The first transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid by inducing ribosome skipping during translation. The first transcription or translation division mechanism can be a DNA sequence, an RNA sequence, or a protein sequence.

[0027] The first transcription or translation division mechanism can be an internal ribosome entry site (IRES), a furin cleavage site, or a 2A peptide. In some embodiments, the first transcription or translation division mechanism is an IRES. In some embodiments, the first transcription or translation division mechanism comprises or consists of SEQ ID NO: 8 or a functional variant thereof. In some embodiments, the first transcription or translation division mechanism is a cleavable peptide, such as a 2A peptide. The first transcription or translation division mechanism can be a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A, and GT2A. In some embodiments, the first transcription or translation division mechanism is a T2A peptide.

[0028] In some embodiments, the first transcriptional or translational division mechanism is a 2A peptide containing a furin recognition site. A furin recognition site, also known as a furin cleavage site, is a protein sequence predicted to be recognized and cleaved by the protease enzyme furin. The furin recognition site can be used to remove any residual added 2A sequence. The furin recognition site can also be used to complement the efficiency of 2A cleavage. In some preferred embodiments, the first transcriptional or translational division mechanism is a T2A peptide containing a furin recognition site. In some embodiments, the first transcriptional or translational division mechanism comprises or consists of SEQ ID NO:3, SEQ ID NO:22, or a functional variant thereof.

[0029] The second transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid. The second transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid via transcription machinery. For example, the nucleic acids encoding each of the proteins can be operably linked to separate promoters. The second transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid via translation machinery. The second transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid via translation machinery. The translation machinery can be intra- or post-translational. The second transcription or translation division mechanism can enable translation initiation in a cap-independent manner, thereby enabling two separate proteins to be produced from a single nucleic acid. The second transcription or translation division mechanism can enable two separate proteins to be produced from a single nucleic acid by inducing ribosome skipping during translation. The second transcription or translation division mechanism can be a DNA sequence, an RNA sequence, or a protein sequence.

[0030] The second transcription or translation division mechanism can be an internal ribosome entry site (IRES), a furin cleavage site, or a 2A peptide. In some embodiments, the second transcription or translation division mechanism is an IRES. In some embodiments, the second transcription or translation division mechanism comprises or consists of SEQ ID NO: 8 or a functional variant thereof. In some embodiments, the second transcription or translation division mechanism is a cleavable peptide, such as a 2A peptide. The second transcription or translation division mechanism can be a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A, and GT2A. In some embodiments, the first transcription or translation division mechanism is a T2A peptide.

[0031] In some embodiments, the second transcriptional or translational division mechanism is a 2A peptide containing a furin recognition site. The furin recognition site can be used to remove any remaining added 2A sequence. The furin recognition site can also be used to complement the efficiency of 2A cleavage. In some preferred embodiments, the second transcriptional or translational division mechanism is a T2A peptide containing a furin recognition site. In some embodiments, the second transcriptional or translational division mechanism comprises or consists of SEQ ID NO:3, SEQ ID NO:23, or a functional variant thereof.

[0032] In some embodiments, the first transcription or translation division machinery is a 2A peptide containing a furin recognition site, and the second transcription or translation division machinery is a 2A peptide containing a furin recognition site. In some embodiments, the first transcription or translation division machinery is a T2A peptide containing a furin recognition site, and the second transcription or translation division machinery is a T2A peptide containing a furin recognition site. In some embodiments, the first transcription or translation division machinery comprises or consists of SEQ ID NO:3 or SEQ ID NO:22, or a functional variant thereof, and the second transcription or translation division machinery comprises or consists of SEQ ID NO:3 or SEQ ID NO:23, or a functional variant thereof.

[0033] The expression termination signal can be any sequence that prevents expression of the first site-specific recombination site, the first transcription or translation splitting mechanism, the C-terminal portion of the split intein, and the C-terminal portion of the split selectable marker from the landing pad nucleic acid, or that prevents expression of the first site-specific recombination site, the first transcription or translation splitting mechanism, the N-terminal portion of the split selectable marker, and the N-terminal portion of the split intein from the landing pad nucleic acid. The expression termination signal can be an insulator sequence. The expression termination signal can be a polyA sequence. In some preferred embodiments, the expression termination signal is one or more stop codons. The one or more stop codons can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 stop codons. A stop codon is a three-nucleotide sequence in DNA or messenger RNA that signals an end to protein synthesis. UAA, UAG, and UGA are stop codons in RNA. TAA, TAG, and TGA are stop codons in DNA. In some embodiments, the one or more stop codons are two sets of three stop codons. In some embodiments, the one or more stop codons comprise or consist of SEQ ID NO: 19 or a functional variant thereof. In some embodiments, the one or more stop codons comprise or consist of SEQ ID NO: 20 or a functional variant thereof.

[0034] A split selectable marker can be any suitable marker gene that expresses an easily detectable marker, and many such marker genes are well known in the art. For example, the selectable marker gene can be an antibiotic resistance gene, a gene encoding a fluorescent protein, a gene encoding glutamine synthetase, or a gene encoding a luminescent protein. A split selectable marker can be a gene encoding a fluorescent protein. A fluorescent protein allows for selection based on the presence or absence of the fluorescent protein (e.g., by FACS). A split selectable marker can be a gene encoding glutamine synthetase. Glutamine synthetase allows for selection based on the ability of cells to produce glutamine, an essential amino acid required for cell survival. Some mammalian cells cannot produce glutamine. For other cells, an inhibitor of glutamine synthase (MSX) can be used. A split selectable marker can be a gene encoding a luminescent protein. A luminescent protein allows for selection based on the presence or absence of the luminescent protein.

[0035] In some embodiments, the split selectable marker is an antibiotic resistance gene. Antibiotic resistance genes allow for selection based on the ability of cells to overcome the antibiotic. Antibiotic resistance genes are particularly preferred split selectable markers because they allow for an efficient selection process when cells are simply grown in a medium containing the antibiotic for each antibiotic resistance gene. Preferably, the split selectable marker can be split anywhere in its amino acid sequence to create a C-terminal portion and an N-terminal portion.

[0036] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 52. The C-terminal portion of the split selectable marker and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 69. The C-terminal portion of the split selectable marker and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 89.

[0037] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 131. The C-terminal portion of the split selectable marker and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 171. The C-terminal portion of the split selectable marker and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 200.

[0038] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 240. The C-terminal portion of the split selectable marker and the N-terminal portion of the hygromycin resistance gene (HygroR) split at amino acid position 292.

[0039] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of the puromycin resistance gene (PuroR) split at amino acid position 32. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of the puromycin resistance gene (PuroR) split at amino acid position 84. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of the puromycin resistance gene (PuroR) split at amino acid position 100. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of the puromycin resistance gene (PuroR) split at amino acid position 119.

[0040] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker are the neomycin resistance gene (Neomycin 133) split at amino acid position 133. R The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and the N-terminal portion of the neomycin resistance gene (Neomycin resistance gene) split at amino acid position 195. R ) can be the C-terminal and N-terminal portions of

[0041] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 46. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 48. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 51. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 75. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 122. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal portion and the N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 140. The C-terminal portion of the split selectable marker and the N-terminal portion of the gene encoding the mScarlet fluorescent protein split at amino acid position 163.

[0042] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of a luciferase protein split at amino acid position 437.

[0043] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of a split glutamate synthetase protein.

[0044] In some preferred embodiments, the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker may be the C-terminal portion and the N-terminal portion of the blasticidin resistance gene (BsrR) split at amino acid position 102.

[0045] In some preferred embodiments, the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof. In some preferred embodiments, the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof. In some embodiments, the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof, and the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof.

[0046] In some embodiments, the landing pad nucleic acid further comprises a third promoter operably linked to a second selectable marker. The second selectable marker can be used to select for integration of the landing pad nucleic acid into the genome of a cell. However, the presence of a second selectable marker is not absolutely necessary, because if the landing pad nucleic acid does not integrate into the genome of interest and the delivery nucleic acid subsequently integrates into the landing pad nucleic acid, the resulting construct will not replicate during cell division. In embodiments in which the system does not include a second selectable marker, the landing pad nucleic acid can be delivered to cells via lentivirus, dilution cloning can be performed to isolate clones, the clones can be retargeted using the delivery nucleic acid, and finally selected using a split selectable marker (such as blasticidin). Any clones that survive this selection will carry the landing pad nucleic acid in their genome.

[0047] The second selectable marker can be any suitable marker gene that expresses an easily detectable marker, and any and many such marker genes are well known in the art. For example, the second selectable marker gene can be an antibiotic resistance gene, a gene encoding a fluorescent protein, a gene encoding glutamine synthetase, or a gene encoding a luminescent protein. Preferably, the second selectable marker is different from the first selectable marker.

[0048] The second selectable marker can be a gene encoding a fluorescent protein. The fluorescent protein allows for selection based on the presence or absence of the fluorescent protein (e.g., by FACs). The second selectable marker can be a gene encoding glutamine synthetase. Glutamine synthetase allows for selection based on the ability of the cell to produce glutamine, an essential amino acid required for cell survival. Some mammalian cells are unable to produce glutamine. For other cells, an inhibitor of glutamine synthase (MSX) can be used. The second selectable marker can be a gene encoding a luminescent protein. The luminescent protein allows for selection based on the presence or absence of the luminescent protein.

[0049] In some embodiments, the second selectable marker gene is an antibiotic resistance gene. The antibiotic resistance gene allows for selection based on the ability of the cell to overcome the antibiotic. Antibiotic resistance genes are particularly preferred second selectable marker genes because they allow for an efficient selection process when the cells are simply grown in a medium containing the antibiotic for each antibiotic resistance gene.

[0050] The second selectable marker may be selected from the group consisting of a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, an ampicillin resistance gene, a carbenicillin resistance gene, a bleomycin resistance gene, an erythromycin resistance gene, a polymyxin B resistance gene, a tetracycline resistance gene, a chloramphenicol resistance gene, a hygromycin resistance gene, a puromycin resistance gene, a neomycin resistance gene and a blasticidin resistance gene.

[0051] In some embodiments, the second selectable marker is hygromycin.

[0052] In some embodiments, the landing pad nucleic acid further comprises an IRES followed by an additional selectable marker, hi one embodiment, the IRES followed by the additional selectable marker is located 3' from the C-terminal portion of the split selectable marker.

[0053] The additional selectable marker can be any suitable marker gene that expresses an easily detectable marker, and any and many such marker genes are well known in the art. For example, the additional selectable marker gene can be an antibiotic resistance gene, a gene encoding a fluorescent protein, a gene encoding glutamine synthetase, or a gene encoding a luminescent protein. Preferably, the additional selectable marker is different from the first selectable marker and the second selectable marker. The additional selectable marker can be used to detect successful production of the retargeted nucleic acid. The additional selectable marker is an optional feature of the system according to the first aspect of the present invention and is not required for the system to function.

[0054] An additional selectable marker can be a gene encoding glutamine synthetase. Glutamine synthetase allows for selection based on the ability of cells to produce glutamine, an essential amino acid required for cell survival. Some mammalian cells are unable to produce glutamine. For other cells, an inhibitor of glutamine synthase (MSX) can be used. An additional selectable marker can be a gene encoding a photoprotein. Photoproteins allow for selection based on the presence or absence of the photoprotein. An additional selectable marker gene can be an antibiotic resistance gene. Antibiotic resistance genes allow for selection based on the ability of cells to overcome the antibiotic. An additional selectable marker can be selected from the group consisting of a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, an ampicillin resistance gene, a carbenicillin resistance gene, a bleomycin resistance gene, an erythromycin resistance gene, a polymyxin B resistance gene, a tetracycline resistance gene, a chloramphenicol resistance gene, a hygromycin resistance gene, a puromycin resistance gene, a neomycin resistance gene, and a blasticidin resistance gene.

[0055] In some embodiments, the additional selectable marker is a fluorescent protein. The fluorescent protein allows for selection (e.g., by FACs) based on the presence or absence of the fluorescent protein. The fluorescent protein allows for quantification of cells in which the landing pad nucleic acid has integrated into the genome of interest and in which the delivery nucleic acid has subsequently integrated into the landing pad nucleic acid, thereby resulting in reconstitution of the selectable marker after translation of the multiple portions of the split selectable marker. Quantification can be performed via FACs.

[0056] Further selectable markers may be selected from the group consisting of EBFP, ECFP, EGFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape1, mRaspberry, mGrape2 and mPlum.

[0057] In some embodiments, the additional selectable marker is EGFP. In some embodiments, the additional selectable marker comprises or consists of SEQ ID NO: 9 or a functional variant thereof.

[0058] In a second aspect, there is provided a cell comprising the system according to the first aspect or a part of the system according to the first aspect. The cell may be any cell. The cell may be any cell suitable for generating a stable cell line. The cell may be an animal cell, more preferably a mammalian cell. The cell may be a human cell. In some embodiments, the cell is a HEK293 cell. HEK293 is a well-known immortalized cell line originally derived from a fetus. In some embodiments, the cell is a CHO-K1 cell. The CHO-K1 cell is derived from a subclone of a parent CHO cell line. The CHO cell line was derived from a biopsy of an ovary from an adult female Chinese hamster.

[0059] In a third aspect, a cell is provided that comprises a landing pad nucleic acid, wherein the landing pad nucleic acid comprises, in 5' to 3' orientation, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting mechanism, a combination of a first split intein and a split selectable marker. In some embodiments, the landing pad nucleic acid comprises, in 5' to 3' orientation, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting mechanism, a C-terminal portion of the split intein, and a C-terminal portion of the split selectable marker. In some embodiments, the landing pad nucleic acid comprises, in 5' to 3' orientation, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting mechanism, an N-terminal portion of the split selectable marker, and an N-terminal portion of the split intein. Cells according to this embodiment are suitable for generating stable cell lines via delivery into the cells of a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination (e.g., the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein, or the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker), a second transcriptional or translational splitting mechanism, and a second site-specific recombination site, and an integrating enzyme or a nucleic acid encoding the integrating enzyme. The delivery nucleic acid can further comprise a first promoter operably linked to a gene of interest. The second split intein and split selectable marker combination can be operably linked to the second promoter or to the first promoter. In embodiments in which the second split intein and split selectable marker combination is operably linked to the first promoter, the second split intein and split selectable marker combination is separated from the gene of interest via a third transcriptional or translational splitting mechanism, preferably an IRES.

[0060] In some embodiments, the landing pad nucleic acid is stably integrated into the genome of the cell.

[0061] In some embodiments, the cell further comprises a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination (e.g., an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein, or a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker), a second transcriptional or translational splitting mechanism, and a second site-specific recombination site. The delivery nucleic acid can further comprise a first promoter operably linked to a gene of interest. The second split intein and split selectable marker combination can be operably linked to the second promoter or to the first promoter. In embodiments in which the second split intein and split selectable marker combination is operably linked to the first promoter, the second split intein and split selectable marker combination is separated from the gene of interest via a third transcriptional or translational splitting mechanism, preferably an IRES.

[0062] In some embodiments, the cells further comprise an integration enzyme, or a nucleic acid encoding an integration enzyme. The integration enzyme can be configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site.

[0063] In some embodiments, the cells are - a delivery nucleic acid comprising, in a 5' to 3' direction, a combination of a second split intein and a split selectable marker (e.g., an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein, or a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker), a second transcription or translation split machinery, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. Further includes:

[0064] In some embodiments, the second split intein and split selectable marker combination can be operably linked to a second promoter or to the first promoter. In embodiments in which the second split intein and split selectable marker combination is operably linked to a first promoter, the second split intein and split selectable marker combination is separated from the gene of interest via a third transcriptional or translational split mechanism, preferably an IRES.

[0065] In a fourth aspect, a method for producing a pharmaceutical composition comprising the steps of: - providing the cell with a landing pad nucleic acid comprising, in 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a combination of a first split intein and a split selectable marker (e.g., a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker, or an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein); - providing to the cell (i) a delivery nucleic acid comprising, in a 5' to 3' direction, a combination of a second split intein and a split selectable marker (e.g., an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein, or a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker), a second transcriptional or translational splitting machinery, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and (ii) an integrating enzyme or a nucleic acid encoding an integrating enzyme, the integrating enzyme being configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site; and - selecting cells that express the selectable marker gene; A method for selecting cells containing a gene of interest is provided, comprising:

[0066] In some embodiments, the second split intein and split selectable marker combination can be operably linked to a second promoter or to the first promoter. In embodiments in which the second split intein and split selectable marker combination is operably linked to a first promoter, the second split intein and split selectable marker combination is separated from the gene of interest via a third transcriptional or translational split mechanism, preferably an IRES.

[0067] In some preferred embodiments, the method steps are performed in the order specified.

[0068] The landing pad nucleic acid can be provided to the cell via any suitable method. By way of non-limiting example, the landing pad nucleic acid can be transfected, transduced, or conjugated into the cell. Preferably, the landing pad nucleic acid can be provided to the cell via electroporation, microinjection, gene gun, impale infection, hydrostatic pressure, continuous injection, sonication, calcium phosphate-based transfection, cationic polymer-based transfection, lipofection-based transfection, fugene-based transfection, or viral delivery.

[0069] In some embodiments, the landing pad nucleic acid is provided to the cell via viral delivery. In some embodiments, the landing pad nucleic acid is provided to the cell via lentiviral delivery.

[0070] The nucleic acid to be delivered can be provided to cells via any suitable method. As a non-limiting example, the nucleic acid to be delivered can be transfected, transduced, or conjugated into cells. Preferably, the nucleic acid to be delivered can be provided to cells via electroporation, microinjection, gene gun, impale infection, hydrostatic pressure, continuous injection, sonication, calcium phosphate-based transfection, cationic polymer-based transfection, lipofection-based transfection, fugene-based transfection, or viral delivery (preferably via a non-integrating virus such as an adenovirus and / or Sendai virus vector).

[0071] In some embodiments, the delivery nucleic acid is provided to cells via lipofection-based transfection.

[0072] In some embodiments, the method further comprises culturing the cells under conditions to express the integration enzyme, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker, and the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein.

[0073] In some embodiments, after providing cells with (i) a delivery nucleic acid and (ii) an integration enzyme, or a nucleic acid encoding an integration enzyme, the integration enzyme catalyzes integration of the delivery nucleic acid into the landing pad nucleic acid, thereby reconstituting the selectable marker after translation of the multiple portions of the split selectable marker, prior to selecting for cells expressing the selectable marker gene.

[0074] In some embodiments, the split selectable marker is relinked to form a functional selectable marker when the gene of interest is successfully integrated.

[0075] In some embodiments, expression of the selectable marker gene indicates that the gene of interest has been integrated into the landing pad nucleic acid.

[0076] In a fifth aspect, a landing pad nucleic acid is provided that includes, in a 5' to 3' direction, an expression termination signal, a site-specific recombination site, a transcriptional or translational splitting machinery, a portion of a split intein, and a portion of a split selectable marker.

[0077] In a sixth aspect, a delivery nucleic acid is provided that includes, in a 5' to 3' direction, a portion of a split selectable marker, a portion of a split intein, a transcriptional or translational split mechanism, and a site-specific recombination site, wherein the delivery nucleic acid further includes a first promoter operably linked to a gene of interest. In some embodiments, the portion of the split selectable marker and the portion of the split intein are operably linked to a second promoter or to the first promoter. In embodiments in which the combination of the second split intein and split selectable marker is operably linked to the first promoter, the combination of the second split intein and split selectable marker is separated from the gene of interest via a third transcriptional or translational split mechanism, preferably an IRES.

[0078] In a seventh aspect, - a landing pad nucleic acid comprising, in the 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, and a combination of a first split intein and a split selectable marker (e.g., a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker, or an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein); - a delivery nucleic acid comprising, in a 5' to 3' direction, a combination of a second split intein and a split selectable marker (e.g., an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein, or a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker), a second transcription or translation split machinery, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. A kit for providing and selecting cells containing a gene of interest is provided, comprising:

[0079] In some embodiments, the second split intein and split selectable marker combination is operably linked to a second promoter or to the first promoter. In embodiments where the second split intein and split selectable marker combination is operably linked to a first promoter, the second split intein and split selectable marker combination is separated from the gene of interest via a third transcriptional or translational split mechanism, preferably an IRES.

[0080] The kit may be suitable for providing cells containing a gene of interest. The kit may be suitable for selecting cells into which the gene of interest has been stably integrated. The kit may be suitable for providing cells containing a gene of interest and for selecting cells into which the gene of interest has been stably integrated.

[0081] In some embodiments, the kit further comprises packaging and instructions for use. Preferably, the instructions are for use in practicing the methods of the invention.

[0082] In an eighth aspect, a method for producing a pharmaceutical composition comprising the steps of: - providing the cell with a landing pad nucleic acid that includes, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a combination of a first split intein and a split selectable marker (e.g., a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker, and an N-terminal portion of a split selectable marker and an N-terminal portion of a split intein). There is provided a method of producing a cell according to the third aspect, comprising:

[0083] Suitably, in any of the fifth, sixth, seventh or eighth aspects, the landing pad nucleic acid and the delivery nucleic acid may comprise any of the features as defined herein in relation to the landing pad nucleic acid and the delivery nucleic acid. Suitably, in the eighth aspect, the cells and the means for providing the nucleic acid to the cells may comprise any of the features as defined herein in relation to the cells and the means for providing the nucleic acid to the cells. [Brief explanation of the drawings]

[0084] [Figure 1][Figure 1A] Schematic representation of a portion of a targeted integration and selection system according to one preferred embodiment of the present invention prior to integration. The landing pad nucleic acid (referred to herein as pPlatform-EGFP) contains, from 5' to 3', three stop codons, an attB site-specific recombination site, a Furin-T2A linker, and a C-terminal Npu DnaE split intein (IntC) linked to the C-terminal portion (rR) of a split blasticidin selectable marker. For convenience, the construct further contains an internal ribosome entry site and GFP, which allows visualization and quantification of cells in which two successful integration events have occurred, resulting in the construct shown in Figure 1B. Similarly, the construct also contains a promoter operably linked to hygromycin to facilitate easier selection of cells in which pPlatform-EGFP has integrated into its genome. The delivery nucleic acid (pDeliver-mCherry) contains, from 5' to 3', a constitutive promoter operably linked to the N-terminal portion (Bs) of a split blasticidin selectable marker linked to the N-terminal Npu DnaE split intein (IntN), a furin-T2A linker, and an attP site-specific recombination site. The construct further contains a promoter operably linked to mCherry, allowing visualization and quantification of cells harboring pDeliver-mCherry. [Figure 1B] A schematic representation of pDeliver-mCherry integrated into the pPlatform-EGFP construct, which subsequently integrates into the genome. After recombination, the coding sequence is cleaved into three separate proteins by the action of T2A and furin cleavage motifs, allowing the NpuDnaE split intein element (IntC and IntN) to splice together with the N- and C-terminal portions (Bs and rR) of the BsrR protein. [Figure 2][Figure 2A] Schematic representation of the pDeliver mCherry plasmid (retargeting plasmid). [Figure 2B] Schematic representation of the pIntegrase plasmid (BXB1 expression plasmid). [Figure 2C] Schematic representation of the pPlatform EGFP (landing pad) lentivirus. [Figure 2D] Schematic representation of integration of phage DNA into host bacterial DNA by recombination between attachment sites (attP and attB) catalyzed by a phage integrase enzyme such as BXB1. [Figure 3] Figure 3A shows flow cytometry data from CHO-K1 pPlatform EGFP (landing pad) cells retargeted with the pDeliver mCherry plasmid (retargeting plasmid). pPlatform cells are CHO-K1 cells transduced with the pPlatform EGFP construct at a low MOI and selected with hygromycin. Retargeted cells are pPlatform cells cotransfected with the mCherry pDeliver retargeting plasmid and a BXB1 expression plasmid and grown in blasticidin selection medium. Both pPlatform and retargeted cells were analyzed for mCherry and EGFP expression by flow cytometry. Figure 3B shows flow cytometry data from HEK293 pPlatform EGFP (landing pad) cells retargeted with the pDeliver mCherry plasmid (retargeting plasmid). pPlatform cells were HEK293 cells transduced with the pPlatform-EGFP construct at a low MOI and selected with hygromycin. Retargeted cells were pPlatform cells cotransfected with the mCherry pDeliver retargeting plasmid and a BXB1 expression plasmid and grown in blasticidin selection medium. Both pPlatform and retargeted cells were analyzed for mCherry and EGFP expression by flow cytometry. [Figure 4][Figure 4A] Schematic representation of a portion of a targeted integration and selection system according to another embodiment of the present invention prior to integration of a delivery nucleic acid into a cell line into which the landing pad nucleic acid has been integrated. The landing pad nucleic acid comprises, from 5' to 3', three stop codons, an attB site-specific recombination site, a Furin-T2A linker, and the N-terminal portion (Bs) of a split blasticidin selectable marker linked to an N-terminal Npu DnaE split intein (IntN). For convenience, the construct further comprises an internal ribosome entry site and GFP, which allows visualization and quantification of cells in which two successful integration events have occurred, resulting in the construct shown in Figure 4B. Similarly, the construct also comprises a promoter operably linked to hygromycin to facilitate easier selection of cells in which pPlatform-EGFP has integrated into their genome. The delivery nucleic acid (pDeliver-mCherry) contains, from 5' to 3', a constitutive promoter operably linked to the C-terminal Npu DnaE split intein (IntC) linked to the C-terminal portion (rR) of the split blasticidin selectable marker, a furin-T2A linker, and an attP site-specific recombination site. The construct further contains a promoter operably linked to mCherry, allowing visualization and quantification of cells harboring pDeliver-mCherry. [Figure 4B] A schematic representation of pDeliver-mCherry integrated into the pPlatform-EGFP construct, which is subsequently integrated into the genome. After recombination, the coding sequence is cleaved into three separate proteins by the action of T2A and furin cleavage motifs, allowing the Npu DnaE split intein element (IntC and IntN) to splice together with the N- and C-terminal portions (Bs and rR) of the BsrR protein. [Figure 5][FIG. 5A] Schematic representation of a portion of a targeted integration and selection system according to another embodiment of the present invention, prior to integration of a delivery nucleic acid into a cell line into which the landing pad nucleic acid will be integrated. The landing pad nucleic acid (referred to herein as pPlatform-EGFP) comprises, from 5' to 3', three stop codons, an attB site-specific recombination site, a Furin-T2A linker, and a C-terminal Npu DnaE split intein (IntC) linked to the C-terminal portion (rR) of a split blasticidin selectable marker. For convenience, the construct further comprises an internal ribosome entry site and GFP, which allows visualization and quantification of cells in which two successful integration events have occurred, resulting in the construct shown in FIG. 5B. Similarly, the construct also comprises a promoter operably linked to hygromycin to facilitate easier selection of cells in which pPlatform-EGFP has integrated into its genome. The delivery nucleic acid (pDeliver-mCherry) contains, from 5' to 3', a constitutive promoter operably linked to mCherry (allowing for visualization and quantification of cells harboring pDeliver-mCherry), an IRES, the N-terminal portion (Bs) of a split blasticidin selectable marker linked to an N-terminal Npu DnaE split intein (IntN), a furin-T2A linker, and an attP site-specific recombination site. [Figure 5B] A schematic representation of pDeliver-mCherry integrated into the pPlatform-EGFP construct, which is subsequently integrated into the genome. After recombination, the coding sequence is cleaved into three separate proteins by the action of the T2A and furin cleavage motifs, allowing the Npu DnaE split intein element (IntC and IntN) to splice together with the N- and C-terminal portions (Bs and rR) of the BsrR protein. [Figure 6][Figure 6A] Flow cytometry data from CHO-K1 pPlatform EGFP (landing pad) cells retargeted with the pDeliver CD19 plasmid (retargeting plasmid). pPlatform cells are CHO-K1 cells transduced with the pPlatform EGFP construct at a low MOI and selected with hygromycin. Retargeted cells are pPlatform cells cotransfected with the pDeliver-CD19 retargeting plasmid and a BXB1 expression plasmid and grown in blasticidin selection medium. Both pPlatform cells and retargeted cells were analyzed for CD19 and EGFP expression by flow cytometry. [Figure 6B] Flow cytometry data from CHO-K1 pPlatform EGFP (landing pad) cells retargeted with the pDeliver FOLR1A plasmid (retargeting plasmid). pPlatform cells were CHO-K1 cells transduced with the pPlatform-EGFP construct at a low MOI and selected with hygromycin. Retargeted cells were pPlatform cells cotransfected with the pDeliver-FOLR1A retargeting plasmid and a BXB1 expression plasmid and grown in blasticidin selection medium. Both pPlatform and retargeted cells were analyzed for FOLR1A and EGFP expression by flow cytometry. DETAILED DESCRIPTION OF THE INVENTION

[0085] Detailed Description and Examples of Embodiments of the Invention While the making and using of various embodiments of the invention are discussed in detail below, it should be understood that the invention provides numerous applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.

[0086] To facilitate understanding of the present invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by one of ordinary skill in the areas relevant to the present invention. Terms such as "a," "an," and "the" are not intended to refer to a singular entity only, but include general classes of which specific examples can be used for illustration. While terminology herein is used to describe specific embodiments of the present invention, their usage does not limit the present invention except as outlined in the claims. The present invention is now further described with reference to the following headed sections. Any of the features described in any of the sections may be applied to any of the aspects of the present invention, in any workable combination.

[0087] system The landing pad nucleic acid is for integration into the genome of a cell. The landing pad nucleic acid is configured for integration into the genome of a cell.

[0088] The delivery nucleic acid is for integration of a gene of interest into the landing pad nucleic acid. The delivery nucleic acid is configured for integration of a gene of interest into the landing pad nucleic acid.

[0089] In some embodiments, the landing pad nucleic acid comprises or consists of SEQ ID NO: 10 or a functional variant thereof. In some embodiments, the landing pad nucleic acid comprises or consists of SEQ ID NO: 15 or a functional variant thereof.

[0090] In some embodiments, the delivery nucleic acid comprises or consists of SEQ ID NO: 14 or a functional variant thereof.

[0091] Integration Enzymes The integration enzyme can be configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. In some embodiments, the integration enzyme can be provided as a nucleic acid encoding the integration enzyme. In some embodiments, the integration enzyme can be provided as an integration enzyme protein.

[0092] In some embodiments, the integration enzyme is a unidirectional serine integrase. Unidirectional integration cannot be reversed by subsequent integration events, and may be particularly preferable for generating stable cell lines expressing a gene of interest. Without wishing to be bound by theory, the unidirectional serine integrase binds to the attachment sites attP and attB, which are then brought together by protein-protein interactions to form a synaptic tetramer. Coordinated double-strand breaks are formed in both of the DNA substrates, followed by subunit rotation and recombination.

[0093] In some preferred embodiments, the integration enzyme is BxB1. BxB1 serine recombinase catalyzes highly efficient unidirectional recombination between short heterologous attP and attB target sites, resulting in DNA integration or deletion depending on the orientation and position of the attP and attB sites. Recombination between attP and attB sites creates attL and attR sites, which are hybrid sites between attP and attB sites. BXB1 has been found to be functional in a variety of mammalian cells and is the most efficient and most accurate of the unidirectional serine integrases. BXB1 has been found to be the most efficient and most accurate of the unidirectional serine integrases in both mice and humans. In some embodiments, the nucleic acid encoding the integration enzyme comprises or consists of SEQ ID NO: 13 or a functional variant thereof. In some embodiments, the nucleic acid encoding the integration enzyme is operably linked to a fourth promoter.

[0094] The fourth promoter can be any promoter suitable for expressing a gene of interest in any cell. The fourth promoter can be any promoter suitable for expressing a gene of interest in mammalian cells. The fourth promoter can be a constitutive promoter, which is a promoter that results in continuous expression of the gene of interest. The fourth promoter can be an inducible promoter, which is a promoter that results in expression of the gene of interest when the respective inducer is added. In some embodiments, the fourth promoter is an EF-1α promoter. In some embodiments, the fourth promoter comprises or consists of SEQ ID NO: 16 or a functional variant thereof.

[0095] The integration enzyme may be a recombinase. The integration enzyme may be a tyrosine recombinase. Preferably, the tyrosine recombinase may be Cre recombinase. Preferably, the tyrosine recombinase may be Flp. Preferably, the integration enzyme may be a CRISPR recombinase.

[0096] A first site-specific recombination site and a second site-specific recombination site In some embodiments, the first site-specific recombination site is BXB1 attB. In some embodiments, the first site-specific recombination site comprises or consists of SEQ ID NO: 1 or a functional variant thereof. In some embodiments, the second site-specific recombination site is Bxb attP. In some embodiments, the second site-specific recombination site comprises or consists of SEQ ID NO: 2 or a functional variant thereof. In some embodiments, the first and second site-specific recombination sites can be reversed.

[0097] Preferably, when the integration enzyme is Cre recombinase, the first site-specific recombination site is LoxP. Preferably, when the integration enzyme is Cre recombinase, the second site-specific recombination site is LoxP. Preferably, when the integration enzyme is Flp recombinase, the first site-specific recombination site is FRT. Preferably, when the integration enzyme is Flp recombinase, the second site-specific recombination site is FRT.

[0098] C-terminal part of split intein and N-terminal part of split intein In some embodiments, the split marker gene is split into two segments—a C-terminal portion of the split selectable marker and an N-terminal portion of the split selectable marker. In some embodiments, the C-terminal portion of the split intein is linked to the C-terminal portion of the split selectable marker. In some embodiments, the C-terminal portion of the split intein is fused to the C-terminal portion of the split selectable marker. In some embodiments, the N-terminal portion of the split selectable marker is linked to the N-terminal portion of the split intein. In some embodiments, the N-terminal portion of the split selectable marker is fused to the N-terminal portion of the split intein.

[0099] The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be relinked by protein trans-splicing. During protein splicing, the intervening sequence (the C-terminal portion of the split intein and / or the N-terminal portion of the split intein) autocatalytically excises itself from the precursor protein and simultaneously ligates two flanking sequences (the C-terminal portion of the split selectable marker and / or the N-terminal portion of the split selectable marker) by a peptide bond. The two flanking sequences are also referred to as exteins. The split intein can catalyze protein ligation in trans, thereby ligating two exteins in two polypeptide chains into one polypeptide chain.

[0100] In some embodiments, the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE intein. In some embodiments, the C-terminal portion of the split intein comprises or consists of SEQ ID NO:4 or a functional variant thereof. In some embodiments, the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE intein. In some embodiments, the N-terminal portion of the split intein comprises or consists of SEQ ID NO:5 or a functional variant thereof. In some embodiments, the C-terminal portion of the split intein comprises or consists of SEQ ID NO:4 and the N-terminal portion of the split intein comprises or consists of SEQ ID NO:5 or a functional variant thereof.

[0101] Transcriptional or translational division mechanism The first transcriptional or translational cleavage mechanism can be an internal ribosome entry site (IRES) or a 2A peptide. An internal ribosome entry site is an RNA element that allows translation initiation in a cap-independent manner. The 2A peptide is approximately 20 amino acids long and undergoes self-cleavage between the last two amino acids, glycine and proline.

[0102] The choice of the first transcription or translation division mechanism allows for control over the relative expression of nucleic acids downstream and upstream of the second transcription or translation division mechanism. For example, in embodiments where the first transcription or translation division mechanism is an IRES, it is expected that less transcription of the downstream nucleic acid will be seen compared to the upstream nucleic acid. For example, in embodiments where the first transcription or translation division mechanism is a 2A peptide, a 1:1 ratio of upstream and downstream nucleic acids is expected. In some embodiments, a 2A peptide may be preferred, as a 1:1 ratio of the N-terminal to C-terminal portions of the split selectable marker may ensure that the system functions more efficiently.

[0103] The mechanisms of action of IRES and 2A peptides for co-expression of multiple genes in a single transcript also differ. In embodiments where the first transcription or translation partitioning mechanism is an IRES, the gene immediately downstream of the promoter is translated by a canonical cap-dependent mechanism, while the gene downstream of the IRES is translated by a cap-independent mechanism, resulting in lower translation efficiency. In embodiments where the first transcription or translation partitioning mechanism is a 2A peptide, the genes linked by the 2A are translated in a single open reading frame, and post-translational self-cleavage occurs, resulting in equal amounts of co-expressed proteins.

[0104] The first transcriptional or translational cleavage mechanism can be a self-cleaving peptide, such as a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A, and GT2A. In some embodiments, the first transcriptional or translational cleavage mechanism is a T2A peptide. The T2A peptide has the highest efficiency among the group of 2A peptides.

[0105] In some embodiments, the first transcription or translation division mechanism is a 2A peptide containing a furin recognition site. The consensus sequence for a furin cleavage site or furin recognition site is RXXR, where X is any amino acid. In some embodiments, the first transcription or translation division mechanism is a T2A peptide containing a furin recognition site. In some embodiments, the first transcription or translation division mechanism comprises or consists of SEQ ID NO:3 or SEQ ID NO:22, or a functional variant thereof.

[0106] The second transcription or translation division mechanism can be an internal ribosome entry site (IRES) or a 2A peptide. An internal ribosome entry site is an RNA element that allows translation initiation in a cap-independent manner. 2A peptides are approximately 20 amino acids long and undergo self-cleavage between the last two amino acids, glycine and proline. The selection of the second transcription or translation division mechanism allows for control over the relative expression of nucleic acids downstream and upstream of the second transcription or translation division mechanism. For example, in embodiments where the second transcription or translation division mechanism is an IRES, less transcription of the downstream nucleic acid is expected compared to the upstream nucleic acid. For example, in embodiments where the second transcription or translation division mechanism is a 2A peptide, a 1:1 ratio of upstream to downstream nucleic acid is expected. In some embodiments, a 2A peptide may be preferred because a 1:1 ratio of the N-terminal to C-terminal portions of the split selectable marker may ensure that the system functions more efficiently.

[0107] The mechanisms of action of IRES and 2A peptides for co-expression of multiple genes in a single transcript also differ. In embodiments where the first transcription or translation partitioning mechanism is an IRES, the gene immediately downstream of the promoter is translated by a canonical cap-dependent mechanism, while the gene downstream of the IRES is translated by a cap-independent mechanism, resulting in lower translation efficiency. In embodiments where the first transcription or translation partitioning mechanism is a 2A peptide, the genes linked by the 2A are translated in a single open reading frame, and post-translational self-cleavage occurs, resulting in equal amounts of co-expressed proteins.

[0108] In some embodiments, the first transcriptional or translational cleavage mechanism is a T2A peptide, which has the highest efficiency among the group of 2A peptides.

[0109] In some embodiments, the second transcription or translation division machinery is a 2A peptide containing a furin recognition site. In some embodiments, the second transcription or translation division machinery is a T2A peptide containing a furin recognition site. In some embodiments, the second transcription or translation division machinery comprises or consists of SEQ ID NO:3 or SEQ ID NO:23, or a functional variant thereof.

[0110] In some embodiments, the first transcription or translation division machinery is a 2A peptide containing a furin recognition site, and the second transcription or translation division machinery is a 2A peptide containing a furin recognition site. In some embodiments, the first transcription or translation division machinery is a T2A peptide containing a furin recognition site, and the second transcription or translation division machinery is a T2A peptide containing a furin recognition site. In some embodiments, the first transcription or translation division machinery comprises or consists of SEQ ID NO:3 or SEQ ID NO:22, or a functional variant thereof, and the second transcription or translation division machinery comprises or consists of SEQ ID NO:3 or SEQ ID NO:23, or a functional variant thereof.

[0111] Split selectable marker In some embodiments, the N-terminal portion of the split selectable marker and the C-terminal portion of the split selectable marker are configured to be relinked to form a functional selectable marker.

[0112] In some embodiments, the gene encoding the selectable marker is split into two segments to provide an N-terminal split selectable marker and a C-terminal split selectable marker. In some embodiments, the gene encoding the selectable marker is split into three segments to provide an N-terminal split selectable marker, a C-terminal split selectable marker, and additional fragments. In some embodiments, the gene encoding the selectable marker is split into four segments to provide an N-terminal split selectable marker, a C-terminal split selectable marker, and two additional fragments. In some embodiments, the gene encoding the selectable marker is split into five segments to provide an N-terminal split selectable marker, a C-terminal split selectable marker, and three additional fragments.

[0113] In some embodiments, the split selectable marker is an antibiotic resistance gene. Antibiotic resistance genes allow for selection based on the ability of cells to overcome the antibiotic. Antibiotic resistance genes are particularly preferred split selectable markers because they allow for an efficient selection process when cells are simply grown in a medium containing the antibiotic for each antibiotic resistance gene.

[0114] Preferably, a split selectable marker can be split anywhere in its amino acid sequence to preferably create a C-terminal portion and an N-terminal portion.

[0115] In some embodiments, the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker can be the C-terminal and N-terminal portions of a blasticidin resistance gene. In one embodiment, the blasticidin resistance gene (BsrR) is split at amino acid position 102.

[0116] In some embodiments, the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof. In some embodiments, the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof. In some embodiments, the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof, and the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof.

[0117] In some embodiments, the second split intein and split selectable marker combination is operably linked to a second promoter.

[0118] In some embodiments, the N-terminal portion of the split selectable marker is operably linked to a second promoter. The second promoter can be any promoter suitable for expressing a gene of interest in any cell. The second promoter can be any promoter suitable for expressing a gene of interest in mammalian cells. The second promoter can be a constitutive promoter, which is a promoter that results in continuous expression of the gene of interest. The second promoter can be an inducible promoter, which is a promoter that results in expression of the gene of interest when the respective inducer is added. In some embodiments, the second promoter is a CMV enhancer and promoter. In some embodiments, the second promoter comprises or consists of SEQ ID NO: 18 or a functional variant thereof. In some embodiments, the second promoter is SV40. In some embodiments, the second promoter comprises or consists of SEQ ID NO: 24 or a functional variant thereof. In some embodiments, the second promoter is PGK. In some embodiments, the second promoter comprises or consists of SEQ ID NO: 17 or a functional variant thereof.

[0119] In some embodiments, the second split intein and split selectable marker combination gene is operably linked to a first promoter. The first promoter can be any promoter suitable for expression of a gene of interest in mammalian cells. In some preferred embodiments, the first promoter is a constitutive promoter. In some embodiments, the first promoter is an inducible promoter, which is a promoter that results in expression of the gene of interest when the respective inducer is added. In some embodiments, the delivery nucleic acid comprises, in the 5' to 3' direction, the first promoter, an IRES, and the second split intein and split selectable marker combination.

[0120] A second selectable marker The second selectable marker can be used to select for cells in which the landing pad nucleic acid has been stably integrated. The second selectable marker can be used to select for cells in which the landing pad nucleic acid has been stably integrated into the genome.

[0121] In some embodiments, the landing pad nucleic acid further comprises a third promoter operably linked to a second selectable marker. The third promoter can be any promoter suitable for expressing a gene of interest in any cell. The third promoter can be any promoter suitable for expressing a gene of interest in mammalian cells. The third promoter can be a constitutive promoter, which is a promoter that results in continuous expression of the gene of interest. The third promoter can be an inducible promoter, which is a promoter that results in expression of the gene of interest when the respective inducer is added. In some embodiments, the third promoter is a PGK promoter. In some embodiments, the third promoter comprises or consists of SEQ ID NO: 17 or a functional variant thereof.

[0122] A second selectable marker can be used to select for integration of the landing pad nucleic acid into the genome of the cell, however, the presence of a second selectable marker is not absolutely necessary, as if the landing pad nucleic acid does not integrate into the genome of the target and the delivery nucleic acid subsequently integrates into the landing pad nucleic acid, the resulting construct will not replicate during cell division.

[0123] In some embodiments, the second selectable marker gene is an antibiotic resistance gene. Antibiotic resistance genes allow for selection based on the ability of cells to overcome antibiotics. Antibiotic resistance genes are particularly preferred second selectable marker genes because they allow for an efficient selection process when cells are simply grown in a medium containing the antibiotic for each antibiotic resistance gene. In some embodiments, the second selectable marker is hygromycin.

[0124] Expression termination signal In some embodiments, the expression termination signal prevents any basal expression of the C-terminal split selectable marker in the landing pad nucleic acid. In the absence of the expression termination signal, some basal expression is possible even in the absence of an upstream promoter operably linked to the C-terminal split selectable marker in the landing pad nucleic acid. In the retargeting construct, the expression termination signal is located upstream of the first promoter operably linked to the gene of interest and no longer prevents expression of the C-terminal split selectable marker.

[0125] In some preferred embodiments, the expression termination signal is one or more stop codons. The one or more stop codons can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 stop codons. In some embodiments, the one or more stop codons are two sets of three stop codons. In some embodiments, the one or more stop codons comprise or consist of SEQ ID NO: 19 or a functional variant thereof. In some embodiments, the one or more stop codons comprise or consist of SEQ ID NO: 20 or a functional variant thereof.

[0126] Gene of interest The gene of interest can encode a protein of interest. The protein of interest can be selected from the group consisting of an antibody (such as a monoclonal antibody), an Fc fusion protein, an anticoagulant, a blood factor, an enzyme, a growth factor, a hormone, an interferon, an interleukin, a thrombolytic agent, an Fc receptor, a T cell receptor, a cell surface receptor, and a tumor-associated antigen (TAA). In some embodiments, the protein of interest can be a monoclonal antibody.

[0127] In some embodiments, the gene of interest is operably linked to a first promoter. The first promoter can be any promoter suitable for expressing the gene of interest in any cell. The first promoter can be any promoter suitable for expressing the gene of interest in mammalian cells. The first promoter can be a constitutive promoter, which is a promoter that causes continuous expression of the gene of interest. The first promoter can be an inducible promoter, which is a promoter that causes expression of the gene of interest when the respective inducer is added. In some embodiments, the first promoter is EF-1a. In some embodiments, the first promoter comprises or consists of SEQ ID NO: 16 or a functional variant thereof.

[0128] The gene of interest operably linked to the first promoter can be located 5' or 3' to the combination of the second split intein and split selectable marker in the delivery nucleic acid (e.g., the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein, or the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker), the second transcription or translation split mechanism, and the second site-specific recombination site. The gene of interest operably linked to the first promoter can be located on either strand of the double-stranded delivery nucleic acid. In embodiments in which the combination of the second split intein and split selectable marker is operably linked to the first promoter, the gene of interest operably linked to the first promoter is preferably located 5' to the combination of the second split intein and split selectable marker in the delivery nucleic acid, the second transcription or translation split mechanism, and the second site-specific recombination site.

[0129] In some embodiments, the gene of interest can be mCherry. In some embodiments, the gene of interest comprises or consists of SEQ ID NO: 12 or a functional variant thereof.

[0130] In some embodiments, the gene of interest may be FOLR1A. In some embodiments, the gene of interest comprises or consists of SEQ ID NO: 25 or a functional variant thereof.

[0131] In some embodiments, the gene of interest may be CD 19. In some embodiments, the gene of interest comprises or consists of SEQ ID NO: 26 or a functional variant thereof.

[0132] definition As used herein, "gene of interest" means a nucleic acid sequence that encodes a product of interest. The product of interest can be a protein of interest, for example, a recombinant protein of interest.

[0133] "EFGP" means enhanced green fluorescent protein.

[0134] As used herein, "landing pad cell line" refers to cells that contain a landing pad nucleic acid that is capable of being stably integrated into the genome of the cell.

[0135] As used herein, "landing pad nucleic acid" means a nucleic acid that includes, in the 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting machinery, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker.

[0136] As used herein, a "stop codon" is a sequence of three nucleotides in DNA or messenger RNA that signals an end to protein synthesis.

[0137] As used herein, "delivery nucleic acid" refers to a nucleic acid comprising, in a 5' to 3' direction, a first promoter operably linked to a gene of interest, a second split intein and split selectable marker combination (e.g., an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein), a second transcription or translation split machinery, and a second site-specific recombination site. The second split intein and split selectable marker combination can be operably linked to a second promoter. The second split intein and split selectable marker combination can be operably linked to a first promoter.

[0138] As used herein, "site-specific recombination site" refers to a short, specific nucleic acid sequence that is recognized and bound by a site-specific recombinase. Those skilled in the art will be familiar with various site-specific recombinases and corresponding site-specific recombination sites that can be used in embodiments of the present invention. Non-limiting examples of such site-specific recombination sites include Bxb1 attB, Wβ attB, BL3 attB, R4 attB, A118 attB, TG1 attB, MR11 attB, ΦC370 attB, SPBc attB, TP901 attB, RV attB, FC1 attB, ΦK38 attB, ΦBT1 attB, and C31 attB.

[0139] As used herein, "operably linked" means that the indicated elements are functionally related, and usually physically related, to each other. Thus, as used herein, the term "operably linked" refers to multiple nucleotide sequences on a single nucleic acid molecule that are functionally related. Thus, a first nucleotide sequence operably linked to a second nucleotide sequence refers to a situation in which the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For example, a promoter is operably linked to a nucleotide sequence if the promoter mediates the transcription or expression of the nucleotide sequence. Those skilled in the art will understand that a regulatory sequence (e.g., a promoter) need not be contiguous with the nucleotide sequence to which it is operably linked, so long as the regulatory sequence functions to direct its expression. Thus, for example, intervening untranslated but transcribed sequences can be present between the promoter and the nucleotide sequence, and the promoter can still be considered "operably linked" to the nucleotide sequence. DNA operably linked to a promoter is under transcription initiation control within the promoter or in functional combination therewith.

[0140] As used herein, the terms "stably introduced" or "stably transformed" mean that a nucleic acid sequence is stably integrated into the genome of a cell, and thus the cell is stably transformed with the construct. When a construct is stably transformed, and thus integrated, into a cell, the integrated nucleic acid of the construct can be inherited by its progeny, more particularly by progeny for multiple successive generations.

[0141] As used herein, the term "transcriptional or translational division mechanism" refers to a nucleic acid sequence or protein sequence that allows two separate proteins to be produced from a single nucleic acid. The first transcriptional or translational division mechanism can allow two separate proteins to be produced from a single nucleic acid through a transcriptional mechanism. For example, nucleic acids encoding each of the proteins can be operably linked to separate promoters to produce two different transcription products. The first transcriptional or translational division mechanism can allow two separate proteins to be produced from a single nucleic acid through a translational mechanism. The translational mechanism can be intra- or post-translational. For example, the transcriptional or translational division mechanism can be a 2A peptide.

[0142] As used herein, the term "split intein" refers to a protein segment that is capable of allowing the ligation of adjacent exteins into a new protein in a process called protein splicing, in which an intein is removed from a precursor protein by ligating C- and N-terminal outer proteins (called exteins) on either side. In this context, a "split intein" refers to a portion of an intein that can combine with a corresponding "split intein" to catalyze protein trans-splicing, leading to the formation of a finished protein, e.g., a selectable marker.

[0143] As used herein, the term "retargeted nucleic acid" refers to a nucleic acid that results from catalysis of site-specific recombination between a first site-specific recombination site and a second site-specific recombination site by an integration enzyme. A retargeted nucleic acid comprises, in the 5' to 3' direction: - an expression termination signal, attL, a first promoter operably linked to a gene of interest, a second promoter operably linked to an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation split mechanism, attR, a first transcription or translation split mechanism, a C-terminal portion of the split intein, and a C-terminal portion of the split selectable marker; - an expression termination signal, attL, a first promoter operably linked to a gene of interest, a second promoter operably linked to the C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker, a first transcription or translation split mechanism, attR, a second transcription or translation split mechanism, an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein; or an expression termination signal, attL, a first promoter operably linked to a gene of interest, a third transcription or translation split mechanism, an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation split mechanism, attR, a first transcription or translation split mechanism, a C-terminal portion of the split intein, and a C-terminal portion of a split selectable marker; may include:

[0144] As used herein, the term "unidirectional serine integrase" refers to a phage-encoded recombinase that promotes conservative recombination between two short DNA fragments - the phage attachment site attP and the bacterial attachment site attB. One of the characteristics of these integrases is that their action is unidirectional, i.e., irreversible.

[0145] As used herein, the term "system" means a set of nucleic acids and optionally proteins that function together as part or all of a mechanism for delivery of a gene of interest and selection of cells containing the gene of interest.

[0146] As used herein, the term "integration enzyme" refers to an enzyme configured to integrate one nucleic acid (such as a delivery nucleic acid) into another nucleic acid (such as a landing pad nucleic acid). The integration enzyme can be configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. As a result of this recombination, the delivery nucleic acid can be integrated into the landing pad nucleic acid. One example of an integration enzyme is a unidirectional serine integrase. Further examples include Cre recombinase or Flp recombinase.

[0147] As used herein, the term "expression termination signal" refers to a sequence that prevents expression of a nucleic acid located 3' to the expression termination signal. In a landing pad nucleic acid, the expression termination signal prevents expression of the first site-specific recombination site, the first transcriptional or translational splitting machinery, the C-terminal portion of the split intein, and the C-terminal portion of the split selectable marker from the landing pad nucleic acid. For example, the expression termination signal can be one or more stop codons.

[0148] As used herein, the term "functional variant" of a sequence (e.g., a nucleic acid sequence or a protein sequence) refers to a variant of a reference sequence that retains the ability to function in the same manner as the reference sequence. For example, a functional variant of SEQ ID NO: 13 (BXB1 enzyme) can be a sequence that substantially retains enzymatic activity. Alternative terms for such functional variants include "biological equivalents" or "equivalents." The level of sequence identity between a functional variant and a reference sequence can be an indication of retained functionality. In some embodiments, a functional variant of a reference sequence includes a sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the reference sequence. For example, a functional variant of SEQ ID NO: 13 can include a sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 13.

[0149] The terms "identity" and "identical" and the like refer to sequence similarity between two polymer molecules, e.g., between two nucleic acid molecules, such as between two DNA molecules. Sequence alignment and sequence identity determination can be performed using, for example, the basic local alignment search tool (BLAST) originally described by Altschul et al., 1990 (J Mol Biol 215:403-10), such as the "Blast 2 sequences" algorithm described in Tatusova and Madden 1999 (FEMS Microbiol Lett 174:247-250). Methods for aligning sequences for comparison are well known in the art. Various programs and alignment algorithms are described, for example, in Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; Higgins and Sharp (1988) Gene 73:237-234; Higgins and Sharp (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-1090; Huang et al. (1992) Comp. Appl. Biosci. 8:155-1565; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50. A detailed discussion of sequence alignment methods and homology calculations can be found, for example, in Altschul et al. (1990) J. Mol. Biol. 215:403-10. The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD) and on the Internet, for use in conjunction with several sequence analysis programs.A description of how to determine sequence identity using this program is available on the Internet under the "help" section for BLAST™. For comparison of nucleic acid sequences, the "Blast 2 sequences" function of the BLAST™ (Blastn; Align Sequence Nucleotide BLAST) program can be used with default parameters. Nucleic acid sequences with greater similarity to a reference sequence will exhibit increasing percentage identities when assessed by this method. Typically, percentage sequence identity is calculated over the entire length of the sequence. For example, a global optimal alignment is preferably found using the Needleman-Wunsch algorithm with the following scoring parameters: match score: +2, mismatch score: -3; gap penalty: gap open 5, gap extension 2. The percentage identity of the resulting optimal global alignment is preferably calculated by the ratio of the number of aligned bases to the total length of the alignment, multiplied by 100, where the alignment length includes both matches and mismatches.

[0150] The term "nucleic acid," as used herein, typically refers to an oligomer or polymer (preferably a linear polymer) of any length composed essentially of nucleotides. A nucleotide unit generally includes a heterocyclic base, a sugar group, and at least one, e.g., one, two, or three, phosphate groups, including modified or substituted phosphate groups. Heterocyclic bases include, inter alia, purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), which are widely present in naturally occurring nucleic acids, other naturally occurring bases (e.g., xanthine, inosine, hypoxanthine), and chemically or biochemically modified (e.g., methylated), non-natural, or derivatized bases. Sugar groups include, inter alia, ribose and / or 2-deoxyribose, which are common in naturally occurring nucleic acids, or pentose (pentofuranos) groups such as arabinose, 2-deoxyarabinose, threose, or hexose sugar groups, as well as modified or substituted sugar groups. Nucleic acids as intended herein include naturally occurring nucleotides, modified nucleotides, or mixtures thereof. Modified nucleotides include modified heterocyclic bases, modified sugar moieties, modified phosphate groups, or combinations thereof. Phosphate group or sugar modifications can be introduced to improve stability, resistance to enzymatic degradation, or some other useful property. The term "nucleic acid" further preferably encompasses DNA, RNA, and DNA-RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesized) DNA, RNA, or DNA-RNA hybrids. Nucleic acids can be naturally occurring, e.g., occurring in nature or isolated from nature; or non-naturally occurring, e.g., recombinant, i.e., produced by recombinant DNA technology, and / or partially or wholly chemically or biochemically synthesized. A "nucleic acid" can be double-stranded, partially double-stranded, or single-stranded. If single-stranded, the nucleic acid can be the sense strand or the antisense strand. In addition, a nucleic acid can be circular or linear.

[0151] As used herein, "tumor-associated antigen" or "TAA" refers to a protein or peptide that is directly or indirectly associated with the pathology of cancer (such as a peptide presented by MHC class I or II molecules on the surface of tumor cells).

[0152] As used herein, a "second split intein and split selectable marker combination" and a "first split intein and split selectable marker combination" refer to a portion of the split intein and a portion of the split selectable marker. The portion of the split intein can be 5' or 3' to the portion of the split selectable marker. The first split intein and split selectable marker combination is different from the second split intein and split selectable marker combination. In some embodiments, if the first split intein and split selectable marker combination comprises, in the 5' to 3' direction, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein, the second split intein and split selectable marker combination comprises, in the 5' to 3' direction, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker. In some preferred embodiments, when the first split intein and split selectable marker combination comprises, in the 5' to 3' direction, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker, the second split intein and split selectable marker combination comprises, in the 5' to 3' direction, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein.

[0153] As used herein, "portion" refers to a portion of a nucleic acid or amino acid sequence of sufficient length to have a desired function. For example, the C-terminal "portion" of a split selectable marker contains sufficient amino acids to form a functional selectable marker when recombined with the N-terminal "portion" of the split selectable marker. In another example, the C-terminal "portion" of a split intein contains sufficient amino acids to form a functional intein when recombined with the N-terminal portion of the split intein. [Example]

[0154] Example 1 array BXB1 attB (SEQ ID NO: 1) TCGGCCGGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATCCGGGC

[0155] BXB1 attP (+ in-frame stop codon) (SEQ ID NO: 2)

[0156] [ka]

[0157] Underlined is the stop codon and two nucleotides to ensure in-frame.

[0158] Furin-T2A linker (pDeliver) (SEQ ID NO: 3)

[0159] [ka]

[0160] The furin cleavage motif is in bold. The underlined linker is glycine-serine-glycine.

[0161] Npu DnaE-C (SEQ ID NO: 4)

[0162] [ka]

[0163] Npu DnaE-N (SEQ ID NO: 5)

[0164] [ka]

[0165] C-terminal Bsr R (SEQ ID NO: 6)

[0166] [ka]

[0167] N-terminal Bsr R (SEQ ID NO: 7)

[0168] [ka]

[0169] Internal ribosome entry site (IRES) (SEQ ID NO: 8)

[0170] [ka]

[0171] EGFP (SEQ ID NO: 9)

[0172] [ka]

[0173] pPlatform Landing Pad-(BXB1 attB - Furin-T2A - Npu DnaE - BsrR (C-term) (SEQ ID NO: 10)

[0174] [ka]

[0175] The underlined sequence indicates BXB1 attB. The sequence in bold indicates Furin-T2A. The underlined and italicized sequence represents Npu DnaE. The bold and italicized sequence indicates BsrR (C-term).

[0176] pDeliver retargeting sequence (N-term BsrR - Npu DnaE-N - Furin-T2A - BXB1 attP) (SEQ ID NO: 11)

[0177] [ka]

[0178] The bolded sequences are the N-terminal Bsr R Shows. The underlined sequence represents Npu DnaE-N.

[0179] mCherry coding sequence (SEQ ID NO: 12)

[0180] [ka]

[0181] BXB1 coding sequence (SEQ ID NO: 13)

[0182] [ka]

[0183] pDeliver mCherry construct (SEQ ID NO: 14)

[0184] [ka]

[0185] [ka]

[0186] The mCherry coding sequence is underlined.

[0187] pPlatform EGFP Landing Pad (SEQ ID NO: 15)

[0188] [ka]

[0189] [ka]

[0190] EF-1a promoter (SEQ ID NO: 16)

[0191] [ka]

[0192] PGK promoter (SEQ ID NO: 17)

[0193] [ka]

[0194] CMV enhancer and promoter (SEQ ID NO: 18)

[0195] [ka]

[0196] 3x stop codon (SEQ ID NO: 19) Tgataatag

[0197] 2x3 stop codon (SEQ ID NO: 20) Tgataatagctgataatag

[0198] Split BsrR containing intein (protein sequence from retargeting nucleic acid) (SEQ ID NO: 21)

[0199] [ka]

[0200] The N-terminal portion of the split selectable marker and the C-terminal portion of the split selectable marker are highlighted in bold.

[0201] Furin-T2A linker protein sequence (pPlatform) (SEQ ID NO: 22) GIRRKRSVSHGSGGSG

[0202] Furin-T2A linker protein sequence (pDeliver) (SEQ ID NO: 23) GIRRKRSVSHGSG

[0203] SV40 promoter (SEQ ID NO: 24)

[0204] [ka]

[0205] FOLR1A coding sequence (SEQ ID NO: 25)

[0206] [ka]

[0207] CD19 coding sequence (SEQ ID NO: 26)

[0208] [ka]

[0209] pDeliver FOLR1A construct (SEQ ID NO: 27)

[0210] [ka]

[0211] [ka]

[0212] The FOLR1A coding sequence is underlined.

[0213] pDeliver CD19 construct (SEQ ID NO: 28)

[0214] [ka]

[0215] [ka]

[0216] The CD19 coding sequence is underlined.

[0217] Example 2 Experimental data building design A targeted integration and selection system according to one preferred embodiment of the present invention is shown in Figures 1A and 1B.

[0218] To select for retargeting events in the landing pad, we used blasticidin S deaminase (Bsr R The system was designed so that the blasticidin S deaminase (Bsr) sequence was split into two halves, with one half in the landing pad (pPlatform vector) and the other half in the retargeting (pDeliver) plasmid. R ) is split between amino acids 102 and 103. Only a successful recombination event (integration at the landing pad in a specific orientation and position) results in the full-length Bsr R This will result in protein translation.

[0219] The platform system utilizes the NpuDnaE split intein system from Nostoc punctiforme, which is capable of highly efficient protein trans-splicing. Trans-splicing is a specialized form of protein processing in which two different primary proteins are joined end-to-end. The use of the NpuDnaE split intein system has been demonstrated in Bsr R This means that no insertions need to be made into the coding sequence of the gene.

[0220] The platform system further utilizes BXB1, a phage-derived serine recombinase that catalyzes site-specific recombination between attP (phage attachment) and attB (bacterial attachment) sites. BXB1 integrase can mediate highly efficient and precise site-specific recombination in mammalian cells. For example, by inserting a BXB1 recombination motif (in this example, attB) into the genome of a cell line via lentiviral delivery, a platform cell line containing a "landing pad" can be created. The landing pad can then be retargeted by transfecting the cell line with a plasmid carrying the corresponding recombination motif (attP) and a plasmid expressing BXB1. A schematic representation of phage DNA integration into host bacterial DNA by recombination between attachment sites catalyzed by the phage integrase enzyme is shown in Figure 2D.

[0221] The N-terminal part (Bs) is the N-terminal part of the NpuDnaE split intein (Int N ) and integrated into the pDeliver retargeting plasmid under a constitutive promoter. N The coding sequence contains an in-frame optimized furin cleavage site / T2A peptide sequence followed by a BXB1 attP recombination motif. R The C-terminal part of (r R ) is the C-terminal part of the NpuDnaE split intein (Int C) and incorporated into the pPlatform construct downstream of a BXB1 attB motif and another optimized furin cleavage site / T2A peptide sequence. The optimized T2A self-cleaving peptide sequence combined with the optimized furin cleavage site motif ensures that the two halves of the system are translated as free proteins.

[0222] Bsr present in the platform integration site in the absence of retargeting R To avoid transcription and translation of the C-terminal half of BXB1, three stop codons were placed upstream of the coding sequence. Retargeting with the BXB1 attB motif caused these stop codons to move upstream of the promoter for the cargo (mCherry) in the pDeliver plasmid.

[0223] Transcription and translation of the C-terminal portion is prevented by an in-frame stop codon upstream of the coding sequence. R The two "halves" are recombined into one single coding sequence containing the intein sequence, allowing translation of the recombined BXB1 attR site.

[0224] Materials and Methods cell culture Unless otherwise specified, all cell culture reagents and antibiotics were obtained from Thermo Fisher Scientific, Carlsbad, CA (e.g., Gibco and Invitrogen brands). HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing 10% FBS (Gibco) and 1x penicillin / streptomycin (Pen / Strep; Gibco). CHO-K1 cells were cultured in RPMI 1640 containing 10% FBS, 1x glutamate (Gibco), and 1x Pen / Strep.

[0225] Integration of pPlatform "landing pad" cassettes Lentiviral delivery of the pPlatform "landing pad" construct was used. To enable selection of stably transduced cells, the construct was additionally designed to contain a hygromycin resistance gene. HEK293 and CHO-K1 cells were seeded in 6-well plates and incubated for 24 hours. After this, lentivirus containing the pPlatform "landing pad" cassette was added at an MOI (ratio of transducing lentiviral particles to cell number) of 15 in the presence of 8 μg / ml polybrene (Sigma-Aldrich, St. Louis, MO). After a further 48 hours of incubation, medium containing hygromycin was added, and the cells were cultured in selective medium for one week. After selection, the cells were stored at -180°C for use as a basis for further experiments. Cells into which the pPlatform "landing pad" construct had stably integrated were expected to survive in selective medium due to the presence of the hygromycin resistance gene in the construct.

[0226] Co-transfection of retargeting construct and BXB1 expression vector HEK293 and CHO-K1 cells selected for stable integration of the pPlatform "landing pad" construct as described above were seeded into 6-well plates, incubated for 24 hours, and then transfected with 2.5 μg of total DNA at a 1:4 ratio of pDeliver retargeting plasmid to pIntegrase BXB1 expression plasmid using Lipofectamine LTX transfection reagent (Invitrogen). After a 48-hour incubation period, medium containing blasticidin was added to the cells, and the cells were cultured in selection medium for a period of one week. After selection, cells were analyzed for expression of EGFP and mCherry via flow cytometry. Cells in which the pDeliver retargeting plasmid had stably integrated in the pPlatform "landing pad" construct at the correct location and orientation were selected. - The N-terminal part of the NpuDnaE split intein from the pDeliver retargeting construct (Int in Figure 1A and Figure 1B) N ) and the N-terminal portion of the blasticidin gene (Bs in Fig. 1A and Fig. 1B) linked to - The C-terminal portion of the NpuDnaE split intein from the pPlatform "landing pad" construct (Int in Figure 1A and Figure 1B) C ) downstream of the C-terminal portion of the blasticidin gene (r in Figure 1A and Figure 1B) R ) It is expected to survive in selective media due to reconstitution of the blasticidin resistance protein from the blasticidin-resistant strain.

[0227] BXB1 is driven by the EF-1α promoter.

[0228] Experimental data After successful growth through both selection media, the retargeted cells were analyzed by flow cytometry for mCherry and EGFP expression. The retargeted cells were compared to the parental platform pool, which had undergone only the first selection media described above. The results of this experiment are shown in Figures 3A and 3B for CHO-K1 and HEK293 cells, respectively.

[0229] The pPlatform "landing pad" construct contained the C-terminal portion of the blasticidin gene (r in Figure 1A and Figure 1B). R ) and the C-terminal portion of the NpuDnaE split intein (Int in Figure 1A and Figure 1B C ) downstream of an internal ribosome entry site. EGFP is not expected to be expressed unless the construct in FIG. 1B is generated after successful integration.

[0230] The pDeliver retargeting plasmid contains mCherry operably linked to a promoter and is therefore expected to be expressed provided that the pDeliver retargeting plasmid is present in or integrated into a cell.

[0231] Successfully retargeted cells are expected to express both mCherry and EGFP. As can be clearly seen in Figures 3A and 3B, the platform system is capable of successful retargeting in both HEK293 and CHO-K1 cells. Because EGFP is expressed only upon successful retargeting, EGFP expression confirms successful integration of the pDeliver retargeting plasmid into the platform site within the pPlatform "landing pad" construct. The mCherry expression profile is narrow, suggesting that all cells grown through blasticidin selection have the same level of expression.

[0232] The system is expected to function in the same manner as when the first split intein and split selectable marker combination comprises, in the 5' to 3' direction, the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein, and the second split intein and split selectable marker combination comprises, in the 5' to 3' direction, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker, as shown in detail in Figures 4A and 4B.

[0233] Example 3 The platform system described in Example 2 was further tested to assess its efficacy in retargeting cells to express other cargo proteins.

[0234] Materials and Methods cell culture CHO-K1 pPlatform cells selected for stable integration of the pPlatform "landing pad" construct as described in Example 2 were cultured in RPMI 1640 (Gibco) containing 10% FBS, 1x glutamate, 800 μg / ml hygromycin (Gibco), and 1x Pen / Strep. Hygromycin was included in the cell culture medium to select for cells containing the pPlatform "landing pad" construct.

[0235] CD19 and FOLR1A retargeting constructs The nucleotide sequence encoding CD19 or FOLR1A was integrated into the pDeliver retargeting plasmid in place of mCherry (the replaced mCherry sequence is underlined above in SEQ ID NO: 14).

[0236] The delivery nucleic acid, pDeliver-CD19, contains, in the 5' to 3' direction, the N-terminal Npu DnaE split intein (Int N ), abscisic acid-inducible promoter operably linked to the N-terminal portion (Bs) of a split blasticidin selectable marker linked to a furin-T2A linker and an attP site-specific recombination site. The construct further comprises a promoter operably linked to CD19, the cargo of the pDeliver-CD19 plasmid.

[0237] The delivery nucleic acid pDeliver-FOLR1A contains, in the 5' to 3' direction, the N-terminal Npu DnaE split intein (Int N ), abscisic acid-inducible promoter operably linked to the N-terminal portion (Bs) of a split blasticidin selectable marker linked to a furin-T2A linker and an attP site-specific recombination site. The construct further comprises a promoter operably linked to FOLR1A, the cargo of the pDeliver-FOLR1A plasmid.

[0238] Retargeted pPlatform cells containing CD19 and FOLR1A retargeting constructs and BXB1 expression vector CHO-K1 cells were seeded into 6-well plates, incubated for 24 hours, and then transfected with the pDeliver retargeting plasmid (FOLR1A or CD19) and the pIntegrase BXB1 expression plasmid at a 1:4 ratio using 2.5 μg of total DNA using Lipofectamine LTX transfection reagent. After 48 hours of incubation, medium containing blasticidin (Gibco) was added to the cells, and the cells were cultured in selective medium for a period of 3 weeks. After selection, expression of FOLR1A or CD19 was induced by the addition of abscisic acid, and 24 hours later, the cells were analyzed for EGFP, FOLR1A, and CD19 expression via flow cytometry. Cells in which the pDeliver retargeting plasmid had stably integrated in the pPlatform "landing pad" construct at the correct location and orientation are expected to survive in selective medium due to reconstitution of the blasticidin resistance protein (as described in Example 2).

[0239] Experimental data After successful growth through both of the above selection media, the retargeted cells were analyzed by flow cytometry for expression of EGFP and CD19 or FOLR1A. The retargeted cells were compared to the parental platform pool, which was subjected only to hygromycin-containing medium selection as described above; i.e., the parental platform pool was selected only for the presence of the pPlatform "landing pad." The results of this experiment are shown in Figures 6A and 6B for pDeliver-CD19 and pDeliver-FOLR1A, respectively.

[0240] As described above, the pPlatform "landing pad" construct contains the C-terminal portion of the blasticidin gene (r R ) and the C-terminal portion of the NpuDnaE split intein (Int in Figure 1A and Figure 1B C) downstream of an internal ribosome entry site. EGFP is not expected to be expressed unless the construct in FIG. 1B is generated after successful integration of a pDeliver cargo sequence (CD19 or FOLR1A).

[0241] The pDeliver retargeting plasmid contains CD19 or FOLR1A operably linked to a promoter, and therefore, it is expected that the cargo protein will be expressed provided that the pDeliver retargeting plasmid is present in or integrated into a cell.

[0242] Successfully retargeted cells are expected to express the cargo protein (CD19 or FOLR1A) and EGFP. Figures 6A and 6B show that the platform system can be successfully retargeted with different cargo proteins. Because EGFP is expressed only upon successful retargeting, EGFP expression confirms successful integration of the pDeliver retargeting plasmid into the platform site within the pPlatform "landing pad" construct.

[0243] The expression profiles of CD19 and FOLR1A indicate that both cargo proteins were successfully integrated into the respective cells (Figures 6A and 6B). The double peaks in both expression profiles suggest that there may be two integration sites (e.g., because the pPlatform "landing pad" has inserted into two sites in the genome that are expressed at different levels) or a mixed population of cells (e.g., two cell populations in which the pPlatform "landing pad" has inserted into different sites).

[0244] This experiment successfully demonstrated, as expected, that the pPlatform and pDeliver constructs are useful tools for retargeting cells with a wide range of cargo proteins of interest.

[0245] Terms 1. - a landing pad nucleic acid comprising, in the 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker; - a delivery nucleic acid comprising, in a 5' to 3' direction, a second promoter operably linked to an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. A system including:

[0246] 2. A system according to clause 1, wherein the integrating enzyme is a unidirectional serine integrase.

[0247] 3. The system according to any preceding clause, wherein the integration enzyme is selected from the group consisting of Bxb1, Wβ, BL3, R4, A118, TG1, MR11, Φ370, SPBc, TP901-1, ΦRV, FC1, K38, ΦBT1 and ΦC31, preferably selected from the group consisting of Bxb1, ΦC31, R4 and ΦBT1.

[0248] 4. A system according to any preceding clause, wherein the integrating enzyme is Bxb1.

[0249] 5. The system according to clause 4, wherein the nucleic acid encoding the integration enzyme comprises or consists of SEQ ID NO: 13 or a functional variant thereof.

[0250] 6. The first site-specific recombination site is Bxb1 attB, Wβ attB, BL3 attB, R4 attB, A118 attB, TG1 attB, MR11 attB, ΦC370 attB, SPBc attB, TP901 attB, RV attB, FC1 attB, ΦK38 attB, ΦBT1 attB and C31 attB A system according to clauses 1 and 2 selected from the group consisting of:

[0251] 7. The second site-specific recombination site comprises: Bxb attP, Wβ attP, BL3 attP, R4 attP, A118 attP, TG1 attP, MR11 attP, ΦC370 attP, SPBc attP, TP901 attP, RV attP, FC1 attP, ΦK38 attP, ΦBT1 attP and C31 attP A system according to clause 1, 2 or 6 selected from the group consisting of:

[0252] 8. The system according to any preceding clause, wherein the first site-specific recombination site is Bxb attB.

[0253] 9. The system according to clause 8, wherein the first site-specific recombination site comprises or consists of SEQ ID NO: 1 or a functional variant thereof.

[0254] 10. A system according to any preceding clause, wherein the second site-specific recombination site is Bxb attP.

[0255] 11. The system according to clause 10, wherein the second site-specific recombination site comprises or consists of SEQ ID NO: 2 or a functional variant thereof.

[0256] 12. The system according to any preceding clause, wherein the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein.

[0257] 13. A system according to any preceding clause, wherein the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein.

[0258] 14. A system according to any preceding clause, wherein the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE intein.

[0259] 15. The system according to any preceding clause, wherein the C-terminal portion of the split intein comprises or consists of SEQ ID NO: 4, or a functional variant thereof.

[0260] 16. A system according to any preceding clause, wherein the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE intein.

[0261] 17. The system according to any preceding clause, wherein the N-terminal portion of the split intein comprises or consists of SEQ ID NO: 5, or a functional variant thereof.

[0262] 18. A system according to any preceding clause, wherein the first transcriptional or translational partitioning mechanism is an internal ribosome entry site (IRES) or a 2A peptide.

[0263] 19. The system according to any preceding clause, wherein the first transcriptional or translational cleavage machinery is a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A, and GT2A.

[0264] 20. The system according to clause 19, wherein the first transcriptional or translational cleavage mechanism is a 2A peptide containing a furin recognition site.

[0265] 21. The system according to any preceding clause, wherein the first transcriptional or translational cleavage mechanism is a T2A peptide.

[0266] 22. The system according to any preceding clause, wherein the first transcriptional or translational cleavage mechanism is a T2A peptide containing a furin recognition site.

[0267] 23. A system according to any preceding clause, wherein the first transcription or translation division mechanism comprises or consists of SEQ ID NO: 3 or SEQ ID NO: 22 or a functional variant thereof.

[0268] 24. A system according to any preceding clause, wherein the second transcriptional or translational partitioning mechanism is an internal ribosome entry site (IRES) or a 2A peptide.

[0269] 25. The system according to any preceding clause, wherein the second transcriptional or translational cleavage machinery is a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A, and GT2A.

[0270] 26. The system according to clause 19, wherein the second transcriptional or translational cleavage mechanism is a 2A peptide containing a furin recognition site.

[0271] 27. The system according to any preceding clause, wherein the second transcriptional or translational cleavage mechanism is a T2A peptide.

[0272] 28. The system according to any preceding clause, wherein the second transcriptional or translational cleavage mechanism is a T2A peptide containing a furin recognition site.

[0273] 29. A system according to any preceding clause, wherein the second transcription or translation division mechanism comprises or consists of SEQ ID NO: 3 or SEQ ID NO: 23 or a functional variant thereof.

[0274] 30. A system according to any preceding clause, wherein the expression termination signal is one or more stop codons, preferably 2, 3, 4, 5, 6, 7, 8, 9, or 10 stop codons.

[0275] 31. A system according to any preceding clause, wherein the expression termination signals are two sets of three stop codons.

[0276] 32. A system according to any preceding clause, wherein the expression termination signal comprises or consists of SEQ ID NO: 19 or a functional variant thereof, or SEQ ID NO: 20 or a functional variant thereof.

[0277] 33. A system according to any preceding clause, wherein the split selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein, a gene encoding glutamine synthetase, or a gene encoding a luminescent protein.

[0278] 34. The C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker - a hygromycin resistance gene (HygroR) split at amino acid position 52, 69, 89, 131, 171, 200, 240 or 292; - the puromycin resistance gene (PuroR) split at amino acid position 32, 84, 100 or 119; - Neomycin resistance gene split at amino acid position 133 or 195 (Neomycin resistance gene split at amino acid position 133 or 195) R ); - Blasticidin resistance gene (BsrR) split at amino acid position 102; - a gene encoding the mScarlet fluorescent protein split at amino acid position 46, 48, 51, 75, 122, 140 or 163; or - A gene encoding the luciferase protein split at amino acid position 437 A system according to any preceding clause, wherein the C-terminal portion and the N-terminal portion of

[0279] 35. The system according to any preceding clause, wherein the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker are the C-terminal and N-terminal portions of the blasticidin resistance gene (BsrR) split at amino acid position 102.

[0280] 36. A system according to any preceding clause, wherein the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof, and the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof.

[0281] 37. The system according to any preceding clause, wherein the landing pad nucleic acid further comprises a third promoter operably linked to a second selectable marker.

[0282] 38. The system according to any preceding clause, wherein the second selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein or a gene encoding a luminescent protein, preferably an antibiotic resistance gene.

[0283] 39. The system according to any preceding clause, wherein the second selectable marker is selected from the group consisting of a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, an ampicillin resistance gene, a carbenicillin resistance gene, a bleomycin resistance gene, an erythromycin resistance gene, a polymyxin B resistance gene, a tetracycline resistance gene, a chloramphenicol resistance gene, a hygromycin resistance gene, a puromycin resistance gene, a neomycin resistance gene, and a blasticidin resistance gene.

[0284] 40. A system according to any preceding clause, wherein the second selectable marker is hygromycin.

[0285] 41. The system according to any preceding clause, wherein the landing pad nucleic acid further comprises IREs immediately 3' from the C-terminal portion of the split selectable marker followed by an additional selectable marker.

[0286] 42. The system according to clause 41, wherein the further selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein, or a gene encoding a luminescent protein.

[0287] 43. A system according to any one of clauses 41 to 42, wherein the further selectable marker is a gene encoding a fluorescent protein.

[0288] 44. The system according to any one of clauses 41 to 43, wherein the further selectable marker is selected from the group consisting of EBFP, ECFP, EGFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape1, mRaspberry, mGrape2 and mPlum.

[0289] 45. A system according to any one of clauses 41 to 44, wherein the further selectable marker is EGFP.

[0290] 46. ​​Cells containing a system subject to any preceding clause.

[0291] 47. A cell according to clause 46, which is an HEK293 cell or a CHO-K1 cell.

[0292] 48. A cell comprising a landing pad nucleic acid, wherein the landing pad nucleic acid comprises, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting machinery, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker.

[0293] 49. The cell according to clause 48, wherein the landing pad nucleic acid is stably integrated into the genome of the cell.

[0294] 50. - A delivery nucleic acid comprising, in a 5' to 3' direction, a second promoter operably linked to an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. 49. A cell according to any one of clauses 48 to 49, further comprising:

[0295] 51. The following process: - providing to the cell a landing pad nucleic acid comprising, in 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting machinery, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker; - providing to the cell (i) a delivery nucleic acid comprising, in a 5' to 3' direction, a second promoter operably linked to an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcriptional or translational splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and (ii) an integrating enzyme or a nucleic acid encoding an integrating enzyme, the integrating enzyme being configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site; and - selecting cells that express the selectable marker gene; 1. A method for providing a gene of interest and selecting cells containing the gene of interest, comprising the steps of:

[0296] 52. The method according to clause 51, wherein the landing pad nucleic acid is provided via electroporation, microinjection, gene gun, impale infection, hydrostatic pressure, continuous injection, sonication, calcium phosphate-based transfection, cationic polymer-based transfection, lipofection-based transfection, fugene-based transfection or viral delivery.

[0297] 53. The method according to any one of clauses 51 to 52, wherein the landing pad nucleic acid is provided via lentiviral delivery.

[0298] 54. The method according to any one of clauses 51 to 53, wherein the delivered nucleic acid is provided via electroporation, microinjection, gene gun, impale infection, hydrostatic pressure, continuous injection, sonication, calcium phosphate-based transfection, cationic polymer-based transfection, lipofection-based transfection, fugene-based transfection or viral delivery.

[0299] 55. The method according to any one of clauses 51 to 54, wherein the delivery nucleic acid is provided via lipofection-based transfection.

[0300] 56. The method according to any one of clauses 51 to 55, further comprising culturing the cells under conditions to express the integration enzyme, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker, and the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein.

[0301] 57. A landing pad nucleic acid comprising, in the 5' to 3' direction, an expression termination signal, a site-specific recombination site, a transcriptional or translational splitting mechanism, a portion of a split intein, and a portion of a split selectable marker.

[0302] 58. A delivery nucleic acid comprising, in the 5' to 3' direction, a second promoter operably linked to a portion of a split selectable marker, a portion of a split intein, a transcriptional or translational splitting mechanism, and a site-specific recombination site, and further comprising a first promoter operably linked to a gene of interest.

[0303] 59. - A landing pad nucleic acid comprising, in the 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting mechanism, a C-terminal portion of a split intein, and a C-terminal portion of a split selectable marker; - a delivery nucleic acid comprising, in a 5' to 3' direction, a second promoter operably linked to an N-terminal portion of a split selectable marker, an N-terminal portion of a split intein, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. A kit for providing and selecting cells containing a gene of interest, comprising:

[0304] 60. - A landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting mechanism, a first split intein, and a split selectable marker in combination; - a delivery nucleic acid comprising, in a 5' to 3' direction, a combination of a second split intein and a split selectable marker, an N-terminal portion of the split selectable marker, an N-terminal portion of the split intein, a second transcription or translation split mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between a first site-specific recombination site and a second site-specific recombination site. 1. A kit for providing and selecting cells containing a gene of interest, comprising: optionally, a second split intein and split selectable marker combination operably linked to a second promoter; a first split intein and split selectable marker combination comprising, from 5' to 3', a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker; and a second split intein and split selectable marker combination comprising, from 5' to 3', an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein.

Claims

1. - a landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a first split intein, and a split selectable marker in combination; - a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site. A system including:

2. 2. The system of claim 1, wherein the second split intein and split selectable marker combination is operably linked to a second promoter, or the second split intein and split selectable marker combination is operably linked to the first promoter and separated from the gene of interest via an IRES.

3. 3. The system of claim 1, wherein the first split intein and split selectable marker combination comprises, in a 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker, and the second split intein and split selectable marker combination comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein.

4. 4. The system of claim 3, wherein the C-terminal portion of the split intein and the N-terminal portion of the split intein are configured to recombine the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker into a functional selectable marker.

5. The system of any one of claims 1 to 4, wherein the integration enzyme is a unidirectional serine integrase.

6. The system of any one of claims 1 to 5, wherein the integration enzyme is selected from the group consisting of Bxb1, Wβ, BL3, R4, A118, TG1, MR11, Φ370, SPBc, TP901-1, ΦRV, FC1, K38, ΦBT1 and ΦC31, preferably selected from the group consisting of Bxb1, ΦC31, R4 and ΦBT1.

7. The system of any one of claims 1 to 6, wherein the integration enzyme is Bxb1.

8. 8. The system of claim 7, wherein the nucleic acid encoding the integration enzyme comprises or consists of SEQ ID NO: 13 or a functional variant thereof.

9. the first site-specific recombination site Bxb1 attB, Wβ attB, BL3 attB, R4 attB, A118 attB, TG1 attB, MR11 attB, ΦC370 attB, SPBc attB, TP901 attB, RV attB, FC1 attB, ΦK38 attB, ΦBT1 attB and C31 attB 9. The system of claim 1, selected from the group consisting of:

10. the second site-specific recombination site is Bxb attP, Wβ attP, BL3 attP, R4 attP, A118 attP, TG1 attP, MR11 attP, ΦC370 attP, SPBc attP, TP901 attP, RV attP, FC1 attP, ΦK38 attP, ΦBT1 attP and C31 attP 10. The system of claim 1, selected from the group consisting of:

11. 11. The system of any one of claims 1 to 10, wherein the first site-specific recombination site is Bxb attB and the second site-specific recombination site is Bxb attP, and optionally, the Bxb attB comprises or consists of SEQ ID NO: 1 or a functional variant thereof, and the Bxb attP comprises or consists of SEQ ID NO: 2 or a functional variant thereof.

12. 12. The system of claim 1, wherein the C-terminal portion of the split intein is the C-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein.

13. 13. The system of claim 1, wherein the N-terminal portion of the split intein is the N-terminal portion of an NpuDnaE, ​​SspDnaB, or SspDnaE intein.

14. 14. The system of any one of claims 2 to 13, wherein the C-terminal portion of the split intein is the C-terminal portion of the NpuDnaE intein, optionally comprising or consisting of SEQ ID NO: 4 or a functional variant thereof, and / or the N-terminal portion of the split intein is the N-terminal portion of the NpuDnaE intein, optionally comprising or consisting of SEQ ID NO: 5 or a functional variant thereof.

15. 15. The system of claim 1, wherein the first transcriptional or translational division mechanism is an internal ribosome entry site (IRES) or a 2A peptide.

16. 16. The system of any one of claims 1 to 15, wherein the first transcriptional or translational division mechanism is a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A and GT2A.

17. 17. The system of claim 1, wherein the first transcriptional or translational division mechanism is a 2A peptide containing a furin recognition site.

18. 18. The system of any one of claims 1 to 17, wherein the first transcriptional or translational division mechanism is a T2A peptide containing a furin recognition site, and optionally the first transcriptional or translational division mechanism comprises or consists of SEQ ID NO: 3 or SEQ ID NO: 22 or a functional variant thereof.

19. 19. The system of any one of claims 1 to 18, wherein the second transcriptional or translational division mechanism is an internal ribosome entry site (IRES) or a 2A peptide.

20. 20. The system of any one of claims 1 to 19, wherein the second transcriptional or translational division mechanism is a 2A peptide selected from the group consisting of F2A, P2A, E2A, T2A, GF2A, GP2A, GE2A and GT2A.

21. 21. The system of claim 20, wherein the second transcriptional or translational division mechanism is a 2A peptide containing a furin recognition site.

22. 22. The system of any one of claims 1 to 21, wherein the second transcriptional or translational cleavage mechanism is a T2A peptide.

23. 23. The system of any one of claims 1 to 22, wherein the second transcriptional or translational division mechanism is a T2A peptide containing a furin recognition site, and optionally the second transcriptional or translational division mechanism comprises or consists of SEQ ID NO: 3 or SEQ ID NO: 23 or a functional variant thereof.

24. 24. The system of any one of claims 1 to 23, wherein the expression termination signal is one or more stop codons, preferably 2, 3, 4, 5, 6, 7, 8, 9 or 10 stop codons, and / or preferably two sets of three stop codons, optionally comprising or consisting of SEQ ID NO: 19 or a functional variant thereof or SEQ ID NO: 20 or a functional variant thereof.

25. 25. The system of any one of claims 1 to 24, wherein the split selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein, a gene encoding glutamine synthetase, or a gene encoding a luminescent protein.

26. the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker, - a hygromycin resistance gene (HygroR) split at amino acid position 52, 69, 89, 131, 171, 200, 240 or 292; - the puromycin resistance gene (PuroR) split at amino acid position 32, 84, 100 or 119; - Neomycin resistance gene split at amino acid position 133 or 195 (Neomycin resistance gene split at amino acid position 133 or 195) R ); or - Blasticidin resistance gene (BsrR) split at amino acid position 102 BsrR, wherein optionally, the C-terminal portion of BsrR comprises or consists of SEQ ID NO: 6 or a functional variant thereof, and the N-terminal portion of BsrR comprises or consists of SEQ ID NO: 7 or a functional variant thereof; - a gene encoding the mScarlet fluorescent protein split at amino acid position 46, 48, 51, 75, 122, 140 or 163; or - A gene encoding the luciferase protein split at amino acid position 437 26. The system of claim 2, wherein the C-terminal portion and the N-terminal portion of

27. 27. The system of any one of claims 1 to 26, wherein the C-terminal portion of the split selectable marker and the N-terminal portion of the split selectable marker are the C-terminal portion and the N-terminal portion of a blasticidin resistance gene (BsrR) split at amino acid position 102, and optionally, the C-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 6 or a functional variant thereof, and the N-terminal portion of the split selectable marker comprises or consists of SEQ ID NO: 7 or a functional variant thereof.

28. 28. The system of any one of claims 1 to 27, wherein the landing pad nucleic acid further comprises a third promoter operably linked to a second selectable marker.

29. 29. The system of any one of claims 1 to 28, wherein the second selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein or a gene encoding a luminescent protein, preferably an antibiotic resistance gene.

30. 30. The system of any one of claims 1 to 29, wherein the second selectable marker is selected from the group consisting of a kanamycin resistance gene, a spectinomycin resistance gene, a streptomycin resistance gene, an ampicillin resistance gene, a carbenicillin resistance gene, a bleomycin resistance gene, an erythromycin resistance gene, a polymyxin B resistance gene, a tetracycline resistance gene, a chloramphenicol resistance gene, a hygromycin resistance gene, a puromycin resistance gene, a neomycin resistance gene, and a blasticidin resistance gene.

31. 31. The system of any one of claims 1 to 30, wherein the second selectable marker is hygromycin.

32. 32. The system of any one of claims 1 to 31, wherein the landing pad nucleic acid further comprises IREs immediately 3' from the C-terminal portion of the split selectable marker followed by a further selectable marker.

33. 33. The system of claim 32, wherein the further selectable marker is an antibiotic resistance gene, a gene encoding a fluorescent protein, or a gene encoding a luminescent protein.

34. 34. The system of claim 32 or 33, wherein the further selectable marker is a gene encoding a fluorescent protein.

35. 35. The system of any one of claims 32 to 34, wherein the additional selectable marker is selected from the group consisting of EBFP, ECFP, EGFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape1, mRaspberry, mGrape2, and mPlum.

36. 36. The system of any one of claims 32 to 35, wherein the further selectable marker is EGFP.

37. 37. A cell comprising the system of any one of claims 1 to 36.

38. 38. The cell of claim 37, which is a HEK293 cell or a CHO-K1 cell.

39. 1. A cell comprising a landing pad nucleic acid, wherein the landing pad nucleic acid comprises, in 5' to 3' orientation, an expression termination signal, a first site-specific recombination site, a first transcription or translation splitting machinery, a combination of a first split intein and a split selectable marker; optionally, the landing pad nucleic acid is stably integrated into the genome of the cell; optionally, the combination of the first split intein and the split selectable marker comprises, in 5' to 3' orientation, a C-terminal portion of a split intein and a C-terminal portion of a split selectable marker; and optionally, the cell comprises: - a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site. wherein optionally, the combination of the second split intein and split selectable marker is operably linked to a second promoter, and the combination of the second split intein and split selectable marker comprises, in a 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein.

40. The following steps: - providing the cell with a landing pad nucleic acid comprising, in a 5' to 3' direction, a combination of an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting machinery, a first split intein, and a split selectable marker; - providing to a cell (i) a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination, a second transcriptional or translational splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and (ii) an integrating enzyme, or a nucleic acid encoding an integrating enzyme, the integrating enzyme being configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site; and - selecting cells that express the selectable marker gene 1. A method for providing a gene of interest and selecting cells containing the gene of interest, comprising: preferably performing the steps in the order specified; and optionally, wherein the second split intein and split selectable marker combination is operably linked to a second promoter; the first split intein and split selectable marker combination comprises, in the 5' to 3' direction, a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker; and the second split intein and split selectable marker combination comprises, in the 5' to 3' direction, an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein.

41. 41. The method of claim 40, wherein the landing pad nucleic acid is provided via electroporation, microinjection, a gene gun, impale infection, hydrostatic pressure, continuous injection, sonication, calcium phosphate-based transfection, cationic polymer-based transfection, lipofection-based transfection, fugene-based transfection, or viral delivery.

42. 42. The method of claim 40 or 41, wherein the landing pad nucleic acid is provided via lentiviral delivery and / or the delivery nucleic acid is provided via lipofection-based transfection.

43. 43. The method of any one of Claims 40 to 42, further comprising culturing the cells under conditions to express the integration enzyme, the C-terminal portion of the split intein and the C-terminal portion of the split selectable marker, and the N-terminal portion of the split selectable marker and the N-terminal portion of the split intein.

44. 44. The method of any one of Claims 40 to 43, wherein after providing a cell with (i) the delivery nucleic acid and (ii) the integration enzyme, or a nucleic acid encoding an integrating enzyme, the integration enzyme catalyzes integration of the delivery nucleic acid into the landing pad nucleic acid, thereby reconstituting the selectable marker after translation of the portions of the split selectable marker prior to selecting for the cells that express the selectable marker gene.

45. 45. The method of any one of claims 40 to 44, wherein the split selectable marker is relinked to form a functional selectable marker when the gene of interest is successfully integrated at the correct location.

46. 46. ​​The method of any one of claims 40 to 45, wherein expression of the selectable marker gene indicates that the gene of interest has been integrated into the landing pad nucleic acid.

47. A landing pad nucleic acid comprising, in the 5' to 3' direction, an expression termination signal, a site-specific recombination site, a transcriptional or translational splitting mechanism, a portion of a split intein, and a portion of a split selectable marker.

48. A delivery nucleic acid comprising, in a 5' to 3' direction, a portion of a split selectable marker, a portion of a split intein, a transcriptional or translational splitting machinery, and a site-specific recombination site, further comprising a first promoter operably linked to a gene of interest, and optionally, said portion of the split selectable marker and said portion of the split intein are operably linked to a second promoter.

49. - a landing pad nucleic acid comprising, in a 5' to 3' direction, an expression termination signal, a first site-specific recombination site, a first transcriptional or translational splitting mechanism, a first split intein, and a split selectable marker in combination; - a delivery nucleic acid comprising, in a 5' to 3' direction, a second split intein and split selectable marker combination, a second transcription or translation splitting mechanism, and a second site-specific recombination site, the delivery nucleic acid further comprising a first promoter operably linked to a gene of interest; and - an integration enzyme or a nucleic acid encoding an integration enzyme, wherein the integration enzyme is configured to catalyze site-specific recombination between the first site-specific recombination site and the second site-specific recombination site.

1. A kit for providing and selecting cells containing a gene of interest, comprising: optionally, the second split intein and split selectable marker combination is operably linked to a second promoter; the first split intein and split selectable marker combination comprises, in the 5' to 3' direction, a nucleotide sequence encoding a C-terminal portion of the split intein and a C-terminal portion of the split selectable marker; and the second split intein and split selectable marker combination comprises, in the 5' to 3' direction, a nucleotide sequence encoding an N-terminal portion of the split selectable marker and an N-terminal portion of the split intein.