Engineered phages and kits for capturing SARS-CoV-2 and methods for detecting SARS-CoV-2 virus using phages or kits
Engineered M13 phages with specific peptides capture and concentrate SARS-CoV-2 on surfaces, addressing the challenge of rapid and accurate virus detection by enhancing capture and concentration methods.
Patent Information
- Application Number
- JP2025518919
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-30
- Filing Date
- 2023-09-28
- Publication Date
- 2025-10-03
AI Technical Summary
Current diagnostic methods for SARS-CoV-2 are not effectively capturing and concentrating the virus for rapid and accurate detection, particularly in biological samples.
Engineered M13 phages displaying specific peptides on the P8 protein, such as FHKGGYEKTWKLGD or EFTSKAR, are used to capture the SARS-CoV-2 virus on surfaces like magnetic beads, enabling direct concentration and detection.
The engineered phages can efficiently capture and concentrate SARS-CoV-2 virus, allowing for sensitive detection even at low viral loads, comparable to RT-PCR sensitivity.
Smart Images

Figure 2025533044000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to the technical fields of biomedical and molecular biology, and in particular to engineered phages for capturing the SARS-CoV-2 virus. [Background technology]
[0002] The 2019 novel coronavirus called SARS-CoV-2, which causes the respiratory disease known as COVID-19, is spreading rapidly worldwide.
[0003] Compared with the SARS-CoV and MERS-CoV coronaviruses that have previously caused respiratory syndrome outbreaks, the novel SARS-CoV-2 virus is highly contagious, even in patients with mild symptoms. The COVID-19 disease caused by this virus is spreading rapidly worldwide, necessitating an urgent need for effective and rapid diagnostics to detect SARS-CoV-2 infection. The SARS-CoV-2 virus's outer surface is covered with spike proteins, one of the unique features of the coronavirus family.
[0004] The spike protein of SARS-CoV-2 is the primary mechanism the virus uses to infect target cells. This protein is composed of two main components: the S1 subunit and the S2 subunit. The S1 subunit is a highly flexible region that contains a domain called the RBD, through which the virus can recognize and bind to the ACE2 receptor, the gateway for the virus to enter the cells of the human body.
[0005] Some of the antibodies specific for SARS-Cov-2 are currently known and are described in the following documents:
[0006] Chinese Patent Application Publication No. 113861288 describes broad-spectrum neutralizing antibodies against the coronavirus SARS-CoV-2. Using phage antibody library technology, the authors successfully obtained broad-spectrum single-domain neutralizing antibodies B3A3 and I3A10, which specifically bind to the SARS-CoV-2 spike RBD protein. The disclosed single-domain antibodies of the present invention have high affinity for the antigen and exhibit clear inhibitory effects against the main epidemic strain of SARS-CoV-2. The specification also describes the use of magnetic beads.
[0007] This specification describes the use of phage display technology to generate antibodies (nanobodies) with antiviral activity against SARS-CoV-2 for therapeutic purposes. In the present invention, phages are alternatively used for diagnostic and non-therapeutic purposes, where such phages display the peptide sequence FHKGGYEKTWKLGD on the major phage coat protein (P8) with specific affinity for the viral spike protein, as specified below, to directly capture and concentrate SARS-CoV-2 in biological samples for diagnostic purposes.
[0008] China Patent Application Publication No. 113444170 describes a phage display antibody library and filter antibodies that can bind to the S protein of the novel coronavirus SARS-CoV-2. This invention is based on synthetic biology and phage display technology, involves introducing mutations into the hypervariable regions of antibody variable regions and transferring the genes into E. coli, thereby constructing a synthetic antibody library containing 10 antibodies. The phage display antibody library of the invention can filter antibodies by specificity and detection function, thereby expanding powerful resources for biological research and medical diagnosis.
[0009] A known document describes the use of a methodology based on the generation of an antibody library for selectively recognizing the SARS-CoV-2 S1 protein. This known document suggests the diagnosis of SARS-CoV-2 by antibodies that recognize the virus, but it nevertheless differs significantly from the present invention for the following reasons: The system according to the present invention uses peptide sequences displayed on the major phage coat protein (P8) which is present in approximately 2700 copies (while the above-mentioned known patent uses phage coat P3). The entire phage structure is used to functionalize magnetic beads for capture and enrichment of the SARS-CoV-2 virus, which is not subject to any known patents.
[0010] Also known is Chinese Patent Application Publication No. 111333722, which describes a method and application for SARS-CoV-2 inhibitors, particularly SARS-CoV-2 neutralizing antibodies. This document uses phage display technology to construct a large-scale library of human phage-immunized antibodies and SARS-CoV-2-S proteins as drones, filters, and single-chain human antibody fragments to obtain antibodies with strong effects on the SARS-CoV-2 virus.
[0011] The antibody of the present invention can be used to treat diseases caused by COVID-19 infection and has important clinical application value.
[0012] Nevertheless, Chinese Patent Application Publication No. 111592595 describes a neutralizing antibody against the novel coronavirus SARS-CoV-2 and its uses. This antibody can be used to prepare diagnostic reagents or kits, drugs, or pharmaceutical compositions for the detection, prevention, and treatment of COVID-19. The present invention uses phage display technology to target SARS-CoV-2 RBD and SARS-CoV-1 RBD, and performs differential antibody screening to obtain neutralizing antibodies against the novel coronavirus SARS-CoV-2.
[0013] The main difference between these documents and the present invention is that the phages of the present invention are used for diagnostic and non-therapeutic purposes; as described below, such phages display the peptide sequence FHKGGYEKTWKLGD on the major phage coat protein (P8) with specific affinity for the viral spike protein, to capture and concentrate SARS-CoV-2 directly in biological samples for diagnostic purposes.
[0014] Chinese Patent Application Publication No. 111647054 describes a reagent for detecting antibodies to the novel coronavirus SARS-CoV-2 and its uses, particularly a polypeptide containing the novel coronavirus SARS-CoV-2 whose sequence corresponds to SEQ ID NO: 1 for synthesizing a polypeptide; a method for preparing the polypeptide, which is used to prepare a reagent for detecting or diagnosing the novel coronavirus SARS-CoV-2, particularly for preparing colloidal gold and related kit reagent strips. The specific primers designed by this invention can successfully synthesize S protein / N protein antigen peptides with excellent binding activity, and the colloidal gold chromatography reagent strips prepared therefrom can rapidly and effectively detect anti-S protein / N protein antibodies to the novel coronavirus SARS-CoV-2 and prevent false negative results. This specification describes the use of phage display technology.
[0015] However, what is described in the cited document refers to a diagnostic system for detecting IgG / IgM antibodies against coronaviruses, and does not relate to the direct diagnosis of the SARS-CoV-2 virus as in the present invention.
[0016] The object of the present invention is to provide a method for detecting the SARS-CoV-2 virus.
[0017] This and other objects are achieved by an engineered phage engineered to capture the SARS-CoV-2 virus, as claimed in the accompanying claims. Summary of the Invention
[0018] The phages for specific capture of SARS-CoV-2 virus according to the present invention are engineered M13 phages displayed on the phage's major coat protein, i.e., P8 protein, peptides of the sequence FHKGGYEKTWKLGD (hereinafter referred to as capture phage S-α) or EFTSKAR (hereinafter referred to as capture phage S1-6), both of which have specific affinity for the spike S1 protein of the SARS-CoV-2 virus.
[0019] The kit for capturing SARS-CoV-2 virus according to the present invention includes a surface functionalized with S-α capture phage or FHKGGYEKTWKLGD peptide or S1-6 capture phage or EFTSKAR peptide. The surface is preferably selected from magnetic beads, metal materials (e.g., gold or platinum), semiconductors (e.g., silicon or silicon nitride), or polymers (e.g., nitrocellulose).
[0020] The method for obtaining the aforementioned captured phage S-α using the FHKGGYEKTWKLGD peptide or the captured phage S1-6 using the EFTSKAR peptide according to the present invention provides for the manipulation of M13 phage using phage display technology.
[0021] More specifically, the method comprises the steps of providing a phage display library of M13 phages, biopanning the phage library using His-tagged S1 spike protein, or providing magnetic microspheres functionalized with SARS-CoV-2 spike S1 protein, or selecting a previously selected phage library by biopanning against the functionalized magnetic microspheres, or eluting the selected phages and separating them from the magnetic microspheres, or isolating from among the selected phages, phages that display on their P8 protein their coat peptide of the sequence FHKGGYEKTWKLGD or EFTSKAR.
[0022] The method for detecting SARS-CoV-2 virus according to the present invention uses the aforementioned kit containing the S-α capture phage or FHKGGYEKTWKLGD peptide or S1-6 capture phage or EFTSKAR peptide immobilized on a surface of the aforementioned type, and comprises the following steps: providing a sample containing the SARS-CoV-2 virus, capturing the SARS-CoV-2 virus using the surface-immobilized S-α capture phage or FHKGGYEKTWKLGD peptide, or S1-6 capture phage or EFTSKAR peptide, isolating the SARS-CoV-2 virus via an appropriate washing procedure, and detecting the capture of the virus by the S-α capture phage or FHKGGYEKTWKLGD peptide, or S1-6 capture phage or EFTSKAR peptide by an appropriate transduction method, such as optical, electrical, electrochemical, or electroluminescent transduction.
[0023] When magnetic microspheres are used as the surface, the step of isolating the viruses by washing involves capturing the magnetic microspheres with a magnetic device.
[0024] According to the present invention, SARS-CoV-2 virus can be isolated from various types of samples, such as biopsies and swabs, and then used to diagnose SARS-CoV-2 viral disease.
[0025] These and other characteristics and advantages of the present invention will become apparent from the following description of preferred embodiments, given by way of example, but not by way of limitation, with the aid of the accompanying figures, in which elements designated with the same or similar numerical reference numbers indicate elements having the same or similar function and structure. [Brief explanation of the drawings]
[0026] [Figure 1a] 1 depicts captured phage S-α with the peptide sequence FHKGGYEKTWKLGD. [Figure 1b] 1 depicts S1-6 captured phage with the EFTSKAR peptide sequence. [Figure 2a] 1 depicts a surface functionalized with the FHKGGYEKTWKLGD peptide sequence. [Figure 2b] 1 depicts a surface functionalized with the EFTSKAR peptide sequence. [Figure 3] FIG. 1 shows a schematic diagram of a possible embodiment of a method for capturing the SARS-CoV-2 virus in the case of a surface represented by a magnetic microsphere functionalized with a capture phage. DETAILED DESCRIPTION OF THE INVENTION
[0027] According to the present invention, referring to Figures 1a and 1b, the phage (phage clone) for specific capture of the SARS-CoV-2 virus is an M13 phage appropriately engineered to display hundreds of peptides (up to 2,800) of the FHKGGYEKTWKLGD or EFTSKAR sequence on the major protein of its coat, i.e., the P8 protein - in Figures 1a and 1b, such phages are designated by reference numbers 10' and 10'', respectively. The FHKGGYEKTWKLGD or EFTSKAR sequence peptides have specific affinity for the spike S1 protein of the SARS-CoV-2 virus.
[0028] According to the present invention, a kit for capturing SARS-CoV-2 virus includes a surface functionalized with capture phage S-α or S1-6 (as shown in Figure 3), or a surface functionalized with the FHKGGYEKTWKLGD or EFTSKAR peptide (as shown in Figures 2a and 2b). In Figures 2a and 2b, the surface is designated by reference numeral 20, the FHKGGYEKTWKLGD peptide by reference numeral 12, and the EFTSKAR peptide by reference numeral 13. In Figure 3, the surface is designated by reference numeral 20'. Surfaces 20 and 20' are preferably selected from magnetic beads, metallic materials (e.g., gold or platinum), semiconductors (e.g., silicon or silicon nitride), or polymers (e.g., nitrocellulose). The magnetic microspheres preferably have a diameter of 0.5 μm to 2.7 μm.
[0029] Referring to Figure 3, a method for capturing SARS-CoV-2 virus (referred to as reference number 30) using the aforementioned kit containing capture phage S-α or S1-6 (referred to as reference number 10) and magnetic microspheres (referred to as reference number 20') is described below.
[0030] The method includes the following steps: providing a sample containing the SARS-CoV-2 virus; Using S-α or S1-6 capture phages to capture and immobilize SARS-CoV-2 virus on magnetic microspheres; Isolate the SARS-CoV-2 virus using an appropriate magnetic device (e.g., a magnet).
[0031] An operational example of the capture of SARS-CoV-2 virus by magnetic microspheres functionalized with S-α or S1-6 capture phages is shown below, demonstrating that the S-α capture phages are immobilized on the magnetic microspheres.
[0032] Following this example, 20 μL (1 mg) of Chemicell SIMAG-AMINE magnetic microspheres with a diameter of 1 μm were removed from the mother batch tube and added to 180 μL of sterile ultrapure water to obtain a concentration of 9x10. 9 Microspheres / mL. From the microsphere-containing uptake water, remove 20 μL and add to an additional 180 μL of water to achieve a concentration of 0.1 mg. Next, wash the microspheres once with 500 μL of water for 10 minutes on a wheel at 8 rpm at room temperature and collect on a magnet. Wash twice with 1 mL of MES buffer (0.9 g in 50 mL HO uptake, pH 6.0) for 10 minutes on a magnetic separator wheel at 8 rpm at room temperature. Then, resuspend the microspheres in 250 μL MES EDC buffer (250 μL MES buffer containing 0.01 g EDC). Next, collect 4 x 10 13 Take 10 μL of S-α phage from the solution and add it to 90 μL of water in a tube for a total volume of 100 μL, resulting in a ratio of approximately 336 phages per microsphere. Then, manually shake the tube for 1 minute and incubate it on a wheel for 2 hours. Next, wash the microspheres three times with 1 mL of PBS and collect them on a magnetic separator for 5 minutes on a wheel. Next, add 1.5 mL of blocking buffer (PBS + 4% BSA, 0.005 g sodium azide) and incubate on a wheel for 1 hour and 30 minutes. Next, collect the microbeads on a magnet for 20 minutes, wash them once with 500 μL PBS, and resuspend them in 200 μL PBS.
[0033] The ability of the aforementioned magnetic microspheres functionalized with S-α capture phage to detect SARS-CoV-2 virus was verified by ELISA method as shown below.
[0034] 20 μL of S-α phage-functionalized microspheres (1.8 x 10 7 A total of 336 phages per microsphere were added to 100 μL of SARS-CoV-2 (e.g., "Amplirum total SARS CoV-2 control SWAB") at different dilutions (1:5, 1:50, 1:100, 1:500). 100 μL of PBS was used in place of virus as a control (K-negative) in a 2 mL tube. The tube was incubated on a wheel at 100 rpm for 1 hour, followed by one wash with 100 μL of wash buffer. The microspheres were then collected on a magnet for 5 minutes. Then, 100 μL of anti-spike antibody HRP (monoclonal mouse anti-SARS-CoV-2 spike) diluted 1:200 was added to the tube and incubated on a wheel at 100 rpm for 1 hour. Next, five washes were performed with 100 μL of wash buffer. After the final wash, 100 μL of TMB was added, and the reaction was blocked with 100 μL of H2SO4. The supernatant was then transferred to a 96-well plate and the absorbance was read at 450 nm. The results obtained are shown in the following table:
[0035] [Table 1]
[0036] The above data demonstrate that S-α phage, which contains the FHKGGYEKTWKLGD functional sequence motif on the P8 protein, is effective in capturing SARS-CoV-2 virus up to a 1:50 dilution (absorbance greater than three times that of the control sample). In particular, the virus suspension used, "Amplirum total SARS-CoV-2 control SWAB," contained approximately 30,000 copies / mL of virus. In the test conducted, 100 μL of virus suspension was used, and the estimated yields were approximately 600 virions at a 1:5 dilution, approximately 60 virions at a 1:50 dilution, approximately 30 virions at a 1:100 dilution, and approximately 6 virions at a 1:500 dilution. While currently evaluated within the limitations of ELISA technology, the proposed detection method is capable of detecting 30–60 virions of SARS-CoV-2, a value similar to that detected by RT-PCR (500 copies / mL).
[0037] An exemplary embodiment of a method for obtaining the above-mentioned captured phages is outlined below.
[0038] To search for specific peptides that can bind to the spike S1 protein of the SARS-CoV-2 virus, the phage display library "M13 P8 phage display 12aa" was selected against magnetic microspheres (e.g., Dynabeads spheres) and His-Tag functionalized with the spike S1 protein of the SARS-CoV-2 virus was selected.
[0039] In the first step of selection, the phage display library is selected against non-functionalized magnetic beads, thereby eliminating all phages that may bind non-specifically to the material (thus obtaining a so-called subtractive library).
[0040] The library thus obtained is subjected to biopanning by resuspending His-tagged S1 spike protein (e.g., "SINOBIOLOGICAL INC. 40591-V08H") in 400 µL of sterile uptake water to a final concentration of 250 µg / mL.
[0041] Next, take 200 μL of the water containing 50 μg of spike S1 protein and transfer it to a microvial, for example, a 1.5 mL microvial. Next, add 150 μL of sterile water and 350 μL of 2X binding / wash buffer to the microvial until a final volume of 700 μL of phage display library is reached. The 2X binding / wash buffer used is, for example, 11.98 g L. -1 Prepared in 100 mM NaH2PO4 (e.g., Fluka catalogue number 71496 - 1 kg lot. BCBC5685V), 35.06 g L-1 NaCl (600 mM) (e.g., Fluka catalogue number S9888 - 1 kg lot 12740) and 0.02% Tween 20 (e.g., SIGMA catalogue number P1379 - 250 mL lot S8BE2460V).
[0042] To functionalize the magnetic microspheres, take 50 μL (2 mg) of His-tagged magnetic microspheres (e.g., using the "Dynabeads His-tag isolation and pulldown - Catalog 10103D, 10104D Invitrogen" kit) and transfer them to a sterile microvial (e.g., a 2 mL microvial) and place it on a magnet for 2 minutes. Next, add the spiked S1 His-tagged protein, previously diluted in 1X binding / wash buffer (700 μL), to the microspheres and mix. Next, incubate the microvial on a wheel for 10 minutes at room temperature. After the incubation time, place the microvial on the magnet for 2 minutes, aspirate the supernatant, and discard. Finally, wash four times with 300 μL of 1X binding / wash buffer for 2 minutes each, resulting in the microsphere / spiked S1 complex.
[0043] To select phages against the SARS-CoV-2 virus spike S1 protein, 700 μL of the previously obtained pre-adsorbed phage display library was mixed with the microsphere / spike S1 complexes described above and incubated in a wheel at room temperature for 30 minutes to obtain microsphere / spike S1 / phage complexes. The microvial containing the microsphere / spike S1 / phage complexes was then placed on a magnet for 2 minutes. The supernatant, containing the remainder of the phage library not bound to the spike S1 protein, was removed from the microvial, transferred to a new tube, and stored at -80°C. The microsphere / spike S1 / phage complexes remaining in the microvial were washed four times with 300 μL of 1X binding / wash buffer. For each wash, the microvial was placed on a wheel for 5 minutes and on a magnet for 2 minutes, and the supernatant was discarded.
[0044] After the final wash of the microsphere / spike S1 / phage complexes, the phages were incubated with 200 μL of glycine-BSA buffer (e.g., glycine HCl "SIGMA catalog G8898-1kg lot 055k0188" 22.3 g / L and BSA "Applichem catalog A6588-0100 lot.5Y009437" 0.1 g / L) at pH 2.2 at room temperature for 20 min.
[0045] To more efficiently release any phages still attached to the microspheres, the solution is preferably sonicated in an ice bath at 20 kHz for 10 minutes. Next, the microspheres are collected on a magnet for 5 minutes, and the supernatant containing the phages is collected. Finally, the eluate is neutralized with 150 μL of Tris-HCl buffer (1 M) at pH 9.1.
[0046] The pool of eluted phages obtained by the above method has the following titers: Total Library Titles = 1x10 13 TU / mL -Number of phages in 5 μL = 5 x 10 10 TU / mL (input) -Number of phages in 1 μL = 1 x 1010 TU / mL (input) - Number of target-binding phages (spike S1 protein) after selection = 5 x 10 4 TU / mL - Yield = number of phages ligated to target / input = 5x10 4 / 5x10 10 =1x10 -6
[0047] The resulting pool of eluted phage is then amplified to increase the phage population from the selection.
[0048] In the first step of amplification, E. coli TGI cells are incubated in lysogeny broth (LB) at 37°C under agitation until the optical density (OD600) reaches 0.8. Then, 800 μL of E. coli TGI cells are infected with 200 μL of the phage suspension eluted from the selection, and incubated at 37°C for 15 minutes under static conditions, followed by 20 minutes under light agitation. A 1 mL aliquot of this infected cell suspension is inoculated onto a 150 mm plate of LA + ampicillin + glucose medium and incubated at 37°C for 16 hours to obtain phage-infected E. coli TGI cells. A carpet of the aforementioned cells is then obtained, on top of which 7 mL of LB, 5 μL of ampicillin (from a 2000X stock solution) and 2.5 mL of 80% glycerol are poured. The cells are then scraped with a spatula, transferred to 20 mL tubes, and stored in aliquots at -20°C.
[0049] In the second amplification step, 10 μL of the cell suspension obtained from the scraping is inoculated into 2 mL of LA + ampicillin medium and incubated at 37 °C under agitation until an OD600 optical density of 0.4 is reached. A 500 μL aliquot of this suspension is dispensed into a tube, and 1 μL of helper phage M13K07 (10 phage / mL) is added to reach a final concentration of 10 phage / mL. The sample is incubated at 37 °C for 15 minutes stationary, then for 20 minutes with agitation at 250 rpm. The infected cells are then diluted with 1X PBS solution. 10-3 and 10 -4 100 μL of the diluted solution is spatulated in LA+ampicillin+IPTG+XGAL medium and incubated at 37° C. for 24 hours until blue colonies are obtained.
[0050] Approximately 50 random phages are then isolated, and each selected phage is labeled with an S and a serial number, except for one designated S-α. Each colony is amplified and then tested in an ELISA to find the phage most reactive with the spike S1 protein of the SARS-CoV-2 virus.
[0051] The SARS-CoV-2 spike S1 protein was adsorbed onto a microtiter plate in carbonate-bicarbonate buffer overnight. 2- / HCO3 - To prepare the buffer, 0.14 g of NaHCO3 and 0.079 g of Na2CO3 were added to 50 mL of H2O u.p. The solution was then filtered through a 0.22 μm filter, and 2 μL of spiked S1 protein was added to 10 μL of CO3. 2- / HCO3 - Resuspend in buffer and use spiked S1 protein at a final concentration of 5 μg / mL.
[0052] Next, wash the plate with wash buffer and shake it manually for 3 minutes. Next, add 300 μL / well of blocking buffer (PBS + 6% milk + 0.05% Tween 20) and incubate the plate at 37°C for 2 hours. Next, wash with 300 μL / well of wash buffer, add 100 μL / well of phage precipitate in TBS at a concentration of 10 phage / mL, and incubate the plate at 37°C for 1 hour. Then, wash five times with wash buffer for 1 minute each, add 100 μL / well of anti-M13-pVIII-HRP antibody (batch aliquot: 9547458n.27-9421-01) diluted 1:5000, and incubate the plate at 37°C for 1 hour. Next, add 300 μL / well of wash buffer and 100 μL / well of TMB and wash ten times for 1 minute each. The plate is then incubated in the dark for 30 minutes and monitored to confirm the development of phage staining. The reaction is blocked with 100 μL / well of H2SO4. Finally, the absorbance (Spike ads) is measured at 450 nm using a microplate reader (such as the "Multiskan" reader). Non-functionalized microspheres were used as a control (K-). The results are shown in the following table.
[0053] [Table 2]
[0054] Absorbance values shown in bold in the previous table indicate positive ELISA responses indicating that phages S30, S34, S35, S3, S1-6, S27, S36, S42, S43, and S-α recognize the spike S1 protein.
[0055] Furthermore, to evaluate the ability of the most reactive phages to recognize not only purified spike S1 protein but also whole SARS-CoV-2 virions, an ELISA procedure was performed using the method described above, using SARS-CoV-2 virus adsorbed to microtiter plates (e.g., "amplirum total SARS CoV-2 control SWAB") as a target. Non-functionalized microspheres were used as a control (K-). The results obtained are shown in the following table.
[0056] [Table 3]
[0057] The absorbance values shown in bold in the previous table indicate positive ELISA responses indicating that the S1-6, S11, S34, and S-α phages recognize the SARS-CoV-2 virus.
[0058] DNA from S1-6, S11, S34, and S-α phages was amplified by PCR and then sequenced to identify the coding sequences of p8 protein fusion peptides that can bind to spike S1 protein.
[0059] The reaction mixture used for PCR amplification was as follows: 21.25 μL of sterile PCRH2O, 10 μL of buffer, and 5 μL of each E24 primer (5'GCTACCCTCGTTCCGATGCTGTC3')-40RE (5'GTTTTCCCAGTCACGAC3') mixture. The mixture was denatured in a thermocycler at 95°C for 10 minutes, followed by the addition of 0.25 μL of myTAQ. Each sample was subjected to the following PCR cycles: 94°C for 4 minutes, followed by 30 cycles of 94°C for 30 seconds, 52°C for 30 seconds, 72°C for 30 seconds, and 72°C for 7 minutes. At the end of the process, 35 μL was used for DNA purification and sequencing.
[0060] The sequencing results were as follows: -S1-6, S11 and S34 phages showed nucleotide sequences corresponding to EFTSKAR. The -S-α phage displayed a functional coding sequence motif for the FHKGGYEKTWKLGD peptide.
Claims
1. A phage for specific capture of SARS-CoV-2 virus, the phage being an M13 phage engineered to display either an FHKGGYEKTWKLGD sequence peptide or an EFTSKAR sequence peptide on the P8 protein of its coat, the peptide having specific affinity for the spike S1 protein of the SARS-CoV-2 virus.
2. A kit for capturing SARS-CoV-2 virus, comprising a surface functionalized with a capture phage engineered as shown on the P8 protein of the coat FHKGGYEKTWKLGD sequence peptide or EFTSKAR sequence peptide, or a surface functionalized with the FHKGGYEKTWKLGD peptide or the EFTSKAR peptide.
3. 3. The kit of claim 2, wherein the surface is selected from a magnetic microsphere, a metal electrode, a semiconductor, or a polymer.
4. 4. The kit of claim 3, wherein the magnetic microspheres have a diameter of 0.5 μm to 2.7 μm.
5. - providing a sample containing the SARS-CoV-2 virus; - capturing the SARS-CoV-2 virus by a capture phage engineered as shown on the P8 protein of its coat FHKGGYEKTWKLGD or EFTSKAR sequence peptide, or by the FHKGGYEKTWKLGD or EFTSKAR peptide, respectively, said capture phage or peptide being immobilized on the surface; isolating the SARS-CoV-2 virus by a washing procedure; - detecting said capture of said SARS-CoV-2 virus by said capture phage or said peptide by transduction.
6. 6. The method of claim 5, wherein the transduction is optical or electrical or electrochemical or electroluminescent transduction.
7. 7. The method of claim 5 or 6, wherein the capture phage is immobilized on a magnetic microsphere, and the step of isolating the SARS-CoV-2 virus by the washing procedure comprises capturing the magnetic microsphere with a magnetic device.