Canine PD-L1 antibodies, antigen-binding fragments thereof, and methods of use thereof
Caninized antibodies targeting canine PD-L1 effectively inhibit PD-L1/PD-1 interaction, addressing limited response rates in cancer therapies and providing a predictive model for human treatment strategies.
Patent Information
- Application Number
- JP2025528507
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-15
- Filing Date
- 2023-11-14
- Publication Date
- 2025-11-28
AI Technical Summary
Current immune checkpoint inhibitor therapies for cancer, particularly PD-1/PD-L1 blockade, have limited response rates (10-40%) and lack effective animal models for optimizing treatment strategies in humans and dogs, where many cancers remain untreatable.
Development of caninized antibodies and antigen-binding fragments that specifically bind to canine PD-L1, with complementarity-determining regions (CDRs) showing at least 80% sequence identity, and methods for administering these antibodies to inhibit PD-L1/PD-1 interaction in canine subjects, along with the use of caninized PD-L1 mice for predicting and modeling anti-cancer activity of test compounds.
The caninized antibodies demonstrate therapeutic efficacy in inhibiting PD-L1/PD-1 interaction, showing promise in treating invasive urothelial carcinoma in dogs and providing a predictive model for human treatment success.
Smart Images

Figure 2025538435000001_ABST
Abstract
Description
[Technical Field]
[0001] Priority This patent application is related to and claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 383,909, filed November 15, 2022, the contents of which are incorporated by reference in their entirety as part of this disclosure.
[0002] Technical Field The present disclosure relates to anti-canine programmed death-ligand 1 (PD-L1) antibodies, antigen-binding fragments thereof, complementarity-determining regions (CDRs) thereof, and caninized antibodies against canine PD-L1. Also provided are methods for predicting and modeling the anti-cancer activity of test compounds in subjects using these antibodies, CDRs, and / or antigen-binding fragments. [Background technology]
[0003] background In a normal, healthy system, immune checkpoints are surface proteins that exist to check and prevent overstimulation of the immune response. In other words, their role is to prevent the immune response from becoming too strong and destroying healthy cells in the body. In the case of cancer, when T cell checkpoint proteins (e.g., programmed cell death protein 1 (PD-1)) bind to binding proteins (e.g., programmed death-ligand 1 (PD-L1)) on tumor cells, they send an "off" signal to T cells, suppressing the anti-tumor immune response. In this way, tumor killer cells within the immune system are unable to kill tumors because their attack methods are blocked by the tumor's own checkpoints.
[0004] Immune checkpoint inhibitor therapy works by using immune checkpoint inhibitors to block checkpoint proteins from binding to their ligands on tumor cells. PD-1, cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), lymphocyte activation 3 (LAG3), T-cell immunoglobulin and mucin domain-containing protein 3 (TIM3), T-cell immunoreceptor with Ig and ITIM domains (TIGIT), and V-domain Ig suppressor of T-cell activation (VISTA) are some examples of checkpoint proteins. Immune checkpoint inhibitor therapy is the most promising form of cancer immunotherapy and has been successful in multiple cancer types, including invasive bladder cancer. In particular, inhibition of the PD-1 / PD-L1 pathway using anti-PD-1 or anti-PD-L1 antibodies has resulted in durable clinical responses in cancer patients, for example, by normalizing imbalanced antitumor immunity.
[0005] The U.S. Food and Drug Administration (FDA) has approved three PD-1 antibodies (pembrolizumab (Keytruda®), nivolumab (Opdivo®), and semipilimab) and three PD-L1 antibodies (atezolizumab, avelumab, and durvalumab) for multiple human cancer types, given their promising and durable clinical responses. While this milestone suggests the promise of cancer immunotherapy, the current status of PD-1 / PD-L1 blockade in cancer remains unsatisfactory due to limited response rates (10–40%). Therefore, new immunotherapy strategies that improve the therapeutic efficacy of current PD-1 / PD-L1 blockade are urgently needed.
[0006] Strategies for improving PD-1 / PD-L1 inhibitor therapy in bladder cancer and other cancers include: 1) identifying host factors, such as genetics, immune status, and molecular subtype, that drive response; 2) evaluating biomarkers and biomarker combinations to predict response and personalize therapy; 3) developing better tools for monitoring immune effects; and 4) selecting drug combination approaches / regimens that address multiple "defects" in the immune response in addition to PD-1 / PD-L1 inhibition. To develop these strategies and test combination approaches, relevant preclinical animal models are typically used. Factors that are likely to affect the PD-1 / PD-L1 axis and therefore can be represented in animal models include aggressive and metastatic cancer behavior, tumor heterogeneity, mutational landscape, genetic and epigenetic crosstalk, molecular subtypes of cancer, immune cell responsiveness, and innate and adaptive mechanisms of drug resistance. Although rodent models, including carcinogenesis-induced, engrafted, and genetically engineered models, aid in cancer research, they lack the collective characteristics important for studying emerging therapies within and across molecular subtypes of bladder cancer and predicting treatment success in humans. What is needed are animal models that can be used to optimize checkpoint inhibitor therapy in humans.
[0007] Furthermore, much rodent data is not predictive for dogs, particularly with regard to immune checkpoint inhibitor therapy. Many cancers remain untreatable in dogs, and therapeutic approaches that are effective in one cancer often fail in another. Therefore, there is also a need to treat specific forms of cancer in dogs. Summary of the Invention
[0008] overview Provided is a caninized antibody or antigen-binding fragment thereof that binds to programmed death-ligand 1 (PD-L1) in a canine subject. In certain embodiments, the antibody or antigen-binding fragment thereof is encoded by a nucleotide sequence that comprises at least 80% sequence identity to (e.g., comprises) SEQ ID NO:2 and / or 4 or SEQ ID NO:6 and / or 8.
[0009] The antibody or antigen-binding fragment thereof may comprise one or more complementarity-determining regions (CDRs) comprising AAS, SEQ ID NO:9, and / or SEQ ID NO:10. The antibody or antigen-binding fragment thereof comprises CDRs, each CDR comprising at least 80% sequence identity with SEQ ID NO:17, WTS, and / or SEQ ID NO:12 (e.g., comprising SEQ ID NO:17, WTS, and / or SEQ ID NO:12). The antibody or antigen-binding fragment thereof may comprise CDRs that independently comprise at least 80% sequence identity with SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:11 (e.g., comprising SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:11). The antibody or antigen-binding fragment thereof may comprise CDRs that independently comprise at least 80% sequence identity with SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13 (e.g., comprising SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13).
[0010] In certain embodiments, the antibody or antigen-binding fragment thereof is fully or incompletely caninized.
[0011] The antibody or antigen-binding fragment thereof may be a chimeric form of a caninized antibody or antigen-binding fragment. In certain embodiments, the antibody or antigen-binding fragment thereof is capable of specifically binding to canine PD-L1. In certain embodiments, the antibody or antigen-binding fragment thereof comprises a caninized murine PD-1 antibody or antigen-binding fragment thereof.
[0012] Also provided are methods for treating cancer in a canine subject. Such methods may comprise administering to the canine subject a therapeutically effective amount of a caninized antibody or antigen-binding fragment thereof that binds to PD-L1 and inhibits PD-L1 / PD-1 interaction in the subject.
[0013] The caninized antibody or antigen-binding fragment thereof of the present methods can include a caninized antibody or antigen-binding fragment thereof described herein. In certain embodiments, for example, the caninized antibody or antigen-binding fragment thereof is encoded by a nucleotide sequence comprising at least 80% sequence identity to SEQ ID NO:2 and / or 4 or SEQ ID NO:6 and / or 8. The caninized antibody or antigen-binding fragment thereof can comprise one or more CDRs independently comprising at least 80% sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. The caninized antibody or antigen-binding fragment thereof can comprise one or more CDRs independently comprising at least 80% sequence identity to SEQ ID NO:18, WTS, and / or SEQ ID NO:12. The caninized antibody or antigen-binding fragment thereof can comprise one or more CDRs independently comprising at least 80% sequence identity to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13.
[0014] In certain embodiments of this method, the caninized antibody or antigen-binding fragment thereof is encoded by a nucleotide sequence comprising SEQ ID NO:2 and / or 4 or SEQ ID NO:6 and / or 8. In certain embodiments of this method, the caninized antibody or antigen-binding fragment thereof comprises one or more CDRs comprising AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments of this method, the caninized antibody or antigen-binding fragment thereof comprises one or more CDRs comprising SEQ ID NO:17, WTS, and / or SEQ ID NO:12. In certain embodiments of this method, the caninized antibody or antigen-binding fragment thereof comprises one or more CDRs comprising SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:11. The caninized antibody or antigen-binding fragment thereof of this method may comprise one or more CDRs comprising SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13.
[0015] In certain embodiments, the therapeutically effective amount is about 2 mg / kg of a subject's body weight (e.g., 2 mg / kg of a subject's body weight) to about 5 mg / kg of a subject's body weight (e.g., 5 mg / kg of a subject's body weight). The therapeutically effective amount may be 2 mg / kg of a subject's body weight. The therapeutically effective amount may be 5 mg / kg of a subject's body weight. The therapeutically effective amount may be about 2.5 mg / kg of a subject's body weight (e.g., 2.5 mg / kg of a subject's body weight) to about 4.5 mg / kg of a subject's body weight (e.g., 4.5 mg / kg of a subject's body weight). The therapeutically effective amount may be about 3.0 mg / kg of a subject's body weight (e.g., 3.0 mg / kg of a subject's body weight) to about 4.0 mg / kg of a subject's body weight (e.g., 4.0 mg / kg of a subject's body weight). The therapeutically effective amount may be about 2.5 mg / kg of a subject's body weight (e.g., 3.0 mg / kg of a subject's body weight) to about 3.5 mg / kg of a subject's body weight (e.g., 3.5 mg / kg of a subject's body weight). The therapeutically effective amount may be 2 mg / kg of a subject's body weight. A therapeutically effective amount may be 5 mg / kg of a subject's body weight. A therapeutically effective amount may be about 5.0 mg / kg of a subject's body weight (e.g., 5.0 mg / kg of a subject's body weight) to about 10.0 mg / kg of a subject's body weight (e.g., 10.0 mg / kg of a subject's body weight). A therapeutically effective amount may be about 5.5 mg / kg of a subject's body weight (e.g., 5.5 mg / kg of a subject's body weight) to about 9.5 mg / kg of a subject's body weight (e.g., 9.5 mg / kg of a subject's body weight). A therapeutically effective amount may be about 6.0 mg / kg of a subject's body weight (e.g., 6.0 mg / kg of a subject's body weight) to about 9.0 mg / kg of a subject's body weight (e.g., 9.0 mg / kg of a subject's body weight). A therapeutically effective amount may be about 6.5 mg / kg of a subject's body weight (e.g., 6.5 mg / kg of a subject's body weight) to about 8.5 mg / kg of a subject's body weight (e.g., 8.5 mg / kg of a subject's body weight). A therapeutically effective amount can be from about 7.0 mg / kg of subject body weight (e.g., 7.0 mg / kg of subject body weight) to about 8.0 mg / kg of subject body weight (e.g., 8.0 mg / kg of subject body weight). A therapeutically effective amount can be from about 7.5 mg / kg of subject body weight (e.g., 7.5 mg / kg of subject body weight) to about 7.8 mg / kg of subject body weight (e.g., 7.8 mg / kg of subject body weight). The ranges specified in this paragraph include the recited endpoints and all 0.1 mg / kg increments within the specified range.
[0016] The cancer can be invasive urothelial carcinoma.
[0017] In certain embodiments of the method, the antibody or antigen-binding fragment thereof is formulated into a pharmaceutical composition.
[0018] Pharmaceutical compositions are also provided, hi certain embodiments, comprising any of the caninized antibodies or antigen-binding fragments thereof described herein and a pharmaceutically acceptable excipient.
[0019] Also provided are methods for predicting and modeling the anti-cancer activity of test compounds in subjects (e.g., having cancer). In certain embodiments, such methods comprise generating a population of caninized PD-L1 mice that express canine PD-L1 on their cell surfaces; assessing the toxicity risk and / or efficacy in treating cancer of a set of test compounds in the caninized PD-L1 mouse population; and selecting one or more test compounds from the set that meet established toxicity risk and / or efficacy criteria.
[0020] Generating the caninized PD-L1 mouse population may further comprise using CRISPR to replace the mouse cd274 gene in the mouse population with the canine PD-L1 gene.
[0021] The method may further comprise assessing the toxicity risk and / or efficacy of one or more selected compounds in treating cancer in a human or canine cohort. In certain embodiments, the method may comprise assessing the oral bioavailability, adsorption, distribution, metabolism, and excretion (ADME) values of a set of test compounds in a caninized PD-L1 mouse population. In certain embodiments, the method further comprises assessing the oral bioavailability and ADME values of one or more selected test compounds in a caninized PD-L1 mouse population.
[0022] In certain embodiments, the set of test compounds includes at least a compound that inhibits PD-L1 / PD-1 interaction in a subject.
[0023] CDRs of the antibody or antigen-binding fragment thereof are also provided. The CDRs may comprise at least 80% sequence identity with AAS, SEQ ID NO:9, and / or SEQ ID NO:10. The CDRs of the antibody or antigen-binding fragment thereof may comprise at least 80% sequence identity with SEQ ID NO:18, WTS, and / or SEQ ID NO:12. The CDRs of the antibody or antigen-binding fragment thereof may comprise at least 80% sequence identity with SEQ ID NO:16, SEQ ID NO:17, and / or SEQ ID NO:11. The CDRs may comprise at least 80% sequence identity with SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13. The CDRs may comprise at least 80% sequence identity with SEQ ID NO:17, WTS, and / or SEQ ID NO:12. The CDRs of the antibody or antigen-binding fragment thereof may comprise at least 80% sequence identity with SEQ ID NO:16, SEQ ID NO:17, and / or SEQ ID NO:11. The CDRs of the antibody or antigen-binding fragment thereof may comprise at least 80% sequence identity to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13.
[0024] In certain embodiments, there is provided a use of a caninized antibody or antigen-binding fragment thereof of the present disclosure, a pharmaceutical composition described herein, or one or more of the CDRs described herein, such use in the preparation of a medicament for treating cancer in a canine subject.
[0025] Other features, advantages, and aspects of the disclosed embodiments and those contained herein, as well as the accomplishments thereof, will become apparent in light of the following detailed description of various exemplary embodiments of the present disclosure, which will be better understood when considered in conjunction with the accompanying drawings. [Brief explanation of the drawings]
[0026] [Figure 1]Figure 1 shows a schematic flow chart depicting the production and validation of the canine PD-L1 antibody used herein, including (A) antigen immunization, canine PD-L1 protein (cPD-L1) injection, (B) hybridoma establishment (over 2,000 clones), (C) cPD-L1-specific antibody (Ab) selection by live cell-based antibody binding assay, (D) therapeutic Ab selection by cPD-1 / PD-L1 inhibition assay, (E) in vivo validation of the therapeutic efficacy of cPD-L1 antibody in canine PD-L1 alone (i.e., caninized PD-L1 mice) and PD-1-bearing mice, (F) cPD-L1 chimeric Ab production (mouse / dog), (G) validation of the cPD-L1 chimeric Ab, and (H) initial safety profile and PK assay in dogs. [Figure 2A] Figure 2A is a schematic diagram of the canine programmed death-ligand 1 (cPD-L1) antibody binding assay. [Figure 2B] Figure 2B is a schematic diagram of the cPD-L1 / canine programmed death protein 1 (cPD-1) inhibition assay. [Figure 2C] Figure 2C is a kinetic graph showing the quantitative binding of programmed death-ligand 1 (PD-L1) antibodies on cPD-L1-expressing BT549 cells at each 3-hour time point, with positive clones highlighted in red. [Figure 2D] Figure 2D shows a representative image of cPD-L1 antibody binding (18 hours), with a green fluorescent merged image of cPD-L1-expressing cells. [Figure 2E] Figure 2E is a kinetic graph showing the quantitative binding of PD-1 protein on cPD-L1-expressing BT549 cells at various time points after addition of cPD-L1 antibody. Positive clones that inhibited PD-L1 / PD-1 protein interaction are highlighted in red. [Figure 2F] Figure 2F shows a representative image of cPD-L1 inhibition (18 hours), showing a green fluorescent merge image of cPD-L1-expressing cells. Note that no fluorescence is observed because the antibody binds to PD-L1 and inhibits its interaction with cPD-1. [Figure 3A]Figure 3A is a schematic diagram depicting the knock-in strategy for mice (c57BL / c background) containing canine PD-L1 and PD-1 molecules. [Figure 3B] Figure 3B demonstrates the validation of cPD-L1 protein expression in MB49cPD-L1 cells, showing flow cytometry analysis of membrane-localized mPD-L1 and cPD-L1 proteins in MB49 cells expressing cPD-L1 (MB49cPD-L1) or MB49 parental cells. [Figure 3C] Figure 3C shows the immunofluorescence staining and protein expression patterns of mPD-L1 and cPD-L1 in MB49 or MB49cPD-L1 tumor masses derived from caninized PD-L1 mice (DAPI used for nuclear counterstaining; scale bar 100 μM). [Figure 3D] Figure 3D is a graph showing the interaction of canine PD-1 (cPD-1) or mouse PD-1 (mPD-1) protein with cPD-L1 or mouse PD-L1 (mPD-L1) protein, with or without canine PD-L1 antibody (12C). Histidine (His)-tagged canine or mPD-L1 protein was immobilized on a nickel-nitriloacetic acid (Ni-NTA) 96-well plate, and a horseradish peroxidase (HRP)-conjugated anti-human IgG Fc-specific secondary antibody was added along with the mPD-1-hFc or cPD-1-hFc protein. The amount of bound PD-1 protein was quantified by measuring OD450. [Figure 3E] Figure 3E shows the binding of cPD-L1 antibodies 12C and 3C to human PD-L1 (hPD-L1), mPD-L1, and cPD-L1 proteins. His-tagged human PD-L1, mPD-L1, or cPD-L1 proteins were immobilized on a Ni-NTA 96-well plate, and anti-cPD-L1 Ab 12C or 3C was added along with an HRP-conjugated anti-dog IgG specific secondary antibody. The amount of bound PD-L1 antibody was quantified by measuring OD450 (Ab = antibody). [Figure 3F]Figure 3F shows data on MB49cPD-L1 tumor growth in caninized PD-L1 mice treated with the cPD-L1 antibodies 12C or 3C. The IgG isotype of the 12C and 3C antibodies is murine IgG1, which is equivalent to human IgG4. Tumors were measured at the indicated time points and excised at endpoint (n=8 / group). [Figure 3G] Figure 3G shows representative images of immunofluorescence staining of the protein expression patterns of CD8 and granzyme B in MB49 tumor masses from mice treated with IgG, 12C, or 3C. DAPI was used for nuclear counterstaining. Scale bar, 100 μm. [Figure 3H] Figures 3H and 3I show quantification of CD8 (Figure 3H) and granzyme B (Figure 3I) in immunofluorescence staining and protein expression patterns using Gen5 software (BioTek, Winooski, VT). n=10. [Figure 3I] Figures 3H and 3I show quantification of CD8 (Figure 3H) and granzyme B (Figure 3I) in immunofluorescence staining and protein expression patterns using Gen5 software (BioTek, Winooski, VT). n=10. [Figure 3J] Figures 3J and 3K are graphs showing representative effects of treatment on PD-L1 mice, where mouse kidney (Figure 3J) and liver (Figure 3K) function was measured at the end of the study. ALT is alanine aminotransferase. Treatment with PD-L1 antibodies had no effect on kidney function (serum creatinine) or liver enzyme activity (ALT = alanine aminotransferase), as measured in blood drawn at the end of the study. [Figure 3K] Figures 3J and 3K are graphs showing representative effects of treatment on PD-L1 mice, where mouse kidney (Figure 3J) and liver (Figure 3K) function was measured at the end of the study. ALT is alanine aminotransferase. Treatment with PD-L1 antibodies had no effect on kidney function (serum creatinine) or liver enzyme activity (ALT = alanine aminotransferase), as measured in blood drawn at the end of the study. [Figure 4A] Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 4B]Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 4C]Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 4D]Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 4E]Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 4F]Figures 4A-4F show the quality attributes of purified anti-cPD-L1, 1210E4 (12C) chimeric antibody. Figure 4A shows a schematic diagram of the cPD-L1, 12C10E4 chimeric antibody expression construct, pTRIOZ-cIgG2-cPD-L1 12C10E4. Figure 4B shows sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purity of the 12C chimeric antibody under non-reducing and reducing (2-mercaptoethanol) conditions (HC, heavy chain; LC, light chain; SM, protein size marker). Figure 4C shows isoelectric focusing (IEF) analysis of the 12C chimeric antibody (preparation, pI standard). Figure 4D shows peptide mapping analysis of the cPD-L1 12C chimeric antibody (SEQ ID NO: 14). After reduction and alkylation, the 2C chimeric antibody was enzymatically digested with trypsin using a Protifi S-trap microcolumn. The peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC / MS-MS). The resulting mass spectral data were analyzed using the PEAK PTM workflow in PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Inc., and the detected MS1 and MS2 ions were mapped to the antibody's amino acid sequence. The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively. Figure 4E shows a size-exclusion chromatography (SEC) analysis of the 12C chimeric antibody (SEC standard). Figure 4F shows the matrix-assisted laser desorption / ionization (MALDI)-mass spectrometry (MS) profile of permethylated N-glycans released from the 12C chimeric antibody treated with PNGase F. The masses of the indicated glycan species represent [M+Na+] values. [Figure 5A] Figure 5A shows 12C antibody binding to BT549cPD-L1 cells. [Figure 5B] Figure 5B shows flow cytometry analysis of 12C chimeric antibody in BT549cPD-L1 cells, using cIgG as a negative control. [Figure 5C]Figure 5C shows the 12C chimeric antibody binding to cPD-L1 and cPD-L2. [Figure 5D] FIG. 5D shows binding affinity (KD) analysis of the 12C chimeric antibody by Octet. [Figure 5E] Figure 5E shows the EC50 of 12C chimeric antibody 12C10E4. EC50 = 0.419 μg / ml. Bound cPD-1 protein was quantified by measuring green fluorescence on an IncuCyte® S3 Live Cell Analysis System (Sartorius AG, Göttingen, Germany). [Figure 5F] Figures 5F and 5G show images related to data obtained from the Canine IO Panel (NanoString) analysis, which was used to examine changes in gene expression following activation of canine peripheral blood mononuclear cells (cPBMCs) from three healthy pet dogs. RNA from resting and activated PBMCs was used in the NanoString study. Approximately 700 genes were examined for changes using the Canine IO Panel. Group-wise analysis was performed using Rosalind. Comparing control and activated PBMCs, 65 genes were differentially expressed, including 30 upregulated and 35 downregulated (P<0.05, FC>1.5). In the heatmap, each column contains data from one sample. [Figure 5G] Figures 5F and 5G show images related to data obtained from the Canine IO Panel (NanoString) analysis, which was used to examine changes in gene expression following activation of canine peripheral blood mononuclear cells (cPBMCs) from three healthy pet dogs. RNA from resting and activated PBMCs was used in the NanoString study. Approximately 700 genes were examined for changes using the Canine IO Panel. Group-wise analysis was performed using Rosalind. Comparing control and activated PBMCs, 65 genes were differentially expressed, including 30 upregulated and 35 downregulated (P<0.05, FC>1.5). In the heatmap, each column contains data from one sample. [Figure 5H] Figures 5H and 5I show data on interferon gamma (IFNγ) and tumor necrosis factor alpha (TNFα) concentrations, respectively, in activated cPBMCs. [Figure 5I] Figures 5H and 5I show data on interferon gamma (IFNγ) and tumor necrosis factor alpha (TNFα) concentrations, respectively, in activated cPBMCs. [Figure 5J] Figures 5J and 5K show flow cytometry analysis of cPD-L1 protein expression in K9TCC cells or K9TCC cells expressing RFP exclusively in the nucleus (K9TCCnRFP) using 123C chimeric Ab. Intrinsic PD-L1 expression was stimulated with 50 ng / mL canine IFNγ for 12 hours. cIgG was used as a negative control. [Figure 5K] Figures 5J and 5K show flow cytometry analysis of cPD-L1 protein expression in K9TCC cells or K9TCC cells expressing RFP exclusively in the nucleus (K9TCCnRFP) using 123C chimeric Ab. Intrinsic PD-L1 expression was stimulated with 50 ng / mL canine IFNγ for 12 hours. cIgG was used as a negative control. [Figure 5L] Figure 5L shows data from quantitative reverse transcription polymerase chain reaction (RT-PCR) of cPD-L1 (CD274) mRNA expression in K9TCC or K9TCCnRFP cells. [Figure 5M] Figure 5M shows images and graphs of K9TCC cells cocultured with cPBMCs activated with CD3 antibody (100 ng / mL) and interleukin-2 (IL-2) (10 ng / mL) at a ratio of 1 tumor cell:15 cPBMC. The number of viable tumor cells at 72 hours is shown in a bar graph (right). The 12C chimeric antibody promoted tumor cell killing. [Figure 5N] FIG. 5N shows data for the analysis of IFNγ concentrations in K9TCC cells and activated cPBMCs in co-culture medium with and without 12C chimeric antibody treatment. [Figure 6A]FIG. 6A shows a schematic diagram of the enzyme-linked immunosorbent assay (ELISA) for pharmacokinetic analysis. [Figure 6B] FIG. 6B is a graph of the concentration of 12C chimeric antibody measured in the serum of dogs treated with 2 mg / kg of 12C antibody. [Figure 6C] FIG. 6C is a graph of the concentration of 12C chimeric antibody measured in the serum of dogs treated with 5 mg / kg of 12C antibody. DETAILED DESCRIPTION OF THE INVENTION
[0027] While the present disclosure is susceptible to various modifications and alternative forms, exemplary embodiments thereof have been shown by way of example in the drawings and will herein be described in detail.
[0028] Sequence Listing The sequences herein (SEQ ID NOS: 1-26) are also provided in computer-readable form encoded in a file submitted herewith and incorporated by reference. The information recorded in computer-readable form is identical to the written sequence listing provided herein in accordance with 37 C.F.R. § 1.821(f).
[0029] SEQ ID NO: 1 is the amino acid sequence of the cPD-L1 12C10E4_dK light chain of the cPD-L1 12C10E4 antibody (deduced from the DNA sequence): [ka] In the sequence, underlined is signal sequence; italic is FR; bold is CDR; bold underline is CL; * is a stop; CDR1: ESVEYYGTSL (SEQ ID NO: 9); CDR2: AAS; and CDR3: CQQSGKVPHTF (SEQ ID NO: 10).
[0030] SEQ ID NO: 2 is the nucleotide sequence of the cPD-L1_12C10E4_dK light chain of the cPD-L1 12C10E4 antibody (encoding SEQ ID NO: 1) (codon optimized for CHO cells): [ka]
[0031] SEQ ID NO: 3 is the amino acid sequence of the cPD-L1_12C10E4_dIgG2_heavy chain of the cPD-L1 12C10E4 antibody (deduced from the DNA sequence): [ka] In the formula, underlined is signal sequence; italic is FR; bold is CDR; bold underline is CH; * is a stop; CDR1: GFSLTSFG (SEQ ID NO: 15); CDR2: IWSGGST (SEQ ID NO: 16); and CDR3: ARGGPDWYFDV (SEQ ID NO: 11).
[0032] SEQ ID NO: 4 is the nucleotide sequence of the cPD-L1_12C10E4_dIgG2_heavy chain of the cPD-L1 12C10E4 antibody (encoding SEQ ID NO: 3): [ka]
[0033] SEQ ID NO: 5 is the amino acid sequence of the cPD-L1 3C8D3 dK light chain of the cPD-L1 3C chimeric antibody clone: [ka] In the sequence, underlined is signal sequence; italic is FR; bold is CDR; bold underline is CL; * is stop; CDR1: QDVGTA (SEQ ID NO: 17); CDR2: WTS; and CDR3: CQQYSSYPLTF (SEQ ID NO: 12).
[0034] SEQ ID NO: 6 is the nucleotide sequence of the cPD-L1 3C chimeric antibody clone cPD-L1_3C8D3_dK_light chain (encoding SEQ ID NO: 5): [ka]
[0035] SEQ ID NO: 7 is the amino acid sequence of the heavy chain of cPD-L1 3C chimeric antibody clone cPD-L1_3C8D3_dIgG2_ [ka] In the sequence, underlined is signal sequence; italic is FR; bold is CDR; bold underline is CL; * is a stop; CDR1: GYTFTDYV (SEQ ID NO: 18); CDR2: INPSNGDT (SEQ ID NO: 19); and CDR3: CARSDYSNYVGFAYW (SEQ ID NO: 13).
[0036] SEQ ID NO: 8 is the nucleotide sequence of the heavy chain of cPD-L1 3C chimeric antibody clone cPD-L1_3C8D3_dIgG2_ (encoding SEQ ID NO: 7): [ka]
[0037] SEQ ID NO: 9 is the amino acid sequence of CDR1: ESVEYYGTSL.
[0038] SEQ ID NO: 10 is the amino acid sequence of CDR3: CQQSGKVPHTF.
[0039] SEQ ID NO: 11 is the amino acid sequence of CDR3: ARGGGPDWYFDV.
[0040] SEQ ID NO: 12 is the amino acid sequence of CDR3: CQQYSSYPLTF.
[0041] SEQ ID NO: 13 is the amino acid sequence of CDR3: CARSDYSNYVGFAYW.
[0042] SEQ ID NO: 14 is a portion of the amino acid sequence of the cPD-L1 12Cχ antibody clone: GDTFICAVMHEALHNHYTQK.
[0043] SEQ ID NO: 15 is the amino acid sequence of CDR1: GFSLTSFG.
[0044] SEQ ID NO: 16 is the amino acid sequence of CDR2: IWSGGST.
[0045] SEQ ID NO: 17 is the amino acid sequence of CDR1: QDVGTA.
[0046] SEQ ID NO: 18 is the amino acid sequence of CDR1: GYTFTDYV.
[0047] SEQ ID NO: 19 is the amino acid sequence of CDR2: INPSNGDT.
[0048] SEQ ID NO: 20 is the nucleotide sequence of the pre-assembled guide RNA for the full-length canine CD274 cDNA (NM_001291972): CAGCAAATATCCTCATGTTTTGG.
[0049] SEQ ID NO:21 is the nucleotide sequence of the forward primer of Primer Set 1 described herein: CCACTTGGTTCTACATGGCT.
[0050] SEQ ID NO:22 is the nucleotide sequence of the reverse primer of Primer Set 1 described herein: CCTCAGCCTGACACATTAGTT.
[0051] SEQ ID NO:23 is the nucleotide sequence of the forward primer of Primer Set 2 described herein: CCTGTCACCTCTGAACATGAA.
[0052] SEQ ID NO:24 is the nucleotide sequence of the reverse primer of primer set 2 described herein: GGACTAAGCTCTAGGTTGTCC.
[0053] SEQ ID NO:25 is the nucleotide sequence of the forward primer of primer set 3 described herein: GACTGGCTTTTAGGGCTTATGT.
[0054] SEQ ID NO:26 is the nucleotide sequence of the reverse primer of primer set 3 described herein: ACACCCCACAAATTACTTCCATT.
[0055] Detailed Description For the purpose of promoting an understanding of the principles of the present disclosure, reference will now be made to the embodiments illustrated in the drawings, and specific language will be used to describe the same. It will be understood, however, that no limitation of scope is intended by the description of these embodiments. On the contrary, the present disclosure is intended to encompass alternatives, modifications, and equivalents that may be included within the spirit and scope of the present application as defined by the appended claims. As stated above, although the present technology may be illustrated and described in one or more preferred embodiments, the compositions, compounds, and methods thereof may include many different configurations, forms, materials, and accessories.
[0056] Novel canine programmed death-ligand 1 (cPD-L1) antibodies and cPD-L1 antigen-binding fragments are provided. The term "canine" includes all domesticated dogs (Canis lupus familiaris or Canis familiaris) unless otherwise specified. These antibodies and antigen-binding fragments can be used, for example, as immuno-oncology drugs. When administered, these antibodies and antigen-binding fragments can increase tumor cell-killing activity in a subject. In certain embodiments, the antibodies and their antigen-binding fragments can inhibit the immunosuppressive function of cPD-L1 in the presence of cancer cells. Given that expression of PD-L1 on T cells and natural killer (NK) cells has been reported, along with the inhibition of PD-L1 on cancer cells by the antibodies and / or their antigen-binding fragments, the direct effect of PD-L1 on T cells or other immune cells, in addition to targeting PD-L1 on cancer cells, may also enhance the efficacy of the antibodies and their antigen-binding fragments when administered to a subject.
[0057] Antibodies and Complementarity Determining Regions (CDRs) Canine programmed cell death protein 1 (PD-1) / PD-L1 inhibitor antibodies have not been widely used in dogs with invasive urothelial carcinoma (InvUC). Tumor regression has been reported in dogs with oral melanoma and soft tissue sarcoma in response to canine chimeric monoclonal antibodies targeting PD-L1. However, the antitumor efficacy of this antibody was uncertain due to the unknown role of concomitant medications in tumor regression (Maekawa et al., A canine chimeric monoclonal antibody targeting PD-L1 and its clinical efficacy in canine oral malignant melanoma or undifferentiated sarcoma, Sci Rep 7: 8951 (2017); Knapp et al., Phase I trial of piroxicam in 62 dogs bearing naturally occurring tumors, Cancer Chemother Pharmacol 29, 214-218 (1992); and Nemoto et al., Development and characterization of monoclonal antibodies against canine PD-1 and PD-L1, Vet Immunol Immunopathol 198: 19-25 (2018)). In other studies, anti-canine PD-1 and anti-PD-L1 antibodies have been developed for diagnostic purposes but have not been tested therapeutically (Choi et al., Development of canine PD-1 / PD-L1 specific monoclonal antibodies and amplification of canine T cell function, PLoS One 15: e0235518 (2020)). Therefore, canine immune checkpoint inhibitor antibodies or anti-canine PD-L1 antibodies have not previously been available for translational research or therapy in dogs.
[0058] Immunotherapeutic PD-L1 antibodies (or antigen-binding fragments thereof) are provided. As used herein, the term "antibody" refers to any form of immunoglobulin that exhibits the desired biological activity. Thus, antibody is used in the broadest sense and specifically includes, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), caninized antibodies, fully canine antibodies, chimeric antibodies, and single-domain antibodies. A "parent antibody" is an antibody obtained by exposing the immune system to an antigen before modifying the antibody for its intended use, such as caninizing an antibody for use as a canine therapeutic antibody.
[0059] The variable regions of each light / heavy chain pair form the antibody binding site. Therefore, an intact antibody generally has two binding sites. Except for bifunctional or bispecific antibodies, the two binding sites are generally identical. Generally, both heavy and light chain variable domains contain three hypervariable regions, also called CDRs, located between relatively conserved variable framework regions (FRs). These CDRs are usually sandwiched between FRs and can bind to specific epitopes. Generally, both light and heavy chain variable domains contain, from N-terminus to C-terminus, FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
[0060] As used herein, unless otherwise specified, "antibody fragment" or "antibody-binding fragment" refers to an antigen-binding fragment of an antibody, i.e., an antibody fragment that retains the ability to specifically bind to the antigen bound by the full-length antibody. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules (e.g., sc-Fv); nanobodies and multispecific antibodies formed from antibody fragments. A "Fab fragment" is composed of one light-chain constant domain, one light-chain variable domain, and one CH1 and one variable domain of a heavy chain. A "Fab fragment" may be the product of papain cleavage of an antibody. The "fragment crystallizable" (Fc) region is the tail region of an antibody that interacts with cell surface receptors and enables the antibody to activate the immune system. The Fc region contains at least two heavy-chain fragments (i.e., two identical polypeptides) containing the CH2 and CH3 domains of the antibody. The two heavy chain fragments can be held together by two or more disulfide bonds and hydrophobic interactions of the CH3 domains.
[0061] A "Fab' fragment" contains one light chain and a portion or fragment of one heavy chain containing the heavy chain variable domain (VH) and CH1 domain, as well as the region between the CH1 and CH2 domains, allowing interchain disulfide bonds to form between the two heavy chains and two Fab' fragments to form an F(ab')2 molecule.
[0062] In certain embodiments, the PD-L1 antibody (or antigen-binding fragment thereof) is a chimeric form of a caninized antibody (e.g., monoclonal) or antigen-binding fragment thereof that specifically binds to PD-L1 in a canine subject (e.g., has high binding affinity for PD-L1 in a canine subject). As used herein, a "chimeric antibody" is an antibody having variable domains from a first antibody and constant domains from a second antibody, where the first and second antibodies are from different species. For example, a chimeric antibody can be generated using variable segments (e.g., framework and CDR portions) of a gene from, e.g., a mouse antibody (e.g., a monoclonal or polyclonal antibody) together with canine or human constant segments. Thus, a typical therapeutic chimeric antibody is a hybrid protein composed of a variable domain or antigen-binding domain (e.g., one or more CDRs of a mouse antibody) from a mouse antibody and a constant domain or effector domain from a human or canine antibody, although other mammalian species can also be used. Chimeric antibodies can also contain amino acid sequences derived from protein sources other than antibodies.
[0063] In certain embodiments, the antibody or antigen-binding fragment thereof specifically binds to canine PD-L1. As used herein, an antibody or antigen-binding fragment thereof and a polypeptide comprising a given antigen sequence (e.g., a portion of the amino acid sequence of a canine antigen, e.g., cPD-L1) are said to "specifically bind" to a canine antigen, e.g., a polypeptide comprising that portion of the amino acid sequence of cPD-L1, but not to other canine proteins lacking that portion of the canine antigen's sequence. For example, an antibody that specifically binds to a polypeptide comprising canine PD-L1 may bind to a FLAG-tagged form of canine PD-L1, but will not specifically bind to other FLAG-tagged canine proteins. An antibody, or binding compound derived from the antigen-binding site of an antibody, and its canine antigen (or variant or mutein thereof) are said to "specifically bind" to that canine antigen or variant or mutein thereof if it has an affinity for that canine antigen or variant or mutein thereof that is at least 10-fold, at least 15-fold, at least 20-fold, or at least 100-fold greater than its affinity for any other canine antigen tested.
[0064] The cPD-L1 antibody may comprise the amino acid sequence of SEQ ID NO: 1 and / or 3, or SEQ ID NO: 5 and / or 7. cPD-L1 is encoded by a nucleotide sequence comprising SEQ ID NO: 2 and / or 4, or SEQ ID NO: 6 and / or 8.
[0065] In certain embodiments, the antibody (or antigen-binding fragment thereof) is caninized. In certain embodiments, the antibody (or antigen-binding fragment thereof) is fully caninized. In certain embodiments, the antibody (or antigen-binding fragment thereof) is incompletely caninized. As used herein, the term "caninized antibody" refers to a form of antibody that contains sequences derived from both a canine antibody and a non-canine (e.g., mouse or rat) antibody. Generally, a caninized antibody may comprise substantially all of at least one, and typically two, variable domains, with all or substantially all of the hypervariable loops corresponding to those of a non-canine immunoglobulin (e.g., including the six mouse anti-canine PD-L1 CDRs as exemplified below) and all or substantially all of the parent framework. A caninized antibody can also refer to an antibody in which a point mutation has been made to change a single amino acid to reflect the amino acid typically found at that position in canine versus the amino acid typically found at that position in mouse or rat species.
[0066] A caninized region is one in which the identity of an amino acid at a selected position has been changed from the original (i.e., rat or mouse) amino acid to one that more closely reflects the common canine amino acid at that position. Such changes are made to prevent or reduce host anti-antibody responses during or after treatment. Such undesirable anti-antibody responses are commonly seen when the host (in this case, a dog) detects an unusual amino acid identity at a critical position. As a non-limiting example, canine antibodies rarely have lysine at position 29, so dogs may mount an undesirable immune response to the lysine found at position 29 (Lys29). The caninization process can then result in a change of lysine 29 to alanine (Lys29Ala) in an attempt to avoid a strong immune response to the antibody, which can exhibit severe side effects. While the most common caninization changes are placed in the variable domains of therapeutic antibodies, caninization changes may be required in one or more other antibody regions as well. An anti-PD-L1 antibody (or antigen-binding fragment thereof) may include a caninized murine PD-L1 antibody or antigen-binding fragment thereof.
[0067] In certain embodiments, the antibody or antigen-binding fragment thereof comprises a caninized antibody in which all or part of the murine (or other mammalian) CDR sequences have been replaced with the corresponding canine CDR sequences or parts thereof. The antibody or antigen-binding fragment thereof may comprise a fusion of one or more variable regions from murine DNA with constant regions from canine DNA. In certain embodiments, the caninized anti-canine PD-L1 antibody is a caninized mammalian (e.g., human) anti-canine PD-L1 antibody.
[0068] CDRs are the portions of the variable regions of immunoglobulins (i.e., antibodies) and T-cell receptors that are responsible for binding to a specific antigen, epitope, or peptide. For example, the amino acid sequence of the variable domain of a complete antigen receptor contains three discontinuously arranged CDRs (CDR1, CDR2, and CDR3). Since antigen receptors generally consist of two variable domains (on two different chains, i.e., heavy and light chains), each antigen receptor contains six CDRs that can collectively contact the antigen.
[0069] The antibodies (or antigen-binding fragments thereof) may comprise one or more genetically modified CDRs. In certain embodiments, a CDR (e.g., of an antibody or antigen-binding fragment thereof) comprises AAS, SEQ ID NO:9, and / or SEQ ID NO:10, or has at least 80%, or about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80% to 100%) sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments, a CDR comprises at least 80%, or about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85% to 95%) sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments, the CDRs comprise about 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87% to 93%) sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments, the CDRs comprise about 90% (e.g., 90%) sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the CDRs (e.g., of an antibody or antigen-binding fragment thereof) comprise AAS, SEQ ID NO:9, and / or SEQ ID NO:10 or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments, the CDRs comprise a sequence substantially identical to AAS, SEQ ID NO:9, and / or SEQ ID NO:10.
[0070] In certain embodiments, the CDR comprises SEQ ID NO: 17, WTS, and / or SEQ ID NO: 12, or has at least about 80%, or about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80% to 100%) sequence identity (or is substantially identical) to SEQ ID NO: 17, WTS, and / or SEQ ID NO: 12. In certain embodiments, the CDR comprises about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85% to 95%) sequence identity to SEQ ID NO: 17, WTS, and / or SEQ ID NO: 12. In certain embodiments, the CDR comprises about 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87% to 93%) sequence identity to SEQ ID NO: 17, WTS, and / or SEQ ID NO: 12. In certain embodiments, the CDRs comprise about 90% (e.g., 90%) sequence identity to SEQ ID NO:17, WTS, and / or SEQ ID NO:12. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the CDRs (e.g., of an antibody or antigen-binding fragment thereof) comprise SEQ ID NO:17, WTS, and / or SEQ ID NO:12, or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO:17, WTS, and / or SEQ ID NO:12.
[0071] In certain embodiments, the CDR comprises SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11, or has at least about 80%, or about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80% to 100%) sequence identity (or is substantially identical) to SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11. In certain embodiments, the CDR comprises about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85% to 95%) sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11. In certain embodiments, the CDR comprises about 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87% to 93%) sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11. In certain embodiments, the CDRs comprise about 90% (e.g., 90%) sequence identity to SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the CDRs (e.g., of an antibody or antigen-binding fragment thereof) comprise SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11, or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO: 11.
[0072] In certain embodiments, the CDR comprises SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13, or has at least about 80%, or about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80% to 100%) sequence identity (or is substantially identical) to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13. In certain embodiments, the CDR comprises about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85% to 95%) sequence identity to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13. In certain embodiments, the CDR comprises about 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87% to 93%) sequence identity to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13. In certain embodiments, the CDRs comprise about 90% (e.g., 90%) sequence identity to SEQ ID NO: 18, SEQ ID NO: 19, and / or SEQ ID NO: 13. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the CDRs (e.g., of an antibody or antigen-binding fragment thereof) comprise SEQ ID NO: 18, SEQ ID NO: 19, and / or SEQ ID NO: 13, or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO: 18, SEQ ID NO: 19, and / or SEQ ID NO: 13.
[0073] In certain embodiments, the anti-cPD-L1 antibody or antigen-binding fragment thereof may comprise one or more CDRs that independently comprise at least about 80% sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:10. In certain embodiments, the anti-cPD-L1 antibody or antigen-binding fragment thereof may comprise one or more CDRs that independently comprise at least about 80% sequence identity to SEQ ID NO:17, WTS, and / or SEQ ID NO:12. In certain embodiments, the cPD-L1 antibody or antigen-binding fragment thereof may comprise one or more CDRs that independently comprise at least about 80% sequence identity to SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:11. In certain embodiments, the cPD-L1 antibody or antigen-binding fragment thereof may comprise one or more CDRs that independently comprise at least about 80% sequence identity to SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:13.
[0074] In certain embodiments, the antibody (or antigen-binding fragment thereof) comprises two or more CDRs described herein.
[0075] In certain embodiments, the antibody is a monoclonal antibody. In certain embodiments, the monoclonal antibody is a murine antibody. In certain embodiments, the monoclonal antibody is a caninized antibody. In certain embodiments, the monoclonal antibody is a caninized murine antibody. The antibody (and / or its antigen-binding fragment) may be an isolated antibody (or isolated antigen-binding fragment). An "isolated antibody" or "isolated antigen-binding fragment" refers to a purified state, meaning in this context that the molecule is substantially free of other biological molecules, such as nucleic acids, proteins, lipids, carbohydrates, or other materials, such as cellular debris and growth media. Generally, unless otherwise specified, the term "isolated" does not contemplate the complete absence of such materials, or the absence of water, buffers, or salts, unless such materials are present in amounts that would substantially interfere with experimental or therapeutic uses of the binding compounds as described herein.
[0076] In certain embodiments, the antibody is a recombinant antibody or antigen-binding fragment. In certain embodiments, the heavy chain variable domain and the light chain variable domain are linked by a flexible linker to form a single chain antibody.
[0077] The antibody or antigen-binding fragment thereof may be a Fab fragment. The antibody or antigen-binding fragment thereof may be a Fab' fragment. The antibody or antigen-binding fragment thereof may be a F(ab')2 molecule. In certain embodiments, the antibody or antigen-binding fragment thereof is a diabody. In certain embodiments, the antibody or antigen-binding fragment thereof is a domain antibody.
[0078] Also provided are nucleic acids (including isolated nucleic acids) encoding any of the antibodies, fragments, and / or portions thereof (including CDRs). In certain embodiments, nucleic acids encoding any of the light chains or caninized antibodies or portions thereof are also provided. Similarly, nucleic acids encoding any of the heavy chains or caninized antibodies or portions thereof are also provided.
[0079] The nucleic acid sequence encoding the antibody may comprise SEQ ID NO:2. In certain embodiments, the nucleic acid sequence encoding the antibody comprises at least about 80% sequence identity to SEQ ID NO:2, or has about 80% to 100% sequence identity (or is substantially identical) to SEQ ID NO:2 (e.g., about 80% to 100%, 80% to about 100%, or 80 to 100%). In certain embodiments, the nucleic acid sequence encoding the antibody comprises about 85% to 95% sequence identity (e.g., about 85% to 95%, 85% to about 95%, or 85 to 95%) to SEQ ID NO:2. In certain embodiments, the nucleic acid sequence encoding the antibody comprises 87% to 93% sequence identity (e.g., about 87% to 93%, 87% to about 93%, or 87 to 93%) to SEQ ID NO:2. The nucleic acid sequence encoding the antibody comprises about 90% sequence identity (e.g., 90%) to SEQ ID NO:2. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In specific embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:2 or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO:2.
[0080] The nucleic acid sequence encoding the antibody may comprise SEQ ID NO:4. In certain embodiments, the nucleic acid sequence encoding the antibody comprises at least about 80% sequence identity to SEQ ID NO:4, or has about 80% to 100% sequence identity (or is substantially identical) to SEQ ID NO:4 (e.g., about 80% to 100%, 80% to about 100%, or 80 to 100%). In certain embodiments, the nucleic acid sequence encoding the antibody comprises about 85% to 95% sequence identity (e.g., about 85% to 95%, 85% to about 95%, or 85 to 95%) to SEQ ID NO:4. In certain embodiments, the nucleic acid sequence encoding the antibody comprises 87% to 93% sequence identity (e.g., about 87% to 93%, 87% to about 93%, or 87 to 93%) to SEQ ID NO:4. The nucleic acid sequence encoding the antibody comprises about 90% sequence identity (e.g., 90%) to SEQ ID NO:4. The ranges specified in this paragraph include the recited endpoints and all 1% increments therebetween. In specific embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:4 or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO:4.
[0081] In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NOs:2 and 4.
[0082] In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:6, or has at least 80% sequence identity to SEQ ID NO:6, or has about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80 to 100%) sequence identity (or is substantially identical) to SEQ ID NO:6. In certain embodiments, the nucleic acid sequence encoding the antibody comprises about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85 to 95%) sequence identity to SEQ ID NO:6. In certain embodiments, the nucleic acid sequence encoding the antibody comprises 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87 to 93%) sequence identity to SEQ ID NO:6. The nucleic acid sequence encoding the antibody comprises about 90% (e.g., 90%) sequence identity to SEQ ID NO:6. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:6 or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO:6.
[0083] In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:8, has at least 80% sequence identity to SEQ ID NO:8, or has about 80% to 100% (e.g., about 80% to 100%, 80% to about 100%, or 80 to 100%) sequence identity (or is substantially identical) to SEQ ID NO:8. In certain embodiments, the nucleic acid sequence encoding the antibody comprises about 85% to 95% (e.g., about 85% to 95%, 85% to about 95%, or 85 to 95%) sequence identity to SEQ ID NO:8. In certain embodiments, the nucleic acid sequence encoding the antibody comprises 87% to 93% (e.g., about 87% to 93%, 87% to about 93%, or 87 to 93%) sequence identity to SEQ ID NO:8. The nucleic acid sequence encoding the antibody comprises about 90% (e.g., 90%) sequence identity to SEQ ID NO:8. The ranges specified in this paragraph include the recited endpoints and all values in 1% increments therebetween. In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NO:8 or a sequence that is 90%, 95%, 98%, or 99% identical to the sequence of SEQ ID NO:8.
[0084] In certain embodiments, the nucleic acid sequence encoding the antibody comprises SEQ ID NOs:6 and 8.
[0085] In certain embodiments, antibodies (or antigen-binding fragments thereof) against canine PD-L1 comprise one or more of the CDRs described herein and / or bind to the amino acid sequence of PD-L1. In certain embodiments, the dissociation constant (K D ) is about 4.0 nmol / L to 10.0 nmol / L (e.g., 4.0 nmol / L to about 10.0 nmol / L, about 4.0 nmol / L to about 10.0 nmol / L, or about 4.0 nmol / L to 10.0 nmol / L). In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof have a K of about 4.2 nmol / L to 9.8 nmol / L (e.g., 4.2 nmol / L to about 9.8 nmol / L, about 4.2 nmol / L to about 9.8 nmol / L, or about 4.2 nmol / L to 9.8 nmol / L). DIn certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 4.4 nmol / L to 9.6 nmol / L (e.g., 4.4 nmol / L to about 9.6 nmol / L, about 4.4 nmol / L to about 9.6 nmol / L, or about 4.4 nmol / L to 9.6 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 4.6 nmol / L to 9.4 nmol / L (e.g., 4.6 nmol / L to about 9.4 nmol / L, about 4.6 nmol / L to about 9.4 nmol / L, or about 4.6 nmol / L to 9.4 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 4.8 nmol / L to 9.2 nmol / L (e.g., 4.8 nmol / L to about 9.2 nmol / L, about 4.8 nmol / L to about 9.2 nmol / L, or about 4.8 nmol / L to 9.2 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 5.0 nmol / L to 9.0 nmol / L (e.g., 5.0 nmol / L to about 9.0 nmol / L, about 5.0 nmol / L to about 9.0 nmol / L, or about 5.0 nmol / L to 9.0 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 5.2 nmol / L to 8.8 nmol / L (e.g., 5.2 nmol / L to about 8.8 nmol / L, about 5.2 nmol / L to about 8.8 nmol / L, or about 5.2 nmol / L to 8.8 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 5.4 nmol / L to 8.6 nmol / L (e.g., 5.4 nmol / L to about 8.6 nmol / L, about 5.4 nmol / L to about 8.6 nmol / L, or about 5.4 nmol / L to 8.6 nmol / L). DIn certain embodiments, the antibody (e.g., caninized antibody) or antigen-binding fragment thereof binds to canine PD-L1 with a K of 8.6 nmol / L. D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 5.6 nmol / L to 8.4 nmol / L (e.g., 5.6 nmol / L to about 8.4 nmol / L, about 5.6 nmol / L to about 8.4 nmol / L, or about 5.6 nmol / L to 8.4 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof have a K of about 5.8 nmol / L to 8.2 nmol / L (e.g., 5.8 nmol / L to about 8.2 nmol / L, about 5.8 nmol / L to about 8.2 nmol / L, or about 5.8 nmol / L to 8.2 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 6.0 nmol / L to 8.0 nmol / L (e.g., 6.0 nmol / L to about 8.0 nmol / L, about 6.0 nmol / L to about 8.0 nmol / L, or about 6.0 nmol / L to 8.0 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 6.2 nmol / L to 7.8 nmol / L (e.g., 6.2 nmol / L to about 7.8 nmol / L, about 6.2 nmol / L to about 7.8 nmol / L, or about 6.2 nmol / L to 7.8 nmol / L). D In certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 6.4 nmol / L to 7.6 nmol / L (e.g., 6.4 nmol / L to about 7.6 nmol / L, about 6.4 nmol / L to about 7.6 nmol / L, or about 6.4 nmol / L to 7.6 nmol / L). DIn certain embodiments, the antibodies (e.g., caninized antibodies) or antigen-binding fragments thereof bind to canine PD-L1 with a K of about 6.6 nmol / L to 7.4 nmol / L (e.g., 6.6 nmol / L to about 7.4 nmol / L, about 6.6 nmol / L to about 7.4 nmol / L, or about 6.6 nmol / L to 7.4 nmol / L). D binds to canine PD-L1 at a concentration of 0.1%. The ranges specified in this paragraph include the recited endpoints and all values therebetween in increments of 1%. The ranges specified in this paragraph include the recited endpoints and all values therebetween in increments of 0.1.
[0086] The antibodies or antigen-binding fragments thereof can stimulate an antigen-specific memory response against tumors or pathogens. In certain embodiments, the antibodies or antigen-binding fragments thereof can stimulate an antibody response in a subject in vivo. In certain embodiments, the antibodies or antigen-binding fragments thereof can stimulate an antibody response in an animal subject (e.g., a canine animal subject). The term "immune response" refers to the action of, for example, lymphocytes, antigen-presenting cells, phagocytes, granulocytes, and soluble macromolecules (including antibodies, cytokines, and complement) produced by the above cells or the liver, and can result in the selective damage, destruction, or elimination of cells or tissues infected with an invading pathogen, or the pathogen, in a mammalian body (e.g., a canine body) by cancer cells.
[0087] In certain embodiments, the antibodies or antigen-binding fragments thereof are capable of binding to canine PD-L1 and inhibiting the binding of canine PD-L1 to PD-1. In certain embodiments, the caninized antibodies and antigen-binding fragments thereof are capable of binding to canine PD-L1 and inhibiting the binding of canine PD-L1 to PD-1.
[0088] The antibodies or antigen-binding fragments can be used to prepare a medicament for treating cancer in canine subjects. The antibodies (or antigen-binding fragments thereof) can be administered in unit dosage forms and / or compositions containing one or more pharmaceutically acceptable carriers, adjuvants, diluents, excipients, and / or vehicles, and combinations thereof. The term "administering" and its modalities generally refer to any and all means of introducing a compound described herein into a host subject, including, but not limited to, oral, intravenous, intramuscular, subcutaneous, transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal, and other routes of administration.
[0089] Alternatively, or in addition, the antibodies or antibody fragments thereof are provided for diagnostic use. In certain embodiments, an expression vector is provided comprising an isolated nucleic acid encoding either a caninized murine anti-canine PD-L1 antibody or an antigen-binding fragment thereof. Also provided are host cells comprising one or more expression vectors described herein. In certain embodiments, these nucleic acids, expression vectors, or polypeptides may be useful in methods for preparing antibodies.
[0090] Pharmaceutical compositions are also provided. The pharmaceutical compositions may comprise one or more of the antibodies, antigen-binding fragments, antigenic peptides (including isolated antigenic peptides) of canine PD-L1 described herein, fusion proteins comprising canine PD-L1 antigenic peptides, nucleic acids encoding the antigenic fragments and / or fusion proteins thereof, expression vectors comprising such nucleic acids, or any combination thereof, together with a pharmaceutically acceptable carrier or diluent. The term "composition" generally refers to any product comprising two or more components, including, but not limited to, an antibody or antigen-binding fragment thereof. In certain embodiments, the pharmaceutical composition comprises a caninized antibody, a caninized antibody, or an antigen-binding fragment thereof, and a pharmaceutically acceptable excipient.
[0091] The compositions can be prepared from isolated antibodies or antigen-binding fragments thereof, or from salts, solutions, hydrates, solvates, and other forms of the antibodies or antigen-binding fragments thereof. Compositions can be prepared from various amorphous, non-amorphous, partially crystalline, crystalline, and / or other forms of the antibodies or antigen-binding fragments thereof, and compositions can be prepared from various hydrates and / or solvates of the compounds.
[0092] The antibodies or antigen-binding fragments thereof can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human or canine subject, in a variety of forms compatible with the selected route of administration. For example, pharmaceutical compositions can be formulated for and administered via oral or parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intraventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular, topical, inhalation, and / or subcutaneous routes. Indeed, in at least one embodiment, the compounds and / or compositions can be administered into the bloodstream, intramuscularly, or directly to an internal organ.
[0093] For example, in at least one embodiment, the antibodies or antigen-binding fragments thereof can be administered systemically (e.g., orally) in combination with a pharmaceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier. For oral therapeutic administration, the antibodies or antigen-binding fragments thereof can be combined with one or more excipients and used in the form of ingestible tablets, lozenges, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. The percentage of compositions and formulations can vary and may be from about 1 to about 99% by weight of the active ingredient, plus binders, excipients, disintegrants, lubricants, and / or sweeteners, as known in the art. The amount of antibody or antigen-binding fragment thereof in such therapeutically useful compositions is such that an effective dosage will be obtained.
[0094] Preparation of parenteral compounds / compositions under sterile conditions, for example, by lyophilization, can be easily achieved using standard pharmaceutical techniques well known to those skilled in the art. In at least one embodiment, the solubility of the compounds used in the preparation of parenteral compositions can be increased by the use of appropriate formulation techniques, such as the incorporation of solubility-enhancing agents.
[0095] As mentioned above, the antibodies or antigen-binding fragments thereof can also be administered by infusion or injection (e.g., using needle (including microneedle) injectors and / or needle-free injectors). Solutions of the active compositions can be aqueous, optionally mixed with a nontoxic surfactant, and / or contain carriers or excipients such as salts, carbohydrates, and buffers (preferably pH 3-9), although for some applications they are more suitably formulated as sterile nonaqueous solutions or as dry forms for use with an appropriate vehicle such as sterile pyrogen-free water or phosphate-buffered saline (PBS). For example, dispersions can be prepared in glycerol, liquid PEG, triacetin, and mixtures thereof, as well as oils. Under ordinary conditions of storage and use, these formulations can further contain a preservative to prevent the growth of microorganisms.
[0096] Treatment method Methods are provided for treating animal cancers, particularly canine invasive urothelial carcinoma (InvUC), which accounts for approximately 90% of canine bladder cancers, using the present antibodies or antigen-binding fragments thereof. In at least one embodiment, the methods comprise administering a therapeutically effective amount of any of the present antibodies or antigen-binding fragments thereof to a canine subject (e.g., to treat the cancer). The cancer may be, for example, any canine cancer, including, but not limited to, InvUC. In certain embodiments, administration of a therapeutically effective amount of a caninized antibody, chimeric antibody, or antigen-binding fragment thereof inhibits PD-L1 / PD-1 interaction in the subject. In certain embodiments, administration of a therapeutically effective amount of a caninized antibody, chimeric antibody, or antigen-binding fragment thereof enhances immune cell activity in the subject.
[0097] The subject can be a mammal. The subject can be a dog. The subject can be a domestic dog.
[0098] An "effective amount" or "therapeutically effective amount" refers to the amount of a therapeutic agent (e.g., an antibody or antigen-binding fragment thereof), or a composition comprising the same, that elicits the desired biological or pharmaceutical response, including, but not limited to, imaging and / or alleviation of signs and / or symptoms of the disease or disorder being treated, in a subject (i.e., a tissue, organ, or organism, e.g., a vertebrate, e.g., a mammal such as a human or a dog) desired by a researcher, veterinarian, medical doctor, or other clinician. In one embodiment, an effective amount is the amount of active agent that can treat or alleviate the signs and / or symptoms of the disease, at a reasonable benefit / risk ratio applicable to any medical treatment. An "effective amount" or "therapeutically effective amount" for use in therapy refers to the amount of active agent / antibody in a preparation that, when administered (e.g., to a mammal such as a human or a dog) as part of a desired dosing regimen, alleviates symptoms, ameliorates pathology, or delays the onset of disease, according to clinically accepted standards for the disorder or condition being treated or for cosmetic purposes, e.g., at a reasonable benefit / risk ratio applicable to any medical treatment.
[0099] By selecting from among various active agents and weighing factors such as potency, relative bioavailability, subject weight, severity of adverse side effects, and mode of administration, in combination with the teachings provided herein, one can design an effective prophylactic or therapeutic treatment regimen that does not cause substantial undesirable toxicity yet is effective in treating a particular subject.
[0100] A wide range of acceptable dosages is contemplated herein, depending on the type of cancer, the route of administration, and / or whether the antibody or antigen-binding fragment thereof is administered locally or systemically. The amount of the composition required for therapeutic use (e.g., a therapeutically or prophylactically effective amount or dose) will vary depending not only on the specific application and administration structure, but also on the selected salt (if applicable) and the characteristics of the subject (e.g., species, breed, age, condition, sex, subject's body surface area and / or weight, tolerance to drugs), and is ultimately at the discretion of the attending physician, veterinarian, clinician, etc.
[0101] A therapeutically effective amount or dose can range, for example, from about 0.05 mg / kg to about 30.0 mg / kg of subject body weight, or from about 0.01 mg / kg to about 5.0 mg / kg of subject body weight, including, but not limited to, 0.01 mg / kg, 0.02 mg / kg, 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1.0 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 3.0 mg / kg, 3.5 mg / kg, 4.0 mg / kg, 4.5 mg / kg, and 5.0 mg / kg (all in kg of subject body weight). The total amount of therapeutically effective compound can be administered in single or divided doses and can fall outside the typical ranges set forth herein, at the discretion of one of ordinary skill in the art.
[0102] In the case of parenteral administration, higher doses may be required. The effective amount for any particular application may vary depending on factors such as the disease or condition being treated, the specific antibody being administered, the size of the subject, or the severity of the disease or condition. Those skilled in the art can empirically determine the effective amount of a particular antibody, its antigen-binding fragment, and / or other therapeutic agent without undue experimentation. A maximum dose, i.e., the highest safe dose based on any medical judgment, can be used. Multiple doses per day can also be used to achieve an appropriate systemic level of the compound. An appropriate systemic level can be determined, for example, by measuring the patient's peak or sustained plasma level of the drug. "Dose" and "administration" are used interchangeably herein.
[0103] Based on the described method and other methods known in the art, it is well within the ability of those skilled in the art to adjust dosage to achieve maximum effectiveness.Depending on the mode of administration, dosage can be appropriately adjusted to achieve desired local or systemic drug level.For example, the dose of intravenous administration can vary from one digit to several digits lower per day.If the subject does not respond adequately to such a dose, a higher dose (or an effective high dose by another more local delivery route) can be adopted as long as the subject can tolerate it.Multiple doses per day are contemplated to achieve an appropriate systemic level of compound.
[0104] Any effective regimen for administering antibodies or antigen-binding fragments thereof can be used. Doses can be single or divided and can be administered according to a wide variety of protocols, such as qd, bid, tid, or even every other day, every other week (biw), weekly, monthly, or quarterly. In each of these cases, it is understood that the effective amounts described herein correspond to the dosage example or, alternatively, to the total daily, weekly, monthly, or quarterly dosage, as determined by the administration protocol.
[0105] For example, the antibody can be administered in a single dose, or the dose can be divided and administered in multiple doses per day. Furthermore, instead of daily administration, staggered administration, for example, 1-5 days per week, is also possible. Such intermittent or staggered daily regimens are considered equivalent to daily treatment. A subject can be treated with multiple injections of an antibody or antigen-binding fragment thereof to treat cancer. A subject can receive multiple injections of the antibody or antigen-binding fragment thereof (e.g., about 2-50 injections), for example, at 12-72 hour intervals or 48-72 hour intervals. Additional injections of the antibody or antigen-binding fragment thereof can be administered to the subject at intervals of several days or months after the initial injection, and the additional injections can prevent cancer recurrence.
[0106] The method can be used in combination with one or more additional therapies and / or active agents, including, but not limited to, booster immunotherapy, administration of a DNA damage response pathway inhibitor, chemotherapy, radiation, and / or surgery.
[0107] Methods for predicting and modeling the anticancer activity of test compounds Domestic dogs naturally develop several types of cancer that resemble clinical cancers in human patients in many ways. While mouse models are the most commonly used animal model in cancer research, they lack the comprehensive characteristics required for an optimal animal model, such as tumor heterogeneity, mutational landscape, cancer molecular subtype, and immune cell responsiveness. Studies in mouse models can be complemented by other models, such as specific cancers that naturally occur in pet dogs. This can be particularly beneficial when developing or studying new immuno-oncology drugs, such as novel immune checkpoint inhibitors (ICIs) or their combination regimens, as domestic dogs can provide naturally occurring cancers in the context of an intact immune system and aggressive, heterogeneous cancers. The development of canine ICIs can expand comparative oncology approaches to improve the current therapeutic efficacy of immunotherapies in human cancers. Therefore, studies of canine immuno-oncology drugs can be translated into knowledge to inform and advance new immuno-oncology therapies in humans. However, until now, there has been a problem in that ICIs targeting canine immune checkpoint molecules such as cPD-1 and cPD-L1 have not been available.
[0108] In the development of immuno-oncology drugs, particularly immunotherapeutic antibodies, the translation of discoveries from mouse models to clinical trials has been hindered by many biological differences between mice and humans, such as the lack of cross-reactivity between species and / or the fact that mouse physiological systems may respond differently to cancer and other pathological disorders than human or canine systems. For example, if an anti-human antibody or anti-canine PD-L1 antibody does not recognize the mouse PD-L1 protein, the therapeutic efficacy of that human or canine antibody cannot be evaluated in a syngeneic mouse model. To overcome this limitation, mice with transplanted human immune systems have been developed for translational research. Indeed, the anti-human PD-1 antibody pembrolizumab demonstrated tumor growth inhibition and CD8+ T cell activation in humanized NSG (HuNSG) mice bearing tumors from patient-derived xenografts (PDXs) (see, e.g., Wang et al., Humanized mice in studying efficacy and mechanisms of PD-1-targeted cancer immunotherapy, FASEB J 32: 1537-1549 (2018)). Although human tumor-bearing, human immune-transplanted mice are important models for preclinical immuno-oncology research, these humanized mouse models face significant obstacles, including limited sources of human cells and tissues, immune rejection, and high costs (see, e.g., Yong et al., Humanized mice as unique tools for human-specific studies, Arch Immunol Ther Exp (Warsz) 66: 245-266 (2018)).
[0109] As an alternative mouse model for immunotherapeutic antibody development, mice with humanized immune checkpoint molecules are commercially available. For example, humanized PD-L1 mice were generated by replacing the mouse PD-L1 gene (cd274) with the human PD-L1 gene (CD274) using a CRISPR (clustered regularly interspaced short palindromic repeats) / CAS9 strategy. While these humanized PD-L1 mice can be used to evaluate the therapeutic efficacy of anti-human PD-L1 antibodies in vivo, a canine PD-L1 gene knock-in mouse model capable of evaluating the therapeutic efficacy of anti-canine PD-L1 antibodies has not been available until now, posing a major obstacle to the development of canine immune checkpoint inhibitors, such as PD-1 / PD-L1 blocking antibodies. These PD-L1 mouse models can be used not only for preclinical immuno-oncology research but also as a translational research tool to bridge the gap between canine and human immunotherapy, potentially increasing the success rate of human immunotherapy applications.
[0110] Also provided are methods for predicting and modeling (e.g., optimizing) the anti-cancer activity of test compounds in secondary subjects using the antibodies or antigen-binding fragments thereof. In certain embodiments, the antibodies or antigen-binding fragments thereof are caninized and evaluated in dogs (e.g., primary subjects), and the most successful test compounds are advanced into human trials (e.g., the secondary subjects are humans).
[0111] In certain embodiments, a method for predicting and modeling the anti-cancer activity of test compounds in a subject comprises generating a population of mice expressing canine PD-L1 on their cell surfaces; assessing the toxicity risk and / or efficacy in treating cancer of a set of test compounds in the PD-L1 mouse population; and selecting one or more test compounds from the set that meet established toxicity risk and / or efficacy criteria. The set of test compounds may, for example, include at least a compound that inhibits (or is reasonably expected to be able to inhibit) PD-L1 / PD-1 interaction in a subject.
[0112] In certain embodiments, the method further comprises assessing the oral bioavailability, adsorption, distribution, metabolism, and excretion (ADME) values of the set of test compounds in a mouse population comprising canine PD-L1 and PD-1. In certain embodiments, the method further comprises assessing the oral bioavailability and ADME values of one or more selected test compounds in a PD-L1 mouse population.
[0113] The method may further comprise assessing the toxicity risk and / or efficacy of one or more selected compounds in treating cancer in a human or canine cohort.
[0114] Toxicity risk and / or efficacy criteria can be established according to known protocols.
[0115] Generating the PD-L1 mouse population may further include replacing the mouse cd274 gene in the mouse population with the canine PD-L1 gene using CRISPR or other known techniques.
[0116] This canine model may be useful for investigating InvUC-specific therapies. This concept is supported by data showing that human InvUC can replicate in dogs and the similarities between human and canine InvUC. Canine InvUC mimics human InvUC in terms of preparation, pathology, local invasion, distant metastasis (over 50% of cancer cases, including lung cancer), and chemotherapy response (e.g., Cekanova et al., Molecular imaging of cyclooxygenase-2 in canine transitional cell carcinomas in vitro and in vivo, Cancer Prev Res (Phila) 6: 466-76 (2013); Fulkerson et al., Naturally occurring canine invasive urinary bladder cancer: A complementary animal model to improve the success rate in human clinical trials of new cancer drugs, Int J Genomics, 6589529 (2017); Knapp et al., Cisplatin versus cisplatin combined with piroxicam in a canine model of human invasive urinary bladder cancer, Cancer Chemother Pharmacol 46: 221-226 (2000); Knapp et al., Urinary Bladder cancer in dogs, a naturally occurring model for cancer biology and drug development, ILAR J 55:100-118 (2014); Lin et al., Targeting canine bladder transitional cell carcinoma with a human bladder cancer-specific ligand, Mol Cancer 10: 9 (2011); Patrick et al.Sommer et al., Naturally-occurring canine invasive urothelial carcinoma: A model for emerging therapies, Bladder Cancer 4: 149-159 (2018); and Suarez-Bonnet et al., Expression of cell cycle regulators, 14-3-3sigma and p53 proteins, and vimentin in canine transitional cell carcinoma of the urinary bladder, Urol Oncol 33: 332 e1-7 (see 2015). In the United States, InvUC accounts for 2% of the approximately 6 million new cancer cases in dogs each year, making a sufficient number of dogs available for translational research (see, for example, Davis and Ostrander, Domestic dogs and cancer research: a breed-based genomics approach, ILAR J 55:59-68 (2014)). Canine clinical trials, in which subjects continue to live as companion animals after the study, are beneficial for each individual dog, and the knowledge gained can benefit both people and their pet dogs. Therefore, dogs offer a valuable opportunity to advance PD-1 / PD-L1 inhibitor therapy in humans. Therefore, therapeutic approaches successful in rodents can be evaluated in dogs, with the most successful ones moving on to human clinical trials. [Example]
[0117] The present disclosure will be better understood by reference to the following examples, which are offered by way of illustration and not by way of limitation.
[0118] material The BT549 human breast cancer cell line and the MB49 murine bladder cancer cell line were obtained from the American Type Culture Collection (ATCC) (Manassas, VA) and Sigma-Aldrich (St. Louis, MO), respectively. The canine bladder cancer cell line K9TCC was generated in the Knapp Lab (see Igase et al. (2020), supra). The human embryonic kidney cell line HEK293FT was obtained from Thermo Fisher Scientific (Waltham, MA). Cell lines were verified by short tandem repeat DNA fingerprinting using the AmpFISTR Identifier PCT Amplification Kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions.
[0119] These cells were tested for mycoplasma using a Mycoplasma PCR Detection Kit (ABM).
[0120] Cells were grown for up to 15 passages in Dulbecco's modified Eagle's medium (DMEM) or DMEM / Nutrient Mixture F-12 (DMEM / F-12) medium supplemented with 10% fetal bovine serum (FBS).
[0121] For stable expression of PD-L1, canine PD-L1 cDNA (Sino Biological, Wayne, PA) was inserted into the pGIPZ vector (Horizen Discovery, Waterbeach, UK) as described in Lim et al. (2016), supra. To knockdown endogenous human PD-L1 and simultaneously reconstitute Flag-cPD-L1, a BT549 cell line expressing Flag-cPD-L1 and endogenous PD-L1 was established using the pGIPZ-shPD-L1 / Flag-cPD-L1 dual expression construct. See, for example, Lim et al., EGFR signaling enhances aerobic glycolysis in triple-negative breast cancer cells to promote tumor growth and immune escape, Cancer Res (2016).
[0122] The transfer plasmids pMD2.G (Addgene #12259) and pCMV dR8.2 (Addgene #12263) were co-transfected into HEK293FT cells using X-tremeGENE HP (Roche Diagnostics, Indianapolis, IN) to package lentivirus, and the supernatant was harvested for lentiviral transduction. Selection with 1 μg / mL puromycin (InvivoGen, San Diego, CA) was routinely performed to maintain ectopic gene expression.
[0123] For mouse PD-L1 knockout, mouse PD-L1 double nickase plasmid (Santa Cruz Biotechnology, Dallas, TX) was transfected into MB49 cells using X-tremeGENE transfection reagent.
[0124] Canine PD-L1-overexpressing MB49 cells (MB49 cPDL1), mouse PD-L1 KO MB49 cells were infected with lentivirus carrying pGIPZ-Flag-cPD-L1 and then selected with puromycin.
[0125] All animal experiments were approved by the Purdue Animal Care and Use Committee (PACUC) at Purdue University.
[0126] For flow cytometry analysis, MB49 or BT549 cells were washed twice with ice-cold cell staining buffer (Biolegend, San Diego, CA) and stained with cIgG control or 12C10E4 cIgG for 1 hour at 4°C. After three washes with staining buffer, cell samples were stained with Alexa Fluor 488-conjugated anti-dog IgG-specific secondary antibodies for 30 minutes at 4°C. Cell samples were loaded onto a BD LSRFortessa (BD, Franklin Lakes, NJ) for analysis. Data analysis was performed using FlowJo v9 software (BD). Green fluorescent signals were measured and quantified every hour using an IncuCyte S3 (Sartorius, Göttingen, Germany). Image analysis was performed according to the manufacturer's protocol.
[0127] Example 1 Generation and selection of anti-canine PD-L1 monoclonal antibodies Monoclonal antibodies 3C8D3 (mAb 3C) and 12C10E4 (mAb 12C) were generated by conventional hybridoma procedures at the Vanderbilt University Antibody and Protein Resource Core Facility using A / J mice immunized with the extracellular domain of canine programmed death-ligand 1 (cPD-L1) (linked to a human Fc tag). Briefly, splenocytes were isolated from immunized mice and fused with SP2 / 0 myeloma cells (see Figure 1). Supernatants from isolated clones were screened for their ability to inhibit canine programmed cell death protein 1 (cPD-1) / cPD-L1 interaction through enzyme-linked immunosorbent assay (ELISA) based on cPD-L1-expressing cells, and mAbs 3C and 12C were selected for further study. Clonal antibodies were purified from the supernatants, and the same assay was repeated. Anti-cPD-L1 mAbs were successfully generated using this conventional hybridoma procedure.
[0128] To screen for antibodies that could inhibit the cPD-1 / cPD-L1 interaction and in a therapeutic setting, we developed live cell-based antibody binding assays and PD-1 / PD-L1 inhibition assays similar to those previously published (see Figures 2A and 2B). See, e.g., Li et al., Eradication of triple-negative breast cancer cells by targeting glycosylated PD-L1, Cancer Cell 33: 187-201 e10 (2018); Lim et al., Deubiquitination and stabilization of PD-L1 by SCN5, Cancer Cell (2016); Li et al., Glycosylation and stabilization of programmed death ligand-1 suppresses T-cell activity, Nat Commun 7: 12632 (2016).
[0129] BT549 cells, a human cancer cell line expressing cPD-L1, were seeded into 96-well or 384-well plates. Hybridoma-derived cPD-L1 antibody and an Alexa Fluor® 488-conjugated anti-mouse IgG fc-specific secondary antibody were added, and the amount of bound PD-L1 antibody was quantified by measuring the green fluorescent signal using an IncuCyte® S3 Live-Cell Analysis System (Sartorius AG, Göttingen, Germany) (Figure 2A).
[0130] BT549 cells expressing cPD-L1 were seeded into 96-well or 384-well plates. cPD-1-human Fc (hFc) protein, Alexa Fluor® 488-conjugated anti-human IgG Fc-specific secondary antibody and / or cPD-L1 antibody were added, and the amount of bound PD-1 protein was then quantified by measuring the green fluorescent signal using an IncuCyte® S3 Live-Cell Analysis System (Sartorius AG, Goettingen, Germany) (Figure 2B).
[0131] Of the over 2,000 hybridomas, 154 clones were screened against membrane-localized cPD-L1 protein in a live cell-based antibody binding assay. Clonal antibodies were purified from the supernatant and re-ran the same assay. Figure 2C shows the quantitative binding kinetics graph of PD-L1 antibody on cPD-L1-expressing BT549 cells at 3 hourly time points. Positive clones are highlighted in bold. Figure 2D shows a representative image of cPD-L1 antibody binding (taken at 18 hours), with a green fluorescent merged image of the cPD-L1-expressing cells shown.
[0132] Ten of these clones were able to inhibit the cPD-L1 / cPD-1 interaction. Figure 2E shows a kinetic graph of quantitative PD-1 protein binding in cPD-L1-expressing BT549 cells at 3-hour time points after addition of cPD-L1 antibody. Positive clones that inhibited PD-L1 / PD-1 protein interaction are highlighted in black boxes. Figure 2F shows a representative image of cPD-L1 inhibition (taken at 18 hours), showing a green fluorescent merge image of cPD-L1-expressing cells. Note the absence of fluorescence (highlighted in white boxes) due to the antibody binding to PD-L1 and inhibiting its interaction with cPD-1.
[0133] Representative positive clones are shown in Figures 2B-2F. Based on specificity, binding affinity, and PD-1 / PD-L1 inhibitory efficacy, mAb 3C and mAb 12C were selected for further analysis.
[0134] Example 2 Generation of canine PD-L1 knock-in mice as a preclinical model To further evaluate the clinical use of cPD-L1 antibodies as immunotherapeutics, we evaluated their therapeutic efficacy in an in vivo model. To do so, we generated mice (on a C57BL / 6 background) expressing canine PD-L1. This was achieved by replacing the mouse cd274 (PD-L1) gene with cPD-L1 using a CRISPR knock-in mouse strategy using a long single-stranded DNA (ssDNA) donor and CRISPR ribonucleoprotein (CRISPR) gene (Figure 3A).
[0135] More specifically, we employed the Efficient Additions with ssDNA inserts-CRISPR (Easi-CRISPR) method for generating human CD247 knock-in mice, replacing mouse CD274 with canine CD274 to generate mice (C57BL / 6 background) expressing PD-L1 on the cell surface. See Quadros et al., Easi-CRISPR: a robust method for one-step generation of mice carrying conditional and insertion alleles using long single-stranded DNA (ssDNA) donors and CRISPR ribonucleoproteins, Genome Biol 18: 92 (2017). Easi-CRISPR is a targeting strategy in which a long ssDNA donor is injected into mouse zygotes along with a preassembled crRNA, tracrRNA, and Cas9 ribonucleoprotein (ctRNP) complex to generate a targeted insertion allele in the resulting live offspring (here, the mouse cd274 (PD-L1) gene is replaced with the canine PD-L1 gene). Long ssDNA (full-length canine CD274 cDNA; NM_001291972) was injected into mouse zygotes along with a preassembled guide RNA (gRNA, CAGCAAATATCCTCATGTTTTGG (SEQ ID NO: 20)) and the Cas9 ribonucleoprotein (ctRNP) complex. The ssDNA and sgRNA were synthesized at Integrated DNA Technologies (IDT, Coralville, IA, USA). All animal experiments related to the generation of knock-in mice were approved by the Purdue Animal Care and Use Committee (PACUC) at Purdue University (West Lafayette, IN). Four-week-old C57BL / 6N female mice (Envigo, Indianapolis, IN, USA) were superovulated, and fertilized mouse eggs were obtained by mating the superovulated females with C57BL / 6N males.
[0136] One-cell stage fertilized mouse embryos were injected with 20 ng / μL Cas9 protein, 10 ng / μL sgRNA, and 5 ng / μL ssDNA into the pronuclei. Microinjection of mice was performed as described (40). Mouse genomic DNA was extracted from the tip of the tail and then genotyped (Primer Set 1 Forward, 5'-CCACTTGGTTCTACATGGCT-3' (SEQ ID NO: 21); Primer Set 1 Reverse, 5'-CCTCAGCCTGACACATTAGTT-3' (SEQ ID NO: 22); Primer Set 2 Forward, 5'-CCTGTCACCTCTGAACATGAA-3' (SEQ ID NO: 23); Primer Set 2 Reverse, 5'-GACTAAGCTCTAGGTTGTCC-3' (SEQ ID NO: 24); Primer Set 3 Forward, 5'-CCTGTCACCTCTGAACATGAA-3' (SEQ ID NO: 25); Primer Set 3 Reverse, 5'-GACTAAGCTCTAGGTTGTCC-3' (SEQ ID NO: 26); Primer Set 4 Forward, 5'-CCTGTCACCTCTGAACATGAA-3' (SEQ ID NO: 27); Primer Set 4 Reverse, 5'-GACTAAGCTCTAGGTTGTCC-3' (SEQ ID NO: 28); Primer Set 5 Forward, 5'-CCTGTCACCTCTGAACATGAA-3' (SEQ ID NO: 29); Primer Set 6 Reverse, 5'-GACTAAGCTCTAGGTTGTCC-3' (SEQ ID NO: 30); Primer Set 7 Forward, 5'-CCTGTCACCTCTGAACATGAA-3' (SEQ ID NO: 31); Primer Set 8 Reverse, 5'-GACTAAGCTCTAGGTTGTCC-3' (SEQ ID NO: Primer set 3 forward, 5'-GACTGGCTTTTAGGGCTTATGT-3' (SEQ ID NO: 25); primer set 3 reverse, 5'-ACACCCCACAAATTACTTCCATT-3' (SEQ ID NO: 26)) and sequencing (primer set 3 forward, 5'-GACTGGCTTTTAGGGCTTATGT-3' (SEQ ID NO: 25); primer set 3 reverse, 5'-ACACCCCACAAATTACTTCCATT-3' (SEQ ID NO: 26)) were used to confirm the location of the insertion and the DNA sequence of canine CD274.
[0137] To evaluate the therapeutic efficacy of cPD-L1 antibodies in a syngeneic animal model, we knocked out mPD-L1 and re-expressed cPD-L1 in the cPD-L1-expressing murine bladder cancer MB49 cell line (MB49 cPD-L1 ) were generated (Figures 3B and 3C). Figure 3B shows the results of MB49 cells expressing cPD-L1 (MB49 cPD-L1 ) Flow cytometry analysis of membrane-localized cPD-L1 protein in
[0138] Example 3 Interaction of cPD-1 or mPD-1 protein with cPD-L1 or mPD-L1 in vitro With and without cPD-L1 antibody (mAb 12C) treatment MB49 cPD-L1 and canine PD-L1 mice expressed cPD-L1 protein instead of mPD-L1 protein, whereas canine PD-L1 mice expressed mouse PD-1 protein. Therefore, before evaluating the therapeutic effects of cPD-L1 antibodies in canine PD-L1 mice, we first investigated whether cPD-L1 protein interacts with mPD-1 protein.
[0139] To measure immune receptor-ligand interactions, His-tagged canine or mouse PD-L1 proteins (cPD-L1-His or mPD-L1-His, respectively) were incubated on nickel-nitriloacetic acid (Ni-NTA)-coated 96-well plates. The plates were then incubated with recombinant Fc-tagged proteins for 1 hour, using anti-human or canine IgG Fc-specific Alexa 488 dye conjugates as secondary antibodies (Jackson ImmunoResearch Inc., West Grove, PA). The fluorescence intensity of the Alexa fluor 488 dye was measured using a microplate reader (Synergy Neo2; BioTek Instruments, Inc., Winooski, VT).
[0140] The binding of cPD-L1 to mPD-1 was similar to that of the cognate cPD-L1 and cPD-1 pair (OD450 was measured to quantify the amount of bound PD-1 protein (Figure 3D)). Consistently, a cPD-L1 antibody (mAb 12C) efficiently inhibited the cPD-L1 / mPD-1 interaction as well as the cPD-L1 / cPD-1 interaction, but not the mPD-L1 / mPD-1 or mPD-L1 / cPD-1 interactions (as this cPD-L1 antibody does not recognize mPD-L1) (Figures 3D and 3E).
[0141] Example 4 Evaluation of the therapeutic efficacy of cPD-L1 antibody in canine PD-L1 mice All procedures using canine PD-L1 B mice (C57BL / c background strain; 6-8 weeks old) were performed under guidelines approved by the Purdue University PACUC. Mice were divided according to the mean tumor volume of each group. 49cPD-L1 (2 × 10 cells / ml) in 25 μL of medium mixed with 25 μL of Matrigel Basement Membrane Matrix (BD Biosciences, San Jose, CA). 5 cells) were injected into the flanks of caninized PD-L1 mice.
[0142] cPD-L1 mice with MB49 cPD-L1 After tumor establishment, mice were divided into control, mAb 12C-treated, and mAb 3C-treated groups, and mice within each subset were divided according to the mean tumor volume of each group.
[0143] Antibody treatment resulted in tumors of approximately 30–40 mm size on days 4, 6, 8, 10, and 12 after tumor cell inoculation. 3 At this time, 100μg of cPD-L1 antibody (mAb 12C or mAb 3C clone) or control mouse IgG (BioXCell) was injected intraperitoneally. Tumors were measured every other day with a vernier caliper, and tumor volume was calculated using the following formula: π / 6 × length × width 2 .
[0144] Tumors were excised at the end point (n=8 / group) (Fig. 3F).
[0145] Immunofluorescence staining of the protein expression patterns of CD8 and granzyme B was performed on MB49 tumor masses from IgG-treated (control), 12C-treated, and 3C-treated mice (Figures 3G–3I). Tumor masses were immediately frozen in optimal cutting temperature (OTC) blocks after excision. 5-μm-thick frozen sections were mounted on saline-coated slides. The frozen sections were fixed in 4% paraformaldehyde for 30 minutes at room temperature and blocked with blocking solution (1% bovine serum albumin, 2% donkey and / or chicken serum, and 0.1 M phosphate-buffered saline (PBS)) for 30 minutes at room temperature. Samples were stained with primary antibodies against CD8 and granzyme B overnight at 4°C, followed by secondary antibody staining for 1 hour at room temperature. Nuclear staining was performed with Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA). Stained sections were visualized under an automated microscope (Lionheart LX; BioTek Instruments, Inc., Winooski, VT). Granzyme B-positive areas and the number of CD8+ cytotoxic T lymphocytes (CTLs) were assessed per high-magnification (200x) field. Fourteen randomly selected microscopic fields from four serial sections of each tissue block were examined for the number of CD8+ CTLs and granzyme B-positive areas in each tissue.
[0146] CD8 (Figure 3H) and granzyme B (Figure 3I) were also quantified using BioTek Gen5 Data Analysis Software (Agilent Technologies, Santa Clara, CA) (n = 10). Treatment with either mAb12C or mAb3C significantly reduced tumor size (Figure 3F) and increased the number of infiltrating cytotoxic T cells, as measured by CD8+ and granzyme B expression, compared to mice treated with control IgG (Figures 3G-3I).
[0147] Furthermore, the effect of treatment on PD-L1 mice was assessed at the end of treatment by measuring the mice's kidney (Figure 3J) and liver (Figure 3K) function. This data confirmed that both cPD-L1 antibodies enhanced anti-tumor immunity in the PD-L1 syngeneic mouse model and demonstrated a favorable safety profile, as mice maintained their body weight and had no changes in renal function as assessed by serum creatinine or liver enzyme activity. These in vitro and in vivo results demonstrated that the cPD-L1 antibody recognizing canine PD-L1 effectively inhibited the PD-1 / PD-L1 pathway and enhanced anti-tumor immunity in mice.
[0148] Example 5 Characterization of caninized PD-L1 chimeric antibodies For clinical use of canine PD-L1 antibodies in dogs, mAb 12C was caninized by replacing the mouse constant domains with canine IgG2 (equivalent to human IgG1) constant domains. Briefly, full-length variable heavy (VH) and variable light (VL) RNA transcripts obtained from hybridoma clones were sequenced by 5' / 3' rapid amplification of cDNA ends (RACE). The codons for the CHO VL and VH chains were optimized and cloned into the pTRIOZ-cIgGB-ck vector (InvivoGen, San Diego, CA, USA), a vector designed for high-yield production of whole monoclonal antibodies using a single plasmid. The light and heavy chains were then replaced with a canine κ light chain constant chain and a canine IgG2 heavy chain constant chain: pTRIOZ-cIgG2-12C10E4. Figure 4A shows a schematic diagram of the cPD-L1 (mAb 12C) chimeric antibody expression construct (pTRIOZ-cIgG2-cPD-L1 mAb 12C). This chimeric cPD-L1 antibody retained the cPD-L1-binding VH chain and VL chain from the murine hybridoma.
[0149] A plasmid encoding the 12C chimeric antibody pTRIOZ cIgG2 12C10E4 was transfected into ExpiCHO-S cells according to the transfection kit instructions (GIBCO, A29133). ExpiCHO-S cells were cultured in ExpiCHO Expression Medium (Thermo Fisher Scientific, Waltham, MA) in a shaking incubator set at 120 rpm, 37°C, and 8.0% CO2. Ten days after transfection, cells were harvested at 4,000 x g for 20 minutes at 4°C. The antibody supernatant was passed through a 0.22 μm filter and neutralized with 10X PBS buffer (Lonza™ BioWhittaker™ Phosphate Buffered Saline (10X), BW17-517Q). The antibody supernatant was preincubated with protein A agarose for 2 hours. The agarose A-bound antibody was applied to a column (BioRad poly-prep chromatography column, #731-1550). The column was washed with low-endotoxin PBS (Lonza™ BioWhittaker™ Dulbecco's Phosphate Buffered Saline (1X) with Calcium and Magnesium, BW17512F24). The bound antibody was eluted with elution buffer (ThermoFisher Scientific, Waltham, MA; Elution Buffers, 0.1 M Glycin-HCl, pH 2.8, #21004) into neutralization buffer (Tris HCl, 1 M, BP1757-500). The purified antibody was concentrated and buffer-exchanged into PBS, pH 7.0. The antibody concentration was determined by UV absorbance at 280 nm.
[0150] To monitor batches during antibody production, attributes of purified chimeric antibodies, such as purity, isoelectric point (pI) value, amino acid sequence, and N-glycan profile, were evaluated (Figure 4B–4F). Briefly, purity and pI value were determined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) analysis and isoelectric focusing (IEF), respectively. SDS-PAGE or IEF gels were purchased from Bio-Rad Laboratories (Hercules, CA) or ThermoFisher Scientific (Waltham, MA). SDS-PAGE was performed under non-reducing and reducing (2-mercaptoethanol) conditions according to the manufacturer's protocol to determine the purity of the 12C chimeric antibodies (Figure 4B). IEF and Coomassie Blue staining were also performed according to the manufacturer's protocol. SDS-PAGE, image acquisition, and quantification of band intensity were performed using an Odyssey CLx infrared imaging system (LI-COR Biosciences, Lincoln, NE). FIG. 4B shows an SDS-PAGE analysis of the 12C chimeric antibody, and FIG. 4C shows an IEF analysis.
[0151] Comparative peptide mapping of the cPD-L1 chimeric antibodies (each mAb 12C batch) was also performed to verify the amino acid sequence. Briefly, the antibodies were reduced and alkylated, followed by enzymatic digestion with trypsin on a Protifi (Farmingdale, NY) S-trap microcolumn. Peptides were then separated and analyzed by reversed-phase liquid chromatography-tandem mass spectrometry (RP-LC-MS / MS) using a Q Exactive HF Hybrid Quadrupole-Orbitrap MS equipped with a Nanospray Flex ion source and coupled to a Dionex UltiMate 3000 RSLC Nano System (ThermoFisher Scientific, Waltham, MA). The resulting mass spectrometry data were analyzed using the PEAK PTM workflow in the PEAKS X PRO Studio 10.6 software package from Bioinformatics Solutions Incorporated, and the detected MS1 and MS2 ions were mapped to the antibody amino acid sequence. See Ma et al., PEAKS: powerful software for peptide de novo sequencing by tandem mass spectrometry, Rapid Commun Mass Spectrom 17: 2337-2342 (2003). Peptide mapping analysis was performed at the Proteomics core facility at Purdue University (West Lafayette, IN). LC / MS-MS data were used to map glycosylation (0.98 Da) of asparagine (N) and glutamine (Q) residues in the mapped antibody sequence.
[0152] The sequence coverage of the heavy and light chains was 100% (453 out of 453 amino acids) and 98.2% (223 out of 227 amino acids), respectively, which is a strong positive indication for the presence of SEQ ID NO: 14 (Figure 4D). This chimeric cPD-L1 antibody retained the cPD-L1-binding VH and VL chains of the murine hybridoma.
[0153] Size-exclusion chromatography (SEC) analysis was performed on the 12C chimeric antibody to detect antibody aggregates and monomers. The antibody was analyzed for 135 minutes at a flow rate of 0.3 ml / min using an AKTA Pure 150 M (Cytiva, Marlborough, MA) and a Superdex 200 Increase 10 / 300 GL column (Cytiva, Marlborough, MA). Elution was monitored using UV absorbance at 280 nm, and data were processed using Unicorn 7 software (Cytiva, Marlborough, MA). SEC analysis was performed at the Molecular Evolution, Protein Engineering, and Production core facility at Purdue University (West Lafayette, IN). The SEC analysis results are shown in Figure 4E.
[0154] Furthermore, matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS profiling) of premethylated N-glycans released from PNGase F-treated 12C chimeric antibodies was performed using the method described in Shajahan et al., Glycomic and glycoproteomic analysis of glycoproteins—a tutorial, Anal Bioanal Chem 409: 4483-4505 (2017). Briefly, N-glycans from the 12C10E4 antibody were released by treating the reduced and alkylated protein with PNGase F. The released N-glycan fraction was then permethylated. Permethylated N-glycans were evaluated by matrix-assisted laser desorption / ionization mass spectrometry (MALDI-MS) using an AB SCIEX TOF / TOF 5800 mass spectrometer (Applied Biosystem / MDS Analytical Technologies, Sunnyvale, CA). N-glycan structure determination was based on molecular weight and followed the principles of the N-glycan biosynthetic pathway. Glycoanalysis was performed at the Complex Carbohydrate Research Center at the University of Georgia (supported by NIH grant R24GM137782). Figure 4F shows the MLD-MS profiling results.
[0155] Example 6 Binding and inhibition assays of caninized cPD-L1 chimeric antibodies Caninized cPD-L1 chimeric antibodies were evaluated using a cell-free cPD-L1 / cPD-1 inhibition assay according to a previously published protocol (see Li et al. (2018), supra).
[0156] Antibody binding and inhibition assays were performed as described in Li et al. (2018), supra. Briefly, to measure the interaction between PD-L1 protein and PD-L1 antibodies, 1 × 10 cells were placed per well in a 96-well plate. 4 BT549 pieces cPD-L1 Cells were seeded on the plates. Plates were then incubated with cIgG control (Rockland Immunochemicals, Pottstown, PA) or 12C10E4 antibody and anti-dog Alexa Fluor 488 dye conjugate (SouthernBiotech, Birmingham, AL). Green fluorescent signals were measured and quantified every hour using an IncuCyte S3 (Sartorius, Göttingen, Germany) (Figure 5A).
[0157] To measure PD-1 protein on cells, 1 x 10 cells were cultured per well in a 96-well plate. 4 BT549 pieces cPD-L1 Cells were seeded on the plates. Plates were then incubated with cIgG control (Rockland Immunochemicals, Pottstown, PA) or 12C10E4 antibody, cPD-1-hFc protein (human Fc protein conjugate; Sino Biological US, Wayne, PA), and / or anti-human Alexa Fluor 488 dye conjugate (ThermoFisher Scientific, Waltham, MA). Green fluorescent signals were measured and quantified every 3 hours using an IncuCyte S3 (Sartorius, Göttingen, Germany) (Figure 5B). Image analysis was performed according to the manufacturer's protocol.
[0158] An ELISA-based bioassay was also performed to compare receptor / ligand and receptor / antibody binding. The 6X His-tagged extracellular domain of cPD-L1 protein was expressed in the ExpiCHO cell line (ThermoFisher Scientific, Waltham, MA) and purified by Ni-NTA agarose (ThermoFisher Scientific, Waltham, MA) according to the manufacturer's protocol.
[0159] For the cPD-L1 / cPD-L1 inhibition assay, a Pierce Ni-NTA-coated 96-well plate (ThermoFisher Scientific, Waltham, MA) was coated with canine PD-L1-His protein and PD-1-Fc protein (human Fc-protein conjugate) (SinoBiological US, Wayne, PA). Anti-human IgG Fc-specific horseradish peroxidase (HRP)-conjugated secondary antibody (SouthernBiotech, Birmingham, AL) was added, followed by anti-canine PD-L1, 12C10E4 antibody. The bound PD-1-Fc protein was analyzed by OD analysis using a Synergy LX multimode reader. 450 The quantity was determined by measuring the bale.
[0160] Chimeric antibody 12C10E4 bound to membrane-localized cPD-L1 protein (Figures 5A and 5B), but did not recognize cPD-L2 protein (Figure 5C).
[0161] Example 7 Binding affinity (K D ) determination Binding affinity (K D) was determined by Octet Biolayer Interferometry (BLI) using an Octet RED384 system (Sartorius, Bohemia, NY). Briefly, His-tagged cPD-L1 protein was loaded onto an Octet NTA biosensor at a concentration of 200 nM. The binding step was performed by immersing the sensor in three concentrations of 12C10E4 antibody (50, 100, and 200 nmol / L) in kinetic buffer. Dissociation was performed and monitored in fresh kinetic buffer. Data were analyzed using Octet Analysis HT software (Sartorius, Bohemia, NY), and bound cPD-1 protein was quantified by measuring green fluorescence on an IncuCyte S3.
[0162] K of chimeric antibodies determined by Octet D The EC200 / ... 50 = 0.419 μg / ml; Figure 5E).
[0163] Example 8 Measurement of peripheral blood mononuclear cell (PBMC) activation and cytokines Primary canine PBMCs (cPBMCs) were isolated from canine blood using SepMate PBMC separation tubes (Stemcell Technologies, Inc., Vancouver, BC, Canada) and Histopaque-1077 (Millipore Sigma, Burlington, MA) according to the manufacturer's protocol. The activation of canine T cells by anti-canine CD3 and anti-canine CD28 antibodies has been well established in previous studies.
[0164] Briefly, canine T cells in PBMCs were activated with 10 ng / mL canine interleukin-2 (IL-2) (Novus Biologicals, Centennial, CO) with or without co-treatment for 48 hours with 1 μg / mL anti-canine CD3ε antibody (CA17.2A12 clone, coated; ThermoFisher Scientific, Waltham, MA) and 3 μg / mL (moderate) anti-canine CD28 antibody (1C6 clone; ThermoFisher Scientific, Waltham, MA). IFNγ, IL-10, and TNFα were multiplexed measured in activated canine PBMCs using a MILLIPLEX canine cytokine / chemokine magnetic bead panel (Sigma-Aldrich, St. Louis, MO) according to the manufacturer's protocol.
[0165] Samples were incubated with cytokine magnetic beads for 2 hours on a shaker, followed by incubation with the secondary detection antibody provided in the kit. Plates were read on an Attune flow cytometer using the FL2 channel (PE channel) for reporter and the FL4 channel (APC channel) for sorting. 300 beads were measured for each cytokine, and data were collected as forward and side scatter on a logarithmic scale of FL2 vs. FL4. Cytokine concentrations were quantified in ng / ml using Cytokine Multiplex Analysis software (MPLEX, Cytomic Analytic LLC). Data showed that anti-CD3 / CD28 and IL-2 treatment significantly induced the expression of IFNγ, IL-10, and TNFα compared to IL-2 treatment alone, and this activation protocol was used for the remainder of the study.
[0166] Example 9 Gene expression analysis of caninized cPD-L1 chimeric antibody Canine IO Panel (NanoString Technologies, Inc., Seattle, WA) assay was used to examine changes in gene expression upon activation of PBMCs from the three healthy pet dogs in Example 8. Activation of cPBMCs was performed as described above in Example 8.
[0167] RNA from resting and activated PBMCs was isolated (RNeasy kit, Qiagen, Germantown, MD) and submitted to the Stark Neurosciences Research Institute Biomarker Core, Indiana University School of Medicine, Indianapolis, IN) for detection of gene modulation upon activation using the nCounter® Canine IO Panel (NanoString Technologies, Inc, Seattle, WA).
[0168] Control cPBMCs (n = 3) were used to examine changes in approximately 700 genes using the Canine IO panel. Data were analyzed by group-wise analysis using Rosalind (Rosalind, San Diego, CA) and compared with activated cells (n = 3). Comparing control and activated PBMCs, 65 genes were differentially expressed, including 30 up-regulated and 35 down-regulated genes (FC≥1.5; P<0.05).
[0169] For specific genes, data were visualized using heat maps, volcano plots, and histograms. In the heat maps, each column represents one sample. IFNγ (Figure 5H) and TNFα (Figure 5I) concentrations were also analyzed in activated canine PBMCs.
[0170] Canine immuno-oncology panel analysis (Figures 5F and 5G; Table 1) and analysis of secreted cytokines (IFNγ and TNFα; Figures 5H and 5I) demonstrated activation of canine PBMCs by anti-canine CD3 and CD28 antibodies and canine IL2 treatment.
[0171] [Table 1-1] [Table 1-2] [Table 1-3]
[0172] Example 10 Caninized cPD-L1 chimeric antibody enhances T cell-mediated tumor cell killing To demonstrate the immune checkpoint inhibition of the 12C chimeric antibody and analyze tumor cell killing via T cell inactivation, a tumor cell killing assay was performed in an ex vivo canine system in which cPD-L1-positive canine bladder cells (K9TCC) were co-cultured with activated canine PBMCs according to a published protocol (see Li et al. (2016), supra). To quantify the number of viable or dead tumor cells in the tumor cell killing assay, K9TCC expressing nuclear-restricted red fluorescent protein (RFP) was used. nRFP K9TCC parental cells and K9TCC cells were established upon IFNγ treatment. nRFP Expression of endogenous cPD-L1 protein and mRNA was confirmed in both activated canine PBMCs and K9TCC cells (Figures 5J-5L). nRFP The cells were used to perform a tumor cell killing assay.
[0173] Briefly, K9TCC was cultured in DMEM / F12 supplemented with 10% FBS. nRFPThe cells were co-cultured with cPBMCs. cPBMCs were activated by incubation with 100 ng of anti-canine CD3ε antibody (see Example 8) (CA17.2A12 clone, ThermoFisher Scientific, Waltham, MA) and 10 ng / mL canine interleukin-2 (IL-2) (Novus Biologicals, Littleton, CO) in DMEM / F12 supplemented with 10% FBS. Primary cPBMCs were isolated from canine blood using SepMate PBMC isolation tubes (Stemcell Technologies, Cambridge, MA) and Histopaque-1077 (Sigma-Aldrich, St. Louis, MO) according to the manufacturer's protocol.
[0174] The number of viable tumor cells after 72 hours is shown in the bar graph in Figure 5J. After 96 hours, RFP signals were measured as viable tumor cells, and the expression of IFNγ, IL10, and TNFα in the supernatants of co-cultured cells was measured using the MILLIPLEX Canine Cytokine / Chemokine Magnetic Bead Panel according to the manufacturer's protocol.
[0175] Although the PBMCs and tumor cells were from different dogs, and therefore the canine lymphocyte antigen (DLA) was not matched between the cPBMCs and K9TCC cells, the 12C chimeric antibody enhanced tumor cell killing activity and IFNγ secretion (Figures 5M and 5N).
[0176] Example 11 Treatment of experimental dogs with 12C10E4 chimeric antibody A single-dose pilot study to evaluate initial safety and pharmacokinetic parameters was conducted in six laboratory beagles, approximately 12-15 months of age, including both male and female dogs. The dogs were housed and evaluated in the preclinical laboratory at the Purdue University (West Lafayette, IN) College of Veterinary Medicine. The 12C10E4 cPD-L1 chimeric antibody for the laboratory dog study was produced at the Purdue University (West Lafayette, IN) Molecular Evolution, Protein Engineering, and Production Facility, as described above. The antibody solution was mycoplasma-free and contained less than 0.5 EU endotoxin / mg antibody (consistent with the endotoxin limit for human PD-L1 antibody solutions).
[0177] After acclimation to the facility, dogs were administered the 12C10E4 cPD-L1 chimeric antibody intravenously (IV) (total volume 6ml / kg body weight) diluted in sterile water over 1 hour via the IV catheter. Six dogs were treated and received either 2mg / kg or 5mg / kg of antibody.
[0178] For pharmacokinetic analysis, blood samples were collected at 1, 6, 24, 48, and 72 hours after the start of antibody administration and weekly for four weeks thereafter. Adverse event monitoring included physical examinations before and during treatment, twice daily for the next seven days, and weekly for four weeks thereafter; daily observations for four weeks; and complete blood counts (CBCs), serum biochemistry panels (including, but not limited to, measurement of 12C10E4 chimeric antibody concentrations in serum from 12C10E4-treated dogs (Figure 6A)), and urinalysis before treatment and weekly for four weeks. Additional testing specific to observed adverse events was planned. Adverse events were classified using the Veterinary Cooperative Oncology Group (VCOG) criteria. See VCOG, Common terminology criteria for adverse events (VCOG-CTCAE) following chemotherapy or biological antitineoplastic therapy in dogs and cats v1.1, Vet Comp Oncol 14: 417-446 (2016).
[0179] The 12C10E4 chimeric antibody was well tolerated, with a half-life of approximately 3 days (Figures 6B and 6C; Table 2). The half-life of the cPD-L1 antibody is shorter than that of human checkpoint inhibitors, suggesting that once-weekly dosing may be appropriate for dogs. One dog experienced a possible infusion reaction, which resolved without intervention. In this single-dose study, the antibody was well tolerated in the experimental dogs, and body weight was maintained (Table 2). Nonspecific changes, such as a slight decrease in monocyte count and a slight increase in CO2 and gamma-glutamyltransferase (GGT), were transient and resolved without intervention (Table 2).
[0180] [Table 2]
[0181] General and Specific Definitions All patents, published patent applications, journal articles, texts, and other publications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this disclosure pertains. All such publications are incorporated by reference into this specification to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[0182] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present disclosure. It is understood that certain embodiments may be practiced without some or all of these specific details, and that the present disclosure is not limited to particular biological systems, cancers, or organs or tissues, which may, of course, vary, but may still be applicable in light of the data provided herein.
[0183] Various techniques and mechanisms in this disclosure may describe a connection or coupling between two components. Words such as attach, couple, connect, and similar terms with their inflectional forms are used interchangeably unless a distinction is indicated or the context makes clear otherwise. These words and expressions do not necessarily imply a direct connection, but may also include a connection through an intermediate component. It should be noted that a connection between two components does not necessarily imply a direct and uninterrupted connection because various other components may exist between the two components described. Therefore, unless otherwise specified, a connection does not necessarily imply a direct and uninterrupted connection.
[0184] Furthermore, where feasible and convenient, like reference numerals have been used in the drawings and description to refer to the same or similar parts or steps. The drawings are in simplified form and are not to scale. The present disclosure is thus presented solely for illustrative purposes, and it will be understood that the principles and embodiments described herein may be applied to antibodies and / or composition components having configurations other than those specifically described herein. Indeed, it is expressly contemplated that the components of the compositions and compounds of the present disclosure may be adjusted to facilitate their desired application.
[0185] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art of chemistry and biology. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the subject matter of this application, preferred methods and materials are described herein. Furthermore, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, if a compound / composition is substituted with "an" alkyl or aryl, the compound / composition may be optionally substituted with 0 or at least one alkyl and / or at least one aryl.
[0186] When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulas, all combinations and subcombinations of the ranges and specific embodiments are intended to be included. The term "about," when referring to a numerical value or numerical range, means that the referenced numerical value or numerical range is an approximation within experimental variability (or within statistical experimental error); thus, the numerical value or numerical range may vary by 1% to 15% of the stated numerical value or numerical range. The term "comprising" (and related terms such as "comprise," "comprises," "having," or "including") is not intended to exclude other specific embodiments, such as any compositions of matter, compositions, methods, or processes described herein, that may "consist of" or "consist essentially of" the recited features.
[0187] "Substantially" allows for a degree of variation in a value or range, and may be, for example, within 90%, within 95%, within 99%, or within 99% of the stated or stated range limits.
[0188] The term "sequence identity" or "percent identity" with respect to two or more polypeptide sequences refers to two or more sequences or subsequences that are identical or have a specified percentage of identical peptides (i.e., about 60% identity over a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity, when compared and aligned for maximum correspondence over a specified region, such as a comparison window or target gene), as determined using sequence comparison algorithms known in the art or by manual alignment and visual inspection. Such sequences are said to be "substantially identical." In other words, identity exists over one or more regions of the overall sequence, so long as the general shape and structure, and hydrogen bonding, if applicable, of the molecules are maintained so that they substantially fit into the target binding site and function as agonists therein.
[0189] The term "fully canine antibody" refers to an antibody that contains only canine immunoglobulin protein sequences. A fully canine antibody may contain mouse glycosylation if produced in a mouse, a mouse cell, or a hybridoma derived from a mouse cell. Similarly, a "mouse antibody" refers to an antibody that contains only mouse immunoglobulin sequences. Alternatively, a fully canine antibody may contain rat glycosylation if produced in a rat, a rat cell, or a hybridoma derived from a rat cell. Similarly, a "rat antibody" refers to an antibody that contains only rat immunoglobulin sequences.
[0190] In certain embodiments, the compounds, compositions and methods of the present disclosure are useful for the prevention and / or treatment of cancer. In certain embodiments, the compounds and / or compositions provided herein are also useful for the treatment of cancer. In certain embodiments, the compounds provided herein are provided or used alone, in combination with targeting agents, and / or in combination therapy with other interventions, such as cytokine-based immunotherapy and other immunotherapy.
Claims
1. A caninized antibody or antigen-binding fragment thereof that specifically binds to programmed death-ligand 1 (PD-L1) in a canine subject.
2. The antibody or antigen-binding fragment thereof of claim 1, encoded by a nucleotide sequence comprising at least 80% sequence identity with SEQ ID NO: 2 and / or 4 or SEQ ID NO: 6 and / or 8.
3. The antibody or antigen-binding fragment thereof of claim 1, comprising one or more complementarity-determining regions (CDRs), each CDR comprising at least 80% sequence identity with AAS, SEQ ID NO: 9, and / or SEQ ID NO:
10.
4. The antibody or antigen-binding fragment thereof of claim 1, comprising CDRs that independently comprise at least 80% sequence identity with SEQ ID NO: 17, WTS, and / or SEQ ID NO:
12.
5. The antibody or antigen-binding fragment thereof of claim 1, comprising CDRs that independently comprise at least 80% sequence identity with SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO:
11.
6. The antibody or antigen-binding fragment thereof of claim 1, comprising CDRs that independently comprise at least 80% sequence identity with SEQ ID NO: 18, SEQ ID NO: 19, and / or SEQ ID NO:
13.
7. The antibody or antigen-binding fragment thereof of claim 1, which is fully or incompletely caninized.
8. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, which is a chimeric form of a caninized antibody or antigen-binding fragment.
9. The antibody or antigen-binding fragment thereof of claim 1, comprising a caninized mouse PD-1 antibody or antigen-binding fragment thereof.
10. 23. A method for treating cancer in a canine subject, comprising administering to the canine subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof of any one of claims 1 to 9 or the pharmaceutical composition of claim 22.
11. The method of claim 10, wherein the caninized antibody or antigen-binding fragment thereof is encoded by a nucleotide sequence comprising at least 80% sequence identity to SEQ ID NO: 2 and / or 4 or SEQ ID NO: 6 and / or 8.
12. The method of claim 10, wherein the caninized antibody or antigen-binding fragment thereof comprises one or more complementarity-determining regions (CDRs) that independently comprise at least 80% sequence identity to AAS, SEQ ID NO:9, and / or SEQ ID NO:
10.
13. The method of claim 10, wherein the caninized antibody or antigen-binding fragment thereof comprises one or more CDRs that independently comprise at least 80% sequence identity to SEQ ID NO: 18, WTS, and / or SEQ ID NO:
12.
14. The method of claim 10, wherein the caninized antibody or antigen-binding fragment thereof comprises one or more CDRs that comprise at least 80% sequence identity with SEQ ID NO: 15, SEQ ID NO: 16, and / or SEQ ID NO:
11.
15. The method of claim 10, wherein the caninized antibody or antigen-binding fragment thereof comprises one or more complementarity-determining regions (CDRs) comprising at least 80% sequence identity with SEQ ID NO: 18, SEQ ID NO: 19, and / or SEQ ID NO:
13.
16. The method of claim 10, wherein the antibody or antigen-binding fragment thereof is formulated into a pharmaceutical composition.
17. 11. The method of claim 10, wherein the therapeutically effective amount is from about 2 mg / kg body weight of the subject (e.g., 2 mg / kg body weight of the subject) to about 5 mg / kg body weight of the subject (e.g., 5 mg / kg body weight of the subject).
18. 11. The method of claim 10, wherein the therapeutically effective amount is 2 mg / kg to 5 mg / kg of the subject's body weight.
19. 11. The method of claim 10, wherein the therapeutically effective amount is 2 mg / kg of subject body weight.
20. 11. The method of claim 10, wherein the therapeutically effective amount is 5 mg / kg of subject body weight.
21. The method of claim 10, wherein the cancer is invasive urothelial carcinoma.
22. A pharmaceutical composition comprising the caninized antibody or antigen-binding fragment thereof according to any one of claims 1 to 9 and a pharmaceutically acceptable excipient.
23. 1. A method for predicting and modeling anti-cancer activity of a test compound in a subject with cancer, comprising: To generate a population of caninized PD-L1 mice expressing canine PD-L1 on the cell surface; assessing the toxicity risk and / or efficacy of a set of test compounds in treating cancer in said population of caninized PD-L1 mice; and Selecting a set of one or more test compounds that meet established toxicity risk and / or efficacy criteria. A method comprising:
24. 24. The method of claim 23, further comprising assessing the toxicity risk and / or efficacy of one or more selected compounds in treating cancer in a human or canine cohort.
25. 24. The method of claim 23, wherein generating the caninized PD-L1 mouse population further comprises using CRISPR to replace the mouse cd274 gene of the mouse population with a canine PD-L1 gene.
26. 24. The method of claim 23, further comprising assessing oral bioavailability, adsorption, distribution, metabolism and excretion (ADME) values of said set of test compounds in said population of caninized PD-L1 mice.
27. 27. The method of claim 26, further comprising assessing the oral bioavailability and ADME value of said selected one or more test compounds in said caninized PD-L1 mouse population.
28. 24. The method of claim 23, wherein the set of test compounds includes at least a compound that inhibits PD-L1 / PD-1 interaction in the subject.
29. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with AAS, SEQ ID NO:9, and / or SEQ ID NO:
10.
30. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO: 18, WTS, and / or SEQ ID NO:
12.
31. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:
11.
32. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:
13.
33. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO: 17, WTS, and / or SEQ ID NO:
12.
34. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO:15, SEQ ID NO:16, and / or SEQ ID NO:
11.
35. A complementarity determining region (CDR) of an antibody or antigen-binding fragment thereof comprising at least 80% sequence identity with SEQ ID NO:18, SEQ ID NO:19, and / or SEQ ID NO:
13.
36. Use of a caninized antibody or antigen-binding fragment thereof of any one of claims 1 to 9, a pharmaceutical composition of claim 22, or one or more CDRs of any one of claims 29 to 35 in the preparation of a medicament for treating cancer in a canine subject.