Novel cell lines and their use in therapy

The Y201 MSC line, characterized by CRISPR/Cas9-modified FGFR3 deletion, addresses MSC therapy challenges by providing consistent EV production and enhanced therapeutic benefits for tissue repair and inflammation suppression.

JP2025535110APending Publication Date: 2025-10-22THE UNIV OF YORK
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025521029
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-13
Filing Date
2023-10-13
Publication Date
2025-10-22

AI Technical Summary

Technical Problem

Existing mesenchymal stem cell (MSC) therapies face challenges with heterogeneity, batch safety, reproducibility, scalability, and cost, particularly in delivering consistent therapeutic benefits through extracellular vesicles (EVs).

Method used

Development of an immortalized MSC line, designated Y201, characterized by robust growth and potent tissue-forming and anti-inflammatory properties, with engineered EVs produced by CRISPR/Cas9-mediated FGFR3 gene deletion, enabling consistent EV production and proliferation in serum-free conditions.

Benefits of technology

Y201 MSCs produce abundant and consistent EVs that stimulate cell proliferation, chondrogenesis, and suppress inflammation, offering improved therapeutic efficacy and cost-effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025535110000010
    Figure 2025535110000010
  • Figure 2025535110000011
    Figure 2025535110000011
  • Figure 2025535110000012
    Figure 2025535110000012
Patent Text Reader

Abstract

The present invention provides novel mesenchymal stem cell (MSC)-like cells and cell populations. Related DNA preparations, cell-free conditioned medium, secretomes, extracellular vesicle populations, compositions, and uses thereof are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention provides novel mesenchymal stem cell (MSC)-like cells and cell populations. Related DNA preparations, cell-free conditioned medium, secretomes, extracellular vesicle populations, compositions, and uses thereof are also provided. [Background technology]

[0002] Mesenchymal stem cells (MSCs) reside within the bone marrow, where they give rise to skeletal tissue and interact with the immune system. The potent repair and immunosuppressive functions of MSCs have driven their widespread clinical use as tissue regeneration and anti-inflammatory mediators. However, MSCs are almost always deployed in therapeutic settings as a mixed, uncharacterized stromal cell population derived from donor tissue (Wilson et al., 2021). This heterogeneity of MSCs leads to inconsistency and ambiguity regarding their mechanism of action, a critical requirement for any investigational drug. Questions also remain about batch safety, reproducibility, scalability, and transportation / storage costs.

[0003] Extracellular vesicles (EVs) are nanosized, membrane-bound carriers that transport proteins and nucleic acids and are produced and released by cells to mediate intercellular signaling. Growing evidence suggests that EVs produced by MSCs can deliver many of the therapeutic benefits of their parent cells, including their restorative and anti-inflammatory properties, but with far fewer safety, delivery, and cost constraints. EVs persist in the body for extended periods without degrading or agglomerating, are acellular, posing minimal immunogenic risk, and can be engineered to carry additional cargo, including pharmaceuticals. Consequently, there has been significant interest in developing EVs as a novel therapeutic modality that combines the efficacy of stem cell therapy with the practicality of biopharmaceuticals. However, key challenges for further progress remain batch consistency and scalability. Summary of the Invention [Problem to be solved by the invention]

[0004] Therefore, there is a need for improved means of delivering the benefits of MSCs in therapeutic settings. [Means for solving the problem]

[0005] To address the challenges associated with the use of MSCs in therapy, we initiated an immortalization and cloning program to deliver a series of MSC lines representing various bone marrow stromal subtypes containing stem cells of varying potency. From a large number of initial clones, we selected eight for detailed characterization based on their robust in vitro growth performance. Advantageously, we specifically identified one line, designated Y201, that exhibited typical MSC characteristics, including potent tissue-forming and anti-inflammatory properties in vitro and in vivo. We demonstrated that Y201 MSCs were highly reproducible and characterized these cells in detail (e.g., their proliferation, transcriptomics, secretomics, surfaceomics, and marker expression).

[0006] We demonstrated that Y201 MSCs produce abundant and consistent EVs by collecting data on their size, morphometry, EV markers, miRNAs, and proteomics. Advantageously, we demonstrated that Y201 EVs stimulate cell proliferation (e.g., proliferation of donor MSCs and chondrocytes derived from arthritis patients), chondrogenesis, and suppress inflammation.

[0007] Surprisingly, further manipulation of Y201 MSCs with targeted deletion of the FGFR3 gene using CRISPR / Cas9 favorably increases proliferation, migratory activity and secretory behavior, allowing growth in serum-free conditions.

[0008] Accordingly, provided herein are mesenchymal stem cell (MSC)-like cells deposited under European Collection of Authenticated Cell Cultures ("ECACC") accession number 22072103, or derivatives thereof.

[0009] Suitably, the derivative may have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC accession number 22072103.

[0010] Suitably, the derivative may differ from the MSC-like cells deposited under ECACC accession number 22072103 only by having reduced FGFR3 expression and / or activity.

[0011] Preferably, the derivative is (a) may have increased levels of at least 10 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) the levels of at least 10 different RNA transcripts selected from Table 6 may be reduced compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0012] Also provided are mesenchymal stem cell (MSC)-like cells deposited under European Collection of Authenticated Cell Cultures ("ECACC") accession number 22072101 or derivatives thereof.

[0013] Also provided is a cell population comprising a plurality of the cells provided herein.

[0014] Also provided is a DNA preparation comprising genomic DNA of the cells provided herein.

[0015] Provided is cell-free conditioned medium obtainable by cell culture of a cell provided herein or a cell population provided herein.

[0016] Suitably, the cell-free conditioned medium may be depleted of extracellular vesicles (EVs).

[0017] Suitably, the cell-free conditioned medium may be substantially free of extracellular vesicles (EVs).

[0018] Also provided is a secretome or portion thereof obtainable by cell culture of a cell provided herein or a cell population provided herein.

[0019] Suitably, the secretome or part thereof may be depleted of extracellular vesicles (EVs).

[0020] Suitably, the secretome or portion thereof may be substantially free of extracellular vesicles (EVs).

[0021] Also provided are extracellular vesicle (EV) populations obtainable by cell culture of the cells provided herein or the cell populations provided herein.

[0022] Suitably, the EV population may be the 100K EV fraction.

[0023] Suitably, the cell-free conditioned medium, or secretome or portion thereof, may comprise at least 10 different proteins selected from Table 2.

[0024] Suitably, the cell-free conditioned medium, or the secretome or part thereof, or the EV population may comprise at least 10 different proteins selected from Table 3.

[0025] Suitably, the cell-free conditioned medium, or the secretome or part thereof, or the EV population may comprise at least 10 different miRNAs selected from Table 4.

[0026] Compositions comprising at least 10 different proteins selected from Table 2 are provided.

[0027] Compositions comprising at least 10 different proteins selected from Table 3 are also provided.

[0028] Further provided is a composition comprising at least 10 different miRNAs selected from Table 4.

[0029] Suitably, the composition may be a cell-free composition.

[0030] Also provided are pharmaceutical compositions comprising an MSC-like cell provided herein, a cell population provided herein, a DNA preparation provided herein, a cell-free conditioned medium provided herein, a secretome or portion thereof provided herein, an extracellular vesicle (EV) population provided herein, or a composition provided herein, and further comprising a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

[0031] Provided herein are pharmaceutical compositions for use as medicaments.

[0032] Also provided is a method of treating a disease, disorder, and / or condition in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0033] Also provided is a pharmaceutical composition provided herein for use in promoting tissue repair.

[0034] Also provided is a method of promoting tissue repair in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0035] Suitably, the pharmaceutical composition may be for treating or preventing a disease or condition associated with cartilage damage.

[0036] Suitably, the method of promoting tissue repair in a subject may be for treating or preventing a disease or condition associated with cartilage damage.

[0037] Suitably, the disease or condition associated with cartilage damage may be arthritis, which may be selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis and psoriatic arthritis.

[0038] Suitably, the pharmaceutical composition may be for use in wound healing and / or tissue regeneration.

[0039] Suitably, the method of promoting tissue repair in a subject may be for wound healing and / or tissue regeneration.

[0040] Also provided are pharmaceutical compositions provided herein for use in treating or preventing inflammation.

[0041] Also provided is a method of treating or preventing inflammation in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition provided herein.

[0042] Suitably, the pharmaceutical composition may be for use in treating or preventing an autoimmune disease or condition.

[0043] Suitably, the method of treating or preventing inflammation may be for treating or preventing an autoimmune disease or condition.

[0044] Also provided is the use of the extracellular vesicle (EV) population provided herein for delivery of cargo to a cell.

[0045] Provided herein are methods for screening a test compound for its ability to induce differentiation of MSC-like cells, the method comprising: a) contacting the test compound with an MSC-like cell described herein or a cell population described herein; and b) determining the effect of the test compound on at least one marker of differentiation.

[0046] Suitably, the at least one marker of differentiation may be selected from the group consisting of osteogenic differentiation markers and chondrogenic differentiation markers; a) the osteogenic differentiation marker may be selected from the group consisting of type I collagen, alkaline phosphatase, BMP2, osteopontin, osteonectin, osteocalcin, bone sialoprotein, and Runx2; and / or b) The chondrogenic differentiation marker may be selected from the group consisting of type II collagen, type X collagen, aggrecan, lubricin, cartilage oligomeric matrix protein, and Sox9.

[0047] There is also provided the use of the MSC-like cells described herein or the cell populations described herein to screen test compounds for their ability to induce differentiation of MSC-like cells.

[0048] Throughout the description and claims of this specification, the terms "comprise" and "contain" and variations thereof mean "including but not limited to" and are not intended to (and do not) exclude other moieties, additives, ingredients, integers or steps.

[0049] Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, the specification is to be understood as contemplating the plural as well as the singular, unless the context requires otherwise.

[0050] It is to be understood that any feature, integer, property, compound, chemical moiety or group described in connection with a particular aspect, embodiment or example of the invention is applicable to any other aspect, embodiment or example described herein, unless inconsistent therewith.

[0051] Various aspects of the invention are described in further detail below.

[0052] Embodiments of the present invention are further described below with reference to the accompanying drawings. [Brief explanation of the drawings]

[0053] [Figure 1-1] Figure 1 shows the karyotype of Y201 MSCs. Representative from 20 individual cells selected from one Y201 culture at passage 73. Y201 karyotypes were independently interpreted. [Figure 1-2] Same as above. [Figure 2]Figure 2 shows the morphology and migration profile of Y201 compared to the control MSC line, MSC#2. A) Crystal violet-stained MSC subtypes (scale = 50 μm). B) Cell morphology metrics calculated from time-lapse CFU-F images: i) length:width ratio, ii) cell perimeter, and iii) cell area. Unpaired t-test, P<0.0001, n=2418 cells. C) Rose plots highlight the differences in migration profiles between the Y201 and MSC#2 subsets. D) Migration metrics calculated from time-lapse images of CFU-F Y201 vs. MSC#2: i) distance migrated, ii) cell velocity, Y201 = 0.413 μm / s ± 0.1064, MSC#2 = 0.2536 μm / s ± 0.068. E) Immunofluorescence micrographs of representative Y201 and MSC#2 cells showing DAPI-stained nuclei (blue), phalloidin-stained actin, and vinculin (green) to label focal adhesions. F) Mean focal adhesion area per cell of Y201 versus MSC#2 (t-test, p<0.0001, n=10-12). G) Mean focal adhesion length (t-test, p<0.0001, n=10-12). Error bars = mean ± SD; *=p≦0.05; **=p<0.01; ***=p<0.001; ****=p<0.0001. [Figure 3-1]Figure 3 shows that secreted factors from Y201 MSCs alter the morphology and migration of another MSC subtype (MSC#2). A) Representative images of macroscopic colony morphology of MSC#2 cells cultured in either unconditioned medium (no CM), Y201-conditioned medium, or MSC#2-conditioned medium. B) Average colony area of ​​MSC#2 colonies treated with various conditioned media (ANOVA: F=60.05, df=1.12, 2.26, p=0.0113). C) Length:width ratio of cells tracked during a single replicate and the average length:width ratio across multiple replicates (n=5). D) Average cell migration velocity across a single experiment and the average velocity across multiple replicates (n=5). E) Displacement distance of cells from the tracking origin for a single replicate and the average distance across multiple replicates (n=5). F) Representative Rose plots of cell migration paths after exposure to Y201 or MSC#2-conditioned medium. G) Phase contrast image of a typical colony at the assay endpoint. Immunofluorescence images of MSC#2 cells treated with either Y201-CM or MSC#2-CM for 24 hours. Cells were stained with DAPI for nuclear staining, phalloidin to reveal actin, and vinculin to label focal adhesions. [Figure 3-2] Same as above. [Figure 4-1]Figure 4 shows that extracellular matrix components are enriched in the Y201 MSC secretome. A) Volcano plot of proteins identified by LC-MS / MS in conditioned medium from Y201 and the control MSC line, MSC#2. Proteins identified as significantly enriched by ANOVA, n=3, p<0.05. B) KEGG pathway enrichment of proteins identified as significantly enriched in i) Y201 and ii) MSC#2. C) Proteins significantly enriched in Y201 compared to MSC#2 are presented in order of overall normalized abundance by LC-MS / MS. Graphs are split for ease of interpretation while maintaining a linear scale. Mean ± SEM. D) Proteins significantly enriched in MSC#2 compared to Y201 are presented in order of normalized abundance by LC-MS / MS. Graphs are split for ease of interpretation while maintaining a linear scale. E) Effect of different substrates (Y201-derived ECM, MSC#2-derived ECM, or plastic) on MSC#2 migration behavior. Mean ± SEM. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 4-4] Same as above. [Figure 4-5] Same as above. [Figure 4-6] Same as above. [Figure 4-7] Same as above. [Figure 5] Figure 5 shows the characterization of EVs isolated from Y201 MSCs. A) Nanoparticle tracking analysis was used to determine the size of 10k and 100k EV fractions from Y201 MSCs. B) Quantification of Y201 EVs versus the control MSC subline MSC#2 using LM14 Nanosight 3.4 software. C) Negatively stained Y201 EV samples imaged using TEM. D) Western blot analysis of EV markers (flotillin-1, CD81, CD63) and negative control (BiP) Y201 and MSC#2 EVs and whole cells. [Figure 6-1]Figure 6 shows the effect of Y201 EV on MSC#2 proliferation. A) Delivery of Y201 EV to bone marrow-derived primary MSCs. Y201 EVs were labeled with CFSE (green) and applied to MSC cultures. CFSE-labeled EV uptake was tracked hourly over a 9-hour period by fluorescence microscopy. Magenta = F-actin, white = nuclei. Data represent intracellular CFSE fluorescence after 5 hours. B) MSC#2 cells were treated with 1x, 5x, and 10x concentrations of Y201 EV, and cell number was determined over 72 hours (DNA content measured as fluorescence using a CyQuant assay). Livecyte image analysis was used to determine the effect of 10x Y201 EV on C) MSC#2 cell number, D) MSC#2 doubling time, E) dry mass, F) dry mass doubling time, and G) MSC#2 confluency. t-test or two-way ANOVA, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 6-2] Same as above. [Figure 7] Figure 7 shows the effect of Y201 EV on MSC#2 cell migration. Using a scratch wound assay, MSC#2 migration with or without exposure to Y201 EV was monitored using Livecyte image analysis. A) Photomicrographs of untreated control (left) and Y201 EV-treated (right) scratch wounds at 0 hours (top) and 24 hours (bottom). B) Gap area, C) MSC#2 track velocity, D) Area T1 / 2, E) MSC#2 collective migration, F) MSC#2 track length, G) Cell velocity, and H) Forward migration compared to untreated control. T-test or two-way ANOVA, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 8] Figure 8 shows the effect of Y201 EVs on the proliferation of primary MSCs. Primary MSCs were exposed to 1x, 5x, and 10x concentrations of Y201 100k EVs, and cell number was measured over 3 days using Alamar Blue. Two-way ANOVA followed by Tukey's multiple comparisons, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 9-1]Figure 9 shows the effect of Y201 EV on the proliferation of primary articular chondrocytes. Primary chondrocytes were exposed to 10x and 20x concentrations of Y201 100k EV, and cell number was measured over 72 hours by Livecyte image analysis to show A) confluency, B) total dry mass, C) cell number, and D) doubling time. E) Western blot of MFG-E8 in Y201 EV (100k fraction), MSC#2 EV, Y201 cells, and MSC#2 cells. L = molecular weight ladder. F) Effect of Y201 EV on the proliferation of primary osteoarthritic articular chondrocytes with or without RGD-blocking peptide (GRGDSP-SEQ ID NO: 16) or RAD control peptide (GRADSP-SEQ ID NO: 17). Two-way ANOVA followed by Tukey's multiple comparisons; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 9-2] Same as above. [Figure 10] Figure 10 shows the effect of Y201 EV on chondrogenesis. Primary donor MSCs as micromass pellets in basal or chondrogenic differentiation conditions with or without exposure to Y201 EV for 7 days. Micromasses were fixed, sectioned, and stained with Safranin O. Red staining indicates chondrogenic differentiation. A) Day 0 control; B) Day 7 no EV control; C) Day 7 + Y201 EV; D) Day 7 no EV control, basal non-differentiation condition; E) Day 7 + Y201 EV, basal non-differentiation condition. Data show an increase in micromass size and red staining / chondrogenesis after treatment with Y201 EV. [Figure 11-1]Figure 11 shows the immunomodulatory potential of EVs isolated from Y201 MSCs. A) In vitro treatment of activated CD4+ T cells with Y201 cells and Y201-EVs shows the effect on the percentage of proliferating T cells and the number of cell cycles achieved (n=2, mean number of events measured: over 18,000). B) Representative images of proliferation generations in activated T cells alone and in activated T cells treated with Y201 cells or their EVs. C and D) Separate plots of proliferation cycles and proliferation index, respectively. E) Polarization of activated T cells in the absence and presence of Y201-EVs (n=2, mean number of events measured: over 32,000). [Figure 11-2] Same as above. [Figure 12] Figure 12. A,B) Peritoneal exudate cell counts after stimulation with zymosan (A) or schistosome eggs (B) in the absence and presence of Y201-EV. C,D) Examination of TCR+CD4+ T cells, naive T cells, and central memory T cells in zymosan or schistosome eggs induced peritoneal inflammation with or without Y201-EV (n=3). One-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, ***p<0.001. [Figure 13] Figure 13 shows a comparison of the colony-forming ability of WT and FGFR3-KO MSCs. CFU efficiency (A), mean colony surface area (B), and total colony surface area (C) were not significantly different between strains. Bars represent mean ± SEM, ns = p > 0.05 as determined by t test (with Welch's correction for B), n = 3 biological replicates. [Figure 14] Figure 14 shows crystal violet staining of WT and FGFR3-KO MSC colonies. Images of wells from WT (A) and FGFR3-KO (B) CFU-F plates. Images of individual colonies of WT (C) and FGFR3-KO (D) cells. [Figure 15]Figure 15 shows a comparison of proliferation rates of WT and FGFR3-KO MSCs. Fluorescence readings of the Alamar Blue cell viability assay at 600 nm compared to the fluorescence of WT cells on day 0 (A). Cell numbers of WT and FGFR3-KO MSCs (B). Bars indicate mean ± SEM, n = 6 (A) and n = 3 (B). **** = p < 0.0001 as determined by Sidak's multiple comparison test. [Figure 16] Figure 16 shows the proliferation of WT and FGFR3-KO MSCs during continuous culture. Cumulative cell number (A) and population doublings (B) of WT and FGFR3-KO MSCs over time. Mean ± SEM is plotted, n = 3 biological replicates. [Figure 17] Figure 17 shows a comparison of the morphology of WT and FGFR3-KO MSCs. Crystal violet-stained brightfield images of WT (A) and FGFR3-KO (B) MSCs. Area (C) shows median, interquartile, and minimum-maximum values. Length-to-width ratio (D) and circularity index (E) show mean ± SEM. ****=p<0.0001, n=1032 for WT and n=345 for FGFR3-KO MSCs, as determined by Mann-Whitney test. [Figure 18] Figure 18 shows the top 10 significantly enriched KEGG pathways for down-regulated genes (A) and up-regulated genes (B) in FGFR3-KO MSCs compared to WT. All pathways had p-values ​​less than 0.05, and q-values ​​of 0.05 are indicated by red lines. [Figure 19] Figure 19 shows the top 10 significantly enriched cellular component Gene Ontology (GO) terms for down-regulated genes (A) and up-regulated genes (B) in FGFR3-KO MSCs compared to WT. All GO terms have a Q value of less than 0.05. [Figure 20]Figure 20 shows the top 10 significantly enriched biological process Gene Ontology (GO) terms for down-regulated genes (A) and up-regulated genes (B) in FGFR3-KO MSCs compared to WT. All GO terms have a Q value of less than 0.05. [Figure 21] Figure 21 shows the top 10 significantly enriched molecular function gene ontology (GO) terms for down-regulated genes (A) and up-regulated genes (B) in FGFR3-KO MSCs compared to WT. [Figure 22] Figure 22 shows visualization of the actin cytoskeleton in WT and FGFR3-KO MSCs. Representative confocal images of WT (A, B) and FGFR3-KO (C, D) MSCs stained with Alexa Fluor 594-conjugated phalloidin, which labels actin (red), and DAPI, which labels nuclei (blue). Scale bars equal 20 μm. [Figure 23] Figure 23 shows a comparison of actin cytoskeleton shape of WT and FGFR3-KO MSCs. Circularity (A) and length to width ratio (B) of WT and FGFR3-KO MSCs. ****=p<0.0001; Mann Whitney test. [Figure 24] Figure 24 shows visualization of Arp3 protein in WT and FGFR3-KO MSCs. Immunofluorescence of WT (A, C, E) and FGFR3-KO (B, D, F) MSCs stained for Arp3 (green), actin (red), and nuclei (blue). Scale bar = 20 μm. [Figure 25] Figure 25 shows scratch closure of WT and FGFR3-KO MSCs after 24 hours of wound healing. Bars indicate mean + SEM, * = p < 0.05, t-test, n = 5. [Figure 26]Figure 26 shows the migration characteristics of WT and FGFR3-KO MSCs. Gap closure of WT and FGFR3-KO MSCs after 24 hours of migration (A). Total track length (B) and instantaneous velocity (C) of individual cells throughout migration. Number of cell divisions within each field of view during migration (D). Area (E), sphericity (F), and directness (G) of individual cells throughout migration. Still images of WT (H) and FGFR3-KO (I) MSCs at the end of 24 hours of migration; lines indicate initial gap spacing. Box plots show minimum, maximum, and quartile values. Bars represent mean + SEM. ****=p<0.0001; **=p<0.01; *=p<0.05, determined by Mann-Whitney test for A-C, E, F, and t-test for D, G. [Figure 27] Figure 27 shows nanoparticle tracking analysis (NTA) of extracellular vesicles (EVs) from WT and FGFR3-KO MSCs. Histogram overlay of EV size distribution for the 2k (A), 10k (B), and 100k (C) fractions. Lines indicate the mean ± SEM of five technical replicates. Bottom line = WT, top line = FGFR3-KO. [Figure 28] Figure 28 shows representative transmission electron micrographs of 100k extracellular vesicles from WT and FGFR3-KO MSCs. EVs isolated from WT (A, B) and FGFR3-KO (C-F) MSCs. Scale bars are indicated on individual panels. [Figure 29] Figure 29 shows cell migration measurements after scratch wounding of WT MSCs treated with components of the FGFR3-KO MSC secretome. Percent scratch closure after 24 hours (A), total track length (B), linearity index (C), and mean cell thickness (D). Instantaneous velocity throughout the time course (E). Bars represent mean + SEM. Lines represent mean. ****=p<0.0001; **=p<0.01; *=p<0.05, Tukey's multiple comparison test (A), Dunn's multiple comparison test (B-D). [Figure 30]Figure 30 shows the effect of WT and FGFR3-KO conditioned medium (CM) on WT MSC wound healing compared to healing of FGFR3-KO MSCs. ****=p<0.0001; **=p<0.01; ns=p>0.05; Dunn's multiple comparison test. Bars represent mean + SEM. [Figure 31] Figure 31 shows the effect of conditioned medium (CM) on MSC morphology and proliferation. WT or FGFR3-KO (KO) MSCs were treated with CM derived from WT (+WT CM) or FGFR3-KO (+KO CM) MSCs. Fluorescence readings from an Alamar Blue cell viability assay were taken at 600 nm and compared to the fluorescence of WT cells on day 0. The key indicates the order of the bars on the graph (A). On day 2 of treatment, cell area (B), length:width ratio (C), and circularity (D) were calculated. Bars represent the mean + SEM, and box plots show the 1st to 99th percentiles and respective quartiles. A shows no significant differences by Tukey's multiple comparison test. For B–D, Dunn's multiple comparison test indicates significant differences compared to the respective untreated controls: **** = p<0.0001; * = p<0.05. [Figure 32] Figure 32 shows the effect of FGFR3-KO extracellular vesicles (EVs) on WT MSC proliferation. Fluorescence readings at 600 nm from an Alamar Blue cell viability assay are shown compared to the fluorescence of WT cells on day 0. The key indicates the order of the lines on the graph from top to bottom. The mean ± SEM of three biological replicates is shown for B, and no significant differences were found by Sidak's multiple comparison test. [Figure 33]Figure 33 shows the growth and morphology of WT and FGFR3-KO MSCs in serum-free (0% FBS) medium. Alamar Blue cell viability assay (A) of WT and FGFR3-KO (KO) MSCs cultured in control or serum-free (SF) medium. Fluorescence was compared to WT MSCs on day 0. Cumulative cell number (B) of WT and FGFR3-KO MSCs; arrows indicate expansion upon transfer to additional culture flasks. Points represent mean ± SEM. The key indicates the order of the lines on the graph from top to bottom. Brightfield images of crystal violet-stained WT MSCs cultured in complete (C) or SF (D) medium, and FGFR3-KO MSCs cultured in complete (E) or SF (F) medium. Scale bar = 200 μm. [Figure 34] Figure 34 shows functional enrichment analysis of the Y201 EV proteome (100k fraction). Enrichment analysis for A) biological process, B) molecular function, and C) cellular component Gene Ontology (GO) terms for the Y201 proteome. Only the most significant terms, as determined by the -log10 adjusted p-value (FDR) and the number of proteins associated with each term, are shown. Protein counts are as indicated. (D) BiNGO network of significant GO biological process terms for the Y201 proteome, annotated to cluster common terms with similar processes. Darker shading corresponds to higher significance (p-value threshold < 0.05). [Figure 35] Figure 35 shows A) a STRING PPI network detailing the relative abundance and strength of interactions between proteins in the Y201 core proteome at the EV surface (100k fraction). Node size was mapped to the relative abundance of proteins; edge width corresponds to the composite score of the interaction. Network representation created using BioRender.com. B) Western blot analysis of fibronectin-1 (FN1) and MFG-E8 in Y201 (100k fraction) and MSC#2 EVs and cell lysates. [Figure 36]Figure 36 shows the uptake of Y201 EV (100k fraction) by MSC#2 cells. A) MSC#2 cells were treated with 10x CFSE-Y201 EV, and intracellular CFSE signal was monitored for 10 hours. Histogram (counts vs. CFSE) signal was normalized to peak value, and the dashed line represents the median value used to quantify CFSE signal levels relative to the control (cells). B) Median CFSE intensity quantified relative to the control was plotted as a bar graph. n=3, error bars=SEM, Kruskal-Wallis test, *p<0.05, **p<0.01, ***p<0.001. [Figure 37] Figure 37 shows the uptake of CFSE-labeled Y201 EVs (100k fraction) by MSC#2 cells with or without an RGD blocking peptide (GRGDSP-SEQ ID NO: 16) or a RAD control peptide (GRADSP-SEQ ID NO: 17). A) Histogram of CFSE signal showing population shift after 4 hours of exposure of cells to Y201-labeled EVs. B) Quantification of fold change in median CFSE fluorescence of MSC#2 cells. n=6, error bars=SEM, one-way ANOVA with Bonferroni correction. [Figure 38-1] Figure 38 shows the effect of Y201 EV (100k fraction) on disease activity in an in vivo adjuvant-induced arthritis model. A) Joint size reduction (mm), B) Synovial infiltration score, C) Joint effusion score, D) Synovial hyperplasia score, and E) Arthritis index. Mice were sacrificed 3 days after treatment, and sections were scored by two independent scorers. F and I) PBS control, and G and J) Hematoxylin and eosin-stained sections of mouse knee joints treated with Y201 EV. Boxed areas in F and G are enlarged in I and J, respectively, showing examples of synovial infiltration (cellular infiltration into the synovium; arrows) and synovial hyperplasia (thickened synovial lining; arrowheads). Scale bar = 500 mm. Mean values ​​are shown ± SD (n = 4). Unpaired t-test with Welch's correction, *p < 0.05, **p < 0.01, ***p < 0.001. [Figure 38-2] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0054] The patents, scientific and technical literature referred to in this specification establishes the knowledge available to those skilled in the art at the time of filing. The entire disclosures of issued patents, published and pending patent applications, and other publications cited in this specification are incorporated by reference herein to the same extent as if each were specifically and individually indicated to be incorporated by reference. In the case of conflict, the present disclosure will control.

[0055] Various aspects of the invention are described in further detail below.

[0056] Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure The cell lines described in this application have been deposited at the United Kingdom Health Security Agency Porton Down and European Collection of Authenticated Cell Cultures (ECACC), an international depository located at the UK Heath Security Agency, Culture Collections, Porton Down, Salisbury, SP4 0JG, UK.

[0057] The deposit was made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0058] Detailed Description As discussed above, the present inventors have identified a novel MSC-like cell line, designated Y201, that advantageously exhibits typical MSC characteristics, including potent tissue-forming and anti-inflammatory properties in vitro and in vivo. The present inventors have shown that Y201 MSCs are highly reproducible and have extensively characterized these cells (e.g., their proliferation, transcriptomics, secretomics, surfeomics, and marker expression).

[0059] We demonstrated that Y201 MSCs produce abundant and consistent EVs by collecting data on their size, morphometry, EV markers, miRNAs, and proteomics. Advantageously, we demonstrated that Y201 EVs stimulate cell proliferation (e.g., proliferation of donor MSCs and chondrocytes derived from arthritis patients), chondrogenesis, and suppress inflammation.

[0060] Surprisingly, we demonstrated that further manipulation of Y201 MSCs using CRISPR / Cas9 to target deletion of the FGFR3 gene favorably increased proliferation, migratory activity, and secretory behavior, allowing growth in serum-free conditions.

[0061] Accordingly, provided herein are mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103 or derivatives thereof.

[0062] The mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103 may be referred to herein as "Y201 cells," "(Y201)WT MSCs," and / or "Y201 MSCs." The Y201 cells (deposited under ECACC accession number 22072103) were deposited under the Budapest Treaty of 1977 on July 21, 2022, with the UK Health Security Agency Porton Down and European Collection of Authenticated Cell Cultures, Porton Down, Salisbury, SP4 0JG, UK.

[0063] Mesenchymal stem cells (MSCs) are multipotent stromal cells capable of differentiating into various mesenchymal cell types of the adipocyte, chondrocyte, and osteocyte lineages, including osteoblasts, chondrocytes, neurons, myocytes, and adipocytes. This ability has been reported in vivo and in vitro in specific cells and tissues. Mesenchymal stem cells (MSCs) are located within the bone marrow, where they give rise to skeletal tissue and interact with the immune system. MSCs possess potent repair and immunosuppressive functions, which have driven their widespread clinical use as tissue regeneration and anti-inflammatory mediators. MSCs are plastic-adherent and migratory, forming colonies (CFU-F) when plated at low seeding densities. MSCs also exhibit robust proliferation and a stable phenotype after immortalization. MSCs can be phenotypically defined by gene or protein expression. MSCs have been characterized as expressing (and therefore being positive for) one or more of CD13, CD29, CD44, CD49a, b, c, e, f, CD51, CD54, CD58, CD71, CD73, CD90, CD102, CD105, CD106, CDw119, CD120a, CD120b, CD123, CD124, CD126, CD127, CD140a, CD166, P75, TGF-bIR, TGF-bIIR, HLA-A, B, C, SSEA-3, SSEA-4, D7 and PD-L1. These cells have also been characterized as not expressing (and therefore being negative for) one or more of CD3, CD5, CD6, CD9, CD10, CD11a, CD14, CD15, CD18, CD21, CD25, CD31, CD34, CD36, CD38, CD45, CD49d, CD50, CD62E, L, S, CD80, CD86, CD95, CD117, CD133, SSEA-1 and ABO. Thus, mesenchymal stem cells may be characterized phenotypically and / or functionally (e.g., by their differentiation capacity and / or their functionality (e.g., their reparative or immunosuppressive function)).

[0064] As used herein, "mesenchymal stem cell (MSC)-like cells" refer to cells that are clonally selected, immortalized cells that share one or more markers and / or behavioral characteristics associated with typical MSCs. For example, MSC-like cells may exhibit a stem cell-like phenotype, e.g., differentiation potential. As described elsewhere herein, the inventors have identified cells deposited under ECACC Accession No. 22072103 (i.e., Y201 cells) that exhibit typical MSC characteristics in vitro and in vivo, particularly potent tissue-forming and anti-inflammatory properties, as demonstrated by in vitro trilineage differentiation, proliferation assays, and T cell activation assays, and in vivo subcutaneous transplantation assays and peritonitis models (see also the Examples section below). Thus, the Y201 cells described herein are an example of MSC-like cells. In another example, as described in more detail elsewhere herein, the present inventors have identified that cells deposited under ECACC Accession No. 22072101 (i.e., Y201 FGFR3 KO cells) also exhibit several typical MSC characteristics in vitro, particularly their marker expression, plastic adhesion, and colony formation ability, as demonstrated using flow cytometry and image analysis (see also the Examples section below). Thus, the Y201 FGFR3 KO cells described in more detail below are also an example of MSC-like cells. Those skilled in the art can easily identify mesenchymal stem cell (MSC)-like cells using routine methods known in the art, for example, using the methods described above as well as the methods described in the Examples section below. A further example of an MSC-like cell is the MSC#2 cell line, which is used as a comparative cell line in the Examples section below.

[0065] The term "derivative," as used herein in the context of cells, refers to a progeny cell derived from a "parent" cell, where the progeny cell is genetically distinct from the parent cell. In other words, a derivative is an altered version of the original (parent) cell from which the derivative is derived. Derivatives may be altered by any means known in the art, by natural or non-natural means (including genetic engineering). The derivative cells described herein may be derived from (e.g., produced from) mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. An example of a derivative derived from mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 is the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101. In this context, the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103 are the "parent" cells, and the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 are the modified progeny cells.

[0066] The derivative cells described herein may be derived from (e.g., may be produced from) the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101. In this context, the derivative cells are modified versions (modified progeny cells) of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 (parent cells).

[0067] In one example, the derivative (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 or a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101) may have reduced expression and / or activity of certain proteins compared to the cells from which the derivative is derived (e.g., the MSC-like cells deposited under ECACC Accession No. 22072103 or a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101).

[0068] As discussed elsewhere herein, the inventors modified Y201 cells to target deletion of the FGFR3 gene using CRISPR / Cas9 to determine the effect on cell behavior. The inventors were surprised to find that such further manipulation of Y201 MSCs advantageously increased the proliferation, migratory activity, and secretory behavior of the engineered cells, further enabling them to grow in serum-free conditions.

[0069] Thus, the present inventors have identified that it is advantageous to modify Y201 cells to create a targeted knockout of FGFR3. Thus, in some instances, derivatives (i.e., derivatives of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103) have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103.

[0070] In a further example, the derivatives (i.e., derivatives of the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103) differ from the MSC-like cells deposited under ECACC accession number 22072103 only by having reduced FGFR3 expression and / or activity.

[0071] Fibroblast growth factor receptor 3 (FGFR3; gene ID 2261) is an example of a fibroblast growth factor receptor (FGFR), a high-affinity receptor for fibroblast growth factors. These factors play diverse roles in cell proliferation, differentiation, and other biological processes, with their precise function dependent on the target cell and developmental stage. The FGFR3 gene is located on the short arm of chromosome 4 and encodes a receptor tyrosine kinase. The FGFR3 protein contains a central transmembrane domain, a tyrosine kinase domain at the carboxyl terminus, and an extracellular domain at the amino terminus. FGFR3 is known to have isoforms, including FGFR-IIIb and FGFR-IIIc, which arise from alternative splicing at the amino terminus. FGF-1 and FGF-9 are ligands for FGFR3b (FGFR-IIIb), and FGF-1, FGF-2, FGF-4, FGF-8, FGF-9, FGF-17, FGF-18, and FGF-23 are ligands for FGFR3c (FGFR-IIIc).

[0072] As used herein, the term "FGFR3" may include both mutant and wild-type forms, their isoforms and variants (e.g., human FGFR3 polypeptides (e.g., human FGFR3-IIIb isoform or human FGFR3-IIIc isoform). As used herein, the italicized term "FGFR3" typically refers to the FGFR3 gene.

[0073] The term "wild-type sequence" specifically encompasses naturally occurring truncated forms (e.g., extracellular domain sequences or transmembrane subunit sequences), naturally occurring mutant forms (e.g., alternatively spliced ​​forms), and naturally occurring allelic variants. The term "wild-type FGFR3" generally refers to a gene or polypeptide comprising the amino acid sequence of a naturally occurring FGFR3 gene or protein. For example, in the context of the present invention, gene ID 2261 present in Y201 cells may be considered wild-type FGFR3. The term "mutation," as used herein, refers to a difference in the amino acid or nucleic acid sequence of a particular protein or nucleic acid (e.g., gene or RNA) compared to the wild-type protein or nucleic acid, respectively. A mutated protein or nucleic acid can be expressed from or found in one allele (heterozygous) or both alleles (homozygous) of a gene. Mutations may include sequence rearrangements such as insertions, deletions, and point mutations (including single nucleotide / amino acid polymorphisms).

[0074] In some examples, FGFR3 expression and / or activity is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In some examples, FGFR3 expression and / or activity is reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In another example, FGFR3 expression and / or activity is reduced by at least 50% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In a further example, FGFR3 expression and / or activity is reduced by at least 70% compared to the MSC-like cells deposited under ECACC Accession No. 22072103.

[0075] The reduction of FGFR3 expression in cells may occur at the nucleic acid or protein level (e.g., at the gene, transcript (e.g., pre-mRNA transcript, mature mRNA transcript, or cDNA transcript) and / or protein level). Methods for determining FGFR3 expression are well known in the art and include, for example, Western blotting. Methods for reducing FGFR3 expression in cells are well known in the art and include using CRISPR / Cas9, gene mutation, or RNAi. In some examples, the amount of FGFR3 expression is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In some examples, the amount of FGFR3 expression is reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In other examples, FGFR3 expression is reduced by at least 50% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In further examples, FGFR3 expression is reduced by at least 70% compared to the MSC-like cells deposited under ECACC Accession No. 22072103.

[0076] The reduction of FGFR3 activity in cells can be, for example, due to a decrease in the amount of FGFR3 protein in cells (for example, due to a decrease in FGFR3 expression, an increase in FGFR3 degradation, and / or an FGFR3 mutation that leads to a decrease in FGFR3 protein).Also (or alternatively), the reduction of FGFR3 activity in cells can be, for example, due to a decrease in the amount of functional FGFR3 protein in cells (for example, due to a decrease in the ability of FGFR3 to interact or bind with its ligand and / or the ability to activate FGFR3 signal transduction).Methods for determining FGFR3 activity are well known in the art, and include, for example, measuring the phosphorylation of ERK1 / 2 by Western blotting.Methods for reducing FGFR3 activity in cells are well known in the art, and include using inhibitors that directly target FGFR3 (for example, by blocking its interaction with its ligand). In some examples, the amount of FGFR3 activity is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In some examples, the amount of FGFR3 activity is reduced by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In another example, FGFR3 activity is reduced by at least 50% compared to the MSC-like cells deposited under ECACC Accession No. 22072103. In a further example, FGFR3 activity is reduced by at least 70% compared to the MSC-like cells deposited under ECACC accession number 22072103.

[0077] In some cases (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may have increased levels of at least 10 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. In other words, at least 10 different RNA transcripts selected from Table 5 may be upregulated in the derivative compared to the level of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0078] In some instances (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may be compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC-like cells) deposited under ECACC Accession No. 22072103. Thus, the derivatives may have increased levels of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different RNA transcripts selected from Table 5. For example, the derivatives may have increased levels of at least 10, at least 20, at least 30, at least 40, or at least 50 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0079] In some examples (e.g., when the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or when the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may have increased levels of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. For example, the derivative may have increased levels of 10, 20, 30, 40 or 50 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0080] In some cases (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may have reduced levels of at least 10 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. In other words, at least 10 different RNA transcripts selected from Table 6 may be downregulated in the derivative compared to the level of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0081] In some instances (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may be compared to the level of the same RNA transcript in the mesenchymal stem cell (MSC-like cells) deposited under ECACC Accession No. 22072103. Thus, the derivative may have reduced levels of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different RNA transcripts selected from Table 6. For example, the derivative may have reduced levels of at least 10, at least 20, at least 30, at least 40, or at least 50 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0082] In some examples (e.g., when the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or when the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may have reduced levels of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. For example, the derivative may have reduced levels of 10, 20, 30, 40 or 50 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0083] As will be apparent to one of skill in the art, in some cases (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may have increased levels of multiple RNA transcripts (e.g., RNA transcripts selected from Table 5) compared to the level of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, or may have decreased levels of multiple RNA transcripts (e.g., RNA transcripts selected from Table 6) compared to the level of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. In this context, it will be apparent to one skilled in the art that the derivative may have any combination of these characteristics (e.g., any combination of (i) increased levels of multiple RNA transcripts selected from Table 5 and (ii) decreased levels of multiple RNA transcripts selected from Table 6, compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103).

[0084] Thus, in some instances (e.g., where the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or where the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity), the derivative may be (a) may have increased levels of at least 10 different RNA transcripts (e.g., 10 different RNA transcripts) selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) may have reduced levels of at least 10 different RNA transcripts (e.g., 10 different RNA transcripts) selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0085] For example, the derivative (a) may have increased levels of at least 20 different RNA transcripts (e.g., 20 different RNA transcripts) selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) may have reduced levels of at least 20 different RNA transcripts (e.g., 20 different RNA transcripts) selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0086] In another example, the derivative is (a) may have increased levels of at least 30 different RNA transcripts (e.g., 30 different RNA transcripts) selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) may have reduced levels of at least 30 different RNA transcripts (e.g., 30 different RNA transcripts) selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0087] In another example, the derivative is (a) may have increased levels of at least 40 different RNA transcripts (e.g., 40 different RNA transcripts) selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) may have reduced levels of at least 40 different RNA transcripts (e.g., 40 different RNA transcripts) selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0088] In another example, the derivative is (a) may have increased levels of at least 50 different RNA transcripts (e.g., 50 different RNA transcripts) selected from Table 5 compared to the levels of the same RNA transcripts in the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103; and / or (b) may have reduced levels of at least 50 different RNA transcripts (e.g., 50 different RNA transcripts) selected from Table 6 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0089] The level (e.g., amount) of RNA transcripts in cells can be easily determined by those skilled in the art using conventional methods known in the art, such as qPCR. Furthermore, those skilled in the art can easily determine, for example, using conventional methods known in the art, whether the derivative has an increased level of a particular RNA transcript (e.g., selected from Table 5) compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103, and / or whether the derivative has a decreased level of a particular RNA transcript (e.g., selected from Table 6) compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103. For example, those skilled in the art can use the methods described in the Examples section below (e.g., RNA-seq).

[0090] In a non-limiting example, the level (e.g., amount) of an RNA transcript in a cell (e.g., Y201 FGFR3 KO cell) can be determined as shown in the Examples section below, compared to a reference cell (e.g., Y201 WT cell). As described below, if there is a log2 fold increase of at least 1 and an adjusted p-value of less than 0.05 in the RNA-seq data for a particular RNA transcript in a cell (e.g., Y201 FGFR3 KO cell) compared to a reference cell (e.g., Y201 WT cell), it can be concluded that there is an increase in the level of that particular RNA transcript. In some examples, RNA transcripts with FPKM reads of less than 5 in both cell lines (e.g., Y201 FGFR3 KO cell and Y201 WT cell) are excluded from the analysis and are not identified as being up-regulated or down-regulated. For example, see the analysis performed in the Examples section below with respect to the data in Table 5.

[0091] In one non-limiting example, the level (e.g., amount) of an RNA transcript in a cell (e.g., Y201 FGFR3 KO cell) can be determined as shown in the Examples section below, compared to a reference cell (e.g., Y201 WT cell). As described below, if there is a log2 fold decrease of at least -1 and an adjusted p-value of less than 0.05 in the RNA-seq data for a particular RNA transcript in a cell (e.g., Y201 FGFR3 KO cell) compared to a reference cell (e.g., Y201 WT cell), it can be concluded that there is a decrease in the level of that particular RNA transcript. In some examples, RNA transcripts with fewer than 5 FPKM reads in both cell lines (e.g., Y201 FGFR3 KO cell and Y201 WT cell) are excluded from the analysis and are not identified as either up-regulated or down-regulated. For example, see the analysis performed in the Examples section below regarding the data in Table 6.

[0092] The terms "increased," "increase," "upregulated," and "higher" are all used herein to generally mean an increase by a statistically significant amount. For the avoidance of doubt, the terms "increased" or "increase" refer to an increase compared to a reference level / control (e.g., the level of RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103). For the avoidance of doubt, in the context of the present invention, the level of an RNA transcript (e.g., a compared RNA transcript selected from Table 5) may be increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240% or at least 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. For example, the level of an RNA transcript (e.g., an RNA transcript selected from Table 5 to be compared) may be increased by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, or 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.For example, the level of an RNA transcript (e.g., a compared RNA transcript selected from Table 5) may be increased by at least about 0.5-fold, or at least about 1.0-fold, or at least about 1.2-fold, or at least about 1.5-fold, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any increase between 1.0-fold and 10-fold or greater, compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0093] The terms "reduce," "reduced," "lowered," "reduced," or "downregulated," "lower" are all used herein to generally mean a decrease by a statistically significant amount. However, for the avoidance of doubt, "reduced," "lowered," "reduced," or "reduced" refers to a decrease compared to a reference level / control (e.g., the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103). For the avoidance of doubt, in the context of the present invention, the level of an RNA transcript (e.g., a compared RNA transcript selected from Table 5) may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240% or at least 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. In some examples, the level of an RNA transcript (e.g., a compared RNA transcript selected from Table 5) may be reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, or 250% compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.For example, the level of an RNA transcript (e.g., a compared RNA transcript selected from Table 6) may be reduced by at least about 0.5 fold, or at least about 1.0 fold, or at least about 1.2 fold, or at least about 1.5 fold, or at least about 2 fold, or at least about 3 fold, or at least about 4 fold, or at least about 5 fold, or at least about 10 fold, or any value between 1.0 fold and 10 fold or less, compared to the level of the same RNA transcript in mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0094] The term "RNA transcript" is used herein according to its conventional meaning, i.e., it refers to a single-stranded ribonucleic acid (RNA) synthesized by transcription of DNA. RNA transcripts include mature RNA products, such as mRNA, tRNA, and rRNA, as well as precursor RNAs, such as precursor mRNAs (pre-mRNAs), which are processed into messenger RNAs (mRNAs).

[0095] As mentioned above, the present inventors have used CRISPR / Cas9 to modify Y201 cells by targeting deletion of the FGFR3 gene.Therefore, the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 or derivatives thereof are also provided herein.For the avoidance of doubt, the definition of "derivative" as provided above also applies here.

[0096] The mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 may be referred to herein as "Y201 FGFR3 KO cells" and / or "FGFR3 KO MSCs." The FGFR3 KO MSCs (deposited under ECACC accession number 22072101) were deposited under the Budapest Treaty of 1977 on July 21, 2022, at the UK Health Security Agency Porton Down and European Collection of Authenticated Cell Cultures, Porton Down, Salisbury, SP4 0JG, UK.

[0097] The inventors have surprisingly shown that the cells provided herein have tissue-forming and anti-inflammatory properties, and therefore may be useful, for example, in therapeutic settings.

[0098] Accordingly, also provided is a cell population comprising a plurality of the cells provided herein.

[0099] As used herein, a "cell population" refers to a plurality of cells (i.e., two or more cells). Thus, as will be apparent to one of skill in the art, in the context of the present invention, a "plurality" refers to "two or more" (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twenty or more, forty or more, sixty or more, eighty or more, one hundred or more, etc.).

[0100] The cell populations provided herein can be genetically homogenous (i.e., having substantially the same genotype) or genetically heterogeneous (i.e., having genetic differences that can be natural genetic variations or man-made mutations caused, for example, by mutagenesis and gene editing techniques).

[0101] As will be apparent to one of skill in the art, the cell population may comprise any of the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof).

[0102] In some examples, the cell populations provided herein may comprise a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103.

[0103] In some examples, the cell populations provided herein may include multiple derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. For example, the cell populations may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103) that have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103. For example, the cell populations may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103), where the derivatives differ from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity.

[0104] In some examples, the cell populations provided herein may comprise a plurality of cells, wherein the plurality of cells is comprised of: (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103; and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited under ECACC Accession No. 22072103, or the derivative differs from the MSC-like cell deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0105] In another example, the cell populations provided herein may comprise a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101.

[0106] In another example, the cell populations provided herein may include multiple derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101.

[0107] In another example, the cell populations provided herein may comprise a plurality of cells, wherein the plurality of cells is comprised of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0108] In some examples, the cell populations provided herein may comprise a plurality of cells, wherein the plurality of cells consists of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0109] Thus, the cell populations described herein may be mixed populations comprising at least two genetically distinct cell subpopulations as described herein. The mixed population may comprise a combination of any two or more cell types as described in detail elsewhere herein.

[0110] Those skilled in the art will know how to generate the cell populations (e.g., mixed cell populations) described herein, for example, using conventional cell culture techniques. Cell culture is described in detail elsewhere herein.

[0111] The cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) may be used to obtain a preparation of genomic DNA by DNA extraction methods. Accordingly, the present invention further provides a DNA preparation comprising (e.g., extracted from) genomic DNA of any of the cells described herein.

[0112] As will be apparent to those skilled in the art, any of the cells described herein can be subjected to genomic DNA extraction, for example, by methods of DNA extraction well known in the art, using, for example, organic extraction, silica spin columns, and magnetic beads. Accordingly, the present invention further provides a DNA preparation comprising genomic DNA extracted from any of the cells described herein.

[0113] In some examples, the DNA preparations provided herein include genomic DNA of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. In other examples, the DNA preparations provided herein include genomic DNA of a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or the derivative differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0114] In another example, the DNA preparations provided herein contain genomic DNA of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101. In another example, the DNA preparations provided herein contain genomic DNA of a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101.

[0115] As used herein, "DNA preparation" refers to a sample containing genomic DNA obtained or generated from a cell described herein; typically, the genomic DNA is mixed with a DNA-compatible buffer. Suitable buffers are well known in the art, such as buffers having a pH of about 7.5 to 8.0 (e.g., Tris-EDTA (TE) buffer). As used herein, "genomic DNA (gDNA)" refers to chromosomal DNA (e.g., chromosomal DNA of a cell described herein).

[0116] As exemplified herein, the inventors have shown that cell-free conditioned medium, secretomes, and / or EVs obtained from cultures of Y201 cells or Y201 FGFR3 KO cells have beneficial therapeutic effects. Accordingly, cell-free conditioned medium obtainable by cell culture of the cells described herein or cell populations described herein is provided.

[0117] For example, provided herein is cell-free conditioned medium obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103.

[0118] Also provided herein is a cell-free conditioned medium obtainable by cell culture of a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells, for example, deposited under ECACC Accession No. 22072103.

[0119] Also provided herein is a cell-free conditioned medium obtainable by cell culture of a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103 and / or a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0120] Also provided is a cell-free conditioned medium obtainable by cell culture of a cell population comprising multiple derivatives of mesenchymal stem cell (MSC)-like cells, e.g., those deposited under ECACC Accession No. 22072103. The cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103) that have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103. For example, the cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103), which derivatives differ from the MSC-like cells deposited under ECACC Accession No. 22072103 only by reduced FGFR3 expression and / or activity.

[0121] In another example, a cell-free conditioned medium is provided that is obtainable by cell culture of a cell population comprising a plurality of cells, the plurality of cells consisting of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited under ECACC Accession No. 22072103, and / or the derivative differs from the MSC-like cell deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0122] In another example, there is provided a cell-free conditioned medium obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0123] In another example, there is also provided a cell-free conditioned medium obtainable by cell culture of a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101.

[0124] Also provided is a cell-free conditioned medium obtainable by cell culture of a derivative of mesenchymal stem cell (MSC)-like cells, for example, deposited under ECACC accession number 22072101.

[0125] Also provided is a cell-free conditioned medium obtainable by cell culture of a cell population comprising multiple derivatives of mesenchymal stem cell (MSC)-like cells, for example, deposited under ECACC accession number 22072101.

[0126] In another example, there is also provided a cell-free conditioned medium obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells is comprised of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0127] Also provided in some examples is a cell-free conditioned medium obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells consists of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0128] The synonymous phrases "cell-free" and "cell-free" are generally well understood in the art and, in the present context, can particularly mean that a composition (e.g., a conditioned medium or composition described herein) is essentially free of cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, a derivative thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or a derivative thereof). In particular, "cell-free" and "cell-free" in the present context can particularly mean that a composition (e.g., a conditioned medium or composition described herein) is essentially free of viable cells (e.g., viable mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, a viable derivative thereof, viable mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or a viable derivative thereof). The degree to which a composition (including conditioned medium) is cell-free tends to be determined primarily by the effectiveness of the methods available for separating cells from the culture medium, such as centrifugation or filtration, or repetition and / or combinations of such methods. In practice, a composition containing conditioned medium may contain up to 5×10 cells. 2Cells may be considered as cell-free if they contain less than 100 cells / ml, 50 cells / ml, 25 cells / ml, 10 cells / ml, or 5 cells / ml, or contain no cells (i.e., 0 cells) / ml; preferably, these counts represent viable cells.To determine the number of cells present in a composition (such as conditioned medium), conventional cell counting methods can be used, such as optical microscopy, flow cytometry, or plating and colony-forming unit (CFU) determination.Methods for determining cell viability are known to those skilled in the art, and can be used, for example, conventional cell viability determination methods, such as dye (e.g., trypan blue or propidium iodide) exclusion assay.

[0129] The cell-free conditioned medium provided herein can be obtained by cell culture of the cells described herein or cell culture of the cell population described herein. As used herein, the terms "culture" and "cell culture" are common in the art and are used interchangeably herein. As used herein, the terms "culture" and "cell culture" refer to the process in which cells (e.g., one cell) (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103, their derivatives, mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 and / or their derivatives) are maintained and / or propagated (e.g., divided) under controlled conditions, preferably in vitro or ex vivo.

[0130] Cell culture typically requires a cell culture medium. As used herein, the term "medium" (or "media") broadly encompasses any cell culture medium that promotes the maintenance and / or proliferation of cells (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof, as described herein). Typically, the medium is a liquid culture medium that facilitates its easy manipulation (e.g., decantation, pipetting, centrifugation, filtration, etc.). As used herein, the terms "medium," "culture medium," "culture media," and "media" are used interchangeably.

[0131] Various cell culture media are known to those skilled in the art, and those skilled in the art will also understand that the type of culture medium used may depend on the type of cells being cultured. Preferably, the cells described herein are cultured in a defined culture medium containing the minimum essential elements necessary to maintain the cells, and the components of the medium are known and controlled. Such minimum essential elements (and corresponding defined culture media) for MSC culture (and therefore the cells provided herein) are known in the art. For example, the culture conditions used herein (e.g., for Y201 cells and / or Y201 FGFR3 KO cells) may include culturing the cells at 37 degrees Celsius in 5% CO2. Examples of suitable cell culture media for use in accordance with the present invention are provided in the Examples section below. For example, serum-free medium and / or the presence or absence of certain nutrients may be beneficial when creating cell-conditioned medium as described elsewhere herein (e.g., to maintain the conditioned medium described herein substantially free of contaminants).

[0132] Typically, the medium comprises a basal medium formulation known in the art. Many basal medium formulations (e.g., available from the American Type Culture Collection (ATCC); or from Invitrogen, Carlsbad, California) can be used to culture the cells described herein, including, but not limited to, Eagle's Minimum Essential Medium (MEM), Dulbecco's Modified Eagle's Medium (DMEM), alpha-modified minimal essential medium (alpha-MEM), basal essential medium (BME), Iscove's Modified Dulbecco's Medium (IMDM), BGJb medium, F-12 nutrient mixture (Ham's), Leibovitz's L-15, DMEM / F-12, essential modified Eagle's medium (EMEM), RPMI-1640, Medium 199, Weymouth MB 752 / 1, or Williams' Medium E, as well as modifications and / or combinations thereof. The compositions of the above basal media are generally known in the art, and it is within the skill of one of ordinary skill in the art to modify or modulate the concentrations of medium and / or medium supplements required for the cells being cultured. A particularly preferred basal medium for culturing the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 and / or derivatives thereof) may be DMEM.

[0133] Such basal medium formulations contain components necessary for the maintenance and / or growth of mammalian cells, which are known per se. By way of example and not limitation, these components may include inorganic salts (especially salts containing Na, K, Mg, Ca, Cl, P, and optionally Cu, Fe, Se, and Zn), physiological buffers (e.g., HEPES, bicarbonate), nucleotides, nucleosides and / or nucleic acid bases, ribose, deoxyribose, amino acids, vitamins, antioxidants (e.g., glutathione), and carbon sources (e.g., glucose, sodium pyruvate, sodium acetate).

[0134] For use in culturing, basal medium can be supplied with one or more additional components.For example, in some cases, additional supplements can be used to supply cells with the trace elements and substances necessary for optimal maintenance, growth and / or expansion.In addition, antioxidant supplements, such as β-mercaptoethanol or N-acetyl-L-cysteine, can be added at appropriate concentrations.Many basal media already contain amino acids, but some amino acids, such as L-glutamine, which are known to be less stable in solution, can be supplemented later. In further examples, the medium may be further supplemented with antibiotic and / or antifungal compounds, such as typically a mixture of penicillin and streptomycin, and / or other compounds including but not limited to amphotericin, ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tyrosine, and zeocin.

[0135] In some cases, the medium is supplemented with penicillin / streptomycin (P / S).

[0136] Lipid and lipid carrier can also be used to supplement cell culture medium.Such lipid and carrier can include, but are not limited to, among others, cyclodextrin, cholesterol, linoleic acid conjugated with albumin, linoleic acid and oleic acid conjugated with albumin, unconjugated linoleic acid, linoleic acid-oleic acid-arachidonic acid conjugated with albumin, oleic acid not conjugated with albumin, and oleic acid conjugated with albumin.Albumin can also be used in fatty acid-free formulation.

[0137] In some cases, cell culture media may be supplemented with mammalian plasma or serum. Plasma or serum often contains cellular factors and components that promote cell viability and expansion. Plasma or serum may be heat-inactivated. Heat inactivation is primarily used in the art to remove complement. Heat inactivation typically involves incubating plasma or serum at 56°C for 30-60 minutes, e.g., 30 minutes, with constant mixing, followed by gradual cooling to ambient temperature. Those skilled in the art will recognize any common modifications and requirements of the above procedure. Plasma or serum may be sterilized before storage or use. Typical means of sterilization may include, for example, filtration through one or more filters having a pore size of less than 1 μm, preferably less than 0.5 μm, e.g., 0.45 μm, 0.40 μm, 0.35 μm, 0.30 μm, or 0.25 μm, more preferably 0.2 μm or less, e.g., 0.15 μm or less, 0.10 μm or less. Serum or plasma suitable for use in the media taught herein may include human serum or plasma, or serum or plasma from a non-human animal, e.g., a non-human mammal such as a non-human primate (e.g., lemur, monkey, ape), fetal or adult cow, horse, pig, lamb, goat, dog, rabbit, mouse or rat serum or plasma, or any combination thereof.

[0138] The media taught herein may preferably contain bovine serum or plasma, preferably fetal bovine (calf) serum or plasma, more preferably fetal bovine (calf) serum (FCS or FBS).

[0139] In some cases, the medium is supplemented with FBS and penicillin / streptomycin (P / S).

[0140] In some instances, serum or plasma may be replaced (e.g., during cell culture) with a serum replacement agent, for example, to provide a serum-free medium (i.e., a chemically defined medium). Thus, the cells described herein can be cultured using a serum-free medium. Providing a serum-free medium can be particularly advantageous in terms of administering the medium to a subject, particularly a human subject (e.g., improving biosafety). As used herein, "serum replacement" broadly refers to any composition that can be used to replace animal serum in cell culture media. For example, a serum replacement agent may replace the functions (e.g., cell maintenance and growth support functions) of animal serum in cell culture media. Conventional serum replacement agents typically contain vitamins, albumin, lipids, amino acids, transferrin, antioxidants, insulin, and trace elements. Many commercially available serum replacement additives, such as KnockOut Serum Replacement (KOSR), N2, B27, Insulin-Transferrin-Selenium Supplement (ITS), and G5, are well known and readily available to those skilled in the art. For example, DMEM (eg, DMEM supplemented with P / S) can be used.

[0141] Plasma, serum, or serum substitute may be included in the medium taught herein at any appropriate ratio (volume of plasma, serum, or serum substitute / volume of medium). For example, about 0.5% v / v to about 70.0% v / v, preferably about 10.0% v / v to about 60.0% v / v, for example, about 10.0% v / v to about 55.0% v / v. For example, plasma, serum, or serum substitute may be included in the medium taught herein at about 0.5% v / v to about 10% v / v. For example, plasma, serum, or serum substitute may be included in the medium taught herein at about 10.0% v / v.

[0142] In some examples, the medium (e.g., the conditioned medium described in more detail below) may lack serum or plasma, i.e., the medium (e.g., the conditioned medium) may be serum-free (e.g., serum-free conditioned medium). The provision of these media can improve the biological safety and / or immunological profile of the medium (e.g., the conditioned medium).

[0143] As an example, a medium for culturing the cells described herein may include Dulbecco's Modified Eagle's Medium (DMEM) (Catalog No. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (Catalog No. 15140122, ThermoFisher Scientific). In some examples, a medium for culturing the cells described herein may include Dulbecco's Modified Eagle's Medium (DMEM) (Catalog No. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (Catalog No. 15140122, ThermoFisher Scientific), which has been centrifuged (e.g., at 10,000 g for 18 hours at 4°C) to deplete serum-derived bovine EVs from the medium. In some cases, during cell expansion, this medium can be diluted to an equal volume with DMEM supplemented with 1% P / S.

[0144] A particularly preferred medium for culturing Y201 WT cells in particular may be a serum-free medium.

[0145] A particularly preferred medium for culturing Y201 FGFR3 KO cells in particular may comprise DMEM.

[0146] The term "conditioned medium" as used herein refers to a medium that has been exposed (e.g., contacted) with at least one cell for a sufficient period of time so that the medium contains at least one additional component that was not present in the medium before the medium was exposed to the cells, the at least one additional component being a cell product / metabolite. In other words, a "conditioned medium" may be considered a medium that contains, among other things, cell-secreted products such as cell-secreted proteins and cell-metabolites. At least one cell may be grown in culture, i.e., in an appropriate medium, for a sufficient period of time so that the conditioned medium contains at least one additional component that was not present in the medium before the medium was exposed to the cells, the at least one additional component being a cell product / metabolite. A conditioned medium may be referred to herein as "CM."

[0147] The period of time sufficient for the medium exposed to (e.g., contacted with) at least one cell to contain at least one additional component that was not present in the medium before the medium was exposed to the cells (at least one additional component is / was produced by the cells) may be, in particular, a period of time sufficient for the at least one cell to achieve secretion of a secretory product (e.g., including a secretory protein and extracellular vesicles) into the medium. For example, the period of time may be at least about 1 hour, at least about 3 hours, at least about 6 hours, at least about 12 hours, at least about 18 hours, at least about 24 hours, at least about 36 hours, or at least about 48 hours. Typically, the period of time is about 72 hours or less, more typically about 60 hours or less, and even more typically about 48 hours or less.

[0148] In some examples, a period of time sufficient for the medium exposed to (e.g., contacted with) at least one cell to include at least one additional component that was not present in the medium prior to exposing the medium to the cells (at least one additional component is produced / has been produced by the cells) may be at least 24 hours. Thus, in some examples, a period of time sufficient for the medium exposed to (e.g., contacted with) at least one cell to include at least one additional component that was not present in the medium prior to exposing the medium to the cells (at least one additional component is produced / has been produced by the cells) may be about 24 hours.

[0149] In some examples, a period of time sufficient for the medium exposed to (e.g., contacted with) at least one cell to include at least one additional component that was not present in the medium prior to exposing the medium to the cells (at least one additional component is produced / has been produced by the cells) may be at least 48 hours. Thus, in some examples, a period of time sufficient for the medium exposed to (e.g., contacted with) at least one cell to include at least one additional component that was not present in the medium prior to exposing the medium to the cells (at least one additional component is produced / has been produced by the cells) may be about 48 hours.

[0150] Thus, conditioned medium can be obtained or directly obtained by culturing the cells or cell populations provided herein in cell culture medium, thereby conditioning the medium. Cell-free conditioned medium can be obtained by separating the culture medium from the cells or cell populations, thereby obtaining the cell-free conditioned medium described elsewhere herein. The term "cell-free" is defined above and applies equally here. Thus, as will be apparent to those skilled in the art, "cell-free conditioned medium" is a conditioned medium that essentially does not contain cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101, and / or derivatives thereof) (conditioned medium is a conditioned medium as defined herein).

[0151] Typically, animal cells, e.g., mammalian cells such as human cells, are cultured under conditions known in the art to promote in vitro cell culture, e.g., a temperature of 37°C, 5% v / v CO2, and greater than 95% humidity, by exposing them to (i.e., contacting) a suitable cell culture medium in a vessel or container suitable for the purpose of the experiment (e.g., a 96-, 24-, or 6-well plate, a T-25, T-75, T-150, T-175, or T-225 flask, or a cell factory). In some examples, the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) and / or cell populations are cultured in a T175 flask.

[0152] Regarding cell culture conditions, suitable materials for cell culture (e.g., plates, flasks, or bioreactors) can be easily selected by those skilled in the art. Other cell culture conditions that can be finely adjusted to obtain the conditioned medium described herein with the desired composition and properties include temperature, cell density at seeding, and oxygen tension.

[0153] When preparing conditioned medium, the cells by whose action the medium is to be conditioned (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) may be contacted with the medium at various initial cell densities. By way of example, the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or population of cells may be contacted with the medium at an initial cell confluency of at least about 50%, e.g., at least about 55%, at least about 60%, e.g., at least about 65%, or at least about 70%, at least about 75%, or at least about 80%, e.g., at least about 85%, or at least about 90%, e.g., at least about 95%, e.g., 96%, 97%, 98%, 99%, or even 100%.

[0154] The term "confluency" refers to the density of cultured cells at which the cells are in contact with each other and cover substantially all of the surface available for cell growth (ie, completely confluent).

[0155] In some examples, the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) and / or cell populations may be contacted with the medium at an initial cell confluency of at least about 80%. In another example, the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) may be contacted with the medium at an initial cell confluency of at least about 90%.

[0156] By way of example, the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) and / or cell populations can be at least about 1000 cells / cm. 2 Initial cell density of the growth surface area, e.g., at least about 2000 cells / cm 2 , at least about 10,000 cells / cm 2 , at least about 25,000 cells / cm 2 , at least about 50,000 cells / cm 2 Growth surface area, e.g., at least about 75,000 cells / cm 2 , at least about 85,000 cells / cm 2 For example, the cells described herein may be contacted with the medium at an initial cell density of about 100,000 cells / cm. 2 Initial cell density below 95,000 cells / cm 2 less than, more typically about 90,000 cells / cm 2 The following initial cell densities may be contacted with the medium: Thus, by way of example, the cells described herein are typically at about 1000 cells / cm 2 ~About 100,000 pieces / cm 2 , for example, about 2,000 pieces / cm 2 ~About 100,000 pieces / cm 2 For example, about 80,000 particles / cm 2 The cells may be contacted with the medium at an initial cell density such as

[0157] When preparing conditioned medium, the medium to be conditioned may be provided in a volume common in tissue culture. Typically, the cells described herein are cultured at a volume of about 0.10 mL / cm. 2 Growth surface area: approx. 0.20 mL / cm 2 Growth surface area, more typically about 0.12 mL / cm 2 ~Approx. 0.18mL / cm 2 , and even more typically about 0.13 mL / cm 2 ~Approx. 0.16mL / cm 2Typically, the cells described herein may be contacted with about 0.14 mL / cm of medium. 2 The growth surface area may be contacted with the medium.

[0158] A method for producing cell-free conditioned medium may include culturing the cells or cell population described herein in a cell culture medium and separating the culture medium from the cells. This method can be performed by using a cell culture medium that is serum-free, by modifying specific cell culture conditions, and / or by separating the cell culture medium from the cells after culturing the cells for a given time point. In some examples, the culture medium is separated from the cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population after exposure to (e.g., contact with) the cells or cell population for at least about 1 hour, at least about 3 hours, at least about 6 hours, at least about 12 hours, at least about 18 hours, at least about 24 hours, at least about 36 hours, or at least about 48 hours. Typically, the period is about 72 hours or less, more typically about 60 hours or less, and even more typically about 48 hours or less. As will be apparent to one of skill in the art, suitable time points can be very short (e.g., 2 hours or less), or longer, e.g., 24 hours, 36 hours or more, or intermediate time points (e.g., 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, or 18 hours).

[0159] In some examples, the culture medium is separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population described herein after at least about 24 hours of exposure to (e.g., contact with) the cells or population of cells described herein.

[0160] In some examples, the culture medium is separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population described herein after at least about 48 hours of exposure to (e.g., contact with) the cells or population of cells described herein.

[0161] In some examples, one or more (e.g., two) separate cell-free conditioned media can be prepared (e.g., produced) using the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell populations. As discussed above, a method for producing cell-free conditioned media can include culturing the cells or cell populations described herein in cell culture medium and separating the culture medium from the cells. This method can be carried out by using a cell culture medium that is serum-free, by modifying certain conditions of the cell culture, and / or by separating the cell culture medium from the cells after culturing the cells for a given time point. In some examples, the first culture medium may be separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population described herein after at least about 24 hours of exposure to (e.g., contact with) the cells or population of cells. The cell culture medium may then be replenished, and a second culture medium may be separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population used to prepare the first culture medium after another at least about 24 hours of exposure to (e.g., contact with) the cells or population of cells.In other words, the cells (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell populations described herein may be used to prepare first and second culture media, the first culture medium may be separated from the cells or cell populations described herein after at least about 24 hours of exposure to (e.g., contact with) the cells or population of cells, and the second culture medium may be separated from the cells or cell populations described herein after another at least about 24 hours of exposure to (e.g., contact with) the cells or population of cells. In some examples, the first culture medium and the second culture medium may be pooled (e.g., after the first culture medium and the second culture medium are separated from the cells or population of cells described herein).

[0162] In some examples, the first culture medium may be separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population described herein after about 24 hours of exposure to (e.g., contact with) the cells or population of cells. The cell culture medium may then be replenished, and the second culture medium may be separated from the cells (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell population used to prepare the first culture medium after about another 24 hours of exposure to (e.g., contact with) the cells or population of cells.

[0163] As known to those skilled in the art, culture medium may be separated from cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell populations when the cells or cell populations are at any suitable confluency (e.g., to obtain cell-free conditioned medium). For example, culture medium may be separated from cells described herein (e.g., mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or cell populations when the cells or cell populations are at about 80% to about 90% confluency. In some cases, 80% confluency is approximately 24,000 cells / cm for Y201 cells. 2 It can be equivalent to.

[0164] Conditioned medium can be separated from the cells or cell population used to condition the medium by any available technique. Conventional techniques include, for example, removing the medium from the culture vessel by decanting or pipetting, centrifuging the medium to pellet cells, cell fragments, and particulate matter present in the medium (e.g., centrifugation at about 100 g to about 2,000 g, e.g., about 200 g to about 1,500 g, e.g., about 300 g, for about 3 minutes to about 30 minutes, e.g., about 5 minutes to 20 minutes, e.g., about 5 minutes), and filtering the medium to filter out cells, cell fragments, and particulate matter present in the medium (e.g., filtration through a standard microbiological filter having a pore size of about 1.0 μm or less, about 0.8 μm or less, about 0.6 μm or less, about 0.4 μm or less, e.g., about 0.2 μm). It is understood that repetition and / or combination of such methods can be used to achieve a relatively more complete separation. Examples of techniques for isolating conditioned medium from the cells or populations of cells used to condition the medium are well known in the art, and specific examples are provided in the Examples section below.

[0165] In some examples, separation of conditioned medium from the cells or cell populations described herein may be performed by simply transferring the supernatant from the cell culture vessel or cell population culture vessel (by decanting or pipetting) to another vessel, and optionally repeating, and / or in combination with filtration (e.g., filtration through a standard microbiological filter having a pore size of about 1.0 μm or less, about 0.8 μm or less, about 0.6 μm or less, about 0.4 μm or less, e.g., about 0.2 μm), or by centrifuging the cell culture supernatant at low speed (e.g., at about 100 g to about 2000 g, e.g., at about 200 g to about 1500 g, e.g., at about 300 g for about 3 minutes to about 30 minutes, e.g., about 5 minutes to 20 minutes, e.g., about 5 minutes) to pellet any remaining cells, cell debris, or particulate matter. In this way, a cell-free preparation (supernatant of centrifugation) is obtained, which may then be used according to commonly available techniques (e.g., immunoassays, spectrophotometric methods (e.g., LC-MS) or enzymatic assays) to determine the identity and concentration of the biomolecules present, for example, soluble proteins or extracellular vesicles as defined below.

[0166] In certain examples, separation of conditioned medium from the cells or cell populations described herein may be performed by transferring (by decanting or pipetting) the supernatant of the cell culture vessel or cell population culture vessel to another vessel, and optionally centrifuging the cell culture supernatant at low speed (e.g., centrifugation at 300 g for about 5 minutes) to pellet any remaining cells, cell debris, or particulate matter. The supernatant obtained after centrifugation may be referred to herein as cell-free conditioned medium.

[0167] In certain examples, separation of conditioned medium from the cells or cell populations described herein may be performed by centrifuging the cell culture or cell population culture at low speed (e.g., centrifugation at 300 g for about 5 minutes) to pellet remaining cells, cell debris, or particulate matter. The supernatant obtained after centrifugation may be referred to herein as cell-free conditioned medium.

[0168] The conditioned medium described herein may include any components secreted by the cells or cell population used to condition the medium. Typically, the conditioned medium described herein includes soluble proteins and extracellular vesicles secreted by the cells or cell population used to condition the medium.

[0169] In certain examples, the conditioned medium described herein may contain the secretome of the cells (or the secretome of a population of cells) used to condition the medium. Thus, a secretome or a portion thereof obtainable by cell culture of the cells described herein (e.g., the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103, derivatives thereof, the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072101 and / or derivatives thereof) or the cell population described herein is provided.

[0170] As used herein, "secretome" refers to the totality (or collection) of components secreted or released by a cell or cell population into its surroundings (e.g., into the culture medium) when the cell or cell population is cultured. Secretome components can be organic and / or inorganic. Secretome components typically include proteins and extracellular vesicles (EVs) (including exosomes and microvesicles). Thus, the secretome described herein typically includes soluble proteins and EVs secreted by the cell or cell population used to condition the medium. Secretome components can also include lipids, cytokines (cellular messengers), hormone-like substances, and so-called immunomodulatory substances. ECM components are also typically components of the secretome, and thus, as will be apparent to those skilled in the art, ECM components are typically present in the conditioned medium.

[0171] Provided herein is a secretome, or a portion thereof, obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103.

[0172] Also provided herein is a secretome, or portion thereof, obtainable by cell culture of a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103.

[0173] Also provided herein is a secretome, or portion thereof, obtainable by cell culture of a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or a derivative of the mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by reduced FGFR3 expression and / or activity).

[0174] Also provided is a secretome, or portion thereof, obtainable by cell culture of a cell population comprising multiple derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. The cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103) that have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103. For example, the cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103), where the derivatives differ from the MSC-like cells deposited under ECACC Accession No. 22072103 only by reduced FGFR3 expression and / or activity.

[0175] In one example, a secretome or portion thereof is provided that is obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells is comprised of: (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103; and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited under ECACC Accession No. 22072103, and / or the derivative differs from the MSC-like cell deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0176] Further provided is a secretome or part thereof obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0177] Also provided is a secretome, or portion thereof, obtainable by cell culture of a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0178] Also provided is a secretome or portion thereof obtainable by cell culture of a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0179] Also provided is a secretome or portion thereof obtainable by cell culture of a cell population comprising multiple derivatives of mesenchymal stem cell (MSC)-like cells, for example, deposited under ECACC accession number 22072101.

[0180] In another example, there is also provided a secretome or portion thereof obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells is comprised of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0181] In another example, there is also provided a secretome or portion thereof obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells consists of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0182] As used herein, a "portion" of a secretome refers to a sample of the secretome, which may be, for example, isolated from the rest of the secretome. In one example, the portion of the secretome may be a specific fraction of the entire secretome (e.g., isolated according to the size of the secretome components therein). In other words, the portion may be enriched in a specific component of the secretome as a whole (the portion has a higher proportion of the specific component compared to the secretome as a whole). In this context, the term "fraction" refers to the result of a separation process in which a mixture (e.g., a solid, liquid, solute, or suspension) is divided, i.e., separated, into two or more smaller amounts ("fractions") of varying composition. Therefore, the composition of the fraction is altered compared to the composition of the mixture subjected to fractionation, i.e., different from the composition of the mixture subjected to fractionation.

[0183] The secretome or a portion thereof may be obtained using conventional methods known in the art (e.g., from cell culture medium as described herein). For example, the secretome may be obtained from the conditioned medium described herein using methods such as centrifugation, filtration, or dialysis.

[0184] In some examples, the cell-free conditioned medium provided herein may be serum-free.

[0185] As discussed elsewhere herein, the conditioned medium and / or secretome provided herein may include any components secreted by the cells or cell populations used to condition the medium, e.g., extracellular vesicles (EVs). For certain purposes described herein, it may be advantageous to remove EVs from the conditioned medium and / or secretome described herein.

[0186] Thus, in some examples, the cell-free conditioned medium provided herein may be depleted of extracellular vesicles (EVs).

[0187] Similarly, in some examples, the secretomes or portions thereof provided herein may be depleted of extracellular vesicles (EVs).

[0188] As will be apparent to those skilled in the art, the conditioned medium or secretome provided herein that is depleted of extracellular vesicles (EVs) has only a minimal amount of contaminating EVs. In other words, the conditioned medium or secretome provided herein that is depleted of EVs may be primarily composed of components not associated with EVs (e.g., cellular or extracellular proteins, lipids, carbohydrates, lipoproteins, etc.). In this context, "minimal amount" may include less than 10% (by concentration) EV contamination, less than 5%, less than 2%, less than 1%, less than 0.5%, less than 0.25%, less than 0.1%, etc. (by concentration). The level of contamination does not need to be 0%. The level of contamination may be determined using EM.

[0189] The conditioned medium or secretome sample described herein may be substantially free of EV.In certain examples, the cell-free conditioned medium provided herein may be substantially free of extracellular vesicles (EV).Similarly, in certain examples, the secretome or its portion provided herein may be substantially free of extracellular vesicles (EV).

[0190] The term "substantially free" when referring to a conditioned medium or secretome that is substantially free of EVs means that the percentage of EVs in the conditioned medium or secretome (as appropriate) is significantly lower than the percentage found in the starting conditioned medium or secretome from which the substantially free EVs are generated (e.g., untreated conditioned medium or secretome). Typically, the percentage of EVs in a substantially EV-free conditioned medium or secretome is less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% of the total conditioned medium or secretome; preferably, the percentage of EVs in a substantially EV-free conditioned medium or secretome is less than 0.5%, less than 0.25%, less than 0.1%, etc., of the total conditioned medium or secretome. The level of contamination need not be 0%.

[0191] EVs may be removed (e.g., extracted) from the conditioned medium or secretome provided herein by conventional methods known in the art (Brennan et al., 2020, A comparison of methods for the isolation and separation of extracellular vesicles from protein and lipid particles in human serum. Sci Rep 10, 1039). In other words, the conditioned medium or secretome provided herein may be depleted of EVs by any suitable means. Examples of suitable methods are described in the Examples section below. Preferably, EVs are removed (e.g., extracted) from the conditioned medium or secretome described herein using (differential) ultracentrifugation. The conditioned medium can be centrifuged at various relative centrifugal forces (rcf) to obtain (e.g., remove) EVs of corresponding densities. Typically, the majority of EVs can be obtained (and therefore removed) by centrifugation steps at 10,000 g and 100,000 g. Preferably, fractions obtained by the 2,000g and 10,000g centrifugation steps are removed from the conditioned medium, followed by collection (and therefore removal) of the fraction obtained by centrifugation at 100,000g.

[0192] In some examples, EVs are removed (e.g., extracted) from the conditioned medium or secretome described herein using tangential flow filtration (TFF).

[0193] Extracellular vesicles have been well characterized in the art and have a well-defined meaning (reviewed in Andaloussi et al., Nature Reviews Drug Discovery, vol. 12, May 2013, pp. 347-357). As used herein, "extracellular vesicles" refers to any membrane-bound particles secreted by cells. Extracellular vesicles have been isolated from several body fluids. They have been shown to play an important role in regulating physiological processes, including stem cell maintenance, immune surveillance, and blood coagulation. They have also been shown to play an important role in the underlying pathology of several diseases.

[0194] Extracellular vesicles are released from cells intact, either by shedding from multivesicular bodies (MVBs) derived from endosomes or by directly budding from the plasma membrane. When they are released (e.g., into the periphery of the cell, e.g., the extracellular space), they are called exosomes or ectosomes (or microvesicles), depending on whether they are formed inside or outside the cell membrane. EVs can be taken up by other cells through endocytosis or fusion.

[0195] Extracellular vesicles are classified according to their cellular origin, biological function, or based on their biogenesis (reviewed in Andaloussi et al., 2013). Based on their biogenesis, the three main classes of extracellular vesicles are exosomes, microvesicles, and apoptotic bodies, with the first two being the most prevalent in biological samples (and therefore in the EV samples derived therefrom). EV markers are well known in the art. Examples of exosome markers include tetraspanins (e.g., TSPAN29 and TSPAN30), ESCRT components, PDCD6IP, TSG101, and flotillin. Examples of microvesicle markers include integrins, selectins, and CD40 ligand.

[0196] Despite recent advances, the terms "exosomes" and "microvesicles" are used interchangeably in many published studies. Herein, the term "extracellular vesicles" is used to refer to both vesicle types.

[0197] The inventors have also shown that EVs obtained from cell culture of the cells or cell populations described herein have advantageous therapeutic properties.

[0198] Accordingly, also provided herein are extracellular vesicle (EV) populations obtainable by cell culture of the cells provided herein or the cell populations provided herein.

[0199] In one example, provided herein is a population of extracellular vesicles (EVs) obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103.

[0200] Also provided herein is a population of extracellular vesicles (EVs) obtainable by cell culture of a cell population comprising a plurality of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103.

[0201] In another example, also provided herein is a population of extracellular vesicles (EVs) obtainable by cell culture of a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 (e.g., a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that has reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103, or a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103 that differs from the MSC-like cells deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0202] Also provided is a population of extracellular vesicles (EVs) obtainable by cell culture of a cell population comprising multiple derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103. The cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103) that have reduced FGFR3 expression and / or activity compared to the MSC-like cells deposited under ECACC Accession No. 22072103. For example, the cell population may include derivatives (e.g., derivatives of mesenchymal stem cell (MSC)-like cells deposited under ECACC Accession No. 22072103), where the derivatives differ from the MSC-like cells deposited under ECACC Accession No. 22072103 only by reduced FGFR3 expression and / or activity.

[0203] In one example, an extracellular vesicle (EV) population is provided that is obtainable by cell culture of a cell population comprising a plurality of cells, the plurality of cells being composed of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103 (e.g., the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited under ECACC Accession No. 22072103, and / or the derivative differs from the MSC-like cell deposited under ECACC Accession No. 22072103 only by having reduced FGFR3 expression and / or activity).

[0204] In a further example, there is further provided a population of extracellular vesicles (EVs) obtainable by cell culture of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0205] Also provided is an extracellular vesicle (EV) population obtainable by cell culture of a cell population comprising multiple mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0206] Also provided is an extracellular vesicle (EV) population obtainable by cell culture of a derivative of mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101.

[0207] Also provided is an extracellular vesicle (EV) population obtainable by cell culture of a cell population containing multiple derivatives of mesenchymal stem cell (MSC)-like cells, for example, deposited under ECACC accession number 22072101.

[0208] In another example, there is also provided an extracellular vesicle (EV) population obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells is composed of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101, and (b) at least one derivative of the mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0209] In another example, there is also provided an extracellular vesicle (EV) population obtainable by cell culture of a cell population comprising a plurality of cells, wherein the plurality of cells is composed of (a) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072103, and (b) at least one mesenchymal stem cell (MSC)-like cell deposited under ECACC Accession No. 22072101.

[0210] As used herein, an "extracellular vesicle (EV) population" refers to a plurality of extracellular vesicles (EVs) (i.e., two or more EVs, e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twenty or more, forty or more, sixty or more, eighty or more, one hundred or more EVs).

[0211] The extracellular vesicle (EV) population described herein can be obtained by culturing the cells provided herein or the cell population provided herein in cell culture medium, thereby conditioning the medium, or can be obtained directly. The conditioned medium provided herein (e.g., cell-free conditioned medium) typically contains extracellular vesicles (EVs) secreted by the cells or cell population used to condition the medium. Thus, an EV population can be obtained by isolating a population of extracellular vesicles (i.e., a plurality of extracellular vesicles) from the conditioned medium provided herein (e.g., cell-free conditioned medium provided herein), thereby obtaining an EV population. Thus, the cell culture conditions and parameters provided above in connection with obtaining conditioned medium also apply to obtaining an EV population.

[0212] EV populations may be isolated from cells or cell populations used to condition the medium, or from conditioned medium already separated from such cells (i.e., cell-free conditioned medium provided herein), by one or more suitable methods known in the art, see, for example, the protocol of Thery et al. (Thery, Clotilde, Sebastian Amigorena, Graca Raposo and Aled Clayton. 2006. "Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids." Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino... [et al.] Chapter 3). Further, suitable methods include differential centrifugation, density gradient ultracentrifugation, and size exclusion chromatography. Differential centrifugation and density gradient ultracentrifugation are the most widely applied methods for isolating EVs.

[0213] Differential ultracentrifugation can be used to separate different EV subpopulations based on their density. For example, in some instances, EVs can be isolated by differential centrifugation of conditioned medium, increasing the centrifugation speed to obtain different fractions.

[0214] Methods for obtaining EVs are presented in the Examples section below, although any suitable alternative method may be used. In one example, EVs may be obtained from serum-free cell-conditioned medium, and EVs are isolated according to the following main principles from the protocol of Thery et al. (Thery, Clotilde, Sebastian Amigorena, Graca Raposo, and Aled Clayton. 2006. "Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids." Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino et al., Chapter 3).

[0215] In some cases, EVs can be obtained via the following method: cells are seeded into a T175 flask in FBS-containing medium, where the EVs in the FBS are depleted until 80-90% confluency is reached. The medium is aspirated, the cells are washed with PBS, and serum-free medium is added. The medium is collected and the cells are counted. EVs are isolated according to the protocol by Thery et al. (referenced above) with minor modifications, with all steps performed at 4°C. The conditioned medium is ultracentrifuged to isolate the EV fraction. The EV pellet can then be thoroughly washed and resuspended in particle-free PBS, with all centrifugations performed at 4°C.

[0216] EV-depleted FBS can be easily obtained by those skilled in the art. For example, to obtain EV-depleted FBS, FBS can be centrifuged at 100,000 g for 18 hours and the supernatant collected.

[0217] A detailed protocol for isolating EVs is provided in Example 2 below, although any known, suitable method for isolating EVs, as discussed above, may alternatively be used. In a specific example, the cell-free conditioned medium described elsewhere herein can be centrifuged in a Ty45i rotor-compatible ultracentrifuge tube (or equivalent) at 100,000 g for 90 minutes at 4° Celsius, followed by removal of the supernatant. The pellet can then be resuspended using filtered, cold PBS (e.g., 600 μl per ultracentrifuge tube), after which the resuspended pellets can be pooled and dispensed into 1.5 ml microcentrifuge tubes (or equivalent) in a minimum volume of at least 1 mL per tube. The microcentrifuge tubes (or equivalent) can then be centrifuged at 100,000 g for 90 minutes at 4° Celsius, followed by removal of the supernatant. Each pellet can then be resuspended in 50-100 μl of HQ-PBS to create a 100K fraction.

[0218] The EV population described herein may also be referred to as an EV sample obtained by cell culture of a cell or cell population, for example, from the conditioned medium described herein. The EV sample may be a processed sample enriched in EVs (i.e., having a higher concentration of EVs compared to, for example, the concentration of EVs in the conditioned medium from which it was produced). In this context, "enriched" or "enrichment" refers to a sample or process in which the proportion of EVs is increased relative to other components of the sample. Enrichment may be measured by comparing the number of EVs before and after processing of the sample, and an increase in the relative number of EVs compared to other components of the sample is considered enriched. Enrichment and / or purity may be measured in terms of concentration relative to the conditioned medium (e.g., an untreated sample) from which the EV sample was generated, where the concentration of EVs is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more greater than the concentration of EVs in the conditioned medium (e.g., an untreated sample). Enrichment and / or purity may be measured when the sample is approximately or at least about 2x, 3x, 4x, 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, or greater for EVs compared to the conditioned medium from which the EV sample was generated. 55x, 60x, 65x, 70x, 75x, 80x, 85x, 90x, 95x, 100x, 110x, 120x, 130x, 140x, 150x, 160x, 170x, 180x, 190x, 200x, 210x, 220x, 23 0x, 240x, 250x, 260x, 270x, 280x, 290x, 300x, 325x, 350x, 375x, 400x, 425x, 450x, 475x, 500x, 525x, 550x, 575x, 600x, 625x, Enrichment may be measured in terms of the number of EVs as enriched by 650x, 675x, 700x, 725x, 750x, 775x, 800x, 825x, 850x, 875x, 900x, 925x, 950x, 975x, 1000x, 1100x, 1200x, 1300x, 1400x, 1500x, 1600x, 1700x, 1800x, 1900x, 2000x (x is synonymous with -fold), and all ranges derivable therein.The level of enrichment may be determined using EM and tunable resistive pulse sensing (TRPS).

[0219] An EV sample (in other words, a sample enriched in EVs) does not need to be 100% pure extracellular vesicles. Preferably, the EV sample has a minimal amount of contaminating cellular or extracellular contents (e.g., cellular or extracellular proteins, lipids, carbohydrates, lipoproteins, etc. not associated with EVs). In other words, the EV sample may be primarily composed of EVs. In this context, "minimal amount" may include less than 10% (by concentration) of contaminants, less than 5%, less than 2%, less than 1%, less than 0.5%, less than 0.25%, less than 0.1%, etc. (by concentration). The level of contamination does not need to be 0%. The level of contamination may be determined using EM.

[0220] The EV sample may be an isolated sample containing substantially pure EVs. The isolated sample may be isolated from any conditioned medium containing EVs. The term "substantially pure" or "substantially pure," when referring to an isolated sample containing substantially pure EVs, means that the percentage of EVs in the population is significantly higher than the percentage found in the conditioned medium (e.g., an untreated sample) from which the EV sample was generated. Typically, the percentage of EVs in an isolated sample containing substantially pure EVs is at least about 50%, preferably at least about 60%, 70%, 75%, more preferably at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total sample.

[0221] In some examples, the EV population is a 2K EV fraction, a 10K EV fraction, or a 100K EV fraction. As described in the Examples section below and known to those skilled in the art, a 2K EV fraction refers to the fraction (or portion) of EVs within a secretome or conditioned medium generated when the secretome or conditioned medium is centrifuged at 2,000 g (e.g., for 20 minutes). Similarly, a 10K EV fraction refers to the fraction (or portion) of EVs within a secretome or conditioned medium generated when the secretome or conditioned medium is centrifuged at 10,000 g (e.g., the fraction (or portion) of EVs within a secretome or conditioned medium generated when the secretome or conditioned medium is centrifuged at 10,000 g for 45 minutes, e.g., the fraction (or portion) of EVs within a secretome or conditioned medium generated when the secretome or conditioned medium is centrifuged twice at 10,000 g for 45 minutes). Additionally, a 100K EV fraction refers to the fraction (or portion) of EVs within a secretome or conditioned medium that is generated when the secretome or conditioned medium is centrifuged at 100,000 g (e.g., the fraction (or portion) of EVs within a secretome or conditioned medium that is generated when the secretome or conditioned medium is centrifuged at 100,000 g for 90 minutes, e.g., the fraction (or portion) of EVs within a secretome or conditioned medium that is generated when the secretome or conditioned medium is centrifuged twice at 100,000 g for 90 minutes). "Fraction" is defined elsewhere herein and applies in this context. For example, centrifugation may be performed at 4 degrees Celsius.

[0222] As described in the Examples section below, the 100K EV fraction may also be identified by the presence of one or more EV markers selected from the group consisting of Alix, flotillin-1, CD81, and CD63. The 100K EV fraction may also be characterized by the absence of the endosomal marker BiP. In other words, the 100K EV fraction may be identified by one or more positive markers selected from Alix, flotillin-1, CD81, and CD63, and / or the negative marker BiP. In one example, the 100K EV fraction may be identified by two or more, or three or more positive markers selected from Alix, flotillin-1, CD81, and CD63, and / or the negative marker BiP.

[0223] The present inventors performed a complete proteomic screening of Y201 conditioned medium and Y201 EVs. Table 2 below presents the top 200 identified proteins in Y201 conditioned medium (i.e., the entire secretome, including EVs). Table 3 below presents the top 200 identified proteins in Y201 EVs. Furthermore, the present inventors further performed a complete microRNA screening of Y201 EVs. Table 4 below presents the miRNAs identified in Y201 EVs.

[0224] In some examples, the cell-free conditioned medium or secretome provided herein, or portions thereof (e.g., when obtained by culturing Y201 cells), may comprise at least 10 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or portions thereof, may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or portions thereof, may comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 2.

[0225] In some examples, the cell-free conditioned medium or secretome provided herein, or a portion thereof (e.g., when obtained by culturing Y201 cells), may comprise at least the top 10 distinct proteins selected from Table 2 (where proteins are listed in order of abundance). For example, the cell-free conditioned medium or secretome provided herein, or a portion thereof, may comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 distinct proteins selected from Table 2.

[0226] In some examples, the cell-free conditioned medium or secretome provided herein, or portions thereof (e.g., when obtained by culturing Y201 cells), may comprise 10 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or portions thereof, may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 2. For example, the cell-free conditioned medium or secretome provided herein, or portions thereof, may comprise 10, 20, 30, 40, or 50 different proteins selected from Table 2.

[0227] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise at least 10 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, portion thereof, or EV population provided herein may comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 3.

[0228] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise at least the top 10 distinct proteins selected from Table 3 (where proteins are listed in order of abundance). For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 distinct proteins selected from Table 3.

[0229] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise 10 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different proteins selected from Table 3. For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise 10, 20, 30, 40, or 50 different proteins selected from Table 3.

[0230] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise at least 10 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, portion thereof, or EV population provided herein may contain at least 10, at least 20, at least 30, at least 40, or at least 50 different miRNAs selected from Table 4.

[0231] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise at least the top 10 distinct miRNAs selected from Table 4 (where miRNAs are listed in order of abundance). For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise at least the top 10, at least the top 20, at least the top 30, at least the top 40, or at least the top 50 distinct miRNAs selected from Table 4.

[0232] In some examples, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein (e.g., when obtained by culturing Y201 cells) may comprise 10 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or portion thereof, or EV population provided herein may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different miRNAs selected from Table 4. For example, the cell-free conditioned medium, secretome, or portion thereof provided herein, or the EV population provided herein may comprise 10, 20, 30, 40, or 50 different miRNAs selected from Table 4.

[0233] Methods for detecting the presence of miRNA and / or protein in a sample are well known and include ELISA, mass spectrometry such as liquid chromatography-mass spectrometry (LC-MS), Northern blotting, in situ hybridization, reverse transcription-qPCR, microarrays, and next-generation sequencing.

[0234] In some examples, miRNAs can be detected using the NanoString nCounter Human v3 miRNA Expression Assay Code Set (NanoString, Inc.) (e.g., as shown in the Examples section below). In this particular example, miRNA counts can be normalized using spike-ins from the NanoString procedure, after which miRNAs with counts greater than 20 in one or more samples are selected for analysis. LC-MS / MS can be used to detect EV proteins, and peptide identifications can be filtered through the Percolator algorithm to achieve an overall false discovery rate (FDR) of 1%. Identifications can be imported back into Progenesis QI and mapped against MS1 peak area. For all identified peptides, peak areas can be normalized to total ion intensity. Relative protein quantification can be performed using the relative peak areas of non-competing peptides. Proteins can be accepted for analysis if they are detected with two or more peptides and one or more unique peptides in at least one sample.

[0235] Compositions comprising at least 10 different proteins selected from Table 2 are provided.

[0236] In one example, a composition may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 2. For example, a composition may comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 2. In some examples, a composition may comprise 10 different proteins selected from Table 2. For example, a composition may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 different proteins selected from Table 2. For example, a composition may comprise 10, 20, 30, 40 or 50 different proteins selected from Table 2.

[0237] Further provided is a composition comprising at least 10 different proteins selected from Table 3.

[0238] In one example, a composition may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different proteins selected from Table 3. For example, a composition may comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different proteins selected from Table 3. In some examples, a composition may comprise 10 different proteins selected from Table 3. For example, a composition may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 different proteins selected from Table 3. For example, a composition may comprise 10, 20, 30, 40 or 50 different proteins selected from Table 3.

[0239] Compositions comprising at least 10 different miRNAs selected from Table 4 are also provided.

[0240] In one example, a composition may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or 200 different miRNAs selected from Table 4. For example, a composition may comprise at least 10, at least 20, at least 30, at least 40, or at least 50 different miRNAs selected from Table 4. In some examples, a composition may comprise 10 different miRNAs selected from Table 4. For example, a composition may comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 different miRNAs selected from Table 4. For example, a composition may comprise 10, 20, 30, 40, or 50 different miRNAs selected from Table 4.

[0241] In some cases, the composition is a cell-free composition.In other words, the composition does not essentially contain cells (for example, the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072103, their derivatives, the mesenchymal stem cell (MSC)-like cells deposited under ECACC accession number 22072101 and / or their derivatives)." Cell-free" is defined in more detail elsewhere in this specification.

[0242] The inventors have demonstrated that the cells, cell populations, cell-free conditioned medium, secretome, and / or EV populations described herein have therapeutic utility.

[0243] Accordingly, there is provided a pharmaceutical composition comprising the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes or portions thereof, extracellular vesicle (EV) populations, or compositions described herein, which further comprises a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

[0244] The MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes or portions thereof, extracellular vesicle (EV) populations, or compositions described herein may therefore be provided as part of a pharmaceutical composition.

[0245] Pharmaceutical compositions may routinely contain pharmaceutically acceptable concentrations of salts, buffering agents, preservatives, compatible carriers, supplemental immune enhancing agents such as adjuvants and cytokines, and, if appropriate, other therapeutic agents or compounds.

[0246] As used herein, "pharmaceutically acceptable" refers to a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual together with a selected MSC-like cell, cell population, DNA preparation, cell-free conditioned medium, secretome or portion thereof, extracellular vesicle (EV) population, or composition without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

[0247] Excipients are natural or synthetic substances that are formulated with an active ingredient (e.g., MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes or portions thereof, extracellular vesicle (EV) populations, or compositions provided herein) to bulk the formulation or to provide therapeutic enhancements to the active ingredient in the final dosage form, such as promoting drug absorption or solubility. Excipients can also be useful in the manufacturing process to aid in in vitro stability, such as preventing denaturation over the expected shelf life, as well as to aid in handling concerns for the active ingredient, such as by promoting powder flow or non-stickiness. Pharmaceutically acceptable excipients are well known in the art. Accordingly, suitable excipients can be readily identified by those skilled in the art. By way of example, suitable pharmaceutically acceptable excipients include water, saline, aqueous dextrose, glycerol, ethanol, and the like.

[0248] Adjuvants are pharmacological and / or immunological agents that modify the effect of other agents in the formulation.Pharmaceutically acceptable adjuvants are well known in the art.Therefore, suitable adjuvants can be easily identified by those skilled in the art.

[0249] A diluent is a diluent agent. Pharmaceutically acceptable diluents are well known in the art. Therefore, a suitable diluent can be easily identified by a person skilled in the art.

[0250] Carrier is non-toxic to recipient at the dosage and concentration used, and is compatible with other components of the formulation.The term "carrier" refers to the natural or synthetic organic or inorganic component that is combined with active ingredient to facilitate application.Pharmaceutically acceptable carriers are well known in the art.Therefore, suitable carriers can be easily identified by those skilled in the art.

[0251] The pharmaceutical compositions described herein can be administered to subjects as a single therapy or as part of a combined therapy.For example, the combination of the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretome or its part, extracellular vesicle (EV) populations or compositions provided herein with doxorubicin can be particularly useful, for example, for the treatment of certain types of cancerous tumors.The administration of the combination can be in any order (preferably, the pharmaceutical composition is administered simultaneously with or after doxorubicin, alternatively, the pharmaceutical composition is administered simultaneously with or before doxorubicin).

[0252] The pharmaceutical compositions described herein can be advantageously used as medicaments to promote tissue repair, wound healing and / or tissue regeneration, or to treat or prevent inflammation.

[0253] Pharmaceutical compositions for use as a medicament (e.g., to promote tissue repair or to treat or prevent inflammation) may comprise the MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes, or portions thereof, extracellular vesicle (EV) populations, or compositions described herein, together with pharmaceutically acceptable excipients, adjuvants, diluents, and / or carriers.

[0254] In some examples, the pharmaceutical compositions provided herein may be for use in promoting tissue repair. As will be apparent to one skilled in the art, the methods of promoting tissue repair and / or regeneration described herein result in improved tissue repair in a subject.

[0255] "Tissue repair," as used herein, refers to the anatomical and / or functional restoration of a tissue to its pre-injury (e.g., pre-injury) state. In other words, tissue repair involves restoring the anatomy and / or function of a damaged tissue so that the repaired tissue more closely resembles the anatomy and / or function of the tissue before injury. As used herein, "tissue repair" may refer to the partial or complete restoration of the anatomy and / or function of a damaged tissue (e.g., compared to the anatomy and / or function of the tissue before injury). Undamaged (i.e., healthy) tissue of the same type as the damaged tissue may be used for anatomical and / or functional comparison to determine the state of the damaged tissue. Tissue repair may include the restoration of physical continuity between portions of tissue that have been separated (e.g., by injury). Preferably, the restoration of such physical continuity involves the rearrangement or reconnection of portions of tissue of a type that did not exist before injury (e.g., pre-injury), e.g., without appreciable separation by scar tissue. Therefore, repair may involve filling of tissue defects, for example, by rearranging the tissue portions separated by the defect and / or by growing new tissue of the type that has been damaged or degraded, rather than by the development of scar tissue. Repair may involve the growth or development of new tissue. Thus, tissue repair may involve tissue regeneration, although in some cases, repair may occur without evidence of new tissue growth. Those skilled in the art will be able to easily identify tissue repair using routine methods known in the art. For example, those skilled in the art can visually compare damaged tissue with healthy tissue of the same type at various times after treatment with the pharmaceutical compositions provided herein.

[0256] In some examples, the pharmaceutical compositions provided herein may be for use in promoting tissue regeneration. As will be apparent to one skilled in the art, the methods of promoting tissue regeneration described herein result in improved tissue regeneration in a subject.

[0257] "Tissue regeneration," as used herein, includes any aspect of anatomical and / or functional restoration of a tissue to its state prior to damage (e.g., injury or damage via degenerative or degradative processes), including the generation of new tissue (meaning either cells or portions of cells). As used herein, "tissue regeneration" may refer to partial or complete regeneration of the anatomical structure and / or function of a damaged tissue. The generation of new tissue may include proliferation of existing cells. For example, in the case of chondrocytes, regeneration may include increased cell proliferation, an increase in the rate and extent of chondrocyte differentiation, and an increase in cartilage tissue formation. For example, in the case of osteoblasts, regeneration may include increased cell proliferation, an increase in the rate and extent of osteogenic differentiation, and an increase in bone tissue formation. For example, in the case of adipocytes, regeneration may include increased cell proliferation, an increase in the rate and extent of adipogenic differentiation, and an increase in adipose tissue formation. New tissue may replace previously existing tissue. The generation of new tissue may include division of existing cells. In some cases, regeneration results in the restoration of original tissue structure and function.

[0258] Tissue damage typically impairs the function and / or anatomical structure of tissue.Those skilled in the art can easily identify damaged (e.g., injured) tissue using conventional methods known in the art (e.g., visually, for example, with the aid of a microscope).Tissue damage can be caused by injury (e.g., trauma), disease, disorder or condition, degeneration and / or decomposition process.

[0259] As known to those skilled in the art, a tissue is a group of cells that have a similar structure and function together as a unit. As used herein, "tissue" includes any external or internal body tissue. Examples of tissues include, but are not limited to, brain, skin, liver, pancreas, stomach, kidney, gastrointestinal tract, esophagus, heart, muscle, connective tissue, cartilage, nerve, fat, or bone marrow tissue. Tissues that are particularly relevant in the context of the present invention include cartilage, bone, and adipose tissue.

[0260] Thus, in some examples, the pharmaceutical compositions provided herein are for use in treating or preventing a disease or condition associated with damage to cartilage, bone and / or adipose tissue.

[0261] Thus, in some examples, the pharmaceutical compositions provided herein are for use in treating or preventing a disease or condition associated with cartilage damage.

[0262] Cartilage is a connective tissue found in many parts of the body. It has several functions, including holding bones together and supporting other tissues. Those skilled in the art can easily identify cartilage damage in a subject, and therefore, diseases or conditions associated with cartilage damage, using, for example, MRI or arthroscopy. Diseases or conditions associated with cartilage damage are well known to those skilled in the art. Non-limiting examples of diseases or conditions associated with cartilage damage include arthritis. Arthritis is defined as acute or chronic articular inflammation in a joint. Arthritis can result in a wide variety of symptoms, including pain, stiffness, reduced range of motion, and joint deformation. There are several different types of arthritis. Non-limiting examples of different types of arthritis include juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis, and psoriatic arthritis.

[0263] In some instances, the pharmaceutical compositions provided herein are for use in treating or preventing arthritis.

[0264] Pharmaceutical compositions provided herein that are particularly suitable for treating or preventing arthritis include those that contain the extracellular vesicle populations described herein, particularly extracellular vesicle (EV) populations obtainable by cell culture of Y201 cells or populations thereof.

[0265] In some instances, the pharmaceutical compositions provided herein are for use in treating or preventing inflammatory arthritis.

[0266] Inflammatory arthritis is a comprehensive term used for a group of arthritis conditions that cause pain, stiffness and damage to joints, examples include, but are not limited to, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis and juvenile idiopathic arthritis subtypes.Therefore, in some cases, arthritis (for example, inflammatory arthritis) is selected from the group consisting of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis and juvenile idiopathic arthritis.The key features of inflammatory arthritis include the signs of inflammation, such as redness, swelling and heat around the joints.Clinicians can search for specific markers in blood, such as rheumatoid factor, C-reactive protein or specific antibodies such as anti-CCP, to identify inflammatory arthritis.Those skilled in the art can easily identify inflammatory arthritis.

[0267] In some instances, the arthritis is selected from the group consisting of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, juvenile idiopathic arthritis, osteoarthritis, and spondyloarthritis.

[0268] In some instances, the arthritis is selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, gout, osteoarthritis, spondyloarthritis, ankylosing spondylitis, post-traumatic osteoarthritis, reactive arthritis, and psoriatic arthritis.

[0269] In some cases, the arthritis is selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis, and psoriatic arthritis. In some cases, the arthritis is juvenile idiopathic arthritis or psoriatic arthritis.

[0270] In some examples, the pharmaceutical compositions provided herein may be for use in wound healing.

[0271] A wound occurs when the structure and / or integrity of one or more tissues is compromised, for example, when skin is torn, muscle is torn, bone is fractured, or tissue is burned. Therefore, as will be apparent to those skilled in the art, a wound is an example of tissue injury. Therefore, those skilled in the art will readily understand that wound healing is an example of tissue repair (and may include tissue regeneration). Wounds can be caused by accidents, trauma, or medical procedures, infections, or underlying disease states; for example, wounds can have other causes. Depending on the location, extent, and severity of a wound, it can be classified as closed or open. Wound healing occurs in three distinct phases. The inflammatory phase is characterized by inflammation at the site of injury. This phase is important for healing and involves extensive cell migration. The second phase of wound healing is the proliferative phase, which is characterized by epithelialization, angiogenesis, granulation tissue formation, and collagen deposition. Angiogenesis, involving the formation of new capillaries, is used to deliver nutrients and maintain granulation. Without the formation of new capillaries into the wound, the necessary nutrients cannot reach the wound, resulting in chronic non-healing wounds.The third and final stage of wound healing is the maturation stage, in which fibroblasts differentiate into collagen.The connective tissue matrix and collagen arrangement undergo contraction, resulting in scar tissue.Although scar formation is important for wound healing, excessive scar formation can lead to further cosmetic and / or pathological consequences, such as keloids and / or hypertrophic scars.

[0272] Wound healing can be determined using conventional methods known in the art, for example, wound healing can be conveniently measured by the reduction in wound area over a defined period of time (e.g., over 5 days, over 10 days, over 15 days, or over 20 days). In other words, wound healing can be measured by comparing the wound area at various times after wounding, and a reduction in wound area over time indicates wound healing.

[0273] In some cases, wound can be acute wound or chronic wound.Acute wound is the wound that heals quickly within 30 days (or 60 days for diabetic patients).Non-limiting examples of acute wound that can be treated by the present invention include abrasion, avulsion, contusion, crush wound, cut, laceration, gunshot wound and puncture wound.Chronic wound includes but is not limited to diabetic skin ulcer, bedsore, surgical wound, spinal cord injury wound, burn, chemical-induced wound and vascular injury wound.

[0274] In some examples, the pharmaceutical compositions provided herein may be for use in treating or preventing inflammation.

[0275] The method of treating or preventing inflammation described herein typically results in the reduction of inflammation (for example, the reduction of local inflammation).The reduction of inflammation can be determined using conventional methods known in the art, for example, the reduction of inflammation can be easily measured by the reduction of inflammatory symptoms and / or the reduction of the area of ​​inflammation over a specified period (for example, over 5 days, over 10 days, over 15 days, or over 20 days).For example, the reduction of inflammation can be measured by comparing inflammation at various time points after inflammation occurs.In some examples, the level of inflammation (for example, the reduction of the level of inflammation) can be determined by measuring the inflammatory biomarkers (for example, C-reactive protein, IL-6 and / or TNF-α) known to those skilled in the art in the subject using conventional methods.

[0276] Inflammation typically refers to a defensive response triggered by tissue damage (e.g., tissue injury or destruction). Inflammation typically acts to destroy, dilute, or surround (sequester) both the damaging agent and the damaged tissue, and is particularly associated with the influx of leukocytes and / or neutrophil chemotaxis. As known to those skilled in the art, inflammation is typically characterized by classic signs and symptoms including edema, erythema (redness), heat, pain, and loss of function (rigidity and immobility). In healthy individuals, inflammation follows a typical course, and resolution is controlled by the release of anti-inflammatory mediators and cytokines, such as interleukin-10 (IL-10), produced by cells called "inhibitory" or "regulatory" as part of a negative feedback loop. Indeed, in the normal process of inflammation in the body, an initial pro-inflammatory response is followed by a pro-resolution response that stops the inflammation after the injury has resolved, leading to a decrease in pro-inflammatory cytokines such as TNFα and IL-12, coupled with increased levels of anti-inflammatory cytokines such as IL-10 and TGF-β, resulting in the generation of a so-called tolerogenic environment.

[0277] Inflammation is part of many disease states. For example, inflammation can be caused by infection with pathogenic organisms and / or viruses, or by non-infectious means such as trauma, injury, toxic chemicals, overuse, detection of foreign antibodies and / or autoimmune responses. Therefore, as will be apparent to those skilled in the art, administering the compositions described herein to a subject can be beneficial in several different situations. For example, administering such compositions to a subject can be beneficial in any situation where inflammation control can be beneficial (e.g., in the treatment of persistent infections, where the continued inflammation caused by infection can lead to tissue damage). Non-limiting examples of situations where administering the pharmaceutical compositions provided herein to a subject can be beneficial include allergies, infectious diseases (e.g., persistent / chronic infections), pulmonary diseases, diabetes, neurological diseases, cardiovascular diseases, intestinal diseases, trauma, graft-versus-host disease, periodontal disease, and cancer. Thus, in some examples, the pharmaceutical compositions provided herein may be for use in treating or preventing allergies, infectious diseases (e.g., persistent / chronic infections), pulmonary diseases, diabetes, neurological diseases, cardiovascular diseases, intestinal diseases, trauma, graft-versus-host disease, periodontal disease, and / or cancer. As described elsewhere herein, the pharmaceutical compositions provided herein may be used together (e.g., in combination) with other treatments or treatment regimens. Those skilled in the art can easily identify inflammation using routine methods known in the art, and therefore can easily identify diseases, conditions, and / or disorders that may benefit from treatment with the pharmaceutical compositions provided herein.

[0278] Inflammation can be acute or chronic.Accordingly, the pharmaceutical compositions provided herein can be used to treat or prevent acute and / or chronic inflammation.For example, the pharmaceutical compositions provided herein can be used to treat or prevent acute and / or chronic inflammation caused by wounds (which may promote wound healing and / or prevent tissue damage in the case of chronic inflammation).

[0279] In some examples, the pharmaceutical compositions provided herein may be for use in treating and / or preventing an infection.

[0280] Inflammation is involved in many autoimmune diseases and conditions, including arthritis, mentioned above.

[0281] In some examples, the pharmaceutical compositions provided herein may be used to treat or prevent autoimmune diseases or conditions. As will be apparent to those skilled in the art, administering such compositions to a subject may be beneficial in several different situations. For example, GvHD, multiple sclerosis, psoriasis, eczema, autoimmune disorders of the GI tract (e.g., Crohn's disease), lupus (systemic lupus erythematosus), fibromyalgia, and (inflammatory) arthritis. Thus, in some examples, the pharmaceutical compositions provided herein may be used to treat or prevent GvHD, multiple sclerosis, psoriasis, eczema, autoimmune disorders of the GI tract (e.g., Crohn's disease), lupus (systemic lupus erythematosus), (inflammatory) arthritis, and / or fibromyalgia. In certain examples, the pharmaceutical compositions provided herein may be for use in treating and / or preventing an autoimmune disease or condition, wherein the autoimmune disease or condition is selected from the group consisting of GvHD, psoriasis, systemic lupus erythematosus, and arthritis, and the arthritis may be selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis, and psoriatic arthritis. Notably, EVs have previously been systemically administered to patients with treatment-refractory GvHD, improving their condition (Kordelas, L., Rebmann, V., Ludwig, A. K. et al. MSC-derived exosomes: a novel tool to treat therapy-refractory graft-versus-host disease. Leukemia 28, 970-973 (2014)).

[0282] As used herein, the terms "treat," "treating," and "treatment" are intended to include interventions made with the intent of preventing the onset of or altering the pathology of a condition, disorder, or symptom (e.g., a condition, disorder, or symptom described herein). Thus, "treatment" refers to both therapeutic and prophylactic or preventative measures, the purpose of which is to prevent or delay (alleviate) the targeted condition, disorder, or symptom. For example, treatment can refer to the amelioration of a condition, disorder, or symptom (e.g., arresting the condition, disorder, or symptom, or reducing the sign, degree, or severity of at least one of its clinical symptoms). For example, "treating" or "treatment" may refer to the improvement of at least one physical parameter, which may not be discernible by the subject. In some examples, "treating" or "treatment" refers to modulating a disorder, condition, or symptom, either physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both.

[0283] The terms "preventing," "prevent" or "prevention," as used herein, refer to a reduction in the risk of acquiring or developing a condition, disorder or condition (e.g., a condition, disorder or condition described herein) (e.g., not developing at least one symptom of the condition or disorder in a subject who may be exposed to a disease-causing agent or who may have a predisposition to the disease or condition before the onset of the condition).

[0284] As used herein, the term "subject" refers to an individual, e.g., a human, having or at risk of having a particular condition, disorder, or symptom (e.g., as described herein). The subject may be a patient, i.e., a subject in need of treatment according to the present invention. The subject may be undergoing treatment for the condition, disorder, or symptom. Alternatively, the subject has not undergone treatment prior to treatment according to the present invention. Preferably, the subject is a human subject.

[0285] The pharmaceutical compositions described herein can be administered to a subject by any conventional route, including injection or gradual infusion over time.Administration can be, for example, by injection, or by intramuscular, intravascular, intracavitary, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, or transdermal administration.For example, administration can be intraarticular.

[0286] The pharmaceutical compositions described herein may be in any form suitable for the above-mentioned administration modes. For example, the composition containing cells may be in any form suitable for injection. As a further example, forms suitable for parenteral injection (including subcutaneous, intramuscular, intravascular or infusion) include sterile solutions, suspensions or emulsions, forms suitable for topical administration include ointments or creams, and forms suitable for rectal administration include suppositories. Alternatively, the administration route may be by direct injection into the target area or by regional or local delivery. Identifying the appropriate dosage of the pharmaceutical composition of the present invention is well within the routine capabilities of those skilled in the art.

[0287] Preferably, a pharmaceutical composition comprises or consists of a quantity of active ingredient (e.g., MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes or portions thereof, extracellular vesicle (EV) populations, or compositions described herein) constituting a pharmaceutical dosage unit. A pharmaceutical dosage unit is defined herein as the amount of active ingredient (i.e., the total amount of MSC-like cells, cell populations, DNA preparations, cell-free conditioned medium, secretomes or portions thereof, extracellular vesicle (EV) populations, or compositions described herein, for example, in a vaccine) that is applied to a subject at a given time. It should be understood herein that separate volumes of a pharmaceutical dosage may differ in composition, i.e., may contain active ingredients and / or adjuvants that differ in type or composition.

[0288] The pharmaceutical compositions described herein are intended for administration in an effective amount. An "effective amount" is an amount that, alone or together with further doses, produces the desired (therapeutic or non-therapeutic) response. The effective amount used will depend, for example, on the therapeutic (or non-therapeutic) purpose, the route of administration, and the condition of the patient / subject. For example, the appropriate dosage of the compositions of the present invention for a given patient / subject will be determined by the attending physician (or the person administering the pharmaceutical composition) taking into account various factors known to modify the action of the compositions of the present invention (e.g., the severity and type of hematological malignancy, body weight, sex, diet, time and route of administration, other drug therapy, and other relevant clinical factors). The dosage and schedule may vary according to the specific condition, disorder or symptom, and overall condition of the patient / subject. The effective dosage can be determined by either in vitro or in vivo methods.

[0289] The pharmaceutical compositions of the present invention may advantageously be presented in unit dosage form.

[0290] Provided herein is the use of the extracellular vesicle (EV) populations provided herein for delivery of cargo to cells.

[0291] Preferably, the EVs in the EV population may contain a cargo. The cargo may be any entity, including but not limited to, a chemical compound, a combination of compounds, a synthetic or naturally occurring supramolecular complex, genetic material, a portion thereof, or a derivative thereof, that has useful properties or is capable of exerting a useful activity. The cargo may be hydrophilic or hydrophobic.

[0292] Suitably, the cargo may be an active pharmaceutical ingredient, which may be selected from the group consisting of a small molecule, a peptide, a protein, an inorganic nanoparticle, an oligonucleotide, or any combination thereof. Where appropriate, the terms "active pharmaceutical ingredient" and "drug" are used interchangeably herein.

[0293] Suitably, the cargo may be an imaging agent, which may be selected from an MRI contrast agent (e.g., Gd), a PET / SPECT radioactive contrast agent (e.g., In, Cu), a paramagnetic nanoparticle (e.g., iron oxide), a fluorescent probe, a bioluminescent probe, a quantum dot, a gold nanoparticle, an optical coherence tomography agent (e.g., gold nanorods, fluorescent proteins, fluorescent / radioactive latex beads / polymers, photoacoustic imaging agents (e.g., carbon nanotubes), a Raman spectroscopy agent (e.g., AuNPs), nanobubbles, or any combination thereof.

[0294] Those skilled in the art will understand that any active pharmaceutical ingredient or any imaging agent can be used in the context of the present invention. Non-limiting examples are provided below. For the avoidance of doubt, an EV may contain multiple cargoes, for example, two or more active pharmaceutical ingredients, two or more imaging agents, or a mixture of active pharmaceutical ingredients and imaging agents.

[0295] Cargo (e.g., contrast agent) may be bound to (or adsorbed onto, or tethered to) the outer surface of EVs. This is advantageous, for example, when they are used in diagnostic methods or for targeted delivery using antibodies or aptamers. Alternatively, cargo may be incorporated into EVs. For example, cargo may be encapsulated within the EVs and / or covalently bound to the EVs.

[0296] In some cases, the cargo may be an siRNA, which may be advantageous in the context of gene therapy, particularly in the delivery of gene therapy, which has historically been a major barrier to the success of gene therapy.

[0297] The cargo may be encapsulated by at least one lipid bilayer of the EV so that it is located within the aqueous core. It is expected that a significant proportion of the active pharmaceutical ingredient or imaging agent will be encapsulated within the EV, although a proportion may not be encapsulated therein. Reference to a substance contained "within" an EV is intended to include a substance that may be completely encapsulated within the EV structure (e.g., within the lipid bilayer wall or within a region encapsulated within the lipid bilayer wall). Alternatively, the substance may be covalently bound to one or more components of the EV particle, e.g., the lipid bilayer structure in the case of an EV.

[0298] EV can be prepared to contain desired cargo.The process of incorporating desired cargo into EV is often referred to as " loading ".The cargo incorporated into EV can be completely or partially located in the internal space of EV in the bilayer membrane of EV, or can be associated with the external surface of EV membrane.The incorporation of cargo into EV is also referred to as encapsulation or entrapment, and these three terms are used interchangeably herein with the same meaning.

[0299] The intent of EV encapsulation of cargo is to protect the cargo from an often-destructive environment while providing an opportunity for the encapsulated cargo to exert its activity primarily at sites or environments where such activity is advantageous, and less so at other sites where such activity may be unnecessary or undesirable.

[0300] This phenomenon is called delivery: for example, a drug substance within an EV can be protected from destruction by enzymes in the body and, once released from the EV, provides treatment at the site of disease.

[0301] EVs and their cargo can be delivered to recipient cells via various mechanisms. For a review, see Gurung et al., 2021 The exosome journey: from biogenesis to uptake and intracellular signaling. Cell Commun Signal 19, 47 (2021). In some cases, EVs are taken up by cells, where their contents are released. EVs can interact with the plasma membrane of recipient cells, for example, via integrins and adhesion molecules, and can be internalized and deliver their cargo via, for example, clathrin-mediated endocytosis, phagocytosis, lipid raft-mediated endocytosis, caveolin-mediated endocytosis, and / or pinocytosis.

[0302] In some cases, EVs and their cargo can be delivered to recipient cells via integrin-mediated endocytosis (e.g., RGD-integrin-mediated endocytosis). Testing whether EVs are taken up by integrin-mediated endocytosis is routine for those skilled in the art, and suitable tests are described in the Examples below.

[0303] The recipient cells may be any suitable cells, and as will be apparent to one skilled in the art, the recipient cells may depend on the cargo of the EV population.

[0304] In some examples, the recipient cells may be selected from the group consisting of MSC cells, MSC-like cells, osteosarcoma cells, macrophages, T cells, B cells, NK cells, neutrophils, monocytes, mast cells, and eosinophils.

[0305] In some examples, the recipient cells may be selected from the group consisting of MSC cells, MSC-like cells, and osteosarcoma cells. In some examples, the recipient cells may be MSC cells or MSC-like cells.

[0306] The term "in vitro" generally means outside or external to an animal or human body. The term "ex vivo" typically refers to tissues or cells removed from an animal or human body and maintained or grown outside the body, e.g., in a culture vessel. As used herein, the term "in vitro" should be understood to include "ex vivo." The term "in vivo" generally means inside, on, or within an animal or human body.

[0307] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991), provide those skilled in the art with the general meaning of many of the terms used in this invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice of this invention, preferred methods and materials are described herein. Therefore, the terms defined immediately below are more fully described by reference to the specification as a whole. Also, as used herein, the singular terms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that the invention is not limited to the particular methodology, protocols, and reagents described, which may vary depending on the context for their use by those skilled in the art.

[0308] Aspects of the present invention are demonstrated by the following non-limiting examples. [Example]

[0309] [Example 1]

[0310] As discussed above, to address the challenges associated with the use of MSCs in therapy, we initiated an immortalization and cloning program to deliver a panel of MSC lines representing various bone marrow stromal subtypes containing stem cells of varying potency. From a number of initial clones, eight were selected for detailed characterization based on their robust in vitro growth performance. Advantageously, we identified one line in particular, designated Y201, that exhibited typical MSC characteristics, possessing potent tissue-forming and anti-inflammatory properties in vitro and in vivo.

[0311] We demonstrated that Y201 MSCs are highly reproducible and characterized these cells in detail (e.g., their proliferation, transcriptomics, secretomics, surfeomics, and marker expression). We demonstrated that Y201 MSCs produce abundant and consistent EVs by collecting data on their size, morphometry, EV markers, miRNAs, and proteomics. Advantageously, we demonstrated that Y201 EVs stimulate cell proliferation (donor MSCs and chondrocytes derived from arthritis patients), chondrogenesis, and suppress inflammation. Surprisingly, further manipulation of Y201 MSCs by targeted deletion of the FGFR3 gene using CRISPR / Cas9 increased proliferation, migratory activity, and secretory behavior, enabling growth in serum-free conditions.

[0312] Some of the features of the Y201 cell line and derivatives claimed herein have been previously described in the literature (James et al., 2015; Kay et al., 2022). The cell line itself is now disclosed herein for the first time.

[0313] method Y201 cells and Y201-EVs Y201 cells Y201 MSCs were generated by immortalization using human telomerase reverse transcriptase (hTERT) and characterized as previously described ( James et al., 2015 ; Kay et al., 2022 ).

[0314] Cell culture and preparation of EV-depleted medium Dulbecco's modified Eagle's medium (DMEM) (catalog no. 41966, ThermoFisher Scientific) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) (catalog no. 15140122, ThermoFisher Scientific) was centrifuged at 10,000g for 18 hours at 4°C to deplete serum-derived bovine EVs from the medium. During cell expansion, the medium was diluted to an equal volume with DMEM supplemented with 1% P / S. Y201 cells and a comparative MSC line, MSC#2, were grown at 37°C in a 5% CO2 / 95% air atmosphere. Human articular chondrocytes (AC) were isolated from primary donors after informed ethical consent (LREC 07 / Q1105 / 9). AC were cultured in DMEM-F12 supplemented with 10% FBS and 1% P / S.

[0315] Conditioned medium collection for secretome analysis and functional assays Conditioned medium was collected from two T175 flasks of Y201 and MSC#2 lines. Cells were grown to approximately 80% confluence, then washed twice with PBS. 17 ml of serum-free DMEM was added to the flask and incubated at 37°C and 5% CO2 for 24 hours. The medium was collected and then centrifuged at 300g to remove large cellular debris. For functional assays, the medium was stored at -80°C until needed. For proteomics analysis, the medium was concentrated at 4500g in a 3 kD MWCO tube (GE Healthcare) until the volume was approximately 1 ml. The medium was stored at -80°C until needed.

[0316] Ptychography, cell tracking and image analysis Ptychography was performed using the PhaseFocus VL21 Livecyte imaging platform for live cell tracking analysis. Images were taken at 20-26 minute intervals depending on colony location for 96 hours, starting 4 days after seeding. Cell morphology and migration were quantified using the PhaseFocus analysis platform, and statistical tests were performed in Graphpad Prism. Rose plots were generated using the mTrackJ plugin for ImageJ. The image analysis program CellProfiler was used to generate a pipeline for evaluating the morphological characteristics of MSCs.

[0317] Colony formation assay and image analysis For colony-forming unit-fibroblast (CFU-F) assays, all cell types were seeded at 10 cells / cm2 in 6-well plates using DMEM supplemented with 20% Hyclone FBS containing 100 units / ml penicillin and 100 μg / ml streptomycin. Conditioned medium for use in the CFU-F assay was collected from Y201 and MSC#2 cells by incubating them in serum-free medium at approximately 80% confluence for 24 hours, after which the medium was collected, centrifuged at 300 g to remove cellular debris, and the cells were counted. The conditioned medium was then diluted with additional serum-free DMEM to obtain 12 ml of conditioned medium per million cells. This medium was then supplemented with Hyclone FBS to a final concentration of 20% for use in the CFU-F assay. For CFU-F, primary cells and cell lines were seeded in unconditioned Hyclone medium, with subsequent medium changes every 4 days after seeding. Plates were fixed and stained on day 10 for cell lines and day 14 for primary cells. Plates were either stained for imaging (0.05% crystal violet + 1% formaldehyde + 1% methanol in PBS) or washed once with PBS, and cells were lysed with 350 μL of RA1 cell lysis buffer + 3.5 μL of β-mercaptoethanol per 3 wells. Lysates were stored at -80°C for subsequent qRT-PCR analysis. Well plates were air-dried and then scanned at 1200 dpi using an Epson Perfection 4990 Photo scanner. A CellProfiler pipeline was then developed to accurately detect and measure colonies.

[0318] Bonding point evaluation Cells were plated at low density on glass coverslips and allowed to adhere for 24 hours. Cells were briefly fixed in 4% methanol-free PFA in PBS and then washed three times with PBS. Cells were permeabilized in 0.1% Triton X-100 in PBS for 30 minutes and washed three times with PBS. Subsequently, cells were blocked with 10% goat serum in PBS for 30 minutes. Anti-vinculin antibody (1:400 dilution) was added in 1% BSA and incubated for 1 hour at room temperature. After washing the cells three times with PBS, goat anti-mouse and Alexafluor 488-conjugated secondary antibody (1:2300, ThermoFisher) was added along with Cruzfluor 594-conjugated phalloidin (1 / 1000, Santa Cruz) in PBS for 45 minutes, followed by three additional washes. Nuclei were counterstained with 0.2 μg / ml DAPI for 10 minutes, then briefly rinsed with distilled dH2O and allowed to air-dry. Coverslips were mounted on microscope slides with Prolong gold antifade (ThermoFisher).

[0319] Slides were imaged with a Zeiss LSM880 or LSM780 microscope, and focal adhesion size was quantified using ImageJ.

[0320] Gene set enrichment analysis (GSEA) The Broad Institute GSEA Molecular Signatures Database (V7.0) was used to collate and evaluate lists of significantly upregulated protein or target gene names of enriched miRNAs. The lists were analyzed against the KEGG Pathway database for significant enrichment.

[0321] EV isolation by sequential fractional ultracentrifugation 5×10 5Y201 cells were seeded into a T175 flask containing EV-depleted medium and allowed to reach 80–90% confluence. The medium was aspirated, the cells were washed three times with PBS, and serum-free medium was added. Two media collections were performed every 24 h and stored at -70°C for EV isolation. Cells were counted at the end of the second collection. EVs were isolated according to the protocol of Thery et al. (Thery, Clotilde, Sebastian Amigorena, Graca Raposo, and Aled Clayton. 2006. “Isolation and Characterization of Exosomes from Cell Culture Supernatants and Biological Fluids.” Current Protocols in Cell Biology / Editorial Board, Juan S. Bonifacino...[et al.] Chapter 3) with minor modifications. All steps were performed at 4°C. The conditioned medium was centrifuged at 300g for 5 minutes to remove dead cells and debris, followed by a second centrifugation at 2000g for 20 minutes. The supernatant was transferred to a Ty45i thick-walled ultracentrifuge tube (Cat. No. 355655, Beckman-Coulter) and centrifuged at 10,000g for 45 minutes in an L100-XP Beckman-Coulter ultracentrifuge. The 10K fraction was collected by thorough resuspension with PBS and transferred to a thick-walled micro-ultracentrifuge tube (Cat. No. 357448, Beckman-Coulter). The supernatant was centrifuged again at 100,000g for 90 minutes, and the 100K fraction was collected in a thick-walled micro-ultracentrifuge tube. The 10K and 100K fractions were centrifuged at 10,000g and 100,000g for 45 and 90 minutes, respectively, in a Beckman-Coulter TL100 ultracentrifuge. The EV pellet was resuspended in PBS, and the EV suspension was transferred to a Protein LoBind tube.

[0322] Concentration and size range of EVs using nanoparticle tracking analysis (NTA) EV concentration and size were determined using NTA3.4 software, and videos were acquired using a Nanosight LM14 equipped with a green laser (532 nm). The 10K and 100K Y201 EV fractions were diluted with PBS to a concentration of 20–120 particles per frame. Using a script, five 60-second video recordings of all events were acquired for further analysis. The experimental conditions were as follows: i) measurement time: 60 seconds x 5, ii) blurring: automatic, iii) detection threshold: 4–5, iv) blur size: automatic, iv) number of frames: 1499.

[0323] Transmission electron microscopy (TEM) Ten μl of the EV suspension was layered onto a 200-mesh copper grid with a Formvar / carbon support membrane and allowed to air-dry for 3 minutes. The grid was washed with three drops of dH2O to remove salt from the PBS. Negative staining was achieved by adding 10 μl of 1% uranyl acetate.

[0324] Western blotting Cell lysates and EVs were separated on a 12% SDS-PAGE gel, and the separated proteins were transferred to a nitrocellulose membrane using the iBlot2 dry blotting system (20 V for 1 min, 23 V for 4 min, and 25 V for 2 min). The membrane was blocked with 5% bovine serum albumin (BSA) in PBST for 1 hour and then incubated with the following mouse monoclonal antibodies: i) flotillin-1 (1:500; SantaCruz: 133153), ii) CD63 (1:1000; SantaCruz: 365604), iii) CD81 (1:1000; SantaCruz: 23962), iv) Alix (SantaCruz: 166952), v) GRP78 BiP (Abcam: 21685), and vi) MFG-E8 (1:200; ProteinTech: 67797-1-Ig) for 1 hour at room temperature or overnight at 4°C. After incubation, the membrane was incubated with anti-mouse horseradish peroxidase-conjugated secondary antibody at a dilution of 1:1500. Protein bands were visualized using the iBright Western Blot Imaging System and ECL PicoPlus Chemiluminescent Substrate (Cat. No. 34577, ThermoFisher Scientific).

[0325] Proteome analysis of Y201 whole secretome and Y201 EVs The enriched whole-secretome sample was added to 8 M urea containing 20 mM HEPES, 1 mM sodium orthovanadate, 1 mM β-glycerophosphate, and 2.5 mM sodium pyrophosphate. Proteins were reduced and alkylated in solution, followed by digestion with a combination of Lys-C and trypsin proteases. The resulting peptides were analyzed over a 1-hour LC-MS acquisition using an Orbitrap Fusion. Peptides were eluted from a 50 cm C18 EN PepMap column into the mass spectrometer. Three biological replicates were performed for each cell line. Tandem mass spectra were searched against the human subset of the UniProt database using Mascot, and peptide identifications were filtered using the Percolator algorithm to achieve an overall false discovery rate (FDR) of 1%. Identifications were imported into Progenesis QI and mapped against MS1 peak areas. Peak areas were normalized to the total ion intensity for all identified peptides. Relative protein quantification was performed using the relative peak areas of non-competing peptides. Relative fold differences and associated p-values ​​for abundance differences were calculated in Progenesis QI.

[0326] EVs isolated from eight T175 cells were added to 8 M urea containing 20 mM HEPES and a phosphatase inhibitor cocktail containing 1 mM sodium orthovanadate, 1 mM β-glycerophosphate, and 2.5 mM sodium pyrophosphate. Proteins were reduced and alkylated in solution, followed by digestion with a combination of Lys-C and trypsin proteases. The resulting peptides were analyzed over a 1-hour LC-MS acquisition using an Orbitrap Fusion (Thermofisher). Peptides were eluted from a 50 cm C18 EN PepMap column into the mass spectrometer. Three biological replicates were performed for each cell line. Tandem mass spectra were searched against the human subset of the UniProt database using Mascot, and peptide identifications were filtered using the Percolator algorithm to achieve an overall false discovery rate (FDR) of 1%. Identifications were imported into Progenesis QI and mapped against MS1 peak areas. Peak areas were normalized to the total ion intensity for all identified peptides. Relative protein quantification was performed using the relative peak areas of non-competing peptides. Proteins were accepted for analysis if they were detected in two or more peptides in at least one sample and one or more unique peptides. Relative fold differences and associated p-values ​​for abundance differences between pairwise comparisons of cell lines were calculated by ANOVA in Progenesis QI.

[0327] Analysis of EV microRNAs EVs from Y201 cells were thawed and allowed to reach room temperature. RNA was extracted using the Total Exosome RNA and Protein Isolation Kit (Invitrogen) according to the manufacturer's instructions. Briefly, samples were thawed and diluted with 1x PBS in RNase-free tubes to a total volume of 200 μL. 200 μL of preheated denaturing solution was then added and mixed, after which the samples were incubated on ice for 5 minutes. 400 μL of acid-phenol:chloroform was then added to each sample, which was vortexed for 60 seconds and centrifuged at 13,000 g for 5 minutes at room temperature. The aqueous (upper) phase was then transferred to a new RNase-free tube, and the recovered volume was recorded and used for subsequent purification. The aqueous phase was diluted with 1.25 volumes of 100% ethanol and mixed. The aqueous phase / ethanol mixture was loaded onto a filter cartridge in a new tube and centrifuged at 10,000 g for 15 seconds. The flow-through was discarded, followed by washing the cartridge with 700 μL of miRNA Wash Solution 1 by centrifugation at 10,000 g for 15 seconds. The flow-through was discarded, followed by two washes with 500 μL of miRNA Wash Solution 2 / 3 using the same settings. The cartridge was then centrifuged at 10,000 g and allowed to dry for 1 minute. The cartridge was then removed and placed in a new collection tube, and the RNA was eluted using 50 μL of preheated elution solution and centrifuged at 10,000 g for 30 seconds. The eluate was then passed through the cartridge twice to improve yield. After RNA purification, the sample was concentrated using an Amicon Ultra 0.5 ml centrifugal filter (Sigma-Aldrich) by first adding RNase-free water to 400 μL. The sample was centrifuged at 14,000 g for 88 minutes, then inverted, and the RNA was collected in a new tube at 8,000 g for 2 minutes. Total RNA was then quantified on a Bioanalyzer 2100 (Applied biosystems) using a Pico chip. 5-3 μL of RNA was used for the NanoString miRNA ligation reaction.NanoString was performed using the nCounter Human v3 miRNA Expression Assay Code Set (NanoString, Inc.) according to the manufacturer's miRNA sample preparation protocol. miRNA counts were normalized using spike-ins from the NanoString procedure, and miRNAs with counts greater than 20 in one or more samples were subsequently selected for analysis. EV miRNA comparisons were performed in the R programming language.

[0328] CyQuant proliferation assay Cells were plated in a 96-well plate at 9,000 cells / cm. 2 MSC#2 cells were seeded at a density of 1x and allowed to adhere overnight. The following morning, MSC#2 cells were treated with 1x, 5x, and 10x concentrations of Y201 EVs. Treatments were calculated using the following formula: (Ni / Nt) / vX, where Ni is the number of donor cells, Nt is the number of recipient cells, v is the volume of the EV suspension, and X is the number of desired treatments. Cells were subjected to EV treatments daily, and the microplates were frozen. To evaluate the proliferative effects of EVs, a CyQuant Proliferation Assay Kit (Cat. No. C7026, Invitrogen) was used. A working CyQuant solution was prepared by diluting the cell lysis buffer stock solution 20-fold using dH2O, and a 400-fold diluted CyQuant GR stock solution was added over 5-10 minutes. Quantitation of cellular DNA per well was achieved by shaking the microplate at 300 rpm for 2 minutes and measuring fluorescence at 480 / 502 nm (excitation / emission) using a CLARIOstar plate reader.

[0329] Proliferation assay using LiveCyte microscopy Cells were plated in 24-well plates at 4,500 cells / cm. 2 MSC#2 cells were seeded at a density of 10x and allowed to adhere overnight. MSC#2 cells were treated with 10x concentrated Y201 EV. The microplate was placed on a LiveCyte microscope and cell proliferation was monitored for 72 hours using quantitative ptychography phase imaging techniques and analyzed using phasefocus software v3.5.

[0330] Articular chondrocytes (AC) isolated from OA donors were seeded at 3,000 cells / cm in 24-well plates and allowed to adhere overnight. Cells were treated with 10x and 20x concentrations of Y201 100K EV, and cell proliferation was monitored for 72 hours by LiveCyte microscopy as described above.

[0331] Inhibition of integrin-mediated transfer of EV cargo into recipient cells AC cells were seeded at 3,000 cells / cm2 in 24-well plates and allowed to adhere overnight at 37°C, 5% CO2. For inhibition studies, cells were treated with 200 μM Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP-SEQ ID NO: 16) or Gly-Arg-Ala-Asp-Ser-Pro (GRADSP-SEQ ID NO: 17) peptides (Sigma-Aldrich, SCP0157, SCP0156) for 6 hours. Cells were washed twice with PBS and Y201 100K EVs were added at 20x treatment. Proliferation rates were monitored for 72 hours using a LiveCyte microscope.

[0332] Scratch assay MSC#2 cells at 30,000 cells / cm 2 Cells were seeded into 24-well plates at a density of 100 μg / ml and allowed to adhere for 6–8 hours. Cells were washed with PBS and serum-starved overnight. To mimic a wound, a scratch was created on a confluent monolayer of cells using a 10 μl pipette tip and washed with PBS to remove dead cells and debris. MSC#2 cells were treated with 10x Y201 100K EV, and wound closure was monitored over 24 hours using quantitative ptychography phase imaging techniques with a LiveCyte microscope. Images were analyzed using Phasefocus software v3.5. Single-cell analysis was performed using the MTrackJ plugin for ImageJ, and measurements were imported into the chemotaxis tool to calculate cell speed, total track length, Euclidean distance, linearity, and forward migration index.

[0333] cartilage formation Primary MSCs were isolated from femoral head donations from three osteoarthritis patients after obtaining ethical approval (LREC 07 / Q1105 / 9). 2.35 × 10 cells per test were cultured prior to the formation of micromass pellets for the test conditions. 5 2.35 x 10 MSCs 6 After 6 hours of exposure to EVs derived from Y201 MSCs, micromass pellets were prepared by centrifugation at 300 g for 5 minutes followed by overnight incubation at 37°C, with 2.35 x 10 cells per pellet in 100 μl growth medium in a microcentrifuge tube. 5 The cells were formed at a density of 1000.

[0334] The pellet was detached, and growth medium was added to a volume of 1.2 ml, taking care not to disrupt the pellet. Negative controls received basal medium containing DMEM containing sodium pyruvate and L-glutamine, supplemented with 1% ITS+3, 40 μg / ml L-proline, and 1% non-essential amino acids. Chondrogenic medium included basal medium supplemented with 0.1 μM dexamethasone, 50 μg / ml L-ascorbic acid, and 10 ng / ml TGF-β1.

[0335] The tubes were incubated at 37°C and the medium was changed every 3-4 days. 6 The cells were treated weekly with EVs derived from Y201 MSCs. On days 0, 7, 14, and 21, the pellets were removed, rinsed twice with 1 ml of PBS, and then fixed with cold paraformaldehyde for 10 minutes. The pellets were again washed twice with PBS and embedded in paraffin wax within 48 hours of fixation using a Leica tissue processor with the minibiopsy program. The pellets were then sectioned at 5 μm thickness. The paraffin-embedded sections were cleared and rehydrated, then stained with 0.02% fast green for 5 minutes and 0.1% safranin O for 15 minutes. After staining, the sections were dehydrated, mounted using DPX mounting medium, and imaged at 20x resolution using Z-stack imaging on an Axio Scan.Z1 slide scanner.

[0336] T cell activation assay MSC-derived EV immunomodulation for inactivation and suppression of T cell proliferation 1.0×10 5 A suspension culture of primary human peripheral blood-derived CD4+ T cells (Stem Cell Technologies) was cultured for 24 hours and then incubated for 2.0 × 10 6 As a positive control, 1.0 × 10 cells were pretreated with EVs isolated from serum-free conditioned medium from 1.0 × 10 Y201 MSCs for 6 hours. 4 Y201 MSCs were seeded into 96-well U-bottom plates and cultured at 37°C, 5% CO2 for 24 hours before the addition of T cells.

[0337] Serial proliferation was assessed as a measure of T cell proliferation. CD4+ T cells were stained with 1 μM VPD450 Violet Proliferation Dye (eBioscience) for 10 min at 37°C. T cells were activated with anti-CD3ε / CD28 Dynabeads (Thermo Fisher) at a 1:1 bead-to-cell ratio, followed by 1.0 × 10 cells in 200 μl of RPMI-1640 containing 10% FBS and 0.05 μg / mL IL-2 (Peprotech). 5 T cells were seeded at a density of 1.0 × 10 cells / well (10:1 ratio). T cells seeded alone (no treatment) or 1.0 × 10 cells / well (10:1 ratio). 4 T cells seeded on Y201 MSCs served as negative and positive controls, respectively, and all conditions were tested with or without activation. Plates were cultured at 37°C for 6 days, after which Dynabeads were removed using DynaMag-2 according to the manufacturer's recommendations. T cell proliferation was assessed by flow cytometry and visualized for peaks of signal intensity decline using the FCS Express 7.0 proliferation assay. Proliferation was assessed by VPD450 dilution (decrease in staining intensity), which was expressed as a proliferation index (PI) calculated from the fluorescence intensity at each cell division, as previously described (Kay et al., 2022). The number of proliferation cycles performed was calculated based on the 50% peak fluorescence intensity decline, measured from the fluorescence intensity at the first and last divisions detected.

[0338] MSC immunomodulation to direct effector T cell polarization To assess T helper differentiation, T cells were activated and cultured with MSC-derived EVs or MSC monolayers as described above. The following reagents and antibodies for reactivation, transport inhibition, and staining were supplied by eBioscience. After 6 days of culture, T cells were restimulated using a combination of phorbol 12-myristate 13-acetate (PMA) (50 ng / ml) (Sigma-Aldrich) and ionomycin (1 μg / ml) (Invitrogen), and intracellular cytokines were maintained using a transport inhibitor cocktail containing 10 μg / ml brefeldin A and 2 μM monensin (Invitrogen). T cells were cultured at 37°C for 4 hours and then stained for the surface marker CD4. Intracellular staining of CD4+ helper T cells was performed with anti-human IFN-γ (Th1), IL-4 (Th2), or IL17a (Th17) or CD4 and CD25, followed by fixation / permeabilization and staining for the nuclear protein FOXP3 for regulatory T cells. All cells were measured using a Cytoflex LX flow cytometer and analyzed by FCS Express 7. Comparisons were made for the percentage of T helper differentiation and median signal intensity within the CD4+ cell population for each antibody tested.

[0339] In vivo evaluation of the immunomodulatory capacity of Y201 MSCs in a mouse peritonitis model An in vivo peritonitis model was used in 8-10 week-old C57BL / 6J mice with zymosan and schistosome egg irritants for the induction of inflammation. These experiments were performed under UK Home Office permission (Project License No. PPL PFB579996, approved by the University of York Animal Welfare and Ethics Review Board) and in accordance with the Animals and Scientific Procedures Act 1986. On day 0, mice were administered 1 mg of zymosan A (Merck) or 5,000 schistosome eggs in 200 μl of PBS via intraperitoneal injection. Immediately after irritant administration, mice in the test condition were treated with 4.0 × 10 schistosome eggs in 100 μl of PBS to treat zymosan-induced inflammation. 7 2.0 x 10 Y201 MSCs, or 2.0 x 10 MSCs in 100 µl PBS to treat schistosome egg-induced inflammation 7 EVs isolated from serum-free conditioned medium collected over 24 h from either Y201 mice were administered by intraperitoneal injection; negative control mice received PBS vehicle only.

[0340] After 24 hours, mice were euthanized using CO2 overdose and cervical dislocation. An intraperitoneal injection of 4 ml of ice-cold RPMI-1640 was performed as a peritoneal lavage. This process was repeated with a second 4 ml of RPMI-1640 lavage, and the lavage fluids were pooled to form peritoneal exudate cells (PECs). For each animal tested, red blood cells were lysed from PECs using erythrocyte lysis buffer (Merck) and cell counts were performed. PEC samples were first stained for Ly6C (APC), Ly6G (FITC), F4 / 80 (PE-Cy7), CD45 (PerCP-Cy5.5) (BioLegend), and Ly6G (FITC), CD11b (BUV395), and SiglecF (BV421) (BD). PEC samples were then stained for TCRb (AF488), CD3 (APC-Cy7), CD4 (PerCP-Cy5.5), CD62L (APC), and CD44 (PE) (BioLegend). For all studies, dead cells were excluded using Zombie Aqua (BioLegend).

[0341] statistical analysis Statistical analysis for all experiments was performed using GraphPad Prism v9.0.2. Statistical significance between our treatments and the control (DMEM) was assessed by T-test and two-way ANOVA with Bonferroni correction. n=3, error bars are SEM, and asterisks represent the following P values: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0342] Fibroblast growth factor receptor 3 (FGFR3) knockout cells Generation of FGFR3 cell lines using CRISPR / Cas9 Single guide RNA (sgRNA) structures were designed using the CRISPR design tool (crispr.mit.edu). Potential sequences were ranked by the program based on specificity and off-target effects, and the sequence with the fewest off-target effects was selected. The selected sgRNA sequence was as follows: (5'-3') sgRNA Fwd:CACCGCATCCGGCAGACGTACACGC (SEQ ID NO: 1) sgRNA Rev:AAACGCGTGTACGTCTGCCGGATGC (SEQ ID NO: 2)

[0343] Single-stranded oligonucleotides (ssODNs) were designed to introduce specific base mutations into the FGFR3 sequence via homologous recombination. The ssODNs were designed so that the double-strand break introduced by Cas9 was within 100 base pairs of the mutation, and antisense sequences of the desired sequence were used to avoid the Cas9 enzyme targeting the ssODN. The ssODN sequences were as follows: (5'-3'): ssODN: CAGCACCGCCGTCTGGTTGGCCGGCAGCCCCGCCTGCAGGATGGGCCGGTGCGGGGAGCACTCCAGCACGTCCAGCGTGTACGTCTGCCGGATGCTGCCAAACTTGTTCTCCACGACGCA (SEQ ID NO: 3)

[0344] All primers were ordered from Integrated DNA Technologies and purified via desalting.

[0345] Y201 hTERT MSCs were electroporated using previously optimized parameters, and individual colonies were isolated using serial dilutions as described elsewhere herein. For comparison with CRISPR / Cas9-treated cells, Y201 hTERT MSCs were used as a WT control throughout the results and are referred to herein as WT hTERT MSCs.

[0346] CRISPR / Cas9 on-target and off-target sequencing PCR amplification was performed as described elsewhere herein, and the products were subjected to Sanger sequencing using a unique forward primer at a concentration of 3.2 μM. The primers used for amplification and sequencing are shown in Table 1.

[0347] [Table 1] Table 1: Primers used in on-target and off-target sequencing

[0348] Calculation of population doubling time Population doubling time was determined by seeding equal numbers of WT and FGFR3-KO MSCs into T25 flasks and counting the cells daily for 4 days. Cells were counted using a Countess II Automated Cell Counter (Invitrogen) using trypan blue cell exclusion dye to subtract dead cells. Doubling time was calculated using the formula: t*log(Nf / Ni), where t is the time in days between counts, Nf is the final number of cells counted, and Ni is the initial number of cells.

[0349] For cumulative population doublings, cells were counted throughout 50 days of continuous culture, and the number of population doublings between each count was calculated using the formula: log(Nf / Ni), where Nf is the final number of cells counted and Ni is the initial number of cells seeded. For both WT and FGFR3-KO MSCs, 500,000 cells were replated after each count.

[0350] Morphological analysis Cell seeding and treatment WT and FGFR3-KO cells were plated in 24-well plates at 1 cm 2 Cells were seeded at 4000 cells per well and allowed to adhere overnight, then washed with PBS and stained with crystal violet.

[0351] Phalloidin staining of actin cytoskeleton WT and FGFR3-KO cells were plated 1 cm on 10 mm circular glass coverslips in 24-well plates. 2Cells were seeded at 4,000 cells per well and allowed to adhere overnight. Coverslips were washed with PBS and fixed with 4% paraformaldehyde for 20 minutes at 37°C and 5% CO2. Cells were washed again with PBS and treated with Alexa Fluor 594 phalloidin (Invitrogen) diluted 1:1,000 in PBS for 1 hour at room temperature in the dark. Cells were washed three times with PBS, counterstained with DAPI for 5 minutes, and then washed three more times with PBS. Coverslips were mounted on slides using Vectashield Mounting Medium (Vector Laboratories), sealed with nail polish, and imaged the following day using a Zeiss 710 LSM confocal microscope.

[0352] Anti-Arp3 immunofluorescence Cells were seeded and fixed as described elsewhere herein, followed by permeabilization with 0.1% Triton X-100 for 30 minutes and then washed three times with PBS. Cells were blocked with 1% bovine serum albumin for 1 hour, after which anti-Arp3 (Sigma) was applied at a 1:200 dilution in 1% BSA for 2 hours at room temperature. Cells were washed in PBS. Goat anti-mouse Alexa Fluor 647-conjugated secondary antibody (Thermofisher) was applied at 1:200 with Alexa Fluor 594 phalloidin at 1:1000 in PBS for 1 hour at room temperature in the dark. Cells were washed in PBS, counterstained with DAPI, mounted, and imaged as described elsewhere herein.

[0353] Characterization of extracellular vesicles (EVs) Conditioned medium collection and EV isolation FBS-EV-depleted medium was made by centrifuging DMEM containing 20% ​​FBS and 1% P / S at 100,000 g for 18 hours at 4° C. using a Ty45i rotor in a Beckman Coulter Optima L-100XP Ultracentrifuge. This FBS-EV-depleted medium was then diluted with serum-free medium containing 1% P / S to a final concentration of 10% FBS.

[0354] WT and FGFR3-KO cells were seeded at 500,000 and 400,000 cells per T175 flask, respectively, in FBS-EV-depleted medium and cultured until approximately 90% confluent. Cells were washed three times with PBS, and the FBS-EV-depleted medium was replaced with serum-free medium. After 24 hours, the medium was collected, and fresh serum-free medium was added and collected again after another 24 hours. This conditioned medium (CM) was stored at -70°C.

[0355] The CM was centrifuged at 300g for 5 minutes to remove cells and debris. The supernatant was used for either CM processing or EV isolation. For EV isolation, the medium was centrifuged at 2000g for 20 minutes, the supernatant transferred to a Ty45i tube, and the pellet resuspended in PBS. The resuspended pellet was transferred to a low-protein binding tube and centrifuged again at 2000g for 20 minutes. The supernatant was discarded, and the pellet represents the isolated 2k fraction. The supernatant from the first 2000g spin was centrifuged at 10,000g for 45 minutes, and the new supernatant was transferred to a new Ty45i tube. The pellet was resuspended, transferred to a microcentrifuge tube, and centrifuged at 10,000g for 45 minutes in a TLA 100.3 rotor to isolate the 10k fraction. The supernatant from the first 10,000g spin was centrifuged at 100,000g for 90 minutes and saved (for use as EV-negative medium). The pellet was resuspended, transferred to a microcentrifuge tube, and centrifuged again at 100,000g for 90 minutes to isolate the 100k fraction. All pellets were thoroughly resuspended in particle-free PBS, and all centrifugations were performed at 4°C.

[0356] Nanoparticle tracking analysis Nanoparticle tracking analysis (NTA) was performed using Nanosight NTA Software 3.4 Build 3.4.003 (Malvern Panalytical). Images were acquired using an sCMOS camera and a 532 nm laser wavelength.

[0357] Transmission electron microscopy EV isolation was performed as described elsewhere herein, except that instead of resuspending the final pellet in PBS, the pellet was resuspended in 2% PFA and kept overnight at 4°C. EVs were then placed on glow-discharged formvar / carbon-coated grids for 20 minutes and then fixed with 1% glutaraldehyde for 5 minutes. The grids were washed eight times with PBS and then incubated with 2% uranyl acetate for 5 minutes in the dark. After centrifugation of the methylcellulose at 100,000 g for 95 minutes, the grids were incubated in methylcellulose-uranyl acetate on ice for 10 minutes. Excess liquid was removed with filter paper, and the samples were allowed to dry before imaging.

[0358] Migration assay Scratch assay WT and FGFR3-KO MSCs were plated in 48-well plates at 1 cm 2 Cells were seeded at 42,500 cells per well and allowed to adhere overnight. After inspecting for cell confluency and uniform distribution, the wells were washed with PBS and the medium was replaced. Scratches were created using a 200 μl pipette tip, ensuring uniform and consistent pressure was applied across the entire well, followed by another wash with PBS and replacement with fresh medium. Cells were imaged at 0 and 24 hours after scratch creation, and labels were placed on the plate to ensure the same field of view was captured. The resulting images were overlaid, and the initial wound size was labeled on all images for each field. The initial and final wound areas were then quantified using ImageJ, and the healing rate was calculated.

[0359] Ptychographic analysis Cells were seeded into Ibidi Culture-Insert Plates according to the manufacturer's instructions and allowed to adhere overnight before removing the inserts to create space in the center of each well for cell migration. Plates were imaged using a Livecyte microscope (Phasefocus) at 37°C and 5% CO2 for 24 hours. Images were acquired every 5 minutes and analyzed using Cell Analysis Toolbox (CAT) software (Phasefocus). The software segmented cells using an advanced fuzzy thresholding algorithm to track individual cell counts.

[0360] Secretome-treated scratch Cells were seeded and scratches were created as described elsewhere herein. Treatments were applied immediately after scratch creation. Control wells were treated with DMEM supplemented with 1% P / S and, where indicated, 10% FBS. CM, EV, and EV-negative media were collected as described elsewhere herein. The 1x treatment dose of EV was calculated using the following formula:

[0361]

number

[0362] RNA-seq analysis RNA isolation, cDNA library preparation and sequencing Total RNA for transcriptome analysis was isolated from Y201 and FGFR3 KO MSCs by centrifugation at 400 g for 5 minutes and then resuspended in 350 μL of RA1 lysis buffer (Nucleospin RNA II kit) and 3.5 μL of β-mercaptoethanol. After lysis, RNA was extracted using Nucleospin RNA II columns (Macherey-Nagel, Germany) according to the manufacturer's instructions. Briefly, the lysate was first clarified by passing it through the column, and then mixed with 350 μL of 70% ethanol to adjust conditions for optimal RNA binding. The RNA was then bound to the column, and the column was desalted using membrane desalting buffer. The column was then treated with DNase I for 15 minutes, washed, and dried to remove the presence of buffer. RNA was then eluted in 30 μL of RNase-free HO and quantified spectrophotometrically using a Nanodrop™. The quality of the RNA was assessed using an Agilent 2100 Bioanalyzer. Oligo-dT beads, which bind to the poly(A) tail specifically found on mRNA, were then used to capture the mRNA, thereby removing other contaminating RNA species in the sample, such as ribosomal RNA. The mRNA was then fragmented, and these fragments were used as templates for cDNA synthesis, followed by adapter ligation. The library was then amplified and sequenced using a HiSeq 2500 sequencer.

[0363] Read Mapping Reads were mapped using the STAR splice-aware read mapper (https: / / github.com / alexdobin / STAR) with the following options: "--outSAMstrandField intronMotif", "--outFilterType BySJout", "--outFilterIntronMotifs RemoveNoncanonical", and "--outSAMtype BAM SortedByCoordinate". Reads were mapped against a pre-computed indexed GRCh38 Gencode 24 version of the human genome provided by the STAR authors.

[0364] Quantitative and differential expression analysis Mapped reads were quantified and differential expression analysis was performed using Cufflinks (http: / / cole-trapnell-lab.github.io / cufflinks / ). Relevant GTF annotation files from Gencode version 24 were provided with the "-g" option, and cDNA fasta sequences were provided with the "-b" option. GTF files obtained from Cufflinks were merged with Cuffmerge and used with Cuffdiff for differential expression analysis.

[0365] RNA-seq analysis RNA-seq data yielded a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as those with a log2 fold change greater than ±1 and an adjusted p-value less than 0.05. Transcripts were then separated into two gene lists corresponding to up- or down-regulation in FGFR3-KO versus WT, and those with fewer than 5 FPKM reads in both cell lines were excluded. GO term analysis was performed using STRING (Szklarczyk et al., 2019), and KEGG pathway analysis was performed using Enrichr (Chen et al., 2013) and KEGG Mapper (Kanehisa and Sato, 2020). Data were exported and graphed using ggplot2 (Wickham, 2016) in RStudio (RStudio Team, 2020).

[0366] Alamar Blue cell viability assay WT and FGFR3-KO cells were seeded into 96-well plates, one plate per time point, and allowed to adhere overnight. Alamar Blue cell viability reagent (Invitrogen) was then added to the plates on day 0 at a final concentration of 10% in fresh medium. Fluorescence was measured 4 hours later using a Clariostar plate reader. For all experiments, treatments were applied on day 0, and Alamar Blue readings were taken at the same time each day for three additional days. For the initial comparison of WT and FGFR3-KO, cells were plated at 1 cm 2 Plate at 9,375 cells per 1 cm for all subsequent experiments. 2 Cells were plated at 7812 cells per well to ensure that they did not reach full confluence before the end of the time course. Day 2 Alamar Blue plates were used for morphological analysis of CM- and U0126-treated MSCs by taking a fluorescence reading followed by washing the plates with PBS and staining with crystal violet. All results were normalized to the fluorescence of the control treatment on day 0 and reported as relative fluorescence.

[0367] More ways Enrichment and clustering of proteome gene ontology terms of Y201 EVs Gene Ontology (GO) enrichment was performed using the ClueGO plugin for the Cytoscape software package (Bindea et al. 2009; Shannon et al. 2003). Gene lists were assessed for enrichment against biological process and molecular function GO gene sets using Benjamini-Hochberg false discovery rate (FDR)-corrected p-values. GO term redundancy was reduced by using the GO fusion setting in ClueGO followed by automated clustering of significant GO terms (FDR-corrected p<0.05). Cluster diagrams were generated from ClueGO results using the AutoAnnotate plugin, which facilitates organization and labeling of similar terms and generates cluster titles based on common words (Kucera et al. 2016). Clusters were moved to aid visualization.

[0368] CFSE-EV label EVs were isolated by differential ultracentrifugation and labeled using carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen, Cat. No. C34554). EVs were incubated with 20 μM CFSE in a final volume of 300 μl of PBS at 37°C for 120 minutes. Labeled EVs were pooled by ultracentrifugation at 100,000 × g for 90 minutes and resuspended in PBS to remove unbound CFSE dye. Labeled EVs were transferred to LoBind Eppendorf protein tubes for storage.

[0369] Analysis of EV uptake by flow cytometry MSC#2 cells were detached from the plastic using 0.05% trypsin-EDTA and resuspended in pre-prepared DMEM medium in a 37°C, 5% CO2 incubator. Cells were counted using an automated cell counter and transferred to LoBind protein tubes at 100,000 cells / tube. MSC#2 cells were treated with 10x concentrations of Y201 CFSE-EVs and unlabeled EVs for 1, 2, 4, 6, 8, and 10 hours, respectively.

[0370] To determine whether EV uptake is RGD-dependent, cells were treated with 200 μM Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP-SEQ ID NO: 16) or Gly-Arg-Ala-Asp-Ser-Pro (GRADSP-SEQ ID NO: 17) peptides (Sigma-Aldrich, SCP0157, SCP0156) for 6 hours. The peptides were removed by pelleting the cells and resuspending them in fresh DMEM medium. CFSE-EVs and unlabeled EVs at 10x concentrations were transfected into the cells for 4 hours. The cells were pelleted by centrifugation at 300 g for 5 minutes at 4°C and washed twice with ice-cold PBS to remove unincorporated EVs. The cells were resuspended in 200 μl of flow buffer (1% FBS in PBS), and EV uptake by MSC#2 cells was determined by flow cytometry using an LX375 CytoFlex tube. The gains were adjusted as follows: i) forward scatter at 20, ii) side scatter at 40, and iii) fluorescein isothiocyanate at 40 to detect CFSE fluorescence.

[0371] Antigen-induced arthritis (AIA) model of inflammatory arthritis AIA was induced in male C57Bl / 6 mice (7–8 weeks old) as previously described (Kehoe et al. Arthritis Res Ther 16, R148(2014)). Swelling was assessed by measuring the difference in diameter (mm) between arthritic (right) and non-arthritic (left) knee joints using a digital micrometer.

[0372] Treatments containing 100 μg / mL EVs suspended in PBS or 15 μL of PBS alone (control) were administered via intra-articular injection into the right knee joint through the patellar ligament one day after arthritis induction. Joint diameters were measured on days 1, 2, and 3 after injection. Four independent experiments were performed to assess the effects on joint swelling and histopathology.

[0373] On day 3 after arthritis induction, animals were sacrificed for histological analysis. Joints were fixed in 10% neutral buffered formalin saline and decalcified in formic acid at 4°C for 4 days before being embedded in paraffin. Sections (5 μm) were stained with hematoxylin and eosin and mounted. H&E sections were scored for synovial intimal hyperplasia (0 = normal to 3 = severe), cellular exudate (0 = normal to 3 = severe), and synovial infiltrate (0 = normal to 5 = severe) by two independent observers blinded to the experimental groups. Scores were summed to obtain a mean arthritis index.

[0374] result Characterization of Y201 Y201 MSCs were generated by immortalization using human telomerase reverse transcriptase (hTERT) and characterized as previously described (James et al., 2015; Kay et al., 2022). Furthermore, we observed that Y201 MSCs possessed a unique karyotype. All 20 cells examined contained an additional chromosome 8 and a chromosomal translocation of the long arm of chromosome 1 band q21 to the short arm of chromosome 13 band p10 (Figure 1). Y201 cells are typically elongated and migratory (Figure 2). We demonstrated that the entire secretome produced by Y201 MSCs, including its constituent extracellular matrix (ECM) components, could alter the morphology and migratory behavior of the comparative MSC subline, MSC#2, so that it took on the behavioral characteristics of Y201 MSCs (Figures 3 and 4). These findings demonstrate that factors secreted by Y201 cells can induce functional changes in other cell types, such as increased migration and tissue regeneration, that may have therapeutic applications. Taken together, the secretome has a favorable effect on a control MSC line, inducing functional changes in the control MSC line that result in the cells becoming more similar to stem-like MSCs in terms of morphology and migratory behavior. The majority of MSCs found in situ do not possess stem cell-like properties, and therefore, administration of the secretome to a wound site may stimulate proliferation by reprogramming resident MSCs to exhibit stem cell-like behavior.

[0375] Characterization of EVs Size, morphology, protein and microRNA cargo EVs were first isolated using differential ultracentrifugation, which separates different EV subpopulations based on their density. Serum-free medium was conditioned by Y201 cells and centrifuged at different speeds (10,000 g and 100,000 g) to obtain two fractions, designated 10k and 100k, respectively.

[0376] EVs were characterized using nanoparticle tracking analysis (NTA) for yield and size distribution, transmission electron microscopy (TEM) and image analysis for morphology, and Western blotting for EV-specific markers. We observed peak EV sizes of 100 nm, 112 nm, 141 nm, and 211 nm in the Y201 10K fraction. The Y201 100K fraction showed reproducible peak mean diameters of 104 nm and 112 nm with typical morphology by TEM. EV yields were approximately 2.5 x 10 per million cells for the 10K and 100K fractions of Y201, respectively. 8 and 4.5 × 10 9 Y201 EVs were positive for the specific markers Alix, flotillin-1, CD81, and CD63 in the 100k fraction and negative for the endosomal marker BiP (Figure 5). EV markers were not detected in the 10k fraction, which was also more variable in terms of size based on NTA data; for this reason, subsequent studies focused on the 100k EV fraction.

[0377] We used follow-up bioinformatics analysis to perform a full proteomic and microRNA screening of EV cargo from the Y201 100k EV fraction (Tables 2, 3, and 4).

[0378] [Table 2] Table 2. Top 200 identified proteins in Y201 conditioned medium. Conditioned medium was analyzed using LC-MS and searched against the human subset of the UniProt database. Abundance was quantified using relative peak areas of non-competing peptides and Progenesis QI.

[0379] [Table 3] Table 3. Top 200 identified proteins in Y201 EVs. Isolated EVs were analyzed using LC-MS and searched against the human subset of the UniProt database. Abundance was quantified using relative peak areas of non-competing peptides and Progenesis QI.

[0380] [Table 4-1] [Table 4-2] Table 4. Identified miRNAs in Y201 EVs. Y201 EVs were analyzed for their miRNA content by NanoString array. Abundance was quantified relative to the baseline reading (undetected probes).

[0381] Analysis of Y201 EV protein cargo To gain further insight into the nature of the enriched Y201 EVome, GO analysis was performed on biological process, molecular function, and cellular component gene sets. Regarding biological processes, the Y201 EVome was primarily enriched for extracellular matrix organization and structure, neutrophil-mediated immunomodulatory activity, and various adhesion and migration processes (Figure 34A). The molecular functions of these proteins are largely related to the binding of cadherins and various nucleic acids, including GDP, nucleic acid triphosphate, and RNA (Figure 34B). Enrichment for cellular component gene sets revealed that these proteins are significantly present at focal adhesions and cell-substrate junctions to a relatively large extent (Figure 34C). To gain a broader perspective on potential Y201 EV functions in vivo, the Y201 EVome was evaluated for enrichment for GO biological process gene sets in the BiNGO plugin for Cytoscape, which constructed a clustered network of significantly enriched processes (Figure 34D). Significantly larger clusters formed around similarly important processes related to the immune system, regulation of cellular processes, developmental processes and organization of cellular components.

[0382] Considering that the most abundant Y201 EV proteins are associated with ECM organization, we attempted to model the extravesicular corona by constructing a protein-protein interaction (PPI) network in STRING (Figure 35A). We identified numerous PPIs between ECM components and cognate vesicular membrane integrins and tetraspanins. Fibronectin (FN1) and milk fat globule epidermal growth factor 8 (MFGE8) were among the most abundant putative corona proteins of Y201 EVs, which we confirmed by Western blot analysis compared with MSC#2 EVs (Figure 35B).

[0383] EV bioactivity Cargo Delivery Using EVs labeled with a membrane-specific fluorescent dye (CFSE) and fluorescence microscopy, we demonstrated that Y201 EVs were taken up by primary bone marrow MSCs, with intracellular EVs first appearing within 5 hours of treatment, demonstrating the potential for EV-mediated cargo delivery (Figure 6A). We also demonstrated that Y201 EVs could be loaded with the anticancer drug doxorubicin and delivered to an osteosarcoma cell line (U2OS) where it inhibited proliferation (data not shown).

[0384] EV uptake by different MSC subtypes MSC#2 cells were treated with Y201 CFSE-labeled EVs and EV uptake was quantified using flow cytometry. A gating strategy using a Cytoflex LX375 was established using the following parameters: FSC vs. SSC plots were created to distinguish cells in suspension from debris. After gating out debris, single cells were distinguished by plotting FSC-H against FSC-A. Cells not treated with stained EVs were used to identify cellular autofluorescence by plotting SSC against the CFSE signal. Finally, cells treated with CFSE-EVs were used to measure successful EV uptake.

[0385] The time course of EV uptake was determined by flow cytometry. Cells were treated with unlabeled or CFSE-labeled EVs for up to 10 hours, after which flow cytometry was performed on live cells. MSC#2 cells exposed to CFSE-Y201 EVs showed increased fluorescence throughout the first 4 hours, with levels remaining elevated up to 10 hours (Figure 36A and B).

[0386] RGD-integrin-mediated uptake and function of Y201 EVs Given the evidence for enrichment of ECM-based coronas, particularly RGD-containing proteins (FN1 and MFGE8), in Y201 EVs, we hypothesized that these EV subtypes were preferentially internalized by integrin-mediated endocytosis. Using MSC#2 cells as model target cells, we treated them with the GRGDSP (SEQ ID NO: 16) integrin-blocking peptide or the GRADSP (SEQ ID NO: 17) peptide control for 6 hours before exposing them to CFSE-stained Y201 EVs. Using flow cytometry, we demonstrated that Y201 EV internalization was significantly inhibited by RGD blockade (GRGDSP (SEQ ID NO: 16)) compared to the control (Figure 37).

[0387] Y201 EV regeneration effect EV functionality was first tested using Y201 EVs on another MSC subline (MSC#2). The dosage was determined by the proportional EV yield per cell and multiplied by a factor of 1 (1x), 5 (5x), or 10 (10x) so that each cell was exposed to EVs from 1x, 5x, or 10x more cells. Y201 EVs significantly increased MSC#2 proliferation (Figure 6B–G). Furthermore, MSC#2 migration was enhanced by Y201 EVs (Figure 7). This supports the therapeutic potential of Y201 EVs for regenerative therapy through stimulation of cell proliferation and migration.

[0388] We translated these findings to primary cells by treating osteoarthritis patient-derived human bone marrow MSCs (derived from discarded bone after total joint replacement surgery) with Y201 EV. We observed a dose-dependent increase in proliferation compared to untreated controls, confirming that Y201 EV can enhance cell proliferation, even in primary cells from elderly donors (Figure 8).

[0389] In disorders such as juvenile idiopathic arthritis, as well as other disorders including rheumatoid arthritis or osteoarthritis, cartilage tissue in the joints is gradually destroyed. Therefore, we determined the effect of Y201 EV on articular chondrocyte proliferation. Chondrocytes are the only specialized cell type found in cartilage tissue and are responsible for the functional and structural integrity of cartilage. Articular chondrocytes were harvested from the surface of discarded joint tissue after total joint replacement surgery. The results showed that a significant dose-dependent increase in chondrocyte proliferation and a decrease in chondrocyte doubling time were achieved by Y201 EV treatment (Figure 9).

[0390] Proteomic EV analysis revealed that MFG-E8 protein was highly enriched in Y201 EVs compared with MSC#2 EVs, which was further confirmed by Western blotting (Figure 9). MFG-E8 binds to phosphatidylserine-enriched EVs and can interact with target cells via αvβ3 / αvβ5 integrin and RGD-binding motifs. We hypothesize that Y201-derived EVs can be internalized by cells via integrin-mediated endocytosis. AC cells were treated with the RGD-containing blocking peptide GRGDSP (SEQ ID NO: 16) or the control peptide GRADSP (SEQ ID NO: 17), and the effect of Y201 EVs on their proliferation rate was monitored over 72 hours. We confirmed that Y201 EV increased AC proliferation compared to untreated controls and that this effect was blocked by exposure to the GRGDSP (SEQ ID NO: 16) peptide, but not the GRADSP (SEQ ID NO: 17) peptide (Figure 9).

[0391] Using bone marrow MSCs from osteoarthritis patient donors, we investigated the effect of Y201 EV on chondrogenic differentiation. We showed that treatment with Y201 EV enhanced chondrogenic differentiation of MSCs, as visualized by Safranin O staining (Figure 10). This demonstrates that Y201 EV has tissue regenerative potential.

[0392] Immunosuppressive effect of Y201 EVs We further investigated the effects of Y201 EVs in an in vitro inflammation model. We showed that EVs from Y201 cells attenuate adaptive immune responses, such as those involved in inflammatory diseases, through inactivation of CD4+ effector T cells in vitro, resulting in a decrease in the proportion (index) of proliferating immune cells and a decrease in the proliferation capacity (cycle) of immune cells. In addition, Y201 EVs have the ability to counteract proinflammatory IFN-γ (Th1) responses through increased IL4 (Th2) differentiation (Figure 11).

[0393] We furthered this research into an in vivo inflammation model that mimics infection-type immune responses. Infectious pathogens may also play a role in initiating or perpetuating inflammatory processes in autoimmune diseases. Y201 EV attenuated the pathogen response to peritoneal infection in vivo through suppression of immune cell recruitment and reduction of T cell differentiation (Figure 12).

[0394] Y201 was modified using CRISPR / Cas9 to target deletion of the FGFR3 gene and determine the effect on cell behavior. Data regarding the characterization of the Y201 FGFR3 KO cell line are provided below.

[0395] In vivo evaluation of the potential therapeutic efficacy of Y201 EV in a mouse arthritis model We tested the bioactivity of Y201 EVs in a disease-relevant in vivo model of adjuvant-induced arthritis after intra-articular EV injection. After histological examination and blinded scoring, we demonstrated that EVs derived from Y201 MSCs induced significant reductions in all measures of disease activity, including joint swelling, synovial infiltration, joint effusion, synovial hyperplasia, and overall arthritis index, compared with vehicle controls (Figures 38A-E). Representative hematoxylin and eosin-stained sections provide evidence of changes in synovial infiltration and hyperplasia in control and Y201 EV-treated samples (Figures 38F-I).

[0396] Comparison of clonogenic and proliferative potential between wild-type (WT) Y201 and FGFR3 knockout (KO) Both WT and FGFR3-KO MSCs were able to form colonies, and there was no significant difference in their colony-forming efficiency (Figure 13A, p = 0.9665), indicating similar adhesion and viability between the MSC lines. There was no significant difference in mean colony surface area (Figure 13B, p = 0.6760), indicating that FGFR3-KO had comparable clonogenic potential to WT MSCs. That is, the total surface area covered by colonies was similar for both lines (Figure 13C, p = 0.5940). However, there were clear differences in cell density within individual colonies. FGFR3-KO colonies were near-confluent or confluent, whereas WT colonies were composed of sparsely distributed cells. This was evidenced by the darker and more pronounced color of crystal violet staining in FGFR3-KO colonies, which was particularly evident when imaged at the single-colony level (Figure 14).

[0397] The proliferation rates of the cell lines were compared. Equal numbers of WT and FGFR3-KO cells were seeded, and an indication of cell number was obtained over a 3-day period using Alamar Blue cell viability reagent. Fluorescence readings were taken daily; an increase in fluorescence indicates an increase in cell number, and therefore proliferation. FGFR3-KO cells show an increase in fluorescence from day 1, but this was not significant. On days 2 and 3, FGFR3-KO cells show significantly increased fluorescence compared to WT cells (Figure 15).

[0398] Cell number was also used as a measure of population expansion, allowing for the determination of the population doubling time for each cell line. At 24 hours after seeding, FGFR3-KO cells showed a 75% increase in cell number compared to 18% for WT cells, indicating that FGFR3-KO cells begin to proliferate immediately after seeding. At each time point, FGFR3-KO MSCs showed a greater increase in cell number than WT MSCs. After 4 days, FGFR3-KO cells had significantly higher cell numbers than WT cells (Figure 15). During the most rapid phase of proliferation, FGFR3-KO cells have an average population doubling time of 18.6 hours compared to 25.0 hours for WT cells.

[0399] To demonstrate that FGFR3-KO MSCs maintained this increased proliferation rate over time, cumulative population doublings and cell numbers were also counted throughout long-term culture (Figure 16). At all time points, FGFR3-KO underwent more population doublings than WT cells, further supporting the increased proliferation rate of FGFR3-KO.

[0400] Comparison of morphological changes between FGFR3-KO and WT MSCs As observed in the CFU-F assay, FGFR3-KO cells appeared to have altered morphology compared to WT cells. However, these cells were at different density levels, with FGFR3-KO cells near confluence, whereas WT cells were more sparsely distributed. To allow for comparative analysis of morphology, cells were divided into 1 cm 2Cells were plated at an equal density of 4000 cells per well, stained with crystal violet, and imaged (Figure 17A, B). Cell shape measurements were then calculated using CellProfiler. Despite no change in cell volume between the strains, FGFR3-KO MSCs exhibited significantly reduced cell area (Figure 17C). This likely indicates that WT cells have a lower sphericity index, thereby flattening out more against the growth surface and thereby covering a larger area. However, FGFR3-KO cells exhibited a much wider cell area, with numerous, widely spread cells that appeared to have extensive lamellipodia. FGFR3-KO cells exhibited a decreased length-to-width ratio and an increased circularity index (Figure 17D, E). WT cells exhibited a typical elongated fibroblast morphology, exhibiting a high length-to-width ratio.

[0401] RNA sequencing comparison between WT and FGFR3-KO MSCs RNA-seq analysis was subjected to bioinformatics investigation. A total of 641 transcripts were found to have significant differential expression between WT and FGFR3-KO MSCs, with 274 transcripts being upregulated and 367 downregulated in FGFR3-KO (Tables 5 and 6).

[0402] [Table 5] Table 5. Top 200 RNA transcripts upregulated in FGFR3 KO MSCs. RNA-seq data yielded a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as those with a log2 fold change greater than 1 and an adjusted p-value less than 0.05. Transcripts were then divided into two gene lists corresponding to those upregulated or downregulated in FGFR3-KO versus WT, and those with fewer than 5 FPKM reads in both cell lines were excluded.

[0403] [Table 6] Table 6. Top 200 RNA transcripts downregulated in FGFR3 KO MSCs. RNA-seq data yielded a list of differentially expressed transcripts between WT and FGFR3-KO MSCs, defined as those with a log2 fold change of less than -1 and an adjusted p-value of less than 0.05. Transcripts were then divided into two gene lists corresponding to those upregulated or downregulated in FGFR3-KO versus WT, and those with fewer than 5 FPKM reads in both cell lines were excluded.

[0404] To determine whether genes involved in specific pathways or cellular behaviors were enriched, we performed Gene Ontology (GO) and KEGG pathway analyses on the differentially expressed transcripts. A clear result from the KEGG analysis was that gene expression changes in FGFR3-KO overlapped with genes altered in cancers, including lung and bladder (Figure 18A). Consistent with this, and also consistent with the increased proliferation rate observed in FGFR3-KO, there was a highly significant enrichment for the GO term "regulation of cell population proliferation." Of the 641 differentially expressed genes in FGFR3-KO, 103 belonged to this GO term, implying that a vast number of pathways regulating cell cycle and proliferation are affected by loss of FGFR3. In addition, transcripts encoding inflammation-related proteins were significantly upregulated in FGFR3-KO. The most significant KEGG enrichment in upregulated genes was for "complement coagulation cascade" (Figure 18B). As expected, there was also significant perturbation of signaling pathways known to be downstream of FGFR3, such as PI3K signaling.

[0405] Analysis of the cellular components of the GO term showed a significant enrichment for actin cytoskeleton (Figure 19A), indicating that several transcripts encoding cytoskeletal proteins had altered expression in FGFR3-KO MSCs. This is consistent with the morphological changes in FGFR3-KO MSCs, which are likely driven by altered expression of cytoskeletal proteins. There was also a significant enrichment for transcripts encoding extracellularly expressed proteins (Figure 19B). Finally, analysis of the biological processes of the GO term showed an enrichment for processes primarily related to migration and tissue morphogenesis, more broadly "developmental processes" (Figure 20).

[0406] Several proteoglycan-binding genes were differentially expressed, and "proteoglycan binding" was the eighth most enriched molecular function GO term in genes that were downregulated in FGFR3-KO (Figure 21).

[0407] Phalloidin staining of actin cytoskeleton Due to the morphological changes and enrichment of actin cytoskeleton genes in FGFR3-KO cells, we performed fluorescent staining of the actin cytoskeleton to visualize the cells in more detail. The arrangement of actin fibers in WT cells appeared striated, with stress fibers running from the leading edge to the tail and several branching fibers at the leading edge (Fig. 22A, B). In FGFR3-KO cells, stress fibers appeared as thicker bundles, particularly prominent at the dorsal edge behind the lamella (Fig. 22C, D). Furthermore, FGFR3-KO cells had an approximately circular shape with prominent, broad transverse arches and lamellipodia.

[0408] Fluorescence images were also used to quantify cell shape measurements, as the clear contrast of the actin cytoskeleton against the background and the high magnification allowed for more accurate measurements of single cells. WT MSCs had a significantly increased length:width ratio and a significantly lower circularity index compared to FGFR3-KO MSCs (Figure 23).

[0409] Arp3 immunofluorescence Due to its role in generating branched actin fibers, Arp3 protein is often enriched in lamellipodia. Therefore, we hypothesized that FGFR3-KO MSCs exhibited higher localization or levels of Arp3 protein, which may enable the formation of extensive lamellipodia. However, in FGFR3-KO cells, there was widespread staining for Arp3, likely contributing to the overall rounded shape of the cells, and there was no clear enrichment in lamellipodia (Figure 24). WT cells showed fewer and more intense patches of Arp3 staining, many of which colocalized with actin.

[0410] Increased scratch wound healing ability Because RNA-seq analysis showed enrichment of differentially expressed migratory genes in FGFR3-KO, their migration ability was compared with that of WT MSCs. WT and FGFR3-KO cells were seeded into well plates and scratches were made with a pipette tip. Images were taken at 0 and 24 hours, and scratch closure was calculated as the percentage of the original wound size covered by cells. FGFR3-KO had significantly increased closure compared to WT MSCs, indicating increased migration ability (Figure 25).

[0411] Individual cell migration measurements FGFR3-KO and WT MSCs were plated in cell culture plates with removable inserts to create space and allow for analysis of migration without wounding the cells. Cells were allowed to migrate for 24 hours, and single-cell migration measurements were collected over the time course.

[0412] Despite reduced track length and velocity during migration at the single-cell level, FGFR3-KO cells covered a larger area at the end of the time course (Figures 26A-C). Additionally, FGFR3-KO MSCs exhibited fewer cell divisions during the time course, suggesting that increased proliferation is not responsible for wound healing (Figure 26D). However, despite typically having a smaller cell area than WT cells, FGFR3-KO cells exhibit significantly larger cell area and significantly reduced sphericity during migration (Figures 26E, F). This suggests that FGFR3-KO cells flatten and spread more than WT cells during migration, which helps them cover a larger surface area. Furthermore, FGFR3-KO cells exhibited higher average straightness, meaning that their migration was less tortuous than WT cells, although this increase was not statistically significant (Figure 26G).

[0413] Image tracking of each well showed that WT MSCs underwent collective cell migration, with leader cells protruding into the gap and followed by other cells. This created a distinct arched shape and maintained cell-cell interactions (Figure 26H). In contrast, FGFR3-KO cells migrated independently of each other rather than following the leader cells, and thus appeared to migrate swarmingly into the space (Figure 26I). This ability to migrate independently of other cells, without being impeded by them, may affect the direction of migration and likely contribute to increased gap closure.

[0414] Characterization and functional analysis of FGFR3-KO MSC secretome Characterization of extracellular vesicle size, yield and morphology Nanoparticle tracking analysis Nanoparticle tracking analysis (NTA) was performed to assess the size and number of EVs secreted by WT and FGFR3-KO MSCs. EVs were isolated by differential centrifugation to obtain fractions designated 2k, 10k, and 100k, which were collected at increasing centrifugation speeds.

[0415] In the 2k fraction, FGFR3-KO EVs had a broader size distribution and tended to be larger in diameter than WT EVs (Figure 27A). The major population of WT 2k EVs had a diameter of 119 nm, while FGFR3-KO had a broad major population ranging from 127 to 150 nm. The yield of EVs per million cells was 1.23 × 10 for WT and FGFR3-KO MSCs, respectively. 8 and 3.10 x 10 8 Thus, FGFR3-KO shows a 2.52-fold increase in EV secretion in their 2k fraction. In the 10k fraction, both lines showed a peak at 101 nm, with a secondary peak at 147 nm for WT MSCs and 141 nm for FGFR3-KO (Figure 27B). Again, the yield of FGFR3-KO was significantly increased: 2.98 x 10 per million cells. 8 EVs were secreted by WT MSCs, 9.29 × 10 8 EVs were secreted by the FGFR3-KO, representing a 3.12-fold increase in secretion by the FGFR3-KO. A significant increase in EV size was also observed for the 100k fraction. WT EVs had a modal population at 105.7 nm compared to 128 nm for FGFR3-KO EVs (Figure 27C). Interestingly, a small peak at 72 nm was observed in the WT 100k fraction. EVs with a diameter less than 100 nm are typically classified as exosomes, although there is much debate in the literature. With this definition, 14% of the WT 100k fraction could be classified as exosomes, compared to less than 1% in the FGFR3-KO fraction. Again, this confirms a shift toward secretion of larger EVs as a result of FGFR3 removal. The 100k fraction had a maximum of 1.70 x 10 EVs per million cells for WT and FGFR3-KO MSCs, respectively. 9 and 4.85 x 10 9 Therefore, the yield was 2.85-fold higher in the FGFR3-KO case.

[0416] Further examination of EV size by TEM demonstrated typical EV morphology (Figure 28). However, some EVs remained intact, allowing us to capture their true spherical shape. FGFR3-KO EVs were much more abundant than WT EVs, which was expected given the higher yields obtained in the NTA calculations. However, the number of WT EVs visualized by TEM was particularly low compared to FGFR3-KO EVs. The high number of FGFR3-KO EVs per field allowed us to clearly observe the heterogeneity in EV size and shape. In the FGFR3-KO 100k fraction, vesicles smaller than 50 nm as well as larger than 500 nm were observed. Fewer EVs were observed in the 10k and 2k fractions for both WT and FGFR3-KO MSCs. However, again, WT EVs were consistently smaller than FGFR3-KO EVs. From this TEM and NTA data, it is clear that FGFR3-KO EVs are larger than WT EVs, suggesting a novel role for FGFR3 in EV biogenesis. This could be indirect as a result of altered morphology and cytoskeleton, or through direct changes to the secretory pathway. We next examined the functional effects of EVs and the broader secretome.

[0417] Functional effects of extracellular vesicles / conditioned medium FGFR3-KO conditioned medium increases migration of WT cells WT MSCs were used in scratch wound assays and either FGFR3-KO-derived EVs, conditioned medium (CM), or EV-negative conditioned medium (EV-CM) was applied. Individual cell counts were tracked for 24 hours throughout wound healing. CM and EV-negative CM significantly increased scratch closure compared to untreated controls (Figure 29A). EVs at 1x, 5x, or 10x doses had no effect on closure. Treatment had no significant effect on track length compared to controls, but 1x and 10x EV treatment significantly decreased track length compared to EV-negative CM (Figure 29B). Minimal changes in the linearity index were observed throughout treatment (Figure 29C). CM significantly increased linearity compared to controls, while 5x EV significantly decreased linearity. This is one parameter likely contributing to the increased rate of wound healing. Additionally, CM-treated cells showed a significant decrease in thickness (Figure 29D) and sphericity index, indicating that they were flatter relative to the surface to which they adhered. In contrast, 5x and 10x EV-treated cells showed significantly increased thickness and sphericity. This may indicate that EV uptake is associated with cells detaching from the growth surface and becoming more spherical.

[0418] Increased velocity is likely the primary factor contributing to the increased migration of MSCs treated with CM and EV-negative CM. Both treatments show a significant increase in instantaneous velocity over time, particularly after 12 hours (Figure 29E). Compared to the control, a 5x EV dose shows a significant decrease in velocity, while 1x and 10x show non-significant decreases.

[0419] These data suggest that the FGFR3-KO secretome, but not EVs, can promote MSC migration. This is due to changes in MSC morphology, velocity, and linearity. Given their known regenerative properties, improved scratch wound healing may be a general feature of MSC-CMs. Therefore, we needed to confirm that the FGFR3-KO secretome specifically was the driver of these changes.

[0420] FGFR3-KO improves scratch wound healing in WT MSCs but not WT CMs To confirm that the FGFR3-KO secretome specifically caused the increased migration, we performed another scratch wound assay using WT CM as a control. To determine whether WT MSCs treated with FGFR3-KO CM could recapitulate the wound healing ability of mutant cells, we also used FGFR3-KO MSCs themselves as a positive control.

[0421] WT cells treated with WT CM showed an increase in mean scratch closure, although this was not significant compared to untreated controls (p=0.0769) (Figure 30). In contrast, WT cells treated with FGFR3-KO CM showed a 2.4-fold increase in scratch closure, significantly higher than both untreated and WT-CM-treated controls. Indeed, treatment with FGFR3-KO CM resulted in wound healing comparable to that of FGFR3-KO cells themselves (p=0.8476).

[0422] Effect of MSC secretome on MSC proliferation and morphology Next, WT and FGFR3-KO MSCs were treated with either WT- or FGFR3-KO MSC-derived CM. Proliferation was assessed using an Alamar Blue cell viability assay, and none of the CM treatments had a significant effect on viable cell numbers at any time point (Figure 31). This indicates that the FGFR3-KO secretome can increase the migration of WT MSCs, but is not sufficient to drive the increased proliferation seen in FGFR3-KO MSCs.

[0423] To elucidate whether the secretome contributes to the different cell shapes between the strains, we also analyzed cell morphology after CM treatment. WT cells showed a significant increase in cell area when treated with their own CM (Figure 31B). This increase in area was not accompanied by any significant changes in length:width ratio or circularity, indicating that cells became larger without any change in shape (Figure 31C, D). FGFR3-KO CM did not affect the area or shape of WT MSCs. However, treatment of FGFR3-KO MSCs with either WT or KO CM caused a significant decrease in cell area, especially when treated with WT CM.

[0424] The effect of FGFR3-KO EVs on WT MSC proliferation was also evaluated. Various EV doses had little effect on day 2. A dose-dependent decrease in viable cell numbers was observed on day 3. Cells treated with 10x EVs had 31% less fluorescence than controls. This experiment was repeated with EV-depleted FBS and 10x EV treatment. No significant effect of this treatment was observed, indicating that neither FGFR3-KO CM nor EVs modulate proliferation in MSCs (Figure 32).

[0425] Survival and proliferation of MSCs without serum supplementation During CM collection, MSCs are cultured in serum-free medium to avoid contamination with FBS EVs. While culture in serum-free medium typically causes growth arrest, it is notable that FGFR3-KO MSCs appeared to continue to proliferate. Therefore, we used an Alamar Blue viability assay to compare the proliferation of WT and FGFR3-KO MSCs in complete (10% FBS) and serum-free (0% FBS) medium. In complete medium, FGFR3-KO cells exhibit significantly higher proliferation than WT MSCs by day 2. By day 3, both WT and FGFR3-KO MSCs cultured in serum-free medium were significantly less proliferative than their complete counterparts (Figure 33A). Interestingly, there was no significant difference between WT MSCs in complete medium and FGFR3-KO MSCs in serum-free medium at any time point. This indicates that FGFR3-KO MSCs proliferate at a similar rate to WT cells, even in the absence of serum.

[0426] To determine whether FGFR3-KO MSCs could sustain proliferation without serum, cells were continuously cultured in serum-free medium for 21 days, and cell numbers were counted at each passage. WT MSCs showed no significant change in cell number over time, indicating a plateau in proliferation in the absence of serum (Figure 33B). In contrast, FGFR3-KO MSCs showed a significant increase in cell number over time. When cells reached confluence, they were equally passaged into additional culture flasks, as indicated by the arrows (Figure 33B). This promoted a rapid increase in proliferation, which then slowed as the cells again approached confluence. This increased viability and proliferation in the absence of serum may indicate an enriched secretome containing anti-apoptotic factors that enable FGFR3-KO MSCs to survive.

[0427] Both WT and FGFR3-KO MSCs undergo dramatic morphological changes in the absence of serum (Figure 33C-F). After 48 hours of culture in serum-free medium, WT MSCs became thinner, spindle-like in shape, and appeared smaller in size. FGFR3-KO MSCs show this shift to thinner morphology, but still contain numerous rounded cells, some with large lamellipodia.

[0428] Taken together, FGFR3 KO cells produce high-quality EVs with minimal serum requirements, making them suitable for engineering applications. This is supported by the fact that EVs do not adversely affect cells treated with them. The FGFR3-KO secretome may be useful in wound healing applications, where stimulating migration may promote improved healing due to enhanced migration to the wound site.

[0429] Table 7 below provides non-limiting examples of characteristics of various MSC clonal lines.

[0430] [Table 7] Table 7: Non-limiting examples of characteristics of various MSC clonal lines [Example 2]

[0431] EVs can be isolated following the protocol used to generate the 100K fraction described in Example 1 above.

[0432] The evening before EV isolation, place the Ty45i rotor in a cold room (4 °C) to cool, and allow the media pot containing conditioned media (which may be prepared, for example, using Y201 cells or FGFR3 KO cells, as described elsewhere herein) to slowly thaw overnight at 4 °C. On the morning of isolation, the TLA100.3 rotor can be placed at 4 °C.

[0433] 1. All steps should be performed quickly, striving to keep the medium cold at all times, keep tubes on ice at all times, and set all centrifuges to 4°C before starting the isolation. Some of these steps can be ignored if not all of the medium or fractions containing or not containing EVs are collected to serve as controls in functional assays.

[0434] 2. Transfer the medium from the medium pot into a 50 ml Falcon tube and centrifuge at 300 g for 5 minutes to remove any large cells or debris using a centrifuge (e.g., a standard benchtop centrifuge).

[0435] 3. At this stage, an appropriate volume of CM can be collected to be used as a control for functional assays.

[0436] 4. Transfer the remainder of the supernatant into 6 new Falcon tubes and centrifuge again at 2000 g and 4° C. for 20 minutes using a centrifuge (e.g., a standard benchtop centrifuge).

[0437] 5. Transfer the supernatant to a Ty45i rotor-compatible ultracentrifuge tube and retain the pellet. Resuspend the pellet using 600 μl of chilled filtered HQ PBS per tube. Finally, pool the resuspended pellets from the six tubes together in pairs in 3 x 1.5 ml Eppendorf tubes (total volume of 1200 μl per pair). Vigorous pipetting may be required and may take time to ensure the pellet is completely resuspended.

[0438] 6. Resuspend the pellet from the 2,000 g centrifuge and centrifuge again at 2,000 g and 4°C in a bench centrifuge, taking care not to disturb the pellet, and aspirate / discard the supernatant. Any bench centrifuge with a temperature control system can be used.

[0439] 7. Resuspend the pellet in 50-100 μl of cold HQ-PBS (e.g., GIBCO brand PBS purchased in 1x bottles, as it is "particle-free") and transfer the suspension to a low-protein binding tube. Freeze the resuspended pellet at -70°C (2K fraction).

[0440] 8. The supernatants previously transferred to six Ty45i ultracentrifuge tubes must be paired, and the tubes must be balanced to within 0.01 g of each other (if the difference is less than 0.009, a small piece of autoclave tape can be used to balance the tubes). Tubes should be inspected for signs of excessive wear and damage before use, and all O-rings must be in place. Tubes should be weighed with all caps, O-rings, and metal lids attached, as all of these have slight weight differences; this can be done, for example, with an AND FX300i balance. Tubes should be filled to at least two-thirds of their maximum capacity. The medium is centrifuged at 10,000 g (9,000 rpm in a Ty45i rotor) at 4°C for 45 minutes in a floor-standing ultracentrifuge (e.g., Machine 100 XP, Beckman) with the lettering on each tube facing outward to make pellet identification easier.

[0441] 9. Transfer the supernatant to a new Ty45i ultracentrifuge tube and collect the pellet. Resuspend the pellet using 600 μl of chilled filtered HQ-PBS per tube. Finally, pool the resuspended pellets from the six Ty45i tubes together in pairs into three 1.5 ml micro-ultracentrifuge tubes (Beckman Microfuge Tube Polyallomer, Cat. No. 357448) (1200 μl total volume per pair). Vigorous pipetting may be required and may take time to ensure the pellet is completely resuspended.

[0442] 10. Re-centrifuge the resuspended pellet from the 10,000g centrifugation at 10,000g (16,000 rpm for the TLA100.3 rotor) in a TL100 ultracentrifuge using a TLA100.3 rotor for 45 minutes at 4°C and aspirate / discard the supernatant, being careful not to disturb the pellet.

[0443] 11. Resuspend the pellet in 50-100 μL of HQ-PBS and transfer the suspension to a low protein binding tube. Store at -70°C (10K fraction).

[0444] 12. The supernatant transferred to six new Ty45i ultracentrifuge tubes should be balanced to within 0.01 g of each other and filled to at least 2 / 3 of their maximum capacity. Centrifuge the medium in a floor-standing ultracentrifuge at 100,000 g (30,000 rpm in a Ty45i rotor, Machine 100 XP, Beckman) for 90 minutes at 4°C (e.g., with the lettering on each tube facing outward to make pellet identification easier). A small pellet may be visible; be sure to move the tubes gently to avoid disturbing the pellet.

[0445] 13. Gently discard the supernatant without disturbing the pellet. If you are performing a functional assay and want to use the supernatant as a negative control, collect an appropriate amount into a new 50 ml Falcon tube and store it at -70°C. Use a pipette to aspirate any residue left behind.

[0446] 14. Resuspend the pellet using 600 μl of chilled filtered PBS per tube. Finally, pool the resuspended pellets from the six Ty45i tubes together in pairs into three 1.5 ml microcentrifuge tubes (total volume of 1200 μl per pair). Vigorous pipetting may be required and may take time to ensure the pellet is completely resuspended.

[0447] 15. Microcentrifuge tubes should have at least 1 mL before centrifugation.

[0448] 16. Centrifuge the microcentrifuge tube at 100,000 g (45,000 rpm for a TLA100.3 rotor) for 90 minutes.

[0449] 17. Aspirate / discard the supernatant, being careful not to disturb the pellet.

[0450] 18. Resuspend the pellet in 50-100 µL of HQ-PBS and transfer the suspension to a protein low binding tube (100k fraction).

[0451] 19. Freeze the resuspended pellet at -70°C.

[0452] The reader's attention is drawn to all articles and documents filed contemporaneously with or prior to this application in connection with this application and which are hereby made available for public inspection, and the contents of all such articles and documents are incorporated herein by reference.

[0453] All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.

[0454] Each feature disclosed in this specification (including any accompanying claims, abstract, and drawings), unless expressly stated otherwise, may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

[0455] The invention is not limited to the details of any of the foregoing embodiments, and extends to any novel one or any novel combination of features disclosed in this specification (including any accompanying claims, abstract and drawings), or any novel one or any novel combination of method or process steps so disclosed.

[0456] References · James S, Fox J, Afsari F, Lee J, Clough S, Knight C, Ashmore J, Ashton P, Preham O, Hoogduijn M, Ponzoni Rde A, Hancock Y, Coles M, Genever P. Multiparameter Analysis of Human Bone Marrow Stromal Cells Identifies Distinct Immunomodulatory and Differentiation-Competent Subtypes. Stem Cell Reports. 2015 Jun 9;4(6):1004-15. doi: 10.1016 / j.stemcr.2015.05.005. · Wilson AJ, Rand E, Webster AJ, Genever PG. Characterization of mesenchymal stromal cells in clinical trial reports: analysis of published descriptors. Stem Cell Res Ther. 2021 Jun 22;12(1):360. doi: 10.1186 / s13287-021-02435-1. · Alasdair G Kay, James M Fox, James Hewitson, Andrew Stone, Sophie Robertson, Sally James, Xiao-nong Wang, Elizabeth Kapasa, Xuebin Yang, Paul G Genever Identification of CD317-Positive Pro-inflammatory Immune Stromal Cells in Human Mesenchymal Stromal Cell Preparations. bioRxiv 2022.02.10.479972; doi: https: / / doi.org / 10.1101 / 2022.02.10.479972

[0457] Sequence Sequence number 1 - CACCGCATCCGGCAGACGTACACGC Sequence number 2 - AAACGCGTGTACGTCTGCCGGATGC Sequence number 3 - CAGCACCGCCGTCTGGTTGGCCGGCAGCCCCGCCTGCAGGATGGGCCGGTGCGGGGAGCACTCCAGCACGTCCAGCGTGTACGTCTGCCGGATGCTGCCAAACTTGTTCTCCACGACGCA Sequence number 4 - CAC GGC CCA GCT CTG AGA AAG Sequence number 5 - ACC CAA ATC CTC ACG CAA CC Sequence number 6 - CAT CAA GCC ATC CAC TAT ACA GAGG CGT CTG GGA GAC ATA CA Sequence number 7 - CTA CAC TGT CCA CCA TACTTA TGC TGG ATG TAT GGG GCT Sequence number 8 - CCT GTC CTC CAT TCA CCC ACA C Sequence number 9 - GAG TTC AGT GAA GGG GAG CC Sequence number 10 - CTG AGA AAG AGG TCA GGA G SEQ ID NO: 11-CTG CTA GAG CAG GAG TGA GG SEQ ID NO: 12-CGG GTC CCA CTC CTA GAC AC SEQ ID NO: 13-CGG CCC TTA CCG ATA CTT CAT SEQ ID NO: 14-CAA TAA ACG TTG GGT GCC GC SEQ ID NO: 15-CTC AGT AAG TGC TGG CCT CTG SEQ ID NO: 16-GRGDSP SEQ ID NO: 17-GRADSP

[0458]

Claims

1. Mesenchymal stem cell (MSC)-like cells or derivatives thereof deposited under European Collection of Authenticated Cell Cultures accession number 22072103.

2. 2. The MSC-like cell of claim 1, wherein the derivative has reduced FGFR3 expression and / or activity compared to the MSC-like cell deposited under European Collection of Authenticated Cell Cultures accession number 22072103.

3. 10. The MSC-like cell of any one of the preceding claims, wherein the derivative differs from the MSC-like cell deposited at the European Collection of Authenticated Cell Cultures under accession number 22072103 only by having reduced FGFR3 expression and / or activity.

4. The derivatives are (a) increased levels of at least 10 different RNA transcripts selected from Table 5 compared to the levels of the same RNA transcripts in mesenchymal stem cell (MSC)-like cells deposited under European Collection of Authenticated Cell Cultures accession number 22072103; and / or (b) the mesenchymal stem cell (MSC)-like cell of claim 2 or 3, wherein the MSC-like cell has reduced levels of at least 10 different RNA transcripts selected from Table 6 compared to the levels of the same RNA transcripts in an MSC-like cell deposited under European Collection of Authenticated Cell Cultures accession number 22072103.

5. Mesenchymal stem cell (MSC)-like cells deposited under European Collection of Authenticated Cell Cultures accession number 22072101 or derivatives thereof.

6. A cell population comprising a plurality of cells according to any one of claims 1 to 5.

7. A DNA preparation comprising genomic DNA of the cell according to any one of claims 1 to 5.

8. A cell-free conditioned medium obtainable by cell culture of the cells according to any one of claims 1 to 5 or the cell population according to claim 6.

9. The cell-free conditioned medium of claim 8, which is depleted of extracellular vesicles (EVs).

10. 10. The cell-free conditioned medium of claim 9, which is substantially free of extracellular vesicles (EVs).

11. A secretome or part thereof obtainable by cell culture of a cell according to any one of claims 1 to 5 or a cell population according to claim 6.

12. 12. The secretome or portion thereof of claim 11, which is depleted of extracellular vesicles (EVs).

13. 13. The secretome or portion thereof of claim 12, which is substantially free of extracellular vesicles (EVs).

14. A population of extracellular vesicles (EVs) obtainable by cell culture of the cells according to any one of claims 1 to 5 or the cell population according to claim 6.

15. 15. The EV population of claim 14, which is a 100K EV fraction.

16. 12. The cell-free conditioned medium of claim 8, or the secretome or portion thereof of claim 11, comprising at least 10 different proteins selected from Table 2.

17. 16. The cell-free conditioned medium of claim 8, or the secretome or portion thereof of claim 11, or the EV population of claim 14 or 15, comprising at least 10 different proteins selected from Table 3.

18. 16. The cell-free conditioned medium of claim 8, or the secretome or portion thereof of claim 11, or the EV population of claim 14 or 15, comprising at least 10 different miRNAs selected from Table 4.

19. A composition comprising at least 10 different proteins selected from Table 2.

20. A composition comprising at least 10 different proteins selected from Table 3.

21. A composition comprising at least 10 different miRNAs selected from Table 4.

22. The composition of any one of claims 19 to 21, which is a cell-free composition.

23. 23. A pharmaceutical composition comprising the MSC-like cells of any one of claims 1 to 5, the cell population of claim 6, the DNA preparation of claim 7, the cell-free conditioned medium of any one of claims 8 to 10 or claims 16 to 18, the secretome or part thereof of any one of claims 11 to 13 or claims 16 to 18, the extracellular vesicle (EV) population of any one of claims 14, 15, 17 or 18, or the composition of any one of claims 19 to 22, further comprising a pharmaceutically acceptable adjuvant, excipient, diluent and / or carrier.

24. 24. A pharmaceutical composition according to claim 23 for use as a medicament.

25. 24. The pharmaceutical composition of claim 23 for use in promoting tissue repair.

26. 26. A pharmaceutical composition for use according to claim 25, for treating or preventing a disease or condition associated with cartilage damage.

27. 27. The pharmaceutical composition for use according to claim 26, wherein the disease or condition associated with cartilage damage is arthritis, and the arthritis may be selected from the group consisting of juvenile idiopathic arthritis, rheumatoid arthritis, osteoarthritis, spondyloarthritis and psoriatic arthritis.

28. 26. A pharmaceutical composition for use according to claim 25, for use in wound healing and / or tissue regeneration.

29. 24. The pharmaceutical composition of claim 23 for use in treating or preventing inflammation.

30. 30. The pharmaceutical composition for use according to claim 29, for use in treating or preventing an autoimmune disease or condition.

31. Use of the extracellular vesicle (EV) population of claim 14 or 15 for delivery of cargo to cells.

32. 10. A method of screening a test compound for its ability to induce differentiation of MSC-like cells, the method comprising: a) contacting a test compound with an MSC-like cell according to any one of claims 1 to 5 or a cell population according to claim 6; and b) determining the effect of the test compound on at least one marker of differentiation.

33. at least one marker of differentiation is selected from the group consisting of an osteogenic differentiation marker and a chondrogenic differentiation marker; a) the osteogenic differentiation marker may be selected from the group consisting of type I collagen, alkaline phosphatase, BMP2, osteopontin, osteonectin, osteocalcin, bone sialoprotein, and Runx2; and / or 33. The method of claim 32, wherein b) the chondrogenic differentiation marker may be selected from the group consisting of type II collagen, type X collagen, aggrecan, lubricin, cartilage oligomeric matrix protein, and Sox9.

34. Use of the MSC-like cells of any one of claims 1 to 5 or the cell population of claim 6 for screening test compounds for their ability to induce differentiation of MSC-like cells.