Targeting GPR158 (MGLYR) with nanobodies for therapeutic benefit
Isolated monoclonal antibodies targeting GPR158 modulate neuronal signaling to treat MDD by enhancing stress resilience and mood regulation, addressing the limitations of current treatments.
Patent Information
- Application Number
- JP2025530712
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-19
- Filing Date
- 2023-11-28
- Publication Date
- 2025-12-16
AI Technical Summary
Current treatments for major depressive disorder (MDD) are limited in effectiveness, and there is a need for new drug targets and strategies that address the complex molecular pathogenesis of the condition, particularly focusing on neurotransmitter signaling imbalances involving GPCRs like GPR158.
Development of isolated monoclonal antibodies, including humanized forms of Nb20, that compete with glycine for binding to GPR158, modulating its signaling through RGS proteins and affecting neuronal excitability and synaptic transmission.
The antibodies demonstrate antidepressant effects in mouse models by modulating GPR158 signaling, providing a potential therapeutic approach for MDD by enhancing stress resilience and mood regulation.
Smart Images

Figure 2025540738000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is related to U.S. Provisional Patent Application No. 63 / 385,387, filed November 29, 2022, and U.S. Provisional Patent Application No. 63 / 503,281, filed May 19, 2023, each of which is incorporated by reference in its entirety for all purposes.
[0002] Reference to sequence listing The sequence listing set forth in the 22.5 kilobyte file 605274SEQLST.xml, created on November 22, 2023, is hereby incorporated by reference.
[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under Grant No. R01 MH105482 awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]
[0004] background Glycine is the simplest amino acid, ubiquitously present in all mammalian tissues. Glycine functions as an inhibitory neurotransmitter but can become excitatory in developing neurons (1, 2). Glycine is transported to axon terminals and packaged into vesicles for discrete synaptic release by specialized glycine transporter systems (3). Glycinergic neurons are distributed throughout the brain, but glycine can also be released by glial cells (4). Known receptors for glycine belong to the family of pentameric ligand-gated ion channels (5). Glycine also functions as a co-agonist of N-methyl-D-aspartate (NMDA) receptors (6). Interestingly, metabotropic neuromodulatory effects of glycine have been observed (7, 8), but the receptors mediating these actions have not been identified. Glycine has distinct effects on neural circuits (4), and glycinergic transmission has been implicated in pathological conditions, including depression (9-11). Taurine, a compound chemically related to glycine, associates with many of the same receptor targets and modulates neuronal signaling, leading to the argument that taurine may function as a neuromodulator (12).
[0005] Metabotropic neuromodulation in the nervous system is primarily mediated by G protein-coupled receptors (GPCRs). GPCRs play essential roles in neuronal physiology and pathology, providing unique targets for drug development (13). Classically, GPCRs signal by activating heterotrimeric G proteins (14-16). However, G protein-independent modes of signal transduction triggered by the recruitment of β-arrestins and other scaffolds to activated GPCRs have also been described (17-19). G protein signaling is tightly regulated by regulator of signaling (RGS) proteins, which promote their deactivation (20). Recent evidence has demonstrated significant interactions between RGS proteins and several different GPCRs, primarily members of class C receptors (21-25).
[0006] With the exception of glycine and taurine, GPCRs are known to mediate the effects of all major neurotransmitters. However, many GPCRs remain orphans, and their endogenous ligands have not yet been identified. It is generally accepted that orphan GPCRs have great potential for providing novel insights into physiological functions and for drug development (26, 27).
[0007] GPR158 is one of the most abundant orphan GPCRs in the brain. It has the unusual biological property of coupling with RGS proteins to transmit signals. In neurons, GPR158 regulates signaling to the second messenger cAMP and controls important ion channels, kinases involved in neuronal excitability and synaptic transmission, and neurotrophic factors (28). Therefore, GPR158 is deeply linked to cognitive and emotional states (29-31). Genetic suppression of GPR158 in mice results in a pronounced antidepressant phenotype and stress resilience, making GPR158 an attractive target for developing novel antidepressants (29).
[0008] Major depressive disorder (MDD) is a widespread neuropsychiatric condition affecting nearly 5% of the population in developed countries. (34) Although significant progress has been made in the treatment of depression, the effectiveness of currently approved therapeutic agents is limited. (35) The search for new strategies and drug targets is considered a relevant goal for managing MDD. (36-38)
[0009] The molecular pathogenesis of MDD is complex and poorly understood. Imbalances in neurotransmitter signaling are thought to induce a variety of maladaptive changes involving ion channels, kinases, and second messengers, particularly cAMP, that affect synaptic communication and neuronal excitability (39-40). These changes are suddenly triggered by environmental factors, such as stress, a major aggravating factor in MDD (41). The neuronal circuits underlying the processing of emotional states and affected by MDD are equally complex and involve many structures, including the prefrontal cortex (PFC), a region deeply implicated in affective disorders and the effects of stress (42).
[0010] Treatments for MDD have traditionally focused on elements mediating monoamine neurotransmitter signaling, which is targeted by the majority of currently approved antidepressants (43). However, several recent agents also target GABA, glutamate, and opioid receptors, highlighting the potential of other neurotransmitter systems in the development of treatments for MDD (44-45). One such underutilized system involves the neurotransmitter glycine. Glycine is released by specific neurons and has unique effects on neural circuits and neuronal activity (1, 46). Glycine and its related naturally occurring compound, taurine, have been implicated in mood regulation and depression (9, 11, 47).
[0011] The effects of glycine were thought to be primarily mediated by specialized glycine receptors, GlyRs, which are inhibitory ion channels (5). Recently, a metabotropic receptor for glycine, mGlyR, was discovered (48). GPR158, previously known as an orphan receptor, exerts excitatory effects on neurons through modulation of the second messenger cAMP. mGlyRs are primarily expressed in the PFC, and their expression is regulated by stress (29, 49). mGlyR levels are significantly upregulated in patients diagnosed with MDD, and knockout of mGlyR in mice results in an antidepressant phenotype and stress resilience (29). mGlyRs employ an extracellular Cache domain for glycine recognition (48). Binding of glycine or taurine to the ligand-binding pocket within this domain alters the activity of the associated Regulator of G Protein Signaling (RGS) complexes on the intracellular side. This affects G protein signaling to second messengers and ion channels, thereby transducing the signal (48). Notably, loss of RGS regulation also results in antidepressant effects in mouse models (50). Overall, these findings point to mGlyRs as attractive targets for developing new antidepressant therapies. Summary of the Invention [Means for solving the problem]
[0012] Summary of the Invention In one aspect, the invention provides isolated monoclonal antibodies that compete with antibody Nb20 for binding to human GPR158. Some antibodies bind to the same epitope on human GPR158 as antibody Nb20.
[0013] Some antibodies comprise the three heavy chain CDRs of antibody Nb20, where Nb20 is a llama antibody characterized by a heavy chain variable region having an amino acid sequence comprising SEQ ID NO: 2. In some antibodies, the three heavy chain CDRs are as defined by IMGT (SEQ ID NOs: 3-5). In some antibodies, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 2.
[0014] Some antibodies are Nb20 or chimeric, veneered, or humanized forms thereof. For example, the antibody can be a humanized antibody. Some antibodies are humanized Nb20 antibodies that specifically bind to human GPR158, where Nb20 is a llama antibody characterized by a mature heavy chain variable region of SEQ ID NO: 2. Some antibodies comprise a humanized mature heavy chain variable region comprising the three heavy chain CDRs of Nb20. In some antibodies, the CDRs are defined by a definition selected from the group consisting of Kabat, Chothia, Kabat / Chothia combined, AbM, Contact, and IMGT.
[0015] The antibody may be an intact antibody. The antibody may be a binding fragment. For some such antibodies, the binding fragment is a single chain antibody, Fab, or F(ab')2 fragment. The antibody may be a Fab fragment or a single chain Fv. The antibody may be a nanobody.
[0016] In some antibodies, the isotype is human IgG1. In some antibodies, the mature heavy chain variable region is fused with a heavy chain constant region. In some antibodies, the heavy chain constant region is a mutant form of a natural human heavy chain constant region that has reduced Fcγ receptor binding compared to a natural human heavy chain constant region. In some antibodies, the heavy chain constant region is of the IgG1 isotype.
[0017] Some antibodies have at least one mutation in the constant region. In some antibodies, the mutation reduces complement binding or activation by the constant region. Some antibodies have mutations at one or more of positions 241, 264, 265, 270, 296, 297, 318, 320, 322, 329, and 331 according to EU numbering. Some antibodies have alanine at positions 318, 320, and 322.
[0018] Some antibodies have a human IgG2, IgG3, or IgG4 isotype. Some antibodies are at least 95% pure w / w. Some antibodies are conjugated to a therapeutic agent, a cytotoxic agent, a cytostatic agent, a neurotrophic agent, or a neuroprotective agent.
[0019] In another aspect, the invention provides a pharmaceutical composition comprising any of the antibodies disclosed herein and a pharmaceutically acceptable carrier.
[0020] In another aspect, the invention provides a nucleic acid encoding the heavy chain of any of the antibodies disclosed herein. In another aspect, the invention provides a recombinant expression vector comprising such a nucleic acid. In another aspect, the invention provides a host cell transformed with such a recombinant expression vector.
[0021] In another aspect, the invention provides a method of humanizing a Nanobody, the method comprising the steps of: (a) selecting one or more acceptor humanization Nanobody scaffolds; (b) identifying the amino acid residues of the Nanobody to be retained; (c) synthesizing a nucleic acid encoding a humanized heavy chain comprising the CDRs of the Nanobody heavy chain; and (d) expressing the nucleic acid in a host cell to produce a humanized Nanobody, wherein the Nanobody is Nb20, and Nb20 is characterized by the mature heavy chain variable region of SEQ ID NO:2.
[0022] In another aspect, the invention provides a method for producing a humanized, chimeric, or veneered antibody, the method comprising: (a) culturing cells transformed with nucleic acid encoding the heavy chain of the antibody, such that the cells secrete the antibody; and (b) purifying the antibody from the cell culture medium, wherein the antibody is a humanized, chimeric, or veneered form of an antibody characterized by the mature heavy chain variable region of SEQ ID NO:2.
[0023] In another aspect, the invention provides methods for producing cell lines that produce humanized, chimeric, or veneered antibodies, comprising the steps of: (a) introducing into cells a vector encoding the antibody heavy chain and a selectable marker; (b) growing the cells under conditions that select for cells with increased copy number of the vector; (c) isolating single cells from the selected cells; and (d) banking cells cloned from the selected single cells based on antibody yield, wherein the antibody is a humanized, chimeric, or veneered form of an antibody characterized by the mature heavy chain variable region of SEQ ID NO: 2. Some such methods include growing the cells under selective conditions and culturing the cells at a concentration of at least 100 mg / L / cell 10 6 and screening for cell lines that naturally express and secrete the antibody at 1000kJ / 24 hours.
[0024] In another aspect, the invention provides methods of treating or preventing an affective, mood, or brain disorder in a subject, comprising administering to the subject an effective regimen of any of the antibodies disclosed herein, thereby treating or preventing the affective, mood, or brain disorder in the subject. In some such methods, the affective, mood, or brain disorder is depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or an anxiety disorder.
[0025] In another aspect, the present invention provides methods for detecting GPR158 in a biological sample from a subject, comprising contacting the biological sample with an effective amount of any of the antibodies disclosed herein. Some such methods further comprise detecting binding of the antibody to GPR158. Some such methods further comprise comparing binding of the antibody to the biological sample with binding of the antibody to a control sample.
[0026] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims. [Brief explanation of the drawings]
[0027] [Figure 1] Figure 1 shows the strategy for identifying nanobodies that specifically interact with GPR158. Briefly, llamas were immunized with membranes expressing GPR158, and lymphocytes were isolated from the llamas' blood. mRNA was extracted from the lymphocytes, and reverse transcription was performed on the extracted mRNA. The reverse-transcribed cDNA was amplified using primers designed to amplify the coding sequences for the variable domains (without the light chain) of IgG2 and IgG3. A phage library was constructed using the amplified cDNA, and then three rounds of panning against mGlyR were performed to enrich for specific binders, which were then isolated and tested.
[0028] [Figure 2] Figure 2 shows the sequence of Nanobody-20 (Nb20) (SEQ ID NO: 2).
[0029] [Figure 3-1]Figures 3A-3B show Nanobody-20 specifically interacting with GPR158 (mGlyR). Figure 3A, upper left panel, is a schematic diagram of recombinant Nb20 protein binding to full-length GPR158 expressed in transiently transfected HEK293 cells. The upper right panel of Figure 3A shows the results of a flow cytometry study of purified recombinant Nb20 protein binding to full-length GPR158 expressed in HEK293 cells. The x-axis measures Nb20 binding, and the y-axis measures GPR158 expression in the cells. Figure 3A, lower left panel, shows a flow cytometry binding histogram of cells transiently expressing GPR158 or mock-transfected or dopamine D1R-transfected cells incubated with Nb20. Only GPR158-expressing cells exhibit a shift to the right of the histogram, thus demonstrating the specificity of Nb20. Figure 3A, bottom right panel, shows the dose-response profile of Nb20 binding to cells expressing GPR158 in a flow cytometry experiment. The specificity of Nb20, which binds only to cells expressing GPR158, is demonstrated. Figure 3B, left panel, is a schematic of the SPR strategy showing Nb20 binding to the extracellular domain (ectodomain) of purified GPR158. Figure 3B, right panel, shows the SPR sensorgram of Nb20 binding and dissociation. [Figure 3-2] Same as above.
[0030] [Figure 4]Figures 4A-4B show that Nanobody-20 inhibits GPR158 (mGlyR) signaling by modulating the GAP activity of RGS7. Figure 4A shows a schematic diagram of the BRET-based GAP assay for testing mGlyR activity. First, Gαo is activated by the dopamine D2R receptor. Once steady-state activity is reached, the D2R antagonist haloperidol is injected, and the kinetics of G protein deactivation are monitored by tracking quenching of the BRET signal. Figure 4B, left panel, shows BRET signal traces showing the time course of Gαo activation and deactivation in GPR158-transfected cells with or without Nb20 treatment. Nb20 significantly slowed Gαo deactivation by the GPR158-RGS7 / Gβ5 complex. Figure 4B, right panel, shows the quantification of the deactivation time constant (1 / τ) of the responses shown in the right panel using different transfection conditions. 1 / τ is calculated from the deactivation curves. The effect of Nb20 was measured only when both GPR158 and RGS7 / Gβ5 were co-transfected. Filled circles (BRET B), open circles (Nb), hatched bars (BRET B), open bars (Nb).
[0031] [Figure 5-1]Figures 5A-5G show the development of mGlyR-selective nanobodies. A) Schematic of the nanobody development pipeline. A phage library was constructed from leukocytes of a llama immunized with mGlyR, followed by three rounds of panning against mGlyR to enrich for specific binders, which were isolated and tested. B) Schematic of the detection strategy in flow cytometry experiments. C) Flow cytometric analysis of nanobody binding in HEK cells transiently expressing mGlyR incubated with or without Nb20 and anti-myc-APC conjugated antibodies. The percentage of cells in each quadrant is shown. D) Dose-response profile of a representative Nb20 binding experiment to cells expressing mGlyR in a flow cytometry experiment. The concentration of Nb20 is indicated. E) Quantification of the data in 5D. Error bars represent SEM values (n = 3 independent experiments). F) Schematic of the surface plasmon resonance (SPR) assay to detect Nb20 binding to a chip containing immobilized recombinant mGlyR ectodomain (Ecto-mGlyR). G) SPR sensorgram of Nb20 binding and dissociation. [Figure 5-2] Same as above. [Figure 5-3] Same as above.
[0032] [Figure 6] Figures 6A-6B show the specificity of Nb20 for mGlyR. A) Schematic of the detection strategy and analysis of binding. Anti-Myc APC-conjugated antibody ± Nb20 was incubated on cells that do not express mGlyR. The percentage of cells in each quadrant is shown. B) Analysis of nanobody binding by flow cytometry of HEK suspension cells transiently expressing mGlyR or other receptors incubated with Nb20 and anti-myc-APC-conjugated antibody.
[0033] [Figure 7]Figure 7 shows the effect of glycine on Nb20 binding to mGlyR. HEK293 cells transfected with mGlyR were incubated with Nb20 (1 μM) and anti-myc APC-conjugated antibody in the presence or absence of 100 μM glycine.
[0034] [Figure 8-1] Figures 8A-8E show the modulation of GAP activity of the mGlyR-RGS7 / Gβ5 complex by Nb20. A) Schematic of the BRET-based GAP assay for testing mGlyR activity. Gαo is first activated by the dopamine D2R receptor. Once steady-state is reached, the D2R antagonist haloperidol is injected, and the kinetics of G protein deactivation are monitored by tracking the quenching of the BRET signal. B, C) BRET signal traces showing the time course of Gαo activation and deactivation with or without Nb20 treatment in cells lacking mGlyR (B) or transfected with mGlyR (C). D) Quantification of the deactivation time constant of the responses shown in 8B and 8C. 1 / τ is calculated from the deactivation curves of n = 3 independent experiments performed in triplicate from each cell transfection group. Data represent the mean ± SEM. ****p<0.0001, ns (not significant) = p>0.05, two-way ANOVA. Shaded bars (Mock), open bars (Nb20). E) Dose-response profile of the change in GAP activity (KGAP) calculated by subtracting the baseline deactivation rate (1 / τ) from the rate of the response in the presence of GPR158-RGS7-Gβ5. Data are means ± SEM of n=3 independent experiments performed in triplicate. [Figure 8-2] Same as above.
[0035] [Figure 9]Figures 9A-9B show the modulation of mGlyR activity by Nb20 and glycine. A) Representative BRET signal traces showing the time course of Gαo activation and deactivation in HEK293 cells transfected with mGlyR and D2R, with or without Nb20, glycine, or both. D2R was activated by dopamine at time 0 seconds. The arrow indicates the addition of the D2R antagonist haloperidol. B) Quantification of the deactivation time constant of the response shown in 9A. 1 / τ is calculated from the deactivation curves of n = 3 independent experiments performed in triplicate from each cell transfection group. Data represent the mean ± SEM. ****p < 0.0001, one-way ANOVA. No statistically significant differences (p > 0.05) were detected between Nb20-treated, glycine-treated, or both-treated groups.
[0036] [Figure 10-1]Figures 10A-10E show the antidepressant effect of Nb20 administration in mice. A-C) Vehicle or nanobody (9.6 μg) in naive mice. A) Schematic of the intracerebroventricular (ICV) injection strategy for administering vehicle or Nb20 to mice. B) Evaluation of mice injected with Nb20 or vehicle control in a panel of behavioral tests consisting of the elevated plus maze (EPM), marble burying (MB), tail suspension test (TST), and forced swim test (TST) (n = 12 mice (6 males and 6 females) in the vehicle group and n = 11 mice (6 males and 5 females) in the ketamine-treated group and n = 12 mice (6 males and 6 females) in the Nb20-treated group). C) Calculation of the emotionality score based on superscoring of the four behavioral tests. D) Schematic of the timeline and experimental strategy for intranasal delivery, stress induction, treatment, and behavioral assessment of mice administered ketamine, Nb20, or control Nb20*. E) Assessment of mice in the indicated behavioral paradigms (n=12 mice / group: 6 males and 6 females). Data are mean ± SEM (non-parametric one-way ANOVA; Dunnett's test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Hatched bars (Nb20*), open bars (Nb20), and crosshatched bars (ketamine). [Figure 10-2] Same as above. [Figure 10-3] Same as above.
[0037] [Figure 11]Figure 11 shows that the antidepressant effects of Nb20 persisted in mice for 2 weeks after administration. Mice were evaluated in the elevated plus maze (EPM), marble burying (MB), tail suspension test (TST), and forced swim test (TST) paradigms 2 weeks after ICV injection of Nb20 or vehicle control (n = 8 mice (4 males and 4 females) in the vehicle group and n = 7 mice (4 males and 3 females) in the Nb20-treated group). Emotionality scores were calculated based on superscoring of the four behavioral tests. Data are means ± SEM (nonparametric one-way ANOVA; Kruskal-Wallis test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Shaded bars (vehicle), open bars (Nb20).
[0038] [Figure 12] Figure 12 shows the effect of a control nanobody (Nb20*) in mice. Mutant Nb20* (9.6 μg), unable to bind to mGlyR, or vehicle was injected ICV into naive mice. Mice were evaluated in the elevated plus maze (EPM), marble burying (MB), tail suspension test (TST), and forced swim test (TST) paradigms (n = 18 mice (9 males and 9 females) in the vehicle-treated group and n = 36 mice (18 males and 18 females) in the Nb20*-treated group). Data are mean ± SEM (nonparametric one-way ANOVA; Kruskal-Wallis test, ns = p > 0.05). Shaded bars (vehicle), open bars (Nb20*).
[0039] [Figure 13]Figure 13 shows the effects of initial treatment with Nb20 or ketamine in mice. After CVS, mice were intranasally treated with ketamine (20 mg / mg), Nb20 (9.6 μg), or control Nb20* (9.6 μg). 24 hours after treatment, mice were assessed in the marble burying (MB), tail suspension test (TST), and forced swim test (TST) paradigms (n = 10 mice / group: 5 males and 5 females). Data are mean ± SEM (nonparametric one-way ANOVA; Kruskal-Wallis test, ns = p > 0.05, * p < 0.05). Shaded bars (Nb20*), open bars (Nb20), and crosshatched bars (ketamine).
[0040] [Figure 14] Figure 14 shows quantification of BDNF in mice treated with ketamine or Nb20. Prefrontal cortex tissue punches (2 mm) from mice treated twice with Nb20*, Nb20, or ketamine were analyzed for the presence of BDNF by ELISA (n = 10 mice / group: 5 males and 5 females). Data are mean ± SEM (nonparametric one-way ANOVA; Kruskal-Wallis test, **p < 0.01, ***p < 0.001). Hatched bars (Nb20*), open bars (Nb20), and crosshatched bars (ketamine).
[0041] [Figure 15]Figures 15A-15E show the effect of Nb20 on neuronal excitability. A) Schematic of electrophysiological recordings in slice preparations targeting layer II-III mPFC neurons in WT mice. Slices were incubated with ACSF (control), Nb20, or mutant Nb20* before recording. B) Representative traces of voltage responses to 200 pA current ramp injections under different conditions. C) Quantification of excitability changes by the number of action potentials fired in response to a 200 pA current ramp (n = 6-8 neurons from 3-6 mice). Nonparametric one-way ANOVA; Kruskal-Wallis test, **p < 0.01, *p < 0.05, and ns = p > 0.05. D) Quantification of excitability changes by rheobase current (n = 6-8 neurons from 3-6 mice). Nonparametric one-way ANOVA; Kruskal-Wallis test, **p<0.01, *p<0.05, and ns=p>0.05. E) Resting membrane potential of layer II-III pyramidal neurons in WT mice (n=6-8 neurons from 3-6 mice). One-way ANOVA; Kruskal-Wallis test, ns=p>0.05. In 15C, 15D, and 15E, hatched bars (control), open bars (Nb20), and crosshatched bars (Nb20*) are shown.
[0042] [Figure 16] Figure 16 shows the evaluation of a stress paradigm in vehicle-injected mice. Stressed, vehicle-injected, and non-stressed, vehicle-injected mice were evaluated in a panel of behavioral tests consisting of marble burying (MB), splash test (ST), tail suspension test (TST), and forced swim test (TST) (n=12 mice (6 males and 6 females) in both groups). Calculation of emotionality scores based on superscoring of the four behavioral tests. Data are mean ± SEM (unpaired t-test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).
[0043] [Figure 17-1]Figures 17A-17G show cryo-EM structures of mGlyR complexed with Nb20. A) Side-view cryo-EM map (left) and corresponding model (right) of the mGlyR-Nb20 homodimer, showing individual monomers. Phospholipids and cholesterol are indicated. B) As in (A), cryo-EM map (left) and corresponding model (right) of the Nb20-mGlyR-RGS7-Gβ5 homodimer, showing monomers. RGS7 and Gβ5 are indicated. C) Plan view of the Cache domain of mGlyR bound to Nb20. D) Detailed interaction network between Nb20 and the Cache domain. E) Side-view TM-based structural superposition of the mGlyR-apo and mGlyR-Nb20 structures. F) Plan view of the structural comparison of the Cache domain, rotated 90° relative to Figure 17E. G) Structural superposition of RGS bound to mGlyR-apo and RGS bound to Nb20-mGlyR. [Figure 17-2] Same as above. [Figure 17-3] Same as above.
[0044] [Figure 18] Figure 18 shows the workflow of cryo-EM data processing. Cryo-EM processing steps to obtain high-resolution maps of the human mGlyR-Nb20 complex and the Nb20-mGlyR-RGS7-Gβ5 complex.
[0045] [Figure 19-1]Figures 19A-19F show cryo-EM data processing of human mGlyR-Nb20 and Nb20-mGlyR-RGS7-Gβ5 complexes. A) Representative cryo-EM micrographs. Scale bars correspond to 100 nm. B) Representative 2D class averages for mGlyR-Nb20 and Nb20-mGlyR-RGS7-Gβ5 complexes. C) and D) Resolutions are reported for maps determined by gold standard Fourier shell correlation (FSC) curves (FSC cutoff value of 0.143 (horizontal line indicated by arrow) for the mGlyR-Nb20 complex (3.47 Å) and (D) the Nb20-mGlyR-RGS7-Gβ5 complex (3.89 Å). E) and F) Euler angle orientation distribution plots from CryoSPARC for the final maps of the mGlyR-Nb20 complex (D) and the Nb20-mGlyR-RGS7-Gβ5 complex. [Figure 19-2] Same as above. [Figure 19-3] Same as above.
[0046] [Figure 20] Figures 20A-20B show validation of Nb20 binding determinants by mutagenesis. A) The binding ability of Nb20* to mGlyR was monitored by flow cytometry. 1.106 cells transiently transfected to express mGlyR were incubated with 1 μM Nb20 or Nb20* or vehicle and anti-Myc APC-conjugated antibody, and binding was measured. A) Representative histogram of binding measurements. B) Quantification of anti-Myc-APC binding detected in flow cytometry experiments. Data represent mean ± SEM of n=3 independent experiments. ns=p>0.05, ****p<0.0001, one-way ANOVA.
[0047] [Figure 21-1]Figures 21A-21G show the cryo-EM structure of mGlyR bound to Nb20. A) Top view of the cryo-EM map showing Nb20 bound to mGlyR. B) Diagram of the putative ligand-binding pocket highlighting residues involved in ligand binding. C) Side view and 90° rotated view of the global structural superposition of mGlyR-Nb20 and mGlyR-apo. E) Comparison of the stalk domain between the mGlyR-Nb20 and mGlyR-apo structures using a global alignment. E) Structural changes in the 7TM region of mGlyR-apo compared to Nb20-mGlyR, viewed from the extracellular side. F) TM-tethered structural superposition of mGlyR-RGS7 / Gβ5 and Nb20-mGlyR-RGS7 / Gβ5. G) Bottom view of Gβ5 from the alignment in 21F. [Figure 21-2] Same as above.
[0048] [Figure 22-1]Figure 22 presents other exemplary FRET and BRET biosensors useful in screening assays for antibodies of the present invention (see Kim, H. et al, (2022) Front. Cell Dev. Biol. 10: 1007893). Column 1 indicates the detection step, column 2 indicates the target GPCR, column 3 indicates the ligand used, column 4 indicates the detection method, column 5 indicates the FRET or BRET pair, column 6 indicates the cell line used, column 7 indicates annotations, and column 8 indicates references. GltI, glutamate / aspartate import solute-binding protein; α2AAR, α2A adrenergic receptor; β1AR, β1 adrenergic receptor; β2AR, β2 adrenergic receptor; A2AR, A2A adenosine receptor; B1R, B1-bradykinin receptor; B2R, B2-bradykinin receptor; H1R, histamine H1 receptor; mAChR, muscarinic acetylcholine receptor; PTH1R, parathyroid hormone 1 receptor; AT1R, angiotensin II Type 1 receptor; V1AR, vasopressin receptor 1A; A1AR, A1A adenosine receptor; GLP-1R, glucagon-like peptide-1 receptor; V2R, vasopressin receptor 2; 5HT2A, serotonin receptor 2A; DRD2, dopamine receptor 2; mGluR1, metabotropic glutamate receptor 1; PTH, parathyroid hormone; AVP, arginine vasopressin; GLP-1, glucagon-like peptide 1; DOI, 2,5-dimethoxy-4-iodoamphetamine. BERKY: BRET-based biosensor using an ER / K linker and YFP; Mini-G: an engineered G alpha protein containing only the sequences essential for coupling to GPCRs. [Figure 22-2] Same as above. DETAILED DESCRIPTION OF THE INVENTION
[0049] A brief description of arrays SEQ ID NO: 1 shows the amino acid sequence of human GPR158.
[0050] SEQ ID NO: 2 shows the amino acid sequence of llama nanobody Nb20.
[0051] SEQ ID NO: 3 shows the amino acid sequence of llama nanobody Nb20 IMGT CDR-H1.
[0052] SEQ ID NO: 4 shows the amino acid sequence of llama nanobody Nb20 IMGT CDR-H2.
[0053] SEQ ID NO: 5 shows the amino acid sequence of llama nanobody Nb20 IMGT CDR-H3.
[0054] SEQ ID NO: 6 shows the nucleotide sequence of the forward primer VH_11.
[0055] SEQ ID NO: 7 shows the nucleotide sequence of the forward primer VH_12.
[0056] SEQ ID NO: 8 shows the nucleotide sequence of the forward primer VH_14.
[0057] SEQ ID NO: 9 shows the nucleotide sequence of the forward primer VH_13.
[0058] SEQ ID NO: 10 shows the nucleotide sequence of the reverse primer VH_sh.
[0059] SEQ ID NO: 11 shows the nucleotide sequence of the reverse primer VH_lg.
[0060] SEQ ID NO: 12 shows the amino acid sequence of the GPR158 ectodomain.
[0061] SEQ ID NO: 13 is Nb20 * The amino acid sequences of the nanobodies are shown.
[0062] SEQ ID NO: 14 is Nb * The amino acid sequence of 20 IMGT CDR-H1 is shown.
[0063] SEQ ID NO: 15 is Nb * The amino acid sequence of 20 IMGT CDR-H2 is shown.
[0064] SEQ ID NO: 16 shows the nucleotide sequence of the CDR1 mutant forward primer.
[0065] SEQ ID NO: 17 shows the nucleotide sequence of the CDR1 mutant reverse primer.
[0066] SEQ ID NO: 18 shows the nucleotide sequence of the CDR2 mutant forward primer.
[0067] SEQ ID NO: 19 shows the nucleotide sequence of the CDR2 mutant reverse primer.
[0068] SEQ ID NO: 20 shows the amino acid sequence from residues 30 to 35 of the Nb20 nanobody of SEQ ID NO: 2.
[0069] SEQ ID NO: 21 is Nb20 of SEQ ID NO: 13 * The amino acid sequence from residues 30 to 35 of the sequence is shown.
[0070] SEQ ID NO: 22 shows the amino acid sequence from residues 54 to 62 of the Nb20 nanobody of SEQ ID NO: 2.
[0071] SEQ ID NO: 23 is Nb20 of SEQ ID NO: 13 * The amino acid sequence from residues 54 to 62 of the sequence is shown. definition
[0072] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as these may vary. It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the terms "an antibody" or "at least one antibody" can encompass multiple antibodies, including mixtures thereof. The conjunction "or" should be construed in an inclusive sense, i.e., equivalent to "and / or," unless the context dictates otherwise.
[0073] In general, the term "about" refers to slight variations in the quantity of a component of a composition that do not have any significant effect on the activity or stability of the composition. When a specific value for a parameter is disclosed herein, it should be understood that the parameter is instead disclosed as "about" that value. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. Unless otherwise clear from the context, the term "about" encompasses slight variations, e.g., values that fall within the standard error limits of measurement (e.g., SEM) for the stated value. Statistical significance means p≦0.05.
[0074] It is to be understood that both the foregoing general and detailed descriptions are exemplary and explanatory only and are not restrictive of the present teachings. To the extent that any material incorporated by reference contradicts the express content of this disclosure, the express content shall control.
[0075] Unless otherwise indicated, in embodiments herein described as "comprising" various components, "consisting of" or "consisting essentially of" the described components is also contemplated. In embodiments herein described as "consisting essentially of" various components, "consisting of" is also contemplated. "Consisting essentially of" means that additional components, compositions, or method steps that do not materially alter the basic and novel characteristics of the compositions and methods described herein may be included in those compositions or methods.
[0076] The designation of a range of values includes all integers within or defining that range, and all subranges defined by integers within that range. Absent an explicit exclusion, such as "excluding the endpoints," all ranges should be interpreted as inclusive of the endpoints. Thus, for example, "within 10 and 15" includes the values 10 and 15. It will be understood by those of skill in the art that the stated range includes the endpoints, positive integers between the endpoints, and rational numbers within the range, where possible (e.g., the range 5 to 10 includes 5, 6, 7, 8, 9, and 10, as well as values such as 6.8 and 9.35, where possible). When values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms a further aspect. For example, if the value "about 10" is disclosed, then "10" is also disclosed.
[0077] An "active ingredient" is any component of a drug product intended to provide pharmacological activity or other direct effect in the diagnosis, cure, mitigation, treatment, or prevention of disease, or to affect the structure or any function of the human or other animal body. Active ingredients include product components that may undergo chemical changes during the manufacture of the drug product and may be present in the drug product in a modified form intended to provide a specific activity or effect. Pharmaceutical dosage forms contain an active pharmaceutical ingredient, which is itself a drug substance, and excipients, which are components of tablets, or liquids in which the active agent is suspended, or other pharmaceutically inactive materials. During formulation development, excipients can be selected to enable the active ingredient to reach the target site in the body at the desired rate and extent.
[0078] A "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount (dosage) of a described active pharmaceutical ingredient or pharmaceutical composition to produce the intended pharmacological, therapeutic, or preventative result. An "effective amount" can also refer to the amount of, for example, an excipient in a pharmaceutical composition sufficient to achieve the desired properties of the composition. An effective amount can be administered as one or more administrations, applications, or dosages.
[0079] As used herein, a "dose," "unit dose," or "dosage" may refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of an active pharmaceutical ingredient and / or pharmaceutical composition thereof calculated to produce a desired response upon its administration.
[0080] The terms "treat," "treatment," and the like refer to methods or steps taken to bring about a reduction or alleviation of the number, severity, and / or frequency of occurrence of one or more symptoms of a disease or condition in a subject. Treatment generally refers to obtaining a desired pharmacological and / or physiological effect. The effect may be, but is not necessarily, prophylactic, in that it prevents or partially prevents a disease, symptom, or condition. The effect may be therapeutic, in that it partially or completely cures a disease, condition, symptom, or adverse effects attributable to a disease, disorder, or condition. The term treatment can encompass (a) preventing a disease from occurring in a subject who may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting a disease, i.e., halting its development; and (c) relieving a disease, i.e., alleviating or ameliorating a disease and / or its symptoms or condition. Treatment can refer to therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those who already have a disease or condition or those in whom a disease or condition should be prevented. Treatment can include inhibiting a disease, disorder, or condition, e.g., preventing its progression; and alleviating a disease, disorder, or condition, e.g., causing regression of a disease, disorder, and / or condition. Treating a disease, disorder, or condition can include ameliorating at least one symptom of a particular disease, disorder, or condition without affecting the underlying pathophysiology, e.g., treating a symptom without affecting or eliminating the underlying cause of the symptom. The terms "treatment," "therapeutic method," and their cognates refer to treatment and prophylactic / preventative measures. Those in need of treatment can include individuals who already have a particular medical disorder as well as individuals who may eventually develop a disorder. The need for treatment is assessed, for example, by the presence of one or more risk factors associated with the development of a disorder, the existence or progression of a disorder, or the likelihood that a subject with a disorder will be amenable to treatment. Treatment can involve slowing or reversing the progression of the disorder.
[0081] Examples of diseases, disorders, or conditions related to affective disorders, mood disorders, or brain disorders are depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, and anxiety disorder. Examples of affective disorders, mood disorders, or brain disorders are depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, and anxiety disorder. "GPR158-related diseases" include affective disorders, mood disorders, or brain disorders, as well as affective disorders, mood disorders, or brain disorders related to depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, and anxiety disorder. Examples of "GPR158-related disorders" are affective disorders, mood disorders, brain disorders, depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, and anxiety disorders.
[0082] The term "disease" refers to any abnormal condition that impairs physiological function. The term is used broadly to encompass any disorder, disease, abnormality, pathological deviation, pathological state, condition, or syndrome in which physiological function is impaired, regardless of the nature of the etiology.
[0083] The term "individual" or "subject" refers to any mammal, including any animal classified as such, including humans, non-human primates, primates, baboons, chimpanzees, monkeys, cynomolgus monkeys, marmosets, rhesus monkeys, llamas, alpacas, camels, rodents (e.g., mice, rats), rabbits, cats, dogs, horses, cows, sheep, goats, pigs, ferrets, guinea pigs, hamsters, gerbils, etc.
[0084] "Orthologs" are genes and their products in different species that have evolved from a common ancestral gene by speciation and retain the same or similar functions. Orthologs are genes that are related by vertical descent and perform substantially the same or identical functions in different organisms. For example, mouse GPR158 and human GPR158 can be considered orthologs. Genes can share a sufficient amount of sequence similarity to indicate that they are orthologs. Proteins can share a sufficient amount of three-dimensional structure to indicate that the protein and the gene that encodes it are orthologs. Methods for identifying orthologs are known in the art.
[0085] Monoclonal antibodies or other biological entities are typically provided in isolated form. This means that the antibody or other biological entity is typically at least 50% w / w pure with respect to interfering proteins and other contaminants arising from its production or purification, although the possibility of combining the monoclonal antibody with an excess of a pharmaceutically acceptable carrier or other vehicle intended to facilitate its use is not excluded. Sometimes, the monoclonal antibody is at least 60%, 70%, 80%, 90%, 95%, or 99% w / w pure with respect to interfering proteins and contaminants arising from its production or purification. In many cases, the isolated monoclonal antibody or other biological entity is the predominant macromolecular species remaining after purification.
[0086] Specific binding of an antibody to its target antigen is defined as an affinity and / or avidity of at least 10 6 M -1 , 10 7 M -1 , 10 8 M -1 , 10 9 M -1 , 10 10 M -1 , 10 11 M -1 , or 10 12 M -1Specific binding means that the strength of the specific binding is detectably greater than and distinguishable from nonspecific binding that occurs to at least one unrelated target. Specific binding can be the result of the formation of bonds between specific functional groups or the formation of a specific spatial fit (e.g., a lock-and-key structure), while nonspecific binding is usually the result of van der Waals forces. However, specific binding does not necessarily mean that an antibody binds to one and only one target.
[0087] The basic antibody structural unit is a tetramer of subunits. Each tetramer contains two identical pairs of polypeptide chains, each pair having one "light" chain (approximately 25 kDa) and one "heavy" chain (approximately 50-70 kDa). The amino-terminal portion of each chain contains a variable region of approximately 100-110 or more amino acids primarily responsible for antigen recognition. This variable region is initially expressed linked to a cleavable signal peptide. The variable region without the signal peptide is sometimes referred to as the mature variable region. Thus, for example, the mature light chain variable region refers to the light chain variable region without the light chain signal peptide. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
[0088] Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which define the antibody's isotype as IgG, IgM, IgA, IgD, and IgE, respectively. Within light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 or more amino acids. See generally Fundamental Immunology, Paul, W., ed., 2nd ed. Raven Press, NY, 1989, Ch. 7 (incorporated by reference in its entirety for all purposes).
[0089] An immunoglobulin light or heavy chain variable region (also referred to herein as a "light chain variable domain" ("VL domain") or "heavy chain variable domain" ("VH domain"), respectively) consists of a "framework" region interrupted by three "complementarity-determining regions" or "CDRs." The framework regions function to align the CDRs for specific binding to an epitope of an antigen. The CDRs contain the amino acid residues primarily responsible for binding of the antibody to the antigen. From the amino terminus to the carboxyl terminus, both VL domains and VH domains contain the following framework (FR) and CDR regions: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The CDR1, CDR2, and CDR3 of the VL domain are also referred to herein as CDR-L1, CDR-L2, and CDR-L3, respectively, and the CDR1, CDR2, and CDR3 of the VH domain are also referred to herein as CDR-H1, CDR-H2, and CDR-H3, respectively. In the present application, when a VL sequence having R as the C-terminal residue is disclosed, R can alternatively be considered to be the N-terminal residue of the light chain constant region. Therefore, it should be understood that the present application also discloses a VL sequence without a C-terminal R.
[0090] The assignment of amino acids to each VL and VH domain follows any conventional definition of a CDR. Conventional definitions include the Kabat definition (Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1987 and 1991)), the Chothia definition (Chothia & Lesk, J. Mol. Biol. 196:901-917, 1987; Chothia et al., Nature 342:878-883, 1989); the Chothia-Kabat CDR combination, in which CDR-H1 is a combination of the Chothia CDR and the Kabat CDR; the AbM definition used by Oxford Molecular's antibody modeling software; and the contact definition by Martin et al. (bioinfo.org.uk / abs) and the IMGT definition (imgt.org / IMGTScientificChart / Numbering / IMGTnumberingCDR_VK.html; Ehrenmann F., Kaas Q., and Lefranc M.-P. Nucleic Acids Res., 38:D301-D307 (2010) and Ehrenmann F., Kaas Q. and Lefranc M.-P. Nucleic Acids Res., 38:D301-D307 (2010) (see Table 1). Kabat provides a widely used numbering convention (Kabat numbering) in which the same numbers are assigned to corresponding residues between different heavy chains or different light chains. When an antibody is said to contain a CDR according to a particular definition of a CDR (e.g., Kabat), that definition specifies the minimum number of CDR residues present in the antibody (i.e., Kabat CDRs). It is not excluded that other residues may also exist that fall within the scope of other conventional CDR definitions but are outside the scope of the particular definition.For example, antibodies containing CDRs defined by Kabat include, among other possibilities, antibodies in which the CDRs contain Kabat CDR residues and no other CDR residues, and antibodies in which the CDR H1 is a composite of Chothia-Kabat CDR H1 and the other CDRs contain Kabat CDR residues and no additional CDR residues based on other definitions.
[0091] Table 1: Traditional definitions of CDRs using Kabat numbering [Table 1] *CDR-H1 from Chothia may end at H32, H33, or H34 (depending on the length of the loop). This is due to the insertion of additional residues at 35A and 35B in the Kabat numbering scheme, whereas Chothia numbering inserts those additional residues at 31A and 31B. If neither H35A nor H35B (Kabat numbering) are present, the Chothia CDR-H1 loop ends at H32. If only H35A is present, the Chothia CDR-H1 loop ends at H33. If both H35A and H35B are present, the Chothia CDR-H1 loop ends at H34.
[0092] The term "antibody" encompasses intact antibodies and binding fragments thereof. Typically, fragments, including separate heavy and light chains, Fab, Fab', F(ab')2, F(ab)c, Dab, nanobody, and Fv, compete with the intact antibody from which they are derived for specific binding to a target. Fragments can be produced by recombinant DNA techniques or by enzymatic or chemical separation of intact immunoglobulins. Antibodies of the present invention also encompass single domain antigen-binding units having a camelid scaffold. Animals in the camelid family include camels, llamas, and alpacas. Camelids produce functional antibodies (IgG2 and IgG3) that lack light chains. Heavy chain variable (V) H) domains fold autonomously and function independently as antigen-binding units. Their binding surface contains only three CDRs, compared to the six CDRs of classical antigen-binding molecules (Fab) or single-chain variable fragments (scFv). Camelid antibodies are capable of achieving binding affinities comparable to those of conventional antibodies. The term "VHH antibody" or "nanobody" refers to a single variable domain of a heavy-chain antibody. A VHH antibody or nanobody is an antigen-binding fragment of a heavy-chain-only antibody.
[0093] The term "antibody" also encompasses bispecific and / or humanized antibodies. Bispecific or bifunctional antibodies are artificial hybrid antibodies with two different binding sites (see, for example, Songsivilai and Lachmann, Clin. Exp. Immunol., 79:315-321 (1990); Kostelny et al., J. Immunol., 148:1547-53 (1992)). Some bispecific or bifunctional antibodies have two different heavy / light chain pairs and two different binding sites. Some bispecific or bifunctional antibodies contain a nanobody binding site and an antibody heavy / light chain binding site. In some bispecific antibodies, one binding site contains a humanized Nb20 mature heavy chain variable region.
[0094] In some bispecific antibodies, one binding site comprises the humanized Nb20 mature heavy chain variable region, further disclosed below, and a heavy chain / light chain pair derived from an antibody that binds to a receptor expressed at the blood-brain barrier, such as the insulin receptor, insulin-like growth factor (IGF) receptor, leptin receptor, or lipoprotein receptor, or transferrin receptor (Friden et al., Proc. Natl. Acad. Sci. USA 88:4771-4775, 1991; Friden et al., Science 259:373-377, 1993). Such bispecific antibodies can cross the blood-brain barrier by receptor-mediated transcytosis. Brain uptake of bispecific antibodies can be further enhanced by engineering the bispecific antibody to reduce its affinity for blood-brain barrier receptors. The reduced affinity for the receptor resulted in a more widespread distribution in the brain (see, e.g., Atwal et al., Sci. Trans. Med. 3, 84ra43, 2011; Yu et al., Sci. Trans. Med. 3, 84ra44, 2011).
[0095] Bispecific antibodies also include: (1) dual variable domain antibodies (DVD-Ig), in which each light and heavy chain contains two variable domains connected in tandem by a short peptide linkage (Wu et al., Generation and Characterization of a Dual Variable Domain Immunoglobulin (DVD-Ig) TM) Molecule, In: Antibody Engineering, Springer Berlin Heidelberg (2010)); (2) Tandabs, which fuse two single-chain diabodies to generate tetravalent bispecific antibodies with two binding sites, each for a target antigen; (3) Flexibodies, which combine scFvs with diabodies to generate multivalent molecules; (4) so-called "dock-and-lock" molecules based on the "dimerization and docking domain" of protein kinase A, which, when applied to Fabs, can result in trivalent bispecific binding proteins consisting of two identical Fab fragments linked to different Fab fragments; or (5) so-called Scorpion molecules, which contain, for example, two scFvs fused to both ends of a human Fc region. Examples of useful platforms for preparing bispecific antibodies include BiTE (Micromet), DART (MacroGenics), Fcab and Mab2 (F-star), Fc-engineered IgG1 (Xencor) or DuoBody (based on Fab arm exchange, Genmab).
[0096] The term "epitope" refers to the site on an antigen to which an antibody binds. Epitopes can be formed from contiguous or noncontiguous amino acids arranged by tertiary folding of one or more proteins. Epitopes formed from contiguous amino acids (also known as linear epitopes) typically are retained upon exposure to denaturing solvents, whereas epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost upon treatment with denaturing solvents. Epitopes typically contain at least three amino acids, more commonly at least five or eight to ten amino acids, in a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, x-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols," in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996).
[0097] Antibodies that recognize the same or overlapping epitopes can be identified in a simple immunoassay that shows the ability of one antibody to compete with the binding of another antibody to a target antigen. Antibody epitopes can also be defined by X-ray crystallography or cryo-electron microscopy (cryo-EM) of an antibody bound to an antigen to identify contact residues. Alternatively, two antibodies have the same epitope if all of the amino acid mutations in the antigen that reduce or eliminate binding of one antibody also reduce or eliminate binding of the other antibody. Two antibodies have overlapping epitopes if some of the amino acid mutations that reduce or eliminate binding of one antibody also reduce or eliminate binding of the other antibody.
[0098] Competition between antibodies is determined by an assay in which the antibody under test inhibits the specific binding of a reference antibody to a common antigen (see, e.g., Junghans et al., Cancer Res. 50:1495, 1990). A test antibody competes with a reference antibody if the binding of the reference antibody is inhibited by at least 50% by an excess amount of the test antibody (e.g., at least 2-fold, 5-fold, 10-fold, 20-fold, or 100-fold), as measured in a competitive binding assay. Some test antibodies inhibit the binding of the reference antibody by at least 75%, 90%, or 99%. Antibodies identified by competitive assays (competing antibodies) include antibodies that bind to the same epitope as the reference antibody and antibodies that bind to adjacent epitopes that are sufficiently close to the epitope bound by the reference antibody to create steric hindrance.
[0099] The term "pharmaceutically acceptable" means the carrier, diluent, excipient or adjuvant must be compatible with the other ingredients of the formulation and not substantially deleterious to the recipient thereof.
[0100] The term "patient" includes human and other mammalian subjects receiving either prophylactic or therapeutic treatment.
[0101] An individual is at high risk for a disease if the subject has at least one known risk factor (e.g., genetic, biochemical, family history, and situational exposure) that places the individual with the risk factor at a statistically significantly higher risk of developing the disease than individuals without the risk factor.
[0102] The term "biological sample" refers to a sample of biological material within or obtainable from a biological source, such as a human or mammalian subject. Such samples can be organs, organelles, tissues, tissue sections, body fluids, peripheral blood, plasma, serum, cells, molecules such as proteins and peptides, and any portion or combination thereof. The term biological sample also encompasses any material removed by processing the sample. The removed material can include cells or their progeny. Processing of a biological sample can include one or more of filtration, distillation, extraction, concentration, fixation, inactivation of interfering components, and the like. Some biological samples are derived from the brain. Some biological samples are brain slices.
[0103] The term "control sample" refers to a biological sample that is not known or suspected to contain tissue affected by a GPR158-related disease, or at least not known or suspected to contain a given type of diseased tissue. A control sample can be obtained from an individual not suffering from a GPR158-related disease, for example, an individual not suffering from an affective disorder, mood disorder, or brain disorder. Alternatively, a control sample can be obtained from a patient suffering from a GPR158-related disease, for example, a patient suffering from an affective disorder, mood disorder, or brain disorder. Such a sample may be obtained at the same time as the biological sample suspected to contain diseased tissue, or may be obtained on a different occasion. Both the biological sample and the control sample may be obtained from the same tissue. Preferably, the control sample consists essentially or entirely of normal healthy tissue and can be used to compare with the biological sample suspected to contain diseased tissue. The tissue in the control sample is preferably of the same type as the tissue in the biological sample. Preferably, the diseased cells suspected to be present in the biological sample originate from the same cell type as the cells in the control sample.
[0104] The term "disease" refers to any abnormal condition that impairs physiological function. The term is used broadly to encompass any disorder, disease, abnormality, pathological deviation, pathological state, condition, or syndrome in which physiological function is impaired, regardless of the nature of the etiology.
[0105] The term "symptom" refers to subjective evidence of disease perceived by a subject. "Sign" refers to objective evidence of disease observed by a physician.
[0106] For the purpose of classifying amino acid substitutions as conservative or non-conservative, amino acids are divided into the following groups: Group I (hydrophobic side chains): met, ala, val, leu, ile; Group II (neutral hydrophilic side chains): cys, ser, thr; Group III (acidic side chains): asp, glu; Group IV (basic side chains): asn, gln, his, lys, arg; Group V (residues that influence chain directionality): gly, pro; and Group VI (aromatic side chains): trp, tyr, phe. Conservative substitutions involve substitutions between amino acids of the same class. Non-conservative substitutions constitute the exchange of a member of one of these classes for another.
[0107] Percentage sequence identity is determined using maximally aligned antibody sequences according to the Kabat numbering convention. After alignment, when a subject antibody region (e.g., the entire mature variable region of a heavy or light chain) is compared to the same region of a reference antibody, the percentage sequence identity between the subject and reference antibody regions is the number of positions occupied by the same amino acid in both the subject and reference antibody regions, not counting gaps, divided by the total number of aligned positions in the two regions, multiplied by 100, and converted to a percentage.
[0108] A composition or method "comprising" or "including" one or more recited elements may include other elements not specifically recited. For example, a composition "comprises" or "includes" an antibody may contain the antibody alone or in combination with other components. When this disclosure refers to a feature comprising a particular element, it should be understood that the disclosure instead refers to a feature consisting essentially of or consisting of that particular element. Furthermore, elements shown or described in combination with other elements may, in various embodiments, exist as stand-alone elements.
[0109] Detailed Description I. General
[0110] The present invention provides an antibody that binds to human GPR158 (mGlyR). Although understanding the mechanism is not necessary to practice the present invention, inhibition of the GAP activity of GPR158 via RGS7 / Gβ5 by the antibody can result in a reduction of affective, mood, or brain disorders. The antibody of the present invention or an agent that induces such an antibody can be used in a method for treating or preventing affective, mood, or brain disorders in a subject. An exemplary antibody is llama Nanobody-20 (Nb20).
[0111] In this study, we explored the therapeutic implications of targeting mGlyRs as an antidepressant treatment. We developed a specific nanobody (Nb20) that targets the ligand-binding Cache domain of mGlyRs, mimicking the effects of glycine. Through a series of studies, we show that Nb20 alters mGlyR function and its influence on neural circuits, thereby producing potent antidepressant effects when delivered noninvasively in a mouse model.
[0112] To identify ligands capable of modulating GPR158, we screened a library of llama-derived single-chain antibody fragments (nanobodies) for specific binding to GPR158. Nanobodies are small fragments of 13-15 kDa corresponding to the variable domain of the heavy chain that recognizes the antigen. Nanobodies share affinity and specificity characteristics with whole immunoglobulins but are less immunogenic, easier to generate, can be produced in prokaryotic systems, and can be administered by a variety of routes.
[0113] First, llamas were immunized with cell membranes expressing GPR158, and then a phage library was generated, also obtained from INSERM. The library was screened to identify nanobodies that bind to GPR158 (Figure 1). After three rounds of amplification, 55 clones were further screened by flow cytometry to identify Nb20, which specifically binds to GPR158 with high affinity in intact cells. Nb20 was sequenced, and unique amino acids corresponding to the CDR regions were identified using the IMGT definition (Figure 2). The identified Nb20 was tagged at the N- and C-termini with His8 and Myc tags, respectively, and affinity-purified to homogeneity. The resulting purified recombinant Nb20 protein was characterized by flow cytometry for binding to full-length GPR158 expressed in HEK293 cells, yielding an affinity of approximately 10 nM in a concentration titration assay (Figure 3A). The purified extracellular domain (ectodomain) of GPR158 was used to further characterize the binding of Nb20 using surface plasmon resonance (SPR), which yielded a Kd of approximately 375 nM (Figure 3B).
[0114] To characterize the pharmacological activity of Nb20, we used a BRET-based GAP assay. GPR158 was coexpressed with RGS7 / Gβ5, a signaling complex of GPR158 known to facilitate the termination of Gαo signaling (Figure 4A). We found that application of Nb20 inhibited the RGS7 / Gβ5-mediated GAP activity of GPR158 (Figure 4B). Nb20 was found to inhibit the RGS7 / Gβ5-mediated GAP activity of GPR158 with an IC50 of at least 5.77 nM (N=3). These results indicate that Nb20 antagonizes GPR158 action and, therefore, is expected to exert antidepressant effects, given that loss of GPR158 activity protects mice from stress-induced depression.
[0115] The amino acid sequence of llama nanobody Nb20 is presented in SEQ ID NO: 2. The variable region CDRs according to the IMGT definition are underlined. [ka] Nb20 IMGT CDR-H1 sequence: GSIGNIYI (SEQ ID NO: 3) Nb20 IMGT CDR-H2 sequence: IRTVRWTKYE (SEQ ID NO: 4) Nb20 IMGT CDR-H3 sequence: NYKDYNAPSDGY (SEQ ID NO: 5) (0095) Embodiments of the present invention are presented in the examples.
[0116] Developing treatments for neuropsychiatric conditions is one of the greatest challenges in modern medicine. Common limitations of traditional small molecule drugs include poor efficacy, off-target side effects, and the difficulty of drug discovery against many targets. In this study, we report a fundamentally different approach: deploying small, engineered single-domain antibodies known as nanobodies to treat depression, a widespread neuropsychiatric condition. We developed a highly selective nanobody against a novel target, the newly discovered glycine receptor mGlyR, which is linked to the pathophysiology of depression. Using a mouse model of stress-induced depression, we show that noninvasive intranasal delivery of the nanobody results in rapid and sustained antidepressant effects. We elucidated the atomic structure of the nanobody-bound mGlyR and used various cell-based approaches to uncover the mechanism of mGlyR modulation and its impact on neuronal circuits. The antibodies of the invention or agents that induce such antibodies can be used in methods to treat or effect prevention of affective disorders, mood disorders, or brain disorders in a subject.
[0117] In this study, we report a unique immunotherapeutic solution for a major neuropsychiatric condition—depressive disorder. Immunotherapy offers high specificity, low off-target toxicity, and remarkable efficacy, making it the method of choice for the treatment of cancer and autoimmune disorders (56-57). Immunotherapy is also increasingly being applied to brain conditions, most successfully in the management of neurodegenerative conditions (58). Several recent studies have also demonstrated the potential utility of immunotherapy for managing neuropsychiatric conditions (59-62). In this study, we are the first to apply an immunotherapeutic strategy to effectively suppress depression-related behaviors in mice, thereby revealing a new direction for therapeutic intervention in this serious health crisis.
[0118] Key to our approach was the development of single-chain antibodies, known as nanobodies, against the newly discovered metabotropic receptor for glycine, mGlyR, a novel target for antidepressant drug development (48). Genetic knockout of mGlyR in mice resulted in a pronounced antidepressant phenotype and resilience to stress-induced depression (29). Molecularly, mGlyR acts noncanonically to transmit its signal by associating with the RGS7 / Gβ5 complex rather than with typical G proteins. Glycine acts as a suppressor of mGlyR signaling, thereby alleviating the inhibitory influence imposed on G proteins by RGS7 / Gβ5, thus disinhibiting the G protein and allowing signal propagation (48). Consistent with the inhibitory effect of glycine on mGlyR and the antidepressant properties of mGlyR knockout, we found that nanobody Nb20 also inhibited mGlyR and produced antidepressant effects. Detailed structural and mechanistic studies indicate that Nb20 interacts with the ligand-binding Cache domain of mGlyR and inhibits the GAP activity of RGS7 / Gβ5 toward its substrate Gαo. Thus, Nb20 likely functions as a synthetic mGlyR-specific antagonist, exploiting the mechanism of mGlyR antagonism by its endogenous ligand, glycine. Engineering novel targets also offers new modalities in the fight to overcome treatment-resistant depression, thereby expanding the limited set of options currently available.
[0119] In recent years, nanobodies have been widely used as reagents for studying and manipulating GPCRs in the nervous system (63-66). Nanobodies exhibit several key advantages that make them powerful tools, including exceptional target selectivity, the ability to recognize distinct conformational states, stability, and a relatively small size that facilitates target access (67). As a result, nanobodies are increasingly being adapted for therapeutic applications against brain disorders (62, 68). The promising potential for nanobodies' therapeutic utility is supported by multiple reports that nanobodies can efficiently reach their targets in the central nervous system. This is likely enabled by several mechanisms, including active and passive transport of nanobodies across the blood-brain barrier, transcytosis, and carrier-assisted delivery (69-72). We have shown that Nb20, which targets mGlyRs, exhibits in vivo antidepressant efficacy when administered intranasally to mice. These findings are similar to previous reports of effective intranasal nanobody delivery (73-74) and suggest that nanobodies are readily taken up by olfactory neurons. Furthermore, nanobody delivery may be further enhanced in depression-related conditions known to disrupt the blood-brain barrier (75). Overall, multiple studies support the efficacy of noninvasive nanobody-based therapy for brain disorders and demonstrate its potential application for the treatment of depression. II.Target molecule
[0120] GPR158, previously known as an orphan GPCR, is also known as mGlyR. An exemplary amino acid sequence of human GPR158 (UniProt Q5T848) is presented in SEQ ID NO: 1, with the 23-amino acid signal peptide shown in bold. GPR158 contains a cleavable signal peptide (residues 1-23), an extracellular domain (residues 24-417), a transmembrane domain (residues 418-664), and a cytoplasmic domain (residues 665-1215), numbered relative to SEQ ID NO: 1. The extracellular domain contains an extracellular cache domain (residues 119-310 of SEQ ID NO: 1). GPR158 forms homodimers. GPR158 homodimers have been reported to interact with RGS7-Gβ5 heterodimers (32, 33). GPR158 residue numbering is relative to SEQ ID NO: 1. [ka]
[0121] Unless the context makes clear otherwise, reference to GPR158 refers to the naturally occurring human form of GPR158, including all isoforms, regardless of the presence or absence of post-translational modifications (e.g., phosphorylation, glycosylation, or acetylation), including soluble forms. Reference to GPR158 encompasses known naturally occurring variations and assortments thereof listed in the Swiss-Prot database, as well as mutations associated with pathological deviations.
[0122] Furthermore, reference to GPR158 includes GPR158 with known post-translational modifications. Examples of known post-translational modifications are listed in the UniProtKB / Swiss-Prot database. Unless otherwise clear from the context, reference to GPR158 or a fragment thereof includes the native human amino acid sequence, including its isoforms, mutants, and allelic variants. III. Antibodies A. Binding Specificity and Functional Properties
[0123] The present invention provides antibodies that bind to GPR158. These antibodies can be obtained by immunization with GPR158 polypeptide purified from natural sources or recombinantly expressed. Antibodies can be screened for binding to GPR158. Nb20 is an example of a monoclonal antibody that binds to human GPR158. The present invention also provides antibodies that bind to the same epitope as any of the aforementioned antibodies, for example, the epitope of Nb20. Antibodies that compete with any of the aforementioned antibodies for binding to GPR158, for example, antibodies that compete with Nb20, are also encompassed.
[0124] The antibodies can be generated de novo by immunization with full-length GPR158 polypeptides or peptide fragments thereof, or by using cell membranes expressing human GPR158 or peptide fragments thereof. In some embodiments, the peptide is attached to a heterologous conjugate molecule that helps raise an antibody response against the peptide. Attachment can be direct or via a spacer peptide or amino acid. Cysteine is used as a spacer amino acid because its free sulfhydryl group facilitates attachment of the carrier molecule. Polyglycine linkers (e.g., 2-6 glycines) with or without a cysteine residue between the glycine and the peptide can also be used. The carrier molecule serves to provide a T cell epitope that helps raise an antibody response against the peptide. Several carriers are commonly used, particularly keyhole limpet hemocyanin (KLH), ovalbumin, and bovine serum albumin (BSA). A peptide spacer can be added to a peptide immunogen as part of solid-phase peptide synthesis. The carrier is typically attached by chemical cross-linking. Some examples of chemical cross-linkers that can be used include cross-linked N-maleimido-6-aminocaproyl ester or m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) (see, e.g., Harlow, E. et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1988; Sinigaglia et al., Nature, 336:778-780 (1988); Chicz et al., J. Exp. Med., 178:27-47 (1993); Hammer et al., Cell 74:197-203 (1993); Falk K. et al., Immunogenetics, 39:230-242 (1994); WO98 / 23635; and Southwood et al. J. Immunology, 160:3363-3373). (1998)).The carrier and spacer, if present, may be attached to either end of the immunogen.
[0125] The peptides, with optional spacers and carriers, can be used to immunize laboratory animals or B cells, as described in more detail below. Hybridoma supernatants can be tested for their ability to bind to GPR158 or its peptide fragments. A carrier or other tag can be attached to the peptide to facilitate screening assays. In this case, the carrier or tag is preferentially different from the spacer and carrier molecule combination used for immunization to eliminate antibodies specific for the spacer or carrier rather than the GPR158 peptide. Any GPR158 isoform can be used. Cell membranes or cells expressing human GPR158 or its fragments can be used for binding studies.
[0126] The present invention provides monoclonal antibodies that bind to an epitope within GPR158. The antibody designated Nb20 is one such exemplary llama antibody. Unless otherwise clear from the context, reference to Nb20 should be understood to refer to any of the llama, chimeric, veneered, and humanized forms of this antibody. This antibody is further characterized by its ability to bind to full-length GPR158 expressed in HEK293 cells with an affinity of at least 10 nM by flow cytometry, its ability to bind to the purified extracellular domain (ectodomain) of GPR158 with a Kd of at least 375 nM using surface plasmon resonance (SPR), and its ability to inhibit the RGS7 / Gβ5-mediated GAP activity of GPR158 with an IC50 of at least 5.77 nM.
[0127] Some antibodies of the present invention bind to the same or overlapping epitope as an antibody designated Nb20. The sequence of the mature heavy chain variable region of this antibody is set forth in SEQ ID NO:2. Other antibodies with such binding specificity can be produced by immunizing mice with GPR158 or a portion thereof containing the desired epitope and, if necessary, screening the resulting antibodies for binding to GPR158 in competition with an antibody containing the heavy chain variable region of llama Nb20. A fragment of GPR158 containing the desired epitope can be linked to a carrier and / or combined with an adjuvant that helps elicit an antibody response against the fragment. Such antibodies can be screened for differential binding to GPR158 or its fragments compared to mutants of specific residues. Screening of such mutants allows for more precisely defining the binding specificity and identifying antibodies whose binding is inhibited by mutagenesis of specific residues and that are likely to share functional properties with the other exemplified antibodies. Mutations can be systematic substitutions with alanine (or serine, if alanine is already present), either one residue at a time, or more widely spaced throughout the target or throughout the section of the target where the epitope is known to reside. Two antibodies bind to the same epitope if their binding is significantly reduced by the same set of mutations.
[0128] Antibodies with the binding specificity of a selected llama antibody (e.g., Nb20) can also be produced using a modification of the phage display method. See Winter, WO92 / 20791. This method is particularly suitable for producing human antibodies. In this method, either the heavy or light chain variable region of a selected non-human antibody is used as the starting material. For example, if a light chain variable region is selected as the starting material, a phage library is constructed in which members display the same light chain variable region (i.e., the non-human starting material) and a different heavy chain variable region. The heavy chain variable region can be obtained, for example, from a library of rearranged human heavy chain variable regions. Phages (e.g., at least 10 8 M -1 and preferably at least 10 9 M -1 ) are selected. The heavy chain variable region from this phage then serves as the starting material for constructing a further phage library. In this library, each phage displays the same heavy chain variable region (i.e., the region identified from the initial display library) and a different light chain variable region. For example, the light chain variable region can be obtained from a library of rearranged human variable light chain regions. Again, phage that exhibit strong specific binding to GPR158 or a fragment thereof are selected. The resulting antibody typically has the same or similar epitope specificity as the non-human starting material. Antibodies with the binding specificity of a selected llama antibody (e.g., Nb20) can be produced, for example, by a variant of the M13-phage display method (+phage helper KM13) using a camelid single-chain antibody as the starting material (M13-phage and phage helper KM13, see Peltomaa, R., et al., ACS Omega 4, 11569-11580 (2019)). The resulting antibodies usually have the same or similar epitope specificity as the llama starting material.
[0129] Other antibodies can be obtained by mutagenesis of the cDNA encoding the heavy chain of an exemplary antibody, such as Nb20. Monoclonal antibodies whose mature heavy chain variable region amino acid sequence is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to that of Nb20 and retain its functional properties, and / or which differ from the respective antibodies by a small number of functionally insignificant amino acid substitutions (e.g., conservative substitutions), deletions, or insertions, are also encompassed by the present invention. Also encompassed are monoclonal antibodies having at least one, two, or all three CDRs as defined by any conventional definition, but preferably by IMGT, with at least one, two, or all three CDRs being 90%, 95%, 99%, or 100% identical to the corresponding CDRs of Nb20.
[0130] The present invention also provides antibodies having some or all (e.g., one, two, or three) CDRs derived entirely or substantially from Nb20. Such antibodies may comprise a heavy chain variable region in which at least two, and usually all three, CDRs are derived entirely or substantially from the heavy chain variable region of Nb20. The antibody may comprise both a heavy chain and a light chain. A CDR is substantially derived from the corresponding Nb20 CDR if it contains no more than four, no more than three, no more than two, or no more than one substitution, insertion, or deletion, except that CDR-H2 (as defined by Kabat) may have no more than six, no more than five, no more than four, no more than three, no more than two, or no more than one substitution, insertion, or deletion. Such antibodies may have at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity in the amino acid sequence of the mature heavy chain variable region to Nb20 and retain their functional properties, and / or may differ from Nb20 by a small number of functionally insignificant amino acid substitutions (e.g., conservative substitutions), deletions, or insertions.
[0131] Some antibodies identified by such assays may bind to human, mouse or mammalian GPR158 or a peptide fragment thereof. Some antibodies identified by such assays may bind to cell membranes and / or cells expressing human, mouse or mammalian GPR158 or a peptide fragment thereof.
[0132] Antibodies can be screened for binding to GPR158 in cell-based assays (whole cells or membranes) or protein-based assays. Cells expressing recombinant GPR158 on their surface can be used in flow cytometry assays (see, for example, Figures 1 and 3A), radioligand binding assays, or microscopy-based assays. An exemplary cell useful in cell-based assays is HEK293 cells expressing recombinant GPR158 on their surface. Protein-based assays using GPR158 or a fragment thereof, such as recombinant cache domain protein, include surface plasmon resonance (SPR) (see, for example, Figure 3B), BioLayer Interferometry (BLI), isothermal titration calorimetry (ITC, NanoITC), or co-immunoprecipitation assays. B. Non-human antibodies
[0133] The production of other non-human antibodies against GPR158 or its fragments, such as llama, alpaca, camel, mouse, guinea pig, primate, rabbit, or rat antibodies, can be achieved, for example, by immunizing animals with GPR158 or its fragments, or cell membranes or fragments thereof expressing GPR158. See Harlow & Lane, Antibodies, A Laboratory Manual (CSHP NY, 1988) (incorporated by reference for all purposes). Such immunogens can be obtained from natural sources, by peptide synthesis, or by recombinant expression. If necessary, the immunogen can be administered fused to a carrier protein or otherwise conjugated. If necessary, the immunogen can be administered with an adjuvant. Several types of adjuvants can be used, as described below. Complete Freund's adjuvant, followed by incomplete adjuvant, is preferred for immunizing laboratory animals. Rabbits or guinea pigs are typically used to generate polyclonal antibodies. Mice are typically used to generate monoclonal antibodies. Antibodies are screened for specific binding to GPR158 or epitopes within GPR158. Such screening can be achieved by determining the binding of a collection of GPR158 variants with the antibody, and determining which GPR158 variants bind to the antibody. Binding can be assessed, for example, by Western blot, flow cytometry, or ELISA. C. Humanized Antibodies
[0134] Humanized antibodies are genetically engineered antibodies in which CDRs from a non-human "donor" antibody are grafted onto a human "acceptor" antibody sequence or an acceptor humanized nanobody scaffold (e.g., Queen, US 5,530,101 and 5,585,089; Winter, US 5,225,539; Carter, US 6,407,213; Adair, US 5,859,205; Foote, US 6,881,557; Vincke, C. et al., (2009) J. Biol. Chem. 284(5):3273-3284, and Sulea, T. (2022). Humanization of Camelid Single-Domain Antibodies. In: Hussack, G., Henry, KA (eds) Single-Domain Antibodies. Methods in Molecular Biology, vol 2446. Humana, New York, (See, NY). The acceptor antibody sequence can be, for example, a mature human antibody sequence, a composite of such sequences, a consensus sequence of human antibody sequences, or a germline region sequence. Thus, a humanized antibody has at least three, four, five, or all CDRs derived entirely or substantially from a donor antibody, and the variable region framework sequences and constant regions, if present, are derived entirely or substantially from human antibody sequences. Similarly, a humanized heavy chain has at least one, two, and usually all three CDRs derived entirely or substantially from a donor antibody heavy chain, and the heavy chain variable region framework sequences and heavy chain constant regions, if present, are derived substantially from human heavy chain variable region framework and constant region sequences. Similarly, a humanized light chain has at least one, two, and usually all three CDRs derived entirely or substantially from a donor antibody light chain, and the light chain variable region framework sequences and light chain constant regions, if present, are derived substantially from human light chain variable region framework and constant region sequences. In addition to nanobodies and dAbs, humanized antibodies include humanized heavy chains and humanized light chains. Humanized nanobodies can be synthesized using acceptor humanized VHH nanobody scaffolds, e.g., h-NbBcII10 FGLAThe CDRs of a humanized antibody may comprise a llama nanobody heavy chain CDR grafted onto a non-human antibody (Vincke, supra). A CDR of a humanized antibody is said to be substantially derived from a corresponding CDR of a non-human antibody if at least 85%, 90%, 95%, or 100% of the corresponding residues (as defined by any conventional definition, but preferably as defined by Kabat) between the respective CDRs are identical. A variable region framework sequence of an antibody chain or constant region of an antibody chain is said to be substantially derived from a human variable region framework sequence or human constant region if at least 85%, 90%, 95%, or 100% of the corresponding residues as defined by Kabat, respectively, are identical. To be classified as humanized under the 2014 World Health Organization (WHO) International Nonproprietary Name (INN) definition of a humanized antibody, the antibody must have at least 85% identity to a human germline antibody sequence (i.e., before somatic hypermutation). A mixed antibody is one in which one antibody chain (e.g., heavy chain) meets the criteria, but the other chain (e.g., light chain) does not. An antibody is classified as chimeric if neither chain meets the criteria, even though the variable framework regions of both chains are substantially human and contain some non-human back mutations. See Jones et al. (2016) The INNs and outs of antibody nonproprietary names, mAbs 8:1, 1-9, DOI: 10.1080 / 19420862.2015.1114320. See also "WHO-INN: International nonproprietary names (INN) for biological and biotechnological substances (a review)" (Internet) 2014, available at worldwideweb.who.int / medicines / services / inn / BioRev2014.pdf, incorporated herein by reference. For the avoidance of doubt, the term "humanized," as used herein, is not intended to be limited to the 2014 WHO INN definition of a humanized antibody.Some of the humanized antibodies presented herein have at least 85% sequence identity to human germline sequences, and some of the humanized antibodies presented herein have less than 85% sequence identity to human germline sequences. Some of the heavy chains of the humanized antibodies presented herein have sequence identity within the range of about 60% to 100%, e.g., about 60%-69%, 70%-79%, 80%-84%, or 85%-89%, to human germline sequences. Some heavy chains fall below the 2014 WHO INN definition, e.g., have about 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, or 82%, 83%, or 84% sequence identity to human germline sequences, while other heavy chains meet the 2014 WHO INN definition and have about 85%, 86%, 87%, 88%, 89% or greater sequence identity to human germline sequences. Some of the light chains of the humanized antibodies presented herein have sequence identities within the range of about 60% to 100%, e.g., about 80%-84% or 85%-89%, to human germline sequences. Some light chains fall below the 2014 WHO INN definition, for example, having about 81%, 82%, 83%, or 84% sequence identity to human germline sequences, while other light chains meet the 2014 WHO INN definition, having about 85%, 86%, 87%, 88%, 89% or more sequence identity to human germline sequences. Some of the humanized antibodies presented herein that are "chimeric" under the 2014 WHO INN definition have a heavy chain paired with a light chain that has less than 85% identity to human germline sequences. Some of the humanized antibodies presented herein are "mixed" under the 2014 WHO INN definition, e.g., having a heavy chain pair with at least 85% sequence identity to human germline sequences and a light chain pair with less than 85% sequence identity to human germline sequences, or conversely, a heavy chain pair with less than 85% sequence identity to human germline sequences and a light chain pair with at least 85% sequence identity to human germline sequences.Some of the humanized antibodies presented herein meet the 2014 WHO INN definition of "humanized," having a heavy chain paired with a light chain that has at least 85% sequence identity to human germline sequences and at least 85% sequence identity to human germline sequences. Additional humanized antibodies of the present invention meet the 2014 WHO INN definition of "mixed."
[0135] Humanized antibodies often incorporate all six CDRs (as defined by any conventional definition, but preferably as defined by Kabat) from a non-human antibody, although fewer than all CDRs (e.g., at least three, four, or five CDRs) can be generated from a non-human antibody (e.g., Pascalis et al., J. Immunol. 169:3076, 2002; Vajdos et al., J. of Mol. Biol., 320: 415-428, 2002; Iwahashi et al., Mol. Immunol. 36:1079-1091, 1999; Tamura et al., J. Immunol., 164:1432-1441, 2000). Some humanized antibodies incorporate one, two, or three heavy chain CDRs from camelid single domain antibodies (see, e.g., Vincke, supra, and Sulea, T., supra). Some humanized antibodies incorporate one, two, or three heavy chain CDRs from the llama nanobody Nb20. Some humanized antibodies are constructed using acceptor humanized VHH nanobody scaffolds, such as h-NbBcII10. FGLA The heavy chain CDRs comprise one, two, or three heavy chain CDRs from Nb20 grafted onto the nucleotide sequence (Vincke, supra).
[0136] In some antibodies, only a portion of the CDRs, i.e., a subset of the CDR residues required for binding, referred to as SDRs, are required in the humanized antibody to maintain binding. CDR residues that do not contact the antigen and are not within the SDRs can be identified from the regions of the Kabat CDRs that are outside the Chothia hypervariable loops (Chothia, J. Mol. Biol. 196:901, 1987) by molecular modeling and / or empirically, or based on previous studies as described in Gonzales et al., Mol. Immunol. 41: 863, 2004 (e.g., residues H60-H65 of CDR H2 are often not required). In such humanized antibodies, where one or more donor CDR residues are absent or the entire donor CDR is removed, the amino acid that occupies that position can be the amino acid that occupies the corresponding position (according to Kabat numbering) in the acceptor antibody or acceptor humanized nanobody scaffold sequence. The number of donor amino acid substitutions with acceptor amino acids to be included in the CDRs reflects a balance of competing considerations. Such substitutions reduce the number of llama amino acids in the humanized antibody, potentially advantageous for reducing potential immunogenicity and / or for satisfying the WHO INN definition of "humanization." However, substitutions can also cause changes in affinity, and it is preferable to avoid significant reductions in affinity. The positions for substitution within the CDRs and the amino acids to be substituted can also be selected empirically.
[0137] If necessary, the human acceptor antibody sequence can be selected from among many known human antibody sequences so as to provide a high degree of sequence identity (e.g., 65-85% identity) between the human acceptor sequence variable region framework and the variable region framework of the corresponding donor antibody chain.
[0138] If more than one human acceptor antibody sequence is selected, a composite or hybrid of those acceptors can be used, and the amino acids used at different positions in the humanized light and heavy chain variable regions can be taken from any of the human acceptor antibody sequences used.
[0139] Certain amino acids from the human variable region framework residues can be selected for substitution based on their potential effect on CDR conformation and / or antigen binding, which can be investigated by modeling, examining the characteristics of amino acids at specific locations, or empirically observing the effects of substituting or mutagenesing specific amino acids.
[0140] For example, if an amino acid differs between the non-human variable region framework residue and the selected human variable region framework residue, the amino acid may be: (1) Direct noncovalent binding to the antigen; (2) adjacent to or within a CDR region as defined by Chothia but not Kabat; (3) otherwise interacting with the CDR region (e.g., within about 6 Å of the CDR region) (e.g., identified by modeling the light or heavy chain against the solved structure of a homologous known immunoglobulin chain); or (4) Residues involved in the VL-VH interface Human framework amino acids can be substituted with equivalent framework amino acids from a non-human antibody where this is reasonably expected.
[0141] In one embodiment, humanized sequences are generated using QuikChange site-directed mutagenesis, a two-step PCR protocol that allows for the introduction of multiple mutations, deletions, and insertions [Wang, W. and Malcolm, BA (1999) BioTechniques 26:680-682].
[0142] Framework residues from classes (1) to (3) defined by Queen, US Pat. No. 5,530,101, are sometimes referred to alternatively as canonical and vernier residues. Framework residues that help define the conformation of the CDR loops are sometimes referred to as canonical residues (Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987); Thornton & Martin, J. Mol. Biol. 263:800-815 (1996)). Framework residues that support the antigen-binding loop conformation and play a role in fine-tuning the antibody-antigen match are sometimes referred to as vernier residues (Foote & Winter, J. Mol. Biol. 224:487-499 (1992)).
[0143] Other framework residues that are candidates for substitution are those that create potential glycosylation sites. Still other candidate substitutions are acceptor human framework amino acids that are unusual at that position for human immunoglobulins. These amino acids can be substituted with amino acids from the equivalent position of the donor antibody or the equivalent position of a more typical human immunoglobulin.
[0144] Another framework residue that is a candidate for substitution is the N-terminal glutamine residue (Q), which can be replaced with glutamic acid (E) to minimize the potential for pyroglutamic acid conversion [Y. Diana Liu, et al., 2011, J. Biol. Chem., 286: 11211-11217]. Conversion of glutamic acid (E) to pyroglutamic acid (pE) occurs more slowly than conversion from glutamine (Q). The lack of a primary amine in glutamine for pE conversion makes the antibody more acidic. Incomplete conversion results in heterogeneity in the antibody, which can be observed as multiple peaks using charge-based analytical methods. Differences in heterogeneity can indicate a lack of process control.
[0145] Llama nanobody Nb20 comprises a mature heavy chain variable region having an amino acid sequence comprising SEQ ID NO:2.
[0146] In some humanized Nb20 antibodies, the variable heavy chain has ≧85% identity to the human sequence.
[0147] The CDR regions of such humanized antibodies may be identical or substantially identical to the CDR regions of Nb 20. The CDR regions may be defined by any conventional definition (e.g., Kabat, Chothia, Kabat / Chothia combined, AbM, Contact, or IMGT), but are preferably defined by IMGT.
[0148] Variable region framework positions follow Kabat numbering unless otherwise specified.
[0149] An additional possibility for variation in humanized Nb20 variants is additional backmutations in the variable region framework. Many of the framework residues in humanized mAbs that do not contact the CDRs are amenable to amino acid substitution from the corresponding positions in the donor llama mAb or other llama or human antibodies, and many residues potentially in contact with the CDRs are also amenable to substitution. Even amino acids within the CDRs can be altered, for example, using residues found in the corresponding positions in the human acceptor sequence or the acceptor humanized Nanobody scaffold sequence used to provide the variable region framework. Furthermore, alternative human acceptor sequences can be used, for example, for the heavy and / or light chains. Furthermore, alternative acceptor humanized Nanobody scaffold sequences can be used, for example, for the heavy chain. When using a different acceptor sequence or a different acceptor humanized Nanobody scaffold sequence, one or more of the recommended backmutations described above may not be performed, since the corresponding donor and acceptor residues are already the same without backmutations.
[0150] Preferably, the substitutions or back mutations (conservative or not) in the humanized Nb20 variants do not substantially affect the binding affinity or potency of the humanized mAb, i.e., the ability to bind to full-length GPR158, the ability to bind to the extracellular domain of GPR158, and / or the ability to inhibit the RGS7 / Gβ5-mediated GAP activity of GPR158. Humanized Nb20 antibodies are further characterized by their ability to inhibit the RGS7 / Gβ5-mediated GAP activity of GPR158. D. Chimeric and Veneered Antibodies
[0151] The present invention further provides chimeric and veneered forms of non-human antibodies, particularly the Nb20 antibody.
[0152] Chimeric antibodies are antibodies that combine the mature variable regions of the light and heavy chains of a non-human antibody (e.g., murine) with human light and heavy chain constant regions. Such antibodies substantially or completely retain the binding specificity of the murine antibody and contain approximately two-thirds human sequence.
[0153] A veneered antibody is a type of humanized antibody that retains some, and usually all, of the CDRs and also retains some of the nonhuman variable region framework residues of the nonhuman antibody, but replaces other variable region framework residues that may contribute to B-cell or T-cell epitopes, such as exposed residues (Padlan, Mol. Immunol. 28:489, 1991), with residues at the corresponding positions in a human antibody sequence. The result is an antibody in which the CDRs are entirely or substantially derived from a nonhuman antibody and the variable region framework of the nonhuman antibody has been made more human-like by the substitutions. Veneered forms of the Nb20 antibody are encompassed by the present invention. E. Human antibodies
[0154] Human antibodies against GPR158 or fragments thereof are provided by a variety of techniques, as described below. Some human antibodies are selected by competitive binding experiments using the phage display method of Winter, supra, or by other means, to have the same epitope specificity as a particular llama antibody, such as nanobody Nb20. Human antibodies can also be screened for a particular epitope specificity by using only fragments of GPR158 as target antigens and / or by screening antibodies against a collection of GPR158 variants.
[0155] Methods for producing human antibodies include the trioma method of Oestberg et al., Hybridoma 2:361-367 (1983); Oestberg, U.S. Pat. No. 4,634,664; and Engleman et al., U.S. Pat. No. 4,634,666, the use of transgenic mice containing human immunoglobulin genes (e.g., Lonberg et al., WO 93 / 12227 (1993); U.S. Pat. No. 5,877,397; U.S. Pat. No. 5,874,299; U.S. Pat. No. 5,814,318; U.S. Pat. No. 5,789,650; U.S. Pat. No. 5,770,429; U.S. Pat. No. 5,661,016; U.S. Pat. No. 5,633,425; U.S. Pat. No. 5,625,126; U.S. Pat. No. 5,569,825; U.S. Pat. No. 5,545,806; Neuberger, Nat. Biotechnol. 14:826). (1996); and Kucherlapati, WO91 / 10741 (1991)), phage display methods (see, e.g., Dower et al., WO91 / 17271; McCafferty et al., WO92 / 01047; US5,877,218; US5,871,907; US5,858,657; US5,837,242; US5,733,743; and US5,565,332); and the methods described in WO2008 / 081008 (e.g., immortalizing memory B cells isolated from, e.g., humans with EBV, screening for desired properties, cloning, and expressing in recombinant form). F. Constant Region Selection
[0156] The heavy and light chain variable regions of a chimeric, veneered, or humanized antibody may be linked to at least a portion of a human constant region. The choice of constant region depends, in part, on whether antibody-mediated cytotoxicity, antibody-dependent cellular phagocytosis, and / or complement-dependent cytotoxicity is desired. For example, human isotypes IgG1 and IgG3 have complement-dependent cytotoxicity, while human isotypes IgG2 and IgG4 do not. Human IgG1 and IgG3 also induce stronger cell-mediated effector functions than human IgG2 and IgG4. The light chain constant region may be lambda or kappa. Numbering conventions for constant regions include EU numbering (Edelman, GM et al., Proc. Natl. Acad. USA, 63, 78-85 (1969)), Kabat numbering (Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1991)), IMGT unique numbering (Lefranc M.-P. et al., IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains, Dev. Comp. Immunol., 29, 185-203 (2005)), and IMGT exon numbering (Lefranc, supra).
[0157] One or several amino acids at the amino or carboxy terminus of the light chain and / or heavy chain, for example, the C-terminal lysine of the heavy chain, can be deleted, or a proportion or all of the molecule can be derivatized.Substitutions can be made in the constant region to reduce or increase effector functions such as complement-mediated cytotoxicity or ADCC (see, for example, Winter et al., U.S. Patent No. 5,624,821; Tso et al., U.S. Patent No. 5,834,597; and Lazar et al., Proc. Natl. Acad. Sci. USA 103:4005, 2006), or to extend half-life in humans (see, for example, Hinton et al., J. Biol. Chem. 279:6213, 2004).Exemplary substitutions include Gln at position 250 and / or Leu at position 428 (EU numbering is used for the constant region in this paragraph) to increase the half-life of the antibody. Substitutions at any or all of positions 234, 235, 236, and / or 237 reduce affinity for Fcγ receptors, particularly FcγRI receptors (see, e.g., US Pat. No. 6,624,821 ). Alanine substitutions at positions 234, 235, and 237 of human IgG1 can be used to reduce effector function. Some antibodies have alanine substitutions at positions 234, 235, and 237 of human IgG1 to reduce effector function. Optionally, positions 234, 236, and / or 237 of human IgG2 are substituted with alanine, and position 235 is substituted with glutamine (see, e.g., US Pat. No. 5,624,821 ). Some antibodies utilize mutations at one or more of positions 241, 264, 265, 270, 296, 297, 322, 329, and 331 according to EU numbering of human IgG1. Some antibodies utilize mutations at one or more of positions 318, 320, and 322 according to EU numbering of human IgG1. Some antibodies utilize a substitution at positions 234 and / or 235 with alanine and / or a substitution at position 329 with glycine.In some antibodies, alanine is substituted at positions 234 and 235. In some antibodies, the isotype is human IgG2, IgG3, or IgG4.
[0158] Antibodies can be expressed as tetramers containing two light chains and two heavy chains, as separate heavy and light chains, as Fab, Fab', F(ab')2, and Fv, or as single-chain antibodies in which the mature heavy and light chain variable domains are linked via a spacer. Antibodies can be expressed as single-chain antibodies or nanobodies comprising the heavy chain variable region.
[0159] Human constant regions exhibit allotypic and isoallotypic variations between different individuals, i.e., constant regions may differ at one or more polymorphic positions in different individuals. Isoallotypes differ from allotypes in that serum that recognizes an isoallotype binds to the non-polymorphic regions of one or more other isotypes. Thus, for example, another heavy chain constant region is that of IgG1 G1m3, with or without a C-terminal lysine. Reference to a human constant region encompasses any natural allotype or constant region with any combination of residues that occupy positions in natural allotypes. G. Expression of Recombinant Antibodies
[0160] Several methods are known for producing chimeric and humanized antibodies using antibody-expressing cell lines (e.g., hybridomas). For example, the immunoglobulin variable region of an antibody can be cloned and sequenced using well-known methods. In one method, the heavy chain variable VH region is cloned by RT-PCR using mRNA prepared from hybridoma cells. A consensus primer is used to target the VH region leader peptide, encompassing the translation initiation codon, as the 5' primer and the g2b constant region-specific 3' primer. Exemplary primers are described in U.S. Patent Publication No. US2005 / 0009150 by Schenk et al. (hereinafter "Schenk"). Sequences from multiple independently derived clones can be compared to ensure that no changes were introduced during amplification. The sequence of the VH region can also be determined or confirmed by sequencing the VH fragment obtained using a 5' RACE RT-PCR methodology and a 3' g2b-specific primer.
[0161] The light chain variable VL region can be cloned in a similar manner. In one approach, a consensus primer set is designed to amplify the VL region using a 5' primer designed to hybridize with the VL region encompassing the translation initiation codon and a 3' primer specific to the Ck region downstream of the VJ junction region. In the second approach, a 5' RACE RT-PCR methodology is employed to clone the VL encoding cDNA. Exemplary primers are described in Schenk, supra. The cloned sequence is then combined with a sequence encoding a human (or other non-human species) constant region.
[0162] In one approach, the heavy and light chain variable regions are re-engineered to encode splice donor sequences downstream of their respective VDJ or VJ junctions and cloned into mammalian expression vectors, such as pCMV-hγ1 for the heavy chain and pCMV-Mcl for the light chain. These vectors encode the human γ1 and Ck constant regions as exon fragments downstream of the inserted variable region cassettes. After sequence verification, the heavy and light chain expression vectors can be co-transfected into CHO cells to produce chimeric antibodies. 48 hours after transfection, conditioned medium is collected and assayed for antibody production by Western blot analysis or for antigen binding by ELISA or flow cytometry. The chimeric antibodies are humanized as described above.
[0163] Chimeric, veneered, humanized, and human antibodies are typically produced by recombinant expression. Recombinant polynucleotide constructs typically contain expression control sequences, including naturally-associated or heterologous expression control elements, such as promoters, operably linked to the coding sequence of the antibody chain. The expression control sequence can be a promoter system in a vector capable of transforming or transfecting into eukaryotic or prokaryotic host cells. Once the vector is incorporated into an appropriate host, the host is maintained under conditions suitable for high-level expression of the nucleotide sequence and for the collection and purification of cross-reactive antibodies.
[0164] These expression vectors are typically replicable in the host organism either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers, such as ampicillin resistance or hygromycin resistance, to permit detection of transformed cells carrying the desired DNA sequences.
[0165] E. coli is one of the prokaryotic hosts useful for expressing antibodies, particularly antibody fragments. E. coli BL21 DE3±pLysS is an exemplary prokaryotic host. Microorganisms such as yeast are also useful for expression. Saccharomyces is a yeast host with suitable vectors containing the desired expression control sequences, origin of replication, termination sequences, etc. Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes. Inducible yeast promoters include, among others, promoters derived from alcohol dehydrogenase, isocytochrome C, and promoters derived from enzymes responsible for maltose and galactose utilization.
[0166] Mammalian cells can be used to express nucleotide segments encoding immunoglobulins or fragments thereof. See Winnacker, From Genes to Clones (VCH Publishers, NY, 1987). Several suitable host cell lines capable of secreting intact heterologous proteins have been developed, including CHO cell lines, various COS cell lines, HeLa cells, HEK293 cells, L cells, and non-antibody-producing myelomas, including Sp2 / 0 and NS0. The cells can be non-human. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription terminator sequences. Expression control sequences can include promoters derived from endogenous genes, cytomegalovirus, SV40, adenovirus, bovine papillomavirus, etc. See Co et al., J. Immunol. 148:1149 (1992).
[0167] Alternatively, the antibody coding sequence can be incorporated into a transgene for introduction into the genome of a transgenic animal and subsequent expression in the milk of the transgenic animal (see, e.g., U.S. Pat. Nos. 5,741,957; 5,304,489; and 5,849,992). Suitable transgenes include light and / or heavy chain coding sequences operably linked to a promoter and enhancer derived from a mammary gland-specific gene such as casein or beta-lactoglobulin.
[0168] The vector containing the desired DNA segment can be transferred into host cells by a method that depends on the type of host cell.For example, calcium chloride or heat shock transformation is commonly used for prokaryotic cells, while calcium phosphate treatment, electroporation, lipofection, particle bombardment, or virus-based transfection can be used for other host cells.Other methods used to transfect mammalian cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and microinjection.For the production of transgenic animals, transgenes can be microinjected into fertilized oocytes, or can be incorporated into the genome of embryonic stem cells, and the nuclei of such cells can be transferred into enucleated oocytes.
[0169] Once the vectors encoding the antibody heavy and light chains are introduced into cell cultures, cell pools can be screened in serum-free medium for growth productivity and product quality. Top-producing cell pools can then be subjected to FACS-based single-cell cloning to generate monoclonal lines. Specific productivities of over 50 pg or 100 pg per cell per day, corresponding to product titers of over 7.5 g per L of culture, can be used. Antibodies produced by single cell clones can also be tested for turbidity, filtration characteristics, PAGE, IEF, UV scanning, HP-SEC, carbohydrate-oligosaccharide mapping, mass spectrometry, and binding assays such as ELISA or Biacore. Selected clones can then be banked in multiple vials and stored frozen for future use.
[0170] Once the antibody is expressed, it can be purified according to standard procedures in the art, including protein A capture, nickel column capture, HPLC purification, column chromatography, gel electrophoresis, etc. (See generally, Scopes, Protein Purification (Springer-Verlag, NY, 1982)).
[0171] Methodologies for commercial production of antibodies can be employed, including codon optimization, promoter selection, transcription element selection, terminator selection, serum-free single cell cloning, cell banking, use of selectable markers for copy number amplification, CHO terminators, or improved protein titer (see, e.g., US 5,786,464; US 6,114,148; US 6,063,598; US 7,569,339; WO2004 / 050884; WO2008 / 012142; WO2008 / 012142; WO2005 / 019442; WO2008 / 107388; WO2009 / 027471; and US 5,888,809). IV. Active immunogens
[0172] The agent used for active immunization serves to induce the same types of antibodies in patients as those described above in connection with passive immunization. The agent for active immunization can be the same type of immunogen as that used to generate monoclonal antibodies in laboratory animals, e.g., a peptide of 3-15, 3-12, 5-12, or 5-8 consecutive amino acids from a region of GPR158. To induce antibodies that bind to the same or overlapping epitope as Nb20, the epitope specificity of these antibodies can be mapped (e.g., by testing binding to a series of overlapping peptides spanning GPR158). A fragment of GPR158 consisting of, containing, or overlapping the epitope can then be used as an immunogen. Some active agents are cell membranes or fragments thereof that express GPR158.
[0173] If heterologous carriers and adjuvants are used, they can be the same as those used to generate the monoclonal antibodies, but can also be selected to provide better pharmaceutical suitability for human use. Suitable carriers include serum albumin, keyhole limpet hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanus toxoid, or toxoids or attenuated toxin derivatives from other pathogenic bacteria, such as diphtheria (e.g., CRM197), E. coli, cholera, or H. pylori. T-cell epitopes are also suitable carrier molecules. Some conjugates can be formed by linking an agent of the invention to immunostimulatory polymer molecules (e.g., tripalmitoyl-S-glyceryl cysteine (Pam3Cys), mannan (mannose polymer), or glucan (β1→2 polymer)), cytokines (e.g., IL-1, IL-1 alpha and beta peptides, IL-2, gamma-INF, IL-10, GM-CSF), and chemokines (e.g., MIP1-α, MIP1-β, and RANTES). The immunogen can be linked to the carrier with or without spacer amino acids (e.g., gly-gly). Additional carriers include virus-like particles. Virus-like particles (VLPs), also referred to as pseudovirus particles or virus-derived particles, represent subunit structures composed of multiple copies of viral capsid and / or envelope proteins that can self-assemble into VLPs with defined spherical symmetry in vivo (Powilleit, et al., (2007) PLoS ONE 2 (5):e415.). Alternatively, peptide immunogens can be linked to at least one artificial T cell epitope, such as a pan-DR epitope ("PADRE"), that can bind to a high percentage of MHC class II molecules. PADREs are described in US 5,736,142, WO 95 / 07707, and Alexander J et al., Immunity, 1:751-761 (1994). Active immunogens can be presented in the form of multimers, in which multiple copies of the immunogen and / or its carrier are presented as a single covalently linked molecule.
[0174] Fragments are often administered with a pharmaceutically acceptable adjuvant. The adjuvant increases the titer and / or binding affinity of the induced antibody compared to when the peptide is used alone. Various adjuvants can be used in combination with immunogenic GPR158 fragments to elicit an immune response. Preferred adjuvants enhance the inherent response to the immunogen without causing conformational changes in the immunogen that affect the qualitative form of the response. Preferred adjuvants include aluminum salts, such as aluminum hydroxide and aluminum phosphate, 3 De-O-acylated monophosphoryl lipid A (MPL™) (see GB 2220211 (RIBI ImmunoChem Research Inc., Hamilton, Montana, now part of Corixa)). Stimulon™ QS-21 is a triterpene glycoside or saponin isolated from the bark of the Quillaja Saponaria Molina tree found in South America (see Kensil et al., in Vaccine Design: The Subunit and Adjuvant Approach (eds. Powell & Newman, Plenum Press, NY, 1995); US Pat. No. 5,057,540), (Aquila BioPharmaceuticals, Framingham, MA; now Antigenics, Inc., New York, NY). Other adjuvants are oil-in-water emulsions (e.g., squalene or peanut oil), optionally combined with immunostimulants such as monophosphoryl lipid A (see Stoute et al., N. Engl. J. Med. 336, 86-91 (1997)), Pluronic® polymers, and killed mycobacteria. Ribi adjuvant is an oil-in-water emulsion. Ribi contains a metabolizable oil (squalene) emulsified with saline containing T® 80.Ribi also contains purified mycobacterial products, which act as immunostimulants, and bacterial monophosphoryl lipid A. Another adjuvant is CpG (WO 98 / 40100). The adjuvant can be administered together with the active agent as a component of the therapeutic composition, or can be administered separately, before, concurrently with, or after administration of the therapeutic agent.
[0175] Analogs of natural GPR158 fragments that induce antibodies against GPR158 can also be used. For example, one or more or all L-amino acids in such peptides can be replaced with D-amino acids. The order of amino acids can also be reversed (retro peptides). Optionally, the peptide contains all D-amino acids in reverse order (retro-inverso peptides). Peptides and other compounds that do not necessarily have significant amino acid sequence similarity to GPR158 peptides nevertheless function as mimics of GPR158 peptides and induce similar immune responses. Anti-idiotypic antibodies against the above-mentioned monoclonal antibodies against GPR158 can also be used. Such anti-Id antibodies mimic antigens and generate immune responses against them (see Essential Immunology, Roit ed., Blackwell Scientific Publications, Palo Alto, CA 6th ed., p. 181).
[0176] The peptide (and, if necessary, a carrier fused to the peptide) can also be administered in the form of a nucleic acid encoding the peptide and expressed in situ in the patient. The nucleic acid segment encoding the immunogen is typically linked to regulatory elements, such as a promoter and enhancer, that enable expression of the DNA segment in the patient's intended target cells. For expression in blood cells, which are desirable for inducing an immune response, promoter and enhancer elements from light or heavy chain immunoglobulin genes or the CMV major intermediate-early promoter and enhancer are suitable for directing expression. The linked regulatory elements and coding sequence are often cloned into a vector. Antibodies can also be administered in the form of nucleic acids encoding the antibody heavy and / or light chain. When both heavy and light chains are present, these chains are preferably linked as a single-chain antibody. Antibodies for passive administration can also be prepared, for example, by affinity chromatography from the serum of patients treated with the peptide immunogen.
[0177] DNA can be delivered in a naked form (i.e., without colloidal or encapsulating materials). Alternatively, retrovirus systems (see, for example, Lawrie and Tumin, Cur. Opin. Genet. Develop. 3, 102-109 (1993)); adenovirus vectors {see, for example, Bett et al., J. Virol. 67, 591 1 (1993)); adeno-associated virus vectors {see, for example, Zhou et al., J. Exp. Med. 179, 1867 (1994)), virus vectors derived from pox viruses, including vaccinia virus and avian pox viruses, virus vectors derived from alphaviruses, such as Sindbis virus and Semliki Forest virus (see, for example, Dubensky et al., J. Virol. 70, 508-519 (1994)). (1996)), Venezuelan equine encephalitis virus (see U.S. Pat. No. 5,643,576), and rhabdoviruses such as vesicular stomatitis virus (see WO 96 / 34625), and papillomaviruses (Ohe et al., Human Gene Therapy 6, 325-333 (1995); Woo et al., WO 94 / 12629 and Xiao & Brandsma, Nucleic Acids. Res. 24, 2630-2622 (1996)).
[0178] The DNA encoding immunogen or the vector containing the DNA can be packaged in liposome.Suitable lipids and related analogues are described in US5,208,036, US5,264,618, US5,279,833 and US5,283,185.The vector and DNA encoding immunogen can also be adsorbed to or associated with particle carriers, examples of which include polymethylmethacrylate polymers and polylactic acid and poly(lactide-co-glycolide) (see, for example, McGee et al., J. Micro Encap. 1996). V. Antibody Screening Assays
[0179] Antibodies can be initially screened for the intended binding specificity, as described above. Active immunogens can similarly be screened for the ability to induce antibodies with such binding specificity. In this case, the active immunogen is used to immunize laboratory animals and the resulting sera are tested for the appropriate binding specificity.
[0180] Antibodies with the desired binding specificity can then be tested in cell and animal models, for example, ex vivo brain slices from animals expressing GPR158.
[0181] A. Cell-based assays:
[0182] Antibodies can be screened in cell-based assays for their effect on GPR158 signaling activity, for example, by measuring GPR158-modulated cAMP levels or the GAP activity of RGS7-Gβ5. Further designed assays can rely on measuring conformational changes induced by antibody binding by placing a fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET) donor / acceptor pair within the GPR158-RGS7-Gβ5 complex.
[0183] In an exemplary cell-based assay, the effect of antibodies on cAMP production is measured using a bioluminescence resonance energy transfer (BRET)-based cAMP biosensor in cells expressing GPR158. CAMYEL (cAMP sensor using YFP-Epac-Rluc) is a unimolecular BRET-based biosensor for cAMP activity, consisting of a truncated, catalytically inactive form of human Epac1 sandwiched between Rluc (donor) and a monomeric, circularly permuted form of YFP-Citrine (acceptor). In the absence of cAMP, Epac adopts a "closed" conformation in which the donor and acceptor are in close proximity, resulting in a BRET signal. When cAMP binds to Epac, the donor and acceptor are separated, resulting in a decrease in BRET (Valkovic, AL et al., Pharmacol Res Perspect. 2018 24;6(5):e00432). In this assay, cells express the cAMP sensor YFP-Epac-RLuc (Camyel) and GPR158. Cells are incubated with coelenterazine H, a substrate for RLuc (Renilla luciferase). Cells are treated with antibody, and the BRET ratio is determined by calculating the ratio of light emitted from RLuc (475 nm, 30 nm bandpass) to light emitted from Venus (535 nm, 30 nm bandpass) to measure the increase in signal upon cAMP elevation. The BRET ratio in antibody-treated cells is compared to the BRET ratio in non-antibody-treated cells. A higher BRET ratio in antibody-treated cells compared to non-antibody-treated control cells indicates increased cAMP production by the antibody.
[0184] In another exemplary cell-based assay, the effect of antibodies on cAMP levels is measured using cADDIS (Montana molecular), a fluorescence-based cAMP sensor that involves Bacmam virus-based delivery of the sensor into cells.
[0185] In an exemplary cADDI assay, HEK293T / 17 cells were co-transfected with GPR158, RGS7, and Gβ5 plasmids (150 μg / ml, GPR158:RGS7:Gβ5:4:1:1) by electroporation (Maxcyte). After an 18-20 hour recovery period post-transfection, the cells were infected with the cADDIS cAMP sensor using BacMam virus and seeded at a density of 50,000 cells per well in black flat-bottom 96-well plates. After 24 hours, the culture medium was removed, and the cells were washed with 1x PBS (containing CaCl2 and MgCl2) and then incubated for 15 minutes at room temperature. Before antibody treatment, baseline fluorescence intensity was recorded using the fluorescence intensity module (FI Ex: 485 nm, Em: 520 nm) on a Pherastar FSX microplate reader (BMG Labtech), followed by a 15-minute forskolin treatment. Cells are then treated with antibody and the fluorescence intensity is recorded. The signal after 15 minutes of antibody treatment is normalized to that of buffer-treated cells and the data are plotted using GraphPad Prism 10 software.
[0186] The cADDIS assay for Gαi results in increased fluorescence when cAMP is reduced in cells after treatment with antibody.
[0187] In another exemplary cell-based assay, the effect of antibodies on cAMP levels is measured using a Homogeneous Time-Resolved Fluorescence (HTRF)-based cAMP Gαi assay (cisbio).
[0188] For an exemplary HTRF Gαi cAMP assay, HEK293T / 17 cells were transfected with GPR158, RGS7, and Gβ5 plasmids by Maxcyte electroporation, as described for the cADDI assay above. 24 hours after transfection, cells were harvested by centrifugation, counted, and resuspended in the stimulation buffer provided with the kit before seeding at a density of 6,000 cells per well into a white 384-well plate. Cells were then treated with antibody or buffer for 30 minutes, followed by an additional 30 minutes of incubation at 37°C after forskolin treatment. Detection reagents, cAMP-cryptate (donor) and anti-cAMP d2 antibody (acceptor), were then added, and the plate was incubated at room temperature for 1 hour. HTRF signals were measured using the HTRF optical module (donor excitation: 337 nm, donor emission: 620 nm, acceptor emission: 665 nm) and the laser energy source of a Pherastar FSX microplate reader (BMG Labtech).
[0189] Data are plotted as the ratio of acceptor fluorescence intensity to donor fluorescence intensity (Em 665 nm / Em 620 nm). A parallel cAMP standard curve is generated to test the assay window and dynamic range. A 10 HTRF ratio is used. 4 and the results are analyzed using GraphPad Prism 10 software.
[0190] The HTRF assay utilizes competition between cryptate-labeled cAMP (donor) and unlabeled cAMP produced by cells for binding to a d2-fluorophore-labeled anti-cAMP antibody (acceptor). Competition with unlabeled cAMP results in a reduction in FRET exchange, and therefore the HTRF signal is inversely proportional to the concentration of cAMP in the sample.
[0191] In another exemplary cell-based assay, the effect of an antibody on the GAP activity of RGS7-Gβ5 in cells expressing GPR158 and RGS7-Gβ5 is measured using bioluminescence resonance energy transfer (BRET) between a recombinant Gβγ fused to a BRET acceptor and a recombinant Gβγ scavenger (reporter) fused to a BRET donor, as shown in Figure 4B. In some assays, the BRET-acceptor-Gβ and the BRET-acceptor-Gγ are encoded by separate constructs. In this assay, an active G protein generates a BRET signal through the interaction of a free BRET-acceptor-Gβγ subunit with a Gβγ scavenger-BRET donor (reporter). This signal is quenched when Gα is deactivated and recombines with the BRET-acceptor-Gβγ to form an inactive heterotrimer. In some cell-based screening methods, cells are transfected with a recombinant target GPCR, a recombinant Gα, and a recombinant Gα. oA , expressing recombinant Gβγ scavenger (reporter) fused with a BRET donor, recombinant Gβγ fused with a BRET acceptor, recombinant RGS7 / Gβ5 (a GTPase-activating protein (GAP) for Gαi / o proteins), and recombinant GPR158.
[0192] In some methods, cells are treated with an antibody and then sequentially exposed to an agonist of the recombinant target GPCR and then an antagonist of the recombinant target GPCR to activate (generate active Gαo) and deactivate (form inactive heterotrimers), respectively, while measuring dual emission at 475±30 nm and 535±30 nm. In some methods, dual emission is measured before, during, and / or after exposing the cells to the agonist and / or antagonist of the recombinant target GPCR. In some methods, dual emission is measured for up to 60 seconds after exposing the cells to the antagonist of the recombinant target GPCR. Test cells are incubated with a substrate for the BRET donor in the presence of the antibody, and the emission of the test cells is measured at 475±30 nm (light emitted from the BRET donor) and 535±30 nm (light emitted from the BRET acceptor). The ratio of light emitted from the BRET acceptor (535 nm, 30 nm bandpass) to light emitted from the BRET donor (475 nm, 30 nm bandpass) is the test BRET ratio. In some methods, the test cells are treated with an antagonist and then the emission of the test cells at 475±30 nm and 535±30 nm is measured to determine the test BRET ratio.
[0193] The test BRET ratio can be compared with the ratio (control BRET ratio) measured in control cells incubated with a BRET donor substrate in the absence of antibody. In some methods, the control cells are incubated with a buffer solution. A test BRET ratio greater than the control BRET ratio indicates that the antibody inhibits the GAP activity of RGS7-Gβ5 modulated by GPR158. Some methods include determining the ratio in the test cells before incubation with an agonist of the recombinant target GPCR (test basal BRET ratio), and subtracting the test basal BRET ratio from the test BRET ratio to determine the difference ratio (test delta net BRET ratio). Some methods include normalizing the test delta net BRET ratio to the maximum ratio (test maximum net BRET ratio) determined in the test cells after treatment with an agonist of the recombinant target GPCR. Some methods include determining the ratio in control cells before incubation with an agonist of the recombinant target GPCR (control basal BRET ratio), and subtracting the control basal BRET ratio from the control BRET ratio to determine the difference ratio (control delta net BRET ratio). Some methods include normalizing the control delta net BRET ratio to the maximum ratio determined in the control cells after treatment with an agonist of the recombinant target GPCR (control maximum net BRET ratio). Some methods compare the test basal BRET ratio with the control basal BRET ratio. The normalized test BRET ratio can be compared with the normalized BRET ratio measured in control cells incubated with a BRET donor substrate in the absence of the antibody (normalized control BRET ratio). A normalized test BRET ratio greater than the normalized control BRET ratio indicates that the antibody inhibits the GAP activity of RGS7-Gβ5 modulated by GPR158.
[0194] In an exemplary BRET assay, the recombinant target GPCR is the dopamine D2 receptor, the recombinant Gβγ scavenger fused to the BRET donor is masGRK3ct-Nluc, the recombinant Gβγ fused to the BRET acceptor comprises Venus-156-239-Gβ1 and Venus-1-155-Gγ2 (1), and the BRET donor substrate is furimazine, as shown in Figure 4B. In an exemplary BRET assay, the recombinant target GPCR is the dopamine D2 receptor, the agonist of the recombinant target GPCR is dopamine, and the antagonist of the recombinant target GPCR is haloperidol.
[0195] In other embodiments, other GPCRs that activate Gαi / o (target GPCRs), as well as their agonists and antagonists, other Gβγ scavengers, other BRET donors, other BRET substrates, and / or other BRET acceptors, can be used in cell-based screening assays to measure the effect of antibodies on the GAP activity of RGS7-Gβ5 in cells expressing GPR158 and RGS7-Gβ5 using bioluminescence resonance energy transfer (BRET). Other exemplary FRET and BRET biosensors are described, for example, in Kim, H. et al. (2022) Front. Cell Dev. Biol. 10:1007893.
[0196] Table 2 lists exemplary Gαi / o-coupled GPCRs (target GPCRs) along with their agonists and antagonists that can be used to activate the Gαi / o proteins in screening assays for antibodies of the present invention. Column 1 lists the receptor family, column 2 lists the receptor name, column 3 lists the agonists, and column 4 lists the antagonists.
[0197] Table 2. Exemplary Gai / o-coupled target GPCRs, agonists, and antagonists [Table 2-1] [Table 2-2]
[0198] Table 3 lists exemplary GPCRs that can be used to activate Go proteins (target GPCRs) in cell-based screening assays for antibodies of the invention. Column 1 lists the receptor class, column 2 lists the ligand type, column 3 lists the receptor family, column 4 lists the receptor name (UniProt), and column 5 lists the receptor name according to the Guide to Pharmacology (IUPHAR), GtP, guidetopharmacology.org.
[0199] Table 3. Exemplary target GPCRs that can be used to activate Go [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6]
[0200] Exemplary BRET donors, substrates, and exemplary BRET acceptors are shown in Table 4 and Table 5, respectively, that can be used in screening assays for antibodies of the present invention.
[0201] Table 4: Exemplary BRET donors and substrates [Table 4]
[0202] Table 5: Exemplary BRET acceptors [Table 5]
[0203] Other exemplary FRET and BRET biosensors useful in screening assays for antibodies of the invention are shown in Figure 22 (see Kim, H. et al, (2022) Front. Cell Dev. Biol. 10:1007893). Column 1 indicates the detection step, column 2 indicates the target GPCR, column 3 indicates the ligand used, column 4 indicates the detection method, column 5 indicates the FRET or BRET pair, column 6 indicates the cell line used, column 7 indicates notes, and column 8 indicates references.
[0204] Figure 22 References: [ka] [ka] [ka]
[0205] B. Animal Models
[0206] The activity of the antibody was assessed in GPR158 knockout mice and wild-type mice, e.g., Gpr158 - / - Mouse (Knockout Mouse Programme (KOMP) (Gpr158 tm1(KOMP)Vlcg) on a C57 / Bl6 background and bred as heterozygous pairs to express Gpr158 - / - and Gpr158 + / + Antibody-treated and non-antibody-treated ex vivo brain slices can be assessed by a variety of criteria, including an increase in the number of action potentials fired across the ramp, while decreasing the amount of current required to elicit the first action potential without a change in resting membrane potential.
[0207] Testing for antibodies is usually performed in conjunction with a control in which a parallel experiment is performed but the antibody is absent (e.g., replaced by vehicle). Reduction, delay, or inhibition of signs or symptoms of the disease attributable to the antibody under test can then be assessed relative to the control. VI. Patients Suitable for Treatment
[0208] The regime may also be used to treat or prevent affective, mood or brain disorders, as well as affective, mood or brain disorders associated with depression, major mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorders.
[0209] Patients suitable for treatment include those who are at risk of disease but do not show symptoms, as well as those who currently show symptoms.Patients at risk of disease include those with known genetic risk of disease.Such individuals include those who have relatives who have experienced the disease, and those whose risk is determined by analyzing genetic or biochemical markers.Genetic markers of risk include mutations in GPR158 and mutations in other genes related to affective disorders, mood disorders or brain disorders, and / or affective disorders, mood disorders or brain disorders related to depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.
[0210] For asymptomatic patients, treatment can begin at any age (e.g., 10, 20, or 30 years of age). However, it is usually not necessary to begin treatment until the patient reaches 40, 50, 60, or 70 years of age. Treatment typically requires multiple doses over a period of time. Treatment can be monitored by assaying antibody levels over time. A diminished response indicates the need for booster doses. VII. Nucleic acids
[0211] The present invention further provides nucleic acids encoding any of the above heavy chains (e.g., SEQ ID NO: 2 or SEQ ID NO: 13). If necessary, such nucleic acids can further encode a signal peptide and be expressed together with the signal peptide linked to the variable region. The nucleic acid coding sequence can be operably linked to regulatory sequences, such as promoters, enhancers, ribosome binding sites, transcription termination signals, etc., to ensure expression of the coding sequence. The nucleic acids encoding the heavy and light chains can be present in isolated form or can be cloned into one or more vectors. The nucleic acids can be synthesized, for example, by solid synthesis or PCR of overlapping oligonucleotides. The nucleic acids encoding the heavy and light chains can be joined, for example, as a single contiguous nucleic acid within an expression vector, or can be cloned separately, for example, each in its own expression vector. VIII. Conjugated Antibodies
[0212] The conjugated antibody that specifically binds to antigens such as GPR158 is useful for detecting the presence of GPR158; for monitoring and evaluating the effectiveness of therapeutic agents that are used to treat patients diagnosed with affective disorders, mood disorders or brain disorders, or affective disorders, mood disorders or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.For example, such antibody can be conjugated with other therapeutic moieties, other proteins, other antibodies, and / or detectable labels.See WO03 / 057838; US8,455,622. Such a therapeutic moiety may be any agent that can be used to treat, combat, reverse, prevent, or ameliorate an undesirable condition or disease in a patient, such as an affective disorder, mood disorder, or brain disorder, or an affective disorder, mood disorder, or brain disorder associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.
[0213] The conjugated therapeutic moiety can include a cytotoxic agent, a cytostatic agent, a neurotrophic agent, a neuroprotective agent, a radiotherapeutic agent, an immunomodulator, or any bioactive agent that facilitates or enhances the activity of the antibody. A cytotoxic agent can be any agent that is toxic to cells. A cytostatic agent can be any agent that inhibits cell proliferation. A neurotrophic agent can be any agent, including a chemical or protein agent, that promotes the maintenance, growth, or differentiation of neurons. A neuroprotective agent can be an agent, including a chemical or protein agent, that protects neurons from acute insults or degenerative processes. An immunomodulator can be any agent that stimulates or inhibits the development or maintenance of an immunological response. A radiotherapeutic agent can be any molecule or compound that emits radiation. When such a therapeutic moiety is coupled to a GPR158-specific antibody, such as the antibody described herein, the coupled therapeutic moiety has a specific affinity for cells that express GPR158 over cells that do not express GPR158. As a result, administration of the conjugated antibody directly targets cells that express GPR158, minimizing damage to surrounding cells that do not express GPR158. This may be particularly useful for therapeutic moieties that are too toxic to administer by themselves. Furthermore, fewer therapeutic moieties may be used.
[0214] Some such antibodies can be modified to act as immunotoxins. See, e.g., U.S. Patent No. 5,194,594. For example, antibodies can be coupled to the plant-derived cytotoxin ricin using bifunctional reagents: S-acetylmercaptosuccinic anhydride for the antibody and succinimidyl 3-(2-pyridyldithio)propionate for the ricin. See Pietersz et al., Cancer Res. 48(16):4469-4476 (1998). Coupling results in the loss of ricin's B-chain binding activity without impairing the toxic potential of the ricin A-chain or the activity of the antibody. Similarly, saporin, an inhibitor of ribosome assembly, can be coupled to antibodies via a disulfide bond between chemically inserted sulfhydryl groups. See Polito et al., Leukemia 18:1215-1222 (2004).
[0215] Some such antibodies can be linked to radioisotopes, such as yttrium. 90 (90Y), Indium 111 (111In), 131 I, 99 mTc, radioactive silver (radiosilver)-111, radioactive silver-199, and bismuth 213Linking of radioisotopes to antibodies can be carried out using conventional bifunctional chelates. For linking radioactive silver-111 and radioactive silver-199, sulfur-based linkers can be used. See Hazra et al., Cell Biophys. 24-25:1-7 (1994). Linking of silver radioisotopes can involve reducing immunoglobulins with ascorbic acid. For radioisotopes such as In and Y, ibritumomab tiuxetan can be used, which reacts with such isotopes to form In-ibritumomab tiuxetan and Y-ibritumomab tiuxetan, respectively. See Witzig, Cancer Chemother. Pharmacol., 48 Suppl 1:S91-S95 (2001).
[0216] Some such antibodies can be linked to other therapeutic moieties. Such therapeutic moieties can be, for example, cytotoxic, cytostatic, neurotrophic, or neuroprotective. For example, the antibody can be conjugated to a toxic chemotherapeutic drug, such as maytansine, geldanamycin, a tubulin inhibitor, such as a tubulin-binding agent (e.g., auristatin), or a minor groove-binding agent, such as calicheamicin. Other representative therapeutic moieties include agents known to be useful in treating, managing, or ameliorating affective, mood, or brain disorders, or affective, mood, or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.
[0217] Antibodies can also be coupled to other proteins. For example, antibodies can be coupled to Fynomers. Fynomers are small binding proteins (e.g., 7 kDa) derived from the human Fyn SH3 domain. They can be stable and soluble and lack cysteine residues and disulfide bonds. They can be engineered to bind to target molecules with the same affinity and specificity as antibodies. Fynomers are suitable for creating antibody-based multispecific fusion proteins. For example, Fynomers can be fused to the N- and / or C-termini of antibodies to create bispecific and trispecific FynomAbs with different architectures. Fynomers can be selected using Fynomer libraries and screening techniques using FACS, Biacore, and cell-based assays, which allow for efficient selection of Fynomers with optimal properties. Examples of phynomers are disclosed in Grabulovski et al., J. Biol. Chem. 282:3196-3204 (2007); Bertschinger et al., Protein Eng. Des. Sel. 20:57-68 (2007); Schlatter et al., MAbs. 4:497-508 (2011); Banner et al., Acta. Crystallogr. D. Biol. Crystallogr. 69(Pt6):1124-1137(2013); and Brack et al., Mol. Cancer Ther. 13:2030-2039 (2014).
[0218] The antibodies disclosed herein may also be coupled or conjugated to one or more other antibodies (e.g., to form antibody heteroconjugates), which may bind to a different epitope within GPR158 or which may bind to a different target antigen.
[0219] The antibody can also be coupled with a detectable label.Such antibody can be used for, for example, diagnosing affective disorders, mood disorders or brain disorders, and / or affective disorders, mood disorders or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia or anxiety disorder, and / or assessing the effectiveness of treatment.Such antibody is particularly useful for carrying out such determinations on subjects who have or are susceptible to affective disorders, mood disorders or brain disorders, and / or affective disorders, mood disorders or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia or anxiety disorder, or on suitable biological samples obtained from such subjects. Representative detectable labels that can be coupled or linked to antibodies include various enzymes, such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; prosthetic groups, such as streptavidin / biotin and avidin / biotin; fluorescent materials, such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; luminescent materials, such as luminol; bioluminescent materials, such as luciferase, luciferin, and aequorin; radioactive silver-111, radioactive silver-199, bismuth, etc. 213 , iodine ( 131 I, 125 I, 123 I, 121 I), carbon ( 14 C), sulfur ( 5 S), tritium ( 3 H), indium ( 115 In, 113 In, 112 In, 111 In), technetium ( 99 Tc), thallium ( 201 Ti), Gallium ( 68 Ga, 67 Ga), palladium ( 103Pd), molybdenum ( 99 Mo), xenon ( 133 Xe), fluorine ( 18 F), 153 Sm, 177 Lu, 159 Gd, 149 Pm, 140 La, 175 Yb, 166 Ho, 90 Y, 47 Sc, 186 Re, 188 Re, 142 Pr, 105 Rh, 97 Ru, 68 Ge, 57 Co, 65 Zn, 85 Sr, 32 P, 153 Gd, 169 Yb, 51 Cr, 54 Mn, 75 Se, 113 Sn, and 117 These include radioactive materials such as Tin; positron-emitting metals using various positron emission tomography techniques; non-radioactive paramagnetic metal ions; and molecules radiolabeled or conjugated with certain radioisotopes.
[0220] Linking of radioisotopes to antibodies can be carried out using conventional bifunctional chelates. For linking radioactive silver-111 and radioactive silver-199, sulfur-based linkers can be used. See Hazra et al., Cell Biophys. 24-25:1-7 (1994). Linking of silver radioisotopes can involve reducing immunoglobulins with ascorbic acid. For radioisotopes such as In and Y, ibritumomab tiuxetan can be used, which reacts with such isotopes to form In-ibritumomab tiuxetan and Y-ibritumomab tiuxetan, respectively. See Witzig, Cancer Chemother. Pharmacol., 48 Suppl 1:S91-S95 (2001).
[0221] Therapeutic moieties, other proteins, other antibodies, and / or detectable labels can be coupled or conjugated to the antibodies of the invention directly or indirectly through an intermediate (e.g., a linker). For example, Arnon et al., “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy,” in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., “Antibodies For Drug Delivery,” in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987);Thorpe, “Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review,” in Monoclonal Antibodies 84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985);“Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer See, for example, "Monoclonal Antibodies For Cancer Detection And Therapy," in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985); and Thorpe et al., Immunol. Rev., 62:119-58 (1982). Suitable linkers include, for example, cleavable and non-cleavable linkers.A variety of linkers can be employed that release the coupled therapeutic moiety, protein, antibody, and / or detectable label under acidic or reducing conditions, upon exposure to specific proteases, or under other defined conditions. IX. Pharmaceutical Compositions and Methods of Use
[0222] In prophylactic applications, the antibody or antibody-inducing agent or pharmaceutical composition thereof is administered to a patient susceptible to or otherwise at risk of a disease (e.g., an affective, mood, or brain disorder) in a regime (dosage, frequency, and route of administration) effective to reduce the risk, reduce the severity, or delay the onset of at least one sign or symptom of the disease. In therapeutic applications, the antibody or antibody-inducing agent is administered to a patient suspected of or already suffering from a disease (e.g., an affective, mood, or brain disorder) in a regime (dosage, frequency, and route of administration) effective to ameliorate or at least inhibit further deterioration of at least one sign or symptom of the disease.
[0223] A regime is considered to be therapeutically or prophylactically effective if individual treated patients obtain an outcome that is more favorable than the average outcome in a control population of comparable patients not treated according to the methods of the invention, or if a more favorable outcome in treated patients versus control patients is demonstrated at the p<0.05 or p<0.01 or even p<0.001 level in a controlled clinical trial (e.g., a Phase II, Phase II / III or Phase III trial).
[0224] The effective dose will vary depending on many different factors, such as the means of administration, the target site, the physiological state of the patient, whether the patient is human or animal, other agents administered, and whether the treatment is prophylactic or therapeutic.
[0225] Exemplary dosage ranges for antibodies are about 0.01 mg / kg to 60 mg / kg, or about 0.1 mg / kg to 3 mg / kg, or 0.15-2 mg / kg, or 0.15-1.5 mg / kg of patient body weight. The antibody can be administered at such doses once daily, every other day, once weekly, once every two weeks, once monthly, four times a year, or according to any other schedule determined by empirical analysis. Exemplary treatments require administration over an extended period of time, e.g., at least six months, in multiple doses. Additional exemplary treatment regimes require administration every two weeks, once monthly, or once every three to six months.
[0226] The amount of active agent for human administration varies from 0.1 μg to 500 μg per patient, more commonly from 1 μg to 100 μg or 1 μg to 10 μg per injection. The timing of injections can vary widely, from once a day to once a year to once every 10 years. A typical regimen consists of immunization followed by booster injections at time intervals such as every 6 weeks or every 2 months. Another regimen consists of immunization followed by booster injections 1 month, 2 months, and 12 months later. Another regimen requires lifelong injections every 2 months. Alternatively, booster injections can be administered at irregular intervals as indicated by immune response monitoring.
[0227] Antibodies or agents for inducing antibodies are preferably administered by a peripheral route (i.e., a route by which the administered or induced antibody crosses the blood-brain barrier to reach the intended site in the brain). Routes of administration include local, intravenous, oral, subcutaneous, intra-arterial, intracranial, intrathecal, intraperitoneal, intranasal, intraocular, or intramuscular. Preferred routes for administering antibodies are intravenous and subcutaneous. Preferred routes for active immunization are subcutaneous and intramuscular. This type of injection is most typically performed into the arm or leg muscles.
[0228] Pharmaceutical compositions for parenteral administration are preferably sterile, substantially isotonic, and manufactured under GMP conditions. Pharmaceutical compositions can be provided in unit dosage form (i.e., a single dosage). Pharmaceutical compositions can be formulated using one or more physiologically acceptable carriers, diluents, excipients, or adjuvants. The formulation will depend on the selected route of administration. For injection, the antibody can be formulated in an aqueous solution, preferably in a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline, or acetate buffer (to reduce discomfort at the injection site). The solution may contain formulating agents such as suspending, stabilizing, and / or dispersing agents. Alternatively, the antibody may be in lyophilized form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0229] This regimen can be administered in combination with another agent that is effective in treating or preventing the disease being treated.For example, in the case of affective disorders, mood disorders or brain disorders, this regimen can be administered in combination with, for example, selective serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), serotonin modulators and stimulants (SMSs), serotonin antagonists and reuptake inhibitors (SARIs), norepinephrine-dopamine reuptake inhibitors (NDRIs), tricyclic antidepressants (TCAs), tetracyclic antidepressants (TeCAs), monoamine oxidase inhibitors (MAOIs), or NMDA receptor antagonists.Exemplary NMDA receptor antagonists are ketamine, esketamine, or dextromethorphan.
[0230] The antibody is administered in an effective regimen, i.e., at a dosage, route of administration, and frequency that delays the onset of, reduces the severity of, inhibits further deterioration, and / or improves at least one sign or symptom of the disorder being treated.If the patient has already suffered from the disorder, the regimen can be referred to as a therapeutically effective regimen.If the patient has an increased risk of the disorder compared with the general population but has not yet experienced symptoms, the regime can be referred to as a prophylactically effective regimen.In some cases, therapeutic or prophylactic efficacy can be observed for individual patients compared with a control based on past history or the past experience of the same patient.In other cases, therapeutic or prophylactic efficacy can be demonstrated in preclinical or clinical trials for a group of treated patients compared with a control group of untreated patients.
[0231] Exemplary dosages of antibodies are 0.1-60 mg / kg (e.g., 0.5 mg / kg, 3 mg / kg, 10 mg / kg, 30 mg / kg, or 60 mg / kg), or 0.5-5 mg per kg of body weight (e.g., 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, or 5 mg / kg), or 10-4000 mg or 10-1500 mg as a fixed dosage. Dosage will depend on the patient's condition and response to previous treatment, if any, including whether the treatment is prophylactic or therapeutic and whether the disorder is acute or chronic, among other factors.
[0232] Administration can be parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Some antibodies can be administered intravenously or subcutaneously into the systemic circulation. Intravenous administration can be by infusion over a period of, for example, 30 to 90 minutes.
[0233] The frequency of administration depends on, among other factors, the half-life of the antibody in circulation, the patient's condition, and the route of administration. The frequency can be once a day, once a week, once a month, four times a year, or at irregular intervals depending on changes in the patient's condition or the progression of the disorder being treated. An exemplary frequency for intravenous administration is between once a week and four times a year over a continuous course of treatment, although more frequent or less frequent administration is also possible. For subcutaneous administration, an exemplary frequency is once a day to once a month, although more frequent or less frequent administration is also possible.
[0234] The number of doses administered depends on whether the disorder is acute or chronic and the response of the disorder to treatment.For acute disorders or acute exacerbations of chronic disorders, 1 to 10 doses are often sufficient.Sometimes, a single bolus dose, divided into portions as needed, is sufficient for acute disorders or acute exacerbations of chronic disorders.For recurrence of acute disorders or acute exacerbations, treatment can be repeated.For chronic disorders, antibody can be administered at regular intervals for at least 1 year, 5 years, or 10 years, or throughout the patient's lifetime, for example, once a week, once every 2 weeks, once a month, 4 times a year, once every 6 months. X. Diagnostic and Monitoring Methods
[0235] Also provided is a method for detecting GPR158 in a subject, for example, by measuring GPR158 in a sample from the subject or by in vivo imaging of GPR158 in the subject.Such a method is useful for diagnosing or confirming the diagnosis of affective disorder, mood disorder or brain disorder, or affective disorder, mood disorder or brain disorder associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder, or susceptibility to the same.This method can also be used for asymptomatic subjects.This method is also useful for monitoring the disease progression and / or response to treatment in subjects who have previously been diagnosed with affective disorder, mood disorder or brain disorder, or affective disorder, mood disorder or brain disorder associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.
[0236] The method works by administering a reagent to a subject, such as any of the antibodies that bind to GPR158 described in this application (e.g., llama, humanized, chimeric, or veneered Nb20 antibodies), and then detecting the agent after it binds. If desired, antibody fragments lacking the full-length constant region, such as Fabs, can be used to avoid a filtered response. In some methods, the same antibody can function as both a treatment reagent and a diagnostic reagent.
[0237] The diagnostic reagent can be administered to the patient's body by intranasal or intravenous injection, or directly into the brain by intracranial injection or by drilling a hole in the skull. The dosage of the reagent should be within the same range for the treatment method. Typically, the reagent is labeled, but in some methods, the primary reagent with affinity for GPR158 is unlabeled, and a secondary labeling agent is used to bind to the primary reagent. The choice of label depends on the detection means. For example, fluorescent labels are suitable for optical detection. Paramagnetic labels are suitable for tomographic detection without surgical intervention. Radioactive labels can also be detected using positron emission tomography (PET) or single-photon emission computed tomography (SPECT).
[0238] Biological samples obtained from subjects with, suspected of, or at risk of having affective disorders, mood disorders, or brain disorders, or affective disorders, mood disorders, or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder can be contacted with the antibody disclosed herein to assess the presence of GPR158.For example, the level of GPR158 in such subjects can be compared with the level of GPR158 present in healthy subjects.Alternatively, the level of GPR158 in such subjects who are receiving treatment for affective disorders, mood disorders, or brain disorders can be compared with the level of GPR158 in subjects who are not receiving treatment for affective disorders, mood disorders, or brain disorders, or affective disorders, mood disorders, or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.Some such tests involve biopsy of tissues obtained from such subjects. ELISA assays may also be useful methods, for example, for assessing GPR158 in body fluid samples. XI. Kit
[0239] The present invention further provides kits (e.g., containers) containing the antibodies disclosed herein and associated materials, such as instructions for use (e.g., package inserts). The instructions can include, for example, instructions for administration of the antibody and, optionally, one or more additional agents. The antibody container can be a unit dose, a bulk package (e.g., a multi-dose package), or a subunit dose.
[0240] Package insert refers to instructions customarily included in commercial packaging for a therapeutic product that contain information regarding the indications, usage, dosage, administration, contraindications and / or warnings regarding the use of such therapeutic product.
[0241] The kit may comprise a second container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and dextrose solution. The second container may also include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes. XII. Other Applications
[0242] Antibodies can be used to detect GPR158 or its fragments in clinical diagnostic or treatment settings, or in research. For example, antibodies can be used to detect the presence of GPR158 in a biological sample. The binding of the antibody to a biological sample can be compared with the binding of the antibody to a control sample. The control sample and the biological sample can contain cells of the same tissue origin. The control sample and the biological sample can be obtained from the same individual or different individuals, and on the same or different occasions. If desired, multiple biological samples and multiple control samples can be evaluated on multiple occasions to protect against random variations unrelated to differences between samples. The biological sample and the control sample can then be directly compared to determine whether antibody binding to the biological sample (i.e., the presence of GPR158) is increased, decreased, or the same as that of the antibody binding to the control sample. Increased antibody binding to the biological sample compared to the control sample indicates the presence of GPR158 in the biological sample. In some cases, the increase in antibody binding is statistically significant. Optionally, antibody binding to the biological sample is at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, or 100-fold greater than antibody binding to a control sample.
[0243] Furthermore, antibodies can be used to detect the presence of GPR158 in biological samples to monitor and evaluate the effectiveness of therapeutic agents used to treat patients diagnosed with affective disorders, mood disorders or brain disorders, or affective disorders, mood disorders or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.Biological samples from patients diagnosed with affective disorders, mood disorders or brain disorders, or affective disorders, mood disorders or brain disorders associated with depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder are evaluated to establish the baseline of antibody binding to the sample (i.e., the baseline of GPR158 presence in the sample), before starting treatment with therapeutic agents.In some cases, multiple biological samples from patients are evaluated at multiple times to establish both a baseline and a measure of random fluctuations unrelated to treatment. The therapeutic agent is then administered according to a regimen. The regimen may include administering the agent multiple times over a period of time. If necessary, antibody binding (i.e., the presence of GPR158) is assessed on multiple occasions for multiple biological samples from the patient, both to establish a measure of random variation and to indicate the trend of response to immunotherapy. The various assessments of antibody binding to biological samples are then compared. If only two assessments are performed, the two assessments can be directly compared to determine whether antibody binding (i.e., the presence of GPR158) has increased, decreased, or remained the same between the two assessments. If more than two measurements are performed, the measurements can be analyzed over a time course, starting from before treatment with the therapeutic agent and progressing through the course of treatment. Assessment of antibody binding may be performed in conjunction with assessment of other signs and symptoms associated with an affective, mood, or brain disorder, or an affective, mood, or brain disorder associated with depression, major mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or anxiety disorder.
[0244] Antibodies can also be used as research reagents for laboratory research to detect GPR158 or its fragments.For such use, antibodies can be labeled with fluorescent molecules, spin-label molecules, enzymes, or radioisotopes, and can be provided in the form of a kit with all the reagents necessary to carry out detection assays.Antibodies can also be used to purify GPR158 or GPR158 binding partners, for example, by affinity chromatography.
[0245] It should be understood that the present disclosure is not limited to the particular embodiments disclosed, and that modifications and other embodiments are intended to be included within the scope of the appended claims. Many variations and adaptations of the aspects described herein will be apparent to those skilled in the art. These variations and adaptations are intended to be encompassed by the teachings of the present disclosure and within the scope of the claims herein. [Example]
[0246] Example 1 Development and characterization of nanobodies targeting mGlyRs
[0247] Given the lack of selective chemical probes for mGlyR, we attempted to obtain small protein ligands that alter mGlyR activity. Given the extensive extracellular elements present in mGlyR, such a strategy is promising, given recent success with other class C GPCRs (51-52). We chose to generate single-domain antibodies (nanobodies) due to their high affinity for the target and novel potential for therapeutic translation. A phage library prepared from a llama immunized with recombinant GPR158 (mGlyR) was screened against HEK293 cell membranes containing mGlyR (Figure 5A). After three rounds of enrichment and rescreening, 61 individual clones were selected. The corresponding nanobodies were isolated after expression in E. coli and tested for binding to mGlyR using a flow cytometry strategy (Figure 5B). Three clones showed positive interactions with GPR158-expressing cells. Of these clones, clone number 20 (Nb20) showed the most robust signal and was selected for further study.
[0248] We first characterized Nb20 binding to mGlyRs using flow cytometry. Cells transfected with Venus-tagged full-length GPR158 were incubated with purified myc-tagged Nb20, and the interaction with the cells was monitored with an APC-conjugated antibody against myc (Fig. 5B). Using this approach, we were able to detect robust Nb20 labeling of the majority of GPR158-transfected cells when an excess amount of Nb20 was used in the assay (Fig. 5C). Control experiments using cells lacking GPR158, Nb20, or both did not show Nb20 labeling of cells (Fig. 5C; Fig. 6A). Titration experiments using increasing concentrations of Nb20 demonstrated a saturation profile with an EC50 of approximately 10 nM (Figs. 5D, 5E). Addition of the mGlyR ligand glycine did not affect the binding of Nb20 to mGlyR (Fig. 7). This interaction was specific to mGlyR, as no binding of Nb to other GPCRs, including the related GPR179 and the unrelated D1R, was observed (Fig. 6B).
[0249] Next, we characterized binding using surface plasmon resonance (SPR). In these experiments, we purified the extracellular portion of recombinantly expressed mGlyR (Ecto-mGlyR; SEQ ID NO: 12, amino acid residues 1-417 of SEQ ID NO: 1, GPR158 / mGlyR) tagged with an Fc tag and immobilized it on an SPR chip using a mouse anti-human IgG CH2 monoclonal antibody (Figure 5F). Application of increasing concentrations of Nb20 demonstrated robust binding to the immobilized Ecto-mGlyR, with an estimated K D =375nM(χ 2 =1.07;K ON =4.19×10 4 ms -1 and K. OFF =1.57×10 -2 s -1 ) (Figure 5G). Overall, these data support the development of a selective affinity tool for mGlyRs—Nb20.
[0250] Example 2 Nb20 inhibits mGlyR signaling via the RGS7 / Gβ5 complex.
[0251] To investigate the functional consequences of the interaction between mGlyR and Nb20, we analyzed the ability of mGlyR to modulate the activity of the GTPase-activating protein (GAP) complex RGS7 / Gβ5, through which mGlyR signals. We used a cell-based assay to monitor GAP activity by tracking the kinetics of G protein deactivation (Figure 8A). In this assay, GPCR-stimulated G protein activation generates a BRET signal when the free Venus-Gβγ subunit interacts with the masGRK3CT-Nluc reporter. This signal is quenched when Gα deactivation is induced by GPCR antagonism and reassociates with Venus-Gβγ to form an inactive heterotrimer. As previously reported (48), we found that introduction of RGS7 / Gβ5 accelerated the deactivation of its substrate, Gαo (Figures 8B and 8D). Application of Nb20 did not significantly affect baseline Gαo deactivation or any of the processes assisted by RGS7 / Gβ5 (Figures 8B, 8D). However, when mGlyR was coexpressed with RGS7 / Gβ5, Nb20 significantly slowed Gαo deactivation (Figures 8C, 8D), suggesting that Nb20 specifically inhibits the GAP activity of RGS7 / Gβ5 through mGlyR. In a dose-response study, the IC of Nb20 on GPR158 was 1.25 (Figures 8C, 8D). 50The β-glucan-1-phosphate dehydrogenase activity (GlyR) activity was approximately 6 nM (Figure 8E). We further explored the effect of Nb20 on mGlyR-mediated GAP activity inhibition through glycine, the endogenous ligand of mGlyR. We found that both glycine and Nb20 produced very similar inhibition of GAP activity, and their combinatorial application showed no blocking or additive effects, thus indicating no interaction between these two ligands (Figures 9A-9B). In summary, these studies demonstrate that Nb20 functions as a selective inhibitor of GAP activity mediated by the mGlyR complex.
[0252] Example 3 Nb20 exerts antidepressant effects in mice
[0253] Functional data indicate that Nb20 blocks the ability of the mGlyR-RGS7 / Gβ5 complex to regulate G protein signaling. Previous studies have shown that genetic deletion of either mGlyR (29) or RGS7 (50) results in a substantial antidepressant phenotype and stress resilience in mice. Therefore, we next tested whether in vivo administration of Nb20 has similar behavioral effects. Mice were injected with either Nb20 (9.6 μg) or vehicle control, delivered intracerebrally (Figure 10A), and 24 h later, evaluated in a panel of behavioral tests assessing various aspects of anxiety / depression-like behavior (Figure 10B). We found that mice receiving Nb20 buried fewer marbles in the marble-burying test and spent less time immobile in the tail suspension test and forced swimming test compared with control animals, reflecting changes in depression-related phenotypes, but did not behave differently from controls in the elevated plus maze, which broadly measures anxiety-like components (Fig. 10B). Calculation of an overall emotionality score based on multiple measures confirmed that mice treated with Nb20 exhibited a significant antidepressant-like phenotype (Fig. 10C). Surprisingly, these behavioral differences between groups persisted for at least 2 weeks after treatment (Fig. 11). To confirm the specificity of the effect, we used a mutant Nb20 that is unable to bind to mGlyRs. * (SEQ ID NO: 13) was used. Mice were mutated Nb20 * We found that treatment with nanobodies did not produce any significant effects in any of the paradigms used (Figure 12). * Nb20 is CDR-H1(Nb20 * CDR-H1, SEQ ID NO: 14) and CDR-H2 (Nb20 * The CDR-H2 is different from that of Nb20 (Nb20 CDR-H3, SEQ ID NO: 15), and the CDR-H3 is identical to that of Nb20 (Nb20 CDR-H3, SEQ ID NO: 5).
[0254] To further explore the therapeutic utility of Nb20, we next assessed its effects in a depression model in which mice were exposed to a chronic mild stress paradigm. In this study, Nb20 was administered noninvasively via intranasal delivery, given the translational relevance of this method to the treatment of depression (53-55). Furthermore, the effects were compared with those of rapid antidepressant treatment with ketamine delivered in the same manner (Figures 10D and 10E). When mice were tested 24 h after injection, no statistically significant behavioral changes were observed in mice treated with ketamine or Nb20, and in the tail suspension test, the Nb20-treated group exhibited significantly better behavioral responses than the control group. * Nb20 showed a slight trend toward a significant increase in the PFC compared with mice treated with Nb20 (TST; p=0.012; one-way ANOVA) (Figure 13). Therefore, we repeated the treatment (Figure 10E) and re-evaluated the mice again 24 hours after the second treatment. Surprisingly, we found that intranasal delivery of Nb20 produced the same rapid and potent antidepressant effect in stressed mice (Figure 10F). The magnitude of this effect was comparable to the antidepressant effect of ketamine across all behavioral paradigms. Consistent with the antidepressant effect, postmortem analysis of the brain revealed that Nb20-treated mice significantly upregulated BDNF, a marker of emotional state, in the PFC, whereas control Nb20 mice did not. * This was not observed in mice treated with Nb20 (Figure 14). Overall, these results demonstrate that Nb20 exerts a long-lasting antidepressant effect in mice, including in models of stress-induced depression.
[0255] Example 4 Inhibition of mGlyRs with Nb20 modulates the physiological properties of mPFC neurons.
[0256] Finally, we attempted to assess the effects of Nb20 on the activity of intact neural networks ex vivo by investigating the intrinsic properties of layer II–III neurons in the prelimbic cortex, where mGlyRs are primarily expressed (57). Knockout of mGlyRs or inhibition of mGlyRs with the endogenous ligand glycine has been shown to increase the excitability of pyramidal neurons in layers II–III (56). Therefore, we incubated brain slices with Nb20 for 10 min, followed by recording, to assess the excitability of layer II–III neurons compared with untreated slices or control slices containing Nb20, which lacks binding to mGlyRs. * Compared to slices incubated with nanobodies (Figure 15A), preincubation with Nb20 significantly increased the number of action potentials fired over the ramp, while reducing the amount of current required to elicit the first action potential (Figures 15B, 15C, 15D), with no change in the resting membrane potential (Figure 15E). In contrast, control Nb20 * had no effect on neuronal firing, rheobase, or resting membrane potential (Figures 15B, 15C, 15D). Overall, these results demonstrate that mGlyR inhibition with Nb20 specifically increases the excitability of layer II-III neurons in the prelimbic cortex, an effect previously associated with antidepressant effects.
[0257] Example 5 material and method
[0258] animal All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the UF Scripps Biomedical Research Institute in accordance with NIH guidelines. Gpr158- / - mice were purchased from KOMP (Gpr158tm1(KOMP)Vlcg), maintained on a C57 / Bl6 background, and bred as heterozygous pairs to generate Gpr158- / - and Gpr158+ / + littermates. After weaning, males and females were separated into separate groups and housed under standard conditions in a pathogen-free facility with a 12:12 light:dark cycle and free access to food and water. For the chronic undefined stress paradigm, wild-type male and female adult (8-week-old) C57Bl / 6J mice (Charles River, Massachusetts) were acclimatized for 1 week before experimental manipulation. These mice were housed singly at room temperature (approximately 24°C) under a 12-hour light / dark cycle (07:00-19:00) with free access to water and food except during testing.
[0259] cDNA constructs Dopamine D2 receptor (cDNA Resource Center: Cat#DRD0200001), RGS7 (GenBank: AY587875), Gβ5 (GenBank: NM_016194), and Gα oA (cDNA Resource Center: Cat# GNA0OA0000) was purchased from the cDNA Resource Center (worldwideweb.cdna.org). masGRK3ct-Nluc, Venus-156-239-Gβ1, and Venus-1-155-Gγ2 were synthesized in pcDNA3.1+ using GenScript. Gα oAThe pCMV5 plasmid encoding GPR158 was a gift from H. Itoh (Nara Institute of Science and Technology, Japan). The GPR158 ectodomain (amino acids 1–417) was subcloned into a previously described Fc- and 6×His-tagged vector (78). Nanobody production was performed using the pCANTAB vector (phage display), and promising candidates, including Nb20, were subcloned into pET28a. A control non-binding nanobody (Nb20) was also subcloned into pET28a. * To generate Nb20 cDNA, PCR-directed mutagenesis was used with two sets of primers to mutate the 30IGNIYI35 (SEQ ID NO: 20) sequence in CDR1 with the 30GGAGAG35 (SEQ ID NO: 21) sequence and the 54RTVRWTKYE62 (SEQ ID NO: 22) sequence in CDR2 with the 54GAVGGAAAG62 (SEQ ID NO: 23) sequence: CDR1 forward primer: GCGGCGGTGCTGGCGCTGGCATGGGCTGGTACCGCCAG (SEQ ID NO: 16) CDR1 reverse primer: CGCCAGCACCGCCGCTTCCAGAGGCTGCACAGGAGAGTC (SEQ ID NO: 17) CDR2 forward primer: CAGCCGCAGCCGCAGCCGCAGCCGCAGCCGACTATGCAGACTCCGTAAAGGGC (SEQ ID NO: 18) CDR2 reverse primer: CTGCGGCTGCGGCTGCGGCTGCAGTTGCGACCAGCTCGCG (SEQ ID NO: 19)
[0260] Chemicals and drugs The following chemicals were used: dopamine hydrochloride (MilliporeSigma Cat#H8502), haloperidol (MilliporeSigma Cat#H1512), Dulbecco's phosphate-buffered saline (PBS) with 0.5 mM MgCl2 and 0.1% glucose (Gibco Cat#10010-023), glycine (National Diagnostics Cat#EC-405), Dulbecco's modified Eagle's medium (Thermo Fisher Scientific Cat#11965-092), fetal bovine serum (Genesee Scientific Cat#25-550), sodium pyruvate (Thermo Fisher Scientific Cat#11360-070), MEM non-essential amino acids (Thermo Fisher Scientific Cat#11140-050), penicillin-streptomycin (Thermo Fisher Scientific Cat#15140-122), and Matrigel (Corning Cat#356230), METAFECTENE® PRO (RKP203 / RK092820, Biontex Germany), Dulbecco's Phosphate Buffered Saline (MilliporeSigma Cat#D5652), PEG6000 / 2M NaCl (Teknova Cat#P4168), Nano-Glo Luciferase (N113B Promega), Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich Cat#I6758), Kanamycin (Thermo Fisher Scientific Cat#11815032). The following chemicals were prepared: LEW (50 mM NaH2PO4, 300 mM NaCl, pH adjusted to 8.0 with NaOH), 2xYT (16.0 g / L tryptone, 10 g / L yeast extract, 5 g / L sodium chloride, final pH 6.8 ± 0.2, 25°C, autoclaved)
[0261] Llama immunization, phage display One llama was immunized with mGlyR-expressing HEK293 cell membranes at Eurogentec (Belgium) in strict accordance with good animal practices in accordance with EU animal welfare legislation. Blood samples were collected from the immunized llama 87 days after immunization, and RNA was extracted from leukocytes using the LeukoLOCK Total RNA Isolation system (Life Technologies Cat# AM1923) according to the manufacturer's instructions. The extracted RNA was reverse transcribed, and cDNA was amplified by PCR using eight primer pairs designed to amplify the non-conventional IgG2 and IgG3 variable heavy chain-only domains (VHHs), respectively, incorporating NotI and SfiI cleavage sites (the SfiI cleavage site is bolded in the forward primer sequence below, and the NotI cleavage site is bolded in the reverse primer sequence below).
[0262] Forward primer: VH_11 (SEQ ID NO: 6): [ka] VH_12 (SEQ ID NO: 7): [ka] VH_14 (SEQ ID NO: 8): [ka] VH_13 (SEQ ID NO: 9): [ka]
[0263] Reverse primer VH_sh (SEQ ID NO: 10): [ka] VH_lg (SEQ ID NO: 11): [ka]
[0264] The amplified cDNA was purified, digested with NotI and Sfil, and then ligated into the phagemid vector pCANTAB5 and electroporated into competent E. coli TG1 cells. Bacteria were grown in 2xYT broth containing 2% glucose at 37°C with agitation until OD 600nm The cells were grown until the β-amyloid ratio reached 0.5. Then, helper phage KM13 (2 × 10 11 (units) was added and left at 37°C for 30 minutes without stirring. Infected bacteria were pelleted by centrifugation at 4000g for 20 minutes at 4°C, and the pellet was resuspended in 2xYT containing 120 μg / ml ampicillin and 50 μg / ml kanamycin. The phage library was grown overnight at 37°C with stirring. Phage expressing the nanobody library were collected and purified by centrifugation at 8000g for 15 minutes at 4°C, and the supernatant was precipitated with 20% PEG6000 / 2.5M NaCl for 1 hour at 4°C, followed by centrifugation at 8000g for 15 minutes at 4°C. The pellet was resuspended in PBS-glycerol 15% and stored at +4°C.
[0265] Identification of nanobodies by phage library screening To obtain anti-mGlyR-specific nanobody clones, we first performed a two-step depletion. 12The library containing the phage units was incubated for 1 hour at room temperature in the first well of a MaxiSorp plate (ThermoFisher Scientific Cat# 441653) coated with 100 μg of mock-transfected HEK293 cell membranes, and the supernatant was transferred to a second, identically coated well and left at room temperature for 1 hour to reduce nonspecific binders. A final selection step was performed using the remaining phage, which had been incubated for 2 hours at room temperature in one well coated with 100 μg of mGlyR-expressing cell membranes. After washing, bound phage were eluted with 50 mM Tris, pH 8, 1 mM CaCl2, 1 μg / ml trypsin for 15 minutes at room temperature. The eluted phage were harvested and amplified overnight with infected E. coli TG1 cells in 2xYT broth containing ampicillin and 2% glucose at 30°C with agitation. The following day, 2x10 9 100 units of helper phage KM13 (AKA VCSM13 Agilent Technologies Cat# 2002521) was added and incubated at 37°C for 1 hour, followed by centrifugation at 3,000g for 10 minutes at room temperature. The pellet was resuspended in 2xYT broth containing 100 μg / ml ampicillin and 25 μg / ml kanamycin and incubated overnight at 30°C with agitation. To isolate TG1 cells and amplified phage, the overnight culture was centrifuged at 3,000g for 30 minutes at 4°C, and the phage in the supernatant was precipitated with 20% PEG-6000 / 2.5M NaCl on ice for 30 minutes, followed by centrifugation at 10,000g for 10 minutes at 4°C. The pellet was resuspended in PBS with 15% glycerol and stored at -20°C; the remainder was used for a second round of panning selection as previously described. A total of three rounds of panning were performed, resulting in the identification of 61 individual clones. Each clone was directly produced from an individual TG1 colony induced with isopropyl-β-26-D-thiogalactopyranoside (IPTG) for screening by flow cytometry. Protein concentrations in the supernatants were determined using UV spectroscopy (Nanodrop).
[0266] Protein production and purification Individual nanobody cDNAs were fused at the C-terminus with c-myc and 8xhis tags, subcloned into the pET28a vector using an in-fusion HD cloning kit (Takara Bio Cat#102518), and sequenced. Freshly transformed E. coli BL21 DE3 (New England Biolabs Cat#C2527H) with the nanobody-encoding pET28a plasmids were grown at OD in Terrific Broth (Kd Medical Inc Cat#501018968) containing 50 μg / ml kanamycin at 37°C with shaking at 220 rpm. 280nm The bacteria were grown until the pH reached [0.6-0.8]. Protein expression was then induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG), and the bacteria were grown overnight at 28°C with shaking at 220 rpm. The bacteria were harvested, centrifuged, and the pellet was lysed by sonication in LEW 1X at 4°C. After centrifugation at 17,000 g for 30 minutes at 4°C, the periplasmic solution was collected and purified on a Ni-IDA column (Macherey Nagel Cat# 745160) according to the manufacturer's recommendations. Ecto-GPR158-Fc was produced in HEK293FT cells (supernatant), purified on a nickel column, and dialyzed / concentrated using Amicon tubing (30 kDa). The protein concentration in the supernatant was determined using UV spectroscopy (Nanodrop).
[0267] Cryo-EM sample preparation and data acquisition Cryo-EM samples were prepared as previously described (32). The purified Nb20-mGlyR-RGS7-Gβ5 complex protein sample was prepared for cryo-electron microscopy (cryo-EM) imaging. A total of 3.0 μL of protein sample was applied to a glow-discharged 200-mesh gold grid (UltraAufoil R1.2 / 1.3) inside an FEI Vitrobot Mark IV (Thermo Fischer Scientific). The Vitrobot was maintained at 4°C and 100% humidity. Excess sample was removed before blotting using a blotting force of 2, a blotting time of 2 seconds, and a wait time of 20 seconds. The grids were then plunge-frozen in liquid ethane to preserve their vitrified state.
[0268] Cryo-EM imaging of the Nb20-mGlyR-RGS7-Gβ5 protein complex was performed using a 300 kV Titan Krios electron microscope equipped with a Gatan K3 Summit direct electron detection (DED) camera (Gatan, Pleasanton, CA, USA) and a post-column GIF quantum energy filter operated in counting mode. The microscope was calibrated to a magnification of 105,000, resulting in a nominal pixel size of 0.873 Å. A total of 6689 movies were collected over a defocus range of -1.5 to -2.0 μm. - / Å 2 A total dose of approximately 12.5e per frame was applied over 40 frames. - This was achieved by using a dose rate of 1 / sec / physical pixel, resulting in a total exposure time of 2.5 seconds.
[0269] Image processing and 3D reconstruction The mGlyR cryo-EM dataset was processed using RELION (79) and cryoSPARC (80). 6689 movies were first motion-corrected for beam-induced motion using MotionCor2 in RELION (81). The motion-corrected images were then imported into cryoSPARC (80), and the patch contrast transfer function (CTF) estimation tool was used for CTF estimation.
[0270] To select particles, we used the TOPAZ algorithm, which employs a convolutional neural network algorithm implemented in CryoSparc (82). A training set of 1,000 micrographs was used to generate a training model, which was then used to select particles across the entire dataset, resulting in a total of 3,247,619 particles. These particles were then extracted from the micrographs in a box size of 340. The extracted particles were subjected to three rounds of reference-free 2D classification, and low-quality particles were discarded. Protein particles showing favorable 2D class means were combined and subjected to several rounds of ab-initio and heterogeneous refinement. This iterative refinement process resulted in the generation of two subsets. One of these subsets contained 91,859 particles corresponding to the Nb20-mGlyR-RGS complex, and the other consisted of 200,127 particles corresponding to the mGlyR-Nb20 complex. The final resolution of these subsets was estimated to be approximately 3.47 Å and 3.8 Å, respectively, using the gold standard Fourier shell correlation (GSFSC) method within cryoSPARC ( 80 ). EM density visualization was performed with UCSF Chimera ( 83 ).
[0271] Model Building and Refinement Models of mGlyR-Nb20 and Nb20-mGlyR-RGS7-Gβ5 were constructed using COOT (84) based on the previously determined mGlyR structure (PDB IDs: 7SHE and 7SHF). When constructing the mGlyR model, a density corresponding to Nb20 was observed, indicating the presence of a bound nanobody. The shape and size of this density were consistent with a bound nanobody. The Nb20 model generated using the AlphaFold method was docked into the cryo-EM map, manually adjusted, constructed, and refined using COOT (84). Because the resolution of the Nb20 density was relatively low, the density corresponding to bulky residues was used as a guide to accurately construct the majority of the bound Nb20.
[0272] The final resolution of the cryo-EM map of Nb20-mGlyR-RGS7-Gβ5 was 3.89 Å. The map showed well-resolved density for the transmembrane (TM) domain, but relatively low density for RGS7, with the RGS domain missing from the map. To construct an atomic model of the Nb20-mGlyR-RGS7-Gβ5 structure, the mGlyR-Nb20 model generated in this study (from the same dataset) was used as a template. The model was docked into the map using UCSF Chimera and further manually adjusted, built, and refined with COOT.
[0273] In the Nb20-mGlyR-RGS7-Gβ5 map, the density for the RGS domain of RGS7 was poorly resolved and fragmented, making it difficult to build a reliable model. Both the mGlyR-Nb20 model and the Nb20-mGlyR-RGS7-Gβ5 model were subjected to iterative manual building in COOT, followed by real-space refinement in PHENIX (85). Local rotamer fitting and constrained-group ADP refinement were also performed. The resulting models were refined in real space using PHENIX for both the unfiltered half map and the total map. Structures were visualized and drawings prepared using UCSF Chimera (83), ChimeraX (86-87), and PyMOL (88). Data collection and refinement statistics are listed in Table 6.
[0274] Table 6. Cryo-EM data collection, refinement, and validation statistics [Table 6]
[0275] Mammalian cell line culture and transfection HEK293FT cells were obtained from ThermoFisher and grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (v / v), minimal Eagle's medium non-essential amino acids, 1 mM sodium pyruvate, and antibiotics (100 units / ml penicillin and 100 mg / ml streptomycin) at 37°C in a humidified incubator containing 5% CO. Cells were transiently transfected in 96-well plates using Metafectene Pro (Biontex, Germany) according to the manufacturer's instructions.
[0276] Cell-based bioluminescence resonance energy transfer (BRET) assay HEK293FT cells were seeded at 50,000 cells per well in white, flat-bottom 96-well plates (Greiner Bio-One) and transiently transfected using Metafectene Pro according to the manufacturer's instructions. Cells were transfected with pcDNA3.1 plasmids encoding dopamine D2R (1), mGlyR (1), RGS7 (1), Gβ5 (1), Gαo (2), Venus-1-155-Gγ2 (1), Venus156-239-Gβ1 (1), and masGRK3ct-Nluc (1) (ratios shown in parentheses). Empty vector (pcDNA3.1(+)) was used to normalize the amount of transfected DNA. Twenty-four hours after transfection in DMEM complete medium supplemented with 0.1% Matrigel (Corning), cells were washed with BRET buffer (Dulbecco's phosphate-buffered saline (PBS) containing 0.5 mM MgCl2 and 0.1% glucose). BRET measurements between Venus-Gβ1γ2 and masGRK3ct-Nluc were performed to monitor the release of free Gβγ dimers following activation of heterotrimers containing Gα subunits in live cells, as previously described (76). Empty vector (pcDNA3.1(+)) was used to normalize the amount of transfected DNA.
[0277] Cells were incubated with 1 μM Nb20 or 100 μM glycine, or both where indicated, and with NanoLuc (Nluc) substrate according to the manufacturer's instructions. To release Gα and initiate Gα deactivation, 100 μM dopamine and 100 μM haloperidol were injected automatically (t = 10 s and t = 25 s) sequentially by a plate reader (PHERAstar FSX, BMG Labtech), and dual emission measurements were performed at 475 ± 30 nm and 535 ± 30 nm. The correlation between Venus-Gβ and light emitted from masGRK3ct-Nluc (475 nm, 30 nm bandpass width) was compared. 1γ2The BRET signal was determined by calculating the ratio of light emitted from the RGS protein (535 nm, bandpass width 30 nm) to the basal BRET ratio. The average baseline value recorded before stimulation with agonist (basal BRET ratio) was subtracted from the experimental BRET signal value, and the resulting difference (Δ net BRET ratio) was normalized to the maximum net BRET value recorded upon stimulation with agonist. The rate constant of the deactivation phase (1 / τ) was obtained by fitting a monophasic exponential decay curve to the trajectory using Graphpad Prism 9.0. The basal deactivation rate (k) was calculated from the deactivation rate measured in the presence of exogenous RGS protein. app ) by subtracting k GAP The rate constant was determined.
[0278] Flow cytometry HEK293FT cells were cultured at 1.10 per well in a 6-well plate. 6 Cells were cultured at a density of 1 / 3 and transfected with 2 μg of mGlyR cDNA or empty pcDNA3.1+ for control experiments using Metafectene Pro. 48 hours after transfection, cells were mechanically detached by repeated pipetting, washed with PBS supplemented with 0.1% BSA, counted, and incubated in PBS-0.1% BSA at 4°C for 1 hour with rotation. 10 μl of Nanobody-20 (Nb20) and anti-myc-APC conjugated antibody (R&D Systems #IC3696A) were added and incubated in the dark at 4°C for 1 hour with rotation. After three washes, cells were analyzed on an LSR-II BD flow cytometer. A gating strategy was used to separate individual cells from debris and doublets. Sorted cells were measured for fluorescence in each channel. Negative control conditions were used to set the positivity threshold for APC (mock cells incubated with Nb and anti-myc-APC antibody) and Venus (mock-transfected cells). Acquired data were analyzed using FlowJo software (FlowJo).
[0279] Surface Plasmon Resonance (SPR) Surface plasmon resonance (SPR) measurements were performed at 25°C using a Biacore X100 instrument with 1x HBS-EP+ (Cytiva) as the running buffer. Mouse anti-human IgG CH2 monoclonal antibody (Cytiva) was immobilized onto a CM5 sensor chip at a density of approximately 9,500 response units (RU) using standard NHS / EDC coupling methods (Cytiva). Subsequently, 10 μg / mL of GPR158-Fc was captured on an activated flow cell to approximately 1,800 RU. A two-fold dilution series of concentrations (500–31.25 nM) of nanobody Nb20 was injected using a multi-cycle method. The lowest concentration (31.25 nM) was repeated to ensure the sensor chip was regenerated. Data were collected using Biacore X100 Control Software 2.0.1 (Cytiva) and analyzed using Biacore X100 Evaluation Software 2.0.1 (Cytiva).
[0280] Brain slice preparation and whole-cell recordings Electrophysiological recordings were performed from layer II-III neurons in the prelimbic cortex in 4- to 12-week-old mice of either sex. Mice were anesthetized with isoflurane and decapitated. Brains were rapidly removed and placed in ice-cold oxygenated solution containing the following for 30 seconds: 93 mM NMDG, 2.5 mM KCl, 1.2 mM NaH2PO4, 30 mM NaHCO3, 20 mM HEPES, 25 mM glucose, 2 mM thiourea, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 0.5 mM CaCl2, and 10 mM MgCl2 (pH adjusted to 7.3-7.4 with HCl). Coronal slices (300 μm thick) were cut using a vibratome (VT1200S, Leica), mounted on porous membranes, and incubated in NMDG for 12 minutes at 34°C. Slices were then transferred to modified HEPES ACSF containing 92 mM NaCl, 2.5 mM KCl, 2 mM CaCl, 2 mM MgCl, 1.2 mM NaHPO, 30 mM NaHCO, 20 mM HEPES, 25 mM glucose, 5 mM sodium ascorbate, 2 mM thiourea, and 3 mM sodium pyruvate (adjusted to pH 7.3–7.4 with NaOH) and allowed to recover for 1 h at room temperature. For recording, slices were transferred to a submerged recording chamber and continuously perfused at 2 ml per minute with oxygenated ACSF containing the following: 126 mM NaCl, 2.5 mM KCl, 2 mM CaCl, 2 mM MgCl, 18 mM NaHCO, 1.2 mM NaHPO, 10 mM glucose, in the presence of the following synaptic blockers: picrotoxin (100 μM), strychnine (1 μM), CNQX (20 μM), and APV (50 μM). Pipettes (3–5 MΩ) were pulled from a P-1000 (Sutter Instruments, CA) and filled with intracellular solution containing the following: 119 mM K-MeSO4, 12 mM KCl, 1 mM MgCl2, 0.1 mM CaCl2, 10 mM HEPES, 1 mM EGTA, 0.4 mM Na-GTP, 2 mM Mg-ATP, (280–300 mOsm, pH adjusted to 7.3 with KOH).Slices were incubated with NB-20, NB-20* (1 μM), or ACSF, and changes in neuronal excitability were assessed by counting the number of spikes elicited in response to 1-second depolarizing ramps ranging from 0 pA to 200 pA. A 20-second interval was allowed between trials. The rheobase was defined as the minimum current required to elicit the first AP. Data acquisition was performed using Clampex 10.7, a MultiClamp 700B amplifier, and a Digidata 1440A (Molecular Devices, CA). Data were analyzed with Clampfit 10.7.
[0281] ELISA Prefrontal cortical tissue punches (2 mm) from treated mice were mechanically homogenized in homogenization buffer containing 20 mM HEPES, pH 8, 1 mM EDTA, 150 mM NaCl, 2 mM MgCl, 1 mM DTT, and cOmplete protease inhibitor cocktail (Roche Cat# 11836153001), then centrifuged at 2000 g to remove nuclear debris and immediately frozen (in liquid nitrogen). BDNF quantification in each sample was determined by diluting the supernatant 1:5 in homogenization buffer and using the immunoassay ELISA MAX BDNF Deluxe Set (Biolegend Cat# 446604) according to the manufacturer's guidelines.
[0282] Mouse studies No statistical methods were used to predetermine sample size. No data were excluded from the analysis. No specific randomization method was used. Animals were randomly assigned to experimental groups according to genotype. Experimenters were blinded to treatment groups.
[0283] Drug treatment. Intracerebroventricular (ICV) administration was performed as previously described (77). Mice were injected with 5 μl of purified, endotoxin-free nanobody solution in saline (1.92 mg / ml) or 5 μl of vehicle. Behavioral assessments were performed 24 h after treatment. For intranasal (IN) administration, mice were treated twice on the same day, 6 h apart, 24 h after the last stressor. Each treatment involved the application of 10 μl of purified, endotoxin-free nanobody solution in saline (0.95 mg / ml) or racemic ketamine hydrochloride (20 mg / kg; VetaKet; Patterson Veterinary; Cat# 78925834) dissolved in saline, with 5 μL delivered to each nostril using a P-10 pipette.
[0284] Stress Paradigm. The chronic undefined stress (CVS) paradigm consists of daily exposure to one of three stressors for 21 consecutive days. All mice are exposed to one stressor per day, with the three stressors repeated every three days. The duration of each stressor varies from day to day to increase unpredictability. Stressors include restraint stress, in which mice are placed in a ventilated 50 mL conical tube in their home cage for one hour. The next stressor is foot shock, administered in a shock box (six mice can be administered simultaneously). Mice receive 100 mild foot shocks at 0.4 mA at random intervals over one hour. The final stressor is exposure to a predator odor for 30 minutes. 15 μL of TMT (Fisher Scientific; 501844430) is pipetted onto a cotton swab and placed in a clean, empty standard mouse cage. Single housing is also considered an additional stressor for mice. Termination criteria, including bleeding, excessive weight loss (loss greater than 20% of the initial weight), and a hunched or moribund phenotype, were used to determine whether mice should continue in the stress paradigm. Two mice (one from each sex) died during the stress paradigm. The remaining stressed mice (n = 30) were randomly assigned to drug treatment conditions (n = 10 per treatment; five per sex). Behavioral testing was performed in matched groups 24 hours after drug treatment. Animals were numbered to maintain blinding in manually scored tests. Mice were sacrificed 48 hours after the final behavioral testing.
[0285] Marble burying. Marble burying (MB) was performed in a standard mouse cage (27 × 16.5 × 12.5 cm) containing 20 marbles in a 4 × 5 equidistant arrangement on 5 cm of corncob bedding. Background white noise (approximately 70 dB) was used during testing. Mice were placed in the center of the cage, and the test consisted of a 30-minute exploration period. Marbles that were at least half-covered at the end of the test were counted as buried.
[0286] Sucrose Splash Test. The splash test (ST) was performed by spraying the dorsal fur of mice with a freshly prepared 10% sucrose solution (Sigma-Aldrich; S9378) on the day of testing (approximately 0.35 mL per mouse) and placing them into an empty, inescapable cylindrical PlexiGlas container (121 cm long and 15 cm diameter). Mice were allowed to habituate to the cylinder for 5 min before being sprayed with sucrose solution and returned to the container. Mice's behavior was recorded for 5 min and later manually scored by a blinded observer. Videos were scored for total grooming time. Observer scores were averaged to obtain a final value.
[0287] Elevated Plus Maze. The elevated plus maze (EPM) was performed using a black Plexiglas elevated plus maze (33 × 6 cm, with two open and two closed arms, with 25 cm walls on the closed arms and 60 cm above the floor; Med Associates, St. Albans, VT). Maze illumination was set at 200 lux in the center of the plus maze, 270 lux on the open arms, and 120 lux on the closed arms. Background white noise (approximately 70 dB) was used during testing. Mice were placed in the center of the elevated plus maze and allowed to explore under dim light conditions for 5 minutes. Mice were recorded using Ethovision XT to calculate the time spent in the open and closed arms and the number of exits from the closed arms and entries into the open arms.
[0288] Tail suspension test. The tail of the mouse was wrapped with tape covering approximately 4 / 5 of the length of the tail and then secured upside down on a hook. The immobility time of each mouse was recorded and tracked over a 6-minute period using Ethovision XT. The automated tracking values were verified by manual scoring by a blinded observer.
[0289] Forced Swim Test. The Porsolt Forced Swim Test (FST) was performed using a vertical, clear glass cylinder (10 cm diameter, 25 cm height) filled with water (25°C). Mice were allowed to spend 6 min in the water, and the time spent immobile was scored. Mice were considered immobile if they were floating motionless or making only the movements necessary to keep their head above water. Automated tracking values were verified by manual scoring by a blinded observer.
[0290] Analysis of emotionality scores. The behavioral paradigms used to calculate emotionality scores were performed in the following order: MB, ST, EPM, TST, and FST. To obtain a comprehensive measure of emotionality, we used a z-scoring methodology to incorporate standard measures of anxiety-like and depression-like behavior, as previously described (89). The test parameters analyzed were: marble burying (number of marbles buried), elevated plus maze (time spent in open arms, number of open arm entries), tail suspension test (immobility time), and forced swim test (immobility time). For each parameter, z scores for each individual animal were calculated using the method previously described in Sutton et al. (29). Briefly, for each parameter, the z scores for each animal were calculated using the formula
number
number
[0291] Data analysis and statistics Functional data shown represent the mean ± SEM of at least three individual experiments, each performed in triplicate, and are expressed as mean ± standard error of the mean (sem). For GAP assays, cells with the same transfection conditions were compared with respect to their treatment, and a two-way ANOVA test was performed. Dose-response curve fitting was performed using nonlinear regression curves, and IC 50 For flow cytometry binding assays, empty vector-transfected cells were used as a control, and dose-response curve fitting was performed using nonlinear regression to obtain EC 50 For SPR, the association rate constant (k on ) and dissociation rate constant (k off ) was calculated based on a 1:1 Langmuir binding model. All fitted data revealed chi-square values less than 1. The equilibrium dissociation constant (KD) was calculated as k off / k on The mean and sem values were calculated from the mean and sem values. For mouse experiments (marble burying, splash test, tail suspension, elevated plus maze, and forced swim tests), comparisons were performed by one-way ANOVA with Dunnett or Kruskal-Wallis post-hoc tests. Assumptions of normality and homogeneity of variance were investigated using the Shapiro-Wilk and Levene tests, respectively. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Means and sem values are shown. For ELISA, one-way ANOVA tests were performed to compare control-treated and treated conditions. *P<0.05; **p<0.01; ***p<0.001; ****P<0.0001. Means and sem values are shown. For electrophysiology experiments, changes were assessed by nonparametric t-tests; Wilcoxon test. Values of *P<0.05, **P<0.01 and ***P<0.001, ***P<0.0001 were considered statistically significant. Calculations, graphs and statistics were generated using GraphPad Prism 9 software (San Diego, CA, USA).
[0292] GPR158 ectodomain The GPR158 (also known as mGlyR) ectodomain (SEQ ID NO: 12) (amino acid residues 1-417 of SEQ ID NO: 1) was subcloned into an Fc- and 6xHis-tagged vector. Ecto-GPR158-Fc was produced in HEK293FT cells (supernatant), purified (on a nickel column), dialyzed / concentrated (in 30 kDa Amicon tubing), and then captured by a mouse anti-human IgG CH2 monoclonal antibody immobilized on a CM5 sensor chip for SPR.
[0293] >GPR158-ectodomain: (SEQ ID NO: 12) [ka]
[0294] Nb20 * Construction >Nb20 * (SEQ ID NO: 13) (also referred to as Nb20-Ctrl, or Nb20ΔCDR1ΔCDR2) (CDRs according to IMGT definition are bold and underlined) [ka] IMGT CDR-H1 GSGGAGAG (SEQ ID NO: 14) IMGT CDR-H2 IGAVGGAAAG (SEQ ID NO: 15) IMGT CDR-H3 NYKDYNAPSDGY (SEQ ID NO: 5) -------------------------
[0295] Cloning Strategy: PCR-based mutagenesis CDR1 mutations: >Forward primer (SEQ ID NO: 16) GCGGCGGTGCTGGCGCTGGCATGGGCTGGTACCGCCAG >Reverse primer (SEQ ID NO: 17) CGCCAGCACCGCCGCTTCCAGAGGCTGCACAGGAGAGTC CDR2 mutations: >Forward primer (SEQ ID NO: 18) CAGCCGCAGCCGCAGCCGCAGCCGACTATGCAGACTCCGTAAAGGGC >Reverse primer (SEQ ID NO: 19) CTGCGGCTGCGGCTGCGGCTGCAGTTGCGACCAGCTCGCG
[0296] Example 6 Structural basis for mGlyR regulation by Nb20 To gain insight into the mechanism underlying Nb20-mediated modulation of mGlyR, we used cryo-electron microscopy (CryoEM) to obtain high-resolution structures of mGlyR complexed with Nb20, with and without the RGS7-Gβ5 complex (Figures 17A and 17B). Three-dimensional sorting (3D) of the particles revealed two predominant 3D classes: Nb-20-mGlyR and Nb20-mGlyR-RGS7 / Gβ5. These classes were then refined to 3.45 Å and 3.83 Å resolution, respectively, without applying any symmetry (Figures 18 and 19). The quality of the resulting maps allowed the construction of complete models of the mGlyR-Nb20 and mGlyR-RGS complexes, guided by the known structures of mGlyR and nanobodies.
[0297] We found that Nb20 binds to the side of the dimer interface formed by the two ligand-binding Cache domains of the mGlyR dimer (Figure 17C). The binding interface is primarily mediated by complementarity-determining regions 1 and 2 (CDR1 and CDR2) of Nb20, which establish extensive contacts with the α2 helix and the loop between the β2 and β3 strands of mGlyR subunit A (residues 195–200) and the loop between the α1 and α2 helices of subunit B (residues 140–153) (Figure 17D). CDR2 of Nb20 interacts with a groove located at the dimer interface between the two cache domains of the mGlyR receptor. Within CDR2, residue W47 forms a π-π stacking interaction with W162 of the α2 helix of mGlyR subunit A. Furthermore, polar contacts exist between R56 of Nb20 and E166 of subunit A, as well as between Y60 of Nb20 and N142 of the adjacent mGlyR subunit (Figure 17D). Furthermore, Nb20 associates with the receptor through polar interactions involving D77 and K79 of the nanobody's CDR1, which interact with R200 and D198 of the loop between residues 195 and 200 of the receptor's subunit A, respectively. We mutated the CDR1 and CDR2 regions involved in binding, thereby creating mutant Nb20 (Nb20 * We verified the binding mode of Nb20 by completely abolishing the interaction of mGlyR with Nb20 (Fig. 20). Notably, the ligand-binding pocket is located adjacent to the binding groove of Nb20 (Fig. 21A, B), and therefore, Nb20 binding is likely to affect the conformational transition of mGlyR induced by glycine binding.
[0298] To determine whether binding to Nb20 actually induces a conformational change in mGlyR, we compared the Nb20-mGlyR structure with the apo structure of mGlyR alone. Superposition of mGlyR-Nb20 onto mGlyR-apo without any global fixation revealed conformational changes across various domains, including the Cache domain, stalk domain, and transmembrane (TM) domain (Fig. 21C). Notably, the stalk domain exhibited a significant shift, with a deviation of 4.2 Å (Fig. 21D). Furthermore, compared to the mGlyR-apo structure, the extracellular half of the TM helix exhibited an outward shift, while the intracellular half of the TM helix exhibited an inward shift (Fig. 21E).
[0299] To pinpoint the precise conformational changes in the extracellular domain induced by Nb20 binding, we aligned the transmembrane (TM) domains (Figure 17E). The TM was tethered, allowing us to observe the dramatic conformational changes in the extracellular domain (ECD) upon Nb20 binding to the receptor. Specifically, the Nb20-bound structure showed a maximum translation of 12 Å and a rotation of approximately 7° in the ECD relative to the mGlyR-apo structure (Figure 17F). These findings suggest that Nb20 binding initiates a wave of events that ultimately remodel the receptor's cytoplasmic interface, involved in interaction with RGS7 / Gβ5 and signal transduction. To test this model, we further compared the cryoEM structure of Nb20-mGlyR-RGS7 / Gβ5 with the previously solved mGlyR-RGS7 / Gβ5 structure (Figure 17G; Figure 21F). In the mGlyR-RGS7 / Gβ5 structure, the ECD domain cannot be observed. However, Nb20 binding stabilizes both the ECD and RGS7-Gβ5, thereby enabling the entire complex to be elucidated. Strikingly, comparison reveals that the RGS domain density, which typically underpins Gβ5, is completely absent in the Nb20-bound structure (Figure 17B; Figure 21F). Superposition of the Nb20-bound and Nb20-free structures at the 7TM region reveals dramatic changes. The DEP / DEX domain of RGS7, which forms direct contact with the receptor, adopts a distinct conformation with a b3-hairpin loop and is no longer disassembled in the Nb-bound structure (Figure 17G), thus suggesting that remodeling at the 7TM interface induces changes in contact residues of the RGS complex. Furthermore, Gβ5 in the Nb20-bound structure is translated by approximately 5 Å compared to its position in the unbound structure (Figure 17G; Figure 21G). The distinct conformation of Gβ5 within this complex is incompatible with coupling to the RGS domain and is likely flexible, and therefore not resolved in this structure (FIG. 17G).Overall, structural studies suggest a model in which binding of Nb20 to the extracellular ligand-binding Cache domain of mGlyR induces a conformational change in the receptor and remodels its intracellular interactions with the RG7 / Gβ5 complex, thereby rearranging the catalytic RGS domain and uncoupling it from Gα protein regulation.
[0300] All patent documents, patents, patent applications, websites, other publications, databases, accession numbers, etc. cited above or below are incorporated by reference in their entirety for all purposes, to the same extent as if each individual item were specifically and individually indicated to be incorporated by reference. Where different versions of a sequence are associated with an accession number at different times, the version associated with the accession number as of the effective filing date of this application is relevant. The effective filing date refers to the filing date of the priority application referencing the accession number prior to the actual filing date or, if applicable, the filing date of the priority application referencing the accession number. Similarly, where different versions of a publication, website, etc. are published at different times, the most recently published version as of the effective filing date of this application is relevant unless otherwise specified. Unless otherwise specified, any feature, step, element, embodiment, or aspect of the present invention can be used in combination with any other feature, step, element, embodiment, or aspect. While the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications can be made that are within the scope of the appended claims.
[0301] References [ka] [ka] [ka] [ka]
change
Claims
1. An isolated monoclonal antibody that competes with antibody Nb20 for binding to human GPR158.
2. The antibody of claim 1, which binds to the same epitope on human GPR158 as antibody Nb20.
3. 3. The antibody of claim 1 or claim 2, comprising the three heavy chain CDRs of antibody Nb20, wherein Nb20 is a llama antibody characterized by a heavy chain variable region having an amino acid sequence comprising SEQ ID NO:
2.
4. The antibody of claim 3, wherein the three heavy chain CDRs are as defined by IMGT (SEQ ID NOs: 3-5).
5. The antibody of claim 4, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:
2.
6. 5. The antibody of any one of claims 1 to 4, which is Nb20 or a chimeric, veneered, or humanized form thereof.
7. 7. The antibody of any one of claims 1 to 4 and 6, which is a humanized antibody.
8. The antibody of claim 6, which is a humanized Nb20 antibody that specifically binds to human GPR158, wherein Nb20 is a llama antibody characterized by the mature heavy chain variable region of SEQ ID NO:
2.
9. 9. The humanized antibody of claim 8, comprising a humanized mature heavy chain variable region comprising the three heavy chain CDRs of Nb20.
10. 10. The humanized antibody of claim 9, wherein the CDRs are according to a definition selected from the group consisting of Kabat, Chothia, Kabat / Chothia combined, AbM, Contact, and IMGT.
11. 11. The antibody of any one of claims 1 to 10, which is an intact antibody.
12. An antibody described in any one of claims 1 to 10, which is a binding fragment.
13. The binding fragment may be a single chain antibody, Fab, or F(ab') 2 The antibody of claim 12, which is a fragment.
14. 11. The antibody of claim 1, which is a Fab fragment or a single chain Fv.
15. 11. The antibody of any one of claims 1 to 10, which is a nanobody.
16. The antibody of any one of the preceding claims, wherein the isotype is human IgG1.
17. 17. The humanized antibody of any one of claims 7 to 11 and 16, wherein the mature heavy chain variable region is fused to a heavy chain constant region.
18. 18. The humanized antibody of claim 17, wherein the heavy chain constant region is a mutated form of the native human heavy chain constant region that has reduced binding to Fcγ receptors compared to the native human heavy chain constant region.
19. 19. The humanized antibody of claim 17 or claim 18, wherein the heavy chain constant region is of the IgG1 isotype.
20. 10. The antibody of claim 1, having at least one mutation in the constant region.
21. 21. The antibody of claim 20, wherein the mutation reduces complement fixation or activation by the constant region.
22. 22. The antibody of claim 21, having a mutation at one or more of positions 241, 264, 265, 270, 296, 297, 318, 320, 322, 329 and 331 according to EU numbering.
23. 23. The antibody of claim 22, having alanines at positions 318, 320 and 322.
24. 19. The antibody of any one of claims 1 to 18, which is of the human IgG2, IgG3, or IgG4 isotype.
25. 25. The antibody of any one of claims 1 to 24, which is at least 95% w / w pure.
26. 10. The antibody of any preceding claim, conjugated to a therapeutic agent, a cytotoxic agent, a cytostatic agent, a neurotrophic agent, or a neuroprotective agent.
27. 27. A pharmaceutical composition comprising an antibody as defined in any one of claims 1 to 26 and a pharmaceutically acceptable carrier.
28. A nucleic acid encoding the heavy chain of an antibody according to any one of claims 1 to 26.
29. 29. A recombinant expression vector comprising the nucleic acid of claim 28.
30. A host cell transformed with the recombinant expression vector of claim 29.
31. 1. A method for humanizing a Nanobody, comprising: (a) selecting one or more acceptor humanized Nanobody scaffolds; (b) identifying the amino acid residues of said Nanobodies that are retained; (c) synthesizing a nucleic acid encoding a humanized heavy chain comprising the CDRs of said Nanobody heavy chain; (d) expressing the nucleic acid in a host cell to produce a humanized Nanobody; Including, The method, wherein the nanobody is Nb20, and Nb20 is characterized by the mature heavy chain variable region of SEQ ID NO:
2.
32. 1. A method for producing a humanized, chimeric, or veneered antibody, comprising: (a) culturing cells transformed with nucleic acid encoding the heavy chain of the antibody, such that the cells secrete the antibody; (b) purifying the antibody from the cell culture medium; Including, The method, wherein the antibody is a humanized, chimeric, or veneered form of an antibody characterized by the mature heavy chain variable region of SEQ ID NO:
2.
33. 1. A method for producing a cell line that produces a humanized, chimeric, or veneered antibody, comprising: (a) introducing into a cell a vector encoding the antibody heavy chain and a selectable marker; (b) growing the cells under conditions that select for cells with increased copy number of the vector; (c) isolating a single cell from the selected cells; (d) banking cells cloned from the single cells selected based on antibody yield; Including, The method, wherein the antibody is a humanized, chimeric, or veneered form of an antibody characterized by the mature heavy chain variable region of SEQ ID NO:
2.
34. growing the cells under selective conditions; and 6 34. The method of claim 33, further comprising the step of screening for cell lines that naturally express and secrete the antibody at 1000 kJ / 24 hours.
35. 27. A method of treating or effecting prevention of an affective, mood, or brain disorder in a subject, comprising administering to said subject an effective regimen of an antibody as defined in any one of claims 1 to 26, thereby treating or effecting prevention of said affective, mood, or brain disorder in said subject.
36. 36. The method of claim 35, wherein the affective disorder, mood disorder, or brain disorder is depression, severe mood dysregulation disorder, major depressive disorder (MDD), dysthymia, stress-induced depression, generalized mood disorder, chronic stress disorder, anhedonia, or an anxiety disorder.
37. A method for detecting GPR158 in a biological sample derived from a subject, the method comprising contacting the biological sample with an effective amount of an antibody described in any one of claims 1 to 25.
38. 38. The method of claim 37, further comprising detecting binding of the antibody to GPR158.
39. 39. The method of claim 37 or claim 38, further comprising the step of comparing the binding of the antibody to the biological sample with the binding of the antibody to a control sample.
Citation Information
Patent Citations
Ligands with binding specificity for vegf and / or egfr and methods of use thereof
JP2009523162A
Antibody and complex binding to norovirus, as well as detection device and detection method using the same
JP2019011297A
mRNA-mediated immunization methods
JP2019528312A
Brain osteocalcin receptors and cognitive impairment
JP2020508982A