Glycosyltransferase UGTSL2 mutant, glycosyltransferase mutant, and method for synthesizing rebaudioside M2
A glycosyltransferase UGTSL2 mutant with targeted mutations and a cascade reaction system addresses the limitations of NtUGT, achieving high enzymatic activity and thermostability for efficient rebaudioside M2 synthesis, suitable for green industrial applications.
Patent Information
- Application Number
- JP2025521475
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-30
- Filing Date
- 2024-04-26
- Publication Date
- 2025-10-09
AI Technical Summary
Current glycosyltransferases, such as NtUGT, suffer from low enzymatic activity and short half-life, limiting the efficient synthesis of rebaudioside M2, a high-value sweetener, due to their low thermostability.
A glycosyltransferase UGTSL2 mutant with specific amino acid mutations, such as N23E, R41P, H91K, K95D, and others, is developed, combined with sucrose synthase to form a cascade reaction system for efficient synthesis of rebaudioside M2, enhancing enzymatic activity and thermostability.
The mutant UGTSL2 exhibits high enzymatic activity and prolonged half-life, enabling efficient and cost-effective synthesis of rebaudioside M2 with improved yield and reduced costs, suitable for green industrial processing.
Smart Images

Figure 2025534044000001_ABST
Abstract
Description
[Technical Field]
[0001] This application claims priority from a Chinese patent filed on June 30, 2023, bearing application number 202310795002.3 and entitled "Glycosyltransferase mutant and method for catalytically synthesizing rebaudioside M2 therefrom," and from a Chinese patent filed on June 30, 2023, bearing application number 202310813254.4 and entitled "Method for synthesizing glycosyltransferase UGTSL2 mutant and rebaudioside M2 therefrom," the entire contents of which are incorporated herein by reference.
[0002] Technical Field The present invention relates to the technical field of biocatalytic synthesis, and in particular to a glycosyltransferase UGTSL2 mutant, a glycosyltransferase mutant and a method for catalytically synthesizing rebaudioside M2 therefrom. [Background technology]
[0003] Demand for natural, calorie-free sugar substitutes is increasing day by day, especially among diabetics. Stevioside is a natural, calorie-free ingredient extracted from stevia leaves and has been approved as a safe food additive in the United States, Europe, Asia, and other countries. In China, stevioside was approved as a food additive in 2014 for use in foods, beverages, nutritional supplements, and other products, and SGs have attracted widespread attention and attention.
[0004] Rebaudioside D is a stevioside with extremely promising applications. Its sweetness is 200 to 300 times greater than that of sucrose, but its short-lived bitter aftertaste adversely affects its market application and widespread use. Rebaudioside M2 is produced by adding another glucosyl group to the C-6' position of the first glucosyl group linked to the C19 position of rebaudioside D, resulting in increased sweetness and eliminated bitterness compared to rebaudioside D. Therefore, rebaudioside M2 has better sugar properties and a more pleasant taste than rebaudioside D.
[0005] Currently, rebaudioside M2 is a monoglycosylated derivative of rebaudioside D and can be obtained by biological transformation. NtUGT from tobacco (Nicotiana tomentosiformis) can catalyze the C-6' glycosylation of the first glucosyl group linked to the C19 position of stevioside compounds, so rebaudioside M2, a high-value sweetener, can be obtained by catalyzing rebaudioside D with NtUGT.
[0006] NtUGT is a "Leloir"-type glycosyltransferase belonging to the GT1 family. It typically synthesizes glycosides using UDPG as a glycosyl donor. It can be obtained in large quantities through heterologous expression in Escherichia coli or Saccharomyces cerevisiae. It is used to catalyze the synthesis of rebaudioside D to produce rebaudioside M2. With the ongoing improvement of UDPG production methods, it can now be synthesized in large quantities using enzymes such as SuSy. Based on this, the SuSy-UGT cascade reaction system uses SuSy to supply the glycosyl donor to NtUGT, enabling UDPG recycling and significantly reducing application costs. In the NtUGT-SuSy cascade reaction system, SuSy provides the glycosyl donor necessary for smooth glycosylation. When the rate of UDPG regeneration is not limiting (e.g., by increasing sucrose concentration), NtUGT is the key to high-efficiency synthesis of rebaudioside M2. Tobacco-derived NtUGTs have low thermostability, and the enzymes are generally inactivated after 10 h of catalysis, limiting the efficient application of glycosyltransferases. Summary of the Invention [Problem to be solved by the invention]
[0007] Therefore, the technical problem to be solved by the present invention is to provide an enzyme mutant of glycosyltransferase UGTSL2 with high enzymatic activity and long half-life, and a glycosyltransferase mutant with high M2 yield and high thermostability, by overcoming the deficiencies of the prior art glycosyltransferase UGTSL2, namely, low enzymatic activity and short half-life, and the deficiencies of NtUGT, namely, low thermostability. [Means for solving the problem]
[0008] In a first embodiment, the glycosyltransferase is a UGTSL2 mutant, and the UGTSL2 mutant is (A) Based on the amino acid sequence shown in SEQ ID NO: 1, The amino acid at position 23 is mutated from N to E, The amino acid at position 41 is mutated from R to P, The amino acid at position 91 is mutated from H to K, The amino acid at position 95 is mutated from K to D, The amino acid at position 123 is mutated from E to P, The amino acid at position 136 is mutated from L to F, The amino acid at position 151 is mutated from R to F, The amino acid at position 124 is mutated from H to E, The amino acid at position 168 mutates from V to Y, The amino acid at position 198 is mutated from C to K, The amino acid at position 202 is mutated from T to E, The amino acid at position 217 is mutated from W to K, The amino acid at position 225 is mutated from P to L, The amino acid at position 226 mutates from F to V, The amino acid at position 285 is mutated from A to V, The amino acid at position 333 is mutated from I to V, The amino acid at position 358 is mutated from N to F, The amino acid at position 392 is mutated from T to V, a protein obtained by mutating the amino acid at position 419 from I to K; (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function; and (C) A fusion protein obtained by linking a tag to the end of the protein defined in (A) or (B).
[0009] Preferably, the amino acid sequence of the UGTSL2 mutant is as shown in SEQ ID NO:3.
[0010] (A) an expression gene encoding the glycosyltransferase mutant according to claim 1 or 2; (B) a recombinant plasmid to which the expression gene of (A) is ligated, and (C) The biological material is either the recombinant expression plasmid or a recombinant cell containing an expression gene for the glycosyltransferase mutant.
[0011] The expressed gene is set forth in SEQ ID NO: 2: AAC is substituted with GAA at positions 69 to 71 of SEQ ID NO: 2; CGT is substituted with CCG at positions 121 to 123 of SEQ ID NO: 2, CAC is substituted with AAA at positions 271 to 273 of SEQ ID NO: 2, AAA is substituted with GAT at positions 283 to 285 of SEQ ID NO: 2, Positions 367 to 369 of SEQ ID NO: 2 are substituted from GAG to CCG, Positions 406 to 408 of SEQ ID NO: 2 are substituted from CTG to TTT, CGT is substituted with TTT at positions 451 to 453 of SEQ ID NO: 2, CAC is substituted with GAA at positions 370 to 372 of SEQ ID NO: 2; positions 502 to 504 of SEQ ID NO: 2 are substituted from GTG to TAT, positions 592 to 594 of SEQ ID NO: 2 are substituted from TGC to AAA; ACC is substituted with GAA at positions 604 to 606 of SEQ ID NO: 2; positions 649 to 651 of SEQ ID NO: 2 are substituted from TGG to AAA; Positions 673 to 675 of SEQ ID NO: 2 are substituted from CCG to CTG, Positions 676 to 678 of SEQ ID NO: 2 are substituted from TTC to GTT, Positions 853 to 855 of SEQ ID NO: 2 are substituted from GCG to GTT, ATT is substituted with GTT at positions 997 to 999 of SEQ ID NO: 2, AAC is substituted with TTC at positions 1072 to 1074 of SEQ ID NO: 2, Positions 1174 to 1176 of SEQ ID NO: 2 are substituted from ACC to GTT, and one or more mutations occurring, such as ATT to AAA substitution at positions 1255 to 1257 of SEQ ID NO: 2; Preferably, the nucleotide sequence of said expressed gene is as shown in SEQ ID NO:4.
[0012] The enzyme composition comprises a glycosyltransferase UGTSL2 mutant, a glycosyltransferase NtUGT_M, and a sucrose synthase AtSuSy, wherein the glycosyltransferase UGTSL2 mutant is as defined in claim 1 or 2; The glycosyltransferase NtUGT_M has the amino acid sequence of: (A1) SEQ ID NO: 5; or (A2) A protein having 95% or more identity with the amino acid sequence defined in (A1) and having the same function, The sucrose synthase AtSuSy has the amino acid sequence shown in SEQ ID NO: 7 (B1), or (B2) A protein having 95% or more identity with the amino acid sequence defined in (B1) and having the same function.
[0013] Preferably, the enzyme activity ratio between the glycosyltransferase UGTSL2 mutant and NtUGT_M is 3 to 7:7 to 3.
[0014] A set of recombinant strains that express the above enzyme composition comprises recombinant strain A and recombinant strain B, wherein the recombinant strain A comprises recombinant plasmid A obtained by constructing together into an expression vector a nucleic acid molecule encoding the glycosyltransferase UGTSL2 mutant described in claim 1 or 2 and a nucleic acid molecule encoding the sucrose synthase AtSuSy, and the recombinant strain B comprises recombinant plasmid B obtained by constructing together into a plasmid a nucleic acid molecule encoding the glycosyltransferase NtUGT_M and a nucleic acid molecule encoding the sucrose synthase AtSuSy, and the amino acid sequence of the glycosyltransferase NtUGT_M is as shown in SEQ ID NO: 5.
[0015] Host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia yeast, or Corynebacterium glutamicum.
[0016] The one-pot biocatalytic synthesis of rebaudioside M2 from rebaudioside A is as follows: The method includes the steps of adding rebaudioside A, sucrose, and the enzyme composition or the induced expression enzyme product of the recombinant strain of the set described in claim 5 to a catalytic reaction system, reacting, inactivating the enzyme, and centrifuging to obtain a supernatant containing rebaudioside M2, where M2 is represented by the following formula (I): [ka]
[0017] Preferably, the method for obtaining an inducibly expressed enzyme product of the recombinant strain includes the steps of: 1) activating the recombinant strain of the set, transferring it to an induction medium, adding an inducer to perform induction culture, centrifuging to collect the bacterial cells, resuspending and disrupting the bacterial cells in an appropriate amount of buffer, and centrifuging to collect the supernatant, which is the inducibly expressed enzyme product; the reaction time is 5 to 100 hours.
[0018] Preferably, the final concentration of the inducer is 0.02 to 1 g / L, and the induction time is 4 to 50 hours.
[0019] Preferably, the concentration of rebaudioside A in the catalytic reaction system is 1 to 1000 g / L, the sucrose concentration is 1 to 9000 g / L, the amount of the inducibly expressed enzyme product added is 1 to 100 MU / L, the pH of the catalytic reaction system is 7.0 to 8.5, preferably 7.0, the reaction temperature is 37 to 40°C, and the enzyme activity ratio of the glycosyltransferase UGTSL2 mutant to NtUGT_M is 3 to 7:7 to 3.
[0020] The catalytic reaction system further contains 1 to 4 mM UDP, preferably 3 mM UDP.
[0021] The present invention has the following advantages (1) to (3).
[0022] (1) The mutant has high enzymatic activity and a long half-life.
[0023] (2) The method of synthesizing rebaudioside M2 from rebaudioside A in a one-pot biocatalysis method of the present application realizes efficient catalysis of rebaudioside A to synthesize rebaudioside M2 in a short time, and the bioenzyme catalytic method is green, environmentally friendly, and pollution-free, making it more suitable for current green industrial processing and production.
[0024] (3) The one-pot biocatalytic synthesis of rebaudioside A to rebaudioside M2 establishes a dual enzyme system to realize the regeneration of UDPG in the body, effectively solving the problem of expensive glycosyl donors, reducing costs, and promoting the application of the biotechnology industry.
[0025] In summary, this application uses consensus strategies, protein molecular dynamics simulations, computer simulations, and screening techniques to construct a site-directed mutation library for the glycosyltransferase UGTSL2 from its structure and then perform protein engineering on UGTSL2. By coupling the glycosyltransferase with sucrose synthase, the glycosyl donor substrate UDPG is recycled using inexpensive sucrose. A "one-pot three-enzyme" cascade reaction system is then established to synthesize rebaudioside M2 from the inexpensive raw material rebaudioside A.
[0026] In a second aspect, the present application provides a glycosyltransferase mutant, the glycosyltransferase mutant comprising: A1) A protein having 90% or more identity with the original protein and having the same function as the amino acid sequence shown in SEQ ID NO: 66, obtained through substitution of amino acid residues; or A2) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of A1).
[0027] Preferably, the glycosyltransferase mutant has the amino acid sequence shown in SEQ ID NO: 66: B1) The amino acid at position 10 is mutated from alanine (A) to valine (V), B2) The amino acid at position 51 is mutated from glutamine (Q) to lysine (K), B3) The amino acid at position 72 is mutated from phenylalanine (F) to leucine (L), B4) The amino acid at position 87 is mutated from leucine (L) to proline (P), B5) The amino acid at position 123 is mutated from leucine (L) to proline (P), B6) The amino acid at position 157 is mutated from leucine (L) to proline (P), B7) The amino acid at position 219 is mutated from asparagine (N) to aspartic acid (D), B8) The amino acid at position 380 is mutated from glycine (G) to leucine (L), B9) A protein obtained by substitution of one or more amino acid residues, including mutation of the amino acid at position 400 from serine (S) to arginine (R).
[0028] Preferably, the amino acid sequence of the glycosyltransferase mutant is an amino acid sequence obtained by inducing all mutations other than B9) above in SEQ ID NO: 66.
[0029] The present invention provides a biomaterial, the biomaterial comprising: C1) a nucleic acid molecule encoding said protein; C2) an expression cassette comprising the nucleic acid molecule of C1); C3) a recombinant vector comprising the nucleic acid molecule of C1), or a recombinant vector comprising the expression cassette of C2); C4) a recombinant microorganism comprising the nucleic acid molecule of C1), or the expression cassette of C2), or the recombinant vector of C3), and C5) A transgenic plant cell line comprising the nucleic acid molecule of C1), or a transgenic plant cell line comprising the expression cassette of C2).
[0030] The nucleic acid molecule encoding the protein is set forth in SEQ ID NO: 65: CAG at positions 150 to 152 of SEQ ID NO: 65 is substituted with AAG, TTC at positions 216 to 218 of SEQ ID NO: 65 is substituted with CTT, CTG at positions 391 to 393 of SEQ ID NO: 65 is substituted with CCT, TTG at positions 471 to 473 of SEQ ID NO: 65 is substituted with CCT, AAC at positions 657 to 659 of SEQ ID NO: 65 is substituted with GAC; GCT at positions 28 to 30 of SEQ ID NO: 65 GTT is replaced by CTG at positions 259 to 261 of SEQ ID NO: 65 CCT is replaced by GGT at positions 1138 to 1140 of SEQ ID NO: 65 TTAThe mutations are those in which one or more of the following are substituted:
[0031] Preferably, the nucleotide sequence of the nucleic acid molecule encoding said protein is as set forth in SEQ ID NO:69.
[0032] The present invention further provides a method for catalytically synthesizing rebaudioside M2 using a glycosyltransferase mutant, comprising: 1) constructing a recombinant strain comprising the co-expression of two enzymes by constructing both the encoding gene of the glycosyltransferase mutant and the sucrose synthase gene into an expression vector to obtain a recombinant plasmid, and then transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain comprising the co-expression of two enzymes; 2) inducing the recombinant strain to express the glycosyltransferase mutant and the sucrose synthase; and 3) producing the following rebaudioside M2 from rebaudioside D and sucrose as raw materials using the two enzymes in step 2). [ka]
[0033] Preferably, the expression vector is pRSFDuet-1.
[0034] Preferably, the final concentration of the inducer used for the induced expression in step 2) is 0.02 to 1 g / L, and the induction time is 4 to 50 hours.
[0035] Preferably, step 2) comprises harvesting the cells, disrupting the cells, centrifuging the cells, and collecting the supernatant to obtain the crude enzyme.
[0036] Preferably, in step 3), the concentration of rebaudioside D is 1 to 500 g / L, the concentration of sucrose is 1 to 1500 g / L, and the amount of crude enzyme added is 1 to 100 g / L.
[0037] Preferably, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia yeast, or Corynebacterium glutamicum.
[0038] Preferably, the rebaudioside D is catalytically synthesized using a glycosyltransferase and rebaudioside A as a substrate.
[0039] The present invention uses glycosyltransferase NtUGT as a starting point, performs site-directed mutations on its active center residues, and compares the relative activity and half-life of the mutant strains to obtain an optimal glycosyltransferase mutant, NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L. This glycosyltransferase mutant is then cascaded with sucrose synthase to catalytically synthesize rebaudioside M2 using stevioside as a substrate and an appropriate amount of sucrose. This mutant is simple to generate and achieves efficient catalytic synthesis of rebaudioside M2. Under the same conditions, the mutant is 5.7-fold more active and approximately 2.9-fold shorter half-life than the original enzyme, resulting in a significantly improved yield of rebaudioside M2 compared to the original enzyme. The catalytic efficiency of the reaction system based on the mutant strain NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L was higher than that of the unmutated system, and the rebaudioside M2 concentration reached 36.7 g / L after 36 h of reaction, with a yield of over 95%.
[0040] The present invention improves the thermostability of glycosyltransferase NtUGT by mutation, and 35℃ The time to production of rebaudioside M2 is increased by approximately 3 times, the catalytic activity is improved by approximately 10 times, and the efficiency of catalytic production of rebaudioside M2 is also improved.
[0041] The present invention improves the enzymatic activity of glycosyltransferase NtUGT by site-directed mutation, and uses the mutant to achieve efficient catalytic synthesis of rebaudioside M2. The synthesis method requires mild conditions, is easy to operate, takes a short time, has high catalytic efficiency, and high yield, and has good application prospects.
[0042] In order to more clearly describe the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly describe the drawings that need to be used in the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings based on these drawings without any creative work. [Brief explanation of the drawings]
[0043]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
[0044] LB medium: NaCl 10g / L, yeast powder 5g / L, peptone 10g / L, agar 20g / L.
[0045] Example 1 Preparation of recombinant bacteria expressing glycosyltransferase UGTSL mutant and sucrose synthase AtSuSy The dual-gene expression vector pRSFDuet-1 (disclosed in Han Guangwei, "Co-expression and Immunogenicity Study of Clostridium perfringens Alpha, β_1, β_2, and ε Toxin Proteins [D]," Chinese Academy of Agricultural Sciences, 2014) was selected. The nucleotide sequence of the glycosyltransferase UGTSL or mutant encoding gene from Stevia rerio was inserted into the NdeI / XhoI site of the vector, and the nucleotide sequence of the sucrose synthase AtSuSy from Arabidopsis thaliana was inserted into the NcoI / EcoRI site to obtain the recombinant expression plasmid pRSFDuet-1-AtSuSy-UGTSL. The recombinant plasmid was then transformed into Escherichia coli BL21(DE3) and induced for expression, yielding BL21-pRSFDuet-1-AtSuSy-UGTSL. The amino acid sequence of glycosyltransferase UGTSL is shown in SEQ ID NO:1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO:2.
[0046] The mutants contain the following single point mutations: UGTSL2_N23E, UGTSL2_R41P, UGTSL2_H91K, UGTSL2_K95D, UGTSL2_E123P, UGTSL2_L136F, UGTSL2_R151F, UGTSL2_H124E, UGTSL2_V168Y, UGTSL2_C198K, UGTSL2_T202E, UGTSL2_W217K, UGTSL2_P225L, UGTSL2_F226V, UGTSL2_A285V, UGTSL2_I333V, UGTSL2_N358F, UGTSL2_T392V, and UGTSL2_I419K.
[0047] N23E is a mutation of the amino acid at position 23 of SEQ ID NO: 1 from N to E, and a nucleic acid molecule encoding the mutant protein is a substitution of AAC to GAA at positions 69 to 71 of SEQ ID NO: 2; R41P is a mutation of the amino acid at position 41 of SEQ ID NO: 1 from R to P, and a nucleic acid molecule encoding the mutant protein is a substitution of CGT to CCG at positions 121 to 123 of SEQ ID NO: 2; H91K is a mutation of the amino acid at position 91 of SEQ ID NO: 1 from H to K, and a nucleic acid molecule encoding the mutant protein is a substitution of positions 271 to 273 of SEQ ID NO: 2 from CAC to AAA; K95D is a mutation of the amino acid at position 95 of SEQ ID NO: 1 from K to D, and a nucleic acid molecule encoding the mutant protein is a substitution of positions 283 to 285 of SEQ ID NO: 2 from AAA to GAT; E123P is a mutation of the amino acid at position 123 of SEQ ID NO: 1 from E to P, and a nucleic acid molecule encoding the mutant protein is a substitution of GAG to CCG at positions 367 to 369 of SEQ ID NO: 2; L136F is a mutation of the amino acid at position 136 of SEQ ID NO: 1 from L to F, and the nucleic acid molecule encoding the mutant protein is a substitution of positions 406 to 408 of SEQ ID NO: 2 from CTG to TTT; R151F is a mutation of the amino acid at position 151 of SEQ ID NO: 1 from R to F, and the nucleic acid molecule encoding the mutant protein is a substitution of CGT to TTT at positions 451 to 453 of SEQ ID NO: 2; H124E is a mutation of the amino acid at position 124 of SEQ ID NO: 1 from H to E, and a nucleic acid molecule encoding the mutant protein is a substitution of CAC to GAA at positions 370 to 372 of SEQ ID NO: 2; V168Y is a mutation of the amino acid at position 168 of SEQ ID NO: 1 from V to Y, and a nucleic acid molecule encoding the mutant protein is a substitution of GTG to TAT at positions 502 to 504 of SEQ ID NO: 2; C198K is a mutation of the amino acid at position 198 of SEQ ID NO: 1 from C to K, and a nucleic acid molecule encoding the mutant protein is a substitution of positions 592-594 of SEQ ID NO: 2 from TGC to AAA; T202E is a mutation of the amino acid at position 202 of SEQ ID NO: 1 from T to E, and a nucleic acid molecule encoding the mutant protein is a substitution of ACC to GAA at positions 604 to 606 of SEQ ID NO: 2; W217K is a mutation of the amino acid at position 217 of SEQ ID NO: 1 from W to K, and a nucleic acid molecule encoding the mutant protein is a substitution of positions 649 to 651 of SEQ ID NO: 2 from TGG to AAA; P225L is a mutation of the amino acid at position 225 of SEQ ID NO: 1 from P to L, and a nucleic acid molecule encoding the mutant protein is a substitution of CCG to CTG at positions 673 to 675 of SEQ ID NO: 2; F226V is a mutation of the amino acid at position 226 of SEQ ID NO: 1 from F to V, and the nucleic acid molecule encoding the mutant protein is a substitution of TTC to GTT at positions 676 to 678 of SEQ ID NO: 2; A285V is a mutation of the amino acid at position 285 of SEQ ID NO: 1 from A to V, and the nucleic acid molecule encoding the mutant protein is a substitution of GCG to GTT at positions 853 to 855 of SEQ ID NO: 2; I333V is a mutation of the amino acid at position 333 of SEQ ID NO: 1 from I to V, and the nucleic acid molecule encoding the mutant protein is a substitution of ATT to GTT at positions 997 to 999 of SEQ ID NO: 2; N358F is a mutation of the amino acid at position 358 of SEQ ID NO: 1 from N to F, and a nucleic acid molecule encoding the mutant protein is a substitution of AAC to TTC at positions 1072 to 1074 of SEQ ID NO: 2; T392V is a mutation of the amino acid at position 392 of SEQ ID NO: 1 from T to V, and the nucleic acid molecule encoding the mutant protein is a substitution of ACC to GTT at positions 1174 to 1176 of SEQ ID NO: 2; I419K is a mutation of the amino acid at position 419 of SEQ ID NO: 1 from I to K, and a nucleic acid molecule encoding the mutant protein is a substitution of ATT to AAA at positions 1255 to 1257 of SEQ ID NO: 2; The UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K- / T202E / W217K / P225L / F226V / A285V / I333V / N358F / T392V / I419K protein mutant contains all of the above mutations and is named UGTSL2_M, and its amino acid sequence is as shown in SEQ ID NO: 3. The nucleotide sequence of the nucleic acid molecule encoding the mutant protein is as shown in SEQ ID NO: 4.
[0048] A specific method for preparing a recombinant expression strain of a glycosyltransferase UGTSL mutant includes the following steps S1 to S5.
[0049] Step S1 involved PCR amplification of the coding gene of the site-directed mutant. Rapid mutation was performed using the PCR amplification technique with the plasmid of the unmutated strain BL21-pRSFDuet-1-AtSuSy-UGTSL as template DNA (underlined bases are mutated).
[0050] Primers for N23E site-specific mutagenesis: Forward primer: 5'-CCGTTTCTG GAA ATTGCGAAACAGCTGGCGGAT-3' (SEQ ID NO: 9) Reverse primer: 5'-CGCAAT TTC CAGAAACGGGCTGATGTGACCGTA-3' (SEQ ID NO: 10) Primers for R41P site-specific mutation: Forward primer: 5'-AGCACC CCG ATTAACCTGGAGAGCATCATTAAGAAAATC-3' (SEQ ID NO: 11) Reverse primer: 5'-GTTAAT CGG GGTGCTGCACAGGTAGATCAGGAA-3' (SEQ ID NO: 12) Primers for H91K site-directed mutation: Forward primer: 5'-ACCCTG AAAAAGGCGCTGAAAATGAGCAAGCCG-3' (SEQ ID NO: 13) Reverse primer: 5'-CGCCTT TTT CAGGGTCGGGTTCAGGTGCGGCGG-3' (SEQ ID NO: 14) Primers for K95D site-directed mutation: Forward primer: 5'-GCGCTG GAT ATGAGCAAGCCGAACTTTAGCCGT-3' (SEQ ID NO: 15) Reverse primer: 5'-GCTCAT ATC CAGCGCCTTGTGCAGGGTCGGGTT-3' (SEQ ID NO: 16) Primers for E123P site-directed mutation: Forward primer: 5'-TGGGCG CCG CACGTTGCGAACGAACAAAACATT-3' (SEQ ID NO: 17) Reverse primer: 5'-AACGTG CGG CGCCCACGGCTGCAGCACGTCGTA-3' (SEQ ID NO: 18) Primers for L136F site-directed mutation: Forward primer: 5'-GCGGGTAAA TTT CTGACCAGCTGCGCGGCGGTG-3' (SEQ ID NO: 19) Reverse primer: 5'-GGTCAG AAA TTTACCCGCCGGAATGTTTTGTTC-3' (SEQ ID NO: 20) Primers for R151F site-directed mutation: Forward primer: 5'-TTT TTT AAGAACCCGGGCGTTGAGTTCCCGTTT-3' (SEQ ID NO: 21) Reverse primer: 5'-GCCCGGGTTCTT AAA AAAGCTAAAGAAATAGCTGAACACCGC-3' (SEQ ID NO: 22) Primers for H124E site-directed mutagenesis: Forward primer: 5'-GCGGAG GAAGTTGCGAACGAACAAAACATTCCGGCG-3' (SEQ ID NO: 23) Reverse primer: 5'-TTCGTTCGCAAC TTC CTCCGCCCACGGCTGCAGCAC-3' (SEQ ID NO: 24) Primers for V168Y site-specific mutation: Forward primer: 5'-CCGGAA TAT GAAAAGGTTAAAATCCGTGAGATTCTGGCG-3' (SEQ ID NO: 25) Reverse primer: 5'-CTTTTC ATA TTCCGGCAGGTGGATCGCCGGAAA-3' (SEQ ID NO: 26) Primers for C198K site-directed mutation: Forward primer: 5'-CTGATG AAA ACCAGCCGTACCATCGAGGCGAAA-3' (SEQ ID NO: 27) Reverse primer: 5'-GCTGGT TTT CATCAGCATCATCTGCTTGTTACC-3' (SEQ ID NO: 28) Primers for T202E site-directed mutation: Forward primer: 5'-AGCCGT GAA ATCGAGGCGAAATACATTGACTATTGC-3' (SEQ ID NO: 29) Reverse primer: 5'-CTCGAT TTC ACGGCTGGTGCACATCAGCAT-3' (SEQ ID NO: 30) Primers for W217K site-directed mutation: Forward primer: 5'-CTGTGCAAC AAA AAGGTGGTTCCGGTGGGTCCG-3' (SEQ ID NO: 31) Reverse primer: 5'-CACCTT TTT GTTGCACAGTTCGGTGCAATAGTC-3' (SEQ ID NO: 32) Primers for P225L site-directed mutation: Forward primer: 5'-GGTCCG CTGTTCCAAGATCTGATCACCAACGAT-3' (SEQ ID NO: 33) Reverse primer: 5'-TTGGAA CAG CGGACCCACCGGAACCACCTTCCA-3' (SEQ ID NO: 34) Primers for F226V site-directed mutation: Forward primer: 5'-CCGCCG GTT CAAGATCTGATCACCAACGATGCG-3' (SEQ ID NO: 35) Reverse primer: 5'-ATCTTG AAC CGGCGGACCCACCGGAACCAC-3' (SEQ ID NO: 36) Primers for A285V site-directed mutation: Forward primer: 5'-TGGGTT GTT CGTTTTCCGAAAGGCGAGGAACGT-3' (SEQ ID NO: 37) Reverse primer: 5'-AAAACG AAC AACCCAGATGAAGTTCACGTTGCT-3' (SEQ ID NO: 38) Primers for I333V site-directed mutation: Forward primer: 5'-GGCTTC GTT AGCCACTGCGGTTGGAACAGCGCG-3' (SEQ ID NO: 39) Reverse primer: 5'-GTGGCT AAC GAAGCCACCGGTGCTCGGGTGGTT-3' (SEQ ID NO: 40) Primers for N358F site-directed mutation: Forward primer: 5'-CCGATCCAC TTC GACCAACCGATTAACGCGAAACTGATGGT-3' (SEQ ID NO: 41) Reverse primer: 5'-CGGTTGGTC GAA GTGGATCGGCATCGCAATGATCGGAACGC-3' (SEQ ID NO: 42) Primers for T392V site-directed mutation: Forward primer: 5'-GCGGAA GTTCTGAAGAGCGTGGTTACCGGC-3' (SEQ ID NO: 43) Reverse primer: 5'-CTTCAG AAC TTCCGCAATCTCGCCACGGTG-3' (SEQ ID NO: 44) Primers for I419K site-directed mutation: Forward primer: 5'-AAGAGC AAA CGTGATGAGGAAATGGACGCGGTT-3' (SEQ ID NO: 45) Reverse primer: 5'-CTCATCACG TTT GCTCTTCAGGTTTTTGCTGATTTCACG-3' (SEQ ID NO: 46)
[0051] In step S2, the PCR target plasmid amplification reaction system consisted of 2 μL each of 10 μM forward primer and reverse primer, 1 μL of dNTP mix, 25 μL of 2×max buffer, 1 μL of template plasmid, and 1 μL of 2U / 50 μL Super-Fidelity DNA polymerase, which was supplemented to 50 μL with sterile water (ddh2O).
[0052] PCR target plasmid amplification reaction conditions were: pre-denaturation at 95°C for 30 s, 30 cycles (denaturation at 95°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 7 min), extensive extension at 72°C for 5 min, and final incubation at 16°C. PCR amplification products were detected by agarose gel electrophoresis.
[0053] In step S3, 1 μL of DpnI endonuclease was added to the PCR-amplified product with confirmed mutations. The reaction mixture was then incubated at 37°C for 1–2 h, transferred to competent E. coli BL21(DE3) cells, and placed on ice for 30 min. Then, heat-shocked at 42°C for 45–90 s and placed on ice for 2 min. 600 μL of LB medium was added and the mixture was shaken at 37°C and 200 rpm for 45 min. The entire mixture was then evenly spread onto a kanamycin-resistant LB plate and cultured overnight at 37°C. Two single colonies were selected from the plate and inoculated into LB liquid medium. After 9 h, the glycerol tube containing the culture was preserved and sequenced. The glycerol tube containing the correct sequence was plated onto a kanamycin-resistant LB plate and activated in a shaker tube. The plasmid was then extracted and the recombinant plasmid was then introduced into E. coli BL21(DE3).
[0054] In step S4, the recombinant expression strains of the mutants UGTSL2_N23E, UGTSL2_R41P, UGTSL2_H91K, UGTSL2_K95D, UGTSL2_E123P, UGTSL2_L136F, UGTSL2_R151F, UGTSL2_H124E, UGTSL2_V168Y, UGTSL2_C198K, UGTSL2_T202E, UGTSL2_W217K, UGTSL2_P225L, UGTSL2_F226V, UGTSL2_A285V, UGTSL2_I333V, UGTSL2_N358F, UGTSL2_T392V and UGTSL2_I419K were obtained by the above method.
[0055] In step S5, the method for obtaining a recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E- / V168Y / C198K- / T202E / W217K / P225L / F226V / A285V / I333V / N358F / T392V / I419K protein mutant is as follows (1) to (3).
[0056] (1) The plasmid of the BL21-pRSFDuet-1-AtSuSy-UGTSL strain was used as the template plasmid for the target plasmid amplification reaction system in step 2 above, and the primers were primers for N23E site-specific mutation. Steps 2 and 3 above were repeated to obtain the N23E strain.
[0057] (2) The confirmed mutated N23E plasmid was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers were primers for R41P site-specific mutation. Steps 2 and 3 above were repeated to obtain the N23E / R41P strain.
[0058] (3) The mutated N23E / R41P plasmid was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers were primers for H91K site-specific mutation. Steps 2 and 3 above were repeated to obtain the N23E / R41P / H91K strain.
[0059] Similarly, recombinant expression strains of UGTSL2_N23E / R41P / H91K / K95D protein mutants, Recombinant expression strain of N23E / R41P / H91K / K95D / E123P protein mutant, Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95DN23E / R41P / H91K / K95D / E123P / L136F protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V / A285V protein mutant; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V / A285V / I333V protein mutants; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V / A285V / I333V / N358F protein mutants; Recombinant expression strain of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V / A285V / I333V / N358F / T392V protein mutants; The recombinant expression strains of UGTSL2_N23E / R41P / H91K / K95D / E123P / L136F / R151F / H124E / V168Y / C198K / T202E / W217K / P225L / F226V / A285V / I333V / N358F / T392V / I419K protein mutants were obtained sequentially.
[0060] Example 2: Obtaining crude enzyme solutions of UGTSL2 and mutants The recombinant expression strains containing UGTSL2 and its mutants prepared in Example 1 were plated onto LB solid plates (10 g / L NaCl, 5 g / L yeast powder, 10 g / L peptone, and 20 g / L agar) containing 50 μg / L kanamycin and incubated in an incubator at 37°C for 12 h. The next day, a single colony was selected from the plate and placed in a shaker tube containing 5 mL of LB liquid medium (containing 50 μg / L kanamycin). The tube was then incubated at 37°C and 200 rpm for 12 h to obtain seed solution. The seed solution was then inoculated into 100 mL of TB medium (containing 25 g / L yeast powder, 15 g / L peptone, 10 g / L NaCl, 2 g / L glucose, 0.5 g / L lactose, and 50 μg / L kanamycin) at a 1% (v:v) inoculum size. The tube was then incubated at 37°C and 200 rpm in a shaker. After 2 hours, the temperature was adjusted to 25°C and the culture was continued for 20 to 22 hours.
[0061] The fermentation broth was collected and centrifuged (4°C, 7000 rpm, 6 min) in a freezer. The supernatant was discarded to obtain a bacterial sludge, which was then washed twice with potassium phosphate buffer. An appropriate amount of potassium phosphate buffer was then added, and the mixture was placed in an ice-water mixture. The bacterial cells were then sonicated using an ultrasonicator at φ6, 300 W, and 30 min. The mixture was then centrifuged in a freezer at 4°C, 8000 rpm, and 30 min. The supernatant was collected and used as a crude enzyme solution. This was then stored in a refrigerator at 4°C for further use.
[0062] The enzymatic activity of glycosyltransferase NtUGT_M was measured by adding 1 mM substrate rebaudioside D, 2 mM UDPG, and 0.5 mg of crude enzyme to 3 mL of enzyme-catalyzed reaction mixture, then supplementing with 100 mM potassium phosphate buffer, pH 7.2. The reaction conditions were 30°C and 200 rpm, with sampling times of 0, 20, and 30 min. Sample treatment: 500 μL was taken and inactivated in a water bath at 95°C for 5 min, followed by HPLC detection. Enzyme activity definition (U): The amount of enzyme required to transform and produce 1 μmol of product per minute is 1 enzyme activity unit. The activity of the wild-type enzyme was defined as 100%, and the relative activity of the other mutant enzymes was calculated.
[0063] The enzyme activity of the glycosyltransferase UGTSL2 was measured by adding 1 mM substrate rebaudioside A, 2 mM UDPG, and 0.5 mg of crude enzyme to 3 mL of enzyme-catalyzed reaction mixture, then supplementing with 100 mM potassium phosphate buffer, pH 7.2. The reaction conditions were 30°C and 200 rpm, with sampling times of 0, 20, and 30 min. Sample treatment: 500 μL was taken and inactivated in a water bath at 95°C for 5 min, followed by HPLC detection. Enzyme activity definition (U): The amount of enzyme required to transform and produce 1 μmol of product per minute is 1 enzyme activity unit. The enzyme activity of the wild-type enzyme was defined as 100%, and the relative enzyme activity of the other mutant enzymes was calculated.
[0064] The half-life detection method was the same as above, incubating the wild-type and mutant enzymes for different periods of time in a water bath at 37°C, measuring the enzyme activity, and generating half-life curves to determine the half-life. The enzyme activity detection method was the same as above. The enzyme activity detection showed that the multi-point mutant UGTSL2_M not only had 690% of the enzyme activity of the wild-type enzyme, but also had a half-life that was extended by 9.4 hours, indicating that its ability to catalyze rebaudioside D was much greater than that of the wild-type enzyme. The specific data are shown in Table 1.
[0065] [Table 1]
[0066] Example 3 Construction of a triple enzyme coupling system The glycosyltransferase UGTSL2_M (nucleotide sequence shown in SEQ ID NO: 4) derived from Stevia was inserted into the NdeI / XhoI site of the pRSFDuet-1 vector obtained in Example 1, and the nucleotide sequence of the sucrose synthase AtSuSy derived from Arabidopsis thaliana (SEQ ID NO: 8) was inserted into the NcoI / EcoRI site to obtain the recombinant expression plasmid pRSFDuet-1-AtSuSy-UGTSL. This was then introduced into E. coli BL21(DE3) for induction and expression, yielding BL21(DE3)-pRSFDuet-1-AtSuSy-UGTSL. The amino acid sequence of the sucrose synthase AtSuSy derived from Arabidopsis thaliana is shown in SEQ ID NO: 7.
[0067] The dual gene expression vector pRSFDuet-1 was selected, and the nucleotide sequence of the glycosyltransferase NtUGT_M from Stevia (SEQ ID NO: 6) was inserted into the NdeI / XhoI site of the vector, and the nucleotide sequence of the sucrose synthase AtSuSy from Arabidopsis (SEQ ID NO: 8) was inserted into the NcoI / EcoRI site to obtain pRSFDuet-1-NtUGT_M-AtSuSy. This recombinant plasmid was then introduced into E. coli BL21(DE3) for induction and expression, yielding BL21(DE3)-pRSFDuet-1-NtUGT_M-AtSuSy. The amino acid sequence of the glycosyltransferase NtUGT_M is shown in SEQ ID NO: 5.
[0068] For fermentation induction with the three enzymes, the BL21(DE3)-pRSFDuet-1-AtSuSy-UGTSL and BL21(DE3)-pRSFDuet-1-NtUGT_M-AtSuSy strains were plated onto LB solid plates (10 g / L NaCl, 5 g / L yeast powder, 10 g / L peptone, and 20 g / L agar) containing 50 μg / L kanamycin and incubated in an incubator at 37°C for 12 h. The next day, a single colony was selected from the plate and transferred to a shaker tube containing 5 mL of LB liquid medium (containing 50 μg / L kanamycin) and incubated at 37°C and 200 rpm for 12 h to prepare seed solution. The seed solution was then inoculated into 100 mL of TB medium (containing 50 μg / L kanamycin) at a 1% (v:v) inoculum size. The mixture was then placed in a shaker at 37°C and 200 rpm for 12 h. After 2 hours, the temperature was adjusted to 25°C and the culture was continued for 20 to 22 hours.
[0069] The fermentation broth was collected and centrifuged (4°C, 7000 rpm, 6 min) in a refrigerated manner. The supernatant was discarded to obtain a bacterial sludge, which was then washed twice with potassium phosphate buffer. An appropriate amount of potassium phosphate buffer was then added, the mixture was placed in an ice-water mixture, and the bacterial cells were sonicated using an ultrasonicator with parameters set to φ6, 300 W, and 30 min. The mixture was then centrifuged in a refrigerated centrifuge at parameters set to 4°C, 8000 rpm, and 30 min. The supernatant was collected and used as a crude enzyme solution, which was then stored in a refrigerator at 4°C for use. A crude enzyme solution containing UGTSL2_M and a crude enzyme solution containing NtUGT_M were obtained, i.e., the crude enzyme solutions used in Examples 4 to 8 below.
[0070] Example 4 Optimization of reaction temperature in one-pot reaction system For UGTSL2_M, NtUGT_M, and AtSuSy, increasing the reaction temperature can result in higher enzyme activity, but often results in the inactivation of the enzyme protein. Therefore, selecting an appropriate reaction temperature to balance enzyme activity and protein inactivation is an important step in catalytic reaction systems. Reaction systems were incubated at temperatures of 30°C, 33°C, 37°C, and 40°C, respectively, with other conditions maintained the same. The reaction mixture contained 50 g / L rebaudioside A, 450 g / L sucrose, 100 mM sodium phosphate buffer at pH 8.0, 2 mM UDP (human uridine diphosphate, Shanghai Yuanyeh Biotechnology Co., Ltd.), and an enzyme activity ratio of 1:1 between UGTSL2_M (25 mU / mL) and NtUGT_M (25 mU / mL). After 48 h, the reaction was terminated by heating and the reaction mixture was analyzed by HPLC. The UGTSL2_M and NtUGT_M enzymes were both crude enzyme solutions prepared in Example 3.
[0071] The results are shown in Figure 1. Experimental results showed that when the reaction was performed at 30°C and 33°C, the yields of RM2 (a by-product of unknown structure) were low, at 15.5 mM and 24.0 mM, respectively, and both RM2 and RM2 could accumulate larger amounts of rebaudioside D and rebaudioside D2. At relatively low temperatures, the catalytic efficiency was reduced, so the two intermediate products, rebaudioside D and rebaudioside D2 (RD2), could not be transformed into the target product, rebaudioside M2, in a timely manner, and the substrate, rebaudioside A, was not completely consumed. When the reaction temperature was increased to 37°C and 40°C, the substrate, rebaudioside A, was completely transformed, and the synthesized rebaudioside M2 was 30.9 mM and 31.1 mM, respectively. The highest yield of rebaudioside M2 was obtained when the reaction temperature was set at 40°C.
[0072] Example 5 Optimization of reaction pH in one-pot reaction system The UGT-SuSy coupling reaction system was catalyzed under buffer conditions of pH 7, 7.5, 8, 8.5, 9, and 9.5, respectively, while maintaining other conditions. The reaction mixture contained 50 g / L rebaudioside A, 450 g / L sucrose, 2 mM UDP, and a 1:1 enzyme activity ratio of UGTSL2_M (25 mU / mL) to NtUGT_M (25 mU / mL). The reaction was incubated at 35°C. After 48 h of catalysis, the reaction was terminated by heating and analyzed by HPLC. The experimental results, shown in Figure 2, intuitively indicated that alkaline buffer conditions inhibited the UGT-SuSy coupling reaction efficiency. In particular, at pH 9 and pH 9.5, a large amount of the substrate, rebaudioside A, was not transformed, and the yields of rebaudioside M2 were 3.36 mM and 0.58 mM, respectively. In weakly alkaline buffer environments (pH 7.5, 8.0, and 8.5), the yield of rebaudioside M2 was still insufficient, at 25.47 mM, 21.31 mM, and 9.36 mM, respectively. Considering the buffer requirements of AtSuSy, UGTSL2_M, and NtUGT_M comprehensively, the highest content of rebaudioside M2 was synthesized when the buffer conditions were set to 100 mM sodium phosphate buffer at pH 7.0, with the yield reaching 28.46 mM.
[0073] Example 6 Optimization of the enzyme activity ratio between UGTSL2_M and NtUGT_M in a one-pot reaction system UGTSL2_M and NtUGT_M are key enzymes in the two-step glycosylation, and their dosage and ratio are closely related to the synthesis efficiency of the target and intermediate products. In optimization experiments for the dosage of UGTSL2_M and NtUGT_M, the ratios of UGTSL2_M to NtUGT_M enzyme activity were set at 3:7, 4:6, 5:5, 6:4, and 7:3 (total enzyme activity was 50 mU / mL). The other conditions were kept the same. The reaction mixture contained 50 g / L rebaudioside A, 450 g / L sucrose, and 2 mM UDP. The reaction was catalyzed at 35°C in 100 mM sodium phosphate buffer, pH 8.0. After 48 h of catalysis, the reaction was stopped by heating and analyzed by HPLC.
[0074] The results are shown in Figure 3. When the ratio of UGTSL2_M to NtUGT_M enzyme activity was 3:7, 4:6, 5:5, 6:4, and 7:3, 23.72 mM, 26.1 mM, 23.08 mM, 21.96 mM, and 19.19 mM of product were synthesized, respectively. The highest yield of rebaudioside M2 was achieved at a ratio of 4:6. Increasing the concentration of UGTSL2_M or NtUGT_M at a ratio of 4:6 resulted in excessive accumulation of intermediate products.
[0075] Example 7 Optimization of the ratio of sucrose added as a substrate in the one-pot reaction system In an experiment optimizing the sucrose content, sucrose was added in amounts 6, 9, 12, 15, and 18 times the amount of acceptor substrate, respectively, while maintaining other conditions. The reaction mixture contained 50 g / L rebaudioside A, 2 mM UDP, and a 1:1 enzyme activity ratio of UGTSL2_M (25 mU / mL) to NtUGT_M (25 mU / mL). The reaction was catalyzed in 100 mM sodium phosphate buffer, pH 8.0, at 35°C. After 48 h of catalysis, the reaction was terminated by heating and analyzed by HPLC. The results are shown in Figure 4. The experimental results indicated that the addition of excess sucrose to the triple enzyme coupling catalysis system reduced the yield of rebaudioside M2 and excessive accumulation of the intermediate product, rebaudioside D, resulting in reduced transformation efficiency of rebaudioside A. Excess sucrose may enhance the pathway through which UGTSL2_M transforms rebaudioside A to synthesize rebaudioside D, resulting in excessive precipitation of rebaudioside D and potentially reducing the catalytic efficiency of NtUGT_M transforming rebaudioside D to synthesize rebaudioside M2. At 6-, 9-, 12-, 15-, and 18-fold increased sucrose concentrations, 27.90, 29.69, 24.02, 17.51, and 8.04 mM of product were synthesized, respectively. The highest yield of rebaudioside M2 was achieved with a substrate to sucrose ratio of 1:9.
[0076] Example 8 Optimization of the ratio of UDP added as a substrate in the one-pot reaction system The UDP contained in the catalytic system originates from the host cell lysate. If the UDP content in the lysate is insufficient, adding a small amount of UDP separately can limit the rate of UDP regeneration and resolve this issue. In experiments to test the amount of UDP added, 0, 1, 2, 3, and 4 mM UDP were added to the triple enzyme coupling catalysis system, while maintaining other reaction conditions. The system contained 50 g / L rebaudioside A (RA), a 9x sucrose / substrate ratio, and a 1:1 enzyme activity ratio of UGTSL2_M (25 mU / mL) to NtUGT_M (25 mU / mL). The reaction was carried out in 100 mM sodium phosphate buffer at pH 8.0 and 35°C. After 48 h of catalysis, the reaction was stopped by heating and analyzed by HPLC. The results are shown in Figure 5. Compared to the blank control group without added UDP, the yield of RM2 in the coupling reaction with the addition of 1 to 4 mM UDP was significantly improved, with 19.38, 21.98, 23.98, 24.99, and 24.74 mM, respectively. Of these, the addition of 3 mM UDP demonstrated the highest yield of rebaudioside M2 catalytically synthesized.
[0077] Example 9: Synthesis of Rebaudioside M2 via Rebaudioside A Catalysis in a One-Pot Process The triple enzyme coupling reaction system used 70 g / L rebaudioside A, 420 g / L sucrose, 3 mM UDP, and a 4:6 enzyme activity ratio of UGTSL2_M (20 mU / mL) to NtUGT_M (30 mU / mL). Under the reaction conditions of 100 mM sodium phosphate buffer, pH 7.0, and 37°C, the substrate rebaudioside A was completely transformed to produce 61.0 mM rebaudioside M2 (78.8 g / L), with a product yield of over 80%.
[0078] Example 10 Construction of recombinant bacteria expressing glycosyltransferase NtUGT mutants The dual gene expression vector pRSFDuet-1 (disclosed in Han Guangwei, "Co-expression and Immunogenicity Study of Clostridium perfringens Alpha, β_1, β_2, and ε Toxin Proteins [D]," Chinese Academy of Agricultural Sciences, 2014) was selected. The nucleotide sequence of the glycosyltransferase NtUGT from Stevia (SEQ ID NO: 65) was inserted into the NdeI / XhoI site of the vector, and the nucleotide sequence of the sucrose synthase AtSuS from Arabidopsis (SEQ ID NO: 68) was inserted into the NcoI / EcoRI site to obtain the recombinant pRSFDuet-1-NtUGT-AtSuS. The recombinant plasmid was then introduced into Escherichia coli BL21(DE3) to construct the dual enzyme co-expressing recombinant strain BL21-pRSFDuet-1-NtUGT-AtSUS (hereinafter referred to as the NtUGT strain). The amino acid sequence of the glycosyltransferase NtUGT was SEQ ID NO: 66, and the amino acid sequence of the sucrose synthase AtSUS was SEQ ID NO: 67. The mutant recombinant plasmids contained the following single-point mutations: NtUGT_A10V, NtUGT_F72L, NtUGT_L87P, NtUGT_L123P, NtUGT_L157P, NtUGT_Q51K, NtUGT_S400R, NtUGT_N219D, and NtUGT_G380L, in which the nucleotide sequence of the glycosyltransferase NtUGT was replaced with a nucleotide sequence encoding the mutant protein.
[0079] The NtUGT_A10V protein mutant is one in which the amino acid at position 10 of SEQ ID NO: 66 is mutated from alanine (A) to valine (V), and the nucleic acid molecule encoding the mutant protein is one in which the GCT at positions 28 to 30 of SEQ ID NO: 65 is GTT has been replaced by The NtUGT_L87P protein mutant is one in which the amino acid at position 87 of SEQ ID NO: 66 is mutated from leucine (L) to proline (P), and a nucleic acid molecule encoding the mutant protein is one in which the amino acid at positions 259 to 261 of SEQ ID NO: 65 is mutated from CTG to CCT has been replaced by The NtUGT_G380L protein mutant is one in which the amino acid at position 380 of SEQ ID NO: 66 is mutated from glycine (G) to leucine (L), and a nucleic acid molecule encoding the mutant protein is one in which GGT at positions 1138 to 1140 of SEQ ID NO: 65 is mutated. TTA has been replaced by The NtUGT_Q51K protein mutant is one in which the amino acid at position 51 of SEQ ID NO: 66 is mutated from glutamine (Q) to lysine (K), and the nucleic acid molecule encoding the mutant protein is one in which the CAG at positions 150 to 152 of SEQ ID NO: 65 is mutated. AAG has been replaced by The NtUGT_F72L protein mutant had the amino acid at position 72 of SEQ ID NO: 66 mutated from phenylalanine (F) to leucine (L), and the nucleic acid molecule encoding the mutant protein had TTC at positions 216-218 of SEQ ID NO: 65 substituted with CTT.
[0080] The NtUGT_L123P protein mutant had the amino acid at position 123 of SEQ ID NO: 66 mutated from leucine (L) to proline (P), and the nucleic acid molecule encoding the mutant protein had CTG at positions 391-393 of SEQ ID NO: 65 substituted with CCT.
[0081] The NtUGT_L157P protein mutant had the amino acid at position 157 of SEQ ID NO: 66 mutated from leucine (L) to proline (P), and the nucleic acid molecule encoding the mutant protein had TTG at positions 471-473 of SEQ ID NO: 65 substituted with CCT.
[0082] The NtUGT_S400R protein mutant had the amino acid at position 400 of SEQ ID NO: 66 mutated from serine (S) to arginine (R). The nucleic acid molecule encoding the mutant protein had TCC at positions 1200-1202 of SEQ ID NO: 65 substituted with CGT.
[0083] The NtUGT_N219D protein mutant had the amino acid at position 219 of SEQ ID NO: 66 mutated from asparagine (N) to aspartic acid (D). The nucleic acid molecule encoding the mutant protein had AAC substituted with GAC at positions 657-659 of SEQ ID NO: 65.
[0084] The present invention further includes an NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L protein mutant, specifically, all of the above mutations except for S400R occur simultaneously, i.e., the amino acid at position 10 is mutated from alanine (A) to valine (V), the amino acid at position 51 is mutated from glutamine (Q) to lysine (K), and the amino acid at position 72 is mutated from phenylalanine (F) to valine (V) relative to the amino acid sequence set forth in SEQ ID NO: 66. The amino acid at position 87 was mutated from leucine (L) to proline (P), the amino acid at position 123 was mutated from leucine (L) to proline (P), the amino acid at position 157 was mutated from leucine (L) to proline (P), the amino acid at position 219 was mutated from asparagine (N) to aspartic acid (D), and the amino acid at position 380 was mutated from glycine (G) to leucine (L). The nucleotide sequence of the nucleic acid molecule encoding the mutant protein is shown in SEQ ID NO: 69. Multi-point mutations enhanced the catalytic effect of S400R, but not the mutant.
[0085] A specific method for preparing a recombinant expression strain of a glycosyltransferase mutant includes the following steps S1 to S5.
[0086] Step S1 involved PCR amplification of the coding gene of the site-directed mutant. Rapid mutation was performed using the plasmid of the unmutated strain BL21-pRSFDuet-1-NtUGT-AtSUS as template DNA by PCR amplification technique (underlined bases are mutated).
[0087] Primers for A10V site-directed mutagenesis: Forward primer: 5'-AG GTT TTCTTGTTCCCGTGGCTGGCGTATGGT-3' (SEQ ID NO: 47) Reverse primer: 5'-CGGGAACAAGAA AAC CTTTAGTTTTGTGTGTTCAGTATCCATA-TG-3' (SEQ ID NO: 48) Primers for Q51K site-specific mutation: Forward primer: 5'-C AAG AAACGTATTCCGCAAAGCTACAGCAGCA-3' (SEQ ID NO: 49) Reverse primer: 5'-gCGGAATACGTTT CTT GATGAAGCTAAGGTTGATCGGAG-3' (SEQ ID NO: 50) Primers for F72L site-specific mutation: Forward primer: 5'-AG CTT CCGCAACTGCCACCGCATTACCATACC-3' (SEQ ID NO: 51) Reverse primer: 5'-TGGCAGTTGCGG AAG CTCCGGCAGGATCAGCT-3' (SEQ ID NO: 52) Primers for L87P site-specific mutation: Forward primer: 5'-G CCT CACCTGAACAGCACGCTGCACAAAGCGT-3' (SEQ ID NO: 53) Reverse primer: 5'-TGCTGTTCAGGTG AGG CGGCAGACCGTTGGTG-3' (SEQ ID NO: 54) Primers for L123P site-specific mutation: Forward primer: 5'-TATGCAA CCT TGGACCTTTGGCGTCGCTAGTT-3' (SEQ ID NO: 55) Reverse primer: 5'-AGGTCCA AGG TTGCATAACGTCGTAGATGATCAGA-3' (SEQ ID NO: 56) Primers for L157P site-specific mutation: Forward primer: 5'-AC CCT GAAGTTGAGTACCCGTTTCCGGCACTT-3' (SEQ ID NO: 57) Reverse primer: 5'-gTACTCAACTTC AGG GTTTTTGTAGAGATGAACGAAATAGCTG-3' (SEQ ID NO: 58) Primers for N219D site-specific mutation: Forward primer: 5'-TATG GAC TATTTGGCTGAAATCATCGAAACTCGC-3' (SEQ ID NO: 59) Reverse primer: 5'-CAGCCAAATA GTC CATATATTTGCCCTCCAACTCACG-3' (SEQ ID NO: 60) Primers for G380L site-specific mutation: Forward primer: 5'-TAGAGATT TTA GTGGCCCTGGAGGTCGTGCGTGAT-3' (SEQ ID NO: 61) Reverse primer: 5'-AGGGCCACTAA AAT CTCTACCAGCAACTTGGCGTT-3' (SEQ ID NO: 62) Primers for S400R site-specific mutation: Forward primer: GATCGCC CGT GTGATTAAGGACGTGACCTCTGG (SEQ ID NO: 63) Reverse primer: TAATCAC ACG GGCGATCTCTTCACGGTGCAGG (SEQ ID NO: 64)
[0088] In step S2, the PCR target plasmid amplification reaction system consisted of 2 μL each of 10 μM forward primer and reverse primer, 1 μL of dNTP mix, 25 μL of 2×max buffer, 1 μL of template plasmid, and 1 μL of 2U / 50 μL Super-Fidelity DNA polymerase, which was supplemented to 50 μL with sterile water (ddh2O).
[0089] PCR target plasmid amplification reaction conditions were: pre-denaturation at 95°C for 30 s, 30 cycles (denaturation at 95°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 7 min), extensive extension at 72°C for 5 min, and final incubation at 16°C. PCR amplification products were detected by agarose gel electrophoresis.
[0090] In step S3, 1 μL of DpnI endonuclease was added to the PCR-amplified product with confirmed mutations. The reaction mixture was then incubated at 37°C for 1–2 h, transferred to competent E. coli BL21(DE3) cells, and placed on ice for 30 min. Then, heat-shocked at 42°C for 45–90 s and placed on ice for 2 min. 600 μL of LB medium was added and the mixture was shaken at 37°C and 200 rpm for 45 min. The entire mixture was then evenly spread onto a kanamycin-resistant LB plate and cultured overnight at 37°C. Two single colonies were selected from the plate and inoculated into LB liquid medium. After 9 h, the glycerol tube containing the culture was preserved and sequenced. The glycerol tube containing the correct sequence was plated onto a kanamycin-resistant LB plate and activated in a shaker tube. The plasmid was then extracted and the recombinant plasmid was then introduced into E. coli BL21(DE3).
[0091] In step S4, the following strains were obtained by the above method: NtUGT_F72L, NtUGT_L123P, NtUGT_L157P, NtUGT_Q51K, NtUGT_S400R, and NtUGT_N219D.
[0092] In step S5, the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L multipoint mutant strain was obtained by the following methods (1) to (7).
[0093] (1) The plasmid of the NtUGT_Q51K strain confirmed to be mutated was used as the template plasmid for the target plasmid amplification reaction system in step 2 above, and the primers were primers for A10V site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K plasmid.
[0094] (2) The NtUGT_A10V / Q51K plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers were primers for F72L site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L plasmid.
[0095] (3) The NtUGT_A10V / Q51K / F72L plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers were primers for L87P site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P plasmid.
[0096] (4) The NtUGT_A10V / Q51K / F72L / L87P plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers used were those for the L123P site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P plasmid.
[0097] (5) The NtUGT_A10V / Q51K / F72L / L87P / L123P plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction system in step 2 above, and the primers used were those for the L157P site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P plasmid.
[0098] (6) The NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction in step 2 above, and the primers used were those for the N219D site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D plasmid.
[0099] (7) The NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D plasmid confirmed to be mutated was used as the template for the target plasmid amplification reaction in step 2 above, and the primers used were those for the G380L site-specific mutation. Steps 2 and 3 above were repeated to obtain the NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L plasmid.
[0100] The AMBER21 software was used to predict and analyze the relevant parameters of the mutation site, and the results are shown in Table 2. Aphafold2 and Rosetta software were used to simulate the NtUGT protein structure and predict the spatial location of the mutated amino acids.
[0101] [Table 2]
[0102] Example 11 Fermentation induction of mutant enzymes The NtUGT single-point mutant NtUGT_Q51K recombinant strain and the multi-point mutant NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L recombinant strain were plated onto LB solid plates containing 50 μg / L kanamycin and incubated in an incubator at 37°C for 12 h. The next day, a single colony was selected from the plate and transferred to a shaker tube containing 5 mL of LB liquid medium (containing 50 μg / L kanamycin). The tube was then incubated at 37°C for 12 h at 200 rpm to prepare seed solution. The seed solution was then inoculated into 100 mL of TB medium (containing 50 μg / L kanamycin) at a 1% (v:v) inoculum size. The tube was then incubated at 37°C for 12 h at 200 rpm. After 2 hours, the temperature was adjusted to 25°C and the culture was continued for 20 to 22 hours.
[0103] The fermentation broth was collected and centrifuged (4°C, 7000 rpm, 6 min) in a freezer. The supernatant was discarded to obtain a bacterial sludge, which was then washed twice with potassium phosphate buffer. An appropriate amount of potassium phosphate buffer was then added, and the mixture was placed in an ice-water mixture. The bacterial cells were then sonicated using an ultrasonicator at φ6, 300 W, and 30 min. The mixture was then centrifuged in a freezer at 4°C, 8000 rpm, and 30 min. The supernatant was collected and used as a crude enzyme solution. This was then stored in a refrigerator at 4°C for further use.
[0104] Detection of enzymatic activity and half-life of wild-type and mutant enzymes The enzymatic activity of glycosyltransferase was measured by adding 1 mM substrate rebaudioside D, 2 mM UDPG, and 0.5 mg of crude enzyme to 3 mL of enzyme-catalyzed reaction mixture, then supplementing with 100 mM potassium phosphate buffer, pH 7.2. The reaction conditions were 30°C and 200 rpm. Sampling times were 0, 20, and 30 min. Sample treatment: 500 μL of sample was taken, inactivated in a water bath at 95°C for 5 min, and detected by HPLC.
[0105] Definition of enzyme activity (U): The amount of enzyme required to produce 1 μmol of product per minute of transformation is 1 enzyme activity unit. The enzyme activity of the wild-type enzyme was set at 100%, and the relative enzyme activities of the other mutant enzymes were calculated.
[0106] The half-life detection method was to incubate the wild-type enzyme and mutant enzyme for different periods of time under 37°C water bath conditions, measure the enzyme activity, and generate half-life curves to determine the half-life time. The enzyme activity detection method was the same as above.
[0107] Enzyme activity detection showed that the single-point mutant NtUGT_Q51K had a 559% increase in enzyme activity compared to the wild-type enzyme, but its half-life was only extended by 0.3 h. The multi-point mutant NtUGT_A10V / Q51K / F72L / L87P / L123P / L157P / N219D / G380L not only had an enzyme activity that was 570% of the wild-type enzyme, but also had a half-life that was extended by 8.6 h, demonstrating a much greater ability to catalyze rebaudioside D than the wild-type enzyme. Specific data are shown in Table 3.
[0108] [Table 3]
[0109] Example 12 Comparison of Rebaudioside M2 Synthesis by Unmutated and Mutated Strains Under the same catalytic reaction conditions, the unmutated and mutated strains were used to synthesize rebaudioside M2 by catalyzing the substrate rebaudioside D. After 36 hours of sampling, the samples were treated and then analyzed by HPLC.
[0110] The catalytic reaction system contained rebaudioside D, sucrose, 10 mg / mL crude enzyme, and 100 mM potassium phosphate buffer at pH 7.2, with a mass ratio of rebaudioside D to sucrose of 1:5. The catalytic reaction conditions were 37°C and 200 rpm. Table 3 was obtained when the substrate loading in the catalytic reaction system was 100 g / L rebaudioside D and 500 g / L sucrose.
[0111] The results are shown in Table 4. Within 36 h of reaction, the mutated strain achieved the highest catalytic synthesis yield of rebaudioside M2 compared to the unmutated strain, with the final product rebaudioside M2 concentration reaching 116.7 g / L, demonstrating efficient catalytic synthesis of rebaudioside M2.
[0112] [Table 4]
Claims
1. (A) based on the amino acid sequence shown in SEQ ID NO: 1, The amino acid at position 23 is mutated from N to E, The amino acid at position 41 is mutated from R to P, The amino acid at position 91 is mutated from H to K, The amino acid at position 95 is mutated from K to D, The amino acid at position 123 is mutated from E to P, The amino acid at position 136 is mutated from L to F, The amino acid at position 151 is mutated from R to F, The amino acid at position 124 is mutated from H to E, The amino acid at position 168 is mutated from V to Y, The amino acid at position 198 is mutated from C to K, The amino acid at position 202 is mutated from T to E, The amino acid at position 217 is mutated from W to K, The amino acid at position 225 is mutated from P to L, The amino acid at position 226 is mutated from F to V, The amino acid at position 285 is mutated from A to V, The amino acid at position 333 is mutated from I to V, The amino acid at position 358 is mutated from N to F, The amino acid at position 392 is mutated from T to V, a protein obtained by mutating the amino acid at position 419 from I to K; (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function; and (C) A glycosyltransferase UGTSL2 mutant, characterized in that it is any one of the fusion proteins obtained by linking a tag to the end of the protein specified in (A) or (B).
2. The glycosyltransferase UGTSL2 mutant according to claim 1, characterized in that the amino acid sequence of the UGTSL2 mutant is set forth in SEQ ID NO:
3.
3. (A) an expression gene encoding the glycosyltransferase mutant according to claim 1 or 2; (B) a recombinant plasmid to which the expression gene of (A) is ligated, and (C) A biological material which is either the recombinant expression plasmid or a recombinant cell containing an expression gene for the glycosyltransferase mutant.
4. glycosyltransferase UGTSL2 mutant, glycosyltransferase NtUGT_M and sucrose synthase AtSuSy; The glycosyltransferase UGTSL2 mutant is as defined in claim 1 or 2, The glycosyltransferase NtUGT_M has (A1) the amino acid sequence shown in SEQ ID NO: 5, or (A2) A protein having 95% or more identity with the amino acid sequence defined in (A1) and having the same function, The sucrose synthase AtSuSy has the amino acid sequence shown in SEQ ID NO: 7 (B1), or (B2) An enzyme composition characterized by being a protein having 95% or more identity with the amino acid sequence defined in (B1) and having the same function.
5. The composition according to claim 4, wherein the enzymatic activity ratio of the glycosyltransferase UGTSL2 mutant to the NtUGT_M is 3-7:7-3.
6. 6. A set of recombinant strains that express the enzyme composition of claim 4 or 5, comprising recombinant strain A and recombinant strain B, wherein the recombinant strain A comprises recombinant plasmid A obtained by constructing together an expression vector a nucleic acid molecule encoding the glycosyltransferase UGTSL2 mutant of claim 1 or 2 and a nucleic acid molecule encoding the sucrose synthase AtSuSy, and the recombinant strain B comprises recombinant plasmid B obtained by constructing together a plasmid a nucleic acid molecule encoding the glycosyltransferase NtUGT_M and a nucleic acid molecule encoding the sucrose synthase AtSuSy, wherein the amino acid sequence of the glycosyltransferase NtUGT_M is as set forth in SEQ ID NO:
5.
7. 7. The set of recombinant strains according to claim 6, characterized in that the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia yeast or Corynebacterium glutamicum.
8. 1. A method for synthesizing rebaudioside M2 by biocatalysis of rebaudioside A in a one-pot manner, comprising the steps of adding rebaudioside A, sucrose, and the enzyme composition of claim 4 or the induced expression enzyme product of the recombinant strain of the set of claim 5 to a catalytic reaction system, reacting, inactivating the enzyme, and centrifuging to obtain a supernatant which is rebaudioside M2, wherein the M2 is represented by the following formula (I): 【Chemical 1】
9. The method for obtaining an inducibly expressed enzyme product of the recombinant strain according to claim 5 or 6 comprises the steps of: 1) activating the recombinant strain of the set according to claim 5 or 6, transferring it to an induction medium, adding an inducer to perform induction culture, centrifuging to collect bacterial cells, resuspending and disrupting the bacterial cells in an appropriate amount of buffer, and centrifuging to collect the supernatant which is the inducibly expressed enzyme product, and the reaction time is 5 to 100 hours.
10. 10. The method of claim 9, wherein the final concentration of the inducer is 0.02-1 g / L and the induction time is 4-50 h.
11. 11. The method of claim 9 or 10, wherein the concentration of rebaudioside A in the catalytic reaction system is 1 to 1000 g / L, the concentration of sucrose is 1 to 9000 g / L, the amount of the inducibly expressed enzyme product added is 1 to 100 mU / L, the pH of the catalytic reaction system is 7.0 to 8.5, preferably 7.0, the reaction temperature is 37 to 40°C, and the enzyme activity ratio of the glycosyltransferase UGTSL2 mutant to NtUGT_M is 3 to 7:7 to 3.
12. A1) A protein having 90% or more identity with the original protein and having the same function as the amino acid sequence shown in SEQ ID NO: 66, obtained by substituting amino acid residues; or A2) A glycosyltransferase mutant, which is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of A1).
13. The amino acid sequence represented by SEQ ID NO: 66 is B1) the amino acid at position 10 is mutated from alanine (A) to valine (V); B2) the amino acid at position 51 is mutated from glutamine (Q) to lysine (K); B3) the amino acid at position 72 is mutated from phenylalanine (F) to leucine (L); B4) the amino acid at position 87 is mutated from leucine (L) to proline (P); B5) the amino acid at position 123 is mutated from leucine (L) to proline (P); B6) the amino acid at position 157 is mutated from leucine (L) to proline (P); B7) the amino acid at position 219 is mutated from asparagine (N) to aspartic acid (D); B8) The amino acid at position 380 is mutated from glycine (G) to leucine (L); B9) The glycosyltransferase mutant according to claim 12, characterized in that it is a protein obtained by substituting one or more amino acid residues, including a mutation of the amino acid at position 400 from serine (S) to arginine (R).
14. C1) A nucleic acid molecule encoding a protein according to claim 12 or 13, C2) an expression cassette comprising the nucleic acid molecule of C1); C3) a recombinant vector comprising the nucleic acid molecule of C1), or a recombinant vector comprising the expression cassette of C2); C4) a recombinant microorganism comprising the nucleic acid molecule of C1), or the expression cassette of C2), or the recombinant vector of C3), and C5) A biomaterial, characterized in that it is any one of a transgenic plant cell line comprising the nucleic acid molecule of C1) or a transgenic plant cell line comprising the expression cassette of C2).
15. 1) constructing a recombinant strain comprising a dual-enzyme co-expression system by constructing both a gene encoding the glycosyltransferase mutant according to any one of claims 12 to 13 and a sucrose synthase gene into an expression vector to obtain a recombinant plasmid, and transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain comprising a dual-enzyme co-expression system; 2) inducing the recombinant strain to express the glycosyltransferase mutant and the sucrose synthase; and 3) a step of producing the following rebaudioside M2 using rebaudioside D and sucrose as raw materials using the two enzymes in step 2) using a glycosyltransferase mutant. 【Chemistry 2】
16. 16. The method of claim 15, wherein the expression vector is pRSFDuet-1.
17. The method according to claim 15, wherein the final concentration of the inducer used for the inducible expression in step 2) is 0.02 to 1 g / L, and the induction time is 4 to 50 hours.
18. 16. The method of claim 15, wherein step 2) comprises harvesting the cells, disrupting the cells, centrifuging the cells, and collecting the supernatant to obtain the crude enzyme.
19. 19. The method of claim 18, wherein in step 3), the rebaudioside D concentration is 1 to 500 g / L, the sucrose concentration is 1 to 1500 g / L, and the crude enzyme is added in an amount of 1 to 100 g / L.
20. 16. The method of claim 15, wherein the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia yeast, or Corynebacterium glutamicum.
21. 21. The method according to any one of claims 15 to 20, wherein the rebaudioside D is catalytically synthesized using a glycosyltransferase and rebaudioside A as a substrate.
Citation Information
Patent Citations
Method for preparing rebaudioside M2 by catalyzing rebaudioside A through recombinant bacterium
CN106834389A
Method for preparing Rebaudioside E through enzyme method
CN109750072A
Method for preparing glycosylated stevioside compound by enzyme method and derivative of glycosylated stevioside compound
CN114875054A
Glycosyltransferase mutant and coding gene thereof
CN115975972A
High-purity steviol glycosides
US20170303565A1