Endolysosomal targeting conjugates for enhanced delivery of cargo molecules to the endolysosomal compartment of target cells

Abstract

To provide ADCs and PDCs that enable more effective delivery of cytotoxic drugs to tumor cells.SOLUTION: To provide an endolysosomal targeting conjugate modified to deliver a cargo molecule such as a cytotoxic drug or an imaging label to a late endosome and / or lysosome in a target cell such as a tumor cell with improved efficiency. The endo-lysosomal targeting conjugate comprises a targeting component and a cargo component. The targeting component is configured to bind to a cell surface molecule of a target cell, and the cargo component includes a cargo molecule. The targeting component and the cargo component may be covalently fused or non-covalently associated. The targeting component may bind to a cell surface molecule or cargo component in the extracellular space with higher affinity than in the endolysosomal compartment of the target cell.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The inventions disclosed herein generally relate to the generation of engineered proteins that can be used as platforms for the delivery of cytotoxic drugs, imaging labels, and other cargo molecules to target cells, such as tumor cells, where the proteins are engineered to more effectively deliver the cargo molecules to late endosomes and lysosomes in the target cells. [Background technology]

[0002] Antibody-drug conjugates (ADCs) or protein-drug conjugates (PDCs) represent a class of therapeutic agents that combine the high specificity of antibodies, antibody fragments, or other proteins that bind to cancer cells or other unwanted cells, such as inflammatory or virally infected cells, with the delivery of highly toxic drugs. A problem with current ADCs or PDCs is that they have toxicity that can be dose-limiting. However, the development of ADCs and PDCs that enable more effective delivery of cytotoxic drugs to tumor cells remains challenging.

[0003] Furthermore, antibodies, antibody fragments, and other targeting proteins can be labeled with radioactive, fluorescent, or near-infrared labels for use as labeled conjugates (LCs) in diagnostic imaging. However, the development of LCs that allow for more effective tumor labeling with higher contrast to background tissue remains challenging. Summary of the Invention

[0004] The present disclosure relates to engineered proteins, referred to herein as endolysosomal-targeting conjugates, that are configured to enable enhanced delivery of cargo molecules, such as cytotoxic drugs (e.g., in ADCs or PDCs) or imaging labels (e.g., in LCs), to the endolysosomal pathway in target cells, such as cancer cells or other cell types.

[0005] According to a first aspect, an endolysosomal targeting conjugate is described. The endolysosomal targeting conjugate has a targeting moiety including an antibody, an antibody fragment, an antibody domain, a nanobody, a protein, a protein fragment, or a protein domain, where the targeting moiety is configured to bind to a cell surface molecule of a target cell in the extracellular space with a lower dissociation constant within the endolysosomal compartment of the target cell. The endolysosomal targeting conjugate also has a cargo moiety, which includes a cargo molecule conjugated to the antibody, an antibody fragment, an antibody domain, a nanobody, a protein, a protein fragment, or a protein domain. The targeting moiety is directly or indirectly fused to the cargo moiety. The targeting moiety is configured to dissociate from the cell surface molecule upon entering the endolysosomal compartment. The endolysosomal targeting conjugate is configured to deliver a cargo molecule to the endolysosomal compartment of the target cell.

[0006] According to a second aspect, an endolysosomal targeting conjugate is described. The endolysosomal targeting conjugate has a targeting moiety comprising an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, where the targeting moiety is configured to bind to a cell surface molecule of a target cell. The endolysosomal targeting conjugate also has a cargo moiety, which is an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain. The targeting moiety comprises a cargo molecule conjugated to a target molecule. The targeting moiety is configured to bind to the cargo moiety in the extracellular space with a lower dissociation constant than in the endolysosomal compartment of the target cell. The targeting moiety is configured to dissociate from the cargo moiety upon entry into the endolysosomal compartment. The endolysosomal targeting conjugate is configured to deliver the cargo molecule to the endolysosomal compartment of the target cell.

[0007] According to a third aspect, a composition is described, the composition comprising an endolysosomal targeting conjugate and a pharmaceutically acceptable vehicle.

[0008] According to a fourth aspect, a method of treating cancer is described, the method comprising administering to a patient an effective dose of an endolysosomal-targeting conjugate composition, wherein the cargo molecule is a cytotoxic drug, and wherein administration of the composition inhibits tumor growth in the patient.

[0009] According to a fifth aspect, a method of imaging a tumor in a patient is described, the method comprising: (1) administering to the patient an effective dose of an endolysosomal-targeting conjugate composition, wherein the cargo molecule is an imaging label; and (2) performing an imaging method in the patient suitable for detecting the imaging label. Administration of the composition provides a sufficient concentration of the imaging label that is detectable by the imaging method.

[0010] According to a sixth aspect, a method for providing an endolysosomal targeting conjugate for the treatment of cancer is described, comprising the steps of: (1) selecting a targeting moiety, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, wherein the targeting moiety is configured to bind to the cell surface molecule in the extracellular space with a lower dissociation constant than in the endolysosomal compartment; (2) selecting a cargo moiety, wherein the cargo moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, wherein the cargo molecule is a cytotoxic drug effective for inhibiting the growth of the selected type of tumor target cell; and (3) providing an endolysosomal targeting conjugate comprising the targeting moiety fused directly or indirectly to the cargo moiety.

[0011] According to a seventh aspect, a method for providing an endolysosomal targeting conjugate for the treatment of cancer is described. The method includes the steps of (1) selecting a targeting moiety, where the targeting moiety comprises an antibody, antibody fragment, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, and (2) selecting a cargo moiety, where the cargo moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, where the cargo molecule is a cytotoxic drug active in inhibiting the growth of the selected type of tumor target cell. In the method, the targeting moiety is modified to further comprise a first protein domain, and the cargo moiety is modified to further comprise a second protein domain, and the first protein domain is configured to bind to the second domain in the extracellular space with a lower dissociation constant in the endolysosomal compartment than in the extracellular compartment.

[0012] The above endolysosomal targeting conjugates and methods may further include the following details, which may be combined with each other if not clearly mutually exclusive: i) the targeting moiety may comprise an antibody, antibody fragment, or nanobody configured to bind to a cell surface molecule in the extracellular space with a dissociation constant of less than 500 nM; (ii) the targeting moiety may bind to a near-neutral p molecule with a lower dissociation constant at acidic endolysosomal pH. H), iii) the near-neutral pH may be greater than about pH 6.8 and less than about pH 7.5, and the acidic endolysosomal pH may be greater than about pH 5.0 and less than about pH 6.5, iv) the targeting moiety may be greater than endolysosomal Ca 2+ Extracellular Ca with a lower dissociation constant at higher concentrations 2+ v) an antibody, antibody fragment, or nanobody configured to bind to a cell surface molecule at a concentration of extracellular Ca; 2+The concentration may be approximately 2 mM, and the endolysosomal Ca 2+ The concentration may be about 2 μM; vi) the targeting moiety may comprise a protein, protein fragment, or protein domain configured to bind to a cell surface molecule in the extracellular space with a dissociation constant of less than 500 nM; vii) the targeting moiety may comprise a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at near-neutral pH with a lower dissociation constant at acidic endolysosomal pH; viii ... 2+ Extracellular Ca with a lower dissociation constant at higher concentrations 2+ix) the cargo moiety may comprise an antibody, antibody fragment, which may be an antibody Fc region or domain of an antibody Fc fragment; x) the antibody Fc region or domain of an antibody Fc fragment may be derived from human IgG1; xi) the cargo moiety may comprise an albumin molecule or domain of albumin; xii) the targeting moiety may comprise a Fab fragment or scFv fragment of a HER2-specific antibody, wherein the heavy chain variable domain of the Fab fragment or scFv fragment has a Ser55 to histidine mutation and a Gly57 to glutamic acid mutation; xiii) the targeting moiety may comprise a Fab fragment or scFv fragment of a HER2-specific antibody, wherein the heavy chain variable domain of the Fab fragment or scFv fragment has a Ser103 to histidine mutation and the light chain variable domain has a Tyr55 to histidine mutation; xiv) an endolysosomal targeting conjugate. xv) the at least first and second targeting moieties may be fused to a heterodimer of two immunoglobulin Fc fragments; xvi) the targeting moieties may comprise a phosphatidylserine binding protein, and the target cell may be a cell having phosphatidylserine on its cell surface; xvii) the phosphatidylserine binding protein may be a core domain of AnxA1, Sy xviii) the phosphatidylserine binding protein may be a Syt1 C2A domain; xix) the targeting moiety may comprise two Syt1 C2A domains; xx) the targeting moiety may comprise four Syt1 C2A domains; xxi) the targeting moiety may comprise more than four Syt1 C2A domains; xxii) the targeting moiety may comprise a phosphatidylserine binding protein and the cargo moiety comprises the Fc portion of human IgG1;The targeting moiety may be covalently fused to the cargo moiety by a linker protein; xxiii) the linker protein may be a Gly4Ser linker; xxiv) the cargo molecule may be a cytotoxic drug; xxv) the cytotoxic drug may be monomethyl auristatin E (MMAE); xxvi) the cargo molecule may be an imaging label; xxvii) the targeting moiety may be configured to bind to a cargo compartment at near-neutral pH with a lower dissociation constant at acidic endosomal pH; xxviii) the targeting moiety may be configured to bind to an endosomal Ca2+ receptor; 2+ Extracellular Ca with a lower dissociation constant at higher concentrations 2+ xxix) the targeting moiety may comprise calbindin D9K domain 2, and the cargo moiety may comprise calbindin D9K domain 1; xxx) the calbindin domain 1 D9K may be fused to the cargo moiety by a linker peptide, and / or the calbindin D9K domain 2 may be fused to the targeting moiety by a linker peptide; xxxi) the composition may be configured to target tumors of one or more types of target cells. xxxii) the cargo molecule may comprise at least one endolysosomal targeting conjugate comprising a peptide linker or a chemical conjugation reaction xxxiii) the imaging label may be a radioactive label, a fluorescent label, or a near-infrared label; xxxiv) the N-terminus of the targeting moiety may be fused to the C-terminus of the cargo moiety; xxxv) the C-terminus of the targeting moiety may be fused to the N-terminus of the cargo moiety; xxxvi) the targeting moiety may be fused to the cargo moiety at a non-terminal position of the cargo moiety; xxxvii) the cargo moiety may comprise an immunoglobulin Fc fragment, and the targeting moiety may be fused to the immunoglobulin Fc fragment of the cargo moiety at the N-terminus or C-terminus of the hinge-CH2-CH3 domain of the immunoglobulin Fc fragment; xxxviii) the targeting moiety may comprise an antibody, antibody fragment, antibody domain, or nanobody configured to bind to human epidermal growth factor receptor 2; xxxix) the targeting moiety may be a prostate-specific membrane antibody. xl) the endolysosomal targeting conjugate may comprise one or more proteins having the amino acid sequence of at least one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48 or homologs thereof; xli) the endolysosomal targeting conjugate may comprise a heterodimer of proteins having the amino acid sequence of SEQ ID NO:2 plus SEQ ID NO:4, SEQ ID NO:6 plus SEQ ID NO:8, SEQ ID NO:42 plus SEQ ID NO:44 or SEQ ID NO:46 plus SEQ ID NO:48 or homologs thereof; xlii) the endolysosomal targeting conjugate may comprise a heterodimer of proteins having the amino acid sequence of SEQ ID NO:18 plus SEQ ID NO:20 plus SEQ ID NO:22;xliv) the targeting moiety may comprise a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at an acidic pH with a dissociation constant of greater than 1.5 μM; xlv) the acidic pH may be about 5.8; xlvi) the targeting moiety may comprise an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at a pH of about 6.8 to about 7.5 with a lower dissociation constant at a pH of about 5.0 to about 6.5; xlvii) the targeting moiety may comprise an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at a pH of about 2 μM; 2+ at a lower dissociation constant of approximately 2 mM Ca 2+ xlviii) the targeting moiety may comprise a protein, protein fragment or protein domain configured to bind to a cell surface molecule at a pH of about 6.8 to about 7.5 with a lower dissociation constant at a pH of about 5.0 to about 6.5; xlix) the targeting moiety may comprise a protein, protein fragment or protein domain configured to bind to a cell surface molecule at a pH of about 2 μM Ca 2+ at a lower dissociation constant of approximately 2 mM Ca 2+ xlx) the targeting moiety may be configured to bind to a cargo compartment at a pH of about 6.8 to about 7.5 with a lower dissociation constant at a pH of about 5.0 to about 6.5; xlxi) the targeting moiety may comprise a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at a concentration of about 2 μM Ca 2+ at a lower dissociation constant of approximately 2 mM Ca 2+xlxii) the cargo molecule may be a cytotoxic radiolabel; xlxiii) the cargo molecule may be a drug or other agent that alters the behavior of the target cell.

[0013] For a more complete understanding of the present invention and its features and advantages, reference is now made to the following description taken in conjunction with the accompanying drawings, which are not to scale and in which like numerals refer to like features, and in which: [Brief explanation of the drawings]

[0014] [Figure 1] 1 is a representative schematic diagram of selected cellular events leading to delivery of cargo molecules into late endosomes and lysosomes by endolysosomal-targeting conjugates. [Figure 2] 1 is a representative schematic diagram of selected cellular events leading to dissociation of the cargo and targeting moieties of an endolysosomal-targeted conjugate in endosomes and subsequent delivery of the cargo moiety into late endosomes and lysosomes. [Figure 3A] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody that binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3B] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody-scFv-Fc fusion protein that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3C]1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody variable domain / antibody variable domain fragment-Fc fusion protein that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3D] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising a Fab fragment fused to the N-terminal position of an immunoglobulin hinge and CH3 domain that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3E] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an scFv fragment fused to the N-terminal position of an immunoglobulin hinge and CH3 domain that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3F] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody variable domain / antibody variable domain fragment fused to the N-terminal position of an immunoglobulin hinge and CH3 domain that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3G] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody variable domain / antibody variable domain fragment fused to albumin that binds to a cell surface protein or receptor at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3H] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody Fab fragment fused to albumin that binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3I] Schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody scFv fragment fused to albumin that binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3J] Schematic diagram of a representative endolysosomal-targeting conjugate comprising a protein, protein domain, or fragment fused to the N-terminal position of an Fc fragment. The protein, protein domain, or protein fragment binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3K] Schematic diagram of a representative endolysosomal-targeting conjugate comprising a protein, protein domain, or fragment fused to the C-terminal position of an Fc fragment. The protein, protein domain, or protein fragment binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3L]Schematic diagram of a representative endolysosomal-targeting conjugate comprising a protein, protein domain, or fragment fused to both the N-terminus and C-terminus of an Fc fragment. The protein, protein domain, or protein fragment binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3M] Schematic diagram of a representative endolysosomal targeting conjugate comprising a protein, protein domain, or protein fragment fused to both the N- and C-termini of an Fc fragment, forming a heterodimer with two protein domain or fragment molecules per Fc fragment. The protein, protein domain, or protein fragment binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3N] Schematic diagram of a representative endolysosomal-targeting conjugate comprising a protein, protein domain, or protein fragment fused to the C-terminal position of an Fc fragment, forming a heterodimer with one protein, protein domain, or fragment molecule per Fc fragment. The protein, protein domain, or protein fragment binds to a cell surface protein or receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3O]1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising Fab-protein (domain) and protein (domain)-Fc fusions designed to associate with each other at near-neutral pH (or extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentrations). [Figure 3P] Schematic representation of representative endolysosomal-targeting conjugates comprising scFv fragment-protein (domain) and protein (domain)-Fc fusions designed to associate with each other at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 3Q] FIG. 1 is a schematic diagram of representative endolysosomal-targeting conjugates comprising antibody variable domain-protein(domain) and protein(domain)-Fc fusions designed to associate with each other at near-neutral pH (or extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentrations). [Figure 3R] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody comprising two Fab fragments that bind to two or more cell surface receptors or molecules at near-neutral pH (or extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or lower endosomal Ca2+ concentrations). [Figure 3S] 1 is a schematic diagram of a representative endolysosomal-targeting conjugate comprising an antibody comprising two scFv fragments that bind to two or more cell surface receptors or molecules at near-neutral pH (or at extracellular Ca2+ concentrations) with higher affinity (lower dissociation constant) than at acidic endosomal pH (or at lower endosomal Ca2+ concentrations). [Figure 4A]Representative data are shown for binding analysis of a representative HER2-targeted endolysosomal targeted agent (without conjugated drug) to HER2 at various pH values. [Figure 4B] Representative data is shown regarding the dissociation constants of a representative HER2-targeted endolysosomal targeted agent (without conjugated drug) to HER2 at various pH values. [Figure 5A] Graphs of representative data for flow cytometry analysis of HER2 expression levels on various tumor cell lines are shown. [Figure 5B] Graphs of representative data for flow cytometry analysis of internalization and accumulation of representative HER2-targeted endolysosomal-targeted conjugates in various tumor cell lines are shown. [Figure 5C] A series of representative microscopy images comparing the localization of representative HER2-targeted endolysosomal-targeted conjugates in dextran-positive lysosomes is shown. [Figure 6] Graphs reporting representative data regarding the effect of HER2-targeted endolysosome-targeted conjugates and control MMAE conjugates on tumor cell viability are shown. [Figure 7A] 1 shows graphs reporting representative whole body and blood counts over time for a representative HER2-targeted endolysosomal-targeted conjugate in mice. [Figure 7B] Graphs reporting representative data regarding the effect of representative HER2-targeted endolysosomal-targeted conjugates and control proteins on tumor growth (MDA-MB-453 cells) in mice are shown. [Figure 8A] Representative binding data are shown for the interaction of representative HER2-targeted fusion proteins containing calbindin domains 2 and 1 fused to antibody Fab (HER2-specific) and Fc fragments, respectively. [Figure 8B]Graphs showing representative data for flow cytometry analysis of internalization and accumulation in prostate cancer cells of representative prostate-specific membrane antigen (PSMA)-targeting antibodies containing calbindin domains 2 and 1 fused to antibody Fab (026, PSMA-specific) and Fc fragments, respectively. [Figure 9] 1 shows a graph reporting a representative gel filtration chromatography analysis of a representative PS-targeted Fc fusion protein. [Figure 10A] Schematic diagram and analysis of representative PS-targeting agents (Fc fusions containing human IgG1-derived Fc linked to the PS-targeting proteins AnxA1, the C2A domain of synaptotagmin 1 (Syt1), and PKCα). Filled circles and rectangles represent the PS-targeting domain and IgG1 hinge region, respectively. The right panel shows SDS-PAGE analysis of the endolysosomal-targeting agents, with molecular weights (MW) indicated in kDa on the left. [Figure 10B] Representative lipid binding distributions of representative PS-targeted drugs using lipid-coated nitrocellulose membranes are shown. [Figure 10C] Graphs are shown reporting representative binding of representative PS-targeted agents to PS-positive 2H11 and MDA-MB-231 cells using flow cytometry analysis. [Figure 10D] 1 shows a graph reporting representative whole body counts versus time for representative PS-targeted agents. [Figure 10E] A graph reporting representative areas under the curve for the data shown in Figure 10D for representative PS-targeted agents is shown. [Figure 10F] Representative whole-body images of tumor-bearing mice injected with a representative PS-targeting agent labeled with a near-infrared dye (IRDye800CW) are shown. [Figure 10G] For the image shown in Figure 10F, a graph reporting representative tumor-associated fluorescence for a representative PS-targeted agent labeled with a near-infrared dye (IRDye800CW) is shown. [Figure 10H]1 shows images of representative tumors following 48 hours of injection into tumor-bearing mice and a graph reporting the mean dye intensity for a representative PS-targeted agent labeled with a near-infrared dye (IRDye800CW). [Figure 11A] Schematic and analysis of representative bivalent and tetravalent PS-targeting agents. The filled circle indicates the Syt1 C2A domain (left panel). The right panel shows SDS-PAGE analysis of Syt1-Fc fusions, with molecular weights (MW) indicated in kDa on the right. [Figure 11B] A representative gel filtration chromatography analysis of a representative PS-targeted Fc fusion protein containing four Syt1 molecules per Fc fragment is shown. [Figure 11C] Representative binding of a representative PS-targeted agent to a PS-coated nitrocellulose membrane and to a lipid-coated nitrocellulose membrane is shown. [Figure 11D] Graphs reporting representative binding of representative PS-targeted drugs and control proteins to cells with exposed PS are shown. [Figure 11E] Graphs reporting representative internalization of representative PS-targeted agents into cells in which PS is exposed are shown. [Figure 11F] A series of representative microscopic images of a representative PS-targeted drug and control protein in endothelial cells (2H11) are shown, with lysosomes in the cells labeled with a LAMP-1 specific antibody. [Figure 11G] Representative microscopic images of another series of representative PS-targeting drugs and control proteins in tumor cells (MDA-MB-231) are shown, with lysosomes in the cells labeled with a LAMP-1-specific antibody. [Figure 12A] A schematic diagram and analysis of representative PS-targeted endolysosomal-targeted conjugates with cargo moieties conjugated with MMAE (small black circles) are shown (left panel). The right panel shows SDS-PAGE analysis of unconjugated or MMAE-conjugated PS-targeted agents, with molecular weights (MW) indicated in kDa on the left. [Figure 12B]Representative mass spectrometry analysis of a representative MMAE-conjugated PS-targeted endolysosome-targeted conjugate is shown. [Figure 12C] 1 shows a representative gel filtration chromatography analysis of a representative PS-targeted endolysosomal-targeted conjugate. [Figure 12D] Representative analyses of binding of representative PS-targeted endolysosomal conjugates to PS in the presence of the indicated Ca concentrations (left panel) or pH levels (right panel) are shown. Bead-associated proteins were analyzed using immunoblotting. [Figure 13A] A series of representative microscopy images of a representative PS-targeted endolysosome-targeted conjugate and a control MMAE conjugate in tumor cells (MDA-MB-231) are shown, where early endosomes in the cells are labeled with an EEA-1-specific antibody. Specific endosomes are cropped and enlarged (labeled a and b). [Figure 13B] A representative series of microscopic images of a representative PS-targeted endolysosome-targeted conjugate and a control MMAE conjugate in tumor cells (MDA-MB-231) are shown, with lysosomes in the cells labeled with a LAMP-1-specific antibody. [Figure 13C] A representative series of microscopic images of the effect of a representative PS-targeted endolysosome-targeted conjugate and a control MMAE conjugate on tubulin in endothelial cells (2H11) and tumor cells (MDA-MB-231) are shown. [Figure 14A] Graphs of representative flow cytometry data showing the levels of PS exposed on tumor cells are shown. [Figure 14B] Graphs reporting representative data regarding the effect of representative PS-targeted endolysosome-targeted conjugates and control MMAE conjugates on tumor cell viability are shown. [Figure 14C]1 shows a graph of representative flow cytometry data showing the levels of a representative PS-targeted endolysosome-targeted conjugate internalized into tumor cells after 2 hours of incubation. [Figure 14D] Graphs of representative data are shown showing that a representative PS-targeted Fc fusion (without conjugated drug) does not affect cell viability. [Figure 15A] 1 shows a graph reporting representative whole body counts versus time for a representative PS-targeted endolysosome-targeted conjugate. [Figure 15B] A representative graph reporting the area under the curve for the data shown in Figure 15A for a representative PS-targeted endolysosomal-targeted conjugate is shown. [Figure 15C] Graphs reporting representative data regarding the effect of representative PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (MDA-MB-231 cells) in mice are shown. [Figure 15D] Graphs reporting representative data regarding the effect of representative PS-targeted endolysosome-targeted conjugates and control proteins on the body weight of tumor-bearing mice are shown. [Figure 15E] Graphs reporting representative data regarding the effect of representative PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (LNCaP cells) in mice are shown. [Figure 16A] 1 shows SDS-PAGE analysis of a control endolysosomal-targeted conjugate and a control protein modified (using DN mutations) to reduce PS-binding activity, with and without conjugation to MMAE. [Figure 16B] Representative lipid binding distributions to lipid-coated nitrocellulose membranes are shown for representative PS-targeted endolysosomal targeting conjugates that bind to PS or control endolysosomal targeting conjugates that have been modified (DN) to bind to PS with low affinity. [Figure 16C]A graph is shown reporting the representative binding of representative PS-targeted endolysosomal-targeted conjugates that either bind to PS or are engineered (DN) to bind with lower affinity to PS to PS-positive 2H11 cells using flow cytometry analysis. [Figure 16D] Graphs reporting representative data regarding the effect of representative PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (LNCaP cells) in mice are shown. [Figure 16E] Representative images of tumors (LNCaP cells) isolated from mice treated with a representative PS-targeted endolysosome-targeted conjugate and a control protein are shown. [Figure 17A] A representative series of microscopic images showing the location of representative PS-targeted endolysosome-targeted conjugates and controls (PBS vehicle) relative to CD31-positive endothelial cells in tumor tissues is shown; and [Figure 17B] A representative series of microscopic images showing the location of representative PS-targeted endolysosome-targeted conjugates and controls (PBS vehicle) on F4 / 80-positive macrophages in tumor tissue is shown. DETAILED DESCRIPTION OF THE INVENTION

[0015] The present disclosure relates to modified antibodies or fusion proteins configured to enable improved delivery of cargo molecules, such as cytotoxic drugs or imaging labels, to late endosomes and lysosomes in target cells. As used herein, the terms "endolysosome" and "endolysosomal compartment" refer to early endosomes, late endosomes, lysosomes, and associated tubulovesicular transport carriers of cells. Accordingly, as used herein, the term "endolysosomal-targeting conjugate" refers to modified antibodies or fusion proteins configured for improved delivery of cargo molecules to the endolysosomal compartment of target cells.

[0016] The antibodies or fusion proteins described herein comprise a targeting moiety and a cargo moiety. The targeting moiety may comprise an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, which is configured to bind to a cell surface molecule, such as a cell surface receptor or other cell surface molecule, that may be present on the extracellular surface of the plasma membrane of a cell, where the molecule is at least partially exposed to the extracellular space. The cargo moiety may comprise an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, such as a cytotoxic drug or an imaging label.

[0017] As used herein, the term "antibody-drug conjugate" or "ADC" refers to an antibody-based conjugate configured to deliver a drug to a cell. In particular, the term "antibody-drug conjugate" or "ADC" as used herein refers to an antibody comprising a targeting moiety and a cargo moiety. The targeting moiety may comprise an antibody Fab fragment, an antibody variable domain, or a nanobody. The targeting moiety is linked to a cargo moiety, which may comprise an antibody constant region (Fc fragment) or a domain of the constant region. One or more cytotoxic drug molecules may be conjugated to the antibody constant region (Fc fragment) or a domain of the constant region of the cargo moiety of the ADC.

[0018] As used herein, the term "protein-drug conjugate" or "PDC" refers to a protein-based conjugate configured to deliver a drug to a cell. In particular, the term "protein-drug conjugate" or "PDC" as used herein refers to a protein comprising a targeting moiety and a cargo moiety. The targeting moiety may comprise a protein or Fab fragment, an antibody variable domain, or a nanobody that binds to a cell surface receptor or molecule. The targeting moiety is linked to a cargo moiety, which may comprise an antibody constant region (Fc fragment), a constant region domain, or a protein such as albumin. One or more cytotoxic drug molecules may be conjugated to the antibody constant region (Fc fragment), a constant region domain, or a protein such as albumin of the cargo component of the PDC.

[0019] As used herein, the term "label conjugate" or "LC" refers to an antibody or protein comprising a targeting moiety linked to a cargo moiety. Thus, the targeting moiety may comprise an antibody Fab fragment, an antibody variable domain, a nanobody, or a protein that binds to a cell surface receptor or molecule. The cargo moiety may comprise an antibody constant region (Fc fragment) or a domain of a constant region, or a protein such as albumin. The antibody constant region (Fc fragment) or domain of a constant region, or the protein of the cargo moiety may be conjugated to one or more imaging labels, such as a radiolabel, a fluorescent molecule, or other labeling molecule.

[0020] Generally, for ADCs or PDCs to effectively deliver drugs to cells, they must selectively bind to target cells, be internalized into the cells, and enter degradative compartments called late endosomes and lysosomes. Before entering lysosomes, ADCs or PDCs enter early endosomes, where sorting for recycling or the lysosomal pathway occurs. Improving delivery to late endosomes and lysosomes (endolysosomal pathway) results in more potent ADCs or PDCs, allowing the use of lower doses.

[0021] Furthermore, LCs that allow for improved delivery of imaging labels to late endosomes and lysosomes in target cells will result in higher contrast for imaging of target cells against the background of non-targeted cells or tissues.

[0022] Thus, the present invention generally relates to endolysosomal-targeting conjugates that are modified to more effectively deliver cargo molecules to the endolysosomal compartment of target cells, and the modified conjugates described herein are configured to respond to differences in the chemical composition within endosomes or late endosomes and the extracellular environment, thereby achieving more effective delivery of cargo molecules, such as cytotoxic drugs or imaging labels, to target cells. Examples of endolysosomal-targeting conjugates described herein include improved ADCs, PDCs, and LCs that are configured for improved targeting of conjugated cargo molecules, such as drugs or imaging labels, to the endolysosomal compartment of target cells, thereby resulting in more potent ADCs or PDCs or higher-contrast LCs.

[0023] The cargo molecules described herein can include any molecule that has a function useful for causing an effect in a target cell. For example, in addition to a cytotoxic drug or an imaging label, an additional cargo molecule can be a radiolabel that kills cells through radiation damage, i.e., can be used for therapy rather than imaging. Examples of such radiolabels are yttrium (Y)-90 and iodine (I)-131. Additional types of cargo molecules can be identified by one of skill in the art upon reading this disclosure.

[0024] In addition to tumor cells, target cells within the meaning of the present disclosure may include other types of unwanted cells, such as inflammatory cells or virus-infected cells, among others identifiable to one of skill in the art upon reading this disclosure.

[0025] As used herein, the term "cell surface molecule" refers to a protein or other biomolecule (eg, phospholipids, carbohydrates) that is at least partially exposed on the extracellular surface of the plasma membrane of a cell.

[0026] 1 and 2 show schematic diagrams of exemplary mechanisms of enhanced delivery of cargo molecules by the endolysosomal targeting conjugates of the present disclosure. Upon binding of the targeting moiety to a cell surface molecule, the endolysosomal targeting conjugate is internalized into the cell (FIGS. 1 and 2).

[0027] As shown in representative schematic form in Figure 1, the endolysosomal targeting conjugates are designed to target endolysosomes at lower (acidic) pH, lower Ca 2+ concentration, lower Cl - or Na + concentration, higher K +They may dissociate from receptors or cell surface molecules in early or late endosomes due to concentration or other environmental conditions that distinguish endosomes from the extracellular space (e.g., as described in Scott, CC, Gruenberg, J. (2010) Ion flux and the function of endosomes and lysosomes: pH is just the start. Bioessays 33, 103-110). Thus, in some examples of endolysosomal targeting conjugates described herein, the conjugates may be attached to cell surface molecules. The affinity of the targeting moiety for the target is higher in the extracellular space than in the endolysosomal compartment. Thus, the targeting moiety and the cell surface molecule may bind with a lower dissociation constant in the extracellular space. The endolysosomal-targeted conjugate is delivered to late endosomes or lysosomes, resulting in the release of the drug or label.

[0028] In another example, as shown in a representative schematic format in Figure 2, the targeting and cargo components of the endolysosomal targeting conjugate may be associated with each other through non-covalent interactions, which may occur at near-neutral pH or extracellular Ca. 2+ concentrations, but not at endosomal (acidic) pH or endosomal Ca 2+ The targeting moiety is not stable under certain conditions, such as concentration or other environmental conditions, that distinguish endosomes from the extracellular space. The cargo moiety is released in early or late endosomes and enters lysosomes, but the targeting moiety can be recycled and reloaded with the cargo moiety. Thus, in some examples of the endolysosomal targeting conjugates described herein, the affinity of the targeting moiety for the cargo moiety is higher in the extracellular space than in the endolysosomal compartment. Thus, the targeting moiety may bind to the cargo moiety with a lower dissociation constant in the extracellular space.

[0029] The targeting moiety and cargo moiety may be covalently linked or may be non-covalently associated with one another.

[0030] Exemplary endolysosomal targeting conjugates described herein include targeting moieties configured to bind to cell surface molecules such as HER2 or prostate-specific membrane antigen (PSMA). In particular, exemplary endolysosomal targeting conjugates may bind to cell surface molecules such as HER2 or PSMA with an affinity of less than 500 nM at near-neutral pH.

[0031] Exemplary endolysosomal targeting conjugates described herein include a targeting moiety configured to bind to a cell surface molecule such as PS, particularly representative PDCs, which may bind to cell surface molecules such as PS with an affinity of less than 500 nM at near-neutral pH.

[0032] HER2 and PSMA are cell surface receptors that are overexpressed on tumors and are therefore well-characterized tumor targets. The endolysosomal targeting conjugates of the present disclosure are not limited to targeting these receptors or cell surface molecules such as prostate stem cell associated antigen (EPCAM), c-MET, carcinoembryonic antigen (CEA), CD19, CD20, CD20, CD33, CD38, epidermal growth factor receptor (EGFR), glypican-2, CD56, insulin-like growth factor receptor 1, tumor endothelial marker 8 (TEM-8), CD46, and many other targets can be identified by one of skill in the art upon reading this disclosure.

[0033] PS is present within the inner leaflet of the plasma membrane of normal cells but becomes exposed on the outer leaflet of the membrane of cancer endothelial cells in response to oxidative stress and inflammatory factors in the tumor microenvironment. Based on studies in murine models, PS exposure appears to be a "universal" marker for tumor vasculature. Typically, less than half of tumor blood vessels are PS-positive, and exposure can increase with radiation and chemotherapy. In addition to tumor endothelium, PS has also been reported to be exposed on many nonapoptotic cancer cells, including melanoma, breast cancer, prostate cancer, and renal cancer.

[0034] Thus, targeting moieties can include any type of molecule configured to specifically bind to a cell surface receptor or other cell surface molecule, including proteins, protein fragments, polynucleotides such as ribonucleic acid or deoxyribonucleic acid, polypeptides, polysaccharides, lipids, amino acids, peptides, sugars, and / or other small or large molecules and / or polymers identifiable by one of skill in the art upon reading this disclosure. do.

[0035] As shown in FIG. 1 , the endolysosomal targeting conjugate 20 includes a targeting moiety 20T and a cargo moiety 20C. Attached to the cargo moiety is a drug or label, indicated by a black circle. The conjugate may reversibly bind to a cell surface receptor or other molecule 30 on the surface of a cell 10. This binding typically occurs at a near-neutral pH, such as a pH greater than about 6.8 and less than about 7.5, since this is the typical pH of the extracellular space 40. Binding to a cell surface receptor or cell surface molecule typically involves the release of extracellular Ca. 2+ This can occur even at concentrations (approximately 2 mM). The cell surface receptor or molecule 30 bound by the endolysosomal targeting conjugate 20 is internalized within the cell 10 via receptor-mediated uptake into the endosome 50. The complex of the endolysosomal targeting conjugate 20 and the cell surface receptor or other molecule 30 is internalized within the early or late endosome due to the acidic pH (approximately pH 5.0 to approximately pH 6.5) or low Ca concentration within these compartments. 2+ Due to its high concentration (approximately 2 μM), the endolysosomal targeting conjugate 20 dissociates from the receptor or other molecule 30. Thus, the receptor or cell surface molecule 30 may be recycled back to the cell surface in a recycling endosome 60, where it may be reloaded with the endolysosomal targeting conjugate 20, whereas the endosomally dissociated endolysosomal targeting conjugate 20 enters lysosomes and degrades into fragments (70). The endolysosomal targeting conjugate is configured to bind to a cell surface receptor or other molecule under conditions within the extracellular space, and at least 10% of the endolysosomal targeting conjugate internalized into the cell dissociates in an endosome or late endosome.

[0036] As shown in Figure 2, an endolysosomal targeting conjugate comprising a targeting moiety 80 and a cargo moiety 90 (with a drug or other label attached, indicated by a black circle) may reversibly bind to a cell surface receptor or other molecule 30 on the surface of a cell 10. Association of the targeting moiety 80 and the cargo moiety 90 typically occurs at a near-neutral pH, such as a pH greater than 6.8 and less than 7.5, since this is the typical pH of the extracellular space 40. Association of the targeting moiety 80 and the cargo moiety 90 occurs via the release of extracellular Ca. 2+ This can occur even at concentrations (approximately 2 mM). The cell surface receptor or molecule 80 to which the endolysosomal targeting conjugate is bound is internalized within the cell 10 via receptor-mediated uptake into the endosome 50. The targeting moiety 80 and cargo moiety 90 are transported within the early or late endosomes by the acidic pH (typically below pH 6.8) or low Ca concentration within these compartments. 2+ The endolysosomal targeting conjugates are configured to bind to cell surface receptors or other molecules under conditions within the extracellular space, and at least 10% of the cargo components internalized in the cell dissociate in endosomes or late endosomes.

[0037] The endolysosomal targeting conjugates according to the present disclosure can be targeted to endolysosomes at near-neutral pH or extracellular Ca 2+The targeting moiety is configured to specifically bind to a cell surface receptor / molecule via the targeting moiety at a specific concentration. As used herein, the term "specifically bind" refers to a detectable, selective intermolecular interaction between the targeting moiety and the cell surface receptor / molecule. For example, to specifically bind, the targeting moiety must exhibit a detectable interaction with the targeted cell surface receptor or cell surface molecule, while not exhibiting a detectable interaction with other cell surface receptors or cell surface molecules, or exhibiting a much lower affinity interaction. Methods for detecting specific binding are known in the art, such as ELISA and other methods that can be identified by those skilled in the art.

[0038] Thus, the endolysosomal-targeted conjugates are internalized into cells expressing the targeted cell surface receptor or other targeted cell surface molecule to which the linked cargo moiety is targeted, and then This allows it to be broken down within the cell.

[0039] The endolysosomal targeting conjugate can comprise at least a first targeting moiety and a second targeting moiety, wherein the antibody Fab fragment, single-chain Fv (scFv), nanobody, protein, or protein fragment of the first targeting moiety is different from the antibody Fab fragment, single-chain Fv (scFv), nanobody, protein, or protein fragment of the second targeting moiety. Thus, the endolysosomal targeting conjugate comprising at least a first targeting moiety and a second targeting moiety can bind to two different cell surface receptors or molecules.

[0040] Furthermore, the endolysosome-targeting conjugate may contain a human or humanized protein or protein fragment to avoid or reduce the possibility of an immune response to the endolysosome-targeting conjugate when administered to humans. The targeting moiety and cargo moiety are preferably human proteins or protein fragments for administration of the endolysosome-targeting conjugate to humans. The targeting moiety and cargo moiety are preferably human proteins or protein fragments, such as human antibodies, antibody fragments, or human albumin or albumin fragments, or humanized antibodies or humanized antibody fragments for administration of the endolysosome-targeting conjugate to humans. When developing an endolysosome-targeting conjugate for use in animals other than humans, proteins or protein fragments derived from or modified to be immunologically compatible with the animal may be used instead.

[0041] Figure 3A shows the effect of endosomal Ca2+ on the endosomal pH (or endosomal Ca2+) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ 1 is a schematic diagram of a representative endolysosomal targeting conjugate (20a) comprising an antibody Fab fragment (100) configured to bind to a cell surface protein or molecule (at a concentration). The Fc fragment (110) is homodimeric. As those skilled in the art will appreciate, the Fc fragment of IgG is the entire base of the Y-shape of the antibody, which includes the sulfhydryl-bridged hinge region and the CH2 and CH3 domains. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0042] Figure 3B shows that the endosomal pH at acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+

[0033] Figure 2 is a schematic diagram of a representative endolysosomal targeting conjugate (20b) comprising an scFv fragment (260) of an antibody configured to bind to a cell surface protein or molecule (at a concentration). The Fc fragment (110) is homodimeric. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0043] Figure 3C shows that the endosomal pH at acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+

[0033] Figure 2 is a schematic diagram of a representative endolysosomal targeting conjugate (20c) comprising an antibody variable domain or fragment (130) configured to bind to a cell surface protein or molecule (at a concentration). The Fc fragment (110) is homodimeric. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0044] The antibody variable region 130 may comprise a portion of the non-variable region of an antibody that is configured to bind to a cell surface receptor or molecule. For example, the antibody variable region 130 may comprise a single domain. The variable regions may be derived from a human IgG antibody (sdAb) or a camelid-derived VHH domain (commonly referred to as a nanobody). Such variable regions have an overall immunoglobulin domain fold containing two antiparallel β-sheets, and may also include domains from other members of the immunoglobulin superfamily, such as T-cell receptor variable domains, antibody constant region domains, or domains of the co-receptor, CD4, among others identifiable by those skilled in the art. Antibody variable regions may also comprise heterodimers of heavy chain variable (VH) domains linked to light chain variable (VL) domains by peptide linkers to form scFv fragments (260). Linker sequences used to link VH and VL domains are well known to those skilled in the art and include the sequence GGGGSGGGSGGGGGS [(G4S)3], which links the C-terminus of the VH domain to the N-terminus of the VL domain. Similar linker sequences can be used to link the C-terminus of the VL domain to the N-terminus of the VH domain. pH-dependent, Ca 2+ scFvs that bind to cell surface receptors or other cell surface molecules, such as in a pH-dependent manner, can be isolated from libraries of scFvs using phage display, yeast display, or other antibody display methods. The targeting component of the endolysosomal targeting conjugate may comprise an antibody Fab fragment, which can be isolated from a library of Fab fragments using phage display or yeast display, among other methods known to those skilled in the art. For nanobodies, scFvs, and Fab fragments, residues in the complementarity-determining regions (CDRs) can be randomly mutated or error-prone polymerase chain reaction can be used to generate libraries of mutated nanobodies or variable domains, followed by selection, to obtain desired binding properties (e.g., pH-dependent, Ca-dependent, etc.) for the targeted cell surface receptor or cell surface molecule. 2+The binding affinity (binding affinity) can be further improved by targeting CDR residues in the light chain variable domain (residues 89-97, Kabat numbering) and the heavy chain variable domain (residues 95-102, Kabat numbering). These libraries can be displayed on phage or yeast, and mutants with the desired binding behavior can be selected using methods known to those skilled in the art.

[0045] Figure 3D shows that the acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ 1 is a schematic diagram of a representative endolysosomal targeting conjugate (20d) comprising an antibody Fab fragment (100) configured to bind to a cell surface protein or molecule (at a concentration). The Fab fragment is linked to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0046] Figure 3E shows that the endosomal pH at acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ Schematic diagram of a representative endolysosomal targeting conjugate (20e) comprising an scFv fragment (260) of an antibody configured to bind to a cell surface protein or molecule (at a concentration). The scFv fragment is linked to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0047] Figure 3F shows that the endosomal pH at acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+1 is a schematic diagram of a representative endolysosomal targeting conjugate (20f) comprising an antibody variable domain or fragment (130) configured to bind to a cell surface protein or molecule (at a concentration). The protein fragment or domain is linked to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0048] Figure 3G shows that the acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+FIG. 3G is a schematic diagram of a representative endolysosomal-targeting conjugate (20g) comprising an antibody variable domain or fragment (130) configured to bind to a cell surface protein or molecule (at a specific concentration). The antibody variable domain or fragment is linked to albumin or an albumin fragment (150), which may be mutated or otherwise modified so that it binds to the neonatal Fc receptor (FcRn) with improved affinity. Mutations can be inserted into the FcRn-binding domain (DIII) of (human serum) albumin, for example, using error-prone PCR followed by display of a library of mutant albumin variants on yeast or phage and selection of variants with higher affinity. Alternatively, higher affinity variants can be generated by mutating residues at or near the albumin:FcRn interface and selecting or screening for albumin variants with improved binding affinity. While FIG. 3G shows the antibody variable domain or fragment (130) at a terminal position of albumin or albumin fragment 150, it may alternatively be at a non-terminal position. The antibody variable domain or fragment may be fused to albumin or albumin fragment 150 in any suitable manner, including via chemical reaction or via a peptide linker. In this example, the cargo molecule (120) is attached to an exposed amino acid such as cysteine ​​or lysine via chemical conjugation.

[0049] In the representative diagrams shown in Figures 3H and 3I, the antibody variable domain or fragment 130 shown in Figure 3G is replaced by a Fab fragment 100 (Figure 3H) or an scFv fragment 260 (Figure 3I), which bind to the endosomal pH (or endosomal Ca). 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+The cargo molecule (120) is configured to bind to a cell surface protein or molecule (at a concentration) in a manner similar to that described above. In this example, the cargo molecule (120) is attached to an exposed amino acid, such as a cysteine ​​or lysine, via chemical conjugation.

[0050] Figure 3J shows that the acidic endosomal pH (or endosomal Ca) 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ 1 is a schematic diagram of a representative endolysosomal targeting conjugate (20j) comprising a protein fragment or domain (160) configured to bind to a cell surface protein or molecule (at a concentration). The protein fragment or domain is linked to the N-terminus of an Fc fragment 110 to form a homodimer. In this example, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0051] In the representative diagrams shown in Figures 3K and 3L, protein fragment or domain 160 is linked to the C-terminus of Fc fragment 110 to form a homodimer (Figure 3K) or to both the N- and C-termini of Fc fragment 110 to form a homodimer (Figure 3L). In this example, cargo molecule 120 is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0052] Figure 3M shows the endosomal pH at acidic endosomal pH (or endosomal Ca). 2+ at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ 3A is a schematic diagram of a representative endolysosomal targeting conjugate (20m) comprising a protein fragment or domain (160) configured to bind to a cell surface protein or molecule (at a concentration). The protein fragment or domain is linked to the N- and C-termini of an Fc fragment (170), which is configured to heterodimerize with another Fc fragment 180 lacking the protein fragment or domain, forming the heterodimeric endonucleases shown in FIG. 3M. This results in the dreisosomal-targeted conjugate 20m. Figure 3N shows a schematic diagram of a representative PDC or LC20n in which a protein fragment or domain (160) is fused to the C-terminus of an Fc fragment (170). In the example shown in Figures 3M and 3N, the cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue. To avoid Fc fragment homodimers in which both Fc fragments have the fused protein fragment or domain (160) or no fused protein or protein domain, knobs-into-holes mutations (e.g., Moore, GL, Bautista, C., Pong, E., Nguyen, DH, Jacinto, J., Eivazi, A., Muchhal, US, Karki, S., Chu, SY, Lazar, GA, (2011). A novel bispecific antibody Endolysosomal-targeting conjugates can be designed to promote heterodimer formation using a fusion protein-binding protein (Fc) format that enables simultaneous bivalent and monovalent co-engagement of distinct target antigens. MAbs 3, 546-557) and / or electrostatic steering mutations (e.g., as described in Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, S.B., Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, I.N., Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J. Biol Chem. 285, 19637-19646). For heterodimer formation, (e.g., Zhou, L., Wang, H.Y., Tong, S., Okamono, C.T., Shen, W.C., Zaro, J.L. (2016) (G4S) between the C-terminus of the antigen-Fc fusion and the N-terminus of the second Fc fragment (as described in [Single chain Fc-dimer-human growth hormone fusion protein for improved drug delivery. Biomaterials, 117, 24-31]). 13 Other methods, such as the insertion of linker peptides, can also be used. The DNA and protein sequences of exemplary endolysosomal-targeting conjugates containing knobs-into-holes mutations, electrostatic steering mutations, and / or other mutations are provided in Example 14.

[0053] Examples of knobs-into-holes mutations include Y349T / T394F:S364H / F405A and Y349T / F405F:S364H / T394F (e.g., as described in Moore, G.L., Bautista, C., Pong, E., Nguyen, D.H., Jacinto, J., Eivazi, A., Muchhal, U.S., Karki, S., Chu, S.Y., Lazar, G.A., (2011) A novel bispecific antibody format enables simultaneous bivalent and monovalent co-engagement of distinct target anabolic nucleotides. MAbs 3, 546-557), among others identifiable by one of skill in the art; and (e.g., Atwell, S., Ridgway, J.B.B., Wells, J.A., Carter, P. (1997) Stable heterodimers from remodeling the domain interface of a homodimer using a phage display). These representative knobs-into-holes mutations include T366W:T366S:L368A / Y407V (as described in [Library. J. Mol. Biol., 270, 26-35]). The numbering refers to the EU antibody numbering system, as will be understood by those skilled in the art.

[0054] Examples of electrostatic steering mutations include E356K / D399K:K392D / K409D and K409D / K370D:D357K / D399K, among others identifiable by one of skill in the art (e.g., as described in Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, S.B., Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, I.N., Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J Biol Chem 285, 19637-19646). The numbering of the residues in these exemplary electrostatic steering mutations refers to the EU antibody numbering system, as will be understood by those skilled in the art.

[0055] Figure 3O is a schematic diagram of a representative endolysosomal targeting conjugate (20o) comprising an antibody Fab fragment (210) fused to domain 2 of calbindin (CalD2, 190). The Fc fragment (110) is fused to domain 1 of calbindin (CalD1, 200). CalD1 (200) and CalD2 (190) interact to target extracellular Ca. 2+ Endosomal Ca concentrations are lower 2+ Other examples include fusion to Fab fragments (210) or Fc (110) and Ca 2+ or proteins or protein fragments that associate with each other in a pH-dependent manner (190, 200). 2+Other examples of proteins that interact in a Ca-dependent manner are found in (e.g., Miyawaki, A., Llopis, J., Heim, R., McCaffery, J.M., Adams, J.A., Ikura, M., Tsien, R.Y. (1997) Fluorescent indicators for Ca 2+calmodulin and calmodulin-binding peptide M13 (as described in, e.g., Seeman, J., Weber, K., Gerke, V. (1996) Structural requirements for annexin I-S100C complex-formation. Biochem. J., 319, 123-129; Malliard, WS, Haigler, HT, Schlaepfer, DD (1995) Calcium-dependent binding of S100C to the N-terminal domain of Annexin I. Biol. Chem., 2, 719-725); The C-terminal protein of BM-40 (SPARC / Osteonectin) is an autonomously folding and crystallizable domain that binds calcium and collagen IV (as described in J. Mol. Biol., 253, 347-357). In other examples of endolysosomal targeting conjugates, the Fab fragment shown in Figure 3O is replaced by an scFv fragment (220) as shown in Figure 3P or by an antibody variable domain, fragment, or nanobody (230) as shown in Figure 3Q. In the examples shown in Figures 3O, 3P, and 3Q, the cargo molecule (120) is conjugated via chemical conjugation to a cysteine ​​residue. It is attached to the hinge region.

[0056] Figure 3R shows that the acidic endosomal pH (or endosomal Ca) 2+at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+

[0033] Figure 2 is a schematic diagram of a representative endolysosomal targeting conjugate (20a) comprising two antibody Fab fragments (100, 240) configured to bind to two different cell surface proteins or molecules (at different concentrations). Fc fragments (170, 180) are fused to different Fab fragments (100, 240), respectively, to form heterodimers. Heterodimer formation is discussed in detail in (e.g., Moore, GL, Bautista, C., Pong, E., Nguyen, DH, Jacinto, J., Eivazi, A., Muchhal, US, Karki, S., Chu, SY, Lazar, GA, (2011). A This may be driven by knobs-into-holes mutations (as described in A novel bispecific antibody format enables simultaneous bivalent and monovalent co-engagement of distinct target antigens. MAbs 3, 546-557) and / or electrostatic steering mutations (as described in, for example, Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, S.B., Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, I.N., Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J. Biol Chem. 285, 19637-19646). In another example shown in Figure 3S, the Fab fragment shown in Figure 3R is replaced by two scFv fragments (250, 260), which bind to the endosomal pH (or endosomal Ca). 2+at near-neutral pH (or extracellular Ca concentration) with higher affinity 2+ In the example shown in Figures 3R and 3S, a cargo molecule (120) is attached to the hinge region via chemical conjugation to a cysteine ​​residue.

[0057] In the examples shown in Figures 3A-3S, the endolysosomal-targeting conjugates have a targeting moiety comprising a Fab fragment, scFvs, or nanobody, and a cargo moiety comprising an Fc fragment, a subfragment of Fc (e.g., the CH2 domain), or albumin linked to a cargo molecule such as a cytotoxic drug or an imaging label, such as a radioactive or fluorescent label. The cargo molecules shown in Figures 3A, 3B, 3C, 3D, 3E, 3F, 3J, 3K, 3L, 3M, 3N, 3O, 3P, 3Q, 3R, and 3S are attached to the hinge region via one or more cysteine ​​residues. In other examples, one or more cargo molecules can be attached to the cargo moiety via various chemistries known to those of skill in the art, such as amine-to-amine (NHS ester), sulfhydryl-to-sulfhydryl (maleimide), amine-to-sulfhydryl (NHS ester / maleimide), sulfhydryl-to-carbohydrate (maleimide / hydrazide), or attachment via an unnatural amino acid with the desired chemical reactivity, among other methods identifiable by those of skill in the art. The unnatural amino acid may be inserted during recombinant production of the targeting moiety. In other examples, such as the examples shown in Figures 3R and 3S, the targeting moiety may bind to two or more targets. Each of the targeting moieties may be fused to an Fc fragment with knobs-into-holes mutations and / or electrostatic steering mutations to drive heterodimer formation.

[0058] In the examples shown in Figures 3J, 3K, 3L, 3M, and 3N, the endolysosome-targeting conjugate may comprise a PS-targeting agent, e.g., made by fusing a PS-binding domain to the Fc fragment of human IgG1 or other Fc fragment. For example, the targeting moiety may be conjugated to a cargo moiety comprising a cytotoxic drug to generate endolysosome-targeting conjugate PDCs, or the targeting moiety may be conjugated to a cargo moiety comprising an imaging label, such as a radioactive label, fluorescent label, or near-infrared label, to generate endolysosome-targeting conjugate LCs. Thus, the endolysosome-targeting conjugates described herein may be conjugated to, e.g., Ca 2+ By using a PS-binding domain that interacts with PS in a Ca-dependent manner, 2+ The endolysosomal targeting conjugate PDC or LC may comprise a protein or protein fragment or domain configured to dissociate from a target cell surface molecule upon exposure to a significant decrease in its level. For example, an endolysosomal targeting conjugate PDC or LC may comprise a targeting moiety such as Fc-Syt1. An endolysosomal targeting conjugate PDC containing Fc-Syt1 may be bivalent, as shown in Figures 3J and 3K, or tetravalent, as shown in Figure 3L.

[0059] The endolysosomal targeting conjugate may comprise a single targeting domain fused to an Fc fragment that forms a heterodimer with the Fc fragment without the fusion protein. To promote heterodimer formation, the Fc fragment may be engineered using knobs-into-holes and / or electrostatic steering mutations, as shown in the examples in Figures 3M and 3N.

[0060] In some examples described herein, the targeting moiety and cargo moiety are not covalently linked, but instead are configured to associate with each other via linkage to engineered domains that associate with each other non-covalently. In particular, non-covalent associations may have stronger affinity when in contact with the chemical environment in the extracellular space than in the endolysosomal compartment. For example, engineered domains may include calbindin domain 1 (CalD1) and calbindin domain 2 (CalD2). CalD1 and CalD2 interact with extracellular Ca 2+ Endosomal Ca binds to each other at high concentrations 2+ It does not bind at concentrations (see Example 6). 2+ Other examples of proteins that interact in a Ca-dependent manner are found in (e.g., Miyawaki, A., Llopis, J., Heim, R., McCaffery, J.M., Adams, J.A., Ikura, M., Tsien, R.Y. (1997) Fluorescent indicators for Ca 2+ based on green fluorescent proteins and calmodulin. Nature, 388, 882-887), and calmodulin-binding peptide M13 (see, e.g., Seeman, J., Weber, K., Gerke, V. (1996) Structural requirements for annexin I-S100C complex formation. Biochem. J., 319, 123-129; Malliard, WS, Haigler, HT, Schlaepfer, DD (1995) Calcium-dependent binding of S100C to The N-terminal domain of Annexin I (as described in Biol. Chem., 2, 719-725) and the N-terminal 13 residues of S100C and annexin I (e.g., Maurer, P., Hohenadl, C., Hohenester, E., Gohring, W., Timpl, R., Engel, J. (1995) The C-terminal protein of BM-40 (SPARC / Osteonectin) is an autonomously A folding and crystallizable domain that binds calcium and collagen (as described in J. Mol. Biol., 253, 347-357) and osteonectin. Examples of some shapes containing such domains are shown in Figures 3O, 3P, and 3Q, although other shapes are possible.

[0061] The endolysosomal targeting conjugates may contain different numbers of targeting moieties and cargo moieties. The shapes shown in Figures 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, 3I, 3J, 3K, 3L, 3M, 3N, 3O, 3P, 3Q, 3R, and 3S are examples and not limitations, as multiple other shapes will be identifiable by one of skill in the art upon reading this disclosure.

[0062] In some examples described herein, the endolysosomal-targeting conjugate may include a toxin such as monomethyl auristatin (MMAE) conjugated via a valine-citrulline-PAB linker. The endolysosomal-targeting conjugate may include, for example, an antibody that binds to a cell surface molecule, such as HER2, at near-neutral pH with higher affinity than at acidic endosomal pH (HER2-ADCs, see Examples 2-5). The modified antibodies and proteins described herein can be expressed in mammalian cells with higher yields and conjugated to drugs with higher efficiency. Upon binding to HER2-positive cells, representative HER2-ADCs are internalized within early endosomes, where the pH decreases from near-neutral to approximately pH 5.5-6.5. This decrease in pH causes HER2-ADCs to dissociate from the early / sorting endosomal membrane, leading to effective lysosomal delivery of the MMAE drug. In particular (see, e.g., Figure 4B), pertuzumab variants SG and YS have dissociation constants higher than 1.5 μM at pH 5.8, whereas WT pertuzumab has a much lower dissociation constant at the same pH. Thus, HER2-ADCs can effectively eradicate HER2-positive cells, and treatment with HER2-ADCs in mouse models of HER2-expressing breast cancer can effectively suppress tumor growth without signs of adverse effects.

[0063] In another example described herein, an endolysosomal-targeting conjugate has a targeting moiety containing a PS-binding domain, such as the C2A domain of synaptotagmin 1 (Syt1), fused to a cargo moiety, such as the Fc region of an antibody conjugated to MMAE via a maleimidocaproylvaline-citrulline-PAB linker (PS-PDCs, see Examples 7-13). PS-targeting proteins can also be expressed in mammalian cells at high yields and conjugated to drugs with high efficiency. Exemplary PS-PDCs are configured to specifically bind to PS in a calcium-dependent manner. Upon binding to PS-positive cells, PS-PDCs are efficiently internalized into early endosomes, where calcium levels decrease from 2 mM to less than 2 μM. This decrease in calcium concentration dissociates PS-PDCs from the early / sorting endosomal membrane, leading to effective lysosomal delivery of the MMAE drug. PS-PDCs can effectively eradicate PS-positive cells, including but not limited to tumor endothelial cells, breast cancer, and prostate cancer cells. Treatment with PS-PDCs can effectively suppress tumor growth in mouse models of human triple-negative breast cancer and prostate cancer without signs of adverse effects, whereas unconjugated proteins have no pharmacological effect. Because PS is a universal marker for cancer endothelial cells and stressed tumor cells, PDCs can be applied to the treatment of most solid tumors.

[0064] pH-dependent or Ca 2+ The targeting moieties of the endolysosomal-targeting conjugates described herein that bind to target cell surface molecules in a target-dependent manner can be isolated from libraries of immunoglobulin variable domains, scFvs (VH:VL heterodimers in which the VH and VL domains are linked together by a linker peptide such as GGGGSGGGSGGGGGS) or Fab fragments using phage display, yeast display, or other methods identifiable by one of skill in the art. These libraries can be derived from naturally occurring antibody variable genes or can be constructed by randomizing or de-randomizing the complementarity-determining regions (CDRs). Libraries can be generated using methods that result in "semi-synthetic" libraries made using oligonucleotide sequences, or can be derived by inserting random mutations into the CDRs of existing antibody VH and VL domain genes. Random mutations can be inserted in the CDRs using error-prone PCR or with a bias toward histidine residues (because of pH dependence), followed by selection using phage display or yeast display. Exemplary CDR residues that are targeted are those in CDR3 of the light chain variable domain (residues 89-97, Kabat numbering) and CDR3 of the heavy chain variable domain (residues 95-102, Kabat numbering). If desired, pH-dependent or Ca2+-dependent CDRs can be selected. 2+ Selection of dependent scFv or Fab fragments can be performed using methods known to those skilled in the art. Furthermore, for the isolation of pH-dependent binders, CDR residues can be systematically mutated to histidines, and the resulting Fab or scFv fragments can be overexpressed and analyzed for binding to the target using, for example, surface plasmon resonance or ELISAs.

[0065] The endolysosomal-targeting conjugates described herein can have variations in the number of targeting moieties (e.g., Fab fragments or scFv fragments), ranging from 1 to 4 targeting moieties (Figure 3). These targeting moieties can be linked to immunoglobulin Fc fragments or other proteins such as albumin, and can include linker sequences between the fusion proteins, domains, or fragments that vary in length and composition, such as 2-3 repeats of GGGGS or its linkers, among other linker sequences identifiable by those skilled in the art. Domains such as CalD1 or CalD2 can also be linked to the targeting moiety and cargo moiety using similar linkers. The Fc fragment of the endolysosomal-targeting conjugate can also have mutations, such as knobs-into-holes and / or electrostatic steering mutations, to allow for the formation of heterodimers of Fc fragments with and without linked targeting moieties.

[0066] A targeting moiety may be fused to the Fc region of an antibody, reducing the size of the protein while retaining the therapeutic function and in vivo persistence that the Fc region elicits. In another example, the Fc region may be replaced with albumin or domain III of albumin, which has long-term in vivo persistence due to the interaction of albumin (or DIII) with the recycling receptor FcRn.

[0067] Representative endolysosomal-targeted conjugated ADCs and PDCs described herein demonstrate improved efficacy in killing cancer cells through enhanced intracellular release of toxins (see Examples 3-5, 9-13). In addition to the exemplary cytotoxic drug, MMAE, other cytotoxic drugs such as maytansinoids, tubulysin, benzodiazepines, and duocarmycins, among others identifiable by those skilled in the art, may be used. Drugs may be conjugated to cargo moieties, such as antibody fragments, antibody domains, nanobodies, proteins, protein fragments, or protein domains, via chemical conjugation. Examples of chemical couplings that may be used include amine to amine (NHS ester), sulfhydryl to sulfhydryl (maleimide), amine to sulfhydryl (NHS ester / maleimide), sulfhydryl to carbohydrate (maleimide / hydrazide), or linkage via unnatural amino acids with the desired chemical reactivity, among other methods identifiable by those skilled in the art. Unnatural amino acids may be inserted during recombinant production of targeting moieties. Polyethylene glycol (PEG) spacers may be inserted between chemically conjugated proteins, protein fragments, or other molecules. Linkers such as valine-citrulline may be cleavable to allow release of the cytotoxic drug in late endosomes or lysosomes by resident proteases such as cathepsins. Trastuzumab If the linkage is not cleavable, as in the case of uzumab-DM1, the antibody may be subjected to proteolytic degradation to release the drug. The choice of linkage chemistry, site of linkage, and peptide can be guided by molecular modeling and can be designed to minimize loss of binding activity of the ADC or PDC for cell surface receptors or other cell surface molecules, as will be understood by those of skill in the art.

[0068] The cargo component of endolysosomal-targeting conjugated LCs can be prepared by conjugating an imaging label identifiable by one skilled in the art to an antibody fragment, antibody domain, protein, protein fragment, or protein domain of the cargo component. Non-limiting examples of imaging labels include near-infrared dyes such as IRDye800CW or radiolabels such as I-124, Cu-64, or Zr-89. Conjugation to Cu-64 or Zr-89 can be achieved via chelation to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), which chelates these radiolabels, among other methods identifiable by one skilled in the art.

[0069] In a further example, the cargo component of the endolysosomal targeting conjugate can be a cytotoxic radiolabel (e.g., yttrium-90, Y-90, or iodine-131, I-131) or a drug or other agent that alters the behavior of the targeted cell. For example, the drug can be an antagonistic ligand for the androgen receptor (AR) and can be used to downregulate AR activity.

[0070] The term "behavior" with respect to a target cell or other cell may refer to an activity, function, output, or other attribute or effect of the phenotype or genotype of the target cell or other cell. As will be understood by those of skill in the art upon reading this disclosure, drugs and other agents generally can be used to produce an effect, such as a therapeutic effect, a cytotoxic effect, or the like, with respect to a particular target cell.

[0071] In some examples described herein, the endolysosomal targeting conjugate may comprise the amino acid sequence of SEQ ID NO:2 plus SEQ ID NO:4, SEQ ID NO:6 plus SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18 plus SEQ ID NO:20 plus SEQ ID NO:22, SEQ ID NO:22 plus SEQ ID NO:24 plus SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42 plus SEQ ID NO:44, SEQ ID NO:46 plus SEQ ID NO:48, or a homolog thereof.

[0072] The endolysosomal targeting conjugate may comprise an amino acid sequence having at least 50% identity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48.

[0073] As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences refers to the nucleotide bases or residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentages of sequence identity or similarity are used in reference to proteins, it is recognized that non-identical residue positions often differ by conservative amino acid substitutions, in which an amino acid residue is replaced with a functionally equivalent residue of an amino acid residue having similar physicochemical properties, thus not altering the functional properties of the molecule.

[0074] As used herein, functionally equivalent residues of an amino acid typically refer to other amino acid residues that have substantially similar physicochemical and stereochemical properties to the first amino acid. Physicochemical properties include water solubility (hydrophobic or hydrophilic), dielectric and electrochemical properties, physiological pH, partial side chain charge (positive, negative, or neutral), and other properties identifiable by one skilled in the art. Stereochemical properties include the spatial and conformational arrangement of amino acids and their chirality. For example, glutamic acid is considered a functionally equivalent residue to aspartic acid within the meaning of the present disclosure. Tyrosine and tryptophan are considered functionally equivalent residues to phenylalanine. Arginine is considered a functionally equivalent residue to lysine.

[0075] Those skilled in the art will understand that similarity between sequences is typically measured by methods that include aligning two polypeptide or polynucleotide sequences to form an aligned sequence, then determining the number of matching characters, i.e., similar or identical characters, between the two aligned sequences, and calculating the total number of matching characters divided by the total number of aligned characters in each polypeptide or polynucleotide sequence, including gaps. The similarity result is expressed as a percentage of identity.

[0076] As used herein, "percentage of sequence identity" means a value determined by comparison of two optimally aligned sequences over a comparison window, where the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where identical nucleic acid bases or amino acid residues occur in both sequences to give the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to give the percentage of sequence identity.

[0077] As used herein, a "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence can be the entire or a subset of a sequence specified, for example, as a full-length protein or a segment of a protein fragment. A reference sequence can be a sequence that can be identified in databases such as GenBank and Uniprot and others identifiable by one of skill in the art.

[0078] As will be appreciated by those skilled in the art, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Computer implementations of suitable mathematical algorithms can be used for the comparison of sequences to determine sequence identity. Such implementations include, but are not limited to, CLUSTAL, ALIGN, GAP, BESTFIT, BLAST, FASTA, among others identifiable by those skilled in the art.

[0079] For example, an endolysosomal targeting conjugate according to the present disclosure may comprise an amino acid sequence having at least 50% sequence identity, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity compared to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8 or SEQ ID NO:10 or SEQ ID NO:12 or SEQ ID NO:14 or SEQ ID NO:16 or SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32 or SEQ ID NO:34 or SEQ ID NO:36 or SEQ ID NO:38 or SEQ ID NO:40 or SEQ ID NO:42 or SEQ ID NO:44 or SEQ ID NO:46 or SEQ ID NO:48.

[0080] The endolysosomal targeting conjugates described herein may be provided in a composition, which comprises the endolysosomal targeting conjugate and a pharmaceutically acceptable vehicle.

[0081] The endolysosomal targeting conjugates or compositions thereof described herein may be administered using any suitable method for delivering them to a subject, such as a single cell, multiple cells, or a multicellular organism, particularly an animal or human, and particularly an animal or human that may have one or more tumors, such as via injection, particularly intravenous, subcutaneous, or intramuscular injection, among other methods identifiable by one of skill in the art.

[0082] The endolysosome-targeting conjugates or compositions thereof described herein may be used in a method for treating cancer, the method comprising administering to a patient an effective dose of the endolysosome-targeting conjugate or composition thereof, wherein the cargo molecule is a cytotoxic drug, and administration of the composition inhibits tumor growth in the patient.

[0083] The endolysosomal targeting conjugates or compositions thereof described herein may be used in a method for imaging tumors in a patient. The method includes administering to the patient an effective dose of an endolysosomal targeting conjugate composition, in which the cargo molecule is an imaging label, and performing an imaging method suitable for detecting the imaging label in the patient. In the method, the composition is administered in a dose effective to provide a sufficient concentration of the imaging label that is detectable by the imaging method, as can be determined by one of skill in the art.

[0084] The endolysosomal-targeting conjugates described herein or compositions thereof may be administered at suitable time intervals, for example, weekly, monthly, or whenever, for example, 50% of patients are expected to exhibit tumor regression.

[0085] In diagnostic / theranostic imaging, administration of an endolysosome-targeted conjugated LC comprising an imaging label, such as a radioactive label, a near-infrared label, or a fluorescent label, to a patient may be followed by a period of 1-7 days to allow for localization of target cells in the patient, e.g., tumor localization in the patient. Following this period, the patient may be imaged using positron emission tomography or other suitable imaging modality, such as localized or whole-body imaging, to allow detection of the location of target cells, such as tumors.

[0086] The endolysosomal targeting conjugates described herein may be designed to selectively target specific cell types, thereby delivering cargo molecules to selected target cells. In particular, the endolysosomal targeting conjugates described herein may be designed to target specific types of tumor cells in a patient. Thus, methods of providing an endolysosomal targeting conjugate described herein may include the steps of: (1) selecting a targeting moiety, where the targeting moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of cell, such as a tumor target cell, and where the targeting moiety is configured to bind to a cell surface molecule expressed on target cells in the extracellular space with higher affinity in the endolysosomal compartment; (2) selecting a cargo moiety, where the cargo moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, where the cargo molecule may be, for example, a cytotoxic drug having a pharmacological effect for inhibiting the growth of a selected type of tumor target cell or an imaging label suitable for imaging the selected tumor cell; and (3) providing an endolysosomal targeting conjugate comprising the targeting moiety fused directly or indirectly to the cargo moiety.

[0087] Alternatively, a method for providing an endolysosomal targeting conjugate for treating cancer and / or imaging a tumor in a patient includes the steps of: (1) selecting a targeting moiety; The method may include (1) selecting a cargo moiety, wherein the targeting moiety comprises an antibody, antibody fragment, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, and (2) selecting a cargo moiety, wherein the cargo moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, wherein the cargo molecule is, for example, a cytotoxic drug having a pharmacological effect for inhibiting the growth of a selected type of tumor target cell or an imaging label suitable for imaging the selected tumor cell. In particular, in the method, the targeting moiety is further modified to comprise a first protein domain and the cargo moiety is further modified to comprise a second protein domain, as described herein, wherein the first protein domain is configured to bind to the second domain in the extracellular space with higher affinity than in the endolysosomal compartment. [Example]

[0088] The following non-limiting examples are provided to further illustrate the endolysosomal targeting conjugates and methods disclosed herein. It should be recognized by those skilled in the art that the methods disclosed in the following examples represent methods found to function well in the practice of the invention and thus can be considered to constitute exemplary modes for its practice. However, those skilled in the art should, in light of this disclosure, recognize that many changes can be made within the specific examples disclosed and still obtain like or similar results without departing from the spirit and scope of the invention. [Example]

[0089] Materials and Methods Cell lines and culture conditionsThe mouse endothelial cell line 2H11 (ATCC, CRL-2163) was cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% heat-inactivated fetal bovine serum (FBS). The human breast cancer cell line MDA-MB-231 (ATCC, HTB-26) was cultured in DMEM supplemented with 10% FBS. The human breast cancer cell lines T-47D (ATCC, HTB-133), MDA-MB-453 (ATCC, HTB-131), and MDA-MB-468 (ATCC, HTB-132) were cultured in RPMI 1640 medium supplemented with 10% FBS. The human breast cancer cell line SK-BR-3 (ATCC, HTB-30) and the human ovarian cancer cell line SK-OV-3 (ATCC, HTB-77) were cultured in McCoy's 5A medium supplemented with 10% FBS. Human prostate cancer cell lines LNCaP and 22Rv1 (ATCC, CRL-1740 and CRL-2505, respectively) were cultured in RPMI 1640 medium supplemented with 10% FBS. The human breast cancer cell line HCC1954 (Gazdar, AF, Kurvari, V., Virmani, A., Gollahon, L., Sakaguchi, M., Westerfield, M., Kodagoda, D., Stasny, V., Cunningham, HT, Wistuba, II, Tomlinson, G., Tonk, V., Ashfaq, R., Leitch, AM, Minna, JD, Shay, JW (1998) Characterization of paired tumor and non-tumor cell lines established from patients with breast cancer. Int. J. Cancer. 78, 766-774) was cultured in RPMI 1640 medium supplemented with 10% FBS. All cancer cell lines were authenticated by DNA fingerprinting at the University of Arizona Genetics Core (UAGC). Cells were cultured at 37°C with 5% CO2. Expi293F cells (Life Technologies, Cat. No. A14635) used for protein expression were cultured in Expi293 expression medium at 37°C with 8% CO2 and 80% humidity.

[0090] Antibodies, antibody-drug conjugates and dextrans The following antibodies were used in this study: rat anti-mouse LAMP1, mouse anti-human LAMP1, and mouse anti-beta-tubulin antibodies (Developmental Studies Hybridoma Bank, clone numbers (clone#) 1D4B, H4A3, and E7), mouse anti-human EEA1 and rat anti-mouse CD31 antibodies (BD Biosciences, catalog numbers 610456 and 557355), goat anti-human IgG (H+L) antibody conjugated with HRP, donkey anti-rat (H+L) antibody conjugated with Alexa Fluor 488, and donkey anti-human IgG (H+L) antibody conjugated with Cy3 (Jackson ImmunoResearch, catalog numbers 109-035-003, 712-545-153, and 709-165-149), goat anti-human IgG (H+L) antibody conjugated with Alexa Fluor 555, and Alexa Fluor Goat anti-mouse IgG (H+L) antibody conjugated with 488 and goat anti-human IgG (H+L) conjugated with Alexa Fluor 647 (Life Technologies, catalog numbers A21433, A11029, and A21445), rabbit anti-human Ki-67 antibody (Abcam, catalog number 92742). Trastuzumab-DM1 (T-DM1, Kadcyla®) was obtained from UT Southwestern Medical Center Pharmacy (Dallas). Alexa Fluor 647-labeled dextran, 10 kDa molecular weight, was purchased from Life Technologies (catalog number D22914).

[0091] 1. Creation of Expression Constructs for Production of Protein-Drug ConjugatesFor use as a control, the Fc region including the hinge region (heavy chain residues 215-447, EU numbering) of hen egg lysozyme-specific human IgG1, HuLys10 (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J. Mol. Biol. 224, 487-499) was cloned into the pcDNA3.4 vector with an N-terminal leader peptide derived from the mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J. Mol. Biol. 224, 487-499; Neuberger, MS (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells. EMBO J.2:1373-1378). Similarly, genes encoding the heavy and light chain genes (cDNA) of the HuLys10 antibody were cloned into pcDNA3.4. To prepare the IgG heavy and light chain constructs, both Cys220 (EU numbering) in the heavy chain of HuLys10 and Cys214 (EU numbering) in the light chain, which forms a sulfhydryl bridge, were mutated to serine residues using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, catalog number 200523).

[0092] cDNA clones for human annexin A1 (AnxA1), human synaptotagmin 1 (Syt1), and human PKCα were purchased from Open Biosystems (clone ID: 3459615, clone ID: 6187902, and clone ID: 40028305, respectively). The genes encoding the AnxA1 PS-binding core domain (amino acids 41-346), the Syt1 PS-binding C2A domain (amino acids 141-266), and the PKCα PS-binding C2 domain (amino acids 157-288) were fused via a Gly4Ser linker sequence to the CH3 domain of the human IgG1 Fc region (residues 215-447, EU numbering) with a leader peptide derived from the mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework). residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224,487-499, Neuberger,MS (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells. EMBO J.2:1373-1378). Cys220 (EU numbering) in the hinge region was mutated in all Fc fusion constructs to allow for two cysteine ​​residues per hinge. Genes encoding the Fc fusions were cloned into the pcDNA3.4 vector (Invitrogen, catalog no. 14308).

[0093] To generate Syt1-Fc-Syt1, the Syt1 PS-binding C2A domain (amino acids 141-266) was linked to the N-terminus of the hinge region of the Fc-Syt1 construct via a Gly4Ser linker sequence. The leader peptide derived from the mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224,487-499, Neuberger, MS (1983) Expression and regulation of immunoglobulin heavy The chain gene was transfected into lymphoid cells. EMBO J.2:1373-1378) was added to the N-terminus of the hinge-linked Syt1 PS-binding C2A domain, and the resulting Fc fusion was cloned into the pcDNA3.4 vector. Mutations that reduce PS binding in the Syt1 C2A domain (D173N, D179N, D231N, D233N, and D239N) were introduced (Striegel, AR, Biela, LM, Evans, CS, Wang, Z., Delehoy, JB, Sutton, RB, Chapman, ER, and Reist, NE 2012). Calcium binding by synaptotagmin's C2A domain is an essential element. of the electrostatic switch that triggers synchronous synaptic transmission. J. Neurosci. 32, 1253-1260) was inserted into the Syt1-Fc construct to generate Fc-Syt1(DN), which was then cloned into the pcDNA3.4 vector. All constructs were made using standard molecular biology methods and designed oligonucleotides.

[0094] Generation of expression constructs for antibody-drug conjugates Synthetic genes encoding the heavy chain variable domain and light chain variable domain of the HER2-specific antibody, pertuzumab (Franklin, MC, Carey, KD, Vajdos, FF, Leahy, DJ, de Vos, AM, Sliwkowski, MX (2004) Insights into ErbB signaling from the structure of the ErbB2-pertuzumab complex. Cancer Cell, 4, 317-328) was purchased from Genescript and cloned into an expression vector for the production of a Fab fragment containing human heavy chain constant region domain 1 (CH1) and human light chain constant domain (kappa chain, Cκ). To identify residues in the pertuzumab heavy and light chain variable domains to target for histidine scanning, the crystal structure of pertuzumab in complex with the antigen, HER2 (Protein Data Bank accession code 1N8Z) was analyzed in PyMOL. Residues in domain II of HER2 (Franklin, MC, Carey, KD, Vajdos, FF, Leahy, DJ, de Vos, AM, Sliwkowski, MX (2004) Insights into ErbB Residues located in the CDRs of pertuzumab (VH domain: Asp31, Tyr32, Asn54, Tyr60, Leu100, Gly101, Pro102, Ser103, Tyr105, Asp107; VL domain: Tyr55; the amino acid numbers mentioned are those in the protein sequences of the pertuzumab heavy and light chain variable domains and do not refer to other numbering conventions) interacting with His245, Val286, Ser288, Leu295, His296, and Lys311, as described in Signaling from the structure of the ErbB2-pertuzumab complex. Cancer Cell, 4, 317-328) were selected as overlap extension splicing sites (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid genes without the use of restriction enzymes: The nucleotides were systematically replaced with histidines using gene splicing by overlap extension (Gene 77, 61-68). The resulting genes were cloned and expressed in E. coli as Fab fragments that were secreted periplasmically.

[0095] The phage display vector, pHEN1 (Hoogenboom, H.R., Griffiths, A.D., Johnson, K.S., Chiswell, D.J., Hudson, P., Winter, G. (1991) Multi-subunit To generate the pertuzumab scFv gene in proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucl. Acids Res. 19, 4133-4137), the Fab fragment expression vector for pertuzumab was modified using standard molecular biology methods to insert a linker peptide [(Gly4Ser)3] between the heavy and light chain variable domain genes, and the scFv gene was subsequently recloned into pHEN1. The following oligonucleotides were used to generate a library of mutant pertuzumab scFvs with randomly mutated residues in the CDRs: The DNA sequences for each oligonucleotide are shown in the 5' to 3' direction: CDRH1Back, GCTTCTGGATTCACATTCACANNBNNBNNBATGGATTGGGTGAGACAGGCT (SEQ ID NO: 49); CDRH1For, TGTGAATGTGAATCCAGAAGC (SEQ ID NO: 50); CDRH2Back, TGGGTGGCTGATGTGAATCCTNNBNNBNNBNNBTCTATCTACAATCAGAGATTC (SEQ ID NO: 51); CDRH2For, AGGATTCACATCAGCCACCCA (SEQ ID NO: 52); CDRH3Back, TACTACTGTGCTAGAAATCTGNNBCCTNNBTTCNNBTTCGATNNBTGGGGACAGGGAACACTG (SEQ ID NO: 53); CDRH3For, CAGATTTCTAGCACAGTAGTA (SEQ ID NO: 54); CDRL2-1Back, CCTAAGCTGCTGATCTACTCTNNBTCTNNBAGANNBACAGGAGTGCCTTCTAGA (SEQ ID NO: 55), CDRL2-1For, AGAGTAGATCAGCAGCTTAGG (SEQ ID NO: 56), CDRL2-2Back, GGAAAGGCTCCTAAGCTGCTGNNBNNBNNBGCTTCTTACAGATACACAGGA (SEQ ID NO: 57), and CDRL2-2For5, CAGCAGCTTAGGAGCCTTTCC (SEQ ID NO: 58).Using molecular biology techniques known to those skilled in the art, a library of scFv genes was generated, approximately 5x10 for each targeted CDR, using electroporation of E. coli TG1 (Lucigen, Cat. No. 60502). 7 A library of mutants was generated.

[0096] Colonies from the library were pooled and transfected with M13KO7 helper phagocytosis. phage (NEB, Cat. No. N0315S) was used to inoculate cultures supplemented with 100 μg / mL ampicillin and 50 μg / mL kanamycin overnight at 30°C. Extruded phage were harvested from the supernatant by precipitation with 4% polyethylene glycol 8000, 3% NaCl. Phage (2x10 12Phages (100 μL of 100 pfu / mL) were pre-panned using Maxisorp 96-well microtiter plates (Thermofisher, catalog no. 44-2404-21) coated with 4% skim milk / phosphate-buffered saline (PBS) and then panned using Maxisorp 96 cell plates coated with 2 μg / mL recombinant human HER2 (extracellular domain)-Fc fusion protein (HER2-ECD-Fc, R&D Research, catalog no. 1129-ER-050). Phages were incubated with 4% skim milk pH 7.4 in the 96-well plates for 2 hours. Plates were washed extensively with PBS pH 7.4 supplemented with 0.1% Tween-20 (PBST), followed by washing with PBS pH 7.4. Phages with pH-dependent binding were selectively eluted with 20 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.8, for 10 minutes at room temperature. The eluted phage were used to infect exponentially growing E. coli TG1. Four rounds of panning were performed, and isolated phage were screened for binding to HER2 at pH 7.0 with higher affinity at pH 5.8. Recombinant scFvs encoded by selected phages were analyzed for binding to HER2 by ELISA and / or surface plasmon resonance.

[0097] The heavy and light chain variable domain genes for pertuzumab scFv or Fab fragments, which have higher affinity at pH 7.0 than at pH 5.8, were cloned into cassette vectors for expression of human IgG1 heavy and light chain (CK) sequences, respectively, using pcDNA4.3 as the backbone vector. The hinge disulfide bond linking the CK domain to the hinge region and one hinge disulfide linking the two heavy chains to each other were removed from the heavy and light chains by mutating the light chain cysteine ​​(Cys214, EU numbering) and two heavy chain cysteines (Cys220, Cys229, EU numbering) to serine.

[0098] To generate an expression construct encoding the HER2-specific Fab fragment of trastuzumab fused to calbindin D9K domain 2 (CalD2), genes encoding the heavy and light chain variable domains of trastuzumab (Carter, P., Presta, L., Gorman, CM, Ridgway, JB, Henner, D., Wong, WL, Rowland, AM, Kotts, C., Carver, ME, Shepard, HM (1992) Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci USA, 89, 4285-4289) were synthesized using Genescript. The calbindin D9K gene (Berggard, T., Julenius, K., Ogard, A., Drakenberg, T., Linse, S. (2001) Fragment complementation studies of protein stabilization by hydrophobic core residues. Biochemistry, 5, 1257-1264) was synthesized by Genescript, and the trastuzumab Fab heavy chain (VH-CH1-linker including part of the hinge) and CalD2 domain genes were fused together with a Ser-Gly-Gly linker using overlap extension splicing (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid genes without the use of restrictive The VH-CH1-CalD2 fusion protein gene and the gene encoding the trastuzumab light chain (with a C-terminal polyhistidine tag) were separately cloned into the pcDNA3.4 vector.

[0099] A similar method was used to generate an expression construct encoding the PSMA-specific (026) VH-CH1-linker peptide fused to the CalD2 domain. Genes encoding the 026 heavy and light chain variable domains (U.S. Patent No. 7,850,971 B2) were synthesized by Genescript. The CalD2 domain gene and the 026 VH-CH1-linker were fused together by overlap extension splicing, and the resulting fusion protein gene was cloned into pcDNA3.4. The gene encoding the 026 light chain with a C-terminal polyhistidine tag was cloned into another pcDNA3.4 vector.

[0100] To generate an expression construct encoding calbindin D9K domain 1 (CalD1) fused to a human IgG1-derived Fc fragment, splicing by overlap extension (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid The Fc domain (hinge-CH2-CH3, derived from human IgG1) gene was fused to the calbindin D9K domain 1 gene via a Gly-Ser-Ser linker via genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68) and cloned into the pcDNA3.4 vector.

[0101] Protein expression and purificationRecombinant antibodies and Fc fusion proteins were produced using the Expi293 expression system from Life Technologies according to the manufacturer's instructions. Briefly, cells were transfected with the expression constructs (described above) for 6–7 days, and recombinant PDCs or ADCs were purified from the culture supernatant using protein G-Sepharose. Bound proteins were eluted using 50 mM diethylamine with 150 mM NaCl. The eluted proteins were neutralized with 2 M Tris pH 7.0, dialyzed against PBS, concentrated, and loaded onto a Hiload 16 / 600 Superdex 200 gel filtration column (GE Healthcare). Monomeric forms of the proteins were isolated, concentrated, and analyzed using a Superdex 200 5 / 150 gel filtration column (GE Healthcare) or a Yarra 3 μm SEC-3000 column (Phenomenex).

[0102] Using the above-mentioned Expi293 expression system, trastuzumab Fab-CalD2, 026 Fab-CalD2, and CalD1-Fc fusion proteins were produced, and Ni 2+ The recombinant protein was purified from the culture supernatant using -NTA-agarose.

[0103] Pertuzumab scFv and Fab fragments were expressed as recombinant proteins using E. coli as a host. The scFv and Fab fragments were secreted into the periplasm and expressed as Ni 2+ -NTA-agarose was used to purify the antibody from osmotically shocked E. coli cells.

[0104] Protein conjugation with maleimidocaproyl-val-cit-PAB-MMAE The Fc fusion or control antibody in PBS was reduced by adding 16 molar equivalents (8 molar equivalents x number of hinge disulfides) of TCEP for 3 hours at room temperature to reduce the hinge disulfide bond. The reduced Fc fusion was then added with maleimidocaproyl-val-cit-PAB-MMAE (MC-VC-PAB-MMAE, Levena Biopharmaceuticals). , Catalog No. SET0201) was added at 8 molar equivalents (4 molar equivalents x number of free cysteines) and incubated at room temperature for 3 hours. Following the conjugation reaction, free MMAE was removed by extensive dialysis of the protein against PBS. The conjugated Fc fusion or control antibody was stored at 4°C.

[0105] To generate ADCs, a similar method was used, except that 8 molar equivalents of TCEP and 4 molar equivalents of MC-VC-PAB-MMAE were used because only one hinge disulfide was present, and the antibody was reduced at 37°C for 2 hours.

[0106] Surface plasmon resonance analysisBinding analysis was performed using a BIAcore T200 (GE Healthcare). Using amine coupling chemistry, the flow cell of a CM5 sensor chip was coupled with recombinant HER2-ECD-Fc (a fusion of the HER2 extracellular domain to an immunoglobulin Fc fragment), wild-type (WT) pertuzumab, mutated pertuzumab variants, or coupling buffer (10 mM sodium acetate, pH 4.8) as a control. Antibody was injected onto the immobilized HER2-ECD-Fc, or HER2-ECD-Fc onto the immobilized antibody, at a flow rate of 5 or 10 μL / min in phosphate-buffered saline (PBS) plus 0.01% (v / v) Tween-20 and 0.05% (v / v) NaN3 (pH 7.4, 7.0, 6.5, and 5.8) at 25 °C. The flow cell was regenerated after each injection with 0.15 M NaCl / 0.1 M glycine (pH 2.8) buffer. For determination of the equilibrium dissociation constant, the antibody was injected over immobilized HER2-ECD-Fc and the interaction was modeled as a 1:1 interaction using custom written software (Ober, RJ, Ward, ES (2002) Compensation for loss of ligand activity in surface plasmon resonance experiments. Anal. Biochem., 306, 228-236), giving an apparent dissociation constant (due to bivalent binding of the antibody to immobilized HER2-ECD-Fc).

[0107] To investigate the calcium dependence of the interaction between the Fab-CalD2 fusion protein and the CalD1-Fc fusion protein, Fab-CalD2 was injected, followed by co-injection of CalD1-Fc in buffer containing various calcium concentrations. Specifically, 100 nM of trastuzumab Fab-CalD2 fusion was co-injected onto immobilized HER2-ECD-Fc in PBS, 0.01% (v / v) Tween-20, 0.05% (v / v) NaN3 pH 7.4 (PBS). + ) plus 2 mM CaCl at 25 °C at a flow rate of 10 μL / min, followed by 100 nM CalD1-Fc fusion in PBS+ Plus 2 mM CaCl2 was injected at a flow rate of 10 μL / min at 25 °C. During the dissociation phase, PBS with various concentrations of CaCl2 or EDTA2Na was injected. + Data were processed using BIAevaluation and custom software.

[0108] Membrane lipid strip binding assay for PS-targeted proteins Lipid-coated membrane strips (Echelon, catalog number P-6002) were first hydrated with TBST (20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.5) and then incubated with blocking solution (4% fatty acid-free BSA dissolved in TBST) for 1 hour at room temperature. Proteins were diluted at 2 μg / ml in blocking buffer and incubated with the membranes for 2 hours at room temperature. The lipid strips were then washed with TBST, and bound proteins were detected using a horseradish peroxidase (HRP)-conjugated goat anti-human IgG (H+L) antibody.

[0109] Flow cytometry analysis of antibody-drug conjugate internalization Cancer cells were plated in 48-well plates and incubated overnight at 37°C. The cells were treated with Alexa 488-labeled ADCs for 0.5, 4, and 20 hours. The treated cells were cooled on ice, and the Alexa 488 surface signal was quenched with 5 μg / mL rabbit anti-Alexa 488 antibody at 4°C for 30 minutes. The samples were washed, harvested by trypsinization, resuspended in PBS, and analyzed using FACS-Accuri. Data were processed using FlowJo (FLOWJO, LLC).

[0110] To analyze intracellular accumulation of CalD1-Fc, LNCaP cells were plated in 48-well plates and allowed to adhere. They were then pulsed with 100 nM Alexa 647-labeled CalD1-Fc or a mixture of 100 nM Alexa 647-labeled CalD1-Fc plus 100 nM 026 Fab-CalD2 for 1 or 2 hours. The cells were washed and detached by trypsinization using trypsin-EDTA (Gibco catalog number 25200056), which dissociated Alexa 647-labeled CalD1-Fc from cell surface-bound 026 Fab-CalD2. The cells were harvested, washed, and analyzed using a BD Accuri C6 flow cytometer.

[0111] Fluorescence microscopy analysis of PS and HER2-targeted drugsTo study the intracellular localization of PS-targeted drugs, 2H11 or MDA-MB-231 cells were grown on glass coverslips (Zeiss, ref. 0109030091) and incubated with 50 nM control IgG (HuLys10) or 50 nM PS-targeted drugs diluted in growth medium for 3 hours. Cells were then washed with PBS and fixed with ice-cold 4% paraformaldehyde (PFA) for 20 minutes at room temperature. Following fixation, cells were permeabilized with 0.1% Triton X-100 and incubated with blocking buffer (PBS, 5% serum, and 0.1% Tween 20) for 30 minutes at room temperature. Primary antibodies specific for mouse LAMP-1 (clone 1D4B), human LAMP-1 (clone H4A3), or mouse EEA1 were diluted in blocking buffer and incubated with the cells for 2 hours at room temperature. The cells were then washed with PBST (PBS with 0.1% Tween 20) and incubated with fluorescently labeled secondary antibodies diluted in blocking buffer for 1 hour at room temperature. Fluorescently labeled goat or donkey anti-human IgG (H+L) antibodies were used to detect internalized PS-targeted drugs. Following incubation, the cells were washed with PBST and mounted with ProLong Gold antifade mountant (Life Technologies, catalog no. P36930). Fluorescence images were acquired using a Zeiss Axiovert 200M inverted fluorescence microscope with a 63X, 1.4NA Plan-Apochromat objective (Carl Zeiss) and a 1.6X internal optovar. The acquired data were processed using the Microscopy Image Analysis Tool (MIATool) software (www4.utsouthwestern.edu / wardlab / miatool.asp).

[0112] To study the intracellular fate of internalized HER2-targeting ADCs, MDA-MB-453 cells were plated on Mattek dishes. Cells were pretreated with 5 μM Alexa 647-labeled dextran (pulsed for 2 hours and chased for 3 hours) and then treated with 10 nM Alexa 488-labeled mutants of pertuzumab conjugated to MMAE (SG-MMAE, YS-MMAE) or T-DM1 for 20 hours. Wild-type (WT) pertuzumab conjugated to MMAE was used as a control. Samples were treated with 33.3 nM rabbit anti-Alexa 488 antibody (Thermofisher, catalog no. A11094) on ice for 30 minutes to quench surface fluorescence. Cells were fixed with 1.7% (w / v) paraformaldehyde supplemented with 0.025% glutaraldehyde for 10 minutes at room temperature. The samples were imaged and the data processed as described above.

[0113] PS pull-down assay for PS-targeted drugs Ca binding of PS-targeting Fc fusions to PS 2+ For dependency studies, proteins were added to binding buffer (2 mM or 2 μM Ca) 2+ The proteins were diluted to 100 nM in PBS pH 7.4 or 6.0 (bed volume) with 10 mM HEPES pH 7.4 and 150 mM NaCl. 50 μl of PS-coated beads (Echelon, catalog number P-B0PS) were added and incubated for 2 hours at room temperature. The beads were then washed with binding buffer, and bound proteins were detected by immunoblotting using an HRP-conjugated goat anti-human IgG (H+L) antibody. To examine pH-dependent binding to PS, the proteins were diluted to 100 nM in PBS pH 7.4 or 6.0. 50 μl (bed volume) of PS-coated beads were added and incubated for 2 hours at room temperature. The beads were then washed with PBS, and bound proteins were detected by immunoblotting using an HRP-conjugated goat anti-human IgG (H+L) antibody.

[0114] Annexin V binding assay to analyze the levels of exposed PS on cellsOne million cells were suspended in Annexin V binding solution (10 mM HEPES pH 7.4 with 150 mM NaCl and 2.5 mM CaCl). Annexin V conjugated with Alexa 488 Fluor (Life Technologies, catalog no. A13201) was added to the cell suspension at a 1:100 dilution and incubated with the cells for 10 minutes at room temperature. The cells were then washed once with Annexin V binding solution and analyzed by flow cytometry (BD FACSCalibur). Flow cytometry data were processed using FlowJo (FLOWJO, LLC).

[0115] Flow cytometry analysis of PS-targeted drugs Cells were trypsinized and resuspended in flow cytometry buffer (PBSw / Ca). 2+ / Mg 2+ The cells were resuspended in 5% PBS (and 1% BSA). 50 nM of PS-targeting Fc fusion was incubated with the cells for 30 minutes at room temperature or on ice, depending on the assay. The cells were washed with flow cytometry buffer and incubated with fluorophore-conjugated secondary antibodies for 30 minutes on ice. The cells were then washed and analyzed by flow cytometry (BD FACSCalibur). Flow cytometry data were processed using FlowJo (FLOWJO, LLC).

[0116] Cell growth and viability assays Cancer cell lines (2H11, MCF-7, SK-BR-3, SK-OV-3, LNCaP, 22Rv1, MDA-MB-231, MDA-MB-453, MDA-MB-468, and HCC1954) were plated in 96-well plates. Cells were grown overnight, followed by addition of PS-targeting PDCs or HER2-targeting ADCs. After 3–5 days of incubation, cell growth and viability were measured using the Cell Proliferation AQ One Solution Cell Proliferation Assay kit (Promega, catalog number G3581). Dose-response curves were plotted using GraphPad Prism software.

[0117] Whole-body imaging, pharmacokinetic, and therapeutic studies in mice Animal procedures used in all mouse studies were approved by the Institutional Animal Care and Use Committees of the University of Texas Southwestern Medical Center and Texas A&M University. BALB / c SCID mice were purchased from the Jackson Laboratory (stock number 001803) and housed in house. Pharmacokinetic studies were performed as previously described (19). Briefly, Lugol's solution was added to the drinking water 96 hours before the experiment. SCID BALB / c female mice (8 weeks old, weighing 18-22 g) were anesthetized with 2% isoflurane in oxygen. 125 I-labeled protein (100-120 μCi, 10-12 μg / mL) The mice were injected (intravenously) with 100 mg / kg of ethanol (100 mg / kg). Whole body counting was performed at various time points using a dose calibrator (Capintec Inc.).

[0118] For whole-body near-infrared imaging (NIR) using PS-targeted agents, female nude mice (6-7 weeks old, purchased from Envigo, catalog number 6903F) or BALB / c SCID mice (6-8 weeks old) were used. For implantation of MDA-MB-231 tumors, mice were anesthetized with 2% isoflurane in oxygen, and a small surgical incision was made to expose the mammary fat pad. MDA-MB-231 cells were trypsinized and dispersed into single cell suspensions in PBS. 5x10 cells were used per mouse. 6 Cells were injected into the mammary fat pad in 100 μl using a 25G needle, and the wound was then closed using wound clips. Buprenorphine was administered at 50 μg / kg (subcutaneously) immediately after surgery and 12 hours later. Mice were monitored daily, and wound clips were removed one week after surgery. For imaging of nude mice, tumors were grown to approximately 150 mm 3When the tumor size reached 30 mm, mice were divided into three groups (n = 3 mice per group) and anesthetized with 2% isoflurane in oxygen. Anesthetized mice were injected (intravenously) with 1 nmole of IRDye800CW-labeled PS-specific agent in PBS. Fluorescence imaging (FLI) was performed using a Caliper Xenogen IVIS Spectrum (Perkin Elmer) in vivo imaging system at time 0 (pre-injection) and 3, 24, and 48 h post-injection. FLI was performed using 745 nm excitation, 800 nm emission, binning 8, FOV 12.9 cm, f-stop 2, and autoexposure. Absolute radiant efficiency (photons / second) in a manually drawn ROI was used to outline the tumor FLI signal, and data were quantified and normalized to tumor volume using Living Imaging software. For imaging in BALB / c SCID mice, tumors were measured at approximately 300 mm. 3 When tumors reached a size of 100 μg / cm, mice were divided into three groups (n = 3 mice per group) and injected (intravenously) with 1 nmole of IRDye800CW-labeled PS-specific agent in PBS. 48 hours after injection, tumors were sectioned and imaged as described above. Fluorescence in manually drawn ROIs to outline the tumor FLI signal was quantified and normalized to tumor weight.

[0119] For tumor treatment studies using PS-targeted PDCs, implantation of MDA-MBA-231 tumor xenografts in BALB / c SCID mice was performed as described for the whole-body imaging experiments. For implantation of LNCaP tumors, 7-8 week-old male BALB / c SCID mice (18-22 g body weight) were anesthetized with 2% isoflurane in oxygen and 5 x 10 cells suspended in 50% RPMI and 50% Matrigel (BD Biosciences) were cultured. 6Mice were injected subcutaneously with 100 LNCaP cells. When MDA-MBA-231 or LNCaP tumors reached approximately 100 mm in size, 72 and 48 hours before treatment, mice were injected intraperitoneally with 5 mg / kg docetaxel. Mice were then injected intravenously twice weekly with 1 nmole of unconjugated protein, PDCs, or PBS vehicle. Tumor and body weights were measured twice weekly. Fc-Syt1 (DN) For treatment experiments with MMAE (Figure 16D), mice were treated for 4 weeks and monitored for an additional 2.5 weeks. The experiment was stopped when tumor size reached 2 cm in any dimension.

[0120] For treatment with HER2-specific ADCs, 6-8 week old female BALB / c SCID mice were inoculated with 4-5x10 IgG using the methods described for whole body imaging experiments. 6 MDA-MB-453 cells were transplanted. The tumors were approximately 60-100 mm 3 Once the mice reached a size of 100 mm, they were injected (intravenously) with 2 mg / kg of ADC, T-DM1, unconjugated protein, or PBS vehicle once every 3 weeks (total of 2 doses).

[0121] Immunohistochemical analysisFemale BALB / c SCID mice bearing MDA-MB-231 tumors were treated with 5 mg / kg docetaxel (intraperitoneally) 72 and 48 hours prior to delivery (intravenously) of either PBS or 1 nmole of Fc-Syt1 conjugated with MMAE. At various time points, mice were perfused with PBS followed by 4% PFA. Tumors were then excised, embedded in OCT (Fisher Scientific, catalog number 23-730-571), and stored at -80°C. 10 μm tissue sections were cut, hydrated with PBS at room temperature, and then fixed with 4% PFA for 30 minutes. Tumor sections were then washed with PBS and incubated with permeabilization / blocking solution (PBS + 0.5% Triton X-100 and 3% BSA) at room temperature for 1 hour. Primary antibodies for human Ki-67 and mouse CD31 were diluted in blocking buffer (PBS + 0.1% Tween 20 + 5% serum) and incubated with tissue sections overnight at 4°C. The next day, tissue sections were washed with PBST (PBS + 0.1% Tween 20) and incubated with fluorophore-conjugated secondary antibodies diluted in blocking buffer at room temperature for 2 hours. After washing with PBST, tissue sections were mounted with ProLong Gold antifade mounting medium. Confocal images were acquired using a Nikon A1R confocal microscope with a 40X, 1.3NA Plan Fluor objective and processed using NIS-Elements software (Nikon). [Example]

[0122] Creation of HER2-targeting drugs with pH-dependent binding to HER2 Figures 4A and 4B show binding analyses of two mutated variants of pertuzumab targeting HER2. The SG mutant, in which Ser55 is mutated to histidine and Gly57 is mutated to glutamic acid in the heavy chain variable domain (SEQ ID NO: 4), and the YS mutant, in which Tyr55 is mutated to histidine in the light chain variable domain and Ser103 is mutated to histidine in the heavy chain variable domain (SEQ ID NOs: 6 and 8). Data were obtained using surface plasmon resonance. Figure 4A shows representative sensorgrams of the interaction of 1 μM HER-extracellular domain (ECD)-Fc fusion with the mutated variants and wild-type (WT) pertuzumab at pH 7.0 and 5.8. For the analysis shown in Figure 4A, antibodies were immobilized on a flow cell. Figure 4B shows the equilibrium dissociation constants (nM) for WT pertuzumab, SG, and YS obtained by injecting antibodies over immobilized HER2-ECD-Fc. The data show that both the SG and YS mutants of pertuzumab have a greater pH dependence for binding to HER2 than WT pertuzumab. [Example]

[0123] Internalization and accumulation of HER2-targeted drugs in HER2-expressing cells Pertuzumab (WT) and the mutated variants SG and YS were conjugated to maleimidocaproyl-val-cit-PAB-MMAE (MC-VC-PAB-MMAE) via the two hinge cysteine ​​residues at a drug-to-antibody ratio (DAR) of two drugs per antibody, followed by analysis of the binding and accumulation of HER2-targeted ADCs (HER2-ADCs) in a panel of various HER2-expressing cell lines. Figure 5A shows the expression levels of HER2 on various cancer cell lines detected using Alexa 647-labeled pertuzumab (solid line) or an Alexa 647-labeled control antibody (dotted line) and flow cytometry. Figure 5B shows the internalized Alexa 647-labeled pertuzumab after 0.5, 4, and 20 hours of incubation. Levels of 488-labeled WT pertuzumab-MMAE (WT-MMAE), SG-MMAE, YS-MMAE, control antibody-MMAE (C-MMAE), or trastuzumab-DM1 (T-DM1) are shown. Cell surface-bound ADC was quenched using an Alexa 488-specific antibody. Error bars indicate standard deviation. * indicates a statistically significant difference (Student's t-test, p<0.05). The data show that SG-MMAE and YS-MMAE accumulate to higher levels than WT-MMAE and T-DM1 for all cancer cell lines examined. MDA-MB-453 cancer cells expressing moderate levels of HER2 (Figure 1). Delivery of ADCs to lysosomes in MDA-MB-453 cells (Figure 5A) was also examined using fluorescence microscopy (Figure 5C). Lysosomes in MDA-MB-453 cells were labeled by pulse chasing with Alexa 647-labeled dextran. Cells were then incubated with 10 nM Alexa 488-labeled ADCs for 20 hours, washed, and the surface signal was quenched with an Alexa-488-specific antibody. Microscopic images (size bar = 3 μm) show substantially higher levels of SG-MMAE and YS-MMAE accumulation in lysosomes compared to WT-MMAE or T-DM1. [Example]

[0124] HER2-ADCs inhibit the growth and survival of HER2-positive cells Analysis of the effect of HER2- ADCs on the viability of HER2+ breast cancer cells shows that SG-MMAE and YS-MMAE are more effective than WT-pertuzumab conjugated to MMAE (WT-MMAE) or T-DM1 in reducing the viability of MDA-MBA-MB-453, SK-OV-3, and JIMT-1 cells (Figure 6). Error bars indicate standard deviation. * indicates a statistically significant difference (Student's t-test, p<0.05). [Example]

[0125] Suppression of tumor growth by HER2-ADCs in a mouse xenograft model Pharmacokinetic analysis of HER2-ADCs (WT-MMAE, SG-MMAE, and YS-MMAE) showed that the in vivo persistence of SG-MMAE and YS-MMAE in BALB / c SCID mice was similar to that of WT-MMAE (Figure 7A, n = 5 mice per group). The ADCs were radiolabeled with 125I and injected into mice (5 mice per group), and residual radioactivity in the blood and systemic levels was determined at the indicated time points. Therapeutic studies using ADCs in BALB / c SCID mice bearing MDA-MB-453 xenografts (moderate HER2 expression levels) showed that SG-MMAE and YS-MMAE were more effective than WT-MMAE or T-DM1 in treatment (Figure 7B). Mice were treated with two 2 mg / kg doses of ADC on days 17 and 38 (Experiment 1, indicated by arrows) or days 24 and 45 (Experiment 2, indicated by arrows). Error bars indicate standard deviation and indicate statistically significant differences at treatment endpoints (SG-MMAE vs. WT-MMAE or T-DM1, YS-MMAE vs. WT-MMAE or T-DM1). * (Student's t-test, p<0.05, n=5-8 mice per group). Collectively, the data indicate that SG-MMAE and YS-MMAE have favorable pharmacokinetics and are also more effective than their parent WT pertuzumab and the clinically approved HER2-specific ADC, T-DM1, in reducing tumor growth. [Example]

[0126] Generation and characterization of ADCs with calcium-dependent association The interaction of a HER2-specific Fab fragment (derived from trastuzumab) fused to domain 2 of calbindin D9K (CalD2) via a hinge-SGG linker at the C-terminus of the CH1 domain (Trastuzumab Fab-CalD2, SEQ ID NO: 18 associated with the trastuzumab light chain, SEQ ID NO: 20) with a human IgG-derived Fc fragment fused to domain 1 of calbindin D9K (CalD1-Fc, SEQ ID NO: 22) using surface plasmon resonance revealed that Ca 2+The sensorgram shows the binding of 100 nM trastuzumab Fab-CalD2 to immobilized HER2-ECD, followed by 100 nM CalD1-Fc and then various Ca concentrations ranging from 0 to 2 mM (Figure 8A). 2+ The data show representative sensorgrams, which show the concentration of Ca 2+ The dissociation of Fab-CalD2 and CalD1-Fc increases with decreasing concentration. PSMA-specific VH-CH1 domain (PRGX1-XG1-029, abbreviated as 026) fused to CalD2 via a hinge-SGG linker. Schuelke, N., Varlamova, OA, Donovan, GP, Ma., D., Gardner, JP, Morrissey, DM, Arrigale, RR, Zhan, C., Chodera, AJ, Surowitz, KG, Maddon, PJ, Heston, WDW, Olson, WC (2003) The homodimer of prostate-specific membrane antigen is a functional target for cancer. We also generated a fusion protein (026-CalD2, SEQ ID NO: 24) containing the 026 light chain (Fab-CalD2). Upon association with the 026 light chain (SEQ ID NO: 26), this CalD2 fusion forms Fab-CalD2. Flow cytometry analysis showed that the accumulation of fluorescently labeled CalD1-Fc (SEQ ID NO: 22) in PSMA-expressing LNCaP cells was enhanced when cells were treated with a mixture of 026-CalD2 and Alexa 647-labeled CalD1-Fc (100 nM each) compared with treatment with 100 nM Alexa 647-labeled CalD1-Fc without 026-CalD2 ("no Fab") (Figure 8B). [Example]

[0127] Preparation and characterization of PS-targeted drugs A panel of PS-targeting drugs was generated by fusing the Fc region of human IgG1 with the following PS-binding domains: the core domain of annexin A1 (AnxA1), the C2A domain of synaptotagmin 1 (Syt1), and the C2 domain of PKCα. The resulting fusion proteins are designated Fc-AnxA1, Fc-Syt1, and Fc-PKCα, respectively. The PS-targeting drugs were purified as homodimers (Figures 9 and 10A, assessed using SDS-PAGE and HPLC) and bound to PS in lipid-binding assays using lipid strips (Figure 10B). They also bound to cardiolipin, which is located on the inner mitochondrial membrane of eukaryotic cells and is therefore not relevant for targeting. Fc-AnxA1 showed a broad lipid-binding profile, binding to both neutral and negatively charged lipids (Figure 10B). Importantly, none of the PS-binding drugs bound to phosphatidylcholine (PC) or sphingomyelin, lipids present in the outer leaflet of the plasma membrane.

[0128] The tumor endothelial cell line 2H11 was used to examine the ability of PS-binding agents to interact with lipids on the cell surface. Binding of fluorescent annexin V indicated that these cells exposed PS and that PS exposure increased after docetaxel treatment. Flow cytometry analysis showed that all PS-binding agents interacted with PS-positive cells, with Fc-Syt1 showing relatively low levels of binding (Figure 10C; 2nd only indicates the secondary antibody control, and Fc indicates the PS-targeting protein or the Fc fragment without the domain).

[0129] We evaluated the pharmacokinetic behavior and tumor localization of three PS-conjugated drugs in mice to determine which recombinant proteins were suitable for further development as protein-drug conjugates (PDCs). Pharmacokinetic studies of the PS-conjugated drugs revealed that Fc-Syt1 had a significantly longer half-life in mice (Figure 10D, E). Whole-body counts following injection of radioiodinated PS-targeted fusion proteins into mice (n = 5 mice per group) are shown in the graph in Figure 10D, and Figure 10E shows the corresponding area under the curve for each radiolabeled protein. Furthermore, proteins were labeled with a residualizing dye, IRDye800CW, injected (intravenously) into female nude mice bearing MDA-MB-231 xenografts (n = 3 mice per group), imaged at the indicated time points (Figure 10F), and tumor fluorescence was quantified in tumors extracted 48 h after injection (Figure 10G). Similar experiments were performed on tumor-bearing BALB / c SC The study was performed in 1D mice (n = 3 mice per group), and tumors were excised and dye levels determined 48 hours later (Figure 10H). Among the three PS-specific agents, Fc-Syt1 showed the highest level of tumor localization. Statistically significant differences for Figures 10E, 10G, and 10H were analyzed using one-way ANOVA followed by Tukey post-hoc test (Figure 10E). ** ,p<0.01, *** ,p<0.001, **** , p<0.0001), error bars indicate SEM. [Example]

[0130] Tetravalency of PS-targeted drugs improves binding and internalization into target cells In some receptor systems, multivalent ligands or mixtures of cross-linking ligands, such as antibodies, have been shown to promote receptor internalization and degradation. To study the role of avidity in the behavior of PS-targeted PDCs, we generated tetravalent Syt1-Fc-Syt1, containing four Syt1 C2A domains (shown diagrammatically in Figure 11A). The tetravalent protein was purified as a homodimer (Figures 11A and 11B, assessed using SDS-PAGE and HPLC). Binding analysis using lipids immobilized on nitrocellulose demonstrated that Syt1-Fc-Syt1 has a higher affinity / avidity for PS than its bivalent parent, Fc-Syt1, and the same lipid selectivity (Figure 11C). Consistent with the binding data shown in Figure 11C, tetravalent Syt1-Fc-Syt1 bound to 2H11 cells at significantly higher levels when analyzed using flow cytometry (Figure 11D).

[0131] The internalization of Fc-Syt1 and Syt1-Fc-Syt1 was also studied using Alexa 647-labeled proteins. 2H11 cells were incubated on ice with labeled Fc-Syt1 and Syt1-Fc-Syt1 at various concentrations to achieve similar surface binding, followed by incubation at 37°C for various times to allow internalization. EDTA was used to detach surface-bound proteins (removing bound Ca). 2+ The internalized levels (resistant to stripping due to its chromatin-dependent nature) were determined by flow cytometry. These studies showed that both proteins efficiently accumulated intracellularly, but tetravalent Syt1-Fc-Syt1 was internalized more rapidly (Figure 11E). For Figures 11D and 11E, statistically significant differences were analyzed using two-way ANOVA followed by Tukey post hoc test (Figure 11D). * ,p<0.05, ** ,p<0.01, *** ,p<0.001, **** , p<0.0001). Error bars in Figures 11D and 11E indicate SEM.

[0132] Fluorescence microscopy was also used to study the intracellular trafficking behavior of Syt1-Fc fusion proteins. 2H11 and MDA-MB-231 cells were incubated with 50 nM PS-targeting drug or control IgG for 4 hours, then washed, fixed, and stained with Cy3 / Alexa 555-labeled anti-human IgG (H+L). The lysosomal marker, LAMP-1, was detected using a LAMP-1-specific antibody followed by an Alexa 488-labeled secondary conjugate. Fc-Syt1 and Syt1-Fc-Syt1 were internalized and delivered to LAMP-1-positive lysosomes in 2H11 (Figure 11F) and MDA-MB-231 (Figure 11G) cells. Scale bars are 10 μm (F) and 5 μm (G). [Example]

[0133] Calcium sensing and endosomal release of PS-PDCs The lysosomal trafficking and internalization behavior of Fc-Syt1 and Syt1-Fc-Syt1 indicated that they could be effective as delivery vehicles for conjugated drugs. Maleimidocaproyl-val-cit-PAB-MMAE was conjugated to the hinge cysteine. The conjugation was performed using a 1:1 ratio (Figure 12A, left panel). To serve as a negative control, maleimidocaproyl-val-cit-PAB-MMAE was conjugated to hen egg lysozyme-specific human IgG1 in which the heavy / light chain interacting cysteine ​​residue had been mutated to serine. SDS-PAGE analysis showed that the conjugation was complete, resulting in a drug-to-antibody ratio (DAR) of 4 (Figure 12A, right panel). This was consistent with Fc-Syt1. This was confirmed by MALDI-TOF mass spectrometry with MMAE. Because complete conjugation disrupts two disulfide bonds in the hinge region, a molecular weight of 43.6 kDa was obtained using mass spectrometry (Figure 12B). This contrasts with the unconjugated or partially conjugated protein, which retains two or one disulfide bond, respectively, resulting in an apparent molecular weight of approximately 82 kDa (Figure 12B). Importantly, HPLC analysis showed that the conjugation process does not lead to protein aggregation (Figure 12C).

[0134] The Syt1 C2A domain binds to Ca 2+ Requires extracellular Ca 2+ Lower Ca levels in early / sorting endosomes compared to 1-2 mM 2+ The concentration (approximately 2 μM) suggests that following internalization, PS-targeted PDCs (PS-PDCs) would dissociate from the limiting membrane of these endosomes. This dissociation may lead to enhanced lysosomal delivery. Both PS-PDCs containing the Syt1 domain were incubated at 2 mM Ca. 2+ bound to PS beads in a buffer containing Ca 2+ When the concentration was reduced to 2 μM, no detectable interaction was observed (Figure 12D). Furthermore, because the pH within sorting endosomes is acidic (pH 6.0-6.5), the effect of pH on PDC:PS interactions was analyzed. Both PDCs bound to PS at similar levels in the pH range of 6.0-7.4 (Figure 12D). Regarding Figure 12D, bead-associated proteins were analyzed using immunoblotting and detection with horseradish peroxidase-conjugated goat anti-human IgG (H+L).

[0135] Ca 2+Consistent with the in vitro binding analysis demonstrating Fc-dependent binding, fluorescence microscopy analysis of MDA-MB-453 cells after 30 min incubation with 100 nM PS-PDC or MMAE-conjugated control, followed by washing, and staining of early endosomes with an early endosomal antigen 1 (EEA1)-specific antibody demonstrated the presence of PS-PDCs in the lumen, but not the limiting membrane, of sorting endosomes following internalization (Figure 13A). In these experiments, PS-PDCs were detected using an Alexa 555-labeled anti-human IgG (H+L) antibody, and intensity analysis of harvested and expanded early endosomes (labeled a and b) is shown on the right side of the figure panels. Furthermore, within 4 h of delivery, Fc-Syt1 MMAE and Syt1-Fc-Syt1 MMAE could be detected in lysosomes (detected using a LAMP-1-specific antibody) (Figure 13B). Both PS-PDCs disrupted the microtubule network in 2H11 and MDA-MB-231 cells after incubation of 2H11 or MDA-MB-453 cells with 100 nM or 50 nM PS-PDCs for 10 or 20 hours, respectively (Figure 13C). Scale bars = 5 μm (Figure 13A), 10 μm (Figure 13B), 15 μm (Figure 13C, upper panel), and 10 μm (Figure 13C, lower panel). [Example]

[0136] Suppression of growth and survival of PS-positive cells by PS-PDCs The effects of PS-specific PDCs on the growth of multiple cell lines, including tumor endothelium (2H11), ER-positive breast cancer (T-47D), HER2-positive breast cancer (SK-BR-3), triple-negative breast cancer (MDA-MB-231), androgen-sensitive prostate cancer (LNCaP), and androgen-insensitive prostate cancer (22Rv1), were examined. Staining of cells with fluorescently labeled annexin V and subsequent flow cytometry analysis showed that all of these cell lines were PS-positive (Figure 14A). Incubation of cells with PS-PDCs effectively inhibited cell growth and survival in a dose-dependent manner (Figure 14B). After 72 hours ( Cell viability following incubation for 96 hours (SK-BR-3, MDA-MB-231, and 22Rv1), or 120 hours (T-47D) is shown. MMAE inhibits bivalent Fc-Syt1 in inhibiting T-47D cell growth Although more potent than MMAE, the two PDCs showed similar effects on other cell lines. In contrast, relatively high concentrations of control IgG (hen egg lysozyme-specific human IgG1) conjugated with MMAE resulted in inhibition of cell growth, likely due to nonspecific fluid-phase absorption of the drug (Fig. 14B). Consistent with the growth-inhibitory effect of PS-PDCs, flow cytometry analysis of the internalization of the two PDCs at concentrations close to their corresponding IC50s revealed that Syt1-Fc-Syt1 Except for the relatively high level of internalization of MMAE in T-47D cells, all other cell lines showed similar behavior after 2 hours of incubation (Figure 14C). For Figure 14C, statistically significant differences were analyzed using a two-way ANOVA followed by a Bonferroni post hoc test (ns, no significant difference; * ,p<0.05, *** , p<0.001, and error bars represent SEM). Furthermore, unconjugated PS-targeting protein had no effect on cell growth in a cell viability assay when added to cells at a concentration of 1 μM for 96 hours (Figure 14D). Thus, the data indicate that Syt1-based PDCs are potent inhibitors of tumor endothelial and cancer cell growth in vitro. [Example]

[0137] Suppression of tumor growth by PS-PDCs in a mouse xenograft model The therapeutic effect of PS-PDCs on tumor xenografts in BALB / c SCID mice was investigated. Prior to treatment, pharmacokinetic studies of PS-PDCs were performed using tetravalent Syt1-Fc-Syt1. MMAE binds to bivalent Fc-Syt1, possibly due to increased target-mediated uptake. It was shown to have a shorter half-life than MMAE (Figures 15A, B). Figure 15A shows whole body counts in BALB / c SCID mice (n = 5 mice per group) following injection of radioiodinated PS-PDC. Figure 15B shows the area under the curve for the clearance curves shown in Figure 15A, and statistically significant differences were analyzed using an unpaired Student's t-test (Figure 15B). **** , p<0.0001). To examine the therapeutic effect of PDCs, they were delivered into female BALB / c SCID mice (n = 5-6 mice per group) bearing orthotopic MDA-MB-231 breast tumors. Tumor-bearing mice were pretreated with docetaxel and delivered twice weekly with the following doses (equivalent to 1 nmole of protein) of PDCs or a control unconjugated protein: Fc-Syt1 or Fc-Syt1 MMAE 4.1 mg / kg, Syt1-Fc-Syt1 or Syt1-Fc-Syt1 In these experiments, the bivalent Fc-Syt1 MMAE potently inhibited breast tumor growth (Figure 15C). MMAE also inhibited tumor growth, but bivalent Fc-Syt1 The effect of Fc-Syt1 on tumor growth was less than that of MMAE. Treatment with unconjugated Fc-Syt1 and Syt1-Fc-Syt1 was without effect on tumor growth (Fig. 15C). Importantly, no wasting or weight loss was observed in any of the treatment groups (Fig. 15D), indicating that PS-specific PDCs are well tolerated in vivo.

[0138] Similar to the efficacy in breast tumor models, bivalent Fc-Syt1 MMAE completely prevented tumor growth in male BALB / c SCID mice bearing prostate cancer LNCaP xenografts that had been pretreated with docetaxel (Figure 15E). Tumor-bearing mice were dosed as in the MDA-MB-231 xenograft experiment (above). Consistent with the in vitro data (Figure 14D), unconjugated PS-targeted fusion proteins were ineffective. However, tetravalent Syt1-Fc-Syt1 MMAE did not significantly inhibit tumor growth in the LNCaP model. The most likely explanation for this difference is the relatively short in vivo persistence of tetravalent PDC. For both Figures 15C and 15E, statistical analysis at the end of treatment was performed using one-way analysis of variance followed by Bonferroni post hoc tests ( * ,p<0.05, *** ,p<0.001, **** , p<0.0001). Error bars in Figures 15A, 15C, and 15E indicate SEM. [Example]

[0139] Fc-Syt1 MMAE-mediated tumor growth inhibition is dependent on PS binding To exclude the possibility that the drug accumulated in tumors through a nonspecific mechanism such as the enhanced permeability and retention (EPR) effect, and to demonstrate that in vivo efficacy was dependent on PS binding, we generated mutated variants of the synaptotagmin 1 C2A domain with reduced affinity for PS. The C2A domain of synaptotagmin 1 contains three Ca chelated by five aspartic acids (D) in domain loops I and III. 2+ It interacts with PS via ions (Striegel, AR, Biela, LM, Evans, CS, Wang, Z., Delehoy, JB, Sutton, RB, Chapman, ER and Reist, NE 2012. Calcium binding by synaptotagmin's C2A domain is an essential element of the electrostatic switch that triggers synchronous synaptic transmission. J. Neurosci. 32, 1253-1260). Ca 2+To disrupt binding, all five aspartic acid residues (D173N, D179N, D231N, D233N, and D239N) were mutated to asparagine (N) to generate Fc-Syt1(DN). Fc-Syt1(DN) was purified and conjugated to MMAE at a DAR of 4 (Figure 16A), and it interacted with PS at essentially background levels in a protein-lipid overlay assay using lipid-coated nitrocellulose strips (Figure 16B). Further flow cytometry analysis showed that Fc-Syt1(DN) had significantly reduced binding to PS-positive cells compared to its wild-type counterpart (Figure 16C). In Figure 16C, statistically significant differences were analyzed using two-way ANOVA followed by Tukey's post hoc test (Figure 16C). *** ,p<0.001, **** , p<0.0001), error bars indicate SEM.

[0140] BALB / c SCID mice (n = 6 mice per group) bearing orthotopic MDA-MB-231 tumors were pretreated with docetaxel and then treated with PS-PDCs or control for 4 weeks, until mice in the control (PBS) group were euthanized due to their large tumor size. Mice were treated twice weekly for 4 weeks (28-56 days) at the following doses (equivalent to 1 nmole of protein): Fc-Syt1 MMAE or Fc-Syt1(DN) 4.1 mg / kg for MMAE, Fc 2.6 mg / kg for MMAE. Fc-Syt1 Treatment of MDA-MB-231 tumors with MMAE led to potent growth inhibition (Figure 16D). More importantly, Fc-Syt1 Tumor growth remained suppressed after MMAE delivery was stopped at 4 weeks. Fc-Syt1 at the end of treatment MMAE and Fc-Syt1(DN) Statistically significant differences between MMAE treatment groups were analyzed using one-way analysis of variance followed by Bonferroni post-hoc tests ( ***, p<0.001), error bars indicate SEM. At the end of the experiment, tumors were isolated from mice in each group and Fc-Syt1 Tumors could not be isolated from 3 of 6 mice in the MMAE-treated group (Fig. 16E). MMAE or Fc-Syt1(DN) Although delivery of MMAE initially slowed tumor growth, rapid proliferation was observed following the end of treatment (Figure 16D). Collectively, the data suggest that PS binding inhibits Fc-Syt1 This indicates that it is essential for the activity of MMAE. [Example]

[0141] Fc-Syt1 MMAE targets multiple cell types in tumor tissue, including both tumor endothelium and cancer cells Fc-Syt1 after docetaxel treatment To further demonstrate that MMAE binds to PS-positive cells in tumor tissue, immunohistochemistry was performed 1 hour (Fig. 17A) or 24 hours (Fig. 17B) after delivery of this PDC into tumor-bearing mice. PBS was injected as a vehicle control, and Alexa 555-labeled anti-human IgG (H+L) was used to detect Fc-Syt1 MMAE was detected. Fc-Syt1 MMAE localized to CD31-positive blood vessels (Fig. 17A), tumor cells, and tumor-infiltrating F4 / 80-positive macrophages (Fig. 17B), which may expose PS. The data indicate that cancer cells not only expose PS in vitro (Fig. 14A), but also retain this loss of PS asymmetry in vivo. [Example]

[0142] DNA and protein sequences of representative antibody-drug conjugates and protein-drug conjugates Table 1 shows the DNA sequences of polynucleotides encoding representative proteins described herein, and Table 2 shows the amino acid sequences of representative proteins encoded by the polynucleotides shown in Table 1, where in the table, the DNA sequence of SEQ ID NO:1 encodes the protein of SEQ ID NO:2, the DNA sequence of SEQ ID NO:3 encodes the protein of SEQ ID NO:4, the DNA sequence of SEQ ID NO:5 encodes the protein of SEQ ID NO:6, the DNA sequence of SEQ ID NO:7 encodes the protein of SEQ ID NO:8, the DNA sequence of SEQ ID NO:9 encodes the protein of SEQ ID NO:10, the DNA sequence of SEQ ID NO:11 encodes the protein of SEQ ID NO:12, the DNA sequence of SEQ ID NO:13 encodes the protein of SEQ ID NO:14, the DNA sequence of SEQ ID NO:15 encodes the protein of SEQ ID NO:16, the DNA sequence of SEQ ID NO:17 encodes the protein of SEQ ID NO:18, the DNA sequence of SEQ ID NO:19 encodes the protein of SEQ ID NO:20, and the DNA sequence of SEQ ID NO:21 encodes the protein of SEQ ID NO: 22 proteins, the DNA sequence of SEQ ID NO:23 encodes the protein of SEQ ID NO:24, the DNA sequence of SEQ ID NO:25 encodes the protein of SEQ ID NO:26, the DNA sequence of SEQ ID NO:27 encodes the protein of SEQ ID NO:28, the DNA sequence of SEQ ID NO:29 encodes the protein of SEQ ID NO:30, the DNA sequence of SEQ ID NO:31 encodes the protein of SEQ ID NO:32, the DNA sequence of SEQ ID NO:33 encodes the protein of SEQ ID NO:34, the DNA sequence of SEQ ID NO:35 encodes the protein of SEQ ID NO:36, the DNA sequence of SEQ ID NO:37 encodes the protein of SEQ ID NO:38, the DNA sequence of SEQ ID NO:39 encodes the protein of SEQ ID NO:40, the DNA sequence of SEQ ID NO:41 encodes the protein of SEQ ID NO:42, the DNA sequence of SEQ ID NO:43 encodes the protein of SEQ ID NO:44, the DNA sequence of SEQ ID NO:45 encodes the protein of SEQ ID NO:46, and the DNA sequence of SEQ ID NO:47 encodes the protein of SEQ ID NO:48. [Table 1-1] [Table 1-2] [Table 1-3] Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 2-1 Table 2-2 Table 2-3 Table 2-4 Table 2-5

[0143] The DNA sequence of SEQ ID NO: 1 is a representative HEK2 gene with a mutation of Cys214 to serine. It is a polynucleotide encoding the light chain of the R2-specific antibody Pertuzumab (SEQ ID NO: 2), configured for heterodimer formation with, for example, the SG heavy chain variant of Pertuzumab (SEQ ID NO: 4).

[0144] In particular, the amino acid sequence of the light chain of the representative HER2-specific antibody pertuzumab (SEQ ID NO: 2) has, from N- to C-terminus, a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214. The cysteine ​​residue (214) normally paired with an immunoglobulin heavy chain is mutated to serine. The numbers of amino acid residues referred to in SEQ ID NO: 2 are those of the protein sequence and do not refer to the EU numbering convention.

[0145] The DNA sequence of SEQ ID NO: 3 is that of a polynucleotide encoding the heavy chain of a representative HER2-specific antibody, Pertuzumab (SEQ ID NO: 4), which has mutations to serine at Cys222 and Cys231 and an SG mutation. The encoded heavy chain (SEQ ID NO: 4) is configured to form a heterodimer with, for example, a light chain variant of Pertuzumab (SEQ ID NO: 2), thereby forming the SG variant of Pertuzumab.

[0146] In particular, the amino acid sequence of the exemplary antibody heavy chain of SEQ ID NO: 4 comprises, from N-terminus to C-terminus, a HER2-specific VH domain at residues 1-119, an immunoglobulin CH1 domain (derived from human IgG1) at residues 120-216, an immunoglobulin hinge (derived from human IgG1) at residues 217-232, an immunoglobulin CH2 domain (derived from human IgG1) at residues 233-342, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 343-449. The exemplary HER2-specific antibody heavy chain of SEQ ID NO: 4 comprises mutations of Ser55 and Gly57 to histidine and glutamic acid, respectively (SG mutations). The cysteine ​​residues (222 and 231) that normally pair with immunoglobulin light chains and form hinge sulfhydryl bridges are mutated to serine. The numbers of amino acid residues referred to in SEQ ID NO: 4 are those of the protein sequence and do not refer to the EU numbering convention.

[0147] The DNA sequence of SEQ ID NO: 5 is that of a polynucleotide encoding the light chain of a representative HER2-specific antibody, Pertuzumab (SEQ ID NO: 6), which has mutations of Cys214 to serine and Tyr55 to histidine. The encoded light chain (SEQ ID NO: 6) is configured for heterodimer formation with, for example, the YS heavy chain variant of Pertuzumab (SEQ ID NO: 8).

[0148] In particular, the amino acid sequence of the light chain of the exemplary HER2-specific antibody pertuzumab (SEQ ID NO: 6) has, from N- to C-terminus, a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214. The exemplary HER2-specific antibody light chain of SEQ ID NO: 6 has a mutation at residue 55 to histidine. The cysteine ​​residue (214) normally paired with an immunoglobulin heavy chain is mutated to serine. The numbers of amino acid residues referred to in SEQ ID NO: 6 are those of the protein sequence and do not refer to the EU numbering convention.

[0149] The DNA sequence of SEQ ID NO: 7 is that of a polynucleotide encoding the heavy chain of a representative HER2-specific antibody, Pertuzumab (SEQ ID NO: 8), which has mutations at Cys222 and Cys231 to serine and mutation at Ser103 to histidine. The encoded heavy chain (SEQ ID NO: 8) is configured to form a heterodimer with, for example, a light chain variant of Pertuzumab (SEQ ID NO: 6) to create a YS variant of Pertuzumab.

[0150] In particular, the amino acid sequence of the representative antibody heavy chain of SEQ ID NO: 8 comprises, from N-terminus to C-terminus, a HER2-specific VH domain at residues 1-119, an immunoglobulin C domain at residues 120-216, and The exemplary HER2-specific antibody heavy chain of SEQ ID NO: 8 has a mutation at residue 103 to histidine. The cysteine ​​residues (222 and 231) that normally pair with the immunoglobulin light chain and form the hinge sulfhydryl bridge are mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 8 are those of the protein sequence and do not refer to the EU numbering convention.

[0151] The DNA sequence of SEQ ID NO:9 is that of a polynucleotide encoding a single-chain Fv of a representative HER2-specific antibody, pertuzumab (SEQ ID NO:10), fused to the N-terminus of an immunoglobulin Fc fragment having mutations at Cys251 and Cys260 to serine and an SG mutation. The encoded fusion protein (SEQ ID NO:10) is configured to form a homodimer.

[0152] In particular, the amino acid sequence of the exemplary antibody heavy chain of SEQ ID NO: 10 comprises, from N-terminus to C-terminus, a HER2-specific VH domain at residues 1-119, a (G4S)3 linker peptide at residues 120-134, a HER2-specific VL domain at residues 135-242, a GGS linker peptide at residues 243-245, an immunoglobulin hinge (derived from human IgG1) at residues 246-261, an immunoglobulin CH2 domain (derived from human IgG1) at residues 262-371, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 372-478. The exemplary HER2-specific antibody scFv-heavy chain fusion of SEQ ID NO: 10 comprises mutations of Ser55 and Gly57 to histidine and glutamic acid, respectively (SG mutations). The cysteine ​​residues (251 and 260) that normally pair with immunoglobulin light chains and form hinge sulfhydryl bridges are mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 10 are those of the protein sequence and do not refer to the EU numbering convention.

[0153] The DNA sequence of SEQ ID NO: 11 is that of a polynucleotide encoding a single-chain Fv of a representative HER2-specific antibody, pertuzumab (SEQ ID NO: 12), fused to the N-terminus of an immunoglobulin Fc fragment having mutations at Cys251 and Cys260 to serine and a YS mutation. The encoded fusion protein (SEQ ID NO: 12) is configured to form a homodimer.

[0154] In particular, the amino acid sequence of the exemplary antibody heavy chain of SEQ ID NO: 12 comprises, from N-terminus to C-terminus, a HER2-specific VH domain at residues 1-119, a (G4S)3 linker peptide at residues 120-134, a HER2-specific VL domain at residues 135-242, a GGS linker peptide at residues 243-245, an immunoglobulin hinge (derived from human IgG1) at residues 246-261, an immunoglobulin CH2 domain (derived from human IgG1) at residues 262-371, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 372-478. The exemplary HER2-specific antibody scFv-heavy chain fusion of SEQ ID NO: 12 comprises mutations of Ser103 and Tyr189 to histidine (YS mutations). The cysteine ​​residues (251 and 260) that normally pair with immunoglobulin light chains and form hinge sulfhydryl bridges are mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 12 are those of the protein sequence and do not refer to the EU numbering convention.

[0155] The DNA sequence of SEQ ID NO: 13 is that of a polynucleotide encoding a single-chain Fv of a representative HER2-specific antibody, pertuzumab (SEQ ID NO: 14), fused to the C-terminus of an immunoglobulin Fc fragment having mutations at Cys6 and Cys15 to serine and an SG mutation. The encoded fusion protein (SEQ ID NO: 14) is configured to form a homodimer.

[0156] In particular, the amino acid sequence of the exemplary antibody heavy chain of SEQ ID NO: 14 comprises, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, a GGS linker peptide at residues 234-236, a HER2-specific VH domain at residues 237-355, a (G4S)3 linker peptide at residues 356-370, and a HER2-specific VL domain at residues 371-478. The exemplary HER2-specific antibody scFv-heavy chain fusion of SEQ ID NO: 14 has mutations of Ser291 and Gly293 to histidine and glutamic acid, respectively (SG mutations). The cysteine ​​residues (6 and 15) that normally pair with immunoglobulin light chains and form hinge sulfhydryl bridges are mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 14 are those of the protein sequence and do not refer to the EU numbering convention.

[0157] The DNA sequence of SEQ ID NO: 15 is that of a polynucleotide encoding a single-chain Fv of a representative HER2-specific antibody, pertuzumab (SEQ ID NO: 16), fused to the C-terminus of an immunoglobulin Fc fragment with mutations of Cys6 and Cys15 to serine and a YS mutation. The encoded fusion protein (SEQ ID NO: 16) is configured to form a homodimer.

[0158] In particular, the amino acid sequence of the exemplary antibody heavy chain of SEQ ID NO: 16 comprises, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, a GGS linker peptide at residues 234-236, a HER2-specific VH domain at residues 237-355, a (G4S)3 linker peptide at residues 356-370, and a HER2-specific VL domain at residues 371-478. The exemplary HER2-specific antibody scFv-heavy chain fusion of SEQ ID NO: 16 has mutations of Ser339 and Tyr425 to histidine (YS mutations). The cysteine ​​residues (6 and 15) that normally pair with immunoglobulin light chains and form hinge sulfhydryl bridges are mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 16 are those of the protein sequence and do not refer to the EU numbering convention.

[0159] The DNA sequence of SEQ ID NO: 17 is that of a polynucleotide encoding a representative CalD2 fusion protein (SEQ ID NO: 18) comprising the VH domain and CH1 domain of the HER2-specific antibody trastuzumab fused to the N-terminus of calbindin domain 2 (CalD2) via a linker peptide comprising a portion of an immunoglobulin hinge (with a Cys223 to serine mutation) and SGG. The encoded fusion protein (SEQ ID NO: 18) forms a heterodimer with, for example, the light chain of trastuzumab (SEQ ID NO: 20), resulting in the formation of a CaD2 fusion protein. 2+ It is configured to associate with SEQ ID NO:22 in a dependent manner.

[0160] In particular, the amino acid sequence of the exemplary CalD2 fusion protein of SEQ ID NO: 18 comprises, from N-terminus to C-terminus, a HER2-specific VH domain at residues 1-120, an immunoglobulin CH1 domain (derived from human IgG1) at residues 121-217, a linker sequence containing part of the heavy chain hinge region at residues 218-228, followed by an SGG sequence at residues 229-231, and a CalD2 domain at residues 232-263. The cysteine ​​residue (223) normally paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 18 are those of the protein sequence and do not refer to the EU numbering convention.

[0161] The DNA sequence of SEQ ID NO: 19 is a representative H The polynucleotide encodes the light chain of the ER2-specific antibody trastuzumab (SEQ ID NO: 20), which is configured for heterodimerization with, for example, the trastuzumab VH-CH1:CalD2 fusion protein (SEQ ID NO: 18).

[0162] In particular, the amino acid sequence of the light chain of the representative HER2-specific antibody trastuzumab (SEQ ID NO: 20) comprises, from N- to C-terminus, a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, followed by a hexahistidine peptide tag at residues 215-220. The cysteine ​​residue (214) normally paired with an immunoglobulin heavy chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 20 are those of the protein sequence and do not refer to the EU numbering convention.

[0163] The DNA sequence of SEQ ID NO:21 is that of a polynucleotide encoding a representative CalD1 fusion protein (SEQ ID NO:22) containing calbindin domain 1 (CalD1) fused to the N-terminus of an immunoglobulin Fc fragment with a Cys52 to serine mutation. The encoded fusion protein (SEQ ID NO:22) can be fused to a fusion protein containing, for example, a trastuzumab VH-CH1:CalD2 fusion protein (SEQ ID NO:18) or a 026 VH-CH1:CalD2 fusion protein (SEQ ID NO:24) with Ca 2+ They are structured to meet in an interdependent manner.

[0164] In particular, the amino acid sequence of the exemplary CalD1 fusion protein of SEQ ID NO:22 comprises, from N-terminus to C-terminus, a CalD1 domain at residues 1-43, a GSS linker peptide at residues 44-46, an immunoglobulin hinge (derived from human IgG1) at residues 47-62, an immunoglobulin CH2 domain (derived from human IgG1) at residues 63-172, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 173-279. The cysteine ​​residue (52) normally paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:22 are those of the protein sequence and do not refer to the EU numbering convention.

[0165] The DNA sequence of SEQ ID NO:23 is that of a polynucleotide encoding a representative CaLD2 fusion protein (SEQ ID NO:24) comprising the VH and CH1 domains of the PSMA-specific antibody 026 fused to the N-terminus of calbindin domain 2 (CalD2) via a linker peptide comprising a portion of an immunoglobulin hinge (with Cys227 mutated to serine) and SGG. The encoded fusion protein (SEQ ID NO:24) can form a heterodimer with, for example, the light chain of 026 (SEQ ID NO:26) to form a heterodimer with SEQ ID NO:22 and CaLD2. 2+ They are structured to meet in an interdependent manner.

[0166] In particular, the amino acid sequence of the exemplary CalD2 fusion protein of SEQ ID NO:24 comprises, from N-terminus to C-terminus, a PSMA-specific VH domain at residues 1-124, an immunoglobulin CH1 domain (derived from human IgG1) at residues 125-221, a linker sequence containing part of the heavy chain hinge region at residues 222-232, followed by an SGG sequence at residues 233-235, and a CalD2 domain at residues 236-267. The cysteine ​​residue (227) normally paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:24 are those of the protein sequence and do not refer to the EU numbering convention.

[0167] The DNA sequence of SEQ ID NO:25 is that of a polynucleotide encoding the light chain of a representative PSMA-specific antibody 026 (SEQ ID NO:26) with a Cys214 to serine mutation. The encoded light chain (SEQ ID NO:26) is a fusion protein of, for example, the 026VH-CH1:CalD2 fusion protein. It is configured for heterodimer formation with the fusion protein (SEQ ID NO: 24).

[0168] In particular, the amino acid sequence of the light chain of representative PSMA-specific antibody 026 (SEQ ID NO:26) comprises, from N- to C-terminus, a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, followed by a hexahistidine peptide tag at residues 215-220. The cysteine ​​residue (214) normally paired with an immunoglobulin heavy chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:26 are those of the protein sequence and do not refer to the EU numbering convention.

[0169] The DNA sequence of SEQ ID NO:27 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:28) containing the Syt1 C2A domain of synaptotagmin fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 to serine mutation. The encoded fusion protein (SEQ ID NO:28) is configured to form a homodimer.

[0170] In particular, the representative Fc-Syt1 amino acid sequence of SEQ ID NO:28 has, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233. Residues 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the C-terminus of the CH3 domain at residues 239-364 via a GGGGS linker peptide (residues 234-238). The cysteine ​​residue (6) paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:28 are those of the protein sequence and do not refer to the EU numbering convention.

[0171] The DNA sequence of SEQ ID NO:29 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:30) containing the Syt1 C2A domain of synaptotagmin fused to both the N- and C-termini of an immunoglobulin Fc fragment with a Cys137 to serine mutation. The encoded fusion protein (SEQ ID NO:30) is configured to form a homodimer.

[0172] In particular, the amino acid sequence of the representative Syt1-Fc-Syt1, SEQ ID NO: 30, comprises, from N- to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364. Residues 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N- and C-termini of the hinge and CH3 domains via a GGGGS linker peptide (residues 127-131 and 365-369), at residues 1-126 and 370-495, respectively. The cysteine ​​residue (137) paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 30 are those of the protein sequence and do not refer to the EU numbering convention.

[0173] The DNA sequence of SEQ ID NO:31 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:32) containing the C2 domain of PKCα fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 to serine mutation. The encoded fusion protein (SEQ ID NO:32) is configured to form a homodimer.

[0174] In particular, the amino acid sequence of a representative Fc-PKCα of SEQ ID NO: 32 comprises, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, an immunoglobulin CH2 domain (derived from human IgG1) at residues 127-233, and an immunoglobulin CH2 domain (derived from human IgG1) at residues 127-233. It has an immunoglobulin CH3 domain (derived from human IgG1). Residues 157-288 of the C2 domain of PKCα are fused to the C-terminus of the CH3 domain at residues 239-370 via a GGGGS linker peptide (residues 234-238). The cysteine ​​residue (6) that pairs with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 32 are those of the protein sequence and do not refer to the EU numbering convention.

[0175] The DNA sequence of SEQ ID NO: 33 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 34) containing an AnxA1 PS-binding core domain fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 to serine mutation. The encoded fusion protein (SEQ ID NO: 34) is configured to form a homodimer.

[0176] In particular, the representative Fc-AnxA1 amino acid sequence of SEQ ID NO: 34 has, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233. Residues 41-346 of the AnxA1 core domain are fused to the C-terminus of the CH3 domain at residues 239-544 via a GGGGS linker peptide (residues 234-238). The cysteine ​​residue (6) paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 34 are those of the protein sequence and do not refer to the EU numbering convention.

[0177] The DNA sequence of SEQ ID NO:35 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:36) containing the Syt1 C2A domain of synaptotagmin fused to the N-terminus of an immunoglobulin Fc fragment with a Cys137 to serine mutation. The encoded fusion protein (SEQ ID NO:36) is configured to form a homodimer.

[0178] In particular, the representative amino acid sequence of Syt1-Fc, SEQ ID NO:36, comprises, from N- to C-terminus, residues 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) as residues 1-126, a GGGGS linker peptide at residues 127-131, an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364. The cysteine ​​residue (137) paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:36 are those of the protein sequence and do not refer to the EU numbering convention.

[0179] The DNA sequence of SEQ ID NO:37 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:38) containing the C2 domain of PKCα fused to the N-terminus of an immunoglobulin Fc fragment with a Cys143 to serine mutation. The encoded fusion protein (SEQ ID NO:38) is configured to form a homodimer.

[0180] In particular, the amino acid sequence of the representative PKCα-Fc of SEQ ID NO: 38 comprises, from N-terminus to C-terminus, residues 157-288 of the C2 domain of PKCα as residues 1-132, a GGGGS linker peptide at residues 133-137, an immunoglobulin hinge (derived from human IgG1) at residues 138-153, an immunoglobulin CH2 domain (derived from human IgG1) at residues 154-263, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 264-370. The cysteine ​​residue (143) paired with the immunoglobulin light chain is ablated to serine. The amino acid residue numbers referred to in SEQ ID NO: 38 are those of the protein sequence and do not refer to the EU numbering convention.

[0181] The DNA sequence of SEQ ID NO: 39 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 40) containing an AnxA1 PS-binding core domain fused to the N-terminus of an immunoglobulin Fc fragment with a Cys317 to serine mutation. The encoded fusion protein (SEQ ID NO: 40) is configured to form a homodimer.

[0182] In particular, the representative AnxA1-Fc amino acid sequence of SEQ ID NO:40 comprises, from N- to C-terminus, residues 41-346 of the AnxA1 core domain as residues 1-306, a GGGGS linker peptide at residues 307-311, an immunoglobulin hinge (derived from human IgG1) at residues 312-327, an immunoglobulin CH2 domain (derived from human IgG1) at residues 328-437, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 438-544. The cysteine ​​residue (317) paired with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO:40 are those of the protein sequence and do not refer to the EU numbering convention.

[0183] The DNA sequence of SEQ ID NO:41 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:42) containing the Syt1 C2A domain of synaptotagmin fused to the N- and C-termini of an immunoglobulin Fc fragment containing a knobs-into-holes mutation and a Cys137 to serine mutation. The encoded fusion protein (SEQ ID NO:42) is configured to form a heterodimer with, for example, a representative Fc fragment (SEQ ID NO:44).

[0184] In particular, the amino acid sequence of the representative Syt1-Fc-Syt1 of SEQ ID NO:42 contains, from N- to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364. Residues 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N- and C-termini of the hinge and CH3 domains via a GGGGS linker peptide (residues 127-131 and 365-369), at residues 1-126 and 370-495, respectively. The representative Syt1-Fc-Syt1 of SEQ ID NO:42 contains "knobs-into-holes" mutations at residues 266 and 311. The cysteine ​​residue (137) that pairs with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 42 are those of the protein sequence and do not refer to the EU numbering convention.

[0185] The DNA sequence of SEQ ID NO:43 is that of a polynucleotide encoding a representative Fc fragment (SEQ ID NO:44) with knobs-into-holes mutations and a Cys6 to serine mutation, which is configured to form a heterodimer with, for example, a representative Syt1-Fc-Syt1 fusion (SEQ ID NO:42).

[0186] In particular, the amino acid sequence of a representative Fc fragment of SEQ ID NO:44 has, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233. The representative Fc fragment of SEQ ID NO:44 has knobs-into-holes mutations at residues 150 and 191. The cysteine ​​residue (6) normally paired with the immunoglobulin light chain is mutated to serine. The numbers of amino acid residues referred to in SEQ ID NO:44 are those of the protein sequence, It does not refer to the EU numbering agreement.

[0187] The DNA sequence of SEQ ID NO:45 is that of a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO:46) containing the Syt1 C2A domain of synaptotagmin fused to both the N- and C-termini of an immunoglobulin Fc fragment containing knobs-into-holes mutations, electrostatic steering mutations, and a Cys137 to serine mutation. The encoded fusion protein (SEQ ID NO:46) is configured to form a heterodimer with, for example, a representative Fc fragment (SEQ ID NO:48).

[0188] In particular, the amino acid sequence of the representative Syt1-Fc-Syt1 of SEQ ID NO:46 contains, from N- to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364. Residues 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N- and C-termini of the hinge and CH3 domains via a GGGGS linker peptide (residues 127-131 and 365-369), at residues 1-126 and 370-495, respectively. The representative Syt1-Fc-Syt1 of SEQ ID NO:46 contains "knobs-into-holes" mutations at residues 266 and 311 and electrostatic steering mutations at residues 309 and 326. The cysteine ​​residue (137) that pairs with the immunoglobulin light chain is mutated to serine. The amino acid residue numbers referred to in SEQ ID NO: 46 are those of the protein sequence and do not refer to the EU numbering convention.

[0189] The DNA sequence of SEQ ID NO:47 is that of a polynucleotide encoding a representative Fc fragment (SEQ ID NO:48) with knobs-into-holes mutations, electrostatic steering mutations, and a Cys6 to serine mutation, which is configured to form a heterodimer with, for example, a representative Syt1-Fc-Syt1 fusion (SEQ ID NO:46).

[0190] In particular, the amino acid sequence of the exemplary Fc fragment of SEQ ID NO:48 has, from N-terminus to C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233. The exemplary Fc fragment of SEQ ID NO:48 has knobs-into-holes mutations at residues 150 and 191 and electrostatic steering mutations at residues 143 and 185. The cysteine ​​residue (6) normally paired with the immunoglobulin light chain is mutated to serine. The numbers of amino acid residues referred to in SEQ ID NO:48 are those of the protein sequence and do not refer to the EU numbering convention.

[0191] The subject matter disclosed above should be considered exemplary and not limiting, and the appended claims are intended to cover all modifications, enhancements, and other aspects that fall within the true spirit and scope of the present disclosure. Thus, to the maximum extent permitted by law, the scope of the present disclosure should be determined by the broadest permissible interpretation of the following claims and their equivalents, and should not be limited or restricted by the above detailed description.

[0192] The various methods and techniques described above provide multiple ways of practicing the application. Of course, it should be understood that not necessarily all objectives or advantages described can be achieved in accordance with any particular embodiment described herein. Thus, for example, one skilled in the art will recognize that the method can be practiced in a way that achieves or optimizes one advantage or advantages described herein without necessarily achieving other objectives or advantages described or suggested herein. Various alternatives are provided herein. It should be understood that some preferred embodiments specifically include one, another, or several features, while others specifically exclude one, another, or several features, and still others mitigate certain features by including one, another, or several advantageous features.

[0193] Additionally, those skilled in the art will recognize the applicability of various features from various embodiments. Similarly, the various elements, features, and steps discussed above, as well as other known equivalents for each such element, feature, or step, can be used by those skilled in the art in various combinations to implement methods in accordance with the principles described herein. Among the various elements, features, and steps, some will be specifically included and others will be specifically excluded in various embodiments.

[0194] While the present application has been disclosed in terms of certain aspects and examples, it will be appreciated by those skilled in the art that the aspects of the present application extend beyond the specifically disclosed aspects to other alternative embodiments and / or uses, as well as modifications and equivalents thereof.

[0195] In some embodiments, numbers expressing quantities and properties of ingredients, such as molecular weights, reaction conditions, and the like, used to describe and claim certain embodiments of the present application are understood to be modified in some instances by the term "about." Accordingly, in some embodiments, the numerical parameters set forth in the specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained in a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the reported significant numbers and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present application are approximations, the numerical values ​​set forth in the specific examples are reported as precisely as practicable.

[0196] In some embodiments, the terms "a," "an," and "the" and similar references, when used in the context of describing particular embodiments of the present application (particularly in the context of certain of the claims below), may be construed to encompass both the singular and the plural. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise stated herein, each separate value is incorporated herein as if it were individually described herein. All methods described herein can be performed in any suitable order unless otherwise stated herein or otherwise clearly contradicted by context. The use of any example or exemplary language (e.g., "such as") provided with respect to certain embodiments of the present specification is intended merely to clarify the application and does not pose a limitation on the scope of the application as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the application.

[0197] Preferred embodiments of this application are described herein, including the best mode known to the inventors for carrying out this application. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is intended that those of ordinary skill in the art can employ such variations as appropriate, and that the application can be practiced otherwise than as specifically described herein. Accordingly, many aspects of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by this application unless otherwise indicated herein or otherwise clearly contradicted by context.

[0198] All patents, patent applications, patent application publications and other materials such as papers, books, specifications, publications, documents, articles, etc. cited herein may not be consistent with or inconsistent with this document. The entire contents of this document are hereby incorporated by reference for all purposes, except for any prosecution file history relating to any of them that may conflict with them or that may have a limiting effect on the broadest scope of any claims now or later related to this document. For example, if there should be an inconsistency or contradiction between the explanation, definition, and / or use of a term in connection with any of the material incorporated herein and that relating to this document, the explanation, definition, and / or use of the term in this document shall control.

[0199] The embodiments of the present application disclosed herein should be understood as examples of the principles of the embodiments of the present application. Other modifications that may be used may be within the scope of the present application. Thus, by way of example, but not of limitation, other forms of the embodiments of the present application may be used in accordance with the description herein. Accordingly, the embodiments of the present application are not strictly limited to the embodiments shown and described.

Claims

1. 1. An endolysosomal targeting conjugate comprising: a targeting moiety comprising an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, wherein the targeting moiety is configured to bind to a cell surface molecule of a target cell in the extracellular space with a lower dissociation constant than within an endolysosomal compartment of the target cell; a cargo moiety, comprising a cargo molecule conjugated to an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain; Including, wherein said targeting moiety is fused directly or indirectly to said cargo moiety; the targeting moiety is configured to dissociate from the cell surface molecule upon entry into an endolysosomal compartment; and The endolysosomal targeting conjugate is configured to deliver the cargo molecule to the endolysosomal compartment of the target cell.

2. 2. The endolysosome-targeting conjugate of claim 1, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule in the extracellular space with a dissociation constant of less than 500 nM.

3. The endolysosomal targeting conjugate of claim 1, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at near-neutral pH with a lower dissociation constant at acidic endolysosomal pH.

4. The endolysosomal targeting conjugate of claim 3, wherein the near-neutral pH is from about pH 6.8 to about pH 7.5 and the acidic endolysosomal pH is from about pH 5.0 to about pH 6.

5.

5. The targeting moiety is an endolysosomal Ca ２＋ Extracellular Ca with a lower dissociation constant at ２＋ The endolysosome-targeting conjugate of claim 1 , comprising an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at a concentration.

6. The extracellular Ca ２＋ The concentration is about 2 mM, and the endolysosomal Ca ２＋ The endolysosome-targeting conjugate of claim 5, wherein the concentration is about 2 μM.

7. The endolysosome-targeting conjugate of claim 1 , wherein the targeting moiety comprises a protein, protein fragment, or protein domain configured to bind to a cell surface molecule in the extracellular space with a dissociation constant of less than 500 nM.

8. The endolysosomal targeting conjugate of claim 1, wherein the targeting moiety is a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at near-neutral pH with a lower dissociation constant at acidic endolysosomal pH.

9. The endolysosomal targeting conjugate of claim 8, wherein the near-neutral pH is from about pH 6.8 to about pH 7.5, and the acidic endolysosomal pH is from about pH 5.0 to about pH 6.

5.

10. The targeting moiety is an endolysosomal Ca ２＋ Extracellular Ca with a lower dissociation constant at ２＋ The endolysosome-targeting conjugate of claim 1 , comprising a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at a concentration.

11. The extracellular Ca ２＋ The concentration is about 2 mM, and the endolysosomal Ca ２＋ The endolysosome-targeting conjugate of claim 10, wherein the concentration is about 2 μM.

12. The endolysosomal targeting conjugate of claim 1 , wherein the cargo moiety comprises an antibody, an antibody fragment, or an antibody domain, including an antibody Fc region or an antibody Fc fragment domain.

13. The endolysosomal targeting conjugate of claim 12 , wherein the antibody Fc region or antibody Fc fragment domain is derived from human IgG1.

14. The endolysosomal targeting conjugate of claim 1 , wherein the cargo moiety comprises an albumin molecule or a domain of albumin.

15. The endolysosomal targeting conjugate of claim 3, wherein the targeting moiety comprises a Fab fragment or scFv fragment of a HER2-specific antibody, wherein the heavy chain variable domain of the Fab fragment or scFv fragment has a mutation of Ser55 to histidine and a mutation of Gly57 to glutamic acid.

16. The endolysosomal targeting conjugate of claim 3, wherein the targeting moiety comprises a Fab fragment or scFv fragment of a HER2-specific antibody, wherein the heavy chain variable domain in the Fab fragment or scFv fragment has a mutation of Ser103 to histidine and the light chain variable domain has a mutation of Tyr55 to histidine.

17. The endolysosome-targeting conjugate of claim 1, comprising at least a first targeting moiety and a second targeting moiety, wherein the first targeting moiety is configured to bind to a different cell surface molecule than the second targeting moiety.

18. 18. The endolysosomal targeting conjugate of claim 17, wherein the first and second targeting moieties are fused to a heterodimer of two immunoglobulin Fc fragments.

19. The endolysosome-targeting conjugate of claim 1 , wherein the targeting moiety comprises a phosphatidylserine-binding protein and the target cell is a cell having phosphatidylserine on its cell surface.

20. The endolysosome-targeting conjugate of claim 19, wherein the phosphatidylserine-binding protein is selected from the group consisting of the core domain of AnxA1, the C2A domain of Syt1, and the C2 domain of PKCα.

21. The endolysosome-targeting conjugate of claim 20, wherein the phosphatidylserine-binding protein is the C2A domain of Syt1.

22. The endolysosome-targeting conjugate of claim 21 , wherein the targeting moiety comprises two C2A domains of Syt1.

23. The endolysosome-targeting conjugate of claim 21 , wherein the targeting moiety comprises four C2A domains of Syt1.

24. The endolysosomal targeting conjugate of claim 21 , wherein the targeting moiety comprises more than four C2A domains of Syt1.

25. the targeting moiety comprises a phosphatidylserine binding protein; the cargo moiety comprises the Fc portion of human IgG1; and 20. The endolysosomal targeting conjugate of claim 19, wherein the targeting moiety is covalently fused to the cargo moiety by a linker protein.

26. The endolysosome-targeting conjugate of claim 25, wherein the linker protein is a Gly4Ser linker.

27. The endolysosome-targeting conjugate of claim 1 , wherein the cargo molecule is a cytotoxic drug.

28. 28. The endolysosome-targeting conjugate of claim 27, wherein the cytotoxic drug is MMAE.

29. The endolysosome-targeting conjugate of claim 1 , wherein the cargo molecule is an imaging label.

30. 1. An endolysosomal targeting conjugate comprising: a targeting moiety comprising an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, wherein the targeting moiety is configured to bind to a cell surface molecule of a target cell; a cargo moiety comprising a cargo molecule conjugated to an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain; Including, wherein the targeting moiety is configured to bind to a cargo moiety in the extracellular space with a lower dissociation constant than in an endolysosomal compartment of a target cell; the targeting moiety is configured to dissociate from the cell surface molecule upon entry into an endolysosomal compartment; and The endolysosomal targeting conjugate is configured to deliver a cargo molecule to the endolysosomal compartment of a target cell.

31. The endolysosomal targeting conjugate of claim 30, wherein the targeting moiety is configured to bind to a cargo compartment at near-neutral pH with a lower dissociation constant at acidic endosomal pH.

32. 32. The endolysosomal targeting conjugate of claim 31, wherein the near-neutral pH is from about pH 6.8 to about pH 7.5, and the acidic endolysosomal pH is from about pH 5.0 to about pH 6.

5.

33. The targeting moiety is an endolysosomal Ca ２＋ Extracellular Ca with a lower dissociation constant at ２＋ 31. The endolysosomal targeting conjugate of claim 30, configured to bind to a cargo moiety at a concentration of

34. The extracellular Ca ２＋ The concentration is about 2 mM, and the endolysosomal Ca ２＋ 34. The endolysosome-targeting conjugate of claim 33, wherein the concentration is about 2 μM.

35. The endolysosomal targeting conjugate of claim 33, wherein the targeting moiety comprises calbindin D9K domain 2 and the cargo moiety comprises calbindin D9K domain 1.

36. The endolysosome-targeting conjugate of claim 35, wherein calbindin D9K domain 1 is fused to a cargo moiety by a linker peptide and / or calbindin D9K domain 2 is fused to a targeting moiety by a linker peptide.

37. The endolysosome-targeting conjugate of claim 30 , wherein the cargo molecule is a cytotoxic drug.

38. 38. The endolysosome-targeting conjugate of claim 37, wherein the cytotoxic drug is MMAE.

39. The endolysosome-targeting conjugate of claim 30 , wherein the cargo molecule is an imaging label.

40. 31. A composition comprising the endolysosomal targeting conjugate of claim 1 or claim 30 and a pharmaceutically acceptable vehicle.

41. 1. A method for treating cancer, comprising: administering to a patient an effective dose of the composition of claim 40; where the cargo molecule is a cytotoxic drug, and administration of the composition inhibits tumor growth in the patient; Methods for treating cancer.

42. 42. The method of claim 41, wherein the composition comprises at least one endolysosomal targeting conjugate configured to target a tumor comprising one or more types of target cells.

43. 1. A method of imaging a tumor in a patient, comprising: administering to a patient an effective dose of the composition of claim 40, wherein the cargo molecule is an imaging label; performing an imaging method suitable for detecting said imaging marker in said patient; where administration of the composition provides a sufficient concentration of imaging label that is detectable by the imaging method; A method for imaging tumors in patients.

44. 1. A method for providing an endolysosomal targeting conjugate for the treatment of cancer, comprising:

10. Selecting the targeting moiety of claim 1, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, wherein the targeting moiety is configured to bind to a cell surface molecule in the extracellular space with a lower dissociation constant than in an endolysosomal compartment. and, selecting a cargo moiety of claim 1, wherein the cargo molecule comprises a cytotoxic drug having therapeutic efficacy for inhibiting the growth of a selected type of tumor target cell; providing an endolysosomal targeting conjugate comprising said targeting moiety fused directly or indirectly to said cargo moiety; A method comprising:

45. 1. A method for providing an endolysosomal targeting conjugate for the treatment of cancer, comprising: selecting the targeting moiety of claim 30, wherein the targeting moiety comprises an antibody, antibody fragment, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell; and selecting a cargo moiety of claim 30, wherein the cargo molecule comprises a cytotoxic drug having therapeutic efficacy for inhibiting the growth of a selected type of tumor target cell, the targeting moiety is modified to further comprise a first protein domain; the cargo moiety is modified to further comprise a second protein domain; and the first protein domain is configured to bind to the second domain in the extracellular space with a lower dissociation constant than in the endolysosomal compartment; method.

46. The endolysosomal targeting conjugate of claim 1 or 30, wherein the cargo moiety comprises a dimer of two immunoglobulin Fc fragments.

47. 31. The endolysosomal targeting conjugate of claim 1 or 30, wherein the cargo molecule is conjugated to an antibody fragment, antibody domain, nanobody, protein, protein fragment or protein domain by a peptide linker or via a chemical conjugation reaction.

48. 31. The endolysosome-targeting conjugate of claim 1 or 30, wherein the imaging label is a radioactive label, a fluorescent label, or a near-infrared label.

49. 31. The endolysosomal targeting conjugate of claim 1 or 30, wherein the N-terminus of the targeting moiety is fused to the C-terminus of the cargo moiety.

50. 31. The endolysosomal targeting conjugate of claim 1 or 30, wherein the C-terminus of the targeting moiety is fused to the N-terminus of the cargo moiety.

51. The endolysosomal targeting conjugate of claim 1 or 30, wherein the targeting moiety is fused to the cargo moiety at a non-terminal position of the cargo moiety.

52. the cargo moiety comprises an immunoglobulin Fc fragment, and the targeting moiety is fused to the immunoglobulin Fc fragment of the cargo moiety at the N-terminus or C-terminus of the hinge-CH2-CH3 domain of the immunoglobulin Fc fragment; 31. The endolysosomal targeting conjugate of claim 1 or 30.

53. 31. The endolysosomal targeting conjugate of claim 1 or 30, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to human epidermal growth factor receptor 2.

54. 31. The endolysosomal targeting conjugate of claim 1 or 30, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a prostate-specific membrane antigen.

55. 31. The endolysosomal targeting conjugate of claim 1 or 30, comprising one or more proteins having at least one amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, or homologs thereof.

56. The endolysosome-targeting conjugate of claim 1 or 30, comprising a heterodimer of proteins having the amino acid sequences of SEQ ID NO:2 and SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, SEQ ID NO:42 and SEQ ID NO:44, SEQ ID NO:46 and SEQ ID NO:48, or homologs thereof.

57. The endolysosome-targeting conjugate of claim 1 or 30, comprising a heterotrimer of proteins having the amino acid sequences of SEQ ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 22, SEQ ID NO: 22, SEQ ID NO: 24, and SEQ ID NO: 26, or homologs thereof.

58. 2. The endolysosome-targeting conjugate of claim 1, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule with a dissociation constant greater than 1.5 μM at acidic pH.

59. 59. The endolysosome-targeting conjugate of claim 58, wherein the acidic pH is about 5.

8.

60. The endolysosome-targeting conjugate of claim 1 , wherein the targeting moiety comprises a protein, protein fragment, or protein domain configured to bind to a cell surface molecule with a dissociation constant greater than 1.5 μM at acidic pH.

61. 61. The endolysosome-targeting conjugate of claim 60, wherein the acidic pH is about 5.

8.

62. 2. The endolysosome-targeting conjugate of claim 1, wherein the targeting moiety comprises an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at a pH of from about 6.8 to about 7.5 with a lower dissociation constant at a pH of from about 5.0 to about 6.

5.

63. The targeting component contains about 2 μM Ca ２＋ A lower dissociation constant at a concentration of approximately 2 mM Ca ２＋ The endolysosome-targeting conjugate of claim 1 , comprising an antibody, antibody fragment, antibody domain, or nanobody configured to bind to a cell surface molecule at a concentration.

64. The endolysosome-targeting conjugate of claim 1, wherein the targeting moiety comprises a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at a pH of from about 6.8 to about 7.5 with a lower dissociation constant at a pH of from about 5.0 to about 6.

5.

65. The targeting component contains about 2 μM Ca ２＋ A lower dissociation constant at a concentration of approximately 2 mM Ca ２＋ The endolysosome-targeting conjugate of claim 1 , comprising a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at a concentration.

66. 31. The endolysosomal targeting conjugate of claim 30, wherein the targeting moiety is configured to bind to the cargo compartment at a pH of about 6.8 to about 7.5 with a lower dissociation constant at a pH of about 5.0 to about 6.

5.

67. The targeting component contains about 2 μM Ca ２＋ A lower dissociation constant at a concentration of approximately 2 mM Ca ２＋ The endolysosomal targeting conjugate of claim 30 , configured to bind to a cargo moiety at a concentration of

68. The endolysosome-targeting conjugate of claim 1 or 30, wherein the cargo molecule is a cytotoxic radiolabel.

69. 31. The endolysosome-targeting conjugate of claim 1 or 30, wherein the cargo molecule is a drug or other agent that modifies the behavior of the target cell.

Images