Methods of treating cancer using anti-DDR1 antibodies and immune checkpoint inhibitors
Combining a DDR1-targeting antibody with immune checkpoint inhibitors addresses the challenge of immune-excluded cancers by disrupting tumor stroma and improving treatment efficacy through enhanced immune cell infiltration and reduced tumor burden.
Patent Information
- Application Number
- JP2025528484
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-16
- Filing Date
- 2023-11-15
- Publication Date
- 2025-11-28
AI Technical Summary
There is an unmet medical need for effective treatment options for immune-excluded cancers, where cancer immune exclusion leads to a spatial imbalance of immune cells, making tumors inaccessible to immune therapies.
Administering a humanized monoclonal antibody targeting DDR1 (9H-1) in combination with immune checkpoint inhibitors, such as PD-1 or PD-L1 antagonists, to disrupt tumor stroma and enhance immune cell infiltration, thereby reducing tumor burden and immune rejection.
The combination therapy demonstrates robust antitumor efficacy, improving treatment outcomes for immune-negative cancers by enhancing immune cell infiltration and reducing tumor size.
Smart Images

Figure 2025538431000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 383,954, filed November 16, 2022, and U.S. Provisional Application No. 63 / 519,935, filed August 16, 2023. The contents of each of these related applications are incorporated herein by reference in their entirety.
[0002] Sequence Listing Reference This application is filed with an electronic Sequence Listing, which is provided as a file entitled INCEN011WOseqlist.xml, created on November 15, 2023, and is 16,422 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0003] Field The present disclosure relates to methods of treating discoidin domain receptor tyrosine kinase 1 (DDR1)-associated disorders by administering an anti-DDR1 antibody in combination with an immune checkpoint inhibitor. [Background technology]
[0004] background Cancer immune exclusion, a cancer phenotype characterized by a spatial imbalance of more immunological cells in tumor proximity but fewer immune cells in physical contact with tumor cells, is common in a high percentage of tumors. Modifying immune-excluded tumors to make them immune-accessible is an active area of oncology exploration.
[0005] Therefore, there remains an unmet medical need for treatment options for immune-excluded cancers. Summary of the Invention [Means for solving the problem]
[0006] Abstract Discoidin domain receptor tyrosine kinase 1 (DDR1) is a receptor tyrosine kinase widely expressed in normal and transformed epithelial cells and activated by various collagens. DDR1 autophosphorylation is induced by all collagens (types I to VI) tested to date. DDR1 is predominantly expressed in normal epithelial cells and aberrantly overexpressed in various human cancers. Its expression is associated with tumor progression, including breast, lung, ovarian, liver, gastric, and glioma cancers. Elevated DDR1 signatures are associated with immunologically cold tumors and reduced response to immune checkpoint inhibitor therapy in non-small cell lung cancer.
[0007] 9H-1 is a first-in-class humanized monoclonal antibody targeting human DDR1, designed to disrupt tumor stroma, allowing the subject's own immune cells to infiltrate and destroy the tumor. Robust single-agent activity has been observed across multiple preclinical tumor models. Thus, 9H-1 may provide an effective treatment for cancer, particularly immune-negative cancers. Furthermore, the use of 9H-1 in combination with immune checkpoint inhibitors may lead to further improved antitumor efficacy over either monotherapy alone.
[0008]
[0003] Embodiments of the present disclosure relate to methods of reducing immune clearance of tumors and / or reducing tumor burden in a subject in need thereof using antibodies that specifically bind to human discoidin domain receptor tyrosine kinase 1 (DDR1) and immune checkpoint inhibitors. Embodiments of specific dosing regimens for administering antibodies that specifically bind to human DDR1 are also provided herein.
[0009] The following numbered embodiments are provided herein: 1. A method for reducing tumor immune rejection in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg. 2. A method for reducing tumor burden in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg. 3. The method of embodiment 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg. 4. The method of embodiment 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg. 5. The method of any one of embodiments 1 to 4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg, or about 1600 mg. 6. The method of any one of embodiments 1 to 5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg, or 1600 mg. 7. The method of any one of embodiments 1 to 6, wherein the anti-DDR1 antibody is administered intravenously. 8. The method of any one of embodiments 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 60 minutes. 9. The method of any one of embodiments 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 30 minutes. 10. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered once weekly. 11. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered once every two weeks. 12. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered once every three weeks. 13. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered once every four weeks. 14. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered once every 8 weeks. 15. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 8 mg once every three weeks. 16. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 24 mg once every three weeks. 17. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 80 mg once every three weeks. 18. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 240 mg once every three weeks. 19. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 400 mg once every three weeks. 20. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 800 mg once every three weeks. 21. The method of any one of embodiments 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 1600 mg once every three weeks. 22. The method of any one of embodiments 1 to 21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist. 23. The method of any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg. 24. The method of any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg, or 1680 mg. 25. The method of any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg. 26. The method of any one of embodiments 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg. 27. The method of any one of embodiments 1 to 26, wherein the PD-1 or PD-L1 antagonist is administered intravenously. 28. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once weekly. 29. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every two weeks. 30. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every three weeks. 31. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every four weeks. 32. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every six weeks. 33. The method of any one of embodiments 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every 8 weeks. 34. The method of any one of the preceding embodiments, wherein the subject has cancer. 35. The method of embodiment 34, wherein said administering said anti-DDR1 antibody and said PD-1 or PD-L1 antagonist treats said cancer in said subject. 36. The method of embodiment 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1. 37. The method of embodiment 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1. 38. The method of embodiment 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostallimab, cemiplimab, sintilimab, penprimab, tislelizumab, toripalimab, or retifanlimab. 39. The method of embodiment 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab, or durvalumab. 40. The method of any one of embodiments 1 to 36, wherein the PD-1 antagonist is pembrolizumab. 41. The method of embodiment 40, wherein pembrolizumab is administered at a dose of 400 mg once every 6 weeks. 42. The method of embodiment 40, wherein pembrolizumab is administered at a dose of 200 mg once every three weeks. 43. The method of embodiment 40, wherein pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks. 44. The method of any one of embodiments 1 to 36, wherein the PD-1 antagonist is nivolumab. 45. The method of embodiment 44, wherein nivolumab is administered at a dose of 240 mg once every two weeks. 46. The method of embodiment 44, wherein nivolumab is administered at a dose of 360 mg once every three weeks. 47. The method of embodiment 44, wherein nivolumab is administered at a dose of 480 mg once every 4 weeks. 48. The method of embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg once every two weeks. 49. The method of embodiment 44, wherein nivolumab is administered at a dose of 3 mg / kg once every three weeks. 50. The method of any one of embodiments 1 to 36, wherein the PD-1 antagonist is cemiplimab. 51. The method of embodiment 50, wherein cemiplimab is administered at a dose of 350 mg once every three weeks. 52. The method of any one of embodiments 1 to 36, wherein the PD-1 antagonist is dostarlimab. 53. The method of embodiment 52, wherein dostarlimab is administered at a dose of 500 mg once every three weeks. 54. The method of embodiment 52, wherein dostarlimab is administered at a dose of 1000 mg once every 6 weeks. 55. The method of any one of embodiments 1 to 35, or 37, wherein the PD-L1 antagonist is atezolizumab. 56. The method of embodiment 55, wherein atezolizumab is administered at a dose of 840 mg once every two weeks. 57. The method of embodiment 55, wherein atezolizumab is administered at a dose of 1200 mg once every three weeks. 58. The method of embodiment 55, wherein atezolizumab is administered at a dose of 1680 mg once every 4 weeks. 59. The method of any one of embodiments 1 to 35, or 37, wherein the PD-L1 antagonist is durvalumab. 60. The method of embodiment 59, wherein durvalumab is administered at a dose of 10 mg / kg once every two weeks. 61. The method of embodiment 59, wherein durvalumab is administered at a dose of 20 mg / kg once every 3 weeks. 62. The method of embodiment 59, wherein durvalumab is administered at a dose of 1500 mg once every three weeks. 63. The method of any one of the preceding embodiments, wherein the cancer expresses DDR1. 64. The method of any one of the preceding embodiments, wherein the cancer is a solid cancer. 65. The method of any one of the preceding embodiments, wherein the cancer is a locally advanced or metastatic solid cancer. 66. The method of any one of the preceding embodiments, wherein the cancer is unresectable. 67. The method of any one of the preceding embodiments, wherein the cancer is refractory to immunotherapy. 68. The method of embodiment 67, wherein said immunotherapy is an antagonistic anti-PD-1 antibody, an antagonistic anti-PD-L1 antibody, an antagonistic anti-PD-1 / PD-L1 antibody, an antagonistic anti-PD-L2 antibody, an antagonistic anti-CTLA-4 antibody, an antagonistic anti-BTLA antibody, an antagonistic anti-TREMR antibody, an antagonistic anti-TIGIT antibody, an antagonistic anti-VISTA antibody, an antagonistic anti-TIM-3 antibody, an antagonistic anti-LAG-3 antibody, an antagonistic anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, and an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody. 69. The method of embodiment 67, wherein the immunotherapy is an antagonist anti-PD-L1 antibody. 70. The method of any one of the preceding embodiments, wherein the cancer is not a sarcoma, hepatocellular carcinoma, or glioma. 71. The method of any one of the preceding embodiments, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, or bone cancer. 72. The method of any one of the preceding embodiments, wherein the cancer is colorectal cancer, ovarian cancer, or non-small cell lung cancer. 73. The method of any one of the preceding embodiments, wherein the subject is not a candidate for standard of care treatment. 74. The method of any one of the preceding embodiments, wherein the cancer is refractory to standard therapeutic treatment. 75. The method of embodiment 74, wherein the standard of care treatment is chemotherapy or radiation. 76. The method of any one of embodiments 1 to 75, wherein administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces tumor size in the subject. 77. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have confirmed metastatic or progressive unresectable cancer with measurable disease by Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) have pathologically proven advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit or for which standard treatments are not available; c) have an Eastern Cooperative Oncology Group performance status (PS) of 0–1; d) have a predicted life expectancy of ≥ 3 months; e) Below: i) Calculated creatinine clearance (CrCL) ≥ 50 mL / min according to the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 10 9 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 10 9 cells / L having one or more of the following; f) have a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia formula); and / or g) not receiving other cancer therapy; 10. The method of any one of the preceding embodiments. 78. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have not received prior treatment with a systemic agent, including a radioimmunoconjugate, antibody-drug conjugate, immune / cytokine, or monoclonal antibody, within 28 days or 5 half-lives of the drug, whichever is shorter; b) no ongoing toxicity from prior therapy; c) No major surgery was performed within 3 months prior to administration of the anti-DDR1 antibody; d) No radiation therapy was received within 28 days prior to administration of the anti-DDR1 antibody; e) not undergoing organ transplantation, allogeneic stem cell transplantation, or autologous stem cell transplantation; f) no diagnosis of primary or acquired immunodeficiency; g) has not been treated with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the anti-DDR1 antibody; h) no active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiation; i) no active autoimmune disease requiring immunosuppressive therapy or a history of such disease; j) no clinical signs of CNS metastases within 28 days prior to administration of the anti-DDR1 antibody; and / or k) No leptomeningeal carcinomatosis 10. The method of any one of the preceding embodiments. 79. The method of any one of the preceding embodiments, wherein the anti-DDR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequences of CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in SEQ ID NO: 7, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO: 8 or 9, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences. 80. (a) The VH is each: SEQ ID NO: 1, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 2, or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 3, or a variant thereof containing 1-5 amino acid changes and / or comprising the amino acid sequences of CDRH1, CDRH2, and CDRH3 of (b) each of the VL's is: SEQ ID NO: 4, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 5, or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 6, or a variant thereof containing 1 to 5 amino acid changes comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of 80. The method of embodiment 79. 81. The method described in embodiment 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 shown in SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively. 82. The method of any one of embodiments 79 to 81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises a VH comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 7; and / or a VL comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 8 or 9. 83. The method described in embodiment 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO: 7 and a VL comprising the amino acid sequence set forth in SEQ ID NO: 8. 84. The method described in embodiment 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO: 7 and a VL comprising the amino acid sequence set forth in SEQ ID NO: 9. 85. The method of any one of embodiments 79 to 84, wherein the anti-DDR1 antibody comprises a heavy chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 10 or 11, and / or a light chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 12. 86. The method of any one of the preceding embodiments, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 87. A method described in any one of embodiments 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10 without a terminal lysine, and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 88. A method described in any one of embodiments 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 11 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 89. A method described in any one of embodiments 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 11 without a terminal lysine, and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 90. The method of any one of the preceding embodiments, wherein the anti-DDR1 is administered to the subject before the PD-1 or PD-L1 antagonist. 91. The method of any one of the preceding embodiments, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist. 92. The method of any one of the preceding embodiments, wherein the anti-DDR1 antibody is administered to the subject simultaneously with the PD-1 or PD-L1 antagonist. 93. The method of any one of the preceding embodiments, wherein administration of the antibody and the immune checkpoint inhibitor prevents further growth in tumor size in the subject. 94. The method of any one of the preceding embodiments, wherein administration of the antibody and the immune checkpoint inhibitor achieves at least stable disease in the subject. 95. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments. 96. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the manufacture of a medicament for the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments. 97. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments. 98. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist. 99. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding embodiments. [Brief explanation of the drawings]
[0010] [Figure 1] FIG. 1 is a bar graph of one embodiment showing the binding of 9H-1 to cells at various concentrations in a flow cytometry assay.
[0011] [Figure 2] FIG. 2 is a graph of one embodiment showing tumor volume in mice treated with 9H-1, 9H-1-LALAPG, or IgG control.
[0012] [Figure 3AB]Figures 3A-D are graphs of one embodiment showing the concentrations of 9H-1 in individual cynomolgus monkeys in all dose groups (Figure 3A), the low dose group alone (Figure 3B), the intermediate dose group (Figure 3C), and the high dose group alone (Figure 3D). [Figure 3CD] Figures 3A-D are graphs of one embodiment showing the concentrations of 9H-1 in individual cynomolgus monkeys in all dose groups (Figure 3A), the low dose group alone (Figure 3B), the intermediate dose group (Figure 3C), and the high dose group alone (Figure 3D).
[0013] [Figure 4] FIG. 4 is a graph of one embodiment showing simulated 9H-1 concentrations at two-week dosing intervals.
[0014] [Figure 5] FIG. 5 is a graph of one embodiment showing simulated 9H-1 concentrations at three-week dosing intervals.
[0015] [Figure 6] 6 is a graph of an embodiment showing the number of CD3+ T cells as a percentage of the total number of cells in the margins and cores of solid tumors in a mouse tumor model. Mice were treated with vehicle (control), the rabbit monoclonal antibody version of 9H-1 (αDDR1), pembrolizumab (αPD-1), or a combination of the rabbit monoclonal antibody version of 9H-1 and pembrolizumab (Combo).
[0016] [Figure 7] 7A-7B show the number of GZMB+ (left) and IFNγ+ (right) cells as a percentage of total CD8+ T cells (FIG. 7A) and tumor volume over time (FIG. 7B) in a mouse solid tumor model according to some non-limiting embodiments. Mice were treated with vehicle (control), a rabbit monoclonal antibody version of 9H-1 (αDDR1), a mouse anti-PD-1 antibody (αPD-1), or a combination of the rabbit monoclonal antibody version of 9H-1 and a mouse anti-PD-1 antibody (Combo).
[0017] [Figure 8] FIG. 8 shows a schematic model of the proposed mechanism by which anti-DDR1 enhances the anti-tumor effects of immune checkpoint inhibitors, according to some non-limiting embodiments.
[0018] [Figure 9] Figures 9A-9D are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figures 9A and 9B), mean tumor volume (mm3) (Figure 9C), and survival probability (Figure 9D) over time in B16F10 DDR1- / - tumors in C57BL / 6 mice over a 23-day period post-inoculation.
[0019] [Figure 10] Figures 10A-10C are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 10A); mean tumor volume (mm3) (Figure 10B); and body weight (g) (Figure 10C) in LLC1 DDR1- / - tumors in C57BL / 6 mice over 26 days post-inoculation.
[0020] [Figure 11] 11A-11C are graphs of one embodiment showing the change in individual tumor volume (mm) (FIG. 11A); mean tumor volume (mm) (FIG. 11B); and body weight (g) (FIG. 11C) in E0771 DDR− / − tumors in C57BL / 6 mice over 31 days post-inoculation.
[0021] [Figure 12] Figures 12A-12C are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 12A); mean tumor volume (mm3) (Figure 12B); and body weight (g) (Figure 12C) in RENCA DDR1- / - tumors in Balb / c mice over 31 days post-inoculation.
[0022] [Figure 13]Figures 13A-13D are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 13A); mean tumor volume (mm3) (Figure 13B); body weight (g) (Figure 13C); and mean body weight (g) (Figure 13D) in 4T1 DDR1- / - tumors in Balb / c mice over 38 days post-inoculation.
[0023] [Figure 14] Figures 14A-14C are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 14A); mean tumor volume (mm3) (Figure 14B); and mean body weight (g) (Figure 14C) in EMT6 DDR1- / - tumors in Balb / c mice over 31 days post-inoculation.
[0024] [Figure 15] Figures 15A-15D are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 15A); mean tumor volume (mm3) (Figure 15B); tumor volume (mm3) (Figure 15C); and mean body weight (g) (Figure 15D) in CT26 DDR1- / - tumors in Balb / c mice over 38 days post-inoculation.
[0025] [Figure 16] Figures 16A-16D are graphs of one embodiment showing the change in individual tumor volume (mm3) (Figure 16A); mean tumor volume (mm3) (Figure 16B); mean body weight (g) (Figure 16C); and survival probability (Figure 16D) in MBT-2 DDR1- / - tumors in C3H / HeN mice over 11 days post-inoculation.
[0026] [Figure 17] FIG. 17 shows an embodiment study design for tumor kinetic studies using CT26 (wild-type (WT) and knockout (KO)) cell lines in BALB / c mice.
[0027] [Figure 18]Figures 18A-18B are graphs of one embodiment showing the change in tumor volume (mm3) (Figure 18A) and the change in body weight % (Figure 18B) in CT26 DDR1 WT+CT26 DDR1 KO (n=10) over 42 days post-inoculation.
[0028] [Figure 19] 19A-19B are graphs of one embodiment showing the change in individual tumor volume (mm 3 ) of the CT26 WT cell line (FIG. 19A) and the CT26 KO cell line (FIG. 19B) over 42 days post-inoculation.
[0029] [Figure 20] Figures 20A-20C show flow cytometry analysis plots of the CT26 parental line using an isotype antibody control (Figure 20A) and using an anti-DDR1 antibody (Figure 20B); and flow cytometry analysis plots of an embodiment of the CT26 DDR1r line using an anti-DDR1 antibody post flow sorting (20C). DETAILED DESCRIPTION OF THE INVENTION
[0030] Detailed Description Embodiments of the present disclosure relate to methods of treating cancer with an antibody that specifically binds discoidin domain receptor tyrosine kinase 1 (DDR1), including human DDR1 (i.e., "specifically binds human DDR1"), and an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a PD-1 antagonist or a PD-L1 antagonist. In some embodiments, the immune checkpoint inhibitor comprises a PVRIG antagonist. In some embodiments, the PVRIG antagonist is an anti-PVRIG antibody that specifically binds human PVRIG. Also provided herein are specific dosing regimens for administering antibodies that specifically bind human DDR1, as well as dosing regimens for combination therapies comprising a PD-1 antagonist and a PD-L1 antagonist. In some embodiments, the dosing regimens provided in the present disclosure provide consistent serum exposure in human subjects with an anti-DDR1 antibody that exceeds that required to inhibit DDR1 function, thereby enhancing the therapeutic effect of a co-administered immune checkpoint inhibitor.
[0031] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs when read in light of the present disclosure. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any claimed subject matter.
[0032] As used herein, the terms "antibody" have their plain and ordinary meaning as understood in light of the present specification, and unless otherwise specified, include full length antibodies, antigen-binding fragments of full length antibodies, and molecules comprising antibody CDRs, VH regions and / or VL regions. Examples of antibodies include, but are not limited to, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intrabodies, heteroconjugate antibodies, antibody-drug conjugates, single domain antibodies, monovalent antibodies, single-chain antibodies or single-chain Fvs (scFvs), camelized antibodies, affibodies, Fab fragments, F(ab')2 fragments, disulfide-linked Fvs (sdFvs), anti-idiotypic (anti-Id) antibodies (including, for example, anti-anti-Id antibodies), and antigen-binding fragments of any of the above. In certain embodiments, antibodies as described herein refer to polyclonal antibody populations. An antibody can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 or IgA2), or any subclass (e.g., IgG2a or IgG2b) of immunoglobulin molecule. In certain embodiments, the antibodies described herein are IgG antibodies, or a class (e.g., human IgG1 or IgG4) or subclass thereof. In one embodiment, the antibody is a humanized monoclonal antibody. In one embodiment, the antibody is a human monoclonal antibody.
[0033] As used herein, the term "CDR" or "complementarity-determining region" has its simple and ordinary meaning as understood in light of the present specification, and unless otherwise specified, refers to the discontinuous antigen-binding sites found in the variable regions of heavy and light chain polypeptides. These specific regions are described, for example, by Kabat et al., J. Biol. Chem. 252, 6609-6616 (1977) and Kabat et al., "Sequences of Proteins of Immunological Interest." (1991), Chothia et al., J. Mol. Biol. 196:901-917 (1987), and MacCallum et al., J. Mol. Biol. 262:732-745 (1996), all of which are incorporated herein by reference in their entirety, where the definitions include overlapping amino acid residues or subsets when compared with each other (see Table 1 below). In certain embodiments, the term "CDR" refers to the CDR defined by MacCallum et al., J. Mol. Biol. 262:732-745 (1996) and Martin A., "Protein Sequence and Structure Analysis of Antibody Variable Domains," in Antibody Engineering, Kontermann and Dubel, eds., Chapter 31, pp. 422-439, Springer-Verlag, Berlin (2001). In certain embodiments, the term "CDR" refers to the CDR defined by Kabat et al., J. Biol. Chem. 252, 6609-6616 (1977) and Kabat et al., "Sequences of Proteins of Immunological Interest." (1991). In certain embodiments, the heavy chain CDRs and light chain CDRs of an antibody are defined using different rules. In certain embodiments, the heavy chain and / or light chain CDRs are defined by performing a structural analysis of the antibody and identifying residues in the variable regions that are predicted to contact the epitope region of the target molecule (e.g., human DDR1).CDRH1, CDRH2, and CDRH3 represent the heavy chain CDRs, and CDRL1, CDRL2, and CDRL3 represent the light chain CDRs. [Table 1]
[0034] As used herein, the terms "variable region" and "variable domain" have their simple and ordinary meanings as understood in light of this specification, are used interchangeably, and are common in the art unless otherwise specified. A variable region typically refers to a portion of an antibody, generally a portion of either the light or heavy chain, typically the amino-terminal 110-120 or 110-125 amino acids in mature heavy chains and approximately 90-115 amino acids in mature light chains, which vary significantly in sequence between antibodies and are used in the binding and specificity of a particular antibody for its specific antigen. Sequence variability is concentrated in regions called complementarity-determining regions (CDRs), while the more highly conserved regions of a variable region are called framework regions (FRs). While not wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with its antigen. In certain embodiments, the variable region is a human variable region. In certain embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In one embodiment, the variable region is a primate (e.g., non-human primate) variable region. In one embodiment, the variable region comprises rodent or mouse CDRs and primate (e.g., non-human primate) framework regions (FRs).
[0035] As used herein, the terms "VH" and "VL" have their plain and ordinary meaning as understood in light of the present specification, and unless otherwise specified, refer to antibody heavy and light chain variable regions, respectively, as described in Kabat et al., (1991) "Sequences of Proteins of Immunological Interest," which is incorporated herein by reference in its entirety.
[0036] As used herein, the term "constant region" has its plain and ordinary meaning as understood in light of this specification and as is common in the art unless otherwise specified. The constant region is that portion of an antibody, e.g., the carboxyl-terminal portions of the light and / or heavy chains, that is not directly involved in binding an antibody to an antigen but can exhibit various effector functions, such as interaction with Fc receptors (e.g., Fc gamma receptors).
[0037] As used herein, the term "heavy chain" has its plain and ordinary meaning as understood in light of the present specification and, unless otherwise specified, when used in reference to antibodies can refer to any of the different types, e.g., alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (μ), based on the amino acid sequence of the constant region, which give rise to antibodies of the IgA, IgD, IgE, IgG, and IgM classes, respectively, including subclasses of IgG, e.g., IgG1, IgG2, IgG3, and IgG4.
[0038] As used herein, the term "light chain" has its plain and ordinary meaning as understood in light of this specification, and unless otherwise specified, when used in reference to an antibody can refer to any of the different types, e.g., kappa (κ) or lambda (λ), based on the amino acid sequence of the constant region. Light chain amino acid sequences are well known in the art. In one embodiment, the light chain is a human light chain.
[0039] As used herein, the terms "specifically bind," "specifically recognize," "immunospecifically bind," and "immunospecifically recognize" have their plain and ordinary meaning as understood in light of this specification, and, unless otherwise specified, are analogous terms in the context of antibodies, and refer to molecules that bind to an antigen (e.g., an epitope or immune complex) as such binding is understood by those skilled in the art. For example, a molecule that specifically binds to an antigen may generally bind to other peptides or polypeptides with lower affinity, as determined, for example, by immunoassay, BIAcore®, KinExA 3000 instrument (Sapidyne Instruments, Boise, Idaho), or other assays known in the art. In one embodiment, a molecule that specifically binds to an antigen binds to the antigen with a K A of at least 2 logs (e.g., a factor of 10), 2.5 logs, 3 logs, 4 logs, or more than the K A when the molecule nonspecifically binds to another antigen. Unless otherwise specified, an antibody or fragment thereof designated as "specifically binding" to an antigen, when the antigen is identified as being from a particular species (e.g., human), may bind to the same antigen in another species with the same or similar affinity. For example, an antibody or fragment thereof that "specifically binds to human DDR1" may bind to mouse DDR1 with similar affinity.
[0040] As used herein, the term "EU numbering system" has its plain and ordinary meaning as understood in light of the present specification, and unless otherwise specified, refers to the EU numbering convention for constant regions of antibodies as described in Edelman GM et al., Proc. Natl. Acad. USA, 63, 78-85 (1969) and Kabat et al., "Sequences of Proteins of Immunological Interest," 1991, each of which is incorporated herein by reference in its entirety.
[0041] As used herein, the term "subject" includes any human or non-human animal. In some embodiments, the subject is a human. In some embodiments, "subject" and "patient" are used interchangeably.
[0042] As used herein, the term "cancer" has its simple and ordinary meaning as understood in light of this specification, and unless otherwise specified, refers to any condition characterized by the uncontrolled division of abnormal cells in the body. For example, mutations may occur in cells that prevent cell division from being regulated, leading to the formation of one or more tumors. Cancer may be benign, pre-malignant, or malignant. Cancers arise in a variety of cells and tissues, including, but not limited to, the oral cavity (e.g., mouth, tongue, pharynx, etc.), digestive system (e.g., esophagus, stomach, small intestine, colon, rectum, liver, bile duct, gallbladder, pancreas, etc.), respiratory system (e.g., larynx, lungs, bronchi, etc.), bones, joints, skin (e.g., basal cell, squamous cell, meningioma, etc.), breast, reproductive system (e.g., uterus, ovaries, prostate, testes, etc.), urinary system (e.g., bladder, kidneys, ureters, etc.), eyes, nervous system (e.g., brain, etc.), endocrine system (e.g., thyroid, etc.), soft tissue (e.g., muscle, fat, etc.), and hematopoietic system (e.g., lymphoma, myeloma, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, etc.).
[0043] As used herein, the term "solid cancer" has its plain and ordinary meaning as understood in light of this specification and, unless otherwise specified, refers to a cancer that results in a malignant solid tumor. Solid tumors include sarcomas and carcinomas. Hematologic cancers typically do not form solid tumors.
[0044] As used herein, the term "unresectable" has its plain and ordinary meaning as understood in light of this specification and refers to a tumor that cannot be treated by surgical removal, unless otherwise specified.
[0045] As used herein, the term "locally advanced" has its plain and ordinary meaning as understood in light of this specification and, unless otherwise specified, refers to a cancer that has high vascular involvement and / or has grown outside the body part or organ in which it started, but has not yet metastasized.
[0046] As used herein, the term "refractory" has its plain and ordinary meaning as understood in light of this specification and refers to a cancer that does not respond to treatment, unless otherwise specified.
[0047] As used herein, the terms "treat," "treating," and "treatment" have their plain and ordinary meaning as understood in light of the present specification and, unless otherwise specified, refer to therapeutic or prophylactic measures described herein. A method of "treatment" employs administration of an antibody to a subject with cancer to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of cancer or recurrent cancer, or to prolong the subject's survival longer than would be expected in the absence of such treatment. In some embodiments, "treatment" includes achieving a complete response, a partial response, or stable disease. In some embodiments, "treatment" includes achieving at least stable disease.
[0048] As used herein, the term "effective amount" has its plain and ordinary meaning as understood in light of this specification, and unless otherwise specified, refers to the amount of therapy that achieves a desired prophylactic or therapeutic effect in the context of administration of the therapy to a subject.
[0049] As used herein, the term "about" when referring to a measurable value, such as a dosage, encompasses a ±5% variation of the given value or range.
[0050] The term "isolated," as used herein with respect to antibodies, has its plain and ordinary meaning as understood in light of the present specification and, unless otherwise specified, refers to an antibody that has been separated from one or more contaminants (e.g., polypeptides, polynucleotides, lipids, host cells, or carbohydrates, etc.) that are present in the natural source of the antibody. All examples of "antibodies" described herein are further contemplated as antibodies that have been isolated, but need not be isolated.
[0051] The determination of "percent identity" between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be achieved using a mathematical algorithm.A non-limiting example of a mathematical algorithm used to compare two sequences is the algorithm of Karlin S&Altschul SF (1990) PNAS 87:2264-2268, which has been modified as in Karlin S&Altschul SF (1993) PNAS 90:5873-5877, each of which is incorporated herein by reference in its entirety.Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul SF et al. (1990) J Mol Biol 215:403, which is incorporated herein by reference in its entirety.BLAST nucleotide searches can be performed, for example, using the NBLAST nucleotide program parameters set at score=100 and word length=12 to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. BLAST protein searches can be performed using XBLAST program parameters set to, for example, score 50 and word length = 3 to obtain amino acid sequences homologous to the protein molecules described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul SF et al. (1997) Nuc Acids Res 25:3389-3402, which is incorporated herein by reference in its entirety. Alternatively, PSI-BLAST can be used to perform an iterated search to detect distant relationships between molecules (Id.). When using BLAST, Gapped BLAST, and PSI Blast programs, the default parameters of each program (e.g., XBLAST and NBLAST) can be used (see, for example, the National Center for Biotechnology Information (NCBI) on the World Wide Web at ncbi.nlm.nih.gov).Another non-limiting example of a mathematical algorithm utilized for comparing sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17, which is incorporated herein by reference in its entirety. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
[0052] The percent identity between two sequences can be determined by using the same technique as above, whether or not gap is allowed.In calculating percent identity, typically, only exact match is counted.In some embodiments, percent identity is calculated by only using exact match without introducing gap.
[0053] As used herein, the term "amino acid change" has its plain and ordinary meaning as understood in light of this specification and, unless otherwise specified, refers to the substitution or insertion of an amino acid at a position within an amino acid sequence.
[0054] Anti-DDR1 antibody In one aspect, any antibody that specifically binds to DDR1 (ie, an anti-DDR1 antibody) is useful in the methods and uses provided herein.
[0055] In one embodiment, the amino acid sequences of the CDRs, VH / VL, and heavy and light chain sequences of exemplary antibodies that specifically bind to DDR1 are shown in Table 2, Table 3, and Table 4, respectively. [Table 2] [Table 3] [Table 4]
[0056] In one embodiment, the antibody comprises a heavy chain variable region (VH) comprising the amino acid sequences of CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in SEQ ID NO: 7, or a variant thereof comprising one to five amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO: 8 or 9, or a variant thereof comprising one to five amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.
[0057] In one embodiment, (a) VH comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 of SEQ ID NO: 1 or a variant thereof comprising 1 to 5 amino acid changes, SEQ ID NO: 2 or a variant thereof comprising 1 to 3 amino acid changes, and SEQ ID NO: 3 or a variant thereof comprising 1 to 5 amino acid changes, respectively; and / or (b) VL comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of SEQ ID NO: 4 or a variant thereof comprising 1 to 5 amino acid changes, SEQ ID NO: 5 or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 6 or a variant thereof comprising 1 to 5 amino acid changes, respectively.
[0058] In one embodiment, (a) VH comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 of SEQ ID NO: 1 or a variant thereof containing one or two amino acid changes, SEQ ID NO: 2 or a variant thereof containing one or two amino acid changes, and SEQ ID NO: 3 or a variant thereof containing one or two amino acid changes; and / or (b) VL comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of SEQ ID NO: 4 or a variant thereof containing one or two amino acid changes, SEQ ID NO: 5 or a variant thereof containing one or two amino acid changes, and SEQ ID NO: 6 or a variant thereof containing one or two amino acid changes, respectively.
[0059] In one embodiment, (a) VH comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 of SEQ ID NO: 1, or a variant thereof comprising one amino acid change, SEQ ID NO: 2, or a variant thereof comprising one amino acid change, and SEQ ID NO: 3, or a variant thereof comprising one amino acid change; and / or (b) VL comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of SEQ ID NO: 4, or a variant thereof comprising one amino acid change, SEQ ID NO: 5, or a variant thereof comprising one amino acid change, and SEQ ID NO: 6, or a variant thereof comprising one amino acid change, respectively.
[0060] In one embodiment, the antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 set forth in SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively.
[0061] In one embodiment, the antibody comprises a VH comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 7; and / or a VL comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 8 or 9.
[0062] In one embodiment, the antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO: 7 and a VL comprising the amino acid sequence set forth in SEQ ID NO: 8. In one embodiment, the amino acid sequence of the VH consists of the amino acid sequence set forth in SEQ ID NO: 7 and the amino acid sequence of the VL consists of the amino acid sequence set forth in SEQ ID NO: 8.
[0063] In one embodiment, the antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO: 7 and a VL comprising the amino acid sequence set forth in SEQ ID NO: 9. In one embodiment, the amino acid sequence of the VH consists of the amino acid sequence set forth in SEQ ID NO: 7 and the amino acid sequence of the VL consists of the amino acid sequence set forth in SEQ ID NO: 9.
[0064] In one embodiment, the antibody comprises a heavy chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 10 or 11; and / or a light chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 12.
[0065] In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 10 without the terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence set forth in SEQ ID NO: 12. In one embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence set forth in SEQ ID NO: 10 and the amino acid sequence of the light chain consists of the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the amino acid sequence of the heavy chain consists of the amino acid sequence set forth in SEQ ID NO: 10 without the terminal lysine, and the amino acid sequence of the light chain consists of the amino acid sequence set forth in SEQ ID NO: 12.
[0066] In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:11 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:12. In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO:11 without the terminal lysine, and a light chain comprising the amino acid sequence set forth in SEQ ID NO:12. In one embodiment, the amino acid sequence of the heavy chain consists of the amino acid sequence set forth in SEQ ID NO:11 and the amino acid sequence of the light chain consists of the amino acid sequence set forth in SEQ ID NO:12, referred to herein as antibody "9H-1." In some embodiments, the heavy chain of 9H-1 does not comprise the terminal lysine of SEQ ID NO:11.
[0067] In some embodiments, the antibody is 9H-1 (PRTH-101) provided by Incendia Therapeutics, Inc. (Boston, Massachusetts).
[0068] Also provided herein are compositions (e.g., pharmaceutical compositions) comprising at least one anti-DDR1 antibody of the present disclosure. The compositions can include an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1) and a pharmaceutically acceptable carrier. Any suitable, useful pharmaceutically acceptable carrier can be used. Remington's Pharmaceutical Sciences, by E.W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the immunogens disclosed herein. Generally, the nature of the carrier will depend on the particular mode of administration employed. For example, parenteral formulations can include injectable fluids containing pharmaceutically and physiologically acceptable fluids as excipients, such as water, physiological saline, balanced salt solution, aqueous dextrose, glycerol, or the like. In addition to biologically neutral carriers, the pharmaceutical compositions to be administered can contain minor amounts of nontoxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, e.g., sodium acetate or sorbitan monolaurate.
[0069] The compositions of the present disclosure can take the form of solutions, suspensions, emulsions, and the like. Examples of suitable pharmaceuticals are described in "Remington's Pharmaceutical Sciences." Such compositions can contain a prophylactically or therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier to provide the form for proper administration to a patient. The formulation can be adapted for administration by a mode of administration that can be oral, intravenous, intraarterial, buccal, intranasal, nebulized, bronchial inhalation, or delivered by mechanical ventilation.
[0070] The antibodies of the present disclosure can be formulated for parenteral administration, as described herein, for example, for injection via intradermal, intravenous, intramuscular, subcutaneous, intratumoral, or intraperitoneal routes. Alternatively, the antibodies can be administered by topical routes directly to mucous membranes, for example, by nasal drops, inhalation, or by nebulizer.
[0071] Generally, the components of the composition of the present disclosure can be supplied separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a sealed container such as an ampoule or sachet indicating the amount of active ingredient.When the composition is to be administered by injection, the composition can be dispensed in an infusion bottle containing sterile pharmaceutical-grade water or saline.When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the components can be mixed before administration.
[0072] Methods and Dosing Regimen The present disclosure relates to methods for reducing immune clearance of tumors and reducing tumor burden in subjects in need thereof using antibodies that specifically bind to human DDR1 (i.e., anti-DDR1 antibodies). Also provided herein are specific dosing regimens for administering anti-DDR1 antibodies that result in a reduction in tumor size and an increased response to immunotherapy in subjects with solid cancers, such as colorectal cancer, ovarian cancer, or non-small cell lung cancer.
[0073] In one aspect, provided herein is a method for reducing tumor immune rejection in a subject in need thereof, the method comprising administering to the subject between 5 mg and 2000 mg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).
[0074] In one aspect, a method of reducing tumor burden in a subject in need thereof is provided, the method comprising administering to the subject between 5 mg and 2000 mg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).
[0075] In one embodiment, the subject has cancer. In one embodiment, the antibody treats cancer in the subject.
[0076] In some embodiments, the antibody is administered once weekly at a dose of about 5 mg to about 2000 mg. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg. In some embodiments, the antibody is administered at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 210 mg, about 220 mg, about 230 mg, about 240 ... In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg.
[0077] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, In some embodiments, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg.
[0078] In certain embodiments, the antibody is administered intravenously or subcutaneously.
[0079] In some embodiments, the antibody is administered once weekly. In some embodiments, the antibody is administered no more frequently than once weekly. In some embodiments, the antibody is administered once every two weeks. In some embodiments, the antibody is administered no more frequently than once every two weeks. In some embodiments, the antibody is administered once every three weeks. In some embodiments, the antibody is administered no more frequently than once every three weeks. In some embodiments, the antibody is administered once every four weeks. In some embodiments, the antibody is administered no more frequently than once every four weeks. In some embodiments, the antibody is administered once every five weeks. In some embodiments, the antibody is administered no more frequently than once every five weeks. In some embodiments, the antibody is administered once every six weeks. In some embodiments, the antibody is administered no more frequently than once every six weeks. In some embodiments, the antibody is administered once every seven weeks. In some embodiments, the antibody is administered once every eight weeks. In some embodiments, the antibody is administered no more frequently than once every eight weeks.
[0080] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg. In some embodiments, the antibody is administered once weekly at a dose of about 8 mg to about 1600 mg. In some embodiments, the antibody is administered once weekly at a dose of about 8 mg to about 800 mg. In certain embodiments, the antibody is administered once weekly at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 215 mg, about 225 mg, about 230 mg, about 240 mg, about 250 mg, about 260 mg, about 270 mg, about 280 mg, about 290 mg, about 300 mg, about 310 mg, about 320 mg, about 330 mg, about 340 mg, about 350 mg, about 360 mg, about 370 mg, about 380 mg, about 390 mg, about 400 mg, about 450 mg, about 450 mg, about 450 mg, about 460 mg, about 470 mg, about 480 mg, about 490 mg, about 500 mg, about 510 mg, about 520 mg, about 530 mg, about 540 mg, about 550 mg, about 560 mg, about 570 mg, about 580 mg, about 590 mg, about 600 mg, about 610 mg, about 620 mg, about 630 mg, about 6 and administered at a dose of 90 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered once weekly at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg.
[0081] In some embodiments, the antibody is administered once weekly at a dose of 5 mg to 2000 mg. In some embodiments, the antibody is administered once weekly at a dose of 8 mg to 1600 mg. In some embodiments, the antibody is administered once weekly at a dose of 8 mg to 800 mg. In some embodiments, the antibody is administered once weekly at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 30 ... In one embodiment, the antibody is administered once weekly at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg, or 1600 mg.
[0082] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every two weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every two weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every two weeks. In one embodiment, the antibody is administered once every two weeks in a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered once every two weeks at a dose of 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg.
[0083] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every two weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every two weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every two weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In some embodiments, the antibody is administered at a dose of 0 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg. In some embodiments, the antibody is administered once every two weeks at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg, or 1600 mg.
[0084] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every three weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every three weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every three weeks. In one embodiment, the antibody is administered once every three weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every three weeks.
[0085] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every three weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every three weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every three weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In one embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg once every three weeks.
[0086] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every four weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every four weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every four weeks. In one embodiment, the antibody is administered once every four weeks in a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every four weeks.
[0087] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every four weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every four weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every four weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In some embodiments, the antibody is administered at a dose of 0 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg. In some embodiments, the antibody is administered once every four weeks at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 400 mg, 800 mg, or 1600 mg.
[0088] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every five weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every five weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every five weeks. In one embodiment, the antibody is administered at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, or The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every five weeks.
[0089] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every five weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every five weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every five weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In one embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg once every five weeks.
[0090] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every six weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every six weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every six weeks. In one embodiment, the antibody is administered once every six weeks in a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every six weeks.
[0091] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every six weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every six weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every six weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In one embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg once every six weeks.
[0092] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every seven weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every seven weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every seven weeks. In one embodiment, the antibody is administered once every seven weeks in a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every seven weeks.
[0093] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every seven weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every seven weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every seven weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg In one embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg once every seven weeks.
[0094] In some embodiments, the antibody is administered at a dose of about 5 mg to about 2000 mg once every eight weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 1600 mg once every eight weeks. In some embodiments, the antibody is administered at a dose of about 8 mg to about 800 mg once every eight weeks. In one embodiment, the antibody is administered once every 8 weeks at a dose of about 8 mg, about 9 mg, about 10 mg, about 15 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, The compound is administered in a dose of about 190 mg, about 200 mg, about 210 mg, about 220 mg, about 230 mg, about 240 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, about 600 mg, about 650 mg, about 700 mg, about 750 mg, about 800 mg, about 850 mg, about 900 mg, about 950 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, or about 1600 mg. In certain embodiments, the antibody is administered at a dose of about 8 mg, about 24 mg, about 25 mg, about 75 mg, about 80 mg, about 240 mg, about 250 mg, about 400 mg, about 800 mg, or about 1600 mg once every eight weeks.
[0095] In some embodiments, the antibody is administered at a dose of 5 mg to 2000 mg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 1600 mg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 8 mg to 800 mg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 8 mg, 9 mg, 10 mg, 15 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 900 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 7 In one embodiment, the antibody is administered at a dose of 8 mg, 24 mg, 25 mg, 75 mg, 80 mg, 240 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, or 1600 mg once every 8 weeks.
[0096] In some embodiments, the antibody is administered intravenously at a dose of 8 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 24 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 25 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 75 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 80 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 240 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 250 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 400 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 800 mg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 1600 mg once every three weeks.
[0097] In one embodiment, the antibody is administered intravenously. In one embodiment, the antibody is administered by intravenous infusion over 60 minutes. In one embodiment, the antibody is administered by intravenous infusion over 30 minutes. In some embodiments, the antibody is administered intratumorally.
[0098] In one embodiment, the dose is a therapeutically effective amount.
[0099] In some embodiments, the antibody is administered using a flat dose (eg, the amount of antibody administered is not based on the subject's weight).
[0100] In one aspect, provided herein is a method for reducing tumor immune rejection in a subject in need thereof, the method comprising administering to the subject 0.1 mg / kg to 100 mg / kg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).
[0101] In one aspect, provided herein is a method of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject 0.1 mg / kg to 100 mg / kg of an antibody that specifically binds to human discoidin domain receptor tyrosine kinase 1 (DDR1).
[0102] In one embodiment, the subject has cancer. In one embodiment, the antibody treats cancer in the subject.
[0103] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg. In certain embodiments, the antibody is administered at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered at a dose of about 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg.
[0104] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg.
[0105] In certain embodiments, the antibody is administered intravenously or subcutaneously, hi some embodiments, the antibody is administered intratumorally.
[0106] In some embodiments, the antibody is administered once weekly. In some embodiments, the antibody is administered no more frequently than once weekly. In some embodiments, the antibody is administered once every two weeks. In some embodiments, the antibody is administered no more frequently than once every two weeks. In some embodiments, the antibody is administered once every three weeks. In some embodiments, the antibody is administered no more frequently than once every three weeks. In some embodiments, the antibody is administered once every four weeks. In some embodiments, the antibody is administered no more frequently than once every four weeks. In some embodiments, the antibody is administered once every five weeks. In some embodiments, the antibody is administered no more frequently than once every five weeks. In some embodiments, the antibody is administered once every six weeks. In some embodiments, the antibody is administered no more frequently than once every six weeks. In some embodiments, the antibody is administered once every seven weeks. In some embodiments, the antibody is administered no more frequently than once every seven weeks. In some embodiments, the antibody is administered once every eight weeks. In some embodiments, the antibody is administered no more frequently than once every eight weeks.
[0107] In some embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg to about 100 mg / kg. In some embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg to about 50 mg / kg. In some embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg to about 25 mg / kg. In some embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg to about 20 mg / kg. In certain embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered once weekly at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg.
[0108] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once weekly. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once weekly. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once weekly. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once weekly. In one embodiment, the antibody is administered once weekly at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg. In certain embodiments, the antibody is administered once weekly at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg.
[0109] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every two weeks. In certain embodiments, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered once every two weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg.
[0110] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every two weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every two weeks. In one embodiment, the antibody is administered once every two weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg. In certain embodiments, the antibody is administered once every two weeks at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg.
[0111] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every three weeks. In certain embodiments, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered once every three weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg.
[0112] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every three weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every three weeks. In one embodiment, the antibody is administered once every three weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every three weeks.
[0113] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every four weeks. In certain embodiments, the antibody is administered once every four weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered once every four weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg.
[0114] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every four weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every four weeks. In one embodiment, the antibody is administered once every four weeks at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every four weeks.
[0115] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every five weeks. In certain embodiments, the antibody is administered once every five weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg once every five weeks.
[0116] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every five weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every five weeks. In one embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg once every five weeks. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every five weeks.
[0117] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every six weeks. In certain embodiments, the antibody is administered once every six weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered once every six weeks at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg.
[0118] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every six weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every six weeks. In one embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg once every six weeks. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every six weeks.
[0119] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every seven weeks. In certain embodiments, the antibody is administered once every seven weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg once every seven weeks.
[0120] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every seven weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every seven weeks. In one embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg once every seven weeks. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every seven weeks.
[0121] In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 100 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 50 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 25 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of about 0.1 mg / kg to about 20 mg / kg once every 8 weeks. In certain embodiments, the antibody is administered once every eight weeks at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.75 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 7.5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 55 mg / kg, about 60 mg / kg, about 65 mg / kg, about 70 mg / kg, about 75 mg / kg, about 80 mg / kg, about 85 mg / kg, about 90 mg / kg, about 95 mg / kg, or about 100 mg / kg. In certain embodiments, the antibody is administered at a dose of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 3 mg / kg, about 10 mg / kg, or about 20 mg / kg once every eight weeks.
[0122] In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 100 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 50 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 25 mg / kg once every 8 weeks. In some embodiments, the antibody is administered at a dose of 0.1 mg / kg to 20 mg / kg once every 8 weeks. In one embodiment, the antibody is administered at a dose of 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 7.5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 55 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, or 100 mg / kg once every 8 weeks. In certain embodiments, the antibody is administered at a dose of 0.1 mg / kg, 0.3 mg / kg, 1 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg once every eight weeks.
[0123] In some embodiments, the antibody is administered intravenously at a dose of 0.1 mg / kg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 0.3 mg / kg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 1 mg / kg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 3 mg / kg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 10 mg / kg once every three weeks. In some embodiments, the antibody is administered intravenously at a dose of 20 mg / kg once every three weeks.
[0124] In one embodiment, prior to administration of the antibody, the subject a) has metastatic or advanced, unresectable cancer with measurable disease by Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) has pathologically proven advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which no standard treatment is available; c) has an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) has a predicted life expectancy of ≥ 3 months; e) has one or more of the following: i) calculated creatinine clearance (CrCL) ≥ 50 mL / min by Cockcroft-Gault calculation; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 x ULN; iv) hemoglobin ≥ 9.0 g / dL; v) platelets ≥ 100 x 10 9 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 10 9 cells / L; f) have a corrected QT interval (QTc) ≦470 ms (as calculated by the Fridericia formula); and / or g) are not receiving other cancer therapies.
[0125] In one embodiment, prior to administration of the antibody, the subject a) has not received prior treatment with a systemic agent, including a radioimmunoconjugate, antibody-drug conjugate, immune / cytokine, or monoclonal antibody, within 28 days or 5 half-lives of the drug, whichever is shorter; b) has no ongoing toxicity from prior therapy; c) has not undergone major surgery within <3 months prior to administration of the antibody; d) has not undergone radiation therapy within <28 days prior to administration of the antibody; e) has not undergone organ transplant, allogeneic stem cell transplant, or autologous stem cell transplant; f) has not been diagnosed with a primary or acquired immune deficiency; g) has not been treated with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the antibody; h) has no active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiation; i) has no active autoimmune disease or a history of such disease requiring immunosuppressive therapy; j) has no clinical symptoms of CNS metastasis within 28 days prior to administration of the antibody; and / or k) has no leptomeningeal carcinomatosis.
[0126] In one embodiment of the method described herein, cancer is associated with increased DDR1 phosphorylation.Exemplary cancer tissues that may be associated with increased DDR1 phosphorylation include, but are not limited to, bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, intestine, gum, head, kidney, liver, lung, nasopharynx, cervix, ovary, prostate, skin, stomach, pancreas, testis, tongue, cervix, or uterus cancer or cancer cells.
[0127] Exemplary histologic types of cancer that may be associated with elevated DDR1 phosphorylation include neoplasia, malignancy; carcinoma; carcinoma, undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrimatous carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; mixed hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; adenocarcinoma, familial polyposis coli; solid tumors; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma ;chromophobe carcinoma; eosinophil carcinoma; eosinophil adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; non-encapsulated sclerosing carcinoma; adrenocortical carcinoma; Papillary serous cystadenocarcinoma; Mucinous cystadenocarcinoma; Mucinous adenocarcinoma; Bookmarking cell carcinoma; Infiltrating ductal carcinoma; Medullary carcinoma; Lobular carcinoma; Inflammatory carcinoma w / squamous metaplasia); thymoma, malignant; ovarian stromal tumor, malignant; theca cell tumor, malignant; granulosa cell tumor, malignant; androblastoma, malignant; Sertoli cell carcinoma; Leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extramammary paraganglioma, malignant; pheochromocytoma; breast angiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma; mixed tumor; mixed Müllerian tumor; nephroblastoma; hepatoblastoma; mesenchymoma, malignant; Brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; Embryonal carcinoma; Teratoma, malignant; Ovarian adenocarcinoma; Choriocarcinoma; Mesonephroma, malignant; Hemangioendothelioma, hemangiopericytoma; Chondroblastoma; Giant cell tumor of bone; Odontogenic tumor, malignant; Ameloblastoma, malignant; Ameloblastic fibrosarcoma; Pinealoma, malignant; Tenochordoma; Glioma, malignant; Ependymoma; Astrocytoma; Protoplasmic astrocytoma; Fibrous astrocytoma; Astroblastoma; Oligodendroglioma; Oligodendroglioma; Primitive neuroectodermal; Ganglioblastoma; Neuroblastoma; Retinoblastoma; Olfactory neurogenic tumor; Meningioma, malignant; Neurofibrosarcoma; Schwannoma, malignant; Granular cell tumor, malignant; Malignant lymphoma; Hodgkin's disease; Paragranuloma; Small lymphocytic; Malignant lymphoma, large cell, diffuse;These include, but are not limited to, malignant lymphoma, follicular; mycosis fungoides; other certain non-Hodgkin's lymphomas; malignant histiocytic proliferation; multiple myeloma; immunoproliferative small intestinal disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; and hairy cell leukemia.
[0128] In one embodiment, the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, stomach (gastric) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, or bone cancer. In one embodiment, the cancer is colorectal cancer, ovarian cancer, or non-small cell lung cancer. In one embodiment, the colorectal cancer is microsatellite stable (MSS). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer does not include breast cancer.
[0129] In one embodiment, the cancer is not a sarcoma, hepatocellular carcinoma, or glioma.
[0130] In one embodiment, the cancer expresses DDR1. In one embodiment, the cancer is a solid cancer. In one embodiment, the cancer is a locally advanced or metastatic solid cancer. In one embodiment, the cancer is unresectable.
[0131] In one embodiment, the cancer is refractory to immunotherapy. In one embodiment, the cancer is refractory to an antagonistic anti-PD-1 antibody, an antagonistic anti-PD-L1 antibody, an antagonistic anti-PD-L2 antibody, an antagonistic anti-CTLA-4 antibody, an antagonistic anti-BTLA antibody, an antagonistic anti-TREMR antibody, an antagonistic anti-TIGIT antibody, an antagonistic anti-VISTA antibody, an antagonistic anti-TIM-3 antibody, an antagonistic anti-LAG-3 antibody, an antagonistic anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, and an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody.
[0132] In one embodiment, the subject is not a candidate for standard of care treatment, hi one embodiment, the subject is intolerant to standard of care treatment.
[0133] In one embodiment, the cancer is refractory to standard of care treatment. In one embodiment, the standard of care treatment is chemotherapy and / or radiation. In one embodiment, the standard of care treatment is abiraterone acetate, afatinib, aldesleukin, alemtuzumab, alitretinoin, altretamine, amifostine, aminoglutethimide, anagrelide, anastrozole, arsenic trioxide, asparaginase, azacitidine, azathioprine, bendamustine, bevacizumab, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carmustine, cetuximab, chlorambucil, cisplatin, cladribine, crizotinib, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dasatinib, daunorubicin, denileukin ...Diftitox, decitabine, docetaxel, dexamethasone, doxifluridine, doxorubicin, epirubicin, epoetin alfa, epothilone, erlotinib, estramustine, entinostat, etoposide, everolimus, exemestane, filgrastim, floxuridine, fludarabine, fluorouracil, fluoxymesterone, flutamide, folate-conjugated alkaloids, gefitinib, gemcitabine , gemtuzumab ozogamicin, GM-CT-01, goserelin, hexamethylmelamine, hydroxyurea, ibritumomab, idarubicin, ifosfamide, imatinib, interferon alpha, interferon beta, irinotecan, ixabepilone, lapatinib, leucovorin, leuprolide, lenalidomide, letrozole, lomustine, mechlorethamine, megestrol, melphalan, mercaptopril methotrexate, mitomycin, mitoxantrone, nelarabine, nilotinib, nilutamide, octreotide, ofatumumab, oprelvekin, oxaliplatin, paclitaxel, panitumumab, pemetrexed, pentostatin, polysaccharide galectin inhibitors, procarbazine, raloxifene, retinoic acid, rituximab, romiplostim, sargramostim, sorafenib, streptozocin, sunitinib The chemotherapeutic agent is selected from the group consisting of tamoxifen, temsirolimus, temozolomide, teniposide, thalidomide, thioguanine, thiotepa, thioguanine, topotecan, toremifene, tositumomab, trametinib, trastuzumab, tretinoin, VEGF inhibitors and TRAP, vinblastine, vincristine, vindesine, vinorelbine, vintafolide (EC145), and vorinostat.
[0134] In one aspect, provided herein is an antibody that specifically binds to human DDR1 for use in the treatment of cancer, wherein the treatment is carried out according to the methods disclosed herein.
[0135] In one aspect, provided herein is an antibody that specifically binds to human DDR1 for use in the manufacture of a medicament for treating cancer, wherein the treatment is carried out according to the methods disclosed herein.
[0136] Combination therapy In one aspect, provided herein is a method of reducing tumor immune rejection in a subject in need thereof, the method comprising administering to the subject an immune checkpoint inhibitor and an antibody that specifically binds to human DDR1.
[0137] In one aspect, provided herein is a method of reducing tumor burden in a subject in need thereof, the method comprising administering to the subject an immune checkpoint inhibitor and an antibody that specifically binds to human DDR1.
[0138] In some embodiments, the immune checkpoint inhibitor comprises a PD-1 antagonist. In some embodiments, the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1. In some embodiments, the anti-PD-1 antibody comprises pembrolizumab, nivolumab, cemiplimab, sintilimab, penprimab, tislelizumab, toripalimab, or retifanlimab. In some embodiments, the immune checkpoint inhibitor comprises a PD-L1 antagonist. In some embodiments, the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1. In some embodiments, the immune checkpoint inhibitor comprises a PVRIG antagonist. In some embodiments, the PVRIG antagonist is an anti-PVRIG antibody that specifically binds to human PVRIG.
[0139] In some embodiments, the methods provided herein comprise administering to a subject a PD-1 or PD-L1 antagonist at a dose of about 100 mg, about 200 mg, about 240 mg, about 350 mg, about 360 mg, about 400 mg, about 480 mg, about 500 mg, about 840 mg, about 1000 mg, about 1200 mg, about 1500 mg, about 1680 mg, about 1700 mg, about 1800 mg, about 1900 mg, or about 2000 mg. In some embodiments, the methods provided herein comprise administering to a subject a PD-1 or PD-L1 antagonist at a dose of about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, or about 30 mg / kg.
[0140] In some embodiments, the immune checkpoint inhibitor is administered intravenously. In some embodiments, the PD-1 or PD-L1 antagonist is administered intravenously. In some embodiments, the immune checkpoint inhibitor is administered intratumorally. In some embodiments, the PD-1 or PD-L1 antagonist is administered intratumorally. In some embodiments, the PD-1 or PD-L1 antagonist is administered weekly, every two weeks, every three weeks, every four weeks, every six weeks, or every eight weeks. In some embodiments, the PD-1 or PD-L1 antagonist is administered no more frequently than once every week, no more frequently than once every two weeks, no more frequently than once every three weeks, no more frequently than once every four weeks, no more frequently than once every six weeks, or no more frequently than once every eight weeks. In some embodiments, the immune checkpoint inhibitor is administered no more frequently than once every week, no more frequently than once every two weeks, no more frequently than once every three weeks, no more frequently than once every four weeks, no more frequently than once every six weeks, or no more frequently than once every eight weeks.
[0141] In some embodiments, the PD-1 antagonist is pembrolizumab. In some embodiments, pembrolizumab is administered at a dose of 400 mg once every 6 weeks or 200 mg once every 3 weeks. In some embodiments, pembrolizumab is administered at a dose of 400 mg once every 3 weeks. In some embodiments, pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks.
[0142] In some embodiments, the PD-1 antagonist is nivolumab. In some embodiments, nivolumab is administered at a dose of 240 mg every two weeks, 360 mg every three weeks, or 480 mg every four weeks. In some embodiments, nivolumab is administered at a dose of 3 mg / kg every two weeks, or 3 mg / kg every three weeks.
[0143] In some embodiments, the PD-1 antagonist is cemiplimab. In some embodiments, the cemiplimab is administered at a dose of 350 mg once every three weeks.
[0144] In some embodiments, the PD-1 antagonist is dostallimab. In some embodiments, dostallimab is administered at a dose of 500 mg once every three weeks or 1000 mg once every six weeks.
[0145] In some embodiments, the PD-L1 antagonist is atezolizumab, hi some embodiments, atezolizumab is administered at a dose of 840 mg once every two weeks, 1200 mg once every three weeks, or 1680 mg once every four weeks.
[0146] In some embodiments, the PD-L1 antagonist is durvalumab. In some embodiments, durvalumab is administered at a dose of 1500 mg once every three weeks. In some embodiments, durvalumab is administered at a dose of 10 mg / kg once every two weeks or 20 mg / kg once every three weeks.
[0147] The antibody that specifically binds to human DDR1 and the immune checkpoint inhibitor can be administered in any suitable manner. In some embodiments, the antibody and the immune checkpoint inhibitor are administered to the subject in parallel, simultaneously, or within the same session (e.g., the same visit to a clinical site). In some embodiments, the antibody and the immune checkpoint inhibitor are administered to the subject in different sessions. The antibody that specifically binds to human DDR1 and the immune checkpoint inhibitor can be administered in any suitable order. In some embodiments, the antibody is administered first, followed by the immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is administered first, followed by the antibody that specifically binds to human DDR1. In some embodiments, the antibody and the immune checkpoint inhibitor are administered at the same dosing frequency. In some embodiments, the antibody and the immune checkpoint inhibitor are administered at different dosing frequencies. In some embodiments, the antibody is administered more frequently than the immune checkpoint inhibitor (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, or a percentage within a range defined by any two of the foregoing values (e.g., 10-200%, 20-150%, 30-100%, 50-100%, etc.)). In some embodiments, the immune checkpoint inhibitor is administered more frequently than the antibody (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200% more frequently, or a percentage within a range defined by any two of the foregoing values (e.g., 10-200%, 20-150%, 30-100%, 50-100%, etc.)).
[0148] In some embodiments, administering an antibody that specifically binds human DDR1 and an immune checkpoint inhibitor to a subject achieves at least stable disease (e.g., cancer). In some embodiments, administering an antibody that specifically binds human DDR1 and an immune checkpoint inhibitor to a subject prevents further progression of cancer in the subject. In some embodiments, administering an antibody that specifically binds human DDR1 and an immune checkpoint inhibitor to a subject prevents further growth in tumor size in the subject. In some embodiments, further growth in tumor size is prevented if the tumor size after administration of the antibody increases in size by no more than, or about, no more than, or by a percentage within a range defined by any two of the foregoing values (e.g., 1-30%, 3-25%, 5-20%, 1-10%, 1-5%, etc.) compared to the size of the tumor at baseline (e.g., before administration of the antibody). In some embodiments, administering to a subject an antibody that specifically binds human DDR1 and an immune checkpoint inhibitor achieves a complete response (e.g., elimination of the tumor). In some embodiments, administering to a subject an antibody that specifically binds human DDR1 and an immune checkpoint inhibitor achieves at least a partial response (e.g., about 50% or more tumor shrinkage).
[0149] kit Also provided herein are kits for treating a subject, e.g., cancer, comprising at least one anti-DDR1 antibody of the present disclosure. In some embodiments, the kit also comprises an immune checkpoint inhibitor (e.g., a PD-1 or PD-L1 antagonist). In some embodiments, the kit comprises one or more containers holding the anti-DDR1 antibody and / or immune checkpoint inhibitor. Any suitable container can be used. Suitable containers include, but are not limited to, vials, test tubes, flasks, bottles, syringes, or other container means into which the antibody can be placed, or preferably suitably aliquoted. In some embodiments, the kit comprises a pre-filled syringe containing the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured to deliver a unit dose (e.g., a therapeutically effective amount) of the anti-DDR1 antibody. In some embodiments, the pre-filled syringe is configured for single-use delivery of the unit dose of the anti-DDR1 antibody. In some embodiments, the kit comprises instructions for use.
[0150] Additional Embodiments Additional non-limiting embodiments of the present disclosure are provided according to the following numbered arrangements: 1. A method for reducing tumor immune rejection in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg. 2. A method for reducing tumor burden in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg. 3. The method of configuration 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg. 4. The method of configuration 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg. 5. The method of any one of configurations 1-4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg, or about 1600 mg. 6. The method of any one of configurations 1 to 5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg, or 1600 mg. 7. The method of any one of configurations 1 to 6, wherein the anti-DDR1 antibody is administered intravenously. 8. The method of any one of configurations 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 60 minutes. 9. The method of any one of configurations 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 30 minutes. 10. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered once weekly. 11. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered once every two weeks. 12. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered once every three weeks. 13. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered once every four weeks. 14. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered once every 8 weeks. 15. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 8 mg once every three weeks. 16. The method of any one of configurations 1-9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 24 mg once every three weeks. 17. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 80 mg once every three weeks. 18. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 240 mg once every three weeks. 19. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 400 mg once every three weeks. 20. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 800 mg once every three weeks. 21. The method of any one of configurations 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 1600 mg once every three weeks. 22. The method of any one of configurations 1 to 21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist. 23. The method of any one of configurations 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg. 24. The method of any one of configurations 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg, or 1680 mg. 25. The method of any one of configurations 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg. 26. The method of any one of configurations 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg. 27. The method of any one of configurations 1 to 26, wherein the PD-1 or PD-L1 antagonist is administered intravenously. 28. The method of any one of configurations 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once weekly. 29. The method of any one of configurations 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every two weeks. 30. The method of any one of configurations 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every three weeks. 31. The method of any one of configurations 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every four weeks. 32. The method of any one of configurations 1-27, wherein the PD-1 or PD-L1 antagonist is administered once every 6 weeks. 33. The method of any one of configurations 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every 8 weeks. 34. The method of any one of the preceding configurations, wherein the subject has cancer. 35. The method of configuration 34, wherein said administering said anti-DDR1 antibody and said PD-1 or PD-L1 antagonist treats said cancer in said subject. 36. The method of paragraph 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1. 37. The method of configuration 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1. 38. The method of configuration 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostallimab, cemiplimab, sintilimab, penprimab, tislelizumab, toripalimab, or retifanlimab. 39. The method of configuration 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab, or durvalumab. 40. The method of any one of configurations 1 to 36, wherein the PD-1 antagonist is pembrolizumab. 41. The method of configuration 40, wherein pembrolizumab is administered at a dose of 400 mg once every 6 weeks. 42. The method of configuration 40, wherein pembrolizumab is administered at a dose of 200 mg once every three weeks. 43. The method of configuration 40, wherein pembrolizumab is administered at a dose of 2 mg / kg once every 3 weeks. 44. The method of any one of configurations 1 to 36, wherein the PD-1 antagonist is nivolumab. 45. The method of configuration 44, wherein nivolumab is administered at a dose of 240 mg once every two weeks. 46. The method of configuration 44, wherein nivolumab is administered at a dose of 360 mg once every three weeks. 47. The method of configuration 44, wherein nivolumab is administered at a dose of 480 mg once every 4 weeks. 48. The method of arrangement 44, wherein nivolumab is administered at a dose of 3 mg / kg once every two weeks. 49. The method of arrangement 44, wherein nivolumab is administered at a dose of 3 mg / kg once every three weeks. 50. The method of any one of configurations 1-36, wherein the PD-1 antagonist is cemiplimab. 51. The method of arrangement 50, wherein cemiplimab is administered at a dose of 350 mg once every three weeks. 52. The method of any one of configurations 1-36, wherein the PD-1 antagonist is dostarlimab. 53. The method of arrangement 52, wherein dostarlimab is administered at a dose of 500 mg once every three weeks. 54. The method of arrangement 52, wherein dostarlimab is administered at a dose of 1000 mg once every 6 weeks. 55. The method of any one of configurations 1 to 35, or 37, wherein the PD-L1 antagonist is atezolizumab. 56. The method of arrangement 55, wherein atezolizumab is administered at a dose of 840 mg once every two weeks. 57. The method of arrangement 55, wherein atezolizumab is administered at a dose of 1200 mg once every three weeks. 58. The method of arrangement 55, wherein atezolizumab is administered at a dose of 1680 mg once every 4 weeks. 59. The method of any one of configurations 1 to 35, or 37, wherein the PD-L1 antagonist is durvalumab. 60. The method of arrangement 59, wherein durvalumab is administered at a dose of 10 mg / kg once every two weeks. 61. The method of configuration 59, wherein durvalumab is administered at a dose of 20 mg / kg once every 3 weeks. 62. The method of configuration 59, wherein durvalumab is administered at a dose of 1500 mg once every three weeks. 63. The method of any one of the preceding configurations, wherein the cancer expresses DDR1. 64. The method of any one of the preceding configurations, wherein the cancer is a solid tumor. 65. The method of any one of the preceding configurations, wherein the cancer is a locally advanced or metastatic solid cancer. 66. The method of any one of the preceding configurations, wherein the cancer is unresectable. 67. The method of any one of the preceding configurations, wherein the cancer is refractory to immunotherapy. 68. The method of configuration 67, wherein the immunotherapy is an antagonistic anti-PD-1 antibody, an antagonistic anti-PD-L1 antibody, an antagonistic anti-PD-1 / PD-L1 antibody, an antagonistic anti-PD-L2 antibody, an antagonistic anti-CTLA-4 antibody, an antagonistic anti-BTLA antibody, an antagonistic anti-TREMR antibody, an antagonistic anti-TIGIT antibody, an antagonistic anti-VISTA antibody, an antagonistic anti-TIM-3 antibody, an antagonistic anti-LAG-3 antibody, an antagonistic anti-CEACAM1 antibody, an agonist anti-GITR antibody, an agonist anti-OX40 antibody, and an agonist anti-CD137 antibody, an agonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody. 69. The method of configuration 67, wherein the immunotherapy is an antagonistic anti-PD-L1 antibody. 70. The method of any one of the preceding configurations, wherein the cancer is not a sarcoma, hepatocellular carcinoma, or glioma. 71. The method of any one of the preceding configurations, wherein said cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, or bone cancer. 72. The method of any one of the preceding configurations, wherein the cancer is colorectal cancer, ovarian cancer, or non-small cell lung cancer. 73. The method of any one of the preceding configurations, wherein the subject is not a candidate for standard of care treatment. 74. The method of any one of the preceding configurations, wherein the cancer is refractory to standard therapeutic treatment. 75. The method of arrangement 74, wherein the standard of care treatment is chemotherapy or radiation. 76. The method of any one of configurations 1 to 75, wherein administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces tumor size in the subject. 77. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have confirmed metastatic or progressive unresectable cancer with measurable disease by Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) have pathologically proven advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit or for which standard treatments are not available; c) have an Eastern Cooperative Oncology Group performance status (PS) of 0–1; d) have a predicted life expectancy of ≥ 3 months; e) Below: i) Calculated creatinine clearance (CrCL) ≥ 50 mL / min according to the Cockcroft-Gault formula; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 × 10 9 cells / L; or vi) absolute neutrophil count ≥ 1.5 × 10 9 cells / L having one or more of the following; f) have a corrected QT interval (QTc) ≤ 470 ms (as calculated by the Fridericia formula); and / or g) not receiving other cancer therapy; 10. The method according to any one of the preceding configurations. 78. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have not received prior treatment with a systemic agent, including a radioimmunoconjugate, antibody-drug conjugate, immune / cytokine, or monoclonal antibody, within 28 days or 5 half-lives of the drug, whichever is shorter; b) no ongoing toxicity from prior therapy; c) No major surgery was performed within 3 months prior to administration of the anti-DDR1 antibody; d) No radiation therapy was received within 28 days prior to administration of the anti-DDR1 antibody; e) not undergoing organ transplantation, allogeneic stem cell transplantation, or autologous stem cell transplantation; f) no diagnosis of primary or acquired immunodeficiency; g) has not been treated with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of the anti-DDR1 antibody; h) no active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiation; i) no active autoimmune disease requiring immunosuppressive therapy or a history of such disease; j) no clinical signs of CNS metastases within 28 days prior to administration of the anti-DDR1 antibody; and / or k) No leptomeningeal carcinomatosis 10. The method according to any one of the preceding configurations. 79. The method of any one of the preceding configurations, wherein the anti-DDR1 antibody comprises a heavy chain variable region (VH) comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences of the VH amino acid sequence set forth in SEQ ID NO: 7, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) comprising the CDRL1, CDRL2, and CDRL3 amino acid sequences of the VL amino acid sequence set forth in SEQ ID NO: 8 or 9, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences. 80. (a) The VH is each: SEQ ID NO: 1, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 2, or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 3, or a variant thereof containing 1-5 amino acid changes and / or comprising the amino acid sequences of CDRH1, CDRH2, and CDRH3 of (b) each of the VL's is: SEQ ID NO: 4, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 5, or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 6, or a variant thereof containing 1 to 5 amino acid changes comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of 79. The method according to claim 79. 81. The method of configuration 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 shown in SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively. 82. The method of any one of configurations 79 to 81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises a VH comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 7; and / or a VL comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 8 or 9. 83. The method of arrangement 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO:7 and a VL comprising the amino acid sequence set forth in SEQ ID NO:8. 84. The method of arrangement 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO:7 and a VL comprising the amino acid sequence set forth in SEQ ID NO:9. 85. The method of any one of configurations 79 to 84, wherein the anti-DDR1 antibody comprises a heavy chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 10 or 11, and / or a light chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 12. 86. The method of arrangement 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10, and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 87. The method of arrangement 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 11 and a light chain comprising the amino acid sequence set forth in SEQ ID NO: 12. 88. The method of any one of the preceding configurations, wherein the anti-DDR1 is administered to the subject before the PD-1 or PD-L1 antagonist. 89. The method of any one of the preceding configurations, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist. 90. The method of any one of the preceding configurations, wherein the anti-DDR1 antibody is administered to the subject simultaneously with the PD-1 or PD-L1 antagonist. 91. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in treating cancer, wherein the treatment is carried out according to the method of any one of the preceding configurations. 92. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the manufacture of a medicament for said treatment of cancer, wherein said treatment is carried out according to the method of any one of the preceding configurations. 93. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding configurations. 94. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist. 95. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding configurations. [Example]
[0151] Example 1 - Binding characteristics and anti-tumor activity of anti-DDR1 antibody 9H-1 The anti-DDR1 antibody 9H-1 was tested for its binding properties in various species and for its ability to inhibit tumor growth in vivo in mouse models of cancer.
[0152] A. Bonding properties First, 9H-1 was tested for its affinity to DDR1 proteins from humans, mice, rats, and cynomolgus monkeys. Using Biacore assay, the affinity of 9H-1 to the extracellular domains of DDR1 from humans, mice, rats, and cynomolgus monkeys was determined. Table 5 below shows that 9H-1 binds to DDR1 from various species with high affinity. [Table 5]
[0153] Next, 9H-1 was tested for its ability to bind to human cells expressing DDR1. Flow cytometry analysis showed that 9H-1 bound significantly more to T47D cells (DDR1 high / DDR2 low) than to BT549 cells (DDR1 low / DDR2 high) (see Figure 1).
[0154] B. Antitumor Activity Briefly, mice were inoculated with human DDR1-expressing E0771 mouse Ddr1- / - cells (an engineered triple-negative breast cancer cell line). Mice were treated every other day with 10 mg / kg of 9H-1, 9H-1-LALAPG (which contains a heavy chain of SEQ ID NO: 11 with the following mutations: L238A, L239A, P333G, numbered according to SEQ ID NO: 11), or IgG control. Tumors were measured every other week.
[0155] The results, shown in Figure 2, demonstrate that 9H-1 significantly inhibits tumor growth in mice compared to mice treated with an IgG control.
[0156] Example 2 - In vivo pharmacokinetics of anti-DDR1 antibody 9H-1 versus model FIH dose To initially determine the human (FIH) dose of the anti-DDR1 antibody 9H-1, a single dose of the antibody was administered to cynomolgus monkeys for pharmacokinetic modeling.
[0157] 9H-1 antibody was administered to cynomolgus monkeys via intravenous infusion pump at low, medium, and high doses according to Table 6 below. Serum samples were collected pre-dose and at 0.25, 8, 24, 72, 120, 168, 240, 288, 336, 504, 576, 672, 840, and 1008 hours post-dose. Analysis was performed by antigen capture ELISA, and the individual concentrations of 9H-1 in each animal are shown in Figures 3A-D. [Table 6]
[0158] A two-compartment model with first-order elimination was chosen to fit the PK data from the cynomolgus monkey study. During model building, a three-compartment structure resulted in a slightly lower AIC, but a two-compartment model was chosen to reduce the risk of overparameterization.
[0159] The fit of a three-compartment model is included for comparison. Parameters were scaled using the following equation: Vh=tvV*(BWh / BWm)^1 V2h=tvV2*(BWh / BWm)^1 Clh=tvCl*(BWh / BWm)^0.8 Cl2h=tvCl2*(BWh / BWm)^0.8
[0160] The mean body weight of cynomolgus monkeys was 2.15 kg, while 80 kg was used as an estimate of human body weight. Several animals and time points were excluded from the modeling database due to apparently erratic PK profiles suggestive of anti-drug antibodies. The following animals and time points were included in the modeling: P0101:0.25~240 hours P0102:0.25~240 hours P0103: 0.25 to 240 hours P0201: 0.25 to 504 hours P0202: 0.25 to 504 hours P0203: 0.25 to 1008 hours
[0161] Table 7 below shows the scaled human model parameters: [Table 7]
[0162] Based on modeling of the cynomolgus monkey data and scaled human parameters, Figures 4 and 5 show the simulated concentrations of 9H-1 at fixed doses of 8-1600 mg administered once every two weeks (Q2W, Figure 4) or once every three weeks (Q3W, Figure 5). These data demonstrate that when the antibody is administered at a fixed dose of either Q2W or Q3W, the concentration of 9H-1 remains above concentrations sufficient to bind to human DDR1 and inhibit DDR1 function. Table 8 below shows the steady-state parameters for simulated human 9H-1 exposure. [Table 8]
[0163] Example 3 - Investigation of the safety, pharmacokinetics, pharmacodynamics, and activity of 9H-1 and anti-PD-1 antibody combination therapy in adult subjects with locally advanced or metastatic solid tumors This example describes an open-label, Phase 1 dose-escalation and expansion study to evaluate the safety and tolerability, efficacy, pharmacokinetics (PK), pharmacodynamics (PD), and activity of a dosing regimen of 9H-1 (an anti-DDR1 humanized monoclonal antibody) in combination with pembrolizumab (an anti-PD-1 antibody) in adults with advanced solid tumors. 9H-1 is a first-in-class humanized monoclonal antibody targeting DDR1, designed to disrupt collagen alignment in the tumor stroma and allow the subject's own immune cells to infiltrate the tumor.
[0164] DDR1-targeted therapy may benefit a wide range of cancer patients. Analysis of tumor biopsies from various cancer types has demonstrated measurable levels of DDR1 expression across a variety of malignancies, with some notable exceptions. DDR1 expression has been noted to be low in hepatocellular carcinoma and sarcoma, which is why they are excluded from trial enrollment. To understand the levels of DDR1 expression associated with benefit and to better understand the types of cancers that could potentially benefit, trial enrollment will include all solid tumors except hepatocellular carcinoma and sarcoma, as well as glioma due to uncertainties regarding blood-brain barrier penetration, as discussed above.
[0165] A. Research design Overall design The goal of the dose-escalation plan is to determine the safety, tolerability, optimal dose, and optimal administration schedule of 9H-1 in combination with anti-PD-1 antibody therapy. Further expansion studies of cohorts of subjects with specific histology, treatment history, and / or baseline characteristics will be conducted to evaluate for signals of anti-tumor activity.
[0166] Three subjects will initially be enrolled in each combination cohort. The first combination cohort will begin at dose level 3, no earlier than after the SRC in the Phase 1 study described in Example 3 allows for the next higher dose monotherapy cohort to be escalated. Pembrolizumab will be administered at 400 mg per administration event. The study will include five cohorts of subjects, with 9H-1 administered intravenously every 3 weeks at doses of 8 mg (Cohort 1), 24 mg (Cohort 2), 80 mg (Cohort 3), 240 mg (Cohort 4), 800 mg (Cohort 5), or 1600 mg (Cohort 6). Subjects enrolled in Cohorts 1 and 2 may be escalated to the Cohort 3 dose level if they have no related adverse events of grade ≥ 2 after 90 days of treatment and dose level 3 has not been excluded according to the dose escalation design described below.
[0167] 9H-1 is administered intravenously (IV) in a diluted solution over 1 hour using an intravenous line containing a sterile, non-pyrogenic, low-protein-binding 0.2- to 5-micron in-line or add-on filter. Once the first two doses have been administered to each subject and no infusion reactions have been observed, the infusion time may be shortened to 30 minutes with the permission of the site PI. The SRC may adjust the premedication and infusion duration if an infusion reaction is observed. Pembrolizumab is administered intravenously (IV) in a diluted solution over 30 minutes using an intravenous line containing a sterile, non-pyrogenic, low-protein-binding 0.2- to 5-micron in-line or add-on filter. No other drugs are administered through the same infusion line.
[0168] Starting with dose cohort 4, up to 10 biomarker backfill slots will be made available to subjects wishing to enroll in the study. Backfill spots will be made available after the dosing cohort is fully enrolled and deemed safe to continue escalation or after it has been determined to be at the recommended Phase 2 dose (RP2D). Pre-treatment archived tissue or a fresh pre-treatment biopsy and a post-treatment biopsy 6 weeks after treatment initiation will be required. Pre- and post-treatment CD8 PET scans are required if the capacity is available at the enrollment site. The specific number of slots available for biomarker backfill and the specific tissue types included or excluded will be determined based on available data.
[0169] Concomitant medications Any medications or vaccines (including over-the-counter (OTC) or prescription drugs, vitamins, and / or herbal supplements) that participants are receiving at the time of enrollment or during the study must be recorded along with the reason for use, dates of administration including start and end dates, and dosage information including dose and frequency.
[0170] Any questions regarding concomitant or prior therapy should be directed to the medical monitor. Medications or vaccinations specifically prohibited in the exclusion criteria are not permitted during the ongoing study. The clinical indication for any specifically prohibited drug or vaccination during the study may necessitate discontinuation of study treatment or vaccination. The investigator will discuss prohibited medications and vaccinations with the sponsor's clinical director. The final decision regarding supportive care or vaccination rests with the investigator and / or the subject's primary physician. However, the decision to continue a subject on study treatment requires the mutual consent of the investigator, sponsor, and subject.
[0171] The following medications and vaccinations are prohibited during the study: - Antitumor systemic chemotherapy or biologic therapy - Immunotherapy not specified in this protocol - Chemotherapy not specified in this protocol - Investigational drugs other than 9H-1 - Radiation therapy (radiation to symptomatic isolated lesions or brain may be possible at the investigator's discretion) - Live or live-attenuated vaccines (killed vaccines are acceptable) within 30 days prior to the first dose of study treatment and while participating in the study. Note: COVID-19 vaccines authorized in certain countries (including for emergency use) are acceptable in the study as long as they are mRNA, adenovirus, or inactivated vaccines. These vaccines will be treated similarly to any other combination therapy. Investigational vaccines (i.e., those not authorized or approved for emergency use) are not acceptable. -Systemic glucocorticoids, except when used for the following purposes: To control the symptoms of AEs suspected to have an immunological etiology 〇For preventing vomiting - To premedicate for IV contrast allergies To treat COPD exacerbations (short-term oral or IV use only at doses >10 mg / day prednisone equivalent) For chronic systemic replacement, do not exceed 10 mg / day of prednisone equivalent Use of other glucocorticoids, except when used for the following purposes: Topical or ocular use ●Intra-articular joint use Inhaled medications in the management of asthma or chronic obstructive pulmonary disease ●Note: Inhaled steroids can help control asthma.
[0172] If the investigator determines that the subject requires any of the above treatments for any reason, 9H-1 must be discontinued.
[0173] Any treatment that the investigator deems necessary for the subject's welfare may be performed at the investigator's discretion and in accordance with local medical standards.
[0174] All concomitant medications will be recorded on the eCRF, including all prescription, over-the-counter, herbal supplements, and IV medications and fluids. Documentation of medication dose, frequency, route, and dates, if any changes occur during the study, should also be included on the eCRF.
[0175] All concomitant medications administered within 28 days before the first dose of study treatment and up to 30 days after the last dose of study treatment should be recorded. All concomitant medications administered during the SAE or ECI should be recorded. BOIN design for dose escalation
[0176] A Bayesian optimal interval (BOIN) design will be used to find the maximum tolerated dose (MTD). The BOIN design is implemented in a simple manner similar to the traditional 3 + 3 design, but is more flexible and has excellent operating characteristics comparable to more complex model-based designs such as the continuous reassessment method (CRM). Dose-limiting toxicities (DLTs) occurring within the first cycle will be used for dose finding.
[0177] The steps to implement the BOIN design are described as follows: 1. Accelerated titration to dose level 3 (1 mg / kg) is performed as follows: The first subject is treated at dose level 1. If no DLT is observed, the dose is escalated to the next higher level. This one-dose-per-subject dose escalation process continues until one of the following events is observed: (i) the first instance of a DLT, or (ii) the second instance of moderate (grade 2) toxicity. Two additional subjects are then treated at the current dose level. From this point on, subjects are treated in cohorts of size 3, as described in steps 2 and 3. If the titration reaches dose level 3 without observing (i) or (ii), subjects are treated in cohorts of size 3 from dose level 4. 2. To assign doses to the next cohort of subjects, dose escalation / de-escalation will be performed according to the rules set forth in Table 9 below. When using Table 9, keep the following in mind: 3. "Exclude" means excluding the current dose and higher doses from the study because they are too toxic to prevent any future subjects from being treated with these doses. 4. If a dose is eliminated, automatically taper the dose to the next lower level. If the lowest dose is eliminated, stop the study for safety. In this case, the dose should not be selected as the MTD. 5. (i.e., titrate up, titrate down, or eliminate) If no effect is elicited, treat a new subject with the current dose. 6. If the current dose is the lowest dose and rules indicate dose tapering, new subjects will be treated at the lowest dose unless the number of DLTs reaches an exclusion boundary, at which point the study will be terminated for safety. 7. If the current dose is the highest dose and rules indicate dose escalation, treat new subjects at the highest dose. 8. Repeat step 2 until a maximum sample size of 30 is reached, or stop the study if the number of evaluable subjects treated at the current dose reaches 9 and a decision is made to maintain the current dose according to Table 9. [Table 9] "Number of DLTs" is the number of subjects with at least one DLT. If no action (i.e., escalation, tapering, or elimination) is triggered, the current dose is maintained to treat the next cohort of subjects. "NA" means the dose cannot be eliminated before treating 3 DLT-evaluable subjects.
[0178] All adverse events (AEs) specified in Table 10 below should be counted as DLTs, except those clearly attributable to disease progression or exogenous causes. [Table 10]
[0179] long-term extension phase Subjects will receive treatment with 9H-1 and pembrolizumab until they meet study discontinuation criteria. Subjects in the dose escalation portion of the study may be transitioned out of their assigned dose cohort to receive the RP2D, as determined.
[0180] Research End The end of the study was defined as the primary completion date, which was the date the last subject completed their last clinic visit (a phone call was also considered a clinic visit) or when the sponsor decided to end the study, whichever came first.
[0181] Recruitment will be discontinued if any of the following occurs: - The study treatment is deemed too toxic to continue treatment before the expected number of subjects have been recruited. This assessment will be made by the CTSC. - The target number of subjects recruited is reached. This number may be increased to include subjects replacing those who are not DLT-evaluable and subjects added to intermediate dose or expansion cohorts. -The stated objectives of the study are achieved. -Sponsor's decision.
[0182] When concluding a study, sponsors and investigators must ensure that due care is taken to protect the interests of subjects.
[0183] Subjects are considered to have completed the study if they have completed all phases of the study, including the follow-up visit 30 days (± 7 days) after the last dose of study treatment, unless they have experienced an ongoing study treatment-related AE or SAE. For subjects being followed for an ongoing SAE or study treatment-related AE, follow-up visits will continue at least every 4 weeks until the event has resolved or subsided to baseline, stabilized, the subject is lost to follow-up or withdraws consent, or medical monitoring is deemed necessary, whichever occurs first. Safety follow-up visits will cease if the subject begins another anti-cancer therapy.
[0184] The total length of the study, from screening of the first participant to study completion, is expected to be approximately 40 months.
[0185] B. Study Population Selection criteria: Participants are eligible to participate in the study if the following criteria apply: 1. Be willing and able to read, understand, and sign the informed consent form. 2. Age ≥ 18 years old. 3. Biologically confirmed measurable disease of metastatic or progressive unresectable malignancy by Response Evaluation Criteria in Solid Tumors (RECIST) v1.1 assessed at screening, excluding sarcoma and glioma. 4. Have pathologically proven advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which standard treatments are not available. 5. Subjects must have an Eastern Cooperative Oncology Group performance status (PS) of 0-1. 6. Subject must have a predicted life expectancy of ≥ 3 months. 7. Subjects must have the following laboratory values (obtained ≤28 days prior to enrollment): a. Calculated creatinine clearance (CrCL) must be ≥ 50 mL / min by Cockcroft-Gault calculation. b. Total bilirubin ≤ 1.5 x ULN unless there is a history of Gilbert's syndrome (if there is a history, total bilirubin must be ≤ 3 x ULN). c. AST and ALT ≤ 2.5 × ULN. d. Hemoglobin ≥ 9.0 g / dL. e. Platelets ≧100×10 9 cells / L. f. Absolute neutrophil count ≥ 1.5 x 10 9 cells / L (without hematopoietic growth factors). 8. Corrected QT interval (QTc) ≤ 470 ms (calculated by the Fridericia formula). 9. Women of childbearing potential (WOCBP) must have a negative urine pregnancy test within 72 hours prior to the first dose of 9H-1 and a negative urine pregnancy test on the first day of dosing. 10. WOCBP and men with female partners of childbearing potential must agree to use adequate birth control throughout their participation and for 90 days after the last dose of 9H-1. 11. Subject must be willing to adhere to the study visit schedule and the prohibitions and restrictions specified in this protocol. 12. Subject must have disease sites suitable for biopsy and be a candidate for tumor biopsy according to treating institution guidelines, or have archival tissue available at the time of enrollment. a. Subjects with disease sites not suitable for biopsy may be considered after consultation with the sponsor. 13. Subject is not enrolled in any other clinical trial and is not receiving any other therapy directed at their malignancy. 14. Subject has received prior PD-1 / PD-L1 therapy but has no prior history of immune-related adverse events to an immune checkpoint inhibitor ≥ Grade 3. For patients with a Grade 2 immune-related adverse event from a prior immune checkpoint inhibitor, it must have resolved to Grade 1 at the time of enrollment, with the following exceptions: a. Alopecia and vitiligo b. Stable grade 2 neuropathy, c. Well-controlled hypothyroidism / hyperthyroidism or other endocrine deficiency well-controlled with hormone replacement. Any such exceptions must be evaluated by the investigator (and approved by the sponsor) to ensure that participation in the study does not expose the subject to undue safety risks.
[0186] Additional selection criteria for biomarker backfill: 1. Subjects must have disease sites suitable for biopsy and be candidates for tumor biopsy according to their treating institution's guidelines. Subjects must be willing to undergo a new tumor biopsy or have archival tissue available at the time of enrollment and willing to undergo at least one biopsy during the study. a. Subjects with disease sites not suitable for biopsy may be considered after consultation with the sponsor.
[0187] Further inclusion criteria for expansion studies: 1. Subjects with the following indications may be included in the expansion study: Cohort B: Non-BRAFV600E mutated colon cancer (MSS) previously treated with or intolerant to 5-fluorouracil, oxaliplatin, irinotecan and appropriate biologic therapy. b. Cohort C: Platinum-resistant ovarian cancer (TMB-low), defined as recurrence or progression within 6 months after completion of the first or subsequent course of platinum therapy, with one or more prior therapies. c. Cohort D: NSCLC defined as primary resistance to PD-1 or PD-L1 therapy, progressing within 6 months of initiating treatment with PD-1 or PD-L1 therapy, having received one or more prior lines of therapy, and no history of a targetable driver mutation.
[0188] Exclusion criteria: Participants will be excluded from the study if any of the following criteria apply: 1. The subject has not received prior treatment with a systemic agent, including a radioimmunoconjugate, antibody-drug conjugate, immune / cytokine, or monoclonal antibody (e.g., anti-CTLA4, anti-PD-1, and anti-PD-L1), within 28 days or 5 half-lives of the drug, whichever is shorter. 2. Subject has ongoing toxicity from prior therapy > Grade 1 according to CTCAE with: a. Alopecia and vitiligo b. Grade ≤2 neuropathy c. Well-controlled hypothyroidism / hyperthyroidism or other endocrine deficiency well-controlled with hormone replacement 3. Subject has undergone major surgery (excluding minor procedures, e.g., vascular access placement) <3 months prior to administration of 9H-1, 4. Subject has received radiation therapy <28 days prior to administration of 9H-1. a. Exception: Limited (e.g., pain relief) radiation therapy is permitted before and during study treatment as long as there is no acute toxicity and the subject has measurable disease outside the radiation field. 5. Subject has undergone or is expected to undergo an organ transplant, including allogeneic or autologous stem cell transplant, at any time. 6. Subject has a diagnosis of either primary or acquired immunodeficiency. 7. Subject has received treatment with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of 9H-1. Exception: Inhaled or topical (including mouthwash) steroids and adrenal replacement doses are permitted in the absence of active autoimmune disease. 8. Subject has an active or prior history of autoimmune disease requiring immunosuppressive therapy. Exceptions may be made. 9. Subject has a known severe intolerance or hypersensitivity reaction to monoclonal antibodies, Fc-containing proteins (e.g., soluble receptors or other Fc-fusion proteins), or IV immune globulin preparations; a previous history of a human anti-human antibody response; or a known allergy to the study drug, its analogs, or any of the excipients in various formulations of any drug. 10. Subject has active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiation (including evidence of cerebral edema by magnetic resonance imaging (MRI) or progression from prior imaging studies), or has ever required steroids, or has had clinical symptoms of / from CNS metastases within 28 days of study treatment. 11. Subject has leptomeningeal carcinomatosis, regardless of prior treatment. 12. Subject currently has a second malignancy elsewhere (Exceptions: non-melanoma skin cancer, adequately treated carcinoma in situ (e.g., cervix), or indolent prostate cancer under observation). A history of other malignancies is acceptable as long as the subject has not recurred for ≥ 2 years or the subject has been treated with curative intent within the past 2 years and is unlikely to recur in the investigator's opinion. 13. Subject has an active and clinically significant bacterial, fungal, or viral infection, including known Hepatitis A, B, or C or HIV (testing not required). 14. Subject has received a live vaccine within the past 30 days (inactivated vaccines are acceptable; seasonal vaccines should be administered >30 days prior to administration of 9H-1). 15. Pregnant or lactating women. 16. History of any of the following within ≤6 months prior to first dose: Congestive heart failure, New York Heart Association grade III or IV; b. Unstable angina, C. myocardial infarction, d. Unstable symptomatic ischemic heart disease, e. Uncontrolled hypertension despite appropriate medical therapy, f.> Grade 2 ongoing symptomatic cardiac arrhythmia, g. Pulmonary embolism or symptomatic cerebrovascular event, or any other serious cardiac condition (e.g., pericardial effusion or restrictive cardiomyopathy). Chronic atrial fibrillation on stable anticoagulation therapy is permitted. 17. Subject has any contraindication to imaging assessment or other study procedures to which the subject will be subjected. 18. Subject has any medical or social condition that, in the opinion of the investigator, may place the subject at high risk, affect compliance, or confound the interpretation of safety or other clinical study data.
[0189] C. Effectiveness Evaluation Participants will undergo tumor assessments until loss of clinical benefit as determined by the investigator (unless the participant withdraws consent or the sponsor terminates the study). All participants who discontinue the study intervention for reasons other than disease progression (e.g., adverse events) will continue tumor assessments until death, disease progression, initiation of another systemic anticancer therapy, loss to follow-up, withdrawal of consent, or end of study, whichever occurs first. At the investigator's discretion, tumor assessments may be repeated whenever progressive disease is suspected.
[0190] Measurable and evaluable lesions should be assessed and recorded at screening. Tumor assessments performed as standard of care prior to obtaining informed consent and within 30 days prior to enrollment do not need to be repeated at screening.
[0191] The screening evaluation must include a CT scan of the chest / abdomen and pelvis (using IV contrast unless contraindicated and appropriate oral contrast according to institutional standards). If a CT scan with contrast is contraindicated (i.e., in participants with contrast allergy or impaired renal clearance), a non-contrast CT scan of the chest may be performed, and an MRI scan of the abdomen and pelvis should be performed. A brain MRI is required for all subjects with neurological symptoms.
[0192] If a CT scan for tumor evaluation is performed on a positron emission tomography (PET) / CT scanner, the CT acquisition must match the criteria for a full contrast-enhanced diagnostic CT scan.
[0193] A bone scan (technetium-99m [TC-99m]) or sodium fluoride (NaF) PET should be performed at screening if clinically indicated. TC-99m and NaF-PET bone scans should be repeated if bone metastases are present at screening and not visible on CT or MRI scans, or if clinically indicated, when a complete response in target disease is identified or when progression in bone is suspected.
[0194] CT scans of the neck or extremities should also be obtained if clinically indicated and repeated throughout the study if there is evidence of disease at screening.
[0195] CD8 PET scans obtained during the study are considered exploratory and will not be used to assess treatment response per RECIST v1.1. However, if possible, CD8 PET scans should be performed with CT scans consistent with full contrast-enhanced diagnostic CT scans. Contrast-enhanced CT scans should be evaluated separately from CD8 PET scans and counted as efficacy endpoint assessments.
[0196] All measurable and evaluable lesions should be reassessed at each subsequent tumor evaluation. The same radiographic procedures used to evaluate disease sites at screening should be used for subsequent tumor evaluations (e.g., the same imaging protocol for CT scans).
[0197] Treatment response will be assessed by the investigator using RECIST v1.1. Assessments should be performed by the same assessor, if possible, to ensure internal consistency across visits. Results must be reviewed by the investigator before administering the next cycle.
[0198] The overall response rate (ORR) will be defined as the primary efficacy endpoint for each dose expansion cohort. Subjects will be considered responders if they observe a CR / PR based on the investigator's overall objective response assessment by RECIST. This endpoint will be analyzed according to the BOP2 method. At the end of the cohort, ORR will be calculated separately for each expansion cohort using the binomial exact method with a 95% confidence interval, with the denominator including all efficacy-evaluable subjects in the cohort (subjects who completed at least three post-baseline RECIST assessments or discontinued the study due to death, AE, lack of efficacy, or progressive disease). As exploratory endpoints, overall confirmed response rate (CR / PR confirmed by the next RECIST assessment), iRECIST ORR, and ORR including all treated subjects in the denominator (intent-to-treat approach) will be analyzed similarly with a 95% confidence interval for each expansion cohort after enrollment completion.
[0199] Progression-free survival (PFS) is defined as an exploratory efficacy endpoint for each histology-specific expansion cohort and is the time from day 1 to the date of first investigator-assessed disease progression according to RECIST v1.1 (or as the primary reason for discontinuation) or death. This time-to-event variable is censored at the date of the last RECIST assessment or discontinuation not due to disease progression or death. This endpoint will be analyzed using the Kaplan-Meier method for each expansion cohort including all dosed subjects. PFS by iRECIST criteria will be derived and analyzed similarly.
[0200] Duration of response (DOR) was exploratory-defined for each histology-specific expansion cohort as the time from the first observed response (CR / PR by RECIST v1.1) to the date of first disease progression after response. This time-to-event variable was censored at the date of the last RECIST assessment after the first response date or the date of discontinuation for reasons other than AE, disease progression, or death. This endpoint was analyzed using the Kaplan-Meier method for each expansion cohort, including all responders in the cohort. DOR by iRECIST criteria was derived and analyzed similarly.
[0201] Disease control rate (DCR) is defined as the percentage of subjects with advanced or metastatic cancer who achieve complete response, partial response, and stable disease by RECIST v1.1. This endpoint will be analyzed using the Kaplan-Meier method for each expansion cohort including all treated subjects.
[0202] Overall survival (OS) is defined as an exploratory endpoint for each histology-specific expansion cohort, the period from day 1 to date of death. This time-to-event variable is censored at the date last known alive. This endpoint will be analyzed using the Kaplan-Meier method for each expansion cohort including all treated subjects.
[0203] D. Safety Assessment Safety assessment consists of monitoring and recording adverse events, including serious adverse events (SAEs) and adverse events (AEs) of special interest, conducting protocol-specified safety laboratory assessments, measuring protocol-specified vital signs, and conducting other protocol-specified tests considered important to the safety assessment of the study.
[0204] E. Pharmacokinetics Serum PK data for 9H-1 and pembrolizumab will be collected throughout the study. Planned PK timepoints may be updated or discontinued after initial assessment of the PK profile has been characterized. If emerging PK data indicate a less frequent schedule is needed, PK sampling may be reduced without protocol amendment.
[0205] The following PK parameters are determined for 9H-1 using non-compartmental methods: max , C max Time to (T max ), and the last verified plasma concentration (C last ), AUC 0-last (AUC 504h or AUC 336h or AUC 672h - dose on Day 1 of Cycle 1 and Day 1 of Cycle 3), time to last measurable concentration (T last ), (t 1 / 2 ), the accumulation ratio of 9H-1 and pembrolizumab, and Vd and CL, if possible. Possible relationships between PK and PD variables, efficacy, and / or selected toxicities will be explored, as appropriate.
[0206] PK profiles to evaluate the PK characteristics of 9H-1 and pembrolizumab will be collected from all enrolled subjects. All subjects enrolled in the combination dose-escalation study will have complete PK profiles collected. Subjects enrolled in the expansion study will have a shortened PK sampling schedule.
[0207] The remaining PK, PD, and ADA samples used for PK and ADA analysis may also be used for exploratory PK and / or PD analysis related to 9H-1 therapy and cancer, which may include using the remaining samples for the development and analysis of exploratory surrogate PK assays.
[0208] Blood samples collected before and after dosing at the EOT visit will be used to determine 9H-1 levels. These determinations will be used to calculate single-dose and repeat-dose PK profiles for each evaluable subject at each dose level administered. Single-dose, single-agent 9H-1 will be estimated using non-compartmental analysis. PK parameters for 9H-1 in combination with pembrolizumab, and pembrolizumab alone will include accumulation rate, C max , T max , C last , T last , AUC 0-last (AUC 504h or AUC 336h or AUC 672h ), Vd, CL and t 1 / 2 Including, but not limited to:
[0209] 9H-1 and pembrolizumab concentrations will be listed and summarized in tabular form using descriptive statistics. 9H-1 and pembrolizumab concentrations will be plotted against time point by cohort. Individual and summary PK parameters will be listed and summarized in tabular form using descriptive statistics.
[0210] F. Immunogenicity The relationship between immunogenicity and 9H-1 serum concentrations and adverse events will be graphed and tabulated to characterize the relationship between changes in ADA at screening and serum concentrations of 9H-1 in combination with pembrolizumab.
[0211] Additionally, potential correlations between immunogenicity and other endpoints (key safety, efficacy, and biomarker parameters) can be assessed. This is done in two steps. First, a descriptive analysis is performed graphically between immunogenicity change from screening values and key safety, efficacy, and biomarker parameters (either categorical or continuous variables). If any potential correlations are identified, further investigation is performed using machine-based modeling techniques, if necessary.
[0212] Concentration / adverse event-immunogenicity relationships will be graphed and tabulated to characterize the relationship between change from the presence of immunogenicity at screening and serum concentrations of single-agent 9H-1.
[0213] Additionally, potential correlations between immunogenicity and other endpoints (key safety, efficacy, and biomarker parameters) can be assessed. This is done in two steps. First, a descriptive analysis is performed graphically between immunogenicity change from screening values and key safety, efficacy, and biomarker parameters (either categorical or continuous variables). If any potential correlations are identified, further investigation is performed using machine-based modeling techniques, if necessary.
[0214] G. Biomarkers The exploratory biomarker objective of this study is to identify biomarkers associated with immuno-oncology research interventions by assessing tumor tissue and circulating soluble factors, including but not limited to DNA, RNA, enzymes, growth factors, cytokines, antibodies, and immune cells, in tissues and blood. Additionally, microbiota profiles may be assessed from stool samples. Assessment of baseline levels and / or changes with study intervention can be performed to determine associations with clinical outcomes, including clinical response and tolerance, and tolerability of the study intervention.
[0215] Collection of samples for biomarker studies is part of this study. The following samples for biomarker studies are required and will be collected from all participants in this study as specified in the SoA: - Blood containing PBMCs -Skin biopsy Tumor tissue biopsy (previous, archived, or fresh) - If possible, optional samples for biomarker studies to be collected from participants in the study are: Tumor tissue biopsy (6 weeks post-treatment), optional for all subjects. Required for biomarker backfill subjects.
[0216] Samples can be tested for genetic analysis of tumor and blood samples, including, but not limited to, assays of circulating free DNA, DNA from tumor and / or immune cells, and T cell receptor sequencing. This investigation can assess whether genetic variations correlate with treatment outcomes. If genetic variations are found to predict efficacy or adverse events, the data can inform optimal use of therapy in cancer subjects. Circulating soluble analytes can be evaluated, including, but not limited to, immune cytokines, growth factors, antibodies, and / or markers associated with immune signatures and activation or cancer. Additionally, tumor and blood samples can be collected before and during study intervention for immune cell profiling, which can include immune cell phenotyping, enumeration, and / or activation status. Both genome-wide and targeted messenger RNA (mRNA) expression profiling and sequencing in tumors and / or blood can be performed to define gene signatures that correlate with treatment outcomes. Epigenetic analysis can also be performed, as these are important biomarkers for some cancers.
[0217] Blood, skin, tissue, and tumor biopsies will be collected from subjects throughout the study for biomarker analysis.
[0218] H. Genetics Instructions for sample collection, storage, and shipping of planned genetic analysis samples are provided in the laboratory manual. Samples should be collected for planned analyses of associations between genetic variants in germline / tumor DNA and clinical outcomes. Blood for planned genetic analyses will be collected for DNA as described in the Schedule of Activities. If written laws or regulations prohibit sample collection for these purposes (or the local IRB / IEC has not approved), such samples should not be collected at the corresponding facility. Additional DNA extracted from planned genetic analysis samples will be stored for future biomedical research only if the participant signs a consent for future biomedical research.
[0219] If DNA extraction is unsuccessful, a replacement genetic blood sample can be requested from the participant. Signed informed consent will be required to obtain a replacement sample, unless included in the original consent. I. Objectives and Endpoints [Table 11] [Table 12]
[0220] For the purposes of analysis, the following populations are defined: [Table 13]
[0221] J. Statistical analysis This study will use an adaptive approach, with on-treatment data guiding the testing of each combination and its success or futility in each study subpopulation.
[0222] The statistical analysis plan was developed and finalized before database lock and describes the study population to be included in the analysis, as well as procedures for accounting for missing, unused, and spurious data. This section summarizes the planned statistical analyses of the primary and secondary endpoints.
[0223] Example 4 - Anti-DDR1 antibody treatment enhances T cell infiltration induced by anti-PD-1 antibody This example demonstrates that a rabbit monoclonal antibody version of 9H-1 (an anti-DDR1 humanized monoclonal antibody) (the rabbit monoclonal antibody comprises heavy and light chains as shown in Table 17 below) enhances T cell infiltration into solid tumors in mice when administered in combination with an anti-PD-1 antibody. [Table 17]
[0224] As shown in Figure 6, when the rabbit monoclonal antibody version of 9H-1 (αDDR1) was administered in combination with a mouse anti-PD-1 antibody (αPD-1), the percentage of CD3+ cells in the core of solid tumors in mice was significantly higher compared to either the rabbit monoclonal antibody version of 9H-1 or the mouse anti-PD-1 antibody alone. Furthermore, Figures 7A and 7B demonstrate a significant increase in T cell activation and a significant decrease in tumor volume for the combination therapy compared to either monotherapy or control treatment, respectively. Without being bound by theory, it is believed that anti-DDR1 treatment disrupts the collagen barrier surrounding solid tumors, allowing increased T cell infiltration, and the addition of anti-PD-1 treatment increases T cell activation and infiltration, further enhancing the anti-tumor effect (Figure 8). Example 5 - In vivo syngeneic mouse tumor model selection: Identification of a DDR1-dependent mouse model of immune exclusion
[0225] The goal of these studies was to identify an immune-exclusionary, DDR1-dependent syngeneic mouse model for evaluating novel DDR1-targeted therapies. The selection criteria used to identify immune-exclusionary mouse tumor models included: (i) expression of DDR1; (ii) the presence of a functional immune system; (iii) immunohistochemical (IHC) evidence that immune cells are present in the periphery of the tumor (i.e., excluded); and (iv) resistance to checkpoint blockade therapy or other treatments (e.g., checkpoint inhibitors (CPIs); chemotherapy, radiation therapy (RT), etc.) that allow for the investigation of combination strategies.
[0226] Eight different syngeneic mouse tumor models, expressing varying levels of DDR-1, with varying levels of resistance to anti-PD1, and known to be immune models, were selected for the selection of a DDR1-dependent mouse model of immune exclusion (Table 14). Purified cell lines (i.e., free of mycoplasma and mouse pathogen contamination) were used in the studies described herein. The knockout cell lines used were generated using transient expression of the CRISPR / Cas9 system (i.e., lacking stable Cas9 expression) to ensure that no non-mouse proteins were expressed in any of the cell lines. Furthermore, rather than isolating single cell clones, DDR1-negative (DDR1 KO) cell pools were sorted using flow cytometry to dilute any potential off-target effects. The sorted cells were expanded and transplanted into wild-type, immunocompetent mice of the same syngeneic strain.
[0227] The observed tumor growth data confirmed the antitumor effects of DDR1 KO (e.g., Figures 12A-16D). Interestingly, the antitumor effects were observed primarily in the BALB / c mouse model (Figures 12A-15D) and the C3H / HeN mouse model (Figures 16A-16D), and to a lesser extent in the C57BL / 6 mouse tumor model (Figures 9A-11C). Renca (renal carcinoma) and MBT-2 mouse models were observed to exhibit strong antitumor effects (Figures 12A-12C; Figures 16A-16D). The observed antitumor effects are summarized in Table 14 below. [Table 14]
[0228] Example 6 - Murine colorectal cancer tumor model in Balb / c mice - Tumor kinetics study using CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines We used the CRISPR-Cas9 system to disrupt DDR1 expression in CT26 mouse colorectal cells, as described in Example 5. Subsequently, isolated CT26 cells with reduced surface DDR1 levels (DDR1r / DDR1 KO) compared to WT controls were sorted using flow cytometry (Figures 20A-20C). DDR1r / DDR1 KO cells and control cells (DDR1 WT) were injected into the flanks of BALB / c mice (n=10 for each condition) to allow tumor formation. Tumor volume at day 31 (all mice were still participating in the study) showed a significant reduction in tumor size in the DDR1r / DDR1 KO condition. These results demonstrated that DDR1 plays a functional role in suppressing tumor growth and progression.
[0229] Methods and Results:
[0230] DDR1 CRISPR knockout: DDR1 was knocked out in the mouse colon cancer cell line CT26 (ATCC, CRL-2638) by using two DDR1 sgRNAs and Cas9-RFP (IDT, catalog number 10008163). Both DDR1 sgRNAs target the sequence encoding the DDR1 extracellular domain.
[0231] The sgRNA sequences were as follows: sgRNA1: TCCATCTCCACGTAGCCCGTGGG (IDT, Design ID: Mm.Cas9.DDR1.1.AC); [SEQ ID NO: 13]; sgRNA2: ACTTACGATG-GATATACTGCTGG (Design ID: Mm.Cas9.DDR1.1.AD). [SEQ ID NO: 14]. RNP complexes with Cas9-RFP and sgRNA were generated in vitro according to the manufacturer's instructions. The RNP complexes were electroporated into CT26 cells using the Lonza Nucleofector™ system.
[0232] FACS sorting: CT26 DDR1 knockout cell pools were isolated by cell sorting (Sony SH800S). Briefly, CT26 cells were harvested 72 hours after electroporation, and cell surface DDR1 expression was detected using an anti-mouse DDR1 antibody (Sun et al., Nature, 2021 Nov;599(7886):673-678; antibody #33). The DDR1-negative population was selected for continuous culture for 1 week. The sorted and expanded cells were collected for a second round of sorting to generate a >99% DDR1-negative population. This CT26 cell pool was negative for mycoplasma pathogens and mouse pathogens (Mouse Essential CLEAR panel, Charles River Research Animal Diagnostic Services).
[0233] Tumor mouse model: Female BALB / c mice (BALB / cAnNCrl strain) (n = 20; age = 6-8 weeks) obtained from Charles River Laboratories were used in this study. Mice weighed approximately 17-25 g at the time of inoculation.
[0234] The CT26 tumor cell line was used in the study and is described in Tables 15 and 16 below. [Table 15] [Table 16]
[0235] Figure 17 shows the design of a tumor kinetics study using CT26 (wild-type DDR1 (WT) and DDR1 knockout (KO)) cell lines in Balb / c mice. Tumor volume (TV) (mm 3 ) and body weight (BW) were monitored 2-3 times weekly throughout the study period, and the changes were plotted as shown in Figures 18A and 18B. Mice with tumor volumes >2,000 mm 3 Mice were removed from the average when a tumor volume of 0.01 mm was reached or the animal died, whichever occurred first. This reduced the average tumor volume at later time points. Individual tumor volumes are shown in Figures 19A and 19B.
[0236] On day 31 of the study, all mice were alive and the TV (mean ± SEM) of animals in CT26 WT (Group 1 (G1)) was 2156.77 ± 371.38 mm 3 and CT26 KO (Group 2 (G2)) was 1126.50 ± 290.45 mm 3 It was.
[0237] Body weight (BW) changes did not differ between groups throughout the study. There were no unexpected deaths or clinical findings during the study, except for G1 mouse #3532, which was euthanized due to morbidity.
[0238] Survival and terminal blood (serum) were collected 2 days prior to study initiation (day 2) and at study endpoint (day 28), respectively. Additionally, at study endpoint (day 28), half of the tumors were placed in 10% formalin, and the other half of the tumors were snap-frozen in liquid nitrogen (Figure 17).
[0239] Incorporation by Reference All patent and non-patent literature references cited above are incorporated herein by reference in their entirety.
Claims
1. A method for reducing tumor immune rejection in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
2. 1. A method of reducing tumor burden in a subject in need thereof, comprising administering to the subject an anti-DDR1 antibody that specifically binds to human DDR1 and an immune checkpoint inhibitor, wherein the anti-DDR1 antibody is administered at a dose of 5 mg to 2000 mg.
3. 3. The method of claim 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 1600 mg.
4. 3. The method of claim 1 or 2, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg to about 800 mg.
5. 5. The method of any one of claims 1 to 4, wherein the anti-DDR1 antibody is administered at a dose of about 8 mg, about 24 mg, about 80 mg, about 240 mg, about 400 mg, about 800 mg, or about 1600 mg.
6. 6. The method of any one of claims 1 to 5, wherein the anti-DDR1 antibody is administered at a dose of 8 mg, 24 mg, 80 mg, 240 mg, 400 mg, 800 mg, or 1600 mg.
7. The method of any one of claims 1 to 6, wherein the anti-DDR1 antibody is administered intravenously.
8. The method of any one of claims 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 60 minutes.
9. The method of any one of claims 1 to 7, wherein the anti-DDR1 antibody is administered by intravenous infusion over 30 minutes.
10. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered once weekly.
11. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered once every two weeks.
12. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered once every three weeks.
13. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered once every four weeks.
14. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered once every 8 weeks.
15. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 8 mg once every three weeks.
16. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 24 mg once every three weeks.
17. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 80 mg once every three weeks.
18. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 240 mg once every three weeks.
19. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 400 mg once every three weeks.
20. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 800 mg once every three weeks.
21. 10. The method of any one of claims 1 to 9, wherein the anti-DDR1 antibody is administered intravenously at a dose of 1600 mg once every three weeks.
22. 22. The method of any one of claims 1 to 21, wherein the immune checkpoint inhibitor comprises a PD-1 or PD-L1 antagonist.
23. 23. The method of any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 100 mg to 2000 mg.
24. 23. The method of any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 200 mg, 240 mg, 350 mg, 360 mg, 400 mg, 480 mg, 500 mg, 840 mg, 1000 mg, 1200 mg, 1500 mg, or 1680 mg.
25. 23. The method of any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 0.5 mg / kg to 30 mg / kg.
26. 23. The method of any one of claims 1-22, wherein the PD-1 or PD-L1 antagonist is administered at a dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, 10 mg / kg, or 20 mg / kg.
27. 27. The method of any one of claims 1 to 26, wherein the PD-1 or PD-L1 antagonist is administered intravenously.
28. 28. The method of any one of claims 1-27, wherein the PD-1 or PD-L1 antagonist is administered once weekly.
29. 28. The method of any one of claims 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every two weeks.
30. 28. The method of any one of claims 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every three weeks.
31. 28. The method of any one of claims 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every four weeks.
32. 28. The method of any one of claims 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every six weeks.
33. 28. The method of any one of claims 1 to 27, wherein the PD-1 or PD-L1 antagonist is administered once every 8 weeks.
34. 10. The method of any one of the preceding claims, wherein the subject has cancer.
35. 35. The method of claim 34, wherein said administering said anti-DDR1 antibody and said PD-1 or PD-L1 antagonist treats said cancer in said subject.
36. 35. The method of claim 34, wherein the PD-1 antagonist is an anti-PD-1 antibody that specifically binds to human PD-1.
37. The method of claim 34, wherein the PD-L1 antagonist is an anti-PD-L1 antibody that specifically binds to human PD-L1.
38. 37. The method of claim 36, wherein the anti-PD-1 antibody is pembrolizumab, nivolumab, dostallimab, cemiplimab, sintilimab, penprimab, tislelizumab, toripalimab, or retifanlimab.
39. 38. The method of claim 37, wherein the anti-PD-L1 antibody is avelumab, atezolizumab, or durvalumab.
40. 37. The method of any one of claims 1 to 36, wherein the PD-1 antagonist is pembrolizumab.
41. 41. The method of claim 40, wherein pembrolizumab is administered at a dose of 400 mg once every six weeks.
42. 41. The method of claim 40, wherein pembrolizumab is administered at a dose of 200 mg once every three weeks.
43. 41. The method of claim 40, wherein pembrolizumab is administered at a dose of 2 mg / kg once every three weeks.
44. The method of any one of claims 1 to 36, wherein the PD-1 antagonist is nivolumab.
45. 45. The method of claim 44, wherein nivolumab is administered at a dose of 240 mg once every two weeks.
46. 45. The method of claim 44, wherein nivolumab is administered at a dose of 360 mg once every three weeks.
47. 45. The method of claim 44, wherein nivolumab is administered at a dose of 480 mg once every four weeks.
48. 45. The method of claim 44, wherein nivolumab is administered at a dose of 3 mg / kg once every two weeks.
49. 45. The method of claim 44, wherein nivolumab is administered at a dose of 3 mg / kg once every three weeks.
50. The method of any one of claims 1 to 36, wherein the PD-1 antagonist is cemiplimab.
51. 51. The method of claim 50, wherein cemiplimab is administered at a dose of 350 mg once every three weeks.
52. The method of any one of claims 1 to 36, wherein the PD-1 antagonist is dostarlimab.
53. 53. The method of claim 52, wherein dostarlimab is administered at a dose of 500 mg once every three weeks.
54. 53. The method of claim 52, wherein dostarlimab is administered at a dose of 1000 mg once every six weeks.
55. 38. The method of any one of claims 1 to 35, or 37, wherein the PD-L1 antagonist is atezolizumab.
56. 56. The method of claim 55, wherein atezolizumab is administered at a dose of 840 mg once every two weeks.
57. 56. The method of claim 55, wherein atezolizumab is administered at a dose of 1200 mg once every three weeks.
58. 56. The method of claim 55, wherein atezolizumab is administered at a dose of 1680 mg once every four weeks.
59. 38. The method of any one of claims 1 to 35, or 37, wherein the PD-L1 antagonist is durvalumab.
60. 60. The method of claim 59, wherein durvalumab is administered at a dose of 10 mg / kg once every two weeks.
61. 60. The method of claim 59, wherein durvalumab is administered at a dose of 20 mg / kg once every three weeks.
62. 60. The method of claim 59, wherein durvalumab is administered at a dose of 1500 mg once every three weeks.
63. 10. The method of any one of the preceding claims, wherein the cancer expresses DDR1.
64. 10. The method of any one of the preceding claims, wherein the cancer is a solid cancer.
65. 10. The method of any one of the preceding claims, wherein the cancer is a locally advanced or metastatic solid cancer.
66. 10. The method of any one of the preceding claims, wherein the cancer is unresectable.
67. 10. The method of any one of the preceding claims, wherein the cancer is refractory to immunotherapy.
68. The immunotherapy is selected from the group consisting of an antagonist anti-PD-1 antibody, an antagonist anti-PD-L1 antibody, an antagonist anti-PD-1 / PD-L1 antibody, an antagonist anti-PD-L2 antibody, an antagonist anti-CTLA-4 antibody, an antagonist anti-BTLA antibody, an antagonist anti-TREMR antibody, an antagonist anti-TIGIT antibody, an antagonist anti-VISTA antibody, an antagonist anti-TIM antibody, 68. The method of claim 67, wherein the antibody is an agonist anti-CD137 antibody, an antagonist anti-DR3 antibody, an agonist anti-TNFSF14 antibody, an agonist anti-CD27 antibody, an agonist anti-ICOS antibody, or an agonist anti-CD28 antibody.
69. 68. The method of claim 67, wherein the immunotherapy is an antagonist anti-PD-L1 antibody.
70. 10. The method of any one of the preceding claims, wherein the cancer is not a sarcoma, hepatocellular carcinoma, or glioma.
71. 10. The method of any one of the preceding claims, wherein the cancer is pancreatic cancer, lung cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, head and neck cancer, gastric (stomach) cancer, ovarian cancer, breast cancer, kidney cancer, prostate cancer, cervical cancer, brain cancer, skin cancer, melanoma, cholangiocarcinoma, or bone cancer.
72. 10. The method of any one of the preceding claims, wherein the cancer is colorectal cancer, ovarian cancer, or non-small cell lung cancer.
73. 10. The method of any one of the preceding claims, wherein the subject is not a candidate for standard of care treatment.
74. 10. The method of any one of the preceding claims, wherein the cancer is refractory to standard therapeutic treatment.
75. 75. The method of claim 74, wherein the standard of care treatment is chemotherapy or radiation.
76. The method of any one of claims 1 to 75, wherein administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist reduces tumor size in the subject.
77. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have confirmed metastatic or progressive unresectable cancer with measurable disease by Response Evaluation Criteria in Solid Tumors (RECIST) v1.1; b) have pathologically proven advanced, unresectable, or metastatic cancer that is refractory or intolerant to standard treatments known to confer benefit, or for which standard treatments are not available; c) have an Eastern Cooperative Oncology Group performance status (PS) of 0-1; d) have a predicted life expectancy of ≥ 3 months; e) Below: i) Calculated creatinine clearance (CrCL) ≥ 50 mL / min according to Cockcroft-Gault calculation; ii) total bilirubin ≤ 1.5; iii) AST and ALT ≤ 2.5 × ULN; iv) hemoglobin ≥ 9.0 g / dL; v) Platelets ≥ 100 x 10 9 cells / L; or vi) absolute neutrophil count ≥ 1.5 x 10 9 cells / L having one or more of: f) a corrected QT interval (QTc) of ≦470 ms (as calculated by the Fridericia formula); and / or g) not receiving other cancer therapy; 10. A method according to any one of the preceding claims.
78. Prior to administration of the anti-DDR1 antibody and the PD-1 or PD-L1 antagonist, the subject: a) have not received prior treatment with a systemic agent, including a radioimmunoconjugate, antibody-drug conjugate, immune / cytokine, or monoclonal antibody, within 28 days or 5 half-lives of the drug, whichever is shorter; b) no ongoing toxicity from prior therapy; c) no major surgery within <3 months prior to administration of the anti-DDR1 antibody; d) has not received radiation therapy <28 days prior to administration of the anti-DDR1 antibody; e) have not undergone organ transplantation, allogeneic stem cell transplantation, or autologous stem cell transplantation; f) no diagnosis of primary or acquired immunodeficiency; g) not having been treated with systemic steroids or any other form of immunosuppressive therapy within 14 days prior to administration of said anti-DDR1 antibody; h) No active central nervous system (CNS) tumor involvement that has not been definitively treated with surgery or radiation; i) no active autoimmune disease requiring immunosuppressive therapy or history of such disease; j) no clinical symptoms of CNS metastases within 28 days prior to administration of said anti-DDR1 antibody; and / or k) no leptomeningeal carcinomatosis; 10. A method according to any one of the preceding claims.
79. The method of any one of the preceding claims, wherein the anti-DDR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequences of CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence shown in SEQ ID NO: 7, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRH1, CDRH2, or CDRH3 amino acid sequences; and / or a light chain variable region (VL) comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of the VL amino acid sequence shown in SEQ ID NO: 8 or 9, or a variant thereof comprising 1 to 5 amino acid changes in any one of the CDRL1, CDRL2, or CDRL3 amino acid sequences.
80. (a) the VH is each SEQ ID NO: 1, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 2, or a variant thereof comprising 1-5 amino acid changes, and SEQ ID NO: 3, or a variant thereof containing 1-5 amino acid changes and / or (b) each of the VL's is: SEQ ID NO: 4, or a variant thereof comprising 1 to 5 amino acid changes; SEQ ID NO: 5, or a variant thereof comprising 1 to 5 amino acid changes, and SEQ ID NO: 6, or a variant thereof containing 1-5 amino acid changes comprising the amino acid sequences of CDRL1, CDRL2, and CDRL3 of 80. The method of claim 79.
81. The method of claim 79 or 80, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 shown in SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively.
82. The method of any one of claims 79 to 81, wherein the anti-DDR1 antibody that specifically binds to human DDR1 comprises a VH comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 7; and / or a VL comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 8 or 9.
83. 83. The method of claim 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO:7 and a VL comprising the amino acid sequence set forth in SEQ ID NO:
8.
84. 83. The method of claim 82, wherein the anti-DDR1 antibody comprises a VH comprising the amino acid sequence set forth in SEQ ID NO:7 and a VL comprising the amino acid sequence set forth in SEQ ID NO:
9.
85. The method of any one of claims 79 to 84, wherein the anti-DDR1 antibody comprises a heavy chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 10 or 11, and / or a light chain comprising an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO:
12.
86. 10. The method of any one of the preceding claims, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10 and a light chain comprising the amino acid sequence set forth in SEQ ID NO:
12.
87. 86. The method of any one of claims 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 10 without the terminal lysine, and a light chain comprising the amino acid sequence set forth in SEQ ID NO:
12.
88. The method of any one of claims 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence shown in SEQ ID NO: 11 and a light chain comprising the amino acid sequence shown in SEQ ID NO:
12.
89. 86. The method of any one of claims 1 to 85, wherein the anti-DDR1 antibody comprises a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 11 without the terminal lysine, and a light chain comprising the amino acid sequence set forth in SEQ ID NO:
12.
90. 10. The method of any one of the preceding claims, wherein the anti-DDR1 is administered to the subject prior to the PD-1 or PD-L1 antagonist.
91. 2. The method of any one of the preceding claims, wherein the anti-DDR1 antibody is administered to the subject after the PD-1 or PD-L1 antagonist.
92. 2. The method of any one of the preceding claims, wherein the anti-DDR1 antibody is administered to the subject simultaneously with the PD-1 or PD-L1 antagonist.
93. 10. The method of any one of the preceding claims, wherein administration of the antibody and the immune checkpoint inhibitor prevents further growth in tumor size in the subject.
94. 10. The method of any one of the preceding claims, wherein administration of the antibody and the immune checkpoint inhibitor achieves at least stable disease in the subject.
95. 10. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein said treatment is carried out according to the method of any one of the preceding claims.
96. 10. An anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the manufacture of a medicament for the treatment of cancer, wherein said treatment is carried out according to the method of any one of the preceding claims.
97. 10. Use of an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for the treatment of cancer, said treatment being carried out according to the method of any one of the preceding claims.
98. A therapeutic combination comprising an antibody that specifically binds to human DDR1 and a PD-1 or PD-L1 antagonist.
99. 10. A combination comprising an anti-DDR1 antibody and a PD-1 or PD-L1 antagonist for use in the treatment of cancer, wherein the treatment is carried out according to the method of any one of the preceding claims.