Inhibitory antibodies against GLUT1

Anti-SLC2A1 monoclonal antibodies provide targeted GLUT1 inhibition for glucose uptake blockade, improving therapeutic outcomes in cancer, autoimmune, inflammatory, and infectious diseases, and metabolic disorders, particularly when combined with metabolic regulators.

JP2025538988APending Publication Date: 2025-12-03ICOSAGEN CELL FACTORY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025525696
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-01
Filing Date
2023-11-01
Publication Date
2025-12-03

AI Technical Summary

Technical Problem

Existing treatments for cancer, autoimmune diseases, inflammation, infectious diseases, and metabolic diseases lack specificity and efficacy in targeting GLUT1 for glucose uptake inhibition, leading to limitations in therapeutic outcomes.

Method used

Development of anti-SLC2A1 monoclonal antibodies that specifically bind to and inhibit GLUT1, allowing for targeted glucose uptake blockade in tumor cells and other disease contexts, with the potential for combination therapies with metabolic regulators.

Benefits of technology

The antibodies effectively inhibit glucose uptake in tumor cells, reducing cancer cell fitness and disease burden, and show promise in treating infectious diseases and metabolic disorders, with enhanced efficacy in combination therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025538988000009
    Figure 2025538988000009
  • Figure 2025538988000010
    Figure 2025538988000010
  • Figure 2025538988000011
    Figure 2025538988000011
Patent Text Reader

Abstract

Anti-SLC2A1 antibodies and antigen-binding fragments thereof are disclosed. The antibodies and fragments are suitable for use in inhibiting tumor cell glucose uptake and reprogramming tumor cell metabolism toward oxidative phosphorylation. The disclosed antibodies and antigen-binding fragments thereof are suitable for use in cancer therapy, alone or in combination with compounds that inhibit the oxidative phosphorylation pathway.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Inventors: Maiken Abel, Korneelia Anton, Denis Belitskin, Paule Hermet, Erkki Juronen, Gaily Kivi, Julia Koskar, Oliver Meikar, Andres Mannik, Anu Planken, Jaan-Eerik Planken, Eve Sankovski, Siret Tahk, Joan Terya, Mart Ustav, Mart Ustav Jr, Kai Virumae, Robin Pau (Sequence Listing) The present application contains a sequence listing which is submitted in a computer readable format.

[0002] FIELD OF THE INVENTION The present invention relates to anti-SLC2A1 monoclonal antibodies, the use of such compounds as single agents or in combination with pharmaceuticals for the treatment or prevention of diseases such as cancer, autoimmune diseases, inflammation, infectious diseases, and metabolic diseases, and the use of such compounds as intermediates for the production of novel modified anti-SLC2A1 monoclonal antibodies. [Background technology]

[0003] Glucose is an essential substrate for mammalian metabolism. The transport of glucose across cell membranes requires specific transport proteins belonging to the glucose transporter family. Within this family, proteins are designated by the symbol GLUT and genes by the symbol SLC2 (Solute Carrier Family 2).

[0004] All known GLUT proteins contain 12 transmembrane domains that form a large hydrophilic cavity in the center of the protein. Amino acids located within the cavity facilitate ligand binding and determine the substrate specificity of the transporter. 1Ligand transport is facilitated by a cycle of conformational changes that begins with ligand uptake in an outward-facing (open to the extracellular medium) conformation, transitions to a closed state in which the ligand is located in the protein cavity, and then to an inward-facing (open to the cytoplasm) state that allows ligand release. 2、3 .

[0005] GLUT family proteins are subdivided into three classes based on protein sequence and similarity. Class I is the "glucose transporter" which includes GLUT1, GLUT2, GLUT3, GLUT4, and GLUT14. Class II glucose transporters include GLUT5, GLUT7, GLUT9, and GLUT11 and are known to also transport fructose. Class III is composed of GLUT6, GLUT8, GLUT10, GLUT12, and GLUT13 (HMIT1), whose substrates are largely unknown. 4 .

[0006] Glucose is the central energy source in the human body. The expression and subcellular location of the most abundant mammalian glucose transporters, GLUT1, GLUT2, GLUT3, and GLUT4, on specific cell types are important aspects in the regulation of glucose consumption. GLUT2, GLUT3, and GLUT4 are involved in certain central processes in the human body. GLUT2 is a key regulator of glucose sensing and insulin secretion in the pancreas, GLUT3 mediates glucose uptake in neuronal cells, while GLUT4 is involved in glucose metabolism in muscle and adipocytes. 5~7 On the other hand, GLUT1 is considered to be the major glucose transporter during embryonic development. 8 In adult tissues, GLUT1 is expressed on red blood cells, endothelial cells of the blood-brain barrier, and brown adipose tissue. 9~11 .

[0007] Importantly, GLUT1 is the glucose transporter predominantly expressed on tumor cells, and its overexpression is associated with poor prognosis. 12、13GLUT1-facilitated glucose uptake into tumor cells allows unlimited growth, invasion, and metastasis of tumor cells, making them sensitive to GLUT1 inhibition. 14 Inhibition of GLUT1 expression or glucose deprivation of cancer cells has been shown to suppress cell growth in vitro and tumor growth in vivo, supporting targeting this transporter in cancer therapy. 15~17 .

[0008] High GLUT1 expression also plays a role in other diseases. Infectious agents such as the malaria parasite Plasmodia depend on glucose consumption for growth and spread. 18 The GLUT1 inhibitors disclosed herein are also useful for inhibiting infectious diseases. In diabetes mellitus, hypoglycemia is a serious side effect of insulin therapy that can be alleviated by GLUT1 inhibitor antibodies and insulin fusion constructs. 19 On the other hand, in diabetic hyperglycemia, dangerously high glucose uptake can be blocked with GLUT1 inhibitors, reducing the incidence of tissue damage such as diabetic retinopathy. 20 . Summary of the Invention

[0009] The present invention provides a number of antibodies that bind to SLC2A1 and block glucose uptake. The blocking antibodies can be used therapeutically as single agents to inhibit glucose uptake. In cancer therapy, anti-SLC2A1 inhibitory antibodies can be used in combination with other drugs to more effectively reduce cancer cell fitness and disease burden.

[0010] Therefore, it is an object of the present invention to provide SLC2A1 antibodies or antigen-binding fragments thereof that block glucose uptake.

[0011] A further object of the present invention is to provide a method for inhibiting glucose uptake in a patient, comprising administering one or more anti-SLC2A1 antibodies or antigen-binding fragments to the patient, wherein glucose uptake is inhibited in a subset of tumor cells.

[0012] An additional object of the present invention is to provide a method for reprogramming tumor cell metabolism by blocking glucose uptake and shifting metabolism, for example, towards oxidative phosphorylation, by providing one or more anti-SLC2A1 antibodies or binding fragments thereof to tumor cell cultures in vitro.

[0013] A further object of the present invention provides a method for reprogramming tumor cell metabolism in a patient by administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, wherein in a subset of tumor cells, inhibition of glucose uptake shifts metabolism, for example, towards oxidative phosphorylation.

[0014] An additional object of the present invention is to provide methods for inhibiting cancer cell metabolism in vitro or in vivo by blocking glucose uptake with one or more anti-SLC2A1 antibodies or binding fragments thereof and inhibiting oxidative phosphorylation with metabolic regulators, such as complex I inhibitors metformin, phenformin, and IACS-010579.

[0015] A further object of the present invention is to provide a method for inhibiting cancer cell metabolism in a patient, comprising administering to the patient one or more anti-SLC2A1 antibodies or binding fragments thereof simultaneously or sequentially with metabolic regulators, such as complex I inhibitors metformin, phenformin, and IACS-010579, wherein inhibition of glucose uptake in a subset of tumor cells, accompanied by inhibition of concomitant metabolic pathways, results in reduced fitness of the cancer cells.

[0016] It is a further object of the present invention to provide a method for treating cancer in a patient, comprising administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, whereby the cancer is treated.

[0017] A further object of the present invention is to provide a method for treating an infectious agent such as malaria in a patient, comprising administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, thereby treating the infectious agent.

[0018] It is a further object of the present invention to provide a method for treating diabetic side effects in a patient, comprising administering one or more anti-SLC2A1 antibodies or binding fragments thereof to the patient, thereby treating the diabetic side effects.

[0019] A further object of the present invention is the method as outlined above, wherein the anti-SLC2A1 antibody or binding fragment thereof is a heavy chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 41 to 80 and 337; a heavy chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 81 to 120 and 339; and a heavy chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID NOs: 121 to 160 and 340; and The object of the present invention is to provide a method for producing a light chain comprising one or more complementary determining region (CDR) amino acids selected from the group consisting of light chain CDR1 comprising amino acids selected from the group consisting of SEQ ID NOs: 201 to 240 and SEQ ID NO: 342, light chain CDR2 comprising amino acids selected from the group consisting of SEQ ID NOs: 241 to 280 and SEQ ID NO: 343, and light chain CDR3 comprising amino acids selected from the group consisting of SEQ ID NOs: 281 to 320 and SEQ ID NO: 344.

[0020] It is a further object of the present invention to provide a method as outlined above, wherein the anti-SLC2A1 antibody comprises a VL amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 40 and SEQ ID NO: 341, and a VH amino acid sequence selected from the group consisting of SEQ ID NOs: 161 to 180 and SEQ ID NO: 337.

[0021] It is a further object of the present invention to provide a method for diagnosing cancer, comprising: a) contacting tissue from a patient suspected of having cancer with at least one anti-SLC2A1 antibody or a binding fragment thereof; and b) determining the presence of SLC2A1 overexpression in the tissue as an indication of the presence of cancer. The anti-SLC2A1 antibody may be as described herein and as outlined above. [Brief explanation of the drawings]

[0022] [Figure 1] ELISA-based SLC2A1 VLP binding assay and EC50 values ​​of anti-SLC2A1 antibodies. Results ± SEM from n=3 independent experiments are shown. ELISA-based binding assay to estimate the binding affinity of anti-SLC2A1 antibodies to SLC2A1-pseudotyped VLPs. The figure shows the binding of six different antibodies and their respective effective concentration 50 (EC50) values. All antibodies bind to SLC2A1 on VLPs with low nanomolar EC50. [Figure 2] (A, B) Flow cytometry-based binding assay of HepG2 (A) and HepG2 (B) wild-type (wt) and SLC2A1 knockout (KO) cells. MFI ratio-mean fluorescence intensity ratio. Results ± SEM are shown from n=3 independent experiments. Anti-SLC2A1 antibody binding to HepG2 wild-type (wt) and SLC2A1 knockout (KO) cell lines was assessed by flow cytometry. The anti-SLC2A1 antibody specifically binds to wt but not KO HepG2 cells. [Figure 3](A, B, C) ELISA-based evaluation of anti-SLC2A1 antibody binding to VLPs carrying SLC2A2, SLC2A3, and SLC2A4. ELISA-based glucose transporter binding comparison of (A) 2E5#22, (B) 6F12#33, and (C) R14#54 antibodies. Results ± SEM from one to two representative experiments with n=2 technical replicates are shown. [Figure 4] (A, B) Deoxyglucose uptake in the presence of anti-SLC2A1 antibody or BAY-876, a glucose uptake inhibitor. Results ± SEM from one to three representative experiments with n=2 technical replicates are shown. (A) A concentration-dependent decrease in glucose uptake is observed after 2 hours of incubation with anti-SLC2A1 antibody or BAY-876. [Figure 5] Effect of single-agent anti-SLC2A1 antibody on MCF7 cell confluence. Results ± SEM from n=3 independent experiments are shown. Inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibody. A decrease in cell confluence is detected after 24 hours of incubation. [Figure 6] Figure 6 shows inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibody and complex I inhibitors metformin (Figure 6), phenformin (Figure 7), and IACS-010759 (Figure 8). Complete and synergistic MCF7 cell growth inhibition is observed when cells are co-treated with anti-SLC2A1 antibody and complex I inhibitor. Effect of anti-SLC2A1 antibody in combination with metformin on MCF7 proliferation. Results ± SEM from one representative experiment with n=4 technical replicates are shown. [Figure 7] Figure 6 shows inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibody and complex I inhibitors metformin (Figure 6), phenformin (Figure 7), and IACS-010759 (Figure 8). Complete and synergistic MCF7 cell growth inhibition is observed when cells are co-treated with anti-SLC2A1 antibody and complex I inhibitor. Effect of anti-SLC2A1 antibody in combination with phenformin on MCF7 proliferation. Results ± SEM from n=3 independent experiments are shown. [Figure 8]Figure 6 shows inhibition of MCF7 breast cancer cell proliferation in the presence of anti-SLC2A1 antibodies and complex I inhibitors metformin (Figure 6), phenformin (Figure 7), and IACS-010759 (Figure 8). Complete and synergistic MCF7 cell growth inhibition is observed when cells are co-treated with anti-SLC2A1 antibodies and complex I inhibitors. Effect of anti-SLC2A1 antibodies in combination with IACS-010759 on MCF7 proliferation. Results ± SEM from n=4 independent experiments are shown. [Figure 9] Comparison of different anti-SLC2A1 antibody clones in their effects on MCF7 proliferation in combination with phenformin. The dashed line indicates the mean MCF7 normalized confluence for untreated samples (UT). Results ± SEM from one representative experiment with n=3 technical replicates are shown. Selection of anti-SLC2A1 antibodies with strong synergistic effects with phenformin co-treatment. Antibodies 2E5#22, 5G5#30, 6F12#33, and 7C3#39 completely inhibit MCF7 cell growth in a concentration-dependent manner when combined with phenformin. [Figure 10] IC50 of co-treatment of anti-SLC2A1 antibody and 130 μM phenformin on MCF7 proliferation. Results ± SEM from two individual experiments with n=2 technical replicates are shown. Anti-SLC2A1 inhibits the growth of MCF7 cell line in a concentration-dependent manner in the presence of 130 μM phenformin. [Figure 11] (A, B, C) Effect of anti-SLC2A1 antibodies in combination with IACS-010759 on prostate cancer (A) and pancreatic cancer (B, C) cell line proliferation. Results from one representative experiment with n=2 technical replicates are shown. Validation of synergistic growth inhibition of anti-SLC2A1 and complex I inhibitors. Anti-SLC2A1 antibodies, when combined with IACS-010759, dramatically inhibit the growth of PC3 prostate cancer and pancreatic cancer cell lines PANC1 and MIAPACA2. [Figure 12] (A, B, C) Antitumor efficacy against established MiaPaca2 xenograft tumors. (A) Measurement of tumor volume (A), body weight (B), and antibody serum concentration (C) over time. Results from one experiment with n = 10 animals per group are shown.

[0023] definition As used herein, an "antibody" is a polypeptide that specifically binds and recognizes an antigen or antigenic fragment thereof.

[0024] A "monoclonal antibody" is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies of the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic epitope.

[0025] The term "disease" refers to any change in the state of the body or some organ that interrupts or interferes with the performance of functions and / or causes discomfort, disability, suffering, or even death to the affected person or to those in contact with them. Cancer or tumors fall within the definition of disease.

[0026] As used herein, the terms "treat," "treatment," and "treating" refer to therapeutic treatment, the purpose of which is to reverse, alleviate, ameliorate, inhibit, slow, or halt the progression or severity of a disease, including cancer.

[0027] A treatment is "effective" if the progression of a disease is reduced or halted. That is, "treatment" includes not only the improvement of symptoms or markers, but also the halting or at least slowing of the progression or worsening of symptoms compared to that expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, a decrease in the extent of disease, a stable (i.e., non-worsening) state of disease, a delay or slowing of disease progression, an improvement or palliation of the disease state, remission (whether partial or total), and / or reduced mortality.

[0028] As used herein, the terms "prevent" or "prevention" refer to stopping, hindering, and / or slowing down a disease. In one embodiment, "prevent" is synonymous with "inhibit."

[0029] As used herein, the term "administering" refers to the placement of a compound disclosed herein in a subject by a method or route that results in at least partial delivery of the agent at a desired site. Pharmaceutical compositions containing a compound disclosed herein can be administered by any suitable route that results in effective treatment in the subject.

[0030] As used herein, "subject" means a mammal, preferably a human. The terms "individual," "patient," and "subject" are used interchangeably herein.

[0031] The terms "increased," "increase," or "enhancing" are all used herein to generally mean an increase by a statically significant amount, and the terms "increased," "increase," or "enhancing" mean an increase of at least 10% compared to a reference level of 20, for example, an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to the reference level, or an increase of up to 100%, or any increase between 10-100%, or at least about 2-fold, or at least about 3-fold, or at least about 25-, 4-fold, or at least about 5-fold, or at least about 10-fold increase compared to the reference level, or any increase from 2-fold to 10-fold or more.

[0032] The terms "reduce," "reducing," "reduction," or "inhibit" are all used herein to generally mean a statistically significant decrease. For example, "reduce," "reducing," "reduction," or "inhibit" refers to a decrease of at least 10% compared to a reference level, e.g., at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to 100% (e.g., a nonexistent or undetectable level compared to a reference level), or any decrease between 10 and 100% compared to a reference level. In the context of a marker or symptom, a statistically significant decrease in such level is meant. A decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40%, or more, preferably to a level accepted as within the normal range for individuals without a given disease.

[0033] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0034] As used herein, the term "in combination" refers to the use of two or more prophylactic and / or therapeutic agents, either simultaneously or sequentially, and in a manner such that their respective effects are additive or synergistic.

[0035] As used herein, a "composition" refers to a single or combination of antibodies or antigen-binding fragments thereof disclosed herein, which may be the same or different, for prophylactic or therapeutic treatment. Such combinations may be selected according to the desired immunity or effect. The antibody-based pharmaceutical compositions of the present invention may be formulated by any number of strategies known in the art (see, e.g., McGoff and Scher, 2000, Solution Formulation of Proteins / Peptides: In McNally, EJ, ed. Protein Formulation and Delivery. New York, NY: Marcel Dekker; pp. 139-158; Akers and Defilippis, 2000, Peptides and Proteins as Parenteral Solutions. In: Pharmaceutical Formulation Development of Peptides and Proteins. Philadelphia, Pa.: Talyor and Francis; pp. 145-177; Akers, et al., 2002, Pharm. Biotechnol. 14:47-127).

[0036] Increasing evidence supports the idea that altered metabolism in cancer cells can be exploited as a therapeutic target. Abnormal glucose metabolism in human tumors is known as the Warburg effect, which is characterized by significantly elevated rates of glucose consumption and lactate excretion, even in the presence of oxygen. 21 Because glycolytic intermediates are used in various pathways to facilitate the biosynthesis of new macromolecules and organelles, elevated levels of glucose consumption sustain high cell proliferation. 22 To allow for the uptake of large amounts of glucose, the expression of glucose transporters is often upregulated on tumor cells. 13、23、24 Increased glucose uptake and utilization has also been observed in clinical settings where glucose uptake is visualized by using labeled glucose analogs. 25 .

[0037] GLUT1 inhibition results in the blockage of downstream metabolic pathways from glucose and can limit the proliferation of glycolysis-dependent cancer cells. Small molecule inhibitors of GLUT1 have been developed, but they lack specificity for GLUT1. 26~28 Targeting other group I glucose transporters is undesirable because they have important functions in central processes in the body. Inhibiting GLUT1 function with monoclonal antibodies may allow for much greater specificity than small molecule drugs.

[0038] Cancers that are highly dependent on glycolysis may be particularly sensitive to GLUT1 inhibition. For example, high expression of SLC7A11 sensitizes cancer cells to acute death during glucose restriction. 29、30 Inactivating mutations in TCA cycle proteins or OXPHOS may also result in greater glucose dependence. 31~34 However, some tumors have inherent metabolic plasticity and can use energy-generating pathways other than glycolysis to sustain their energy needs. Inhibiting glycolysis alone has been shown to induce a metabolic shift toward mitochondria-dependent oxidative phosphorylation (OXPHOS). 35 Anti-GLU1 therapeutic monoclonal antibodies and simultaneous targeting of glycolysis with OXPHOS may hold more promise to specifically restrict the growth of such tumor cells.

[0039] Combination therapy The compounds of the present invention can be administered as a single pharmaceutical agent or in combination with one or more other pharmaceutical agents, provided that the combination does not cause unacceptable side effects. The present invention also relates to such combinations. Possible combinatorial approaches using compounds include standard chemotherapy options, but also combinations of existing and novel targeted therapies and immunotherapies (e.g., angiogenesis inhibitors, receptor tyrosine kinase inhibitors, CTLA4, and PD-1 / PD-L1 inhibitors). In addition, compounds that affect metabolic pathways can be added to the composition, including, but not limited to, metformin, phenformin, and complex I inhibitors such as IACS-010759.

[0040] Generally, the use of systemic tumor agents in combination with the compounds or compositions of the present invention may include: (1) results in better efficacy in reducing tumor growth or even eliminating tumors compared to administration of either agent alone; (2) providing for the administration of smaller amounts of chemotherapeutic / targeting / immunogenic agents; (3) provide a treatment that is well tolerated in patients with fewer adverse pharmacological complications than those observed with monotherapy and certain other combination therapies; (4) provide for the treatment of a wider range of different cancer types in mammals, particularly humans; (5) provide a higher response rate among treated patients; (6) Providing longer survival times among treated patients compared with standard treatment; (7) providing more time for tumor progression; and / or (8) Helps produce efficacy and tolerability results that are at least as good as those of the drugs used alone, compared to known examples where combinations of other cancer drugs produce antagonistic effects.

[0041] The compounds and compositions of the present disclosure are expected to be effective as therapeutic agents in treating various tumor types. In vitro and in vivo experiments have been conducted using breast cancer, colorectal cancer, and pancreatic cancer, all of which are expected to respond to the compounds and compositions. Furthermore, the compositions and compounds may be used to treat several other cancer types, including, but not limited to, lung cancer, hepatocellular carcinoma, biliary tract cancer, and cervical cancer.

[0042] Additionally, the compounds and compositions of the present disclosure are expected to be effective in treating infectious diseases such as malaria, and in treating the side effects of diabetes in patients.

[0043] A further use of the compounds and compositions of the present disclosure is a method for diagnosing cancer in a patient by contacting tissue from the patient with an anti-SLC2A1 antibody and determining the presence of SLC2A1 overexpression in the tissue as an indicator of the presence of cancer. DETAILED DESCRIPTION OF THE INVENTION

[0044] Immunization of chickens, discovery and isolation of SLC2A1-binding monoclonal antibodies using Hybrifree technology Immunization, discovery, and isolation of monoclonal antibodies recognizing the SLC2A1 protein were performed using Hybrifree technology (Kivi G, et al., BMC 15 Biotechnol. 2016;16:2, incorporated herein by reference). Brown Nick chickens, approximately 5 to 8 months old, were immunized five times with 0.6 mg of SLC2A1 DNA expression vector per injection in combination with electroporation (EP). This was followed by one final boost with SLC2A1-pseudotyped VLPs. Chickens were immunized intramuscularly and intradermally every 2 to 2.5 weeks. 2.5 weeks after the fifth immunization, chickens were boosted intramuscularly, intravenously, or intradermally with SLC2A1-pseudotyped VLPs. After confirmation of antigen-specific antibody responses in the serum, spleens were collected 2 to 4 days after the final immunization. Animals were anesthetized, and spleens were removed and stored on ice (within 1 hour) until processing. To prepare cell homogenates, spleens were homogenized in ice-cold PBS using a 40 μm cell dissociation sieve. Cells were pelleted and frozen in 1 mL cryovials using ice-cold freezing medium (fetal bovine serum (FBS) + 10% DMSO). For antibody isolation, the frozen spleen cell suspension was thawed, washed, and collected in 10 mL of RPMI 1640 supplemented with penicillin / streptomycin and 10% FBS. The cells were then seeded into 100 mm cell culture dishes and incubated at 37°C in an 8% CO2 atmosphere for approximately 1 hour. The floating cells (a fraction enriched for B cells and separated from plastic-adherent cells, e.g., macrophages) were then collected, the viable cell count determined, and the cells were transferred to capture medium (RPMI 1640 supplemented with 0.5% BSA and 0.1% NaN3). For capture or panning of B cells expressing SLC2A1 protein-specific antibodies on their surface, MaxiSorp™ surface 96-well (Thermo Fisher Scientific, US) was coated with SLC2A1 pseudotyped VLPs and blocked with 2% BSA in PBS for 1 hour. 4 × 10 cells were added in capture medium. 4One hundred microliters of cell suspension containing viable cells was loaded into a single well. The plate was centrifuged (200 × g, 5 min) and incubated for 45–60 min. The medium was discarded, and loosely attached cells were removed by washing 4–5 times with PBS. Finally, plastic-bound cells were lysed and subjected to total RNA isolation and cDNA synthesis using oligo T primers. cDNA synthesis was performed using the SuperScript™ IV First-Strand Synthesis System (Thermo Fischer Scientific catalog number: 18091050) and the oligo d(T)20 primer provided with the kit. The antibody VH and VL region cDNAs were amplified using a forward primer that bound to the FR1 region of the VH or VL lambda light chain coding sequence, respectively, and a reverse primer that bound to the junction region between the variable and constant region coding sequences of the chicken IgY heavy chain and lambda light chain.

[0045] The chicken HC forward primer is SEQ ID NO: 321 (GTGACCACAGGCGTCCACAGCGCCGTGACGTTGGACGAGTCCG) Chicken HC reverse primer is SEQ ID NO: 322 (CACGCTAGGTCCCTTGGTCGAAGCGGAGGAGACGATGACTTCGGTC) The chicken LC-lambda forward primer is SEQ ID NO: 323 (GGCTGACAGACGCCAGGTGCGCGCTGACTCAGCCGTCCTCG) The chicken LC reverse primer is SEQ ID NO: 324 (GGAGCGGCCTTAGGCTGGCCTAGGACGGTCAGGGTTGTCCC)

[0046] Using a ligase-independent cloning strategy, both VH and VL PCR products recovered from the same capture reaction were precisely ligated to promoter and secretory leader peptide cDNAs at the 5' end and constant domain cDNAs at the 3' end. The reaction creates a natural junction between the variable and constant domains of the human IgG1 heavy and lambda light chains, respectively. The final product of the cloning reaction is the pQMCF IgG shuttle expression vector, which contains an ampicillin resistance gene for selective growth of transformed E. coli and separate mammalian expression cassettes for the IgG1 heavy and light chains. Transformation of the cloning reaction into competent E. coli cells and bacterial cultures were grown in liquid medium. Subsequently, a library pool of antibody expression vectors was obtained by purification of the plasmid DNA products from the grown bacteria. In principle, such a library pool is a VH / VL combinatorial library of a limited number of VH and VL sequences recovered from the same capture reaction and ligated pairwise into a single expression vector molecule. The efficiency of antigen-specific IgG reconstitution from VH and VL combinations was first analyzed via transfection of the library pool. DNA was transfected into CHO cells, and after 48–72 h, the culture supernatant was assessed by ELISA for the secretion of IgG molecules that specifically recognized the SLC2A1 protein (VLP), thus indicating the presence of the desired VH / VL combination in the library. Library pools that showed clearly positive signals were then divided into individual clones by reverse transformation into competent E. coli cells and harvesting individual bacterial colonies, each containing a single type of plasmid with a unique VH and VL combination. Specific SLC2A1 binding determination by ELISA was then repeated using supernatants from CHO cells transfected with plasmid DNA preparations derived from single clones instead of the library pool. Finally, the VH and VL sequences were identified by sequencing the VH and VL inserts of positive plasmid clones.

[0047] Affinity maturation library and oligonucleotide design Affinity maturation libraries were designed based on structural analysis and a rational approach. Four oligonucleotides were synthesized that anneal to the H1, H2, H3, and L3 CDR regions containing different numbers of randomized codons. Randomization of the oligonucleotides was achieved using non-equimolar degenerate oligonucleotides that combined mixtures of nucleotides at specific positions during DNA synthesis (Integrated DNA Technologies) to generate mutagenic oligonucleotides.

[0048] The mutated oligonucleotides were used to generate an affinity maturation library with randomized CDR regions H1, H2, H3, and L3 using the Kunkel mutagenesis protocol (Kunkel, 1985). To force mutations and avoid obtaining wt#33 Fab displayed on phage, two STOP codons (TAA and TGA) were introduced in tandem into the template phagemid in CDR H2 by Kunkel mutagenesis. These STOP codons replaced two amino acids in CDR H2 to generate a stop template, resulting in a non-functional Fab. The STOP template was generated using the AM_H2_Stop_Short oligonucleotide according to SEQ ID NO: 332. CTGGAATTCGTCGCAGCTATTTAATGATGGACAGCCTACGCGAC

[0049] The ccc-dsDNA containing the desired mutations was electroporated into SS320 E. coli cells and grown overnight. The following day, the phage library was extracted by PEG / NaCl precipitation. Nunc ImmunoSorp 96-well ELISA plates (Thermo Fisher Scientific, US) were coated with SLC2A1 VLP or BSA in PBS, then washed and blocked with 1% BSA, 0.05% Tween 20. The library was incubated on the negative BSA selection plate, after which the library was transferred to an SLC2A1 selection plate for positive selection. Unbound, nonspecific, and weakly binding phage were removed by washing, and target-binding phage were eluted using 0.1 M HCl followed by neutralization with 1 M Tris pH 11 buffer. The eluted phage were then collected and used for titration or reinfection. For reinfection, XL1 Blue cells were infected with the phage output and helper phage M13KO7 (New England Biolabs, USA), and the phages were precipitated the next day. SLC2A1-specific phages were identified by SLC2A1 VLP ELISA, and the VH and VL sequences of positive phage clones were identified by PCR amplification and sequencing of the VH and VL inserts.

[0050] The forward primer for PCR amplification was according to SEQ ID NO:333. TGTAAAACGACGGCCAGTCTATTGCTACAAATGCCTATGCATCC The reverse primer for PCR amplification was according to SEQ ID NO:334. CAGGAAACAGCTATGACCCACCGGTTCGGGGAAGTAG The sequencing forward primer was according to SEQ ID NO:335. TGTAAAACGACGGCCAGT The reverse sequencing primer was according to SEQ ID NO: 336 CAGGAAACAGCTATGACC

[0051] ELISA-based VLP binding assay An ELISA-based VLP binding assay was performed to compare the EC50 values ​​of antibody clones (Figure 1). Similarly, an ELISA-based VLP binding assay was performed to compare the binding of antibodies to different glucose transporters (Figure 3). MaxiSorp™ high-capacity binding ELISA plates (Thermo Fisher Scientific, US) were coated overnight with 5 μg / mL of SLC2A1, SLC2A2, SLC2A3, or SLC2A4 pseudotyped VLPs or mock VLPs in PBS. The plates were washed and blocked for 1 hour with 0.05% Tween 20, 2% BSA in PBS. Serial dilutions of antibodies were incubated on the washed plates for 1 hour, followed by incubation with a goat anti-human IgG horseradish peroxidase (HRP)-conjugated antibody (Invitrogen) for 1 hour. TMB (3,3',5,5'-tetramethylbenzidine) solution VII (Biopanda Diagnostics) was used as the substrate for HRP, and 0.5 M H2SO4 was used as the stop solution. After each step, the wells were washed with 0.05% Tween 20, 0.1% Proclin 300 in PBS. Absorbance at 450 nm was measured using a Thermo Scientific™ Multiskan™ FC Microplate Photometer. Exemplary antibodies 1G2#9, 2A2#12, 2E5#22, 5G5#30, 6F12#33, and 7C3#39 all bound to SLC2A1 VLPs with low nanomolar EC50 values ​​(Figure 1). Exemplary antibodies 2E5#22 and 6F12#33 both bound less to SLC2A2, SLC2A3, and SLC2A4 VLPs than to mock VLPs (Figure 3).

[0052] Flow cytometry-based cell binding assay A flow cytometry-based binding assay in HepG2 wild-type (wt, Abcam, ab275467) and SLC2A1 knockout (KO) cells (Abcam, ab280797) was used to demonstrate the specific binding of anti-SLC2A1 antibodies to the SLC2A1 membrane protein (Figure 2). 6Cells were incubated on ice in the presence of a 100 nM anti-SLC2A1 antibody solution in flow cytometry buffer (1% FBS, 1 mM EDTA in PBS). This was followed by incubation with a secondary goat anti-human IgG AF488 antibody (Jackson Immuno Research). Mean fluorescent intensity (MFI) was measured in the FITC channel using a Becton, Dickinson and Company Accuri C6 Plus flow cytometer, and MFI ratios were calculated by dividing the MFI of each antibody by the MFI of an anti-HEL isotype (Icosagen Cell Factory) control staining. MFI ratios greater than 1.5 were considered binding. None of the evaluated antibodies bound to HepG2 SLC2A1 KO cells because the MFI ratios were below 1.5. However, all antibodies bound to HepG2 wt cells with MFI ratios well above 1.5. The results demonstrate specific binding to the SLC2A1 membrane protein.

[0053] 2-deoxyglucose uptake assay To evaluate whether the described anti-SLC2A1 antibodies inhibit glucose uptake, a commercially available glucose uptake-Glo assay kit (Promega) was used according to the manufacturer's instructions. Briefly, HEK-293-ALL cells were transfected with a human SLC2A1 expression plasmid and incubated overnight at 37°C in the presence of 5% CO2. Cells were washed twice with 0.5% BSA PBS, and 7,000 cells per well were plated into white, clear-bottom 96-well plates in 0.5% BSA PBS in the presence of 0.35 nM to 6.89 μM anti-SLC2A1 antibodies or the glucose uptake inhibitor BAY-876 (CaymanChem). Cells were incubated at room temperature for 2 hours. Glucose uptake was initiated by the addition of 1 mM 2-deoxyglucose (2DG) and allowed to proceed for 20 minutes at 37°C in the presence of 5% CO2. After adding the STOP and neutralization reagents included in the kit, luminescence was measured using a GloMax Explorer microplate reader (Promega). Nonspecific luminescence was measured in lysates from cells without added 2DG. Data were normalized to nonspecific luminescence and to the average luminescence in the absence of inhibitor. After adding anti-SLC2A1 antibodies, a strong concentration-dependent decrease in glucose uptake was observed; exemplary antibodies 2E5#22 and 6F12#33 or BAY-876 were used to show the results in Figure 4.

[0054] Cell proliferation inhibition assay The effect of anti-SLC2A1 antibodies on cancer cell proliferation was assessed without labeling using the Incucyte S3 Live cell analysis instrument and the Cell-by-Cell analysis software module (Sartorius) (Figures 5-11). MCF7, PC3, PANC1, or MIAPACA2 cells were plated in Plasmax medium (Ximbio) supplemented with 2.5% FBS on flat-bottom tissue culture 96-well plates. Cells were incubated overnight, and 0.02 nM to 13 μM anti-SLC2A1 antibodies, anti-HEL isotype control, PBS, or BAY-876 were added to the cells alone or in combination with metformin (CaymanChem), phenformin (Sigma-Aldrich), or IACS-010759 (CaymanChem). Cell confluence or object counts were measured using the Incucyte S3 for 24 to 96 hours and normalized to the 0-hour or 4-hour time point. Anti-SLC2A1 antibodies inhibit cancer cell proliferation, especially in combination with the complex I inhibitors metformin, phenformin, and IACS-010759. Exemplary antibodies 1G2#9, 2A2#12, 2E5#22, 5G5#30, 6F12#33, 7C3#39, and R14#54 were used in proliferation assays.

[0055] Antitumor efficacy against MiaPaca2 xenograft tumors Hsd:Athymic-Nude Foxn1 nu Mice (10 per group) were subcutaneously inoculated with 5e6 MiaPaca2 cells / mouse. Tumors were allowed to grow to a size of 100 mm, and then IP treatment with 200 μg of 6F12#33 per mouse was initiated, with or without a daily dose of phenformin at 20 mg / kg / IP every 72 hours. Figures 12A-12C show the results of tumor volume over time, body weight measurements over time, and serum concentrations over time. Statistically significant tumor growth inhibition was observed for co-treatment with 6F12#33 and phenformin compared to phenformin alone, using a mixed-effects model followed by Tukey's post-hoc test. Body weight did not change. Serum antibody levels, monitored by VLP ELISA, remained stable throughout the experiment.

[0056] Characterization of antibody clones The resulting antibody clones are listed in the table below with respect to VH and VL sequences and heavy and light chain CDRs.

[0057] [Table 1-1]

[0058] [Table 1-2]

[0059] [Table 1-3]

[0060] [Table 1-4]

[0061] [Table 1-5]

[0062] [Table 1-6]

[0063] [Table 1-7]

[0064] [Table 1-8]

[0065] ELISA results show that the anti-SLC2A1 antibodies bind with high affinity to their target expressed on the VLP surface (Figure 1). Furthermore, the antibodies bind to HepG2 tumor cells, which endogenously express SLC2A1 (Figure 2). The antibodies are highly specific for SLC2A1, as they do not bind to HepG2 cells that are negative for SLC2A1 (knockout (KO) HepG2 cells, Abcam, ab280797). Specific binding to SLC2A1 compared to other related glucose transporters was demonstrated in an ELISA-based SLC2A2, SLC2A3, and SLC2A4 VLP binding assay (Figure 3). Partial binding of the 2E5#22 antibody was observed to VLPs other than SLC2A1, which is due to the low endogenous levels of SLC2A1 on all VLPs (determined by mass spectrometry, data not shown). Importantly, the anti-SLC2A1 antibodies described herein are potent inhibitors of glucose uptake (Figure 4). Inhibition of glucose uptake directly affects the ability of cancer cells to fuel their growth via glycolysis. However, this may cause cells to rely on OXPHOS as an alternative to sustain proliferation. Indeed, when MCF7 breast cancer cells were incubated in the presence of anti-SLC2A1 antibody 2E5#22, only slight inhibition of cell growth was observed using the Incucyte Live-Cell Analysis system, which tracks cell growth as a time course of confluence or cell number (Figure 5). Metformin, phenformin, and IACS-010759 are all inhibitors of OXPHOS. We used anti-SLC2A1 antibodies in combination with metformin, phenformin, and IACS-010759 to simultaneously inhibit both glycolysis and OXPHOS, enhancing growth inhibition. When MCF7 breast cancer cells were treated with anti-SLC2A1 5G5#30 or 6F12#33 in combination with metformin, phenformin, or IACS-010759, the growth of MCF7 breast cancer cells was dramatically inhibited (Figures 6, 7, and 8, respectively). The effect of combined treatment with metformin, phenformin, or IACS-010759 and anti-SLC2A1 was much greater than the growth inhibition induced by anti-SLC2A1 alone (Figures 6, 7, and 8).However, metformin, phenformin, or IACS-010759 alone did not affect cell growth of the MCF7 breast cancer cell line (Figures 6, 7, and 8, respectively).

[0066] The rapid and potent antiproliferative effect of anti-SLC2A1 antibodies in combination with OXPHOS inhibitors such as phenformin allows for easy comparison of anti-SLC2A1 antibodies after 24 hours of co-treatment incubation (Figure 9). In Figure 9, antibodies 2E5#22, 5G5#30, 6F12#33, and 7C3#39 stand out as the most potent growth inhibitors of MCF7 breast cancer cell growth in combination with phenformin. No growth inhibition was detected when phenformin was used alone or in combination with antibodies 1G2#9 and 2A2#12 or an isotype control (Figure 9). In Figure 10, the anti-SLC2A1 antibodies R14#54 and 6F12#33 exhibited concentration-dependent growth inhibition of MCF7 cells in the presence of 130 μM phenformin, with R14#54 appearing to be the most potent antibody.

[0067] The anti-SLC2A1 antibodies 2E5#22 and 6F12#33 and the OXPHOS inhibitor IACS-010759 were used as exemplary compounds to evaluate the efficacy of combination therapy in other tumor types; other compounds with similar OXPHOS inhibitory effects can also be used. Strong synergistic growth inhibition by 2E5#22 and IACS-010759 was observed in the prostate cancer cell line PC3 compared to single-agent treatment (Figure 11A). Furthermore, the same dramatic growth reduction was detected in the pancreatic cancer cell lines PANC1 and MIAPACA2 with co-treatment of 6F12#33 and IACS-010759 compared to single-agent treatment (Figures 11B and 11C, respectively). While growth of PC3 and MIAPACA2 cells was inhibited by IACS-010759 treatment alone, MIAPACA2 cells showed sensitivity to anti-SLC2A1 treatment alone (Figure 11). This highlights the heterogeneity in metabolic pathways utilized by tumor cells. Nevertheless, combining anti-SCL2A1 antibodies with OXPHOS inhibitors had a significant growth inhibitory effect, and the in vitro results presented in Figure 11 indicate that this combination may be an option for limiting the growth of various tumor types.

[0068] In an in vivo experimental system, when MIAPACA2 pancreatic cancer cells were xenografted into immunodeficient mice, anti-SLC2A1 antibody alone did not affect tumor growth. However, as observed in in vitro assays, co-treatment with anti-SLC2A1 antibody 6F12#33 and phenformin resulted in statistically significant tumor growth inhibition (Figure 12A). No changes in animal weight were observed during treatment (Figure 12B), and antibody levels did not decrease (Figure 12C).

[0069] References [1] Yan, N. Trends Biochem. Sci. 38, 151-159 (2013). [2] Jardetzky, O. Nat. 1966 2115052 211,969-970(1966). [3]Quistgaard,EM et al.Nat.Struct.Mol.Biol.2013 206 20,766-768(2013). [4]Mueckler,M.et al.Mol.Aspects Med.34,121-138(2013). [5]Thorens,B.Diabetology 58,221-232(2015). [6]Leto,D.et al.Nat.Rev.Mol.Cell Biol.13,383-396(2012). [7]Vannucci, SJet al.Glia 21,2-21(1997). [8]Moley, KHSemin.Reprod.Med.17,137-152(1999). [9]Hankir,MKet al.EMBO Rep.19,e46404(2018).

[10] Mueckler, M. et al.Science(80-.).229,941-945(1985).

[11] Morgello,S.et al.Glia 14.43-54(1995).

[12] Shim,BYet al.Int.J.Color.Dec.2012 283 28,375-383(2012).

[13] Sun, HWet al. PLoS One 11, e0168907 (2016).

[14] Hanahan, D. et al.Cell 144,646–674(2011).

[15] Noguchi,Y.et al.Cancer Lett.154,175-182(2000).

[16] Ito,S.et al.J.Natl.Cancer Inst.94,1080-1091(2002).

[17] Seki, T. et al. Nature 608,421-428(2022).

[18] Wei,M.et al.Biochem.Biophys.Res.Commun.503,1154–1159(2018).

[19] Wang,J.et al.Proc.Natl.Acad.Sci.USA116,10744-10748(2019)。

[20] Lu, L. et al. J. Cell. Physiol. 228, 251-257 (2013).

[21] Warburg,O.et al.J.Gen.Physiol.8,519-530(1927)。

[22] Heiden,MGVet al.Science(80-.).324,1029-1033(2009)。

[23] Yamamoto,T.et al.Biochem.Biophys.Res.Commun.170,223-230(1990)。

[24] Zhang,X.et al.BMC Cancer 21,1-10(2021)。

[25] Beaney,RPSemin.Nucl.Med.14,324-341(1984)。

[26] Ojelabi,OAet al.J.Biol.Chem.291,26762(2016)。

[27] Siebeneicher,H.et al.ChemMedChem 11,2261(2016)。

[28] Olszewski,K.et al..Cell Chem.Biol.29,423-435.e10(2022)。

[29] Koppula, P. et al. J. Biol. Chem. 292, 14240 (2017).

[30] Shin,CEt al.Nat.Commun.2017 81 8,1-11(2017)。

[31] Martinez-Reyes,I.et al.Nat.Commun.2020 111 11,1-11(2020)。

[32] Yang,Y.et al.Cancer Genet.Cytogenet.196,45-55(2010)。

[33] Birsoy,K.et al.Nat.2014 5087494 508,108-112(2014)。

[34] Saxena,N.et al.JNCI J.Natl.Cancer Inst.108,287(2016)。

[35] Sottnik,J.L.et al.Clin.Exp.Metastasis 28,865-875(2011)。

Claims

1. An antibody or antigen-binding fragment thereof that binds to the SLC2A1 protein and inhibits glucose uptake in tumor cells.

2. 2. The antibody or antigen-binding fragment of claim 1, wherein the antibody or antigen-binding fragment binds to SLC2A1 with an EC50 value of less than 10 nM, more preferably less than 5 nM, and most preferably less than 2 nM.

3. the antibody or antigen-binding fragment: a heavy chain CDR1 comprising an amino acid selected from the group consisting of SEQ ID NOs: 41-80 and SEQ ID NO: 337; a heavy chain CDR2 comprising an amino acid selected from the group consisting of SEQ ID NOs: 81-120 and SEQ ID NO: 339; a heavy chain CDR3 comprising an amino acid selected from the group consisting of SEQ ID NOs: 121-160 and SEQ ID NO: 340; and 3. The antibody or antigen-binding fragment of claim 1, comprising one or more complementarity-determining regions (CDRs) having an amino acid sequence selected from the group consisting of: a light chain CDR1 comprising amino acids selected from the group consisting of SEQ ID NOs: 201-240 and SEQ ID NO: 342; a light chain CDR2 comprising amino acids selected from the group consisting of SEQ ID NOs: 241-280 and SEQ ID NO: 343; and a light chain CDR3 comprising amino acids selected from the group consisting of SEQ ID NOs: 281-320 and SEQ ID NO:

344.

4. 4. The antibody or antigen-binding fragment of claim 1, comprising a heavy chain variable region having an amino acid sequence according to any one of SEQ ID NOs: 161-180 and SEQ ID NO: 337 and / or a light chain variable region having an amino acid sequence according to any one of SEQ ID NOs: 1-40 and SEQ ID NO:

341.

5. A method for inhibiting glucose uptake in tumor cells, comprising administering to a patient having a tumor a compound comprising at least one anti-SLC2A1 antibody or antigen-binding fragment thereof.

6. The method of claim 5, wherein the antibody or antigen-binding fragment is according to any one of claims 1 to 4.

7. 7. The method of claim 5 or 6, wherein the method comprises administering the compound simultaneously or sequentially with at least one oxidative phosphorylation inhibitor.

8. 8. The method of claim 7, wherein the at least one oxidative phosphorylation inhibitor is selected from the group consisting of metformin, phenformin, and IACS-010579.

9. A pharmaceutical composition for use in the treatment of cancer, said composition comprising one or more anti-SLC2A1 antibodies or antigen-binding fragments thereof, optionally in combination with one or more oxidative phosphorylation inhibitors.

10. The pharmaceutical composition of claim 9, wherein the one or more antibodies or antigen-binding fragments thereof are selected from the antibodies and antigen-binding fragments of any one of claims 1 to 4.

11. 11. The pharmaceutical composition of claim 9 or 10, wherein the one or more oxidative phosphorylation inhibitors are selected from the group consisting of metformin, phenformin, and IACS-010579.

12. The pharmaceutical composition according to any one of claims 9 to 11, wherein the composition inhibits metabolism of cancer cells selected from breast cancer cells, hepatocellular carcinoma cells, colorectal cancer cells, lung cancer cells, pancreatic cancer cells, biliary tract cancer cells, and cervical cancer cells.

13. An anti-SLC2A1 antibody or binding fragment thereof for use in the treatment of an infectious disease.

14. A method for treating an infectious disease, comprising administering to a patient an anti-SLC2A1 antibody or binding fragment thereof.

15. The anti-SLC2A1 antibody or binding fragment thereof of claim 13, or the method of claim 14, wherein the infectious disease is malaria.

16. An anti-SLC2A1 antibody or binding fragment thereof for use in treating side effects of diabetes.

17. A method for treating a side effect of diabetes in a patient, comprising administering to said patient an anti-SLC2A1 antibody or binding fragment thereof.

18. A method for diagnosing cancer, comprising contacting tissue from a patient suspected of having said cancer with an anti-SLC2A1 antibody or a fragment thereof, and determining the presence of overexpression of SLC2A1 in said tissue as an indication of the presence of cancer, wherein the overexpression is determined to be sufficient to treat said patient.