Lipid compounds and compositions for delivery of active agents - Patent Application 20070122999

Abstract

The present invention relates to novel lipid compounds and lipid nanoparticle (LNP) compositions containing the same. The lipid compounds of the present invention can directly or indirectly bind to and surround active substances through multivalent interactions, thereby increasing the structural stability of the active substance. Furthermore, lipid nanoparticles containing the lipid compounds significantly improve the intracellular delivery efficiency and activity of active substances upon administration to the body, and therefore may be useful for the treatment and prevention of diseases.

Description

[Technical Field]

[0001] The present invention relates to lipid compounds that deliver active substances into cells in vivo, and lipid nanoparticle compositions containing said lipid compounds. [Background technology]

[0002] In recent years, the COVID-19 pandemic emergency and the continued emergence of new virus variants have led to rapid development of mRNA vaccine technology, which allows for faster development and greater versatility than traditional vaccines. mRNA vaccines have been the subject of intensive research over the past decade, and in addition to SARS-CoV-2, they are being studied for influenza, Zika virus, rabies, respiratory syncytial virus (RSV), cytomegalovirus (CMV), and cancer vaccines. Unlike traditional vaccines that contain pathogens (such as viruses), mRNA vaccines contain only mRNA, which carries the genetic information of the virus, making them significantly safer (non-infectious).

[0003] COVID-19 mRNA vaccines primarily contain mRNA encoding the spike protein found on the surface of SARS-CoV-2. Once administered, mRNA is delivered to the cytoplasm of cells, where it expresses the spike protein. This protein then functions as an antigen, leading to the production of antibodies against the virus. Because mRNA vaccines can be manufactured by modifying the mRNA base sequence according to the virus's genetic information, vaccine development and production speeds are extremely fast, making them effective at responding to virus variants. This makes mRNA vaccines more versatile and flexible than conventional vaccines, offering advantages in terms of speed of production and cost.

[0004] However, mRNA is structurally very fragile and can be easily destroyed by enzymes such as RNase (ribonuclease), and genetic information can be damaged depending on the storage environment. Therefore, a delivery vehicle is essential that fully protects the mRNA structure to maximize vaccine efficacy, and improves mRNA delivery to the cytoplasm through high intracellular delivery efficiency and smooth endosomal escape. Known mRNA delivery vehicles include viral vectors and lipid nanoparticles (LNPs). However, viral vectors have concerns about immune responses and long-term toxicity, as well as limitations on the size of the mRNA they can contain. Therefore, lipid nanoparticles (LNPs) are attracting attention as the most promising delivery vehicle.

[0005] In particular, the recent COVID-19 pandemic has led to a growing demand for next-generation LNP delivery vehicles that improve the structural stability of mRNA and the stability of LNPs containing it, as well as the efficacy and safety of vaccines, and even enable targeting to specific tissues (sites) within the body. To this end, research into the development of new lipid compounds and LNP compositions containing them is actively underway worldwide. Summary of the Invention [Problem to be solved by the invention]

[0006] One object of the present invention is to provide a lipid compound that can improve the binding strength and stability of an active substance, and a lipid nanoparticle composition containing the lipid compound.

[0007] Another object of the present invention is to provide a lipid nanoparticle composition comprising said lipid compound.

[0008] Another object of the present invention is to provide a method for producing active agent-lipid nanoparticles.

[0009] Yet another object of the present invention is to provide a pharmaceutical composition comprising the lipid nanoparticle composition and a pharmaceutically acceptable carrier.

[0010] Yet another object of the present invention is to provide a method for preventing or treating a disease, comprising the step of administering the lipid nanoparticle composition to an individual in need thereof. [Means for solving the problem]

[0011] To achieve the above object, the present invention provides a lipid compound represented by the following Chemical Formula 1, an isomer thereof, or a salt thereof:

[0012] [C1]

[0013] JPEG2025540651000002.jpg34117

[0014] In the above formula,

[0015] R 1 is hydrogen, hydroxy, C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 2-6 Alkenyloxy, -CN, -NO2, -N(R)2, -C(=O)R, -C(=O)OR, -OC(=O)R, -C(=O)N(R)2, -NRC(=O)R, -NRC(=O)N(R)2, -NRC(=S)N(R)2, C 3-14 cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl or -O-3-14 membered heterocyclyl, wherein said C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 2-6 Alkenyloxy, C 3-14 Cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl and -O-3-14 membered heterocyclyl are each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6may be substituted with alkyl,

[0016] X 1 is a single bond, -CO-C 1-6 Alkyl, -CO-C 2-6 Alkenyl, -C(=O)NR-, -NRC(=O)-, -NRC(=O)NR-, -NRC(=S)NR-, C 6-10 Aryl, C 3-14 cycloalkyl, 5- to 10-membered heteroaryl, 3- to 14-membered heterocyclyl, nucleobase, amino acid monomer or amino acid oligomer, wherein said -CO-C 1-6 Alkyl, -CO-C 2-6 Alkenyl, C 6-10 Aryl, C 3-14 The cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, nucleobase, amino acid monomer, or amino acid oligomer is each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6 may be substituted with alkyl,

[0017] L 1 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b and

[0018] n is an integer of 1 to 5, and when n is 2 to 5, X 1 and L 1 is chosen independently in each case,

[0019] L 2 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or Ra MR b and L 2 is the above L 1 Same or different from

[0020] Y is hydrogen, -(CH2) m OH, -(CH2) m SH or -(CH2) m SeH, where m is an integer from 0 to 5;

[0021] R 2 and R 3 are each independently C 1-30 Alkyl, C 2-30 alkenyl, or R c MR d where C 1-30 Alkyl and C 2-30 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-16 Alkyl or C 2-16 substituted with alkenyl,

[0022] M and M 1 are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)2-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-;

[0023] R is independently hydrogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 3-14 cycloalkyl, 5-10 membered heteroaryl, or 3-14 membered heterocyclyl;

[0024] R a and R b are independently -(CH2) l- , -C 3-20 Cycloalkyl-(CH2) l- , -(CH2) l- C 3-20Cycloalkyl-, -C 6-20 Aryl-(CH2) l - 、 -(CH2) l -C 6-20 Aryl-, -NH-(CH2) l- or -(CH2)-, where l is an integer from 0 to 10;

[0025] R c is C 1-14 Alkylene or C 2-14 is alkenylene,

[0026] R d is C 1-20 Alkyl, C 2-20 alkenyl or hydrogen, wherein said C 1-20 Alkyl and C 2-20 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 substituted with alkenyl,

[0027] The heteroaryl is an aromatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S, and the heterocyclyl is an aliphatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S. [Effects of the Invention]

[0028] The lipid compounds according to the present invention can bind to and surround active substances directly or indirectly through multivalent interactions, thereby increasing the structural stability of the active substance, and lipid nanoparticle compositions containing them can significantly improve the intracellular delivery efficiency and activity of the active substance. [Brief explanation of the drawings]

[0029] [Figure 1] The figure shows an example of the structure of mRNA-LNP and the structure of a conventional lipid compound that constitutes it. [Figure 2]1 shows the binding mode between a lipid compound and mRNA according to one embodiment of the present invention. [Figure 3] 1 is a graph showing the results of measuring the apparent pKa of mRNA-LNP prepared according to one embodiment of the present invention. [Figure 4] 1 is a graph showing the results of measuring the size (hydrodynamic diameter) and polydispersity index (PDI) of mRNA-LNPs prepared according to an embodiment of the present invention. [Figure 5] 1 is a graph showing the results of measuring the surface charge of mRNA-LNP prepared according to one embodiment of the present invention. [Figure 6] These are images of the whole body of a mouse that was intramuscularly injected with fLuc mRNA-LNP prepared according to one embodiment of the present invention, taken at various time points after administration using an imaging device (IVIS Lumina III) designed specifically for small animals. [Figure 7] The graph shows the results of quantitative analysis of the luminescence images obtained in the experiment in Figure 6. [Figure 8] 1 is a graph showing the measurement of mRNA levels of four indicators related to immune responses induced by LNP in cells treated with mRNA-LNP prepared according to one embodiment of the present invention. [Figure 9] The graph shows the results of analyzing five toxicity indicators for the liver, kidneys, etc. by collecting blood samples after a certain period of time following injection of mRNA-LNP prepared according to one embodiment of the present invention into a living body. [Figure 10] 1 is a graph showing measurements of the size, polydispersity, and encapsulation efficiency of LNP samples according to the time elapsed after production of mRNA-LNPs prepared according to one embodiment of the present invention and the temperature conditions. BEST MODE FOR CARRYING OUT THE INVENTION

[0030] To achieve the above object, the present invention provides a lipid compound represented by the following Chemical Formula 1, an isomer thereof, or a salt thereof:

[0031] [C1]

[0032] JPEG2025540651000003.jpg34117

[0033] In the above formula,

[0034] R 1 is hydrogen, hydroxy, C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 2-6 Alkenyloxy, -CN, -NO2, -N(R)2, -C(=O)R, -C(=O)OR, -OC(=O)R, -C(=O)N(R)2, -NRC(=O)R, -NRC(=O)N(R)2, -NRC(=S)N(R)2, C 3-14 cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl or -O-3-14 membered heterocyclyl, wherein said C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 2-6 Alkenyloxy, C 3-14 Cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl and -O-3-14 membered heterocyclyl are each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6 may be substituted with alkyl,

[0035] X 1 is a single bond, -CO-C 1-6 Alkyl, -CO-C 2-6 Alkenyl, -C(=O)NR-, -NRC(=O)-, -NRC(=O)NR-, -NRC(=S)NR-, C 6-10 Aryl, C 3-14 cycloalkyl, 5- to 10-membered heteroaryl, 3- to 14-membered heterocyclyl, nucleobase, amino acid monomer or amino acid oligomer, wherein said -CO-C1-6 Alkyl, -CO-C 2-6 Alkenyl, C 6-10 Aryl, C 3-14 The cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, nucleobase, amino acid monomer, or amino acid oligomer is each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6 may be substituted with alkyl,

[0036] L 1 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b and

[0037] n is an integer of 1 to 5, and when n is 2 to 5, X 1 and L 1 is chosen independently in each case,

[0038] L 2 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b and L 2 is the above L 1 Same or different from

[0039] Y is hydrogen, -(CH2) m OH, -(CH2) m SH or -(CH2) m SeH, where m is an integer from 0 to 5;

[0040] R 2 and R 3 are each independently C 1-30Alkyl, C 2-30 alkenyl, or R c MR d where C 1-30 Alkyl and C 2-30 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-16 Alkyl or C 2-16 substituted with alkenyl,

[0041] M and M 1 are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)2-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-;

[0042] R is independently hydrogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 3-14 cycloalkyl, 5-10 membered heteroaryl, or 3-14 membered heterocyclyl;

[0043] R a and R b are independently -(CH2) l- , -C 3-20 Cycloalkyl-(CH2) l- , -(CH2) l- C 3-20 Cycloalkyl-, -C 6-20 Aryl-(CH2) l - 、 -(CH2) l -C 6-20 Aryl-, -NH-(CH2) l- or -(CH2)-, where l is an integer from 0 to 10;

[0044] R c is C 1-14 Alkylene or C 2-14 is alkenylene,

[0045] R dis C 1-20 Alkyl, C 2-20 alkenyl or hydrogen, wherein said C 1-20 Alkyl and C 2-20 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 substituted with alkenyl,

[0046] The heteroaryl is an aromatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S, and the heterocyclyl is an aliphatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S.

[0047] In another aspect, the present invention provides a lipid nanoparticle composition comprising the lipid compound of Chemical Formula 1, an isomer thereof, or a salt thereof. DETAILED DESCRIPTION OF THE INVENTION

[0048] The present invention will be described in more detail below.

[0049] In the present invention, the term "halogen" means F, Cl, Br or I, unless otherwise specified.

[0050] The term "hydroxy" refers to the group --OH.

[0051] The term "alkyl" in the present invention means a linear or branched saturated hydrocarbon functional group. 1-6 "Alkyl" has 1 to 6 carbon atoms. Specifically, C 1-6Alkyl includes, but is not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, 1-methylbutyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 4-methyl-2-pentyl, 3,3-dimethylbutyl, 2-ethylbutyl, etc. The alkyl groups may be independently substituted with one or more substituents, for example, a methyl group may be substituted with 1 to 3 functional groups such as halogen, alcohol, thiol, selenol, etc., C 1-6 It may be substituted with alkyl and other hydrocarbon groups.

[0052] The term "alkylene" refers to a linear or branched saturated hydrocarbon chain containing no hydrogen at either end, such as ethylene (-CH2CH2-) or propylene (-CH2CH2CH2-). The alkylene group may be independently substituted with one or more substituents.

[0053] The term "alkenyl" means a linear or branched unsaturated hydrocarbon group containing one or more double bonds, said alkenyl group being optionally substituted independently with one or more substituents. As an example, "C 2-6 Alkenyl has 2 to 6 carbon atoms. Specifically, C 1-6 Alkenyl includes, but is not limited to, ethenyl (vinyl group), n-propenyl, n-butenyl, 1-methyl-2-propenyl, 2-methyl-2-propenyl, n-pentenyl, 1-methyl-2-butenyl, 2-methyl-2-butenyl, n-hexenyl, and the like.

[0054] The term "alkenylene" refers to propenylene (-CH=CHCH 2- ), 2-pentenylene (-CH2CH=CHCHCH2CH 2-Alkenylene refers to a linear or branched unsaturated hydrocarbon chain having at least one double bond, such as an alkyl group, and no hydrogen atoms at either end. The alkenylene group may be independently substituted with one or more substituents.

[0055] The term "alkoxy" refers to the formula "-O-alkyl", where the alkoxy group may be independently substituted with one or more substituents. For example, C 1-6 Alkoxy includes, but is not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, tert-butoxy, n-pentoxy, isopentoxy, tert-pentoxy, sec-pentoxy, neopentoxy, hexyloxy, etc. In one embodiment, the alkoxy group may be substituted with one or more substituents, for example, 1 to 3 halogens, hydroxy, or C 1-6 It may be substituted with alkyl and other hydrocarbon groups.

[0056] The term "alkenyloxy" refers to the formula "-O-alkenyl", which may be independently substituted with one or more substituents. For example, C 2-6 Alkenyloxy includes, but is not limited to, ethenyloxy, n-propenyloxy, isopropenyloxy, n-butenyloxy, 1-methyl-2-propenyloxy, 2-methyl-2-propenyloxy, n-pentenyloxy, 1-methyl-2-butenyloxy, 2-methyl-2-butenyloxy, n-hexenyloxy, etc. In one embodiment, the alkenyloxy group may be substituted with one or more substituents, for example, 1 to 3 halogens, hydroxy, or C 1-6 It may be substituted with alkyl and other hydrocarbon groups.

[0057] The term "cycloalkyl" refers to at least one saturated ring or at least one non-aromatic ring hydrocarbon, where the non-aromatic ring may have some degree of unsaturation. Unless otherwise specified, cycloalkyl may be monocyclic or polycyclic, where the polycyclic ring is intended to include fused rings, bridged rings, or spiro rings. The cycloalkyl group may be optionally substituted with one or more substituents. In one embodiment of the present invention, "C 3-14 "Cycloalkyl" refers to a cycloalkyl having 3 to 14 carbon atoms forming a ring. In one embodiment, 0, 1, 2, 3, or 4 atoms of each ring of the cycloalkyl group may be substituted by a substituent. 3-14 Representative examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, cyclooctyl, bicyclo[1.1.0]butyl, bicyclo[2.2.1]heptyl, adamantyl, and the like.

[0058] The term "aryl" refers to a monocyclic or bicyclic aromatic ring. That is, as used herein, aryl can include phenyl, naphthyl, etc., and biaryl, unless otherwise defined. In one embodiment of the present invention, C 6-10 Aryl refers to an aromatic ring having 6 to 10 carbon atoms. In one embodiment, 0, 1, 2, 3, 4, 5, or 6 atoms of each ring of the aryl group may be substituted by a substituent.

[0059] The term "heteroaryl" refers to an aromatic 5-10 membered monocyclic or bicyclic heterocycle containing 1-6 heteroatoms selected from N, O, and S. That is, a heteroaryl can be a 5- or 6-membered aromatic heterocycle containing 1-6 heteroatoms selected from N, O, and S, or a bicyclic ring in which the heteroaryl ring is fused to a benzene ring or another heteroaryl ring. In one embodiment, 0, 1, 2, 3, or 4 atoms of each ring of a heteroaryl group can be optionally substituted by a substituent.Representative examples of the heteroaryl include pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1,2,3-triazolyl, 1,3,4-triazolyl, 1-oxa-2,3-diazolyl, 1-oxa-2,4-diazolyl, 1-oxa-2,5-diazolyl, 1-oxa-3,4-diazolyl, 1-thia-2,3-diazolyl, 1-thia-2,4-diazolyl, 1-thia-2,5-diazolyl, 1-thia-3, 4-diazolyl, tetrazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indazolyl, benzimidazolyl, benzotriazolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrazolo[4,3-d]pyridinyl, pyrazolo[4 , 3-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, pyrazolo[3,4-b]pyridinyl, purinyl, indolizinyl, imidazo[1,2-a]pyridinyl, imidazo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyridinyl, pyrrolo[1,2-b]pyridazinyl, imidazo[1,2-c]pyrimidinyl, quinolinyl, isoquinolinyl, cinnolinyl, azaquinazolinyl, quinoxalinyl, phthalazinyl, 1,6-naphthyridinyl, 1,7-naphthyridinyl, 1,8-naphthyridinyl pyrimidinyl, 1,5-naphthyridinyl, 2,6-naphthyridinyl, 2,7-naphthyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[4,3-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrido[2,3-b]pyrimidinyl, pyrido[2,3-b]pyrazinyl, pyrido[3,4-b]pyrazinyl, pyrimido[5,4-d]pyrimidinyl, pyrazino[2,3-b]pyrazinyl, pyrimido[4,5-d]pyrimidinyl and similar groups.

[0060] The term "heterocyclyl" refers to a saturated or partially unsaturated ring containing, in addition to carbon atoms, 1 to 4 heteroatoms selected from N, O, and S. Unless otherwise specified, a heterocyclyl may be monocyclic or polycyclic. For example, a "3- to 14-membered heterocyclyl" refers to an aliphatic heterocycle containing 3 to 14 ring-forming atoms, and may include a 3- to 6-membered aliphatic heterocycle, or a bicyclic ring in which the heterocyclyl ring is fused to a benzene ring or another heterocyclyl ring. In one embodiment, 0, 1, 2, 3, or 4 atoms of each ring of a heterocyclyl group may be substituted by a substituent. For example, heterocyclyl includes, but is not limited to, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, dioxolyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl, oxazepanyl, indolyl, isoindolyl, dihydroindolyl, dioxoisoindolinyl, dihydrofuryl, dihydroimidazolinyl, dihydrooxazolyl, dihydrobenzodioxinyl, tetrahydropyridinyl, dihydropyranyl, dihydrobenzofuranyl, benzodioxolyl, or benzodioxanyl, and similar groups.

[0061] The term "nucleobase" refers to a nitrogen-containing biological compound that constitutes a nucleotide, a unit of RNA or DNA nucleic acids. Specifically, the main nucleobases found in RNA are adenine, guanine, cytosine, and uracil. Nucleobases can be naturally occurring or modified. In certain embodiments, a nucleobase can further include any atom or group of atoms capable of hydrogen bonding to a nucleobase of another nucleic acid. For example, naturally occurring nucleobases include the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U). In addition, the nucleobases include various modified nucleobases or nucleobase mimics known to those skilled in the art.

[0062] The term "amino acid" refers to a compound or unit that makes up a protein and has the chemical formula NHCl. n It refers to a compound containing an amino group (NH2) and a carboxy group (-COOH), which can be represented as COOH.

[0063] The term "substitution" refers to the replacement of a hydrogen atom in a molecular structure with a substituent such that the atom on the specified atom does not exceed its valence, resulting in a chemically stable compound. For example, "group A is substituted with substituent B" means that a hydrogen atom bonded to an atom such as a carbon that constitutes the backbone of group A is replaced with substituent B, forming a covalent bond between group A and substituent B.

[0064] The term "substituent" refers to another group attached to the core group, and there can be one or more substituents. When there are multiple substituents, the substituents can be the same or different. When the core group and the substituents are all hydrocarbon groups, the number of carbon atoms in the core does not include the number of carbon atoms in the substituents. For example, a butyl group (-C4H9) with a methoxy group (-O-CH3) as a substituent is classified as a C1 alkoxy group and a C4 alkyl group.

[0065] The term "isomer" refers to multiple stereoisomers. Embodiments of the present invention may produce multiple stereoisomers during the manufacturing process. If no specific stereoisomer is indicated, it can include all stereoisomers that can be produced during the reaction.

[0066] The term "active agent" refers to a biologically active substance, and refers to any substance that, when administered to a subject, has or has a therapeutic, diagnostic, and / or prophylactic effect and induces a desired biological and / or pharmacological effect. Such active agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, nucleic acids, etc. When delivered to a cell or organ, the active agent may exhibit a desired change in the cell, organ, or other body tissue or system, and may be useful for treating one or more diseases, disorders, or conditions. Specific examples of the active agent include siRNA, shRNA, rRNA, tRNA, mRNA, miRNA, saRNA, circRNA, DNA, cDNA, plasmids, DNAzymes, ribozymes, PNAs, aptamers, antisense oligonucleotides, CRISPRs, proteins, carbohydrates, or drugs.

[0067] In the examples of the present invention, the following abbreviations are used throughout: "Ac" means acetyl, "AcO" or "OAc" means acetoxy, "ACN" means acetonitrile, "aq" means aqueous, "BOC", "Boc" or "boc" means N-tert-butoxycarbonyl, "Bn" means benzyl, "Bu" means butyl, "nBu" means normal-butyl, "tBu" means tert-butyl, "Cbz" means benzyloxycarbonyl, "DCC" means N,N'-dicyclohexylcarbodiimide, "DCM" means methylene chloride (CHCl), "DEA" means diethylamine, "DIPEA" means diisopropylethylamine, "DMF" means N,N-dimethylformamide, "DMSO" means dimethylsulfoxide, "EDC" means 1-ethyl-3-(3-dimethylaminopropyl)carboxydiimide, "EDTA" means ethylenediaminetetraacetic acid, and "Et" means ethyl. "EtOH" means ethanol, "HATU" means (1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate, "HOAc" or "AcOH" means acetic acid, "IPA" means isopropyl alcohol, "LAH" means lithium aluminum hydride, "mCPBA" means meta-chloroperoxy-benzoic acid, "Me" means methyl, "MeOH" means methanol, "MS" means mass spectrometry, "MTBE" means methyl tert-butyl ether, "NHS" means N-chlorosuccinimide, "Ph" means phenyl, "PyBOP" means benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate, "TFA" means trifluoroacetic acid, "THF" means tetrahydrofuran, "TLC" means thin layer chromatography, and "R f" means residence fraction, "rt" means residence time, "rt" means ambient temperature, "h" means hours, "min" means minutes, "s" means seconds, "equiv." means equivalent, and "sat." means saturation.

[0068] Figure 1 shows an example of the structure of mRNA-LNP and the conventional lipid compound structures that make it up. Referring to Figure 1, lipid nanoparticle (LNP) delivery vehicles generally consist of four lipid compounds surrounding an active substance: (A) cationic lipids or ionizable lipids that exhibit cationic properties in a (weakly) acidic environment; (B) phospholipids that form the outermost layer of the LNP; (C) cholesterol (structural lipids) that fill the voids within the LNP and increase its rigidity; and (D) PEGylated lipids (PEG (poly(ethyleneglycol))-lipids; PEG-lipids) that are distributed primarily on the surface of the LNP, contribute to stabilizing the LNP structure, and increase its solubility in water. Here, the ionizable lipids interact with the active substance in a (weakly) acidic environment, immobilizing it by surrounding its surface. The active substance may include siRNA, shRNA, rRNA, tRNA, mRNA, miRNA, saRNA, circRNA, DNA, cDNA, plasmid, DNAzyme, ribozyme, PNA, aptamer, antisense oligonucleotide, CRISPR, protein, carbohydrate, drug, etc.

[0069] FIG. 2 shows the binding mode between a lipid compound and mRNA according to one embodiment of the present invention.

[0070] 2, conventional lipid compounds have a cationizable tertiary amine at the center, a hydrophobic lipid tail, and a polar head group (e.g., a hydroxy group), whereas the lipid compounds of the present invention further contain an additional interactive group (yellow star).

[0071] In one embodiment of the lipid compound, the tertiary amine moiety may exhibit cationic properties in a (weakly) acidic environment, forming an attractive force between it and the anionic moiety of the active substance. In this case, the additional interactive group may form an additional interaction with another moiety of the active substance. The additional interaction may be a non-covalent bond such as hydrogen bonding or π-π interaction.

[0072] In other words, attractive forces such as electrostatic interactions, hydrogen bonds, and π-π interactions are formed between the lipid compound and the active substance, thereby increasing the stability between the lipid compound and the active substance and the stability of the lipid nanoparticles (LNPs) containing them.

[0073] The present invention provides a lipid compound represented by the following Chemical Formula 1, an isomer thereof, or a salt thereof:

[0074] [C1]

[0075] JPEG2025540651000004.jpg34117

[0076] In the above formula,

[0077] R 1 is hydrogen, hydroxy, C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6Alkoxy, C 2-6 Alkenyloxy, -CN, -NO2, -N(R)2, -C(=O)R, -C(=O)OR, -OC(=O)R, -C(=O)N(R)2, -NRC(=O)R, -NRC(=O)N(R)2, -NRC(=S)N(R)2, C 3-14 cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl or -O-3-14 membered heterocyclyl, wherein said C 1-6 Alkyl, C 2-6 Alkenyl, C 1-6 Alkoxy, C 2-6 Alkenyloxy, C 3-14 Cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, -O-5-10 membered heteroaryl and -O-3-14 membered heterocyclyl are each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6 may be substituted with alkyl,

[0078] X 1 is a single bond, -CO-C 1-6 Alkyl, -CO-C 2-6 Alkenyl, -C(=O)NR-, -NRC(=O)-, -NRC(=O)NR-, -NRC(=S)NR-, C 6-10 Aryl, C 3-14 cycloalkyl, 5- to 10-membered heteroaryl, 3- to 14-membered heterocyclyl, nucleobase, amino acid monomer or amino acid oligomer, wherein said -CO-C 1-6 Alkyl, -CO-C 2-6 Alkenyl, C 6-10 Aryl, C 3-14 The cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, nucleobase, amino acid monomer, or amino acid oligomer is each independently unsubstituted or substituted with 1 to 3 halogens or C 1-6 may be substituted with alkyl,

[0079] L1 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b and

[0080] n is an integer of 1 to 5, and when n is 2 to 5, X 1 and L 1 is chosen independently in each case,

[0081] L 2 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b and L 2 is the above L 1 Same or different from

[0082] Y is hydrogen, -(CH2) m OH, -(CH2) m SH or -(CH2) m SeH, where m is an integer from 0 to 5;

[0083] R 2 and R 3 are each independently C 1-30 Alkyl, C 2-30 alkenyl, or R c MR d where C 1-30 Alkyl and C 2-30 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-16 Alkyl or C 2-16 substituted with alkenyl,

[0084] M and M 1are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)2-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-;

[0085] R is independently hydrogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 3-14 cycloalkyl, 5-10 membered heteroaryl, or 3-14 membered heterocyclyl;

[0086] R a and R b are independently -(CH2) l- , -C 3-20 Cycloalkyl-(CH2) l- , -(CH2) l- C 3-20 Cycloalkyl-, -C 6-20 Aryl-(CH2) l - 、 -(CH2) l -C 6-20 Aryl-, -NH-(CH2) l- or -(CH2)-, where l is an integer from 0 to 10;

[0087] R c is C 1-14 Alkylene or C 2-14 is alkenylene,

[0088] R d is C 1-20 Alkyl, C 2-20 alkenyl or hydrogen, wherein said C 1-20 Alkyl and C 2-20 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 substituted with alkenyl,

[0089] The heteroaryl is an aromatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S, and the heterocyclyl is an aliphatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S.

[0090] In one embodiment, R 1 is hydrogen, hydroxy, C 1-6 Alkyl, C 1-6 Alkoxy, -CN, -NO2, -NH2, -C(=O)-C 1-3 Alkyl, -C(=O)NH2, -NHC(=O)-C 1-3 It can be alkyl, -NHC(=O)NH2, or -NHC(=S)NH2.

[0091] In one embodiment, in the compound of Formula 1, X1 is a single bond, C 1-6 Alkyl-CO-, C 2-6 Alkenyl can be -CO-, -C(=O)NH-, -C(=O)N(CH3)-, -NHC(=O)-, -N(CH3)C(=O)-, -NHC(=O)NH-, -N(CH3)C(=O)NH-, -NHC(=S)NH- or -N(CH3)C(=S)NH-.

[0092] Another example is X 1 can be a 5-10 membered heteroaryl.

[0093] Specifically, the X 1is pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1,2,3-triazolyl, 1,3,4-triazolyl, 1-oxa-2,3-diazolyl, 1-oxa-2,4-diazolyl, 1-oxa-2,5-diazolyl, 1-oxa-3,4-diazolyl, 1-thia-2,3-diazolyl, 1-thia-2,4-diazolyl, 1-thia-2,5-diazolyl, 1-thia-3,4-diazolyl, tetrazolyl Allyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indazolyl, benzimidazolyl, benzotriazolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrazolo[4,3-d]pyridinyl, pyrazolo[4,3-c]pyridinyl Pyrazolo[3,4-c]pyridinyl, pyrazolo[3,4-b]pyridinyl, purinyl, indolizinyl, imidazo[1,2-a]pyridinyl, imidazo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyridinyl, pyrrolo[1,2-b]pyridazinyl, imidazo[1,2-c]pyrimidinyl, quinolinyl, isoquinolinyl, cinnolinyl, azaquinazolinyl, quinoxalinyl, phthalazinyl, 1,6-naphthyridinyl, 1,7-naphthyridinyl, 1,8-naphthyridinyl The pyrimido[2,3-b]pyrimidinyl may be, but is not limited to, pyrido[3,4-b]pyrimidinyl, pyrido[4,3-b]pyrimidinyl, pyrido[3,4-b]pyrimidinyl, pyrido[2,3-b]pyrazinyl, pyrido[3,4-b]pyrazinyl, pyrimido[5,4-d]pyrimidinyl, pyrazino[2,3-b]pyrazinyl, or pyrimido[4,5-d]pyrimidinyl.

[0094] As another example, X 1may be a nucleobase. The nucleobase may be adenine, guanine, cytosine or uracil, and may include substitutions or modifications thereof.

[0095] As another example, X 1 may be an amino acid monomer, which may be alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, tryptophan, lysine, arginine, histidine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, or proline.

[0096] As another example, X 1may be an amino acid oligomer. The amino acid oligomer may be a small polymer formed by polymerizing 2 to 20 of the amino acid monomers. In this case, each amino acid monomer may be independently selected from the group consisting of alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, tryptophan, lysine, arginine, histidine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, and proline.

[0097] In one embodiment, L in the compound of Formula 1 1 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b It could be.

[0098] The M and M 1 may be independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)2-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-. That is, the M and M 1 is R a may be selected to be the same or different from each other at both ends.

[0099] R a and R b are independently -(CH2)l- , -C 3-20 Cycloalkyl-(CH2) l- , -(CH2) l- C 3-20 Cycloalkyl-, -C 4-20 Aryl-(CH2) l -, -(CH2) l -C 4-20 aryl-, where l is an integer of 0 to 10. That is, the R a and R b may be selected to be the same or different from each other at both ends of M.

[0100] In one embodiment, n in the compound of Formula 1 may be an integer of 1 to 5. When n is 2 to 5, X 1 and the L 1 may be selected independently in each case. Thus, each X 1 may all be selected the same or differently, and each L 1 may all be selected to be the same or different.

[0101] In one embodiment, L in the compound of Formula 1 2 is C 1-14 Alkylene, C 2-14 Alkenylene, M, R a M.R. a , M.R. a M 1 or R a MR b The L 2 is the L 1 may be the same as or different from L 2 The M, M 1 , R a and R b is the same as above.

[0102] In one embodiment, Y in the compound of Formula 1 is hydrogen, —(CH) m OH, -(CH2) m SH or -(CH2) m SeH, where m can be an integer from 0 to 5.

[0103] In one embodiment, R in the compound of Formula 1 2 and R 3 are each independently C 1-30 Alkyl, C 2-30 alkenyl, or R c MR d In this case, the C 1-30 Alkyl and C 2-30 Each alkenyl may be independently substituted with one or more substituents, such as C 1-16 Alkyl or C 2-16 It may be substituted with alkenyl.

[0104] The M's can independently be -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O-, or -OC(=O)NH-.

[0105] R c is C 1-14 Alkylene or C 2-14 It may be alkenylene.

[0106] R d is C 1-20 Alkyl, C 2-20 alkenyl or hydrogen, wherein said C 1-20 Alkyl and C 2-20 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 It may be substituted with alkenyl.

[0107] The salt of Formula 1 should have low toxicity to mammals, including humans, and should not adversely affect the biological activity and physicochemical properties of the parent compound. For example, the salt may be an acid addition salt formed with a free acid.

[0108] The free acid may be an inorganic acid or an organic acid. Inorganic acids may be hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, bromic acid, etc., and organic acids may be acetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, fumaric acid, maleic acid, malonic acid, phthalic acid, succinic acid, lactic acid, citric acid, gluconic acid, tartaric acid, salicylic acid, malic acid, oxalic acid, benzoic acid, embonic acid, aspartic acid, glutamic acid, etc.

[0109] The acid addition salts can be prepared by conventional methods, for example, by dissolving the compound of Formula 1 in an excess of aqueous acid and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile.

[0110] Furthermore, the salt may be an alkali metal salt (such as a sodium salt) or an alkaline earth metal salt (such as a potassium salt).

[0111] The alkali metal salt or alkaline earth metal salt can be obtained, for example, by dissolving the compound of Chemical Formula 1 in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate.

[0112] In another embodiment of the present invention, the compound of Formula 1 may be a compound of Formula 2 below:

[0113] [Case 2]

[0114] JPEG2025540651000005.jpg47146

[0115] In the above formula,

[0116] j and k are independently integers from 1 to 12;

[0117] M 2 and M 3are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O)2-, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-;

[0118] R 4 , R 5 , R 6 and R 7 are each independently hydrogen, C 1-24 Alkyl or C2-24 alkenyl, wherein said C 1-24 Alkyl and C 2-24 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 Substituted with alkenyl.

[0119] In one embodiment, R in the compound of Formula 2 1 , n, X 1 , L 1 , L 2 and Y are as described above for the compound of Formula 1.

[0120] In one embodiment, j and k in the compound of Formula 2 may each independently be an integer of 1 to 12.

[0121] In one embodiment, M in the compound of Formula 2 2 and M 3 are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O) 2- , -C(=O)S-, -SC(=O), -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-.

[0122] In one embodiment, R in the compound of Formula 2 4 , R 5 , R 6and R 7 are each independently hydrogen, C 1-24 Alkyl or C 2-24 alkenyl, wherein said C 1-24 Alkyl and C 2-24 Each alkenyl is independently unsubstituted or substituted with 1 to 3 C 1-20 Alkyl or C 2-20 It may be substituted with alkenyl.

[0123] Specific examples of the compound of Formula 1 according to the present invention include, but are not limited to, the following:

[0124] (1) heptadecan-9-yl 8-((6-acetamido-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0125] (2) heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0126] (3) heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0127] (4) heptadecan-9-yl 17-hydroxy-3,11-dioxo-19-(6-oxo-6-(undecyloxy)hexyl)-7-oxa-2,4,10,12,19-pentaazaheptacosano-27-ate,

[0128] (5) heptadecan-9-yl 25-hydroxy-3,11,19-trioxo-27-(6-oxo-6-(undecyloxy)hexyl)-7,15-dioxa-2,4,10,12,18,20,27-heptaazapentatriacontano-35-ate;

[0129] (6) heptadecan-9-yl 8-((2-hydroxy-6-(3-methylthioureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0130] (7) heptadecan-9-yl 8-((6-(cyclopentanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0131] (8) heptadecan-9-yl 8-((2-hydroxy-6-((R)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0132] (9) heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0133] (10) heptadecan-9-yl 8-((2-hydroxy-6-((R)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0134] (11) heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0135] (12) heptadecan-9-yl 8-((6-(cyclohexanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0136] (13) heptadecan-9-yl 8-((2-hydroxy-6-(piperazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0137] (14) heptadecan-9-yl 8-((6-(1,4-dimethylpiperazine-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0138] (15) heptadecan-9-yl 8-((6-(2-(1,4-dimethylpiperazin-2-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0139] (16) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0140] (17) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0141] (18) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0142] (19) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0143] (20) heptadecan-9-yl 8-((2-hydroxy-6-(4-nitro-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0144] (21) heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0145] (22) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0146] (23) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0147] (24) heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0148] (25) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0149] (26) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0150] (27) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0151] (28) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0152] (29) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0153] (30) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0154] (31) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0155] (32) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0156] (33) heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0157] (34) heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0158] (35) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0159] (36) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0160] (37) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0161] (38) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0162] (39) Heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0163] (40) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0164] (41) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0165] (42) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0166] (43) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0167] (44) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0168] (45) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0169] (46) heptadecan-9-yl 8-((2-hydroxy-6-(isoxazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0170] (47) heptadecan-9-yl 8-((2-hydroxy-6-(isoxazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0171] (48) heptadecan-9-yl 8-((2-hydroxy-6-(oxazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0172] (49) heptadecan-9-yl 8-((2-hydroxy-6-(oxazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0173] (50) heptadecan-9-yl 8-((6-(furan-3-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0174] (51) heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0175] (52) heptadecan-9-yl 8-((2-hydroxy-6-(picolinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0176] (53) heptadecan-9-yl 8-((2-hydroxy-6-(nicotinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0177] (54) heptadecan-9-yl 8-((2-hydroxy-6-(isonicotinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0178] (55) heptadecan-9-yl 8-((2-hydroxy-6-(pyridazine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0179] (56) heptadecan-9-yl 8-((2-hydroxy-6-(pyridazine-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0180] (57) Heptadecan-9-yl 8-((2-hydroxy-6-(pyrazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0181] (58) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0182] (59) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0183] (60) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0184] (61) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-indole-2-carboxyamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0185] (62) Heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-indole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0186] (63) heptadecan-9-yl 8-((2-hydroxy-6-(1H-indole-3-carboxyamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0187] (64) Heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-indole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0188] (65) heptadecan-9-yl 8-((6-(4-amino-2-oxo-1,2-dihydropyrimidine-1-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0189] (66) heptadecan-9-yl 8-((6-(2,4-dioxo-1,2,3,4-tetrahydropyrimidine-1-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0190] (67) heptadecan-9-yl 8-((6-(6-amino-9H-purine-9-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0191] (68) heptadecan-9-yl 8-((6-(2-amino-6-oxo-6,9-dihydro-1H-purine-9-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0192] (69) heptadecan-9-yl 8-((6-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0193] (70) heptadecan-9-yl 8-((6-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0194] (71) heptadecan-9-yl 8-((6-(2-(6-amino-9H-purin-9-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0195] (72) heptadecan-9-yl 8-((6-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0196] (73) heptadecan-9-yl 8-((6-((S)-2-amino-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0197] (74) heptadecan-9-yl 8-((6-((S)-2-acetamido-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0198] (75) heptadecan-9-yl 8-((6-((S)-2-amino-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0199] (76) Heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0200] (77) Heptadecan-9-yl 8-((6-((S)-2-amino-3-(1H-indol-3-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0201] (78) Heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-indol-3-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0202] (79) Heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0203] (80) heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0204] (81) Heptadecan-9-yl(6S,9S)-1,6-diamino-9-(3-guanidinopropyl)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18,-tetraazahexacosano-26-ate;

[0205] (82) heptadecan-9-yl 8-((6-((S)-2-((S)-2-amino-3-1H-imidazol-5-yl)propanamido)-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate;

[0206] (83) heptadecan-9-yl 8-((6-((S)-2-((S)-2-amino-3-(1H-imidazol-5-yl)propanamido)-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate;

[0207] (84) Heptadecan-9-yl(6S,9S)-9-((1H-imidazol-5-)methyl)-1,6-diamino-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18,-tetraazahexacosano-26-ate;

[0208] (85) Heptadecan-9-yl(6R,9S,12S)-1,6-diamino-9,12-bis(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate;

[0209] (86) Heptadecan-9-yl(6S,9S)-1-amino-6-((R)-2-amino-3-(1H-imidazol-5-yl)propanamido)-9-(3-guanidinopropyl)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate;

[0210] (87) Heptadecan-9-yl(2R,5S,8S)-5-((1H-imidazol-5-yl)methyl)-2-amino-8-(3-guanidinopropyl)-15-hydroxy-1-(1H-imidazol-5-yl)-3,6,9-trioxo-17-(6-oxo-6-(undecyloxy)hexyl)-4,7,10,17-tetraazapentacosanoate.

[0211] (88) Heptadecan-9-yl(6R,9S,12S)-9-((1H-imidazol-5-yl)methyl)-1,6-diamino-12-(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate;

[0212] (89) Heptadecan-9-yl(2R,5S,8S)-5,8-bis((1H-imidazol-5-yl)methyl)-2-amino-15-hydroxy-1-(1H-imidazol-5-yl)-3,6,9-trioxo-17-(6-oxo-6-(undecyloxy)hexyl)-4,7,10,17-tetraazapentacosanoic acid 25-ate;

[0213] (90) Heptadecan-9-yl(6R,9S,12S)-9,12-bis((1H-imidazol-5-yl)methyl)-1,6-diamino-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate;

[0214] (91) Heptadecan-9-yl(6R,9S,12S)-12-((1H-imidazol-5-yl)methyl)-1,6-diamino-9-(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate;

[0215] (92) Heptadecan-9-yl(6S,9S)-9-((1H-imidazol-5-yl)methyl)-1-amino-6-((R)-2-amino-3-(1H-imidazol-5-yl)propanamido)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate;

[0216] (93) Heptadecan-9-yl 1-(4-amino-2-oxopyrimidin-1(2H)-yl)-9-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-17-hydroxy-2,5,11-trioxo-19-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,19-pentaazaheptacosano-27-ate;

[0217] (94) Heptadecan-9-yl 9-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-1-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-15-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-23-hydroxy-2,5,11,17-tetraoxo-25-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,25-heptaazatritriacontano-23-ate;

[0218] (95) Heptadecan-9-yl 15-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-9-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetyl)-21-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-1-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-29-hydroxy-2,5,11,17,23-pentaoxo-31-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,21,24,31-nonaazanonatriacontano-39-ate;

[0219] (96) Heptadecan-9-yl 21-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-15-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetyl)-1-(2-(6-amino-9H-purin-9-yl)acetyl)-27-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-amino ethyl)-9-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetyl)-35-hydroxy-2,5,11,17,23,29-hexaoxo-37-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,21,24,27,30,37-undecaazapentatetracontano-45-ate,

[0220] (97) heptadecan-9-yl 8-((6-(4-(4-amino-1-methyl-1H-pyrrole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0221] (98) heptadecan-9-yl 8-((6-(4-(4-(4-amino-1-methyl-1H-imidazole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate;

[0222] (99) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-4-(1-methyl-4-(1-methyl-4-(1-methyl-1H-imidazole-2-carboxamido)-1H-imidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate;

[0223] (100) heptadecan-9-yl 8-((2-hydroxy-4-(3-methylureido)butyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0224] (101) heptadecan-9-yl 8-((2-hydroxy-5-(3-methylureido)pentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0225] (102) Heptadecan-9-yl 8-((2-hydroxy-7-(3-methylureido)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0226] (103) Heptadecan-9-yl 8-((2-hydroxy-8-(3-methylureido)octyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0227] (104) Heptadecan-9-yl 9-hydroxy-3-oxo-11-(6-oxo-6-(undecyloxy)hexyl)-7-oxa-2,4,11-triazanonadecano-19-ate,

[0228] (105) Heptadecan-9-yl 12-hydroxy-3-oxo-14-(6-oxo-6-(undecyloxy)hexyl)-7,10-dioxa-2,4,14-triazadocosano-22-ate,

[0229] (106) Heptadecan-9-yl 15-hydroxy-3-oxo-17-(6-oxo-6-(undecyloxy)hexyl)-7,10,13-trioxa-2,4,17-triazapentacosano-25-ate,

[0230] (107) Heptadecan-9-yl 8-((2-(hydroxymethyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0231] (108) Heptadecan-9-yl 8-((2-(2-hydroxyethyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0232] (109) Heptadecan-9-yl 8-((2-(3-hydroxypropyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0233] (110) (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-((2-hydroxy-6-(3-methylureido)hexyl)(methyl)amino)butanoate,

[0234] (111) heptadecan-9-yl 8-((2-hydroxy-6-(piperazine-1-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0235] (112) heptadecan-9-yl 8-((2-hydroxy-6-(4-methylpiperazine-1-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0236] (113) heptadecan-9-yl 8-((2-hydroxy-6-(2-(piperazin-1-yl)acetamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0237] (114) Heptadecan-9-yl 8-((2-hydroxy-6-(2-(4-methylpiperazin-1-yl)acetamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0238] (115) heptadecan-9-yl 8-((6-(furan-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0239] (116) Heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0240] (117) Heptadecan-9-yl 8-((6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0241] (118) Heptadecan-9-yl 8-((6-(dodecan-2-yloxy)-6-oxohexyl)(2-hydroxy-6-(3-methylureido)hexyl)amino)octanoate,

[0242] (119) Heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)(6-oxo-6-(tridecan-3-yloxy)hexyl)amino)octanoate,

[0243] (120) 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxy-6-(3-methylureido)hexyl)amino)pentyl dodecanoate,

[0244] (121) (9Z,28Z)-heptatriaconta-9,28-dien-19-yl 4-((2-hydroxy-6-(3-methylureido)hexyl)(methyl)amino)butanoate,

[0245] (122) Heptadecan-9-yl 8-((2-hydroxy-6-(1,3,5-triazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0246] (123) heptadecan-9-yl 8-((2-hydroxy-4-(1H-pyrrole-3-carboxamido)butyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0247] (124) Heptadecan-9-yl 8-((2-hydroxy-5-(1H-pyrrole-3-carboxamido)pentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0248] (125) heptadecan-9-yl 8-((2-hydroxy-7-(1H-pyrrole-3-carboxamido)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0249] (126) heptadecan-9-yl 8-((2-hydroxy-8-(1H-pyrrole-3-carboxamido)octyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0250] (127) heptadecan-9-yl 8-((3-(2-(1H-pyrrole-3-carboxamido)ethoxy)-2-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0251] (128) Heptadecan-9-yl 10-hydroxy-1-oxo-12-(6-oxo-6-(undecyloxy)hexyl)-1-(1H-pyrrol-3-yl)-5,8-dioxa-2,12-diazaicosan-20-ate,

[0252] (129) Heptadecan-9-yl 13-hydroxy-1-oxo-15-(6-oxo-6-(undecyloxy)hexyl)-1-(1H-pyrrol-3-yl)-5,8,11-trioxa-2,15-diazatricosano-23-ate,

[0253] (130) heptadecan-9-yl 8-((2-(hydroxymethyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0254] (131) Heptadecan-9-yl 8-((2-(2-hydroxyethyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0255] (132) Heptadecan-9-yl 8-((2-(3-hydroxypropyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0256] (133) heptadecan-9-yl 8-((6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate,

[0257] (134) Heptadecan-9-yl 8-((6-(dodecan-2-yloxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0258] (135) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(tridecan-3-yloxy)hexyl)amino)octanoate,

[0259] (136) 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)pentyl dodecanoate,

[0260] (137) (9Z,28Z)-heptatriaconta-9,28-dien-19-yl 4-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(methyl)amino)butanoate,

[0261] (138) (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(methyl)amino)butanoate,

[0262] (139) Heptadecan-9-yl 8-((6-(heptan-2-yloxy)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0263] (140) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(octan-2-yloxy)-6-oxohexyl)amino)octanoate,

[0264] (141) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(nonan-2-yloxy)-6-oxohexyl)amino)octanoate,

[0265] (142) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(tridecan-2-yloxy)hexyl)amino)octanoate,

[0266] (143) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(tetradecan-2-yloxy)hexyl)amino)octanoate,

[0267] (144) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(octan-3-yloxy)-6-oxohexyl)amino)octanoate,

[0268] (145) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-3-yloxy)hexyl)amino)octanoate,

[0269] (146) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(nonan-4-yloxy)-6-oxohexyl)amino)octanoate,

[0270] (147) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-4-yloxy)hexyl)amino)octanoate,

[0271] (148) Heptadecan-9-yl 8-((6-(decan-5-yloxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0272] (149) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-5-yloxy)hexyl)amino)octanoate,

[0273] (150) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-6-yloxy)hexyl)amino)octanoate,

[0274] (151) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylpentyl)oxy)-6-oxohexyl)amino)octanoate,

[0275] (152) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyloctyl)oxy)-6-oxohexyl)amino)octanoate,

[0276] (153) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylnonyl)oxy)-6-oxohexyl)amino)octanoate,

[0277] (154) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyldecyl)oxy)-6-oxohexyl)amino)octanoate,

[0278] (155) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylundecyl)oxy)-6-oxohexyl)amino)octanoate,

[0279] (156) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyldodecyl)oxy)-6-oxohexyl)amino)octanoate,

[0280] (157) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyltridecyl)oxy)-6-oxohexyl)amino)octanoate,

[0281] (158) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyltetradecyl)oxy)-6-oxohexyl)amino)octanoate,

[0282] (159) Heptadecan-9-yl 8-((6-((2-ethylhexyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0283] (160) heptadecan-9-yl 8-((6-((2-butyloctyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0284] (161) Heptadecan-9-yl 8-((6-((2-hexyloctyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0285] (162) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-octyldodecyl)oxy)-6-oxohexyl)amino)octanoate,

[0286] (163) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methylnonyl)oxy)-6-oxohexyl)amino)octanoate,

[0287] (164) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methyloctyl)oxy)-6-oxohexyl)amino)octanoate,

[0288] (165) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((7-methylnonyl)oxy)-6-oxohexyl)amino)octanoate,

[0289] (166) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((8-methyldecyl)oxy)-6-oxohexyl)amino)octanoate,

[0290] (167) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((7-methyloctyl)oxy)-6-oxohexyl)amino)octanoate,

[0291] (168) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((8-methylnonyl)oxy)-6-oxohexyl)amino)octanoate,

[0292] (169) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((9-methyldecyl)oxy)-6-oxohexyl)amino)octanoate,

[0293] (170) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((10-methylundecyl)oxy)-6-oxohexyl)amino)octanoate,

[0294] (171) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((11-methyldodecyl)oxy)-6-oxohexyl)amino)octanoate,

[0295] (172) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((12-methyltridecyl)oxy)-6-oxohexyl)amino)octanoate,

[0296] (173) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((5-methylheptan-2-yl)oxy)-6-oxohexyl)amino)octanoate,

[0297] (174) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((5-methyloctan-2-yl)oxy)-6-oxohexyl)amino)octanoate,

[0298] (175) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methylheptan-2-yl)oxy)-6-oxohexyl)amino)octanoate,

[0299] (176) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyloctan-3-yl)oxy)-6-oxohexyl)amino)octanoate,

[0300] (177) Heptadecan-9-yl 8-((6-((2,6-dimethylheptan-4-yl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate,

[0301] (178) Heptadecan-9-yl 8-((6-((7-ethyl-2-methylundecane-4-yl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate.

[0302] The lipid compounds according to the present invention can be advantageously used in lipid nanoparticle compositions to deliver active substances to mammalian cells or organs. For example, lipid nanoparticle compositions prepared containing the lipid compounds described herein are safe for in vivo administration and have excellent long-term stability at refrigerated and room temperature.

[0303] In another aspect, the present invention provides a method for preparing the lipid compound of Formula 1. Specifically, the lipid compound of Formula 1 can be prepared by the method shown in the reaction scheme described in the Examples, but is not limited to such a method. In particular, those skilled in the art will fully understand that the lipid compound of Formula 1 of the present invention can be prepared by various methods using techniques known in the art.

[0304] In yet another aspect, the present invention provides a lipid nanoparticle composition comprising the lipid compound of Chemical Formula 1, an isomer thereof, or a salt thereof.

[0305] Specifically, the composition may include a lipid compound of the compound of Chemical Formula 1, an isomer thereof or a salt thereof, a phospholipid, a structural lipid (e.g., cholesterol), a PEG-lipid, and an active substance.

[0306] The "phospholipid" in the present invention is a lipid that can contain a phosphate residue and one or more carbon chains, for example, unsaturated fatty acid chains. Phospholipids can contain one or more multiple (for example, double or triple) bonds (for example, one or more unsaturated). Certain phospholipids can promote condensation into membranes. For example, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (for example, cell or intracellular membranes). The condensation of phospholipids into membranes can allow one or more components of lipid-containing compositions to pass through the membrane, for example, allowing one or more components to be delivered to cells.

[0307] The lipid nanoparticle composition of the present invention may contain one or more phospholipids, such as one or more (poly)unsaturated lipids. The phospholipids can be assembled into one or more lipid bilayers. Generally, the phospholipids may contain a phospholipid residue and one or more fatty acid residues. The phospholipid residue may be selected from the group consisting of, for example, but not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid residue may be selected from the group consisting of, for example, but not limited to, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, paitanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0308] Specifically, the phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleo ... phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-dicosahexanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoylphosphatidylethanolamine The phosphatidylcholine may be selected from the group consisting of, but not limited to, 1-stearoyl-2-oleoyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0309] The lipid nanoparticle composition of the present invention may contain one or more structured lipids. The structured lipid may be selected from the group consisting of, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In some embodiments, the structured lipid is cholesterol. In some embodiments, the structured lipid may include, but is not limited to, cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone), or a combination thereof.

[0310] The lipid nanoparticle composition according to the present invention may contain one or more PEGylated lipids. The term "PEGylated lipid" refers to a lipid containing a polyethylene glycol (PEG) moiety, such as "PEG-lipid." PEGylated lipids include, for example, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be, but is not limited to, PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0311] In yet another embodiment, the present invention provides a method for delivering an active agent (e.g., mRNA) to a cell (e.g., a mammalian cell), the method comprising administering to a subject a lipid nanoparticle composition comprising a lipid compound of Formula 1, an isomer thereof or a salt thereof, a phospholipid, a structural lipid (e.g., cholesterol), a PEGylated lipid (PEG-lipid), and an active agent, wherein the administration involves contacting cells in the subject with the lipid nanoparticle composition, and the active agent is delivered to the cells.

[0312] The present invention also provides a method for preparing a pharmaceutical composition comprising the steps of: mixing an organic phase in which the lipid compound of Chemical Formula 1, its isomer, or a salt thereof, a phospholipid, a structural lipid, and a PEGylated lipid are mixed as ionizable lipids in a molar ratio of (20-60):(0-25):(30-60):(0-5), and an aqueous phase in which an active substance is dissolved;

[0313] The lipid compound of formula 1, its isomer, or salt thereof and the active substance are mixed in a weight ratio of (4-30):1, so that the ratio (N / P ratio) of the number of ionizable nitrogen atoms in the lipid compound of formula 1, its isomer, or salt thereof to the number of phosphorus atoms in the phosphate group exhibiting anionicity in the active substance is in the range of 1.5-15.

[0314] Specific examples of the lipid compound of Chemical Formula 1, its isomer, or a salt thereof, the phospholipid, the structured lipid, and the PEGylated lipid, as well as the active substance, are as described above.

[0315] Furthermore, the present invention provides a pharmaceutical composition comprising the lipid nanoparticle composition and a pharmaceutically acceptable carrier.

[0316] Furthermore, the present invention provides a method for preventing or treating a disease, comprising the step of administering the lipid nanoparticle composition to an individual in need thereof.

[0317] The pharmaceutical composition may further comprise a pharmaceutically acceptable ingredient.

[0318] The pharmaceutical composition can be administered orally or parenterally, where parenteral refers to a broad range of administration routes, including intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, intranasal, sublingual, intrathecal, inhalation, ocular, rectal, vaginal, and ventricular administration.

[0319] The pharmaceutical compositions are formulated using commonly used diluents or excipients, such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and lozenges. These solid formulations are prepared by mixing one or more compounds according to the present invention with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as wetting agents, sweeteners, flavorings, and preservatives, may be included.

[0320] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions that can be used include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases that can be used include witepsol, macrogol, tween 61, cocoa butter, laurin butter, glycerol, gelatin, etc.

[0321] The pharmaceutical composition or lipid nanoparticle composition according to the present invention can be administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dose level can be determined based on factors including the type and severity of the patient's disease, drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment duration, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.

[0322] The present invention will be described in detail below through examples and experimental examples, but these examples and experimental examples are intended to exemplify the present invention and are not intended to limit the scope of the present invention.

[0323] [Example]

[0324] Example 1. Preparation of heptadecan-9-yl 8-((6-acetamido-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 1)

[0325] JPEG2025540651000006.jpg119170

[0326] Step 1: Synthesis of tert-butyl hex-5-en-1-yl carbamate (compound 1b)

[0327] 1-Amino-5-hexyne hydrochloride salt (compound 1a, CAS#848650-01-1, 4.87 g, 35.9 mmol) and triethylamine (42 mL, 301 mmol) were dissolved in anhydrous CHCl (65 mL), followed by the addition of BocO (20.0 g, 91.5 mmol) in an ice bath at 0 °C. The flask was then stirred overnight at room temperature and concentrated. The crude reaction product was purified by silica gel chromatography (CHCl 100%) to yield tert-butyl hex-5-en-1-ylcarbamate (compound 1b, 2.07 g, 29%) as a clear liquid.

[0328] 1 H NMR (400MHz, DMSO-d6): δ6.77(t, J=5.7Hz, 1H), 5.78(ddt, J=16.9, 10.2, 6.7Hz, 1 H), 5.09-4.83(m, 2H), 2.90(q, J=6.4Hz, 2H), 2.00(q, J=6.8Hz, 2H), 1.37(m, 13H).

[0329] Step 2: Synthesis of tert-butyl (4-(oxiran-2-yl)butyl)carbamate (compound 1c)

[0330] tert-Butyl hex-5-en-1-ylcarbamate (compound 1b, 2.03 g, 10.2 mmol) was placed in a 250 mL flask and dissolved in anhydrous DCM (15 mL). A separately prepared solution of mCPBA (77%, 9.16 g, 40.9 mmol) in anhydrous DCM (65 mL) was then slowly added to the flask with vigorous stirring in an ice bath at 0 °C. The flask was then stirred at room temperature for 19 hours. Sodium sulfite (50 mL of a 10% aqueous solution) and sodium bicarbonate (50 mL of a 10% aqueous solution) were then added and stirred vigorously for 30 minutes. The mixture was transferred to a separatory funnel, and the organic layer was washed with brine and dried over sodium sulfate. The mixture was concentrated and purified by silica gel chromatography (hexane: EtOAc = 3:1) to give tert-butyl (4-(oxiran-2-yl)butyl)carbamate (compound 1c, 1.65 g, 75%) as a clear liquid. 1 H NMR (600MHz, CDCl3): δ4.53(s, 1H), 3.13(q, J=6.6Hz, 2H), 2.96-2.82(m, 1H), 2.74(dd, J=5.0, 3.9Hz, 1, 1H) 2.46(dd, J=5.0, 2.7Hz, 1H), 1.65-1.44(m, 15H). HRMS(ESI):m / z calcd for C 11 H 21 NO3Na + [M+Na] + ,238.1419,found,238.1413.

[0331] Step 3: Synthesis of tert-butyl(6-amino-5-hydroxyhexyl)carbamate (Compound 1d)

[0332] tert-Butyl (4-(oxiran-2-yl)butyl)carbamate (Compound 1c, 1.61 g, 7.48 mmol) was placed in a 500 mL flask and dissolved in ethanol (100 mL). Aqueous ammonia (33%, 220 mL) was then added with stirring. The mixture was stirred at room temperature for 18 hours, the solvent was evaporated, and the mixture was dried in vacuo to give tert-butyl (6-amino-5-hydroxyhexyl)carbamate (Compound 1d, 1.62 g, 93%) as a white solid. 1H NMR (400MHz, DSMO-d6): δ6.75(t, J=5.7Hz, 1H), 4.36(s, 1H), 2.88(q, J=6.4Hz, 2H), 2.49-2.29(m, 2H), 1.37(m, 15H). HRMS (ESI):m / z calcd for C 11 H 25 N2O3 + [M+H] + , 233.1865, found, 233.1854.

[0333] Step 4: Synthesis of heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)amino)octanoate (Compound 1f)

[0334] A 50 mL flask was charged with tert-butyl (6-amino-5-hydroxyhexyl)carbamate (Compound 1d, 1.53 g, 6.59 mmol) and heptadecan-9-yl 8-bromooctanoate (Patent Document 1 [PCT / US2017 / 033403 (BENENATO, K.; HOGE, S.; MARTINI, P.; MCFADYEN, I.; PRESNYAK, V.; KUMARASINGHE, ES) 2017.05.18]) (Compound 1e, 1.20 g, 2.60 mmol), which was then dissolved in ethanol (25 mL) and stirred at 70°C for 32 hours. The mixture was concentrated and then purified by silica gel chromatography (DCM:MeOH:ammonia water (33%)=140:10:1) to give heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)amino)octanoate (Compound 1f, 1.24 g, 78%) as a white solid.

[0335] 1 H NMR (600MHz, acetone-d6): δ4.85 (m, 1H), 3.55 (m, 1H), 3.06 (q, J=6.5Hz, 2H), 2.65- 2.37(m, 4H), 2.28(t, J=7.3Hz, 2H), 1.64-1.22(m, 53H), 1.00-0.76(t, J=6.9Hz, 6H). HRMS(ESI):m / z calcd for C36 H 73 N2O5 + [M+H] + , 613.5519, found, 613.5507.

[0336] Step 5: Synthesis of heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate (Compound 1h)

[0337] Heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)amino)octanoate (Compound 1f, 651 mg, 1.06 mmol) and undecyl 6-bromohexanoate (Patent Document 2 [PCT / US2018 / 022717 (BENENATO, KE; KUMARASINGHE, ES; CORNEBISE, M.) 2018.03.15]) (Compound 1g, 552 mg, 1.58 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (3.0 mL). Then, DIPEA (0.2 mL, 1.7 mmol), K2CO3 (586 mg, 4.24 mmol), and KI (199 mg, 1.20 mmol) were added. The flask was then stirred at 75 °C for 18 hours and concentrated. The mixture was diluted with DCM, washed with brine, and dried over sodium sulfate. The crude mixture was concentrated and purified by silica gel chromatography (DCM:MeOH:ammonia water (33%) = 200:10:1) to give heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate (Compound 1h, 539 mg, 58%) as a white solid.

[0338] 1H NMR (400MHz, CDCl3): δ4.92-4.80(m, 1H), 4.54(br, 1H), 4.05(t, J=6.8Hz, 2H), 3.53(br, 1H) , 3.12(t, J=5.76Hz, 2H) 2.71-2.07(m, 10H), 1.74-1.06(m, 79H), 0.88(td, J=6.9, 1.6Hz, 9H).

[0339] Step 6: Synthesis of heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i)

[0340] Heptadecan-9-yl 8-((6-((tert-butoxycarbonyl)amino)-2-hydroxyhexyl)(-oxo-6-undecyloxy)hexyl)octanoate (Compound 1h, 170 mg, 0.192 mmol) was placed in an oven-dried flask and cooled to 200°C with anhydrous CH₂ C After dissolving with I2 (0.4 mL), TFA (1.6 mL) was added at 0 °C and stirred at room temperature for 40 min. The solvent was removed in vacuo to give heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 198 mg, 58%) as a white solid.

[0341] 1 H NMR (400MHz, CDCl3): δ9.56(s, 1H), 7.87(s, 3H), 4.85(qu, J=6.2Hz, 1H), 4.04(t, J=6. 8Hz, 3H), 3.42-2.75(m, 8H), 2.41-2.18(m, 4H), 1.89-1.03(m, 68H), 1.03-0.65(m, 9H).

[0342] Step 7: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-undecyloxy)hexyl)amino)octanoate (Compound 1)

[0343] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 18.9 mg, 0.0187 mmol) was placed in an oven-dried flask and dissolved in anhydrous CHCl (0.5 mL). EtN (10 μL) and acetic anhydride (1j, 1.6 μL) were then added sequentially, and the mixture was stirred at room temperature for 20 hours. The mixture was concentrated and then purified by silica gel chromatography (hexane / EtOAc / MeOH / aqueous ammonia (33%) = 70:40:10:1) to give heptadecan-9-yl 8-((6-acetamido-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 1, 11.9 mg, 77%) as a clear liquid.

[0344] 1 H NMR (400MHz, acetone-d6): δ6.96(s, 1H), 4.87(qu, J=5.9Hz, 1H), 4.04(t, J=6.9Hz, 2H), 3.57-3.52(m, 1H) 3.15(q, J=6.5Hz, 2H), 2.57-2.24(m, 10H), 1.65-1.22(m, 68H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI)m / z:[M+H] + calcd for C 50 H 99 N2O6823.7498, found 823.7491.

[0345] Example 2. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 2)

[0346] JPEG2025540651000007.jpg91170

[0347] Step 1: Synthesis of 1-(hex-5-en-1-yl)urea (compound 2b)

[0348] A 50 mL sealable flask was charged with triphosgene (306 mg, 1.03 mmol) and dissolved in THF (4.9 mL). A separately prepared solution of 1-amino-5-hexyne hydrochloride (compound 1a, 400 mg, 2.95 mmol) and DIPEA (1.14 g, 1.54 mL, 8.85 mmol) in THF (15 mL) was then slowly added to the resulting solution in an ice bath at 0 °C while stirring thoroughly. The flask was then stirred at room temperature for 1 hour to form intermediate 2a. The flask containing the mixed solution was then transferred to an ice bath at 0 °C, and ammonia solution (0.4 M, dioxane solution, 22.1 mL, 8.85 mmol) was added. The mixture was stirred at room temperature for 20 hours and then extracted with DCM. The combined organic layer was washed with saturated aqueous NaCl, dried over sodium sulfate, and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 10% MeOH in DCM) to give 1-(hex-5-en-1-yl)urea (compound 2b, 302 mg, 72%) as a white solid.

[0349] 1 H NMR (400MHz, CDCl3): δ5.78 (ddt, J=17.0, 10.2, 6.7Hz, 1H), 5.00 (dd, J=17.1, 1.7Hz, 1H), 4.95 (dd, J=10.2.0.8.Hz, 1H) 4.90 (Br, s , 1H), 4.47(Br, s, 2H), 3.15(t, J=6.7Hz, 2H), 2.06(dt, J=14.1, 7.0Hz, 2H), 1.49(tt, J=6.9, 6.7Hz, 2H)1.44(tt, J=7.1, 7.0Hz, 2H); 13 C NMR (150MHz, CDCl3): δ159.0, 138.6, 114.9, 40.7, 33.5, 29.6, 26.2; HRMS (ESI) m / z: [M+H] + Calculated for C7H 15 N2O 143.1179, found 143.1185.

[0350] Step 2: Synthesis of 1-(4-(oxiran-2-yl)butyl)urea (compound 2c)

[0351] 1-(hex-5-en-1-yl)urea (compound 1c, 302 mg, 2.12 mmol) was placed in a 50 mL flask and dissolved in anhydrous DCM (14 mL). A separately prepared solution of mCPBA (77%, 1.43 g, 6.37 mmol) in anhydrous DCM (28 mL) was then slowly added to the resulting solution while stirring thoroughly in an ice bath at 0 °C. The flask was then stirred at room temperature for 48 hours and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 10% AcOH in DCM to remove meta-chlorobenzoic acid, followed by 10% MeOH in DCM) to yield 1-(4-(oxiran-2-yl)butyl)urea (compound 2c, 188 mg, 56%) as a white solid.

[0352] 1 H NMR (600MHz, CDCl3): δ5.57(s, 1H), 4.49(s, 2H), 3.11(qd, J=6.7, 1.4Hz, 2H), 2.85-2.8 2(m, 1H), 2.63(dd, J=5.1, 4.1, Hz, 1H), 2.39(dd, J=5.2, 2.6Hz, 1H), 1.55-1.40(m, 6H).

[0353] Step 3: Synthesis of 2-hydroxy-6-ureidohexane-1-aminium chloride (compound 2e)

[0354] 1-(4-(oxiran-2-yl)butyl)urea (compound 2c, 156 mg, 0.986 mmol) was placed in a 25 mL flask and dissolved in EtOH (13.2 mL). Aq. NH3 (30-33%, 6.53 mL) was added and stirred at room temperature for 40 hours to form intermediate 2d. The mixture was concentrated, diluted with DCM (20 mL), and transferred to a separatory funnel. Intermediate 2d was chlorinated into a salt by adding water (20 mL) and aq. HCl (1.0 M, 1.1 mL) and extracted into the aqueous layer. The aqueous layer was dried to give 2-hydroxy-6-ureidohexane-1-aminium chloride (compound 2e, 205 mg, 98%) as a white solid.

[0355] 1H NMR (600MHz, DMSO-d6): δ7.71(s, 3H), 5.92(s, 1H), 5.36(s, 2H), 5.18(s, 1H), 3.60(s, 1H), 2.9 4(q, J=4.9Hz, 2H), 2.87-2.81(m, 1H), 2.63-2.57(m, 1H), 1.40-1.30(m, 5H), 1.29-1.21(m, 1H).

[0356] Step 4: Synthesis of 8-((2-hydroxy-6-ureidohexyl)amino)octanoate (compound 2f)

[0357] 2-Hydroxy-6-ureidohexane-1-aminium chloride (compound 2e, 118 mg, 0.557 mmol) and heptadecan-9-yl 8-bromooctanoate (compound 1e, 129 mg, 0.279 mmol) were placed in a 5 mL flask and dissolved in anhydrous DMF (2.8 mL). Then, DIPEA (108 mg, 0.84 mmol, 0.15 mL), KCO (231 mg, 1.67 mmol), and KI (51 mg, 0.31 mmol) were added. The flask was then stirred at 75 °C for 42 h and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 20% MeOH, 2% aq. NH3 (30-33%) in DCM) to give heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)amino)octanoate (compound 2f, 84 mg, 54%) as a white solid.

[0358] 1 H NMR (600MHz, CDCl3): δ5.66(br, 1H), 5.08(s, 2H), 4.85(qu, J=6.0Hz, 1H), 3.74(s, 1H), 3.14(q, J=4.9Hz, 2H) 2.77(d, J=11. 8Hz, 1H), 2.74-2.65(m, 2H), 2.57(dd, J=11.7, 9.7Hz, 1H), 2.27(t, J=7.5Hz, 2H), 1.63-1.21(m, 44H), 0.87(t, J=7.0Hz, 6H). HRMS(ESI):m / z calcd for C 32 H 66 N3O4 +[M+H]556.5048, found 556.5053.

[0359] Step 5: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 2)

[0360] Heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)amino)octanoate (compound 2f, 48 mg, 0.086 mmol) and undecyl 6-bromohexanoate (compound 1g, 32 mg, 0.090 mmol) were placed in a 4 mL vial and dissolved in anhydrous DMF (0.86 mL). Then, DIPEA (33 mg, 0.26 mmol, 45 μL), KCO (36 mg, 0.26 mmol), and KI (16 mg, 0.094 mmol) were added. The flask was then stirred at 75 °C for 18 h and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 6.25% MeOH, 0.625% aq. NH3 (30-33%) in DCM) to give heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (compound 2, 44 mg, 62%) as a clear oil.

[0361] 1 H NMR (400MHz, CDCl3): δ4.90(br, 1H), 4.85(qu, J=6.2Hz, 1H), 4.51(br, 2H), 4.04(t, J=6.8Hz, 2H), 3.56(br, 1H), 3.17(q, J=5.8Hz, 2H) 2.56-2.22(m, 9H), 1.69-1.17(m, 68H), 0.87(t, J=6.7Hz, 9H). HRMS(ESI):m / z calcd for C 49 H 98 N3O6 + [M+H) + 824.7450, found 824.7454.

[0362] Example 3. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 3)

[0363] JPEG2025540651000008.jpg93170

[0364] Step 1: Synthesis of 1-(hex-5-en-1-yl)-3-methylurea (compound 3a)

[0365] A 50 mL sealable flask was charged with triphosgene (306 mg, 1.03 mmol) and dissolved in THF (4.9 mL). A separately prepared solution of 1-amino-5-hexyne hydrochloride (compound 1a, 400 mg, 2.95 mmol) and DIPEA (1.14 g, 1.54 mL, 8.85 mmol) in THF (15 mL) was then slowly added to the resulting solution in an ice bath at 0 °C while stirring thoroughly. The flask was then stirred at room temperature for 1 hour to form intermediate 2a. The flask containing the mixed solution was then transferred to an ice bath at 0 °C, and methylamine (2.0 M in THF, 4.4 mL, 8.85 mmol) was added. The mixture was stirred at room temperature for 20 hours and then extracted with DCM. The combined organic layer was washed with saturated aqueous NaCl, dried over sodium sulfate, and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 10% MeOH in DCM) to give 1-(hex-5-en-1-yl)-3-methylurea (compound 3a, 351 mg, 76%) as a white solid.

[0366] 1 H NMR (400MHz, CDCl3): δ5.79 (ddt, J=17.4, 10.3, 6.7Hz, 1H), 5.00 (dd, J=17.1, 1.6Hz, 1H), 4.95 (dd, J=10.2, 0.8, Hz, 1H), 4.34 (Br, s, 2H), 3.17(t, J=7.0Hz, 2H), 2.77(s, 3H), 2.07(dt, J=14.1, 7.0Hz, 2H), 1.51(tt, J=8.6, 7.1Hz, 2H), 1.42(tt, J=7.9, 6.9Hz, 2H);13 C NMR (150MHz, CDCl3): δ159.0, 138.6, 114.9, 40.7, 33.5, 29.8, 27.4, 26.3. HRMS(ESI)m / z:[M+H] + Calculate for C8H 17 N2O 157.1335, found 157.1340.

[0367] Step 2: Synthesis of 1-methyl-3-(4-(oxiran-2-yl)butyl)urea (compound 3b)

[0368] 1-(hex-5-en-1-yl)-3-methylurea (compound 3a, 100 mg, 0.640 mmol) was placed in an oven-dried flask and dissolved in anhydrous DCM (4.3 mL). A solution of mCPBA (77%, 430 mg, 1.92 mmol) in anhydrous DCM (8.5 mL) was then slowly added to the resulting solution while stirring vigorously in an ice bath at 0 °C. The flask was then stirred at room temperature for 48 hours and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 10% AcOH in DCM to remove meta-chlorobenzoic acid, followed by 10% MeOH in DCM) to yield 1-methyl-3-(4-(oxiran-2-yl)butyl)urea (compound 3b, 34 mg, 31%) as a white solid.

[0369] 1 H NMR (600MHz, acetone-d6): δ5.38(s, 1H), 5.19(s, 1H), 3.11(qd, J=6.9, 1.6Hz, 2H), 2.84-2.82(m, 1H) , 2.64(d, J=4.7Hz, 3H), 2.63(dd, J=5.2, 1.2, Hz, 1H), 2.39(dd, J=5.3, 2.6Hz, 1H), 1.55-1.39(m, 6H).

[0370] Step 3: Synthesis of 2-hydroxy-6-(3-methyl-ureido)hexane-1-aminium chloride (compound 3d)

[0371] 1-Methyl-3-(4-(oxiran-2-yl)butyl)urea (compound 3b, 41 mg, 0.238 mmol) was placed in an oven-dried flask and dissolved in EtOH (3.2 mL). Aq. NH3 (30-33%, 1.6 mL) was added and stirred at room temperature for 40 h to form intermediate 3c. The mixture was concentrated, diluted with DCM (10 mL), and transferred to a separatory funnel. Intermediate 3c was chlorinated into a salt by adding water (10 mL) and aq. HCl (1.0 M, 0.3 mL) and extracted into the aqueous layer. The aqueous layer was dried to give 2-hydroxy-6-(3-methylureidohexane)-1-aminium chloride (compound 3d, 53 mg, 99%) as a white solid.

[0372] 1 H NMR (600MHz, DMSO-d6): δ7.80(s, 3H), 5.90(s, 1H), 5.71(s, 2H), 5.17(s, 1H), 3.61(s, 1H), 2.96(t, J= 6.1Hz, 2H), 2.86-2.80(m, 1H), 2.63-2.56(m, 1H), 2.52(s, 3H), 1.42-1.30(m, 5H), 1.29-1.21(m, 1H).

[0373] Step 4: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)amino)octanoate (compound 3e)

[0374] 2-Hydroxy-6-(3-methylureido)hexane-1-aminium chloride (compound 3d, 38 mg, 0.17 mmol) and heptadecan-9-yl 8-bromooctanoate (compound 1e, 39 mg, 0.084 mmol) were dissolved in anhydrous DMF (1.7 mL) and then added DIPEA (33 mg, 0.25 mmol, 0.044 mL), KCO (35 mg, 0.25 mmol), and KI (15 mg, 0.093 mmol). The flask was then stirred at 75 °C for 42 h and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 20% MeOH, 2% aq. NH3 (30-33%) in DCM) to give heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)amino)octanoate (compound 3e, 19 mg, 40%) as a white solid.

[0375] 1 H NMR (400MHz, CDCl3): δ5.61(s, 1H), 5.42(s, 1H), 4.84(qu, J=6.2Hz, 1H), 4.50(B r, 1H), 3.93(s, 1H), 3.14(d, J=4.8Hz, 2H), 2.92(d, J=11.7Hz, 1H), 2.87(t, J=7. 8Hz, 2H), 2.77(d, J=11.2Hz, 1H), 2.72(d, J=4.44Hz, 3H), 2.26(t, J=7.5Hz, 2H), 1.72(s, 2H), 1.59(qu, J=6.8Hz, 2H), 1.55-1.21(m, 40H), 0.87(t, J=6.8Hz, 6H). HRMS(ESI):m / zcalcd for C 33 H 68 N3O4 + [M+H] + , 570.5204, found 570.5207.

[0376] Step 5: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 3)

[0377] Heptadecan-9-yl 8-((2-hydroxy-6(3-methylureido)hexyl)amino)octanoate (Compound 3e, 25 mg, 0.086 mmol) and undecyl 6-bromohexanoate (Compound 1g, 32 mg, 0.090 mmol) were placed in a 4 mL vial and dissolved in anhydrous DMF (0.86 mL). Then, DIPEA (33 mg, 0.26 mmol, 45 μL), KCO (36 mg, 0.26 mmol), and KI (16 mg, 0.094 mmol) were added. The flask was then stirred at 75 °C for 18 h and concentrated. The crude reaction product was purified by silica gel chromatography (eluting with 6.25% MeOH, 0.625% aq. NH3 (30-33%) in DCM) to give heptadecan-9-yl 8-((2-hydroxy-6(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (compound 3, 44 mg, 62%) as a clear oil.

[0378] 1 H NMR (300MHz, CDCl3): δ4.85(qu, J=6.1Hz, 1H), 4.52(t, J=5.2Hz, 1H), 4.42(q, J=4.3Hz, 1H), 4.05(t, J=6.7Hz, 2H), 3.58(br, 1H) ), 3.18(q, J=6.0Hz, 2H), 2.76(d, J=4.8Hz, 3H), 2.61-2.20(m, 10H), 1.68-1.11(m, 68H), 0.87(t, J=6.5Hz, 9H);HRMS(ESI):m / z calcd for C 50 H 100 N3O6 + [M+H] + 838.7607, found, 838.7609.

[0379] Example 4. Preparation of heptadecan-9-yl 8-((6-(cyclopentanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 7)

[0380] JPEG2025540651000009.jpg40170

[0381] Step 1: Synthesis of heptadecan-9-yl 8-((6-(cyclopentanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 7)

[0382] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 35.7 mg, 0.0353 mmol), cyclopentanecarboxylic acid (7a, 14.9 mg, 0.130 mmol), and DIPEA (30 μL, 0.23 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (2.0 mL). HATU (26.6 mg, 0.0700 mmol) was added in an ice bath at 0 °C, and the mixture was stirred at room temperature for 4 hours. The mixture was concentrated and then purified by silica gel chromatography (hexane / EtOAc / MeOH / aqueous ammonia (33%) = 70:40:10:1) to give heptadecan-9-yl 8-((6-(cyclopentanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 7, 21.4 mg, 69%) as a clear liquid.

[0383] 1 H NMR (600MHz, acetone-d6): δ6.89(s, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.55( br, 1H), 3.17(q, J=6.7Hz, 2H), 2.62-2.23(m, 11H), 1.80-1.15(m, 76H), 0.88(t, J=6.9Hz, 9H).

[0384] Example 5. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-((R)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 8)

[0385] JPEG2025540651000010.jpg70170

[0386] Step 1: Synthesis of tert-butyl (3R)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-carboxylate (compound 8b)

[0387] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 34.7 mg, 0.0327 mmol), (R)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (8a, 14.3 mg, 0.0644 mmol), and DIPEA (50 μL, 0.278 mmol) were added to an oven-dried flask and dissolved in anhydrous DMF (1.0 mL). HATU (15.5 mg, 0.0399 mmol) was added in an ice bath at 0 °C and stirred at ambient temperature for 2 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (hexane / EtOAc / MeOH / aqueous ammonia (33%) = 130:40:10:1) to give tert-butyl (3R)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-carboxylate (Compound 8b, 21.6 mg, 66%) as a clear liquid.

[0388] 1 H NMR (600MHz, acetone-d6): δ7.15(s, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.63-3.11(m, 8H), 2.95( dt, J=22.0, 7.9Hz, 1H), 2.58-2.22(m, 12H), 1.80-1.15(m, 77H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcdforC 58 H 112 N3O8+ [M+H] + 978.8444, found, 978.8461.

[0389] Step 2: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-((R)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 8)

[0390] A 5 mL flask was charged with tert-butyl (3R)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-2-carboxylate (compound 8b, 21.1 mg, 0.0209 mmol), which was dissolved in anhydrous CHCl (0.2 mL). TFA (0.8 mL) was then added, and the mixture was stirred at room temperature for 30 minutes. The solvent was removed in vacuo, and the residue was purified on an LH-20 column (100% methanol) to give the trifluoroacetate salt of heptadecan-9-yl 8-((2-hydroxy-6-((R)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (compound 8, 18.5 mg, 89%) as a clear liquid.

[0391] 1 H NMR (600MHz, acetone-d6): δ4.87(qu, J=6.2Hz, 1H), 4.38-4.08(m, 4H), 4.03(t, J=6.7Hz, 2H), 3 .70-2.70(m, 10H), 2.54-2.10(m, 6H), 1.90-1.05(m, 72H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / z calcd forC 53 H 105 N3O6 2+ [M+2H] 2+ 439.8996, found, 439.9000.

[0392] Example 6. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 9)

[0393] JPEG2025540651000011.jpg69170

[0394] Step 1: Synthesis of tert-butyl (3S)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-carboxylate (compound 9b)

[0395] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 36.2 mg, 0.0341 mmol), (S)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (9a, 14.7 mg, 0.0662 mmol), and DIPEA (50 μL, 0.278 mmol) were dissolved in anhydrous DMF (1.0 mL). HATU (15.6 mg, 0.0402 mmol) was added to an oven-dried flask and stirred at room temperature for 2 h in an ice bath at 0 °C. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (Hexane / EtOAc / MeOH / aqueous ammonia (33%) = 130:40:10:1) to give tert-butyl (3S)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-carboxylate (Compound 9b, 23.7 mg, 70%) as a clear liquid.

[0396] 1H NMR (600MHz, acetone-d6): δ7.15(s, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.63-3.11(m, 8H), 2.95( dt, J=22.0, 7.9Hz, 1H), 2.58-2.22(m, 12H), 1.80-1.15(m, 77H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcdforC 58 H 112 N3O8 + [M+H] + 978.8444, found, 978.8455.

[0397] Step 2: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 8)

[0398] A 5 mL flask was charged with tert-butyl (3S)-3-((6-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)-5-hydroxyhexyl)carbamoyl)pyrrolidine-1-2-carboxylate (compound 9b, 22.5 mg, 0.0223 mmol), which was dissolved in anhydrous CHCl (0.2 mL). TFA (0.8 mL) was then added, and the mixture was stirred at room temperature for 30 minutes. The solvent was removed in vacuo, and the residue was purified on an LH-20 column (100% methanol) to give the trifluoroacetate salt of heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 9, 19.0 mg, 85%) as a clear liquid.

[0399] 1H NMR (600MHz, acetone-d6): δ4.87(qu, J=6.2Hz, 1H), 4.38-4.08(m, 4H), 4.03(t, J=6.7Hz, 2H), 3 .70-2.70(m, 10H), 2.54-2.10(m, 6H), 1.90-1.05(m, 72H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / z calcd forC 53 H 105 N3O6 2+ [M+2H] 2+ 439.8996, found, 439.8991.

[0400] Example 7. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-((R)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 10)

[0401] JPEG2025540651000012.jpg59170

[0402] Step 1: Synthesis of (R)-1-methylpyrrolidine-3-carboxylic acid (compound 10a)

[0403] (R)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (8a, 9.0 mg, 0.078 mmol) was placed in a 4 mL vial and dissolved in methanol (0.78 mL). Then, 35% aqueous formaldehyde (37 μL, 0.47 mmol) was added. After stirring for 5 minutes, NaBH3CN (7.4 mg, 0.12 mmol) was added and stirred for 5 minutes. After confirming the completion of the reaction by TLC, 1 equivalent of 1N HCl was added and the mixture was dried in vacuo. The resulting (R)-1-methylpyrrolidine-3-carboxylic acid (compound 10a) was used in the next reaction without further purification.

[0404] Step 2: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-((R)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 10)

[0405] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 26.3 mg, 0.0261 mmol), (R)-1-methylpyrrolidine-3-carboxylic acid (10a, all obtained in the previous step), and DIPEA (100 µL, 0.573 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (2.6 mL). HOBt (14.1 mg, 0.104 mmol) and EDC HCl (20.0 mg, 0.104 mmol) were added sequentially in an ice bath at 0 °C and the mixture was stirred at room temperature for 16 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM / MeOH / aqueous ammonia (33%) = 70:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-((R)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 10, 6.7 mg, 29%) as a clear liquid.

[0406] 1 H NMR (600MHz, acetone-d6): δ7.05(s, 1H), 4.87(qu, J=6.3Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.60-3.49(m, 1H), 3.17(q, J=6.4Hz, 1H), 2.83(quq, J=7.0, 1 .3Hz, 2H), 2.65(t, J=8.3Hz, 2H), 2.57-2.27(m, 12H), 2.26(s, 3H), 2.00-1. 92(m, 2H), 1.67-1.14(m, 77H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcd for C 54 H 107 N3O6 2+ [M+2H]2+ 446.9075, found, 446.9084.

[0407] Example 8. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 11)

[0408] JPEG2025540651000013.jpg57170

[0409] Step 1: Synthesis of (S)-1-methylpyrrolidine-3-carboxylic acid (compound 11a)

[0410] (S)-1-(tert-butoxycarbonyl)pyrrolidine-3-carboxylic acid (9a, 9.5 mg, 0.083 mmol) was placed in a 4 mL vial and dissolved in methanol (0.83 mL). 35% aqueous formaldehyde solution (39 μL, 0.50 mmol) was then added. After stirring for 5 minutes, NaBH3CN (7.8 mg, 0.12 mmol) was added and stirred for 5 minutes. After confirming the completion of the reaction by TLC, 1 equivalent of 1N HCl was added and the mixture was dried in vacuo. The resulting (S)-1-methylpyrrolidine-3-carboxylic acid (compound 11a) was used in the next reaction without further purification.

[0411] Step 2: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 11)

[0412] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 27.8 mg, 0.0275 mmol), (S)-1-methylpyrrolidine-3-carboxylic acid (11a, all obtained in the previous step), and DIPEA (100 µL, 0.577 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (2.8 mL). HOBt (14.9 mg, 0.110 mmol) and EDC HCl (21.1 mg, 0.110 mmol) were added sequentially in an ice bath at 0 °C and the mixture was stirred at room temperature for 16 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM / MeOH / aqueous ammonia (33%) = 70:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 11, 8.7 mg, 36%) as a clear liquid.

[0413] 1 H NMR (600MHz, acetone-d6): δ7.05(s, 1H), 4.87(qu, J=6.3Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.60-3.49(m, 1H), 3.17(q, J=6.4Hz, 1H), 2.83(quq, J=7.0, 1 .3Hz, 2H), 2.65(t, J=8.3Hz, 2H), 2.57-2.27(m, 12H), 2.26(s, 3H), 2.00-1. 92(m, 2H), 1.67-1.14(m, 77H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcd for C 54 H 107 N3O6 2+ [M+2H] 2+ 446.9075, found, 446.9077.

[0414] Example 9. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 16)

[0415] JPEG2025540651000014.jpg36170

[0416] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 16)

[0417] 1H-Pyrrole-2-carboxylic acid (compound 16a, 25.2 mg, 0.227 mmol) and DIPEA (200 µL, 1.16 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (1.7 mL). HATU (57.6 mg, 0.151 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 30 min. Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 73.8 mg, 0.0731 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 21 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM:MeOH:ammonia water (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-2-carboxamido)hexyl)(6-oxo-(undecyloxy)hexyl)amino)octanoate (Compound 16, 9.76 mg, 15%) as a clear liquid.

[0418] 1H NMR (600MHz, acetone-d6): δ10.54(s, 1H), 7.31(s, 1H), 6.92(sext, J=1.3Hz, 1H), 6 .71(sept, J=1.3Hz, 1H), 6.11(dt, J=3.7, 2.6Hz, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t , J=6.7Hz, 2H), 3.56(sept, J=3.4Hz, 1H), 3.45(br, 1H), 3.33(qd, J=6.6, 2.7Hz, 2H), 2.53(qu, J=5.6Hz, 2H), 2.44-2.25(m, 8H), 1.66-1.22(m, 68H), 0.88(t, J=7.0Hz, 9H; 13 C NMR (150MHz, acetone-d6): δ173.7, 173.5, 161.6, 127.9, 121.6, 109.6, 109.5, 74.1, 67.9, 64 .6, 62.2, 55.2, 55.0, 39.7, 35.6, 35.01, 34.97, 34.7, 32.7, 32.6, 30.9, 30.34 (2C, overlapped ), 30.30, 30.26, 30.25-29.4(7C, overlappedwithsolventresidual), 28.0(2C, overlapped), 27.8, 27.6, 26.7, 26.1, 25.9, 25.7, 24.0, 23.3(2C, overlapped), 14.4(2C, overlapped);HRMS (ESI):m / z calcd for C 53 H 100 N3O6 + [M+H] + 874.7607, found 874.7589.

[0419] Example 10. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 17)

[0420] JPEG2025540651000015.jpg33170

[0421] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 17)

[0422] 1H-Pyrrole-3-carboxylic acid (compound 17a, 25.4 mg, 0.229 mmol) and DIPEA (200 µL, 1.16 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (1.7 mL). HATU (59.6 mg, 0.157 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 30 min. Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 74.8 mg, 0.0741 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 21 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM:MeOH:ammonia water (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-(undecyloxy)hexyl)amino)octanoate (Compound 17, 38.9 mg, 60%) as a clear liquid.

[0423] 1 H NMR (400MHz, CDCl3): δ8.99(s, 1H), 7.32(s, 1H), 6.74(d, J=2.2Hz, 1H), 6.41(s, 1H), 5.98(s, 1H), 4.86(qu, J=6.2Hz, 1H), 4.05(t, J=6.8Hz, 2H), 3.56(br, 1H), 3.41(sept, J=5.7Hz, 2H), 2.50(br, 2H), 2.43-2.19(m, 8H), 1.69-1.15(m, 68H), 0.87(t, J=6.7Hz, 9H); 13C NMR (150MHz, acetone-d6): δ173.6, 173.5, 164.9, 121.7, 121.1, 119.1, 107.9, 74.1, 67.9 , 64.6, 62.2, 55.2, 55.0, 39.6, 35.6, 35.01, 34.96, 34.7, 32.66, 32.61, 31.1, 30.35, 30.3 HRMS (ESI):m / z calcd for C 53 H 100 N3O6 + [M+H] + 874.7607, found 874.7589.

[0424] Example 11. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 18)

[0425] JPEG2025540651000016.jpg37170

[0426] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 18)

[0427] 1-Methyl-1H-pyrrole-2-carboxylic acid (compound 18a, 28.6 mg, 0.229 mmol) and DIPEA (0.25 mL, 1.47 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (1.7 mL). HATU (56.0 mg, 0.147 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 30 min. Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 74.1 mg, 0.0734 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 16 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM:MeOH:ammonia water (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-(undecyloxy)hexyl)amino)octanoate (Compound 18, 36.3 mg, 56%) as a clear liquid.

[0428] 1 H NMR (600MHz, acetone-d6): δ7.23(s, 1H), 6.78(t, J=2.1Hz, 1H), 6.68(dd, J=3. 9, 1.7Hz, 1H), 5.98(dd, J=3.9, 2.6Hz, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6 .7Hz, 2H), 3.91(s, 3H), 3.57(br, 1H), 3.45(br, 1H), 3.35-3.26(m, 2H), 2.53(q u, J=6.5Hz, 2H), 2.43-2.25(m, 8H), 1.66-1.22(m, 68H), 0.88(t, J=7.0Hz, 9H); 13C NMR (150MHz, acetone-d6): δ173.6, 173.5, 162.4, 128.0, 127.3, 112.1, 107.4, 74.1, 68.0, 64.6, 62.2, 55.2, 55. 0, 39.6, 36.6, 35.6, 35.0, 35.0, 34.7, 32.7, 32.6, 30.9, 30.4, 30.34, 30.30, 30.25, 30.24-29.4 (7C, overlapped with solvent residual), 28.0(2C, overlapped), 27.8, 27.6, 26.7, 26.1, 25.9, 25.7, 24.0, 23.3(2C, overlapped), 14.4(2C, overlapped);HRMS(ESI):m / z calcd for C 54 H 102 N3O6 + [M+H] + 888.7763, found 888.7753.

[0429] Example 12. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 19)

[0430] JPEG2025540651000017.jpg36170

[0431] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 19)

[0432] 1-Methyl-1H-pyrrole-3-carboxylic acid (compound 19a, 29.4 mg, 0.235 mmol) and DIPEA (0.25 mL, 1.4 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (1.7 mL). HATU (57.3 mg, 0.151 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 30 min. Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 74.6 mg, 0.0739 mmol) was added to a solution of anhydrous DMF (1.0 mL) in an ice bath at 0 °C and stirred at room temperature for 16 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM:MeOH:ammonia water (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-(undecyloxy)hexyl)amino)octanoate (Compound 19, 21.4 mg, 33%) as a clear liquid.

[0433] 1 H NMR (600MHz, DMSO-d6): δ7.62(t, J=5.7Hz, 1H), 7.19(t, J=1.9Hz, 1H), 6.65(t , J=4.9, 1H), 6.40(dd, J=2.7, 1.8Hz, 1H), 4.77(qu, J=6.2Hz, 1H), 3.98(t, J=6. 5Hz, 2H), 3.60(s, 3H), 3.51(s, 1H), 3.43(br, 1H), 3.13(q, J=6.0Hz, 2H), 2.34( t, J=7.1Hz, 4H), 2.27-2.21(m, 6H), 1.56-1.17(m, 68H), 0.84(t, J=7.0Hz, 9H); 13C NMR (150MHz, DMSO-d6): δ173.3, 173.0, 163.9, 124.4, 122.6, 120.5, 108.0, 73.4, 68.1, 6 4.0, 61.5, 54.6, 54.4, 39.0, 36.4, 35.3, 34.3, 34.07, 34.04, 31.77, 31.72, 30.3, 29.46, 2 9.43, 29.40, 29.34, 29.26, 29.19, 29.11, 29.08, 29.05, 28.9, 28.6, 27.2, 27.1, 26.82, 2 6.75, 25.8, 25.2, 25.1, 24.9, 23.3, 22.57, 22.55, 14.4(2C, overlapped);HRMS(ESI):m / z calcd for C 54 H 102 N3O6 + [M+H] + 888.7763, found 888.7731.

[0434] Example 13. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21)

[0435] JPEG2025540651000018.jpg149170

[0436] Step 1: Synthesis of methyl 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylate (compound 21c)

[0437] Methyl 3-hydroxy-1H-pyrrole-2-carboxylate (compound 21a, 81.5 mg, 0.578 mmol) was dissolved in anhydrous DMF (1.0 mL) in an oven-dried flask. Then, in an ice bath at 0 °C, NaH (60%, 51.9 mg, 1.30 mmol) and 1-(chloromethyl)-4-methoxybenzene (compound 21b, 0.200 mL, 1.28 mmol) were added sequentially and stirred at room temperature for 14 h. The mixture was concentrated and purified by silica gel chromatography (hexane / EtOAc = 3:1) to give methyl 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylate (compound 21c, 61.9 mg, 28%) as a white solid.

[0438] 1 H NMR (400MHz, acetone-d6): δ7.39(d, J=8.7Hz, 2H), 7.10(d, J=8.7Hz, 2H), 6.98(d, J=3.0Hz, 1H), 6.92(d, J=8.7Hz, 2H), 6.84 (d, J=8.7Hz, 2H), 5.99(d, J=3.1, 1H), 5.42(s, 2H), 4.99(s, 2H), 3.79(s, 3H), 3.75(s, 3H), 3.70(s, 3H);HRMS(ESI):m / zcalcd for C 22 H 24 No. 5 + [M+H] + 382.1649, found 382.1654.

[0439] Step 2: Synthesis of 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylic acid (compound 21d)

[0440] Methyl 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylate (Compound 21c, 61.9 mg, 0.162 mmol) was placed in a 4 mL vial and dissolved in ethanol (2.0 mL). 2N aqueous KOH solution (293 μL, 0.585 mmol) was added and stirred at 80 °C for 17 h. After confirming the completion of the reaction by TLC, the mixture was dried in vacuo. The resulting 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylic acid (Compound 21d) was used in the next reaction without further purification.

[0441] Step 3: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21e)

[0442] Place heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 61.3 mg, 0.0607 mmol), 1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxylic acid (Compound 21d, all obtained in the previous step), and DIPEA (0.100 mL, 0.574 mmol) in an oven-dried flask and dissolve in anhydrous DMF (1.0 mL). Then, add HOBt (23.8 mg, 0.176 mmol) and EDC·HCI (25.0 mg, 0.131 mmol) in an ice bath at 0 °C and stir at room temperature for 20 h. The mixture was concentrated and then purified by silica gel chromatography (Hexane / EtOAc / MeOH=14:8:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21e, 36.1 mg, 53%) as a clear liquid.

[0443] 1 H NMR (600MHz, acetone-d6): δ7.43 (d, J=8.6Hz, 2H), 7.22 (t, J=5.5Hz, 1H), 7.18 (d, J=8.6Hz, 2H), 6.96 (d, J=8.7Hz, 2H), 6.82(d, J=8.7Hz, 2H), 6.81(d, J=3.1Hz, 1H), 6.02(d, J=3.1Hz, 1H), 5.56(s, 2H), 5.0 6(s, 2H), 4.87(qu, J=6.3Hz, 1H), 4.03(t, J=6.7Hz, 2H), 3.82(s, 3H), 3.75(s, 3H), 3.53(br, 1H), 3.27 (q, J=6.5Hz, 2H), 2.58-2.21(m, 10H), 1.67-1.15(m, 68H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcd for C 69 H 116 N3O9 + [M+H] + 1130.8706, found 1130.8734.

[0444] Step 4: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21)

[0445] Heptadecan-9-yl 8-((2-hydroxy-6-(1-(4-methoxybenzyl)-3-((4-methoxybenzyl)oxy)-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21e, 19.9 mg, 0.0176 mmol), anisole (20 μL, 0.18 mmol), and TFA (0.5 mL, 6.53 mmol) were placed in a 4 mL vial in that order and stirred at 40 °C for 17 h. The mixture was concentrated and then purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 140:80:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 21, 4.23 mg, 27%) as a clear liquid.

[0446] 1 H NMR (600MHz, acetone-d6): δ9.86(s, 1H), 7.01(s, 1H), 6.66(d, J=2.9Hz, 1H), 5.71(d, J=2.6Hz, 1H), 4.87(qu, J=5.8Hz, 1H), 4.04( t, J=6.7Hz, 2H), 3.57(br, 1H), 3.36(br, 2H), 2.61-2.21(m, 10H), 1.72-1.12(m, 68H), 0.88(t, J=6.9Hz, 9H);HRMS(ESI):m / zcalcd for C 53 H 100 N3O7 + [M+H] + 890.7556, found 890.7554.

[0447] Example 14. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 24)

[0448] JPEG2025540651000019.jpg139154

[0449] Step 1: Synthesis of methyl 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylate (compound 24c)

[0450] Methyl 3-hydroxy-1-methyl-1H-pyrrole-2-carboxylate (compound 24a, 87.0 mg, 0.561 mmol) was dissolved in anhydrous DMF (1.12 mL) in an oven-dried flask. KCO (775 mg, 5.61 mmol) and benzyl bromide (compound 24b, 0.67 mL, 5.6 mmol) were then added sequentially and stirred at 60 °C for 50 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (ether / hexane = 1:2) to give methyl 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylate (compound 24c, 104 mg, 76%) as a clear liquid.

[0451] 1 H NMR (400MHz, acetone-d6): δ7.48(d, J=7.5Hz, 2H), 7.37(t, J=7.4Hz, 2H), 7.29(t, J=7.3Hz , 1H), 6.79(d, J=2.9Hz, 1H), 5.90(d, J=3.0Hz, 1H), 5.07(s, 2H), 3.81(s, 3H), 3.75(s, 3H); 13 C NMR (150MHz, acetone-d6): δ162.2, 154.3, 138.9, 129.1, 128.3, 128.1, 127.8, 109.3, 95.9, 72.7, 50.6, 37.8; HRMS(ESI): m / zcalcd for C 14 H 16 No. 3 + [M+H] + 246.1125, found 246.1129.

[0452] Step 2: Synthesis of 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylic acid (compound 24d)

[0453] Methyl 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylate (Compound 24c, 26.4 mg, 0.108 mmol) was placed in a 4 mL vial and dissolved in ethanol (0.86 mL). 2N aqueous KOH (0.22 mL, 0.43 mmol) was added and stirred at 80 °C for 5 h. After confirming the completion of the reaction by TLC, the mixture was dried in vacuo. 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylic acid (Compound 24d) was used in the next reaction without further purification.

[0454] Step 3: Synthesis of heptadecan-9-yl 8-((6-(3-benzyloxy)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (compound 24e)

[0455] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 54.0 mg, 0.0535 mmol), 3-(benzyloxy)-1-methyl-1H-pyrrole-2-carboxylic acid (Compound 24d, all obtained in the previous step), and DIPEA (0.10 mL, 0.59 mmol) were added to an oven-dried flask and dissolved in anhydrous DMF (1.78 mL). HATU (26.0 mg, 0.0683 mmol) was added in an ice bath at 0 °C and stirred at room temperature for 2 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 140:70:10:1) to give heptadecan-9-yl 8-((6-(3-benzyloxy)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 24e, 37.5 mg, 71%) as a clear liquid.

[0456] 1H NMR (600MHz, acetone-d6): δ7.49(d, J=7.5Hz, 2H), 7.41(t, J=7.5Hz, 2H), 7.35(t, J=7.4 Hz, 1H), 7.18(t, J=5.1Hz, 1H), 6.64(d, J=3.0Hz, 1H), 5.94(d, J=3.0Hz, 1H), 5.15(s, 2H), 4.87(qu, J=6.2Hz, 1H), 4.03(t, J=6.7Hz, 2H), 3.86(s, 3H), 3.54(br, 1H), 3.36-3.25(m, 2H), 2.54(q, J=5.7Hz, 2H), 2.46-2.22(m, 8H), 1.68-1.16(m, 68H), 0.88(t, J=7.0Hz, 9H); 13 C NMR (150MHz, acetone-d6): δ173.6, 173.4, 161.9, 149.7, 138.1, 129.4, 128.9, 128.6, 125.1, 111.9, 95 .0, 74.1, 73.5, 67.8, 64.6, 62.2, 55.1, 55.0, 38.9, 37.7, 35.6, 34.99, 34.96, 34.6, 32.65, 32.61, 30.9, 30.35, 30.34, 30.30, 30.26, 30.24-29.4 (7C, overlapped with solvent), 28.01, 27.97, 27.7, 2 7.6, 26.7, 26.1, 25.9, 25.7, 24.0, 23.3(2C, overlapped), 14.4(2C, overlapped);HRMS(ESI):m / zcalcd for C 61 H 108 N3O7 + [M+H] + 994.8182, found 994.8147.

[0457] Step 4: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 24)

[0458] Place heptadecan-9-yl 8-((6-(3-benzyloxy)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 24e, 19.6 mg, 0.0197 mmol) in a 5 mL flask and dissolve in ethanol (2.0 mL). Add 10% Pd / C (55% water, 10 mg), fill with a hydrogen balloon, and stir at room temperature for 90 minutes. The mixture was filtered through Celite, concentrated, and then purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 70:40:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 24, 14.2 mg, 80%) as a clear liquid.

[0459] 1 H NMR (600MHz, acetone-d6): δ7.20(s, 1H), 6.53(d, J=2.7Hz, 1H), 5.63(d, J=2.8Hz, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.7Hz, 2H), 3.83(s, 3) H), 3.58(sext, J=4.3Hz, 1H), 3.35(q, J=6.6Hz, 2H), 2.54(dt, J=12.8, 7.7Hz, 2H), 2.44-2.26(m, 8H), 1.64-1.23(m, 68H), 0.88(t, J=7.0Hz, 9H); 13C NMR (150MHz, acetone-d6): δ173.6, 173.5, 162.7, 148.3, 125.2, 111.1, 96.6, 74.1, 67.9, 64. 6, 62.2, 55.2, 55.0, 39.0, 37.5, 35.6, 35.0, 35.0, 34.7, 32.7, 32.6, 31.1, 30.35, 30.34, 30.30 , 30.26, 30.22-29.44 (7C, overlapped with solvent), 28.01, 28.00, 27.8, 27.6, 26.7 ,26.1,25.9,25.7,24.0,23.3(2C,overlapped),14.3(2C,overlapped);HRMS(ESI):m / zcalcd for C 54 H 102 N3O7 + [M+H] + 904.7712, found 904.7689.

[0460] Example 15. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 33)

[0461] JPEG2025540651000020.jpg39169

[0462] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 33)

[0463] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 44.5 mg, 0.0443 mmol), 1H-imidazole-2-carboxylic acid (Compound 33a, 17.9 mg, 0.160 mmol), and DIPEA (0.08 mL, 0.44 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (4.4 mL). HATU (33.5 mg, 0.0881 mmol) was added in an ice bath at 0 °C and stirred at room temperature for 3 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 80:40:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 33, 14.2 mg, 37%) as a clear liquid.

[0464] 1 H NMR (600MHz, acetone-d6): δ11.91(s, 1H), 7.69(s, 1H), 7.27(s, 1H), 7.03(s, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.6Hz, 2H) , 3.77(s, 3H), 3.58(br, 1H), 3.39(q, J=6.4Hz, 2H), 2.52(br, 2H), 2.46-2.24(m, 8H), 1.69-1.15(m, 68H), 0.88(t, J=7.0Hz, 9H); 13C NMR (150MHz, acetone-d6): δ173.67, 173.5, 159.2, 129.9, 119.8, 111.5, 74.1, 67.9, 64.6, 62.2, 55.2, 55.0, 39.6, 35.6, 35 .0, 35.0, 34.7, 32.7, 32.6, 30.7, 30.34(2C, overlapped), 30.30, 30.26, 30.24-29.4(7C, overlappedwithsolventresidua l)、28.0(2C、overlapped)、27.8、27.6、26.7、26.1、25.9、25.7、23.9、23.3(2C、overlapped)、14.4(2C、overlapped) HRMS(ESI):m / z calcd for C 52 H 99 N4O6 + [M+H] + 875.7559, found 875.7530.

[0465] Example 16. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 34)

[0466] JPEG2025540651000021.jpg35169

[0467] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 34)

[0468] 1H-Imidazole-4-carboxylic acid (compound 34a, 16.5 mg, 0.147 mmol), HATU (31.2 mg, 0.0821 mmol), and DIPEA (0.120 mL, 0.689 mmol) were dissolved in anhydrous DMF (3.5 mL) and stirred at room temperature for 30 min. Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 41.2 mg, 0.0408 mmol) was added to an oven-dried flask and stirred at room temperature for 16 h. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 34, 19.8 mg, 55%) as a clear liquid.

[0469] 1 H NMR (600MHz, DMSO-d6) δ12.41(s, 1H), 7.78(d, J=7.0Hz, 1H), 7.67(d, J=1.2Hz, 1H), 7.55(s, 1H), 4.83-4.72(m, 1H), 4.18-3.99(m, 1 H), 3.98(t, J=6.5Hz, 2H), 3.43(d, J=7.4Hz, 1H), 3.19(q, J=6.7Hz, 2H), 2.41-2.10(m, 10H), 1.76-1.04(m, 68H), 0.84(t, J=7.0, 9H). 13 C NMR (150MHz, DMSO-d6) δ172.8, 172.5, 162.0, 136.5, 135.2, 118.5, 72.9, 67.6, 63.6, 61.0, 54.1, 54. 0, 40.1, 38.2, 34.8, 33.8, 33.60, 33.56, 31.3, 31.2, 28.98, 28.95, 28.92, 28.87, 28.8, 28.7, 28.63,

[0470] 28.60, 28.58, 28.4, 28.1, 26.7, 26.6, 26.4, 26.3, 25.4, 24.7, 24.6, 24.5, 22.8, 22.09, 22.07, 13.9;HRMS(ESI):m / z calcd for C 53 H 99 N4O6[M+H] + 875.7565,

[0471] Found 875.7544.

[0472] Example 17. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 35)

[0473] JPEG2025540651000022.jpg40169

[0474] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 35)

[0475] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 120.4 mg, 0.113 mmol), 2-hydroxy-1H-imidazole-4-carboxylic acid (Compound 35a, 24.9 mg, 0.194 mmol), and DIPEA (0.230 mL, 1.32 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (4.5 mL). HATU (45.0 mg, 0.118 mmol) was added in an ice bath at 0°C and the mixture was stirred at room temperature for 20 hours. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) and an LH-20 column (methanol 100%) to give heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 35, 26.9 mg, 25%) as a clear liquid.

[0476] 1 H NMR (600MHz, DMSOd6) δ10.20(s, 1H), 10.11(t, J=2.3Hz, 1H), 7.71(t, J=5.6Hz, 1H), 6.97(t, J=2.2Hz, 1H), 4.95-4.60(m, 1H), 3 .98(t, J=6.5Hz, 3H), 3.43(d, J=6.2Hz, 1H), 3.13(q, J=6.2Hz, 2H), 2.45-2.06(m, 10H), 1.81-1.04(m, 68H), 0.85(t, J=7.0, 9H); 13C NMR (150MHz, DMSO-d6) δ172.8, 172.6, 158.6, 153.8, 117.8, 112.4, 72.9, 67.6, 63. 6, 61.0, 54.1, 53.9, 40.1, 38.5, 34.7, 33.8, 33.600, 33.597, 31.30, 31.26, 29.5, 2 8.99, 28.96, 28.93, 28.88, 28.8, 28.7, 28.63, 28.61, 28.58, 28.5, 28.1, 26.7, 26. 6, 26.34, 26.28, 25.4, 24.7, 24.6, 24.5, 22.8, 22.10, 22.08, 13.9;HRMS(ESI):m / z calcd for C 53 H 99 N4O7[M+H] + 891.7514, found 891.7487.

[0477] Example 18. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 36)

[0478] JPEG2025540651000023.jpg35168

[0479] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 36)

[0480] Heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 100 mg, 0.0991 mmol), 1-methyl-1H-imidazole-2-carboxylic acid (Compound 36a, 16.8 mg, 0.133 mmol), and DIPEA (0.20 mL, 1.1 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (2.7 mL). A solution of HATU (41.7 mg, 0.110 mmol) in anhydrous DMF (1.0 mL) was added to the flask in a 0 °C ice bath and stirred at room temperature for 100 min. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 36, 71.4 mg, 81%) as a clear liquid.

[0481] 1 H NMR (600MHz, CDCl3): δ7.44(s, 1H), 6.99(s, 1H), 6.95(s, 1H), 4.85(qu, J=6.2Hz, 1H), 4.05(t, J=6.8Hz, 2H), 4.04(s, 3H), 3.94(b r, 1H), 3.44-3.35(m, 2H), 3.03(br, 6H), 2.32(t, J=7.2Hz, 2H), 2.28(t, J=7.5Hz, 2H), 1.78-1.19(m, 68H), 0.88(t, J=7.0Hz, 9H); 13CNMR (150MHz, DMSO-d6): δ172.7, 172.6, 158.8, 138.8, 126.8, 125.8, 73.0, 63.6, 38.2, 34.9, 34.6, 33.8, 33.5, 33.3, 31.3, 31.2, 29.2, 28.97, 2 8.96, 28.92, 28.84, 28.77, 28.70, 28.62, 28.56, 28.3, 28.1, 25.4, 24.7, 24.5, 24.1, 22.08, 22.06, 13.9(2C, overlapped);HRMS(ESI):m / zcalcd for C 53 H 101 N4O6 + [M+H] + 889.7716, found 889.7693.

[0482] Example 19. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 37)

[0483] JPEG2025540651000024.jpg35169

[0484] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 37)

[0485] 1-Methyl-1H-imidazole-4-carboxylic acid (compound 37a, 11.3 mg, 0.133 mmol) and DIPEA (0.20 mL, 1.1 mmol) were placed in an oven-dried flask and dissolved in anhydrous DMF (1.7 mL). A solution of HATU (30.5 mg, 0.0802 mmol) in anhydrous DMF (1.0 mL) was added in a 0 °C ice bath and stirred at room temperature for 30 min. A solution of heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 74.5 mg, 0.0738 mmol) in anhydrous DMF (1.0 mL) was added in a 0 °C ice bath and stirred at room temperature for 23 h. The mixture was diluted with DCM, and the organic layer was washed with brine, dried over sodium sulfate, and concentrated. The residue was purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 37, 50.2 mg, 77%) as a clear liquid.

[0486] 1 H NMR (600MHz, acetone-d6): δ7.50(s, 1H), 7.48(d, J=1.3, 1H), 7.33(s, 1H), 4.87(qu, J=6.2Hz, 1H), 4.04(t, J=6.6Hz, 2H), 3.77(s, 3H), 3 .58(br, 1H), 3.45(br, 1H), 3.35(q, J=6.6Hz, 2H), 2.53(qu, J=6.5Hz, 2H), 2.44-2.24(m, 8H), 1.72-1.14(m, 68H), 0.88(t, J=7.0Hz, 9H); 13C NMR (150MHz, acetone-d6): δ173.6, 173.5, 162.8, 138.7, 138.4, 123.2, 74.1, 67.9, 64.6, 62.2 , 55.2, 55.0, 39.2, 35.6, 35.00, 34.97, 34.7, 33.7, 32.65, 32.61, 31.0, 30.35, 30.34, 30.30, 3 0.25, 30.24-29.4(7C,overlappedwithsolventresidual), 28.0(2C,overlapped), 27.8, 27.6, 26.7, 26.1, 25.9, 25.7, 24.0, 23.3(2C,overlapped), 14.4(2C,overlapped);HRMS(ESI):m / z calcd for C 53 H 101 N4O6 + [M+H] + 889.7716, found 889.7692.

[0487] Example 20. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 38)

[0488] JPEG2025540651000025.jpg34170

[0489] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 38)

[0490] An oven-dried flask was charged with 1-methyl-1H-imidazole-5-carboxylic acid (compound 38a, 25.7 mg, 0.229 mmol) and DIPEA (0.250 mL, 1.44 mmol) and dissolved in anhydrous DMF (1.5 mL). A solution of HATU (33.4 mg, 0.0879 mmol) in anhydrous DMF (0.5 mL) was added in a 0 °C ice bath and stirred at room temperature for 30 min. A solution of heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 79.1 mg, 0.0784 mmol) in anhydrous DMF (1.0 mL) was added in a 0 °C ice bath and stirred at room temperature for 20 h. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) and an LH-20 column (methanol 100%) to give heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 38, 30.2 mg, 43%) as a clear liquid.

[0491] 1 H NMR (400MHz, DMSO-d6) δ8.18(t, J=5.7Hz, 1H), 7.69(s, 1H), 7.52(d, J=1.0Hz, 1H), 4.77(qu, J=6.3Hz, 1H), 4.02(d, J=3.8Hz, 1H), 3.9 8(t, J=6.5Hz, 2H), 3.79(br, 3H), 3.44(s, 1H), 3.16(q, J=6.5Hz, 2H), 2.40-2.16(m, 10H), 1.69-1.07(m, 68H), 0.84(t, J=6.6Hz, 9H). 13 C NMR (150MHz, DMSO-d6) δ172.8, 172.9, 159.8, 141.6, 131.5, 126.0, 72.9, 67.6, 63.9, 61.0, 54.1, 54.0, 40.1,

[0492] 38.5, 34.7, 33.8, 33.60, 33.56, 33.4, 31.3, 31.2, 29.5, 28.99, 28.96, 28.92, 28.9, 28.8, 28.7, 28.63, 28.61 , 28.58, 28.4, 28.1, 26.7, 26.6, 26.4, 26.3, 25.4, 24.7, 24.6, 24.5, 22.8, 22.10, 22.08, 13.9;HRMS(ESI):m / z calcd for C 53 H 101 N4O6[M+H] + 889.7721, found, 889.7705.

[0493] Example 21. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 39)

[0494] JPEG2025540651000026.jpg34170

[0495] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 39)

[0496] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 91.2 mg, 0.0903 mmol), 2-hydroxy-1-methyl-1H-imidazole-4-carboxylic acid (Compound 39a, 27.8 mg, 0.196 mmol), and DIPEA (0.160 mL, 0.919 mmol) were dissolved in anhydrous DMF (3.5 mL). HATU (43.3 mg, 0.114 mmol) was added to the mixture in an ice bath at 0 °C and stirred at room temperature for 18 h. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) and an LH-20 column (methanol 100%) to give heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 39, 46.3 mg, 52%) as a clear liquid.

[0497] 1 H NMR (500MHz, DMSO-d6) δ10.30(d, J=2.1Hz, 1H), 7.74(t, J=5.6Hz, 1H), 7.09(d, J=2.1Hz, 1H), 4.77(qu, J=6.3Hz, 1H), 4.02(s , 1H), 3.98(t, J=6.5Hz, 2H), 3.43(s, 1H), 3.11(m, 5H), 2.43-2.13(m, 10H), 1.67-1.02(m, 68H), 0.85(td, J=6.9, 1.4Hz, 9H); 13CNMR (150MHz, DMSO-d6) δ172.8, 172.5, 158.5, 152.9, 116.3, 116.2, 73.0, 67.7, 63.71, 63.6 6, 61.1, 60.6, 54.2, 54.0, 40.2, 38.7, 34.8, 33.9, 33.7, 32.3, 31.43, 31.40, 31.38, 29.7, 29 .6, 29.12, 29.08, 29.00, 28.9, 28.85, 28.81, 28.75, 28.71, 28.6, 28.2, 26.8, 26.7, 26.5, 26 .4, 25.5, 25.1, 24.8, 24.7, 24.58, 24.55, 22.9, 22.21, 22.19, 14.04, 13.98;HRMS(ESI):m / z calcd for C 53 H 101 N4O7[M+H] + 905.7670, found 905.7646.

[0498] Example 22. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 40)

[0499] JPEG2025540651000027.jpg36170

[0500] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 40)

[0501] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 114 mg, 0.113 mmol), 2-hydroxy-1-methyl-1H-imidazole-5-carboxylic acid (Compound 40a, 41.0 mg, 0.288 mmol), and DIPEA (0.200 mL, 1.15 mmol) were dissolved in anhydrous DMF (4.5 mL). HATU (43.3 mg, 0.114 mmol) was added to the mixture in an ice bath at 0 °C and stirred at room temperature for 18 h. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 200:10:1) and an LH-20 column (methanol 100%) to give heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 40, 28.2 mg, 28%) as a clear liquid.

[0502] 1 H NMR (600MHz, DMSO-d6) δ10.44(s, 1H), 7.91(t, J=5.7Hz, 1H), 7.08(s, 1H), 4.77(qu, J=6.2Hz, 1H), 4.01(d, J=3.7Hz, 1H), 3.98 (t, J=6.5Hz, 2H), 3.43(s, 1H), 3.27(s, 3H), 3.12(q, J=6.3Hz, 2H), 2.39-2.17(m, 10H), 1.60-1.06(m, 68H), 1.00-0.73(m, 9H); 13C NMR (150MHz, DMSO-d6) δ172.8, 159.6, 153.6, 117.9, 111.9, 72.9, 67.6, 63.6, 54 .1, 54.0, 40.1, 38.4, 34.7, 33.8, 33.5931, 33.5933, 31.30, 31.26, 29.5, 28.99, 28.96, 28.93, 28.88, 28.8, 28.7, 28.62, 28.59, 28.48, 28.46, 28.1, 26.7, 26.6, 26.35, 26.28, 25.4, 24.7, 24.6, 24.5, 22.8, 22.09, 22.08, 13.9;HRMS(ESI):m / z calcd for C 53 H 101 N4O7[M+H] + 905.7670, found 905.7657.

[0503] Example 23 Preparation of heptadecan-9-yl 8-((6-(furancarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 50)

[0504] JPEG2025540651000028.jpg34170

[0505] Step 1: Synthesis of heptadecan-9-yl 8-((6-(furancarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 50)

[0506] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 19.4 mg, 0.0193 mmol), furan-3-carboxylic acid (compound 50a, 9.3 mg, 0.083 mmol), and DIPEA (50 μL, 0.29 mmol) were dissolved in anhydrous DMF (2.0 mL). HOBt (9.6 mg, 0.071 mmol) and EDC HCl (10.5 mg, 0.0547 mmol) were added sequentially to an ice bath at 0 °C and the mixture was stirred at room temperature for 18 h. The mixture was concentrated and then purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 70:40:10:1) to give heptadecan-9-yl 8-((6-(furan-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 50, 10.3 mg, 691) as a clear liquid.

[0507] 1 H NMR (500MHz, acetone-d6) δ8.04(s, 1H), 7.58(s, 1H), 7.40(s, 1H), 6.80(s, 1H), 4.87(q, J=6.5Hz, 1H), 4.04(t, J =6.7Hz, 2H), 3.57(s, 1H), 3.32(d, J=7.1Hz, 2H), 2.70-2.18(m, 10H), 1.71-1.13(m, 68H), 0.88(t, J=6.6Hz, 9H).

[0508] Example 24. Preparation of heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 51)

[0509] JPEG2025540651000029.jpg36170

[0510] Step 1: Synthesis of heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 51)

[0511] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (compound 1i, 20.1 mg, 0.0199 mmol), thiophene-3-carboxylic acid (compound 51a, 10.5 mg, 0.0816 mmol), and DIPEA (50 μL, 0.28 mmol) were dissolved in anhydrous DMF (2.0 mL). HOBt (9.94 mg, 0.0736 mmol) and EDC HCl (9.65 mg, 0.0503 mmol) were added sequentially to an ice bath at 0 °C and the mixture was stirred at room temperature for 17 h. The mixture was concentrated and then purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 140:80:10:1) to give heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 51, 11.9 mg, 67%) as a clear liquid.

[0512] 1 H NMR (400MHz, acetone-d6) δ8.05(dd, J=2.9, 1.3Hz, 1H), 7.58(s, 1H), 7.54(dd, J=5.0, 1.3Hz, 1H), 7.49(dd, J=5.1, 2.9Hz, 1H), 4.89 (t, J=6.3Hz, 1H), 4.05(t, J=6.6Hz, 2H), 3.59(s, 1H), 3.45-3.30(m, 2H), 2.64-2.25(m, 10H), 1.77-1.09(m, 68H), 1.09-0.68(m, 9H).

[0513] Example 25 Preparation of heptadecan-9-yl 8-((6-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 70)

[0514] JPEG2025540651000030.jpg35170

[0515] Step 1: Synthesis of heptadecan-9-yl 8-((6-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 70)

[0516] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 32.8 mg, 0.0325 mmol), 2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetic acid (Compound 70a, 0.012 mg, 0.065 mmol), and DIPEA (0.10 mL, 0.58 mmol) were dissolved in anhydrous DMF (3.2 mL). HATU (18.5 mg, 0.0487 mmol) was placed in an ice bath at 0 °C and stirred at room temperature for 16 h. The mixture was concentrated and then purified by silica gel chromatography (Hexane / EtOAc / MeOH / ammonia (33%) = 70:40:10:1) to give heptadecan-9-yl 8-((6-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 70, 22.4 mg, 74%) as a clear liquid.

[0517] 1H NMR (400MHz, acetone-d6) δ9.96(s, 1H), 7.50(d, J=7.8Hz, 1H), 7.40(s, 1H), 5.55(d, J=7.8Hz, 1H), 4.87(qu, J=6.1Hz, 1H), 4.41( s, 2H), 4.04(d, J=6.5Hz, 2H), 3.56(br, 1H), 3.22(q, J=5.6Hz, 2H), 2.60-2.22(m, 10H), 1.72-1.07(m, 68H), 0.88(t, J=6.1Hz, 9H).

[0518] Example 26 Preparation of heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 76)

[0519] JPEG2025540651000031.jpg37170

[0520] Step 1: Synthesis of heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 76)

[0521] Oven-dried heptadecan-9-yl 8-((6-amino-2-hydroxyhexyl)(6-oxo-6-undecyloxy)hexyl)octanoate trifluoroacetate salt (Compound 1i, 27.6 mg, 0.0274 mmol), N-acetyl-L-hisdite (Compound 76a, 0.011 mg, 0.055 mmol), and DIPEA (0.10 mL, 0.58 mmol) were dissolved in anhydrous DMF (9.1 mL). HATU (17.7 mg, 0.0466 mmol) was placed in an ice bath at 0 °C and stirred at room temperature for 20 h. The mixture was concentrated and then purified by silica gel chromatography (DCM / MeOH / ammonia (33%) = 90:10:1) to give heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 76, 12.2 mg, 51%) as a clear liquid.

[0522] 1 H NMR (400MHz, acetone-d6) δ7.67(d, J=7.8Hz, 1H), 7.64(s, 1H), 7.32(s, 1H), 6.92(s, 1H), 4.89(br, 1H), 4.86(qu, J=6.3Hz, 1H), 4. 51(s, 1H), 4.03(t, J=6.5Hz, 2H), 4.01(br, 1H), 3.17-2.87(m, 4H), 2.40-1.72(m, 10H), 1.72-1.05(m, 68H), 0.87(t, J=6.0Hz, 9H).

[0523] The same procedure as in Example 1 was carried out, except that aminoalkene hydrochlorides of various lengths were used instead of 1-amino-5-hexyne hydrochloride in Step 1 of Example 1, or various alkyl tails were used in Steps 4 and 5, and 1H-pyrrole-3-carboxylic acid was used in Step 6, similar to Step 1 of Example 13, to synthesize compounds 122-178 shown in Table 1 below.

[0524] The same procedures as in Examples 2 and 3 were carried out, except that aminoalkene hydrochlorides of various lengths were used in place of 1-amino-5-hexyne hydrochloride in Step 1 of Example 3, various amine derivatives or isocyanate derivatives were used in place of methylamine, and various alkyl tails were used in Steps 4 and 5 to synthesize compounds 4-6, 110-110, and 117-121 shown in Table 1 below.

[0525] The same procedure as in Example 4 was carried out, except that various carboxylic acid derivatives were used in place of cyclopentanecarboxylic acid in Step 1 of Example 4 to synthesize compounds 12-99, 111-116, and 122 shown in Table 1 below.

[0526] [Table 1] TIFF2025540651000033.tif221170TIFF2025540651000034.tif228170TIFF2025540651000035.tif239170TIFF2025540 651000036.tif239170TIFF2025540651000037.tif235170TIFF2025540651000038.tif228170TIFF2025540651000039.t if231170TIFF2025540651000040.tif217170TIFF2025540651000041.tif218170TIFF2025540651000042.tif246170TIF F2025540651000043.tif236170TIFF2025540651000044.tif204170TIFF2025540651000045.tif212170TIFF20255406510 00046.tif186170TIFF2025540651000047.tif242170TIFF2025540651000048.tif232170TIFF2025540651000049.tif24 6170TIFF2025540651000050.tif239170TIFF2025540651000051.tif221170TIFF2025540651000052.tif232170TIFF202 5540651000053.tif232170TIFF2025540651000054.tif242170TIFF2025540651000055.tif242170TIFF20255406510000 56.tif241170TIFF2025540651000057.tif242170TIFF2025540651000058.tif215170TIFF2025540651000059.tif155170

[0527] Example 27. mRNA-LNP production

[0528] Ionizable lipids prepared according to Examples 1 to 29 above or commercially available (Compound 1-178, SM-102 (Broadpharm, USA; Patent Document 3 [PCT / US2016 / 052352 (BENENARO, KE; KUMARASINGHE, ES; CORNEBISE, M.) 2016.09.16]), ALC-0315 (Broadpharm, USA; Patent Document 4 [PCT / US2016 / 029572 (TAM, Y.; HOPE, MJ; WEISSMAN, D.; PARDI, N.) 2016.04.27]), DLin-MC3-DMA (MC3; Broadpharm, USA; Patent Document 5 [US2010 / 0324120 A1 (JIANXIN, C. et al.) 2016.04.27]), etc.) were used. [2010.12.23.], etc.), phospholipids (e.g., DSPC; Sigma-Aldrich, USA), cholesterol (Sigma-Aldrich, USA), and PEGylated lipids (e.g., ALC-0159 (Broadpharm, USA; Patent Document 6 [PCT / US2015 / 034496 (ANSELL, SM; DU, X) 2015.06.05]), DMG-PEG (DMG-PEG2000; Sigma-Aldrich, USA), etc.) were dissolved in the organic phase (ethanol). 5-100 μg of mRNA (e.g., firefly luciferase mRNA (fLuc mRNA), enhanced green fluorescent protein mRNA (EGFP mRNA), SARS-CoV-2 spike mRNA, TriLink Biotechnologies, USA) was diluted in 0.2-2.0 mL of 5-50 mM acetic acid aqueous solution.

[0529] An aqueous phase was prepared.

[0530] mRNA-lipid nanoparticles (LNPs) were prepared by mixing an organic phase (ethanol) containing ionizable lipids, phospholipids, cholesterol, and PEGylated lipids with an aqueous phase (sodium acetate or sodium citrate solution) containing mRNA at an average flow rate of 25-250 μL / 10 s using a microfluidic mixer (NanoAssemblr® Spark, Precision Nanosystems, Canada). Specifically, the constituent lipid compounds were dissolved in ethanol in a molar ratio of (20-60):(0-25):(30-60):(0-5) (ionizable lipid:phospholipid:cholesterol:PEGylated lipid), where the total ratio was 100 and the weight ratio of ionizable lipid:mRNA was (4-30):1. To remove ethanol from the mRNA-encapsulated lipid nanoparticles and adjust the pH of the lipid nanoparticle solution to match in vivo pH (~7.4), the nanoparticles were dialyzed against phosphate-buffered saline (PBS, pH 7.4, Invitrogen, USA) for several times over 12-18 hours using a dialysis cassette (Slide-A-Lyzer Dialysis Cassette, 10K MWCO, ThermoFisher, USA).

[0531] Hereinafter, lipid nanoparticle compositions are referred to according to the type of ionizable lipid used in the preparation of mRNA-LNPs.

[0532] The numbers in the figures or tables refer to the compound numbers of the examples used in the production of mRNA-LNP. For example, "16" in Figure 3 refers to mRNA-LNP produced using compound 16, and is referred to as "Composition 16." Experimental Examples

[0533] Experimental Example 1. pK of mRNA-LNP a measurement

[0534] Apparent pK of mRNA-LNP prepared in Example 27 awas measured by analysis using 6-(p-toluidino)-2-naphthalenesulfonic acid sodium salt (TNS; Sigma-Aldrich, USA).

[0535] Anionic TNS generally does not exhibit fluorescence in aqueous solution, but as the pH decreases, the content of positively charged ionizable lipids increases, and TNS interacts electrostatically with these lipids, moving to the hydrophobic domain (lipophilic), and exhibiting increasingly strong fluorescence. When the pH of the solution increases and the ionizable lipids are neutralized, they are no longer able to interact electrostatically with TNS, losing their lipophilicity and detaching from the hydrophobic domain, resulting in quenching of TNS fluorescence. Based on this principle, the change in TNS fluorescence intensity due to changes in ambient pH can be plotted as an S-shaped curve, and the log value of the inflection point can be calculated to determine the pK of lipid nanoparticles. a Usually, the pK a Lipid nanoparticles with a pH value of 6.0-7.0 have a surface charge close to zero in plasma (pH ~ 7.4) upon intravascular injection, which reduces the likelihood of binding to body tissues and increases the rate of delivery to liver cells. Once inside the cells, they become highly charged within the endosomes (pH 5.5), facilitating the endosomal escape of the active substances to be delivered, such as genes, proteins, and synthetic drugs, resulting in excellent in vivo drug delivery efficiency (Non-Patent Document 1 [Sabnis, S. et al. Mol. Ther. 2018, 26, 1509], Non-Patent Document 2 [Jayaraman, M. et al. Angew. Chem. Int. Ed. 2012, 51, 8529]).

[0536] Specifically, a master buffer solution containing 10 mM sodium phosphate, 10 mM sodium borate, 10 mM sodium citrate, and 150 mM sodium chloride (NaCl) was prepared. The pH was then adjusted to various pH values ​​from 2.5 to 12 using 1 M sodium hydroxide (NaOH) and 1 M hydrochloric acid (HCl). A 150 or 300 μM TNS standard stock solution was then prepared by dissolving it in DMSO. LNPs were prepared at mRNA concentrations of 0.02–0.08 mg / mL in 1X PBS buffer or 20 mM tris(hydroxymethyl)aminomethane (Tris) buffer containing 8% sucrose. 90–94 μL of each solution at each pH was placed in triplicate in a black-bottomed 96-well plate (n=3). Each well was filled with 3.26-4.00 μL of lipid nanoparticles and 2 μL of TNS solution. After careful mixing, the fluorescence intensity of each well was measured using a multiplate reader (Cary Eclipse, Agilent Technologies, USA) at λex 330 nm and λem 435 nm. The measurement results are shown in Figure 3.

[0537] FIG. 3 shows the apparent pK of mRNA-LNP prepared in Example 27 by TNS binding assay. a The results of the measurements are shown in the graph.

[0538] Specifically, compositions 16, 17, 19, and 33 to 40 were selected from the mRNA-LNPs prepared in Example 27, and pK a The above-mentioned Compositions 16, 17, 19, and 33 to 40 were produced under their respective optimal formulation conditions, and the optimal formulation conditions were determined based on known conditions in reports from the institutions that developed ionizable lipids.

[0539] pK of the mRNA-LNP a The measurement results are shown in Table 2 below, along with the optimal formulation conditions for each.

[0540] Referring to Figure 3 and Table 2, the pKa values ​​of the mRNA-LNPs prepared in the examples are all between 6.0 and 7.0, which suggests that their drug delivery efficiency in vivo is appropriate.

[0541] It was also confirmed that the pKa values ​​were similar to those of mRNA-LNPs produced using commercially available ionizable lipids, SM-102 and MC3.

[0542] [Table 2]

[0543] Experimental Example 2. Measurement of size, polydispersity, and surface charge of mRNA-LNP

[0544] Each mRNA-LNP prepared in Example 27 was diluted with PBS to a concentration of 1 μg / mL of mRNA, and the size, polydispersity index (PDI), and surface charge of the mRNA-LNP were measured using a Malvern Zetasizer Nano ZS90 (Malvern Instruments, UK).

[0545] For particles administered to the systemic circulatory system, such as blood vessels, they must be smaller than 200 nm in size in order to pass through the endothelium capillaries of the liver. Only a small PDI of 0.3 or less can be considered to have a uniform particle size distribution, and consistent and efficient efficacy can be expected (Non-Patent Document 3 [Danaei, M. et al. Pharmaceutics 2018, 10, 57]).

[0546] Figure 4 is a graph showing the results of measuring the hydrodynamic diameter and polydispersity index (PDI) of the mRNA-LNP prepared in Example 27, and Figure 5 is a graph showing the results of measuring the surface charge of the mRNA-LNP prepared in Example 27. The measurement results are summarized in Table 2.

[0547] Referring to Figures 4 and 5 and Table 2, the measured sizes of the mRNA-LNPs were all within the appropriate range of 200 nm or less, and the PDI was 0.2 or less, which means that all were considered to be highly uniform.

[0548] Experimental Example 3. Measurement of mRNA encapsulation efficiency

[0549] The mRNA encapsulation efficiency (EE, %) of the mRNA-containing LNPs was measured using a RiboGreen RNA analysis kit (Quant-iT RiboGreen® RNA, Invitrogen).

[0550] The lipid nanoparticles prepared in Example 27 were diluted to 50 μL with 1X TE (Tris-EDTA) buffer or 1X TE buffer containing 2% Triton-X 100 to a final mRNA concentration of 20-30 ng / mL and added to each well of a 96-well plate. 50 μL of 1X TE buffer was added to the group without Triton-X 100 (Group A), and 50 μL of 1X TE buffer containing 2% Triton-X 100 was added to the group with Triton-X 100 (Group B). The lipid nanoparticles were incubated at 37°C for 10 minutes to decompose with Triton-X 100 and release the mRNA contained therein. Then, 100 μL of RiboGreen reagent was added to each well. The fluorescence intensity of Groups A and B was measured using a multiplate reader (λex 480 nm, λem 520 nm), and the mRNA encapsulation efficiency (%) was calculated using the following equation: The mRNA encapsulation efficiency (%) for each lipid nanoparticle was calculated as the average of two repeated measurements. The measurement results are summarized in Table 2.

[0551] As summarized in Table 2, the encapsulation efficiency of all mRNA-LNPs was confirmed to be around 90%, confirming that mRNA was encapsulated with a fairly high efficiency.

[0552] [Number 1]

[0553] mRNA encapsulation efficiency (%) = [(fluorescence intensity of group B - fluorescence intensity of group A) / (fluorescence intensity of group B)] x 100

[0554] Experimental Example 4. Evaluation of protein expression efficiency of EGFP mRNA-LNP administered to cells

[0555] LNPs containing EGFP mRNA encapsulated using various ionizable lipids prepared by the method of Example 27 were administered to HeLa cells (ATCC, USA) to compare in vitro protein expression efficiency (related to transfection, endosomal escape, mRNA stability, etc.) over time. EGFP mRNA-LNPs prepared using the ionizable lipids MC3 or SM-102 were used as controls.

[0556] The remaining lipid compounds constituting the LNPs were cholesterol, the PEG-lipid was DMG-PEG, and the phospholipid was DSPC, but 1 mol% of the total phospholipids was sulfo-cyanine 5.5-DSPE for tracking the LNPs under a fluorescence microscope.

[0557] Specifically, 18 hours before administration of mRNA-LNP, 1 × 10 HeLa cells were plated in an 8-well plate. 5After seeding at a density of 100 cells / well, the cells were cultured in DMEM medium (Gibco, USA) containing FBS and antibiotics at 37°C and 5% CO2. The concentration of mRNA-LNP administered was adjusted to 100 ng / well based on mRNA, and the cells were treated with the medium at 5, 10, 15, 30 minutes, 1 hour, 3 hours, 6 hours, 24 hours, and 48 hours. After each treatment, the medium was removed and the cells were fixed with 4% PFA for 15 minutes, and then images were taken using a fluorescence microscope.

[0558] Experimental Example 5. Evaluation of protein expression efficiency of fLuc mRNA-LNP administered by intramuscular injection (im) and intravenous injection (iv)

[0559] All of the following animal experiments were conducted with the approval of the Animal Experiment Ethics Committee at the Korea Institute of Bioscience and Biotechnology.

[0560] The fLuc mRNA-LNPs prepared using various ionizable lipids, as prepared by the method of Example 27, were administered intramuscularly (i.m.) or intravenously (i.v.) to compare their in vivo protein expression efficiency. EGFP mRNA-LNPs prepared using commercially available ionizable lipids MC3 or SM-102 were used as controls. All mRNA-LNPs were injected at an equivalent weight-based dose (n ≥ 4) for each concentration.

[0561] Specifically, the mRNA-LNPs were administered intramuscularly or intravenously to 6-10-week-old female C57BL / 6 mice (Orient Bio) at a dose of 0.1-0.5 mg / kg body weight of fLuc mRNA. Subsequently, 10 min before imaging, 200 μL (15 mg / mL) of luciferin was intraperitoneally injected to confirm protein expression at 1, 3, 6, 24, 48, and 72 h postinjection. Whole-body luminescence images were then acquired using an in vivo imaging system (IVIS) Lumina III (PerkinElmer, Waltham, MA) under respiratory anesthesia with 3% isoflurane and 97% medical oxygen. The acquired luminescence images were quantitatively analyzed using imaging software (Living Image Software Version 4.4; PerkinElmer, USA).

[0562] Figure 6 shows whole-body images of a mouse intramuscularly injected with fLuc mRNA-LNP prepared in Example 27 of the present invention, taken at various time points after administration using an imaging device (IVIS Lumina III) designed specifically for small animals.

[0563] Figure 7 shows the results of quantitative analysis of the luminescence images obtained in the experiment in Figure 6. After intramuscular injection of the prepared fLuc mRNA-LNP into mice, the luminescence intensity at the injection site was measured at various time points. The measured values ​​are summarized in Table 3 below.

[0564] [Table 3] TIFF2025540651000062.tif70170

[0565] Referring to Figures 6, 7 and Table 3, all of the mRNA-LNPs prepared in Example 27 successfully expressed proteins in vivo.

[0566] In addition, luminescence intensity at the injection site was measured 3 hours after intramuscular injection, and protein expression rates were calculated in comparison with control MC3- or SM-102-based LNPs. The analysis results of protein expression rates are summarized in Table 4 below.

[0567] [Table 4]

[0568] Referring to Table 4, among the measured mRNA-LNPs, most mRNA-LNPs, except for compositions 18, 33, 37, and 40, showed higher protein expression than the control group MC3 at 3 hours after injection, and compositions 17 and 21, which had the best effects, showed significantly higher protein expression than the control group SM-102 at 3 hours after injection.

[0569] Experimental Example 6. Optimization of mRNA-LNP formulation

[0570] We attempted to optimize the composition ratio between mRNA and lipid compounds constituting fLuc mRNA-LNPs prepared using various ionizable lipids 1-178 prepared by the method of Example 27.

[0571] Specifically, formulation optimization was performed by adjusting the molar ratio (based on moles) between the four constituent lipid compounds of LNP (ionizable lipid:phospholipid:cholesterol:PEGylated lipid) in the range of (20-60):(0-25):(30-60):(0-5), and by adjusting the N / P ratio (number of ionizable nitrogen atoms in the ionizable lipid:number of phosphorus atoms in the phosphate group that indicates anionicity in the mRNA) in the range of 1.5-15. Specifically, fLuc mRNA-LNPs containing each ionizable lipid were prepared in more than 15 different formulations according to the same systematic method. Each mRNA-LNP was then intramuscularly injected into mice as described in Experimental Example 5, and luminescence images were acquired and analyzed using an IVIS system over a period of time. The optimal formulation conditions (composition ratio and N / P ratio) for each ionizable lipid and the mRNA-LNPs containing it were determined to yield the highest protein expression rate. The optimal composition ratio and N / P ratio for each ionizable lipid are shown in Table 2.

[0572] Experimental Example 7. Evaluation of endosomal escape efficiency of EGFP mRNA-LNP administered to cells

[0573] LNPs containing EGFP mRNA encapsulated using various ionizable lipids prepared by the method of Example 27 were administered to cells, and the efficiency of mRNA release from endosomes to the cytoplasm of the mRNA-LNPs that entered the cells was compared. EGFP mRNA-LNPs prepared using the ionizable lipids MC3 or SM-102 were used as controls.

[0574] The remaining lipid compounds comprising the LNPs were cholesterol, DMG-PEG as the PEG-lipid, and DSPC as the phospholipid. 0.1 mol% of the total lipids (i.e., if the phospholipid content is 10 mol% of the total lipids, this corresponds to 1 mol% of the total phospholipids) was sulfo-cyanine 5.5-DSPE or ATTO 647N DOPE (Sigma-Aldrich, USA) for tracking the LNPs under a fluorescence microscope.

[0575] Specifically, 18 hours before administration of mRNA-LNP, 1 × 10 HeLa cells (ATCC, USA) were plated in an 8-well plate. 5 After seeding at a density of 100 cells / well, the cells were cultured in DMEM medium (Gibco, USA) containing FBS and antibiotics at 37°C and 5% CO2. As a control, cells injected with unformulated EGFP mRNA into the cytoplasm by electrical stimulation were also seeded in other wells for comparison. The dose of mRNA-LNP administered was adjusted to 100 ng / well based on mRNA, and the HeLa cells were treated. After 4 hours, the cells were fixed with 4% PFA and photographed under a fluorescence microscope.

[0576] Meanwhile, to quantitatively measure the number of cytoplasmic mRNA molecules, the cells were treated with smFISH and imaged under a microscope after a certain period of time. The endosomal escape efficiency was compared and analyzed for each ionizable lipid component as the ratio (R / L) of the number of cytoplasmic mRNAs (R) to the number of LNPs that entered the cell (L). To confirm the fluorescence intensity-based analysis results, we used a co-staining method with the endocytic markers EEA1 (early endosomes) and Lamp1 (lysosomes).

[0577] Experimental Example 8: Verification of in vitro immunogenicity of SARS-CoV-2 spike mRNA-LNP

[0578] SARS-CoV-2 mRNA-encapsulated LNPs prepared using various ionizable lipids, as prepared by the method described in Example 27, were applied to cells to analyze the mRNA levels of inflammation-related factors (CCL2, CCL3, IL-1β, and IL-6). Specifically, HEK-293T cells were treated with LNPs at 1 μg / well of mRNA. After 24 hours, cells were lysed using Trizol (Thermo Fisher, #15596026), then chloroform was added and incubated for 2-3 minutes. The cells were then centrifuged at 12,000 g for 15 minutes at 4°C, and the aqueous layer containing the RNA was transferred to a new tube. Isopropanol was added, incubated at 4°C for 10 minutes, and then centrifuged at 12,000 g for 15 minutes at 4°C. The supernatant was discarded, and the pellet was washed with 75% ethanol. The sample was mixed using a vortex mixer and centrifuged at 7,500 g for 5 minutes at 4°C. After discarding the supernatant, resuspend the pellet in 2-50 μL of RNase-free water. The extracted RNA was reverse-transcribed using a cDNA synthesis kit (Toyobo, #FSK-101) and amplified using RT-qPCR (Dice TP800 thermal real-time PCR system) with SFC green qPCR master mix (SFC, #pgm1005). All measurements were normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene. Each experiment was performed three times per condition, and measurements were performed twice (n=6). The gene-specific primer sequences are as follows:

[0579] Homo sapiens CC motif chemokine ligand 2(CCL2), mRNA

[0580] NCBI Reference Sequence:NM_002982.4

[0581] F:CAATCAATGCCCCAGTCACC

[0582] R:TCGGAGTTTGGGTTTGCTTG

[0583] Homo sapiens CC motif chemokine ligand 3(CCL3)、transcript variant 1、mRNA

[0584] NCBI Reference Sequence:NM_002983.3

[0585] F:TGTCCTCCTCTGCACCATG

[0586] R:STATECACCGGGC

[0587] Homo sapiens interleukin 1 beta (IL1B) mRNA

[0588] NCBI Reference Sequence:NM_000576.3

[0589] F:GGAGAATGACCTGAGCACCT

[0590] R:GGAGGTGGAGAGCTTTCAGT

[0591] Homo sapiens interleukin 6(IL6)、transcript variant 3、mRNA

[0592] NCBI Reference Sequence:NM_001371096.1

[0593] F:AGTCCTGATCCAGTTCCTGC

[0594] R:CTACATTTGCCGAAGAGCCC

[0595] The snowflake is based on 8 ingredients and 5 ingredients.

[0596] FIG. 8 is a graph showing the mRNA levels of four indicators related to immune responses induced by LNP in cells treated with mRNA-LNP prepared in Example 27.

[0597] Table 5 below summarizes the in vitro immunogenicity (based on PBS) of spike mRNA-LNPs produced according to one example.

[0598] [Table 5]

[0599] Experimental Example 9. In vivo toxicity evaluations

[0600] The fLuc mRNA-LNP prepared by the method of Example 27 was administered intramuscularly (im) to the living body, and the toxicity of the LNP was evaluated through serum biochemistry analysis.

[0601] At 24 and 48 hours after intravenous injection, 50-100 μL of serum was collected from each mouse by retro-orbital blood collection. Serum biochemistry analyses were performed using a Hitachi 7150 Chemistry Analyzer to measure liver function indicators: aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP), as well as kidney function indicators: blood urea nitrogen (BUN) and creatinine.

[0602] Figure 9 shows the results of analyzing five toxicity indicators for the liver, kidneys, etc. by collecting blood samples after a certain period of time has elapsed since the mRNA-LNP prepared in Example 27 was injected into the body.

[0603] As shown in Figure 9, Composition 17 showed similar ALP and BUN values ​​to the controls PBS and SM-102, and showed lower AST toxicity than the controls PBS and SM-102, confirming its excellent safety.

[0604] Experimental Example 10. Stability measurement of mRNA-LNP depending on storage temperature and period

[0605] The fLuc mRNA-LNPs prepared using various ionizable lipids according to the method of Example 27 were stored at constant temperatures of 4°C and 25°C, and the size, polydispersity index (PDI), and encapsulation efficiency (EE) of the mRNA-LNPs were measured using the methods of Experimental Examples 2 and 3 at 1 day, 3 days, and 30 days after preparation.

[0606] 10 is a graph showing the size, polydispersity, and encapsulation efficiency of LNP samples measured according to the time elapsed since preparation and temperature conditions of mRNA-LNP prepared in Example 27. The analytical results are summarized in Table 6 below.

[0607] Referring to Figure 10 and Table 6, even after 30 days, the size, polydispersity, and encapsulation efficiency of the LNPs remained stable without any significant changes at storage temperatures of 4°C and 25°C.

[0608] [Table 6] TIFF2025540651000066.tif113170

[0609] The above description of the present invention is for illustrative purposes only, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described embodiments are illustrative in all respects and are not limiting.

Claims

1. A lipid compound of the following chemical formula 1, an isomer thereof, or a salt thereof. In the above formula, R １ is hydrogen, hydroxy, C １－６ Alkyl, C ２－６ Alkenyl, C １－６ Alkoxy, C ２－６ Alkenyloxy, —CN, —NO ２ , -N(R) ２ , -C(=O)R, -C(=O)OR, -OC(=O)R, -C(=O)N(R) ２ , -NRC(=O)R, -NRC(=O)N(R) ２ , -NRC(=S)N(R) ２ , C ３－１４ cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, —O-5-10 membered heteroaryl or —O-3-14 membered heterocyclyl, wherein said C １－６ Alkyl, C ２－６ Alkenyl, C １－６ Alkoxy, C ２－６ Alkenyloxy, C ３－１４ Cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, —O-5-10 membered heteroaryl and —O-3-14 membered heterocyclyl are each independently unsubstituted or substituted with 1 to 3 halogen or C １－６ may be substituted with alkyl, X １ is a single bond, -CO-C １－６ Alkyl, —CO—C ２－６ Alkenyl, —C(═O)NR—, —NRC(═O)—, —NRC(═O)NR—, —NRC(═S)NR—, C ６－１０ Aryl, C ３－１４ cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, nucleobase, amino acid monomer or amino acid oligomer, wherein said —CO—C １－６ Alkyl, —CO—C ２－６ Alkenyl, C ６－１０ Aryl, C ３－１４ The cycloalkyl, 5-10 membered heteroaryl, 3-14 membered heterocyclyl, nucleobase, amino acid monomer or amino acid oligomer is each independently unsubstituted or substituted with 1 to 3 halogen or C １－６ may be substituted with alkyl, L １ is C １－１４ Alkylene, C ２－１４ Alkenylene, M, R ａ M.R. ａ , M.R. ａ M １ or R ａ MR ｂ and n is an integer of 1 to 5, and when n is 2 to 5, X １ and L １ is chosen independently in each case, L ２ is C １－１４ Alkylene, C ２－１４ Alkenylene, M, R ａ M.R. ａ , M.R. ａ M １ or R ａ MR ｂ and the L ２ is the above L １ Same or different from Y is hydrogen, -(CH ２ ) ｍ OH, -(CH ２ ) ｍ SH or -(CH ２ ) ｍ SeH, where m is an integer from 0 to 5; R ２ and R ３ are each independently C １－３０ Alkyl, C ２－３０ alkenyl, or R ｃ MR ｄ wherein said C １－３０ Alkyl and C ２－３０ Each alkenyl is independently unsubstituted or substituted with 1 to 3 C １－１６ Alkyl or C ２－１６ substituted with alkenyl, M and M １ are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O) ２ -, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-; R is independently hydrogen, C １－６ Alkyl, C ２－６ Alkenyl, C ３－１４ cycloalkyl, 5-10 membered heteroaryl, or 3-14 membered heterocyclyl; R ａ and R ｂ are independently -(CH ２ ) ｌ -, -C ３－２０ Cycloalkyl-(CH ２ ) ｌ -, -(CH ２ ) ｌ -, -C ３－２０ Cycloalkyl-, -C ６－２０ Aryl-(CH ２ ) ｌ - 、 - (CH ２ ) ｌ -C ６－２０ Aryl-, -NH-(CH ２ ) ｌ - or - (CH ２ )-, where l is an integer from 0 to 10; R ｃ is C １－１４ Alkylene or C ２－１４ is alkenylene, R ｄ is C １－２０ Alkyl, C ２－２０ alkenyl or hydrogen, wherein said C １－２０ Alkyl and C ２－２０ Each alkenyl is independently unsubstituted or substituted with 1 to 3 C １－２０ Alkyl or C ２－２０ substituted with alkenyl, The heteroaryl is an aromatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S, and the heterocyclyl is an aliphatic heterocycle containing 1 to 6 heteroatoms selected from N, O, and S.

2. The lipid compound according to claim 1, wherein the compound of Chemical Formula 1 is a compound of Chemical Formula 2: In the above formula, j and k are independently integers from 1 to 12; M ２ and M ３ are each independently -NHC(=O)-, -C(=O)NH-, -C(=O)O-, -OC(=O)-, -C(=O)-, -NH-, -S-, -SS-, -O-, -S(O) ２ -, -C(=O)S-, -SC(=O)-, -NHC(=O)NH-, -NHC(=O)O- or -OC(=O)NH-; R ４ , R ５ , R ６ and R ７ are each independently hydrogen, C １－２４ Alkyl or C ２－２４ alkenyl, wherein said C １－２４ Alkyl and C ２－２４ Each alkenyl is independently unsubstituted or substituted with 1 to 3 C １－２０ Alkyl or C ２－２０ Substituted with alkenyl.

3. R １ is hydrogen, hydroxy, C １－６ Alkyl, C １－６ Alkoxy, -CN, -NO ２ , -NH ２ , -C(=O)-C １－３ Alkyl, —C(═O)NH ２ , -NHC(=O)-C １－３ Alkyl, —NHC(═O)NH ２ or -NHC(=S)NH ２ and X １ is a single bond, C １－６ Alkyl, —CO—, C ２－６ Alkenyl-CO-, -C(=O)NH-, -C(=O)N(CH ３ )-, -NHC(=O)-, -N(CH ３ )C(=O)-, -NHC(=O)NH-, -N(CH ３ )C(=O)NH-, -NHC(=S)NH- or -N(CH ３ )C(═S)NH—, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1,2,3-triazolyl, 1,3,4-triazolyl, 1-oxa-2,3-diazolyl, 1-oxa-2,4-diazolyl, 1-oxa-2,5-diazolyl, 1-oxa-3,4-diazolyl, 1-thia-2,3-diazolyl, 1-thia-2,4-diazolyl, 1-thia-2,5-diazolyl, 1-thia-3,4-diazolyl, tetrazolyl, pyridinyl, Pyridazinyl, pyrimidinyl, pyrazinyl, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indazolyl, benzimidazolyl, benzotriazolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrazolo[4,3-d]pyridinyl, pyrazolo[4,3-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, pyrazolo[3 , 4-b]pyridinyl, purinyl, indolizinyl, imidazo[1,2-a]pyridinyl, imidazo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyridinyl, pyrrolo[1,2-b]pyridazinyl, imidazo[1,2-c]pyrimidinyl, quinolinyl, isoquinolinyl, cinnolinyl, azaquinazolinyl, quinoxalinyl, phthalazinyl, 1,6-naphthyridinyl, 1,7-naphthyridinyl, 1,8-naphthyridinyl, 1,5-naphthyridinyl, 2,6-naphthyridinyl, 2,7-naphthyridinyl, pyrido[3,2 3. The lipid compound according to claim 1 or 2, or an isomer thereof, or a salt thereof, wherein the lipid compound is selected from the group consisting of pyrido[4,3-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrido[2,3-b]pyrimidinyl, pyrido[2,3-b]pyrazinyl, pyrido[3,4-b]pyrazinyl, pyrimido[5,4-d]pyrimidinyl, pyrazino[2,3-b]pyrazinyl, pyrimido[4,5-d]pyrimidinyl, a nucleobase, an amino acid monomer, or an amino acid oligomer.

4. The lipid compound according to any one of claims 1 to 3, wherein the lipid compound is selected from the group consisting of: (1) heptadecan-9-yl 8-((6-acetamido-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (2) heptadecan-9-yl 8-((2-hydroxy-6-ureidohexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (3) heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (4) heptadecan-9-yl 17-hydroxy-3,11-dioxo-19-(6-oxo-6-(undecyloxy)hexyl)-7-oxa-2,4,10,12,19-pentaazaheptacosano-27-ate, (5) heptadecan-9-yl 25-hydroxy-3,11,19-trioxo-27-(6-oxo-6-(undecyloxy)hexyl)-7,15-dioxa-2,4,10,12,18,20,27-heptaazapentatriacontano-35-ate, (6) heptadecan-9-yl 8-((2-hydroxy-6-(3-methylthioureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (7) heptadecan-9-yl 8-((6-(cyclopentanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (8) heptadecan-9-yl 8-((2-hydroxy-6-((R)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (9) heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (10) heptadecan-9-yl 8-((2-hydroxy-6-((R)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (11) heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (12) heptadecan-9-yl 8-((6-(cyclohexanecarboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (13) heptadecan-9-yl 8-((2-hydroxy-6-(piperazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (14) heptadecan-9-yl 8-((6-(1,4-dimethylpiperazine-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (15) heptadecan-9-yl 8-((6-(2-(1,4-dimethylpiperazin-2-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (16) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (17) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (18) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (19) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (20) heptadecan-9-yl 8-((2-hydroxy-6-(4-nitro-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (21) heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (22) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (23) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (24) heptadecan-9-yl 8-((2-hydroxy-6-(3-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (25) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (26) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (27) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (28) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (29) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (30) heptadecan-9-yl 8-((2-hydroxy-6-(4-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (31) heptadecan-9-yl 8-((2-hydroxy-6-(5-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (32) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (33) heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (34) heptadecan-9-yl 8-((2-hydroxy-6-(1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (35) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (36) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (37) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (38) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (39) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (40) heptadecan-9-yl 8-((2-hydroxy-6-(2-hydroxy-1-methyl-1H-imidazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (41) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (42) heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (43) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (44) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (45) heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-pyrazole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (46) heptadecan-9-yl 8-((2-hydroxy-6-(isoxazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (47) heptadecan-9-yl 8-((2-hydroxy-6-(isoxazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (48) heptadecan-9-yl 8-((2-hydroxy-6-(oxazole-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (49) heptadecan-9-yl 8-((2-hydroxy-6-(oxazole-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (50) heptadecan-9-yl 8-((6-(furan-3-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (51) heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (52) heptadecan-9-yl 8-((2-hydroxy-6-(picolinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (53) heptadecan-9-yl 8-((2-hydroxy-6-(nicotinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (54) heptadecan-9-yl 8-((2-hydroxy-6-(isonicotinamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (55) heptadecan-9-yl 8-((2-hydroxy-6-(pyridazine-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (56) heptadecan-9-yl 8-((2-hydroxy-6-(pyridazine-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (57) heptadecan-9-yl 8-((2-hydroxy-6-(pyrazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (58) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-4-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (59) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-5-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (60) heptadecan-9-yl 8-((2-hydroxy-6-(pyrimidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (61) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-indole-2-carboxyamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (62) Heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-indole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (63) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-indole-3-carboxyamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (64) Heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-1H-indole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (65) Heptadecan-9-yl 8-((6-(4-amino-2-oxo-1,2-dihydropyrimidine-1-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (66) Heptadecan-9-yl 8-((6-(2,4-dioxo-1,2,3,4-tetrahydropyrimidine-1-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (67) Heptadecan-9-yl 8-((6-(6-amino-9H-purine-9-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (68) heptadecan-9-yl 8-((6-(2-amino-6-oxo-6,9-dihydro-1H-purine-9-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (69) Heptadecan-9-yl 8-((6-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (70) Heptadecan-9-yl 8-((6-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (71) Heptadecan-9-yl 8-((6-(2-(6-amino-9H-purin-9-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (72) Heptadecan-9-yl 8-((6-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (73) Heptadecan-9-yl 8-((6-((S)-2-amino-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (74) Heptadecan-9-yl 8-((6-((S)-2-acetamido-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (75) Heptadecan-9-yl 8-((6-((S)-2-amino-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (76) Heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (77) Heptadecan-9-yl 8-((6-((S)-2-amino-3-(1H-indol-3-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (78) Heptadecan-9-yl 8-((6-((S)-2-acetamido-3-(1H-indol-3-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (79) Heptadecan-9-yl 8-((2-hydroxy-6-((S)-pyrrolidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (80) Heptadecan-9-yl 8-((2-hydroxy-6-((S)-1-methylpyrrolidine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (81) Heptadecan-9-yl(6S,9S)-1,6-diamino-9-(3-guanidinopropyl)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate, (82) Heptadecan-9-yl 8-((6-((S)-2-((S)-2-amino-3-1H-imidazol-5-yl)propanamido)-5-guanidinopentanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (83) heptadecan-9-yl 8-((6-((S)-2-((S)-2-amino-3-(1H-imidazol-5-yl)propanamido)-3-(1H-imidazol-5-yl)propanamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (84) Heptadecan-9-yl(6S,9S)-9-((1H-imidazole-5-)methyl)-1,6-diamino-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate, (85) heptadecan-9-yl(6R,9S,12S)-1,6-diamino-9,12-bis(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate, (86) Heptadecan-9-yl(6S,9S)-1-amino-6-((R)-2-amino-3-(1H-imidazol-5-yl)propanamido)-9-(3-guanidinopropyl)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate, (87) Heptadecan-9-yl(2R,5S,8S)-5-((1H-imidazol-5-yl)methyl)-2-amino-8-(3-guanidinopropyl)-15-hydroxy-1-(1H-imidazol-5-yl)-3,6,9-trioxo-17-(6-oxo-6-(undecyloxy)hexyl)-4,7,10,17-tetraazapentacosano-25-ate, (88) Heptadecan-9-yl(6R,9S,12S)-9-((1H-imidazol-5-yl)methyl)-1,6-diamino-12-(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate, (89) Heptadecan-9-yl(2R,5S,8S)-5,8-bis((1H-imidazol-5-yl)methyl)-2-amino-15-hydroxy-1-(1H-imidazol-5-yl)-3,6,9-trioxo-17-(6-oxo-6-(undecyloxy)hexyl)-4,7,10,17-tetraazapentacosano-25-ate, (90) Heptadecan-9-yl(6R,9S,12S)-9,12-bis((1H-imidazol-5-yl)methyl)-1,6-diamino-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate, (91) Heptadecan-9-yl(6R,9S,12S)-12-((1H-imidazol-5-yl)methyl)-1,6-diamino-9-(3-guanidinopropyl)-19-hydroxy-1-imino-7,10,13-trioxo-21-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,14,21-pentaazanonacosano-29-ate, (92) Heptadecan-9-yl(6S,9S)-9-((1H-imidazol-5-yl)methyl)-1-amino-6-((R)-2-amino-3-(1H-imidazol-5-yl)propanamido)-16-hydroxy-1-imino-7,10-dioxo-18-(6-oxo-6-(undecyloxy)hexyl)-2,8,11,18-tetraazahexacosano-26-ate, (93) Heptadecan-9-yl 1-(4-amino-2-oxopyrimidin-1(2H)-yl)-9-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-17-hydroxy-2,5,11-trioxo-19-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,19-pentaazaheptacosano-27-ate, (94) Heptadecan-9-yl 9-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-1-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-15-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-23-hydroxy-2,5,11,17-tetraoxo-25-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,25-heptaazatritriacontano-23-ate, (95) heptadecan-9-yl 15-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-9-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetyl)-21-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-aminoethyl)-1-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-29-hydroxy-2,5,11,17,23-pentaoxo-31-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,21,24,31-nonaazanonatriacontano-39-ate; (96) Heptadecan-9-yl 21-(2-(4-amino-2-oxopyrimidin-1(2H)-yl)acetyl)-15-(2-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)acetyl)-1-(2-(6-amino-9H-purin-9-yl)-27-(2-(6-amino-9H-purin-9-yl)acetyl)-3-(2-amino ethyl)-9-(2-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetyl)-35-hydroxy-2,5,11,17,23,29-hexaoxo-37-(6-oxo-6-(undecyloxy)hexyl)-3,6,9,12,15,18,21,24,27,30,37-undecaazapentatetracontano-45-ate, (97) Heptadecan-9-yl 8-((6-(4-(4-amino-1-methyl-1H-pyrrole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (98) Heptadecan-9-yl 8-((6-(4-(4-(4-amino-1-methyl-1H-imidazole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-1-methyl-1H-pyrrole-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (99) Heptadecan-9-yl 8-((2-hydroxy-6-(1-methyl-4-(1-methyl-4-(1-methyl-4-(1-methyl-1H-imidazole-2-carboxamido)-1H-imidazole-2-carboxamido)-1H-pyrrole-2-carboxamido)-1H-pyrrole-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (100) heptadecan-9-yl 8-((2-hydroxy-4-(3-methylureido)butyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (101) Heptadecan-9-yl 8-((2-hydroxy-5-(3-methylureido)pentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (102) Heptadecan-9-yl 8-((2-hydroxy-7-(3-methylureido)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (103) Heptadecan-9-yl 8-((2-hydroxy-8-(3-methylureido)octyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (104) heptadecan-9-yl 9-hydroxy-3-oxo-11-(6-oxo-6-(undecyloxy)hexyl)-7-oxa-2,4,11-triazanonadecano-19-ate, (105) heptadecan-9-yl 12-hydroxy-3-oxo-14-(6-oxo-6-(undecyloxy)hexyl)-7,10-dioxa-2,4,14-triazadocosano-22-ate, (106) Heptadecan-9-yl 15-hydroxy-3-oxo-17-(6-oxo-6-(undecyloxy)hexyl)-7,10,13-trioxa-2,4,17-triazapentacosano-25-ate, (107) Heptadecan-9-yl 8-((2-(hydroxymethyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (108) Heptadecan-9-yl 8-((2-(2-hydroxyethyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (109) Heptadecan-9-yl 8-((2-(3-hydroxypropyl)-6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (110) (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-((2-hydroxy-6-(3-methylureido)hexyl)(methyl)amino)butanoate, (111) Heptadecan-9-yl 8-((2-hydroxy-6-(piperazine-1-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (112) Heptadecan-9-yl 8-((2-hydroxy-6-(4-methylpiperazine-1-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (113) Heptadecan-9-yl 8-((2-hydroxy-6-(2-(piperazin-1-yl)acetamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (114) Heptadecan-9-yl 8-((2-hydroxy-6-(2-(4-methylpiperazin-1-yl)acetamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (115) Heptadecan-9-yl 8-((6-(furan-2-carboxamido)-2-hydroxyhexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (116) Heptadecan-9-yl 8-((2-hydroxy-6-(thiophene-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (117) Heptadecan-9-yl 8-((6-(3-methylureido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (118) Heptadecan-9-yl 8-((6-(dodecan-2-yloxy)-6-oxohexyl)(2-hydroxy-6-(3-methylureido)hexyl)amino)octanoate, (119) Heptadecan-9-yl 8-((2-hydroxy-6-(3-methylureido)hexyl)(6-oxo-6-(tridecan-3-yloxy)hexyl)amino)octanoate, (120) 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxy-6-(3-methylureido)hexyl)amino)pentyl dodecanoate, (121) (9Z,28Z)-heptatriaconta-9,28-dien-19-yl 4-((2-hydroxy-6-(3-methylureido)hexyl)(methyl)amino)butanoate, (122) Heptadecan-9-yl 8-((2-hydroxy-6-(1,3,5-triazine-2-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (123) Heptadecan-9-yl 8-((2-hydroxy-4-(1H-pyrrole-3-carboxamido)butyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (124) Heptadecan-9-yl 8-((2-hydroxy-5-(1H-pyrrole-3-carboxamido)pentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (125) Heptadecan-9-yl 8-((2-hydroxy-7-(1H-pyrrole-3-carboxamido)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (126) Heptadecan-9-yl 8-((2-hydroxy-8-(1H-pyrrole-3-carboxamido)octyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (127) Heptadecan-9-yl 8-((3-(2-(1H-pyrrole-3-carboxamido)ethoxy)-2-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (128) Heptadecan-9-yl 10-hydroxy-1-oxo-12-(6-oxo-6-(undecyloxy)hexyl)-1-(1H-pyrrol-3-yl)-5,8-dioxa-2,12-diazaicosan-20-ate, (129) Heptadecan-9-yl 13-hydroxy-1-oxo-15-(6-oxo-6-(undecyloxy)hexyl)-1-(1H-pyrrol-3-yl)-5,8,11-trioxa-2,15-diazatricosano-23-ate, (130) Heptadecan-9-yl 8-((2-(hydroxymethyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (131) Heptadecan-9-yl 8-((2-(2-hydroxyethyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (132) Heptadecan-9-yl 8-((2-(3-hydroxypropyl)-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (133) Heptadecan-9-yl 8-((6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate, (134) Heptadecan-9-yl 8-((6-(dodecan-2-yloxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (135) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxyamido)hexyl)(6-oxo-6-(tridecan-3-yloxy)hexyl)amino)octanoate, (136) 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)pentyl dodecanoate, (137) (9Z,28Z)-heptatriaconta-9,28-dien-19-yl 4-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(methyl)amino)butanoate, (138) (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(methyl)amino)butanoate, (139) Heptadecan-9-yl 8-((6-(heptan-2-yloxy)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (140) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(octan-2-yloxy)-6-oxohexyl)amino)octanoate, (141) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(nonan-2-yloxy)-6-oxohexyl)amino)octanoate, (142) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(tridecan-2-yloxy)hexyl)amino)octanoate, (143) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(tetradecan-2-yloxy)hexyl)amino)octanoate, (144) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(octan-3-yloxy)-6-oxohexyl)amino)octanoate, (145) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxyamido)hexyl)(6-oxo-6-(undecan-3-yloxy)hexyl)amino)octanoate, (146) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-(nonan-4-yloxy)-6-oxohexyl)amino)octanoate, (147) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-4-yloxy)hexyl)amino)octanoate, (148) Heptadecan-9-yl 8-((6-(decane-5-yloxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (149) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-5-yloxy)hexyl)amino)octanoate, (150) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-oxo-6-(undecan-6-yloxy)hexyl)amino)octanoate, (151) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylpentyl)oxy)-6-oxohexyl)amino)octanoate, (152) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyloctyl)oxy)-6-oxohexyl)amino)octanoate, (153) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylnonyl)oxy)-6-oxohexyl)amino)octanoate, (154) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyldecyl)oxy)-6-oxohexyl)amino)octanoate, (155) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methylundecyl)oxy)-6-oxohexyl)amino)octanoate, (156) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyldodecyl)oxy)-6-oxohexyl)amino)octanoate, (157) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyltridecyl)oxy)-6-oxohexyl)amino)octanoate, (158) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyltetradecyl)oxy)-6-oxohexyl)amino)octanoate, (159) Heptadecan-9-yl 8-((6-((2-ethylhexyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (160) Heptadecan-9-yl 8-((6-((2-butyloctyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (161) Heptadecan-9-yl 8-((6-((2-hexyloctyl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (162) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-octyldodecyl)oxy)-6-oxohexyl)amino)octanoate, (163) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methylnonyl)oxy)-6-oxohexyl)amino)octanoate, (164) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methyloctyl)oxy)-6-oxohexyl)amino)octanoate, (165) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((7-methylnonyl)oxy)-6-oxohexyl)amino)octanoate, (166) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((8-methyldecyl)oxy)-6-oxohexyl)amino)octanoate, (167) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((7-methyloctyl)oxy)-6-oxohexyl)amino)octanoate, (168) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((8-methylnonyl)oxy)-6-oxohexyl)amino)octanoate, (169) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((9-methyldecyl)oxy)-6-oxohexyl)amino)octanoate, (170) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((10-methylundecyl)oxy)-6-oxohexyl)amino)octanoate, (171) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((11-methyldodecyl)oxy)-6-oxohexyl)amino)octanoate, (172) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((12-methyltridecyl)oxy)-6-oxohexyl)amino)octanoate, (173) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((5-methylheptan-2-yl)oxy)-6-oxohexyl)amino)octanoate, (174) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((5-methyloctan-2-yl)oxy)-6-oxohexyl)amino)octanoate, (175) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((6-methylheptan-2-yl)oxy)-6-oxohexyl)amino)octanoate, (176) Heptadecan-9-yl 8-((2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)(6-((2-methyloctan-3-yl)oxy)-6-oxohexyl)amino)octanoate, (177) Heptadecan-9-yl 8-((6-((2,6-dimethylheptan-4-yl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate, (178) Heptadecan-9-yl 8-((6-((7-ethyl-2-methylundecane-4-yl)oxy)-6-oxohexyl)(2-hydroxy-6-(1H-pyrrole-3-carboxamido)hexyl)amino)octanoate.

5. The lipid compound according to any one of claims 1 to 4, an isomer thereof, or a salt thereof; an active substance; Phospholipids and A structural lipid; A lipid nanoparticle composition comprising a PEGylated lipid (PEG-lipid).

6. The lipid nanoparticle composition of claim 5, wherein the active substance is at least one selected from the group consisting of chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

7. The lipid nanoparticle composition of claim 5 or 6, wherein the active substance is a nucleic acid.

8. The phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleo ... Phosphorus (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoylphosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl The lipid nanoparticle composition of any one of claims 5 to 7, wherein the lipid nanoparticle composition is selected from the group consisting of phosphatidylethanolamine (SOPE), 1-stearoyl-2-oleoylphosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

9. The lipid nanoparticle composition of any one of claims 5 to 8, wherein the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof.

10. The lipid nanoparticle composition of any one of claims 5 to 9, wherein the PEGylated lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, and mixtures thereof.

11. an organic phase in which the lipid compound, its isomer, or its salt according to any one of claims 1 to 4, a phospholipid, a structured lipid, and a PEGylated lipid are mixed in a molar ratio of (20-60):(0-25):(30-60):(0-5); mixing an aqueous phase in which the active substance is dissolved, A method for producing active substance-lipid nanoparticles, comprising mixing a lipid compound, an isomer, or a salt thereof according to any one of claims 1 to 4 with the active substance in a weight ratio of (4-30):1, wherein the ratio (N / P ratio) of the number of ionizable nitrogen atoms in the lipid compound, an isomer, or a salt thereof according to any one of claims 1 to 4 to the number of phosphorus atoms in the phosphate group exhibiting anionicity in the active substance is in the range of 1.5 to 15.

12. A pharmaceutical composition comprising the lipid nanoparticle composition of any one of claims 5 to 10 and a pharmaceutically acceptable carrier.

13. A method for preventing or treating a disease, comprising administering the lipid nanoparticle composition of any one of claims 5 to 10 to an individual in need of such prevention or treatment.

Images